Direct measurement of the protein response to an electrostatic perturbation that mimics the catalytic cycle in ketosteroid isomerase

PubMed Central

Jha, Santosh Kumar; Ji, Minbiao; Gaffney, Kelly J.; Boxer, Steven G.

2011-01-01

Understanding how electric fields and their fluctuations in the active site of enzymes affect efficient catalysis represents a critical objective of biochemical research. We have directly measured the dynamics of the electric field in the active site of a highly proficient enzyme, Δ5-3-ketosteroid isomerase (KSI), in response to a sudden electrostatic perturbation that simulates the charge displacement that occurs along the KSI catalytic reaction coordinate. Photoexcitation of a fluorescent analog (coumarin 183) of the reaction intermediate mimics the change in charge distribution that occurs between the reactant and intermediate state in the steroid substrate of KSI. We measured the electrostatic response and angular dynamics of four probe dipoles in the enzyme active site by monitoring the time-resolved changes in the vibrational absorbance (IR) spectrum of a spectator thiocyanate moiety (a quantitative sensor of changes in electric field) placed at four different locations in and around the active site, using polarization-dependent transient vibrational Stark spectroscopy. The four different dipoles in the active site remain immobile and do not align to the changes in the substrate electric field. These results indicate that the active site of KSI is preorganized with respect to functionally relevant changes in electric fields. PMID:21949360

Dissecting the active site of a photoreceptor protein

NASA Astrophysics Data System (ADS)

Hoff, Wouter; Hara, Miwa; Ren, Jie; Moghadam, Farzaneh; Xie, Aihua; Kumauchi, Masato

While enzymes are quite large molecules, functionally important chemical events are often limited to a small region of the protein: the active site. The physical and chemical properties of residues at such active sites are often strongly altered compared to the same groups dissolved in water. Understanding such effects is important for unraveling the mechanisms underlying protein function and for protein engineering, but has proven challenging. Here we report on our ongoing efforts on using photoactive yellow protein (PYP), a bacterial photoreceptor, as a model system for such effects. We will report on the following questions: How many residues affect active site properties? Are these residues in direct physical contact with the active site? Can functionally important residues be recognized in the crystal structure of a protein? What structural resolution is needed to understand active sites? What spectroscopic techniques are most informative? Which weak interactions dominate active site properties?

Functional and structural characterization of the pentapeptide insertion of Theileria annulata lactate dehydrogenase by site-directed mutagenesis, comparative modeling and molecular dynamics simulations.

PubMed

Erdemir, Aysegul; Mutlu, Ozal

2017-06-01

Lactate dehydrogenase (LDH) is an important metabolic enzyme in glycolysis and it has been considered as the main energy source in many organisms including apicomplexan parasites. Differences at the active site loop of the host and parasite LDH's makes this enzyme an attractive target for drug inhibitors. In this study, five amino acid insertions in the active site pocket of Theileria annulata LDH (TaLDH) were deleted by PCR-based site-directed mutagenesis, expression and activity analysis of mutant and wild type TaLDH enzymes were performed. Removal of the insertion at the active site loop caused production of an inactive enzyme. Furthermore, structures of wild and mutant enzymes were predicted by comparative modeling and the importance of the insertions at the active site loop were also assigned by molecular docking and dynamics simulations in order to evaluate essential role of this loop for the enzymatic activity. Pentapeptide insertion removal resulted in loss of LDH activity due to deletion of Trp96 and conformational change of Arg98 because of loop instability. Analysis of wild type and mutant enzymes with comparative molecular dynamics simulations showed that the fluctuations of the loop residues increase in mutant enzyme. Together with in silico studies, in vitro results revealed that active site loop has a vital role in the enzyme activity and our findings promise hope for the further drug design studies against theileriosis and other apicomplexan parasite diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

Mutation at a strictly conserved, active site tyrosine in the copper amine oxidase leads to uncontrolled oxygenase activity.

PubMed

Chen, Zhi-Wei; Datta, Saumen; Dubois, Jennifer L; Klinman, Judith P; Mathews, F Scott

2010-08-31

The copper amine oxidases carry out two copper-dependent processes: production of their own redox-active cofactor (2,4,5-trihydroxyphenylalanine quinone, TPQ) and the subsequent oxidative deamination of substrate amines. Because the same active site pocket must facilitate both reactions, individual active site residues may serve multiple roles. We have examined the roles of a strictly conserved active site tyrosine Y305 in the copper amine oxidase from Hansenula polymorpha kinetically, spetroscopically (Dubois and Klinman (2006) Biochemistry 45, 3178), and, in the present work, structurally. While the Y305A enzyme is almost identical to the wild type, a novel, highly oxygenated species replaces TPQ in the Y305F active sites. This new structure not only provides the first direct detection of peroxy intermediates in cofactor biogenesis but also indicates the critical control of oxidation chemistry that can be conferred by a single active site residue.

Direct non-productive HIV-1 infection in a T-cell line is driven by cellular activation state and NFκB

PubMed Central

2014-01-01

Background Molecular latency allows HIV-1 to persist in resting memory CD4+ T-cells as transcriptionally silent provirus integrated into host chromosomal DNA. Multiple transcriptional regulatory mechanisms for HIV-1 latency have been described in the context of progressive epigenetic silencing and maintenance. However, our understanding of the determinants critical for the establishment of latency in newly infected cells is limited. Results In this study, we used a recently described, doubly fluorescent HIV-1 latency model to dissect the role of proviral integration sites and cellular activation state on direct non-productive infections at the single cell level. Proviral integration site mapping of infected Jurkat T-cells revealed that productively and non-productively infected cells are indistinguishable in terms of genomic landmarks, surrounding epigenetic landscapes, and proviral orientation relative to host genes. However, direct non-productive infections were inversely correlated with both cellular activation state and NFκB activity. Furthermore, modulating NFκB with either small molecules or by conditional overexpression of NFκB subunits was sufficient to alter the propensity of HIV-1 to directly enter a non-productive latent state in newly infected cells. Importantly, this modulatory effect was limited to a short time window post-infection. Conclusions Taken together, our data suggest that cellular activation state and NFκB activity during the time of infection, but not the site of proviral integration, are important regulators of direct HIV-1 non-productive infections. PMID:24502247

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

PubMed Central

Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

2015-01-01

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

Relevance of Local Flexibility Near the Active Site for Enzymatic Catalysis: Biochemical Characterization and Engineering of Cellulase Cel5A From Bacillus agaradherans.

PubMed

Saavedra, Juan M; Azócar, Mauricio A; Rodríguez, Vida; Ramírez-Sarmiento, César A; Andrews, Barbara A; Asenjo, Juan A; Parra, Loreto P

2018-03-25

Detailed molecular mechanisms underpinning enzymatic reactions are still a central problem in biochemistry. The need for active site flexibility to sustain catalytic activity constitutes a notion of wide acceptance, although its direct influence remains to be fully understood. With the aim of studying the relationship between structural dynamics and enzyme catalysis, the cellulase Cel5A from Bacillus agaradherans is used as a model for in silico comparative analysis with mesophilic and psychrophilic counterparts. Structural features that determine flexibility are related to kinetic and thermodynamic parameters of catalysis. As a result, three specific positions in the vicinity of the active site of Cel5A are selected for protein engineering via site-directed mutagenesis. Three Cel5A variants are generated, N141L, A137Y and I102A/A137Y, showing a concomitant increase in the catalytic activity at low temperatures and a decrease in activation energy and activation enthalpy, similar to cold-active enzymes. These results are interpreted in structural terms by molecular dynamics simulations, showing that disrupting a hydrogen bond network in the vicinity of the active site increases local flexibility. These results provide a structural framework for explaining the changes in thermodynamic parameters observed between homologous enzymes with varying temperature adaptations. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Way of the Web: Answers to Your Questions about Web Site Marketing.

ERIC Educational Resources Information Center

Wassom, Julie

2002-01-01

Provides suggestions for effective web site marketing for child care and early education programs. Includes key considerations in designing a web site, specific elements that cause visitors to stay on and return to the site, use of interactive sites, web-site updating and revision, and use of traditional marketing activities to direct prospective…

Structure of the Bifunctional Acyltransferase/Decarboxylase LnmK from the Leinamycin Biosynthetic Pathway Revealing Novel Activity for a Double-Hot-Dog Fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lohman, Jeremy R.; Bingman, Craig A.; George N. Phillips Jr.

The β-branched C3 unit in leinamycin biosynthesis is installed by a set of four proteins, LnmFKLM. In vitro biochemical investigation confirmed that LnmK is a bifunctional acyltransferase/decarboxylase (AT/DC) that catalyzes first self-acylation using methylmalonyl-CoA as a substrate and subsequently transacylation of the methylmalonyl group to the phosphopantetheinyl group of the LnmL acyl carrier protein [Liu, T., Huang, Y., and Shen, B. (2009) J. Am. Chem. Soc. 131, 6900–6901]. LnmK shows no sequence homology to proteins of known function, representing a new family of AT/DC enzymes. Here we report the X-ray structure of LnmK. LnmK is homodimer with each of themore » monomers adopting a double-hot-dog fold. Cocrystallization of LnmK with methylmalonyl-CoA revealed an active site tunnel terminated by residues from the dimer interface. But, to canonical AT and ketosynthase enzymes that employ Ser or Cys as an active site residue, none of these residues are found in the vicinity of the LnmK active site. Instead, three tyrosines were identified, one of which, Tyr62, was established, by site-directed mutagenesis, to be the most likely active site residue for the AT activity of LnmK. Moreover, LnmK represents the first AT enzyme that employs a Tyr as an active site residue and the first member of the family of double-hot-dog fold enzymes that displays an AT activity known to date. The LnmK structure sets the stage for probing of the DC activity of LnmK through site-directed mutagenesis. These findings highlight natural product biosynthetic machinery as a rich source of novel enzyme activities, mechanisms, and structures.« less

Increase in D-tagatose production rate by site-directed mutagenesis of L-arabinose isomerase from Geobacillus thermodenitrificans.

PubMed

Oh, Hyo-Jung; Kim, Hye-Jung; Oh, Deok-Kun

2006-02-01

Among single-site mutations of L-arabinose isomerase derived from Geobacillus thermodenitrificans, two mutants were produced having the lowest and highest activities of D-tagatose production. Site-directed mutagenesis at these sites showed that the aromatic ring at amino acid 164 and the size of amino acid 475 were important for D-tagatose production. Among double-site mutations, one mutant converted D-galactose into D-tagatose with a yield of 58% whereas the wild type gave 46% D-tagatose conversion after 300 min at 65 degrees C.

Garden Grove's Newsy Web Site Wins Honors

ERIC Educational Resources Information Center

Tech Directions, 2009

2009-01-01

This article details the construction and content of the Garden Grove (CA) High School Web site. The site wins the January 2009 "Tech Directions" Web Site of the Month. It provides information on the school's academic programs, administrative and teaching staff, guidance department, and athletics and other extracurricular activities, in addition…

Management and integration of engineering and construction activities: Lessons learned from the AP1000{sup R} nuclear power plant China project

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCullough, M. C.; Ebeling-Koning, D.; Evans, M. C.

2012-07-01

The lessons learned during the early phase of design engineering and construction activities for the AP1000 China Project can be applied to any project involving multiple disciplines and multiple organizations. Implementation of a first-of-a-kind design to directly support construction activities utilizing resources assigned to design development and design delivery creates challenges with prioritization of activities, successful closure of issues, and communication between site organizations and the home office. To ensure successful implementation, teams were assigned and developed to directly support construction activities including prioritization of activities, site communication and ensuring closure of site emergent issues. By developing these teams, themore » organization is better suited to meet the demands of the construction schedule while continuing with design evolution of a standard plant and engineering delivery for multiple projects. For a successful project, proper resource utilization and prioritization are key for overcoming obstacles and ensuring success of the engineering organization. (authors)« less

Improving the activity of the subtilisin nattokinase by site-directed mutagenesis and molecular dynamics simulation.

PubMed

Weng, Meizhi; Deng, Xiongwei; Bao, Wei; Zhu, Li; Wu, Jieyuan; Cai, Yongjun; Jia, Yan; Zheng, Zhongliang; Zou, Guolin

2015-09-25

Nattokinase (NK), a bacterial serine protease from Bacillus subtilis var. natto, is a potential cardiovascular drug exhibiting strong fibrinolytic activity. To broaden its commercial and medical applications, we constructed a single-mutant (I31L) and two double-mutants (M222A/I31L and T220S/I31L) by site-directed mutagenesis. Active enzymes were expressed in Escherichia coli with periplasmic secretion and were purified to homogeneity. The kinetic parameters of enzymes were examined by spectroscopy assay and isothermal titration calorimetry (ITC), and their fibrinolytic activities were determined by fibrin plate method. The substitution of Leu(31) for Ile(31) resulted in about 2-fold enhancement of catalytic efficiency (Kcat/KM) compared with wild-type NK. The specific activities of both double-mutants (M222A/I31L and T220S/I31L) were significantly increased when compared with the single-mutants (M222A and T220S) and the oxidative stability of M222A/I31L mutant was enhanced with respect to wild-type NK. This study demonstrates the feasibility of improving activity of NK by site-directed mutagenesis and shows successful protein engineering cases to improve the activity of NK as a potent therapeutic agent. Copyright © 2015 Elsevier Inc. All rights reserved.

Accurate Detection of Adenylation Domain Functions in Nonribosomal Peptide Synthetases by an Enzyme-linked Immunosorbent Assay System Using Active Site-directed Probes for Adenylation Domains.

PubMed

Ishikawa, Fumihiro; Miyamoto, Kengo; Konno, Sho; Kasai, Shota; Kakeya, Hideaki

2015-12-18

A significant gap exists between protein engineering and enzymes used for the biosynthesis of natural products, largely because there is a paucity of strategies that rapidly detect active-site phenotypes of the enzymes with desired activities. Herein, we describe a proof-of-concept study of an enzyme-linked immunosorbent assay (ELISA) system for the adenylation (A) domains in nonribosomal peptide synthetases (NRPSs) using a combination of active site-directed probes coupled to a 5'-O-N-(aminoacyl)sulfamoyladenosine scaffold with a biotin functionality that immobilizes probe molecules onto a streptavidin-coated solid support. The recombinant NRPSs have a C-terminal His-tag motif that is targeted by an anti-6×His mouse antibody as the primary antibody and a horseradish peroxidase-linked goat antimouse antibody as the secondary antibody. These probes can selectively capture the cognate A domains by ligand-directed targeting. In addition, the ELISA technique detected A domains in the crude cell-free homogenates from the Escherichia coli expression systems. When coupled with a chromogenic substrate, the antibody-based ELISA technique can visualize probe-protein binding interactions, which provides accurate readouts of the A-domain functions in NRPS enzymes. To assess the ELISA-based engineering of the A domains of NRPSs, we reprogramed 2,3-dihydroxybenzoic acid (DHB)-activating enzyme EntE toward salicylic acid (Sal)-activating enzymes and investigated a correlation between binding properties for probe molecules and enzyme catalysts. We generated a mutant of EntE that displayed negligible loss in the kcat/Km value with the noncognate substrate Sal and a corresponding 48-fold decrease in the kcat/Km value with the cognate substrate DHB. The resulting 26-fold switch in substrate specificity was achieved by the replacement of a Ser residue in the active site of EntE with a Cys toward the nonribosomal codes of Sal-activating enzymes. Bringing a laboratory ELISA technique and adenylating enzymes together using a combination of active site-directed probes for the A domains in NRPSs should accelerate both the functional characterization and manipulation of the A domains in NRPSs.

Quantum Mechanics/Molecular Mechanics Modeling of Drug Metabolism: Mexiletine N-Hydroxylation by Cytochrome P450 1A2.

PubMed

Lonsdale, Richard; Fort, Rachel M; Rydberg, Patrik; Harvey, Jeremy N; Mulholland, Adrian J

2016-06-20

The mechanism of cytochrome P450(CYP)-catalyzed hydroxylation of primary amines is currently unclear and is relevant to drug metabolism; previous small model calculations have suggested two possible mechanisms: direct N-oxidation and H-abstraction/rebound. We have modeled the N-hydroxylation of (R)-mexiletine in CYP1A2 with hybrid quantum mechanics/molecular mechanics (QM/MM) methods, providing a more detailed and realistic model. Multiple reaction barriers have been calculated at the QM(B3LYP-D)/MM(CHARMM27) level for the direct N-oxidation and H-abstraction/rebound mechanisms. Our calculated barriers indicate that the direct N-oxidation mechanism is preferred and proceeds via the doublet spin state of Compound I. Molecular dynamics simulations indicate that the presence of an ordered water molecule in the active site assists in the binding of mexiletine in the active site, but this is not a prerequisite for reaction via either mechanism. Several active site residues play a role in the binding of mexiletine in the active site, including Thr124 and Phe226. This work reveals key details of the N-hydroxylation of mexiletine and further demonstrates that mechanistic studies using QM/MM methods are useful for understanding drug metabolism.

Structural evolution of luciferase activity in Zophobas mealworm AMP/CoA-ligase (protoluciferase) through site-directed mutagenesis of the luciferin binding site.

PubMed

Prado, R A; Barbosa, J A; Ohmiya, Y; Viviani, V R

2011-07-01

The structural origin and evolution of bioluminescent activity of beetle luciferases from AMP/CoA ligases remains a mystery. Previously we cloned the luciferase-like enzyme from Zophobas morio mealworm, a reasonable protoluciferase model that could shine light on this mystery. Kinetic characterization and studies with D- and L-luciferin and their adenylates showed that stereoselectivity constitutes a critical feature for the origin of luciferase activity in AMP/CoA ligases. Comparison of the primary structures and modeling studies of this protoluciferase and the three main families of beetle luciferases showed that the carboxylic acid substrate binding site of this enzyme is smaller and more hydrophobic than the luciferin binding site of beetle luciferases, showing several substitutions of otherwise conserved residues. Thus, here we performed a site-directed mutagenesis survey of the carboxylic binding site motifs of the protoluciferase by replacing their residues by the respective conserved ones found in beetle luciferases in order to identify the structural determinants of luciferase/oxygenase activity. Although most of the substitutions had negative impact on the luminescence activity of the protoluciferase, only the substitution I327T improved the luminescence activity, resulting in a broad and 15 nm blue-shifted luminescence spectrum. Such substitution indicates the importance of the loop motif 322YGMSEI327 (341YGLTETT347 in Photinus pyralis luciferase) for luciferase activity, and indicates a possible route for the evolution of bioluminescence function of beetle luciferases.

The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

PubMed Central

Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

2007-01-01

Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

Inducible model for β-six-mediated site-specific recombination in mammalian cells

PubMed Central

Servert, Pilar; Garcia-Castro, Javier; Díaz, Vicente; Lucas, Daniel; Gonzalez, Manuel A.; Martínez-A, Carlos; Bernad, Antonio

2006-01-01

The prokaryotic β recombinase catalyzes site-specific recombination between two directly oriented minimal six sites in chromatin-integrated substrates. Here, we demonstrate that an enhanced green fluorescent protein (EGFP)-fused version of β recombinase (β-EGFP) is fully active, retaining most specific activity. It is used to develop a recombination-dependent activatable gene expression (RAGE) system based on the androgen receptor (AR) ligand-binding domain (LBD). Two hybrid molecules, a direct fusion of the LBD-AR to the C-terminus of β recombinase (β-AR) and a triple fusion of β-EGFP to the same ligand-binding domain (β-EGFP-AR), were engineered and their subcellular behavior, stability and catalytic activity were evaluated. Both chimeric β recombinase proteins showed in vivo inducible recombinogenic activity dependent on addition of an androgen receptor agonist, although the β-AR fusion protein demonstrated more accurate ligand-dependent translocation from cytoplasm to nucleus. PMID:16394020

A measurement of the magnetic field direction at the site of major flares

NASA Technical Reports Server (NTRS)

Lundstedt, H.

1982-01-01

Lundstedt et al. (1981) showed that the direction of the photospheric magnetic field at the site of a flare is a good predictor of the solar wind velocity observed at earth four days later. It is described here how the field direction was obtained, and possible errors involved in the determination of the angle are discussed. The discussion also includes a characterization of the solar active regions.

Estimations of direct release rate of 137Cs and 90Sr to the ocean from the Fukushima Dai-ichi Nuclear Power Plant for five-and-a-half years

NASA Astrophysics Data System (ADS)

Tsumune, Daisuke; Aoyama, Michio; Tsubono, Takaki; Misumi, Kazuhiro; Tateda, Yutaka

2017-04-01

A series of accidents at the Fukushima Dai-ichi Nuclear Power Plant (1F NPP) following the earthquake and tsunami of 11 March 2011 resulted in the release of radioactive materials to the ocean by two major pathways, direct release from the accident site and atmospheric deposition. Additional release pathways by river input and runoff from 1F NPP site with precipitation and were also effective for coastal zone in the specific periods before starting direct release on March 26 2011. Direct release from 1F NPP site is dominant one year after the accident. We estimated the direct release rate of 137Cs and 90Sr for more than five-and-a-half years after the accident by the Regional Ocean Model System (ROMS). Direct release rate of 137Cs were estimated for five-and-a-half years after the accident by comparing simulated results and measured activities adjacent to the 1F NPP site(at 5,6 discharge and south discharge). Directly release rate of 137Cs was estimated to be the order of magnitude of 1014 Bq/day and decreased exponentially with time to be the order of magnitude of 109 Bq/day by the end of September 2016. Estimated direct release rate have exponentially reduced with constant rate since November 2011. Apparent half-life of direct release rate was estimated to be 346 days. The estimated total amounts of directly released 137Cs was 3.7±0.7 PBq for five and a half years. Simulated 137Cs activities attributable to direct release were in good agreement with observed activities, a result that implies the estimated direct release rate was reasonable. Simulated 137Cs activity affected off coast in the Fukushima prefecture. We used the measured 137Cs activities by the Tokyo Electric Power Company (TEPCO) for the estimation of direct release. The sea water samples were corrected from the coast. The averaged 137Cs activities from November 2013 to June 2016 were 391 and 383 Bq/m3 at 5,6 discharge and south discharge, respectively. The averaged 137Cs activities measured by the Nuclear Regulation Agency (NRA) is about five times smaller than the one by the TEPCO because the NRA corrected seawater samples at 300-500m offshore by ship. Horizontal resolution of the model was 1km x 1km, therefore it is important to consider the difference of activities in the sub-grid scale for the detailed estimations of direct release. 90Sr/137Cs activity ratio measured adjacent to the 1F NPP is variable with time. The 90Sr/137Cs activity ratio was 0.62 due to the global fallout before the accident. The 90Sr/137Cs activity ratio decreased to 0.01 after the accident before April 2011. And the ratio increased to 1 by September 2013. And then the ratio decreased to 0.1-1. After October 2015, the ratio decreased to 0.1-0.2. Directly release rate of 90Sr was estimated to be the order of magnitude of 1012 Bq/day and decreased to the order of magnitude of 108 Bq/day by the end of September 2016. The estimated total amounts of directly released 90Sr was 35 ± 7 TBq.

Enabling Remote Access to Fieldwork: Gaining Insight into the Pedagogic Effectiveness of "Direct" and "Remote" Field Activities

ERIC Educational Resources Information Center

Stokes, Alison; Collins, Trevor; Maskall, John; Lea, John; Lunt, Paul; Davies, Sarah

2012-01-01

This study considers the pedagogical effectiveness of remote access to fieldwork locations. Forty-one students from across the GEES disciplines (geography, earth and environmental sciences) undertook a fieldwork exercise, supported by two lecturers. Twenty students accessed the field site directly and the remainder accessed the site remotely using…

Improving the neutral phytase activity from Bacillus amyloliquefaciens DSM 1061 by site-directed mutagenesis.

PubMed

Xu, Wei; Shao, Rong; Wang, Zupeng; Yan, Xiuhua

2015-03-01

Neutral phytase is used as a feed additive for degradation of anti-nutritional phytate in aquatic feed industry. Site-directed mutagenesis of Bacillus amyloliquefaciens DSM 1061 phytase was performed with an aim to increase its activity. Mutation residues were chosen based on multiple sequence alignments and structure analysis of neutral phytsaes from different microorganisms. The mutation sites on surface (D148E, S197E and N156E) and around the active site (D52E) of phytase were selected. Analysis of the phytase variants showed that the specific activities of mutants D148E and S197E remarkably increased by about 35 and 13% over a temperature range of 40-75 °C at pH 7.0, respectively. The k cat of mutants D148E and S197E were 1.50 and 1.25 times than that of the wild-type phytase, respectively. Both D148E and S197E showed much higher thermostability than that of the wild-type phytase. However, mutants N156E and D52E led to significant loss of specific activity of the enzyme. Structural analysis revealed that these mutations may affect conformation of the active site of phytase. The present mutant phytases D148E and S197E with increased activities and thermostabilities have application potential as additives in aquaculture feed.

Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

PubMed

Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

1997-02-28

The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm.

PubMed

Elwell, Jennifer A; Lovato, TyAnna L; Adams, Melanie M; Baca, Erica M; Lee, Thai; Cripps, Richard M

2015-04-15

Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arises through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. Copyright © 2015 Elsevier Inc. All rights reserved.

Bimetallic Effect of Single Nanocatalysts Visualized by Super-Resolution Catalysis Imaging

DOE PAGES

Chen, Guanqun; Zou, Ningmu; Chen, Bo; ...

2017-11-01

Compared with their monometallic counterparts, bimetallic nanoparticles often show enhanced catalytic activity associated with the bimetallic interface. Direct quantitation of catalytic activity at the bimetallic interface is important for understanding the enhancement mechanism, but challenging experimentally. Here using single-molecule super-resolution catalysis imaging in correlation with electron microscopy, we report the first quantitative visualization of enhanced bimetallic activity within single bimetallic nanoparticles. We focus on heteronuclear bimetallic PdAu nanoparticles that present a well-defined Pd–Au bimetallic interface in catalyzing a photodriven fluorogenic disproportionation reaction. Our approach also enables a direct comparison between the bimetallic and monometallic regions within the same nanoparticle. Theoreticalmore » calculations further provide insights into the electronic nature of N–O bond activation of the reactant (resazurin) adsorbed on bimetallic sites. Subparticle activity correlation between bimetallic enhancement and monometallic activity suggests that the favorable locations to construct bimetallic sites are those monometallic sites with higher activity, leading to a strategy for making effective bimetallic nanocatalysts. Furthermore, the results highlight the power of super-resolution catalysis imaging in gaining insights that could help improve nanocatalysts.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Guanqun; Zou, Ningmu; Chen, Bo

Compared with their monometallic counterparts, bimetallic nanoparticles often show enhanced catalytic activity associated with the bimetallic interface. Direct quantitation of catalytic activity at the bimetallic interface is important for understanding the enhancement mechanism, but challenging experimentally. Here using single-molecule super-resolution catalysis imaging in correlation with electron microscopy, we report the first quantitative visualization of enhanced bimetallic activity within single bimetallic nanoparticles. We focus on heteronuclear bimetallic PdAu nanoparticles that present a well-defined Pd–Au bimetallic interface in catalyzing a photodriven fluorogenic disproportionation reaction. Our approach also enables a direct comparison between the bimetallic and monometallic regions within the same nanoparticle. Theoreticalmore » calculations further provide insights into the electronic nature of N–O bond activation of the reactant (resazurin) adsorbed on bimetallic sites. Subparticle activity correlation between bimetallic enhancement and monometallic activity suggests that the favorable locations to construct bimetallic sites are those monometallic sites with higher activity, leading to a strategy for making effective bimetallic nanocatalysts. Furthermore, the results highlight the power of super-resolution catalysis imaging in gaining insights that could help improve nanocatalysts.« less

Modulation of individual steps in group I intron catalysis by a peripheral metal ion.

PubMed

Forconi, Marcello; Piccirilli, Joseph A; Herschlag, Daniel

2007-10-01

Enzymes are complex macromolecules that catalyze chemical reactions at their active sites. Important information about catalytic interactions is commonly gathered by perturbation or mutation of active site residues that directly contact substrates. However, active sites are engaged in intricate networks of interactions within the overall structure of the macromolecule, and there is a growing body of evidence about the importance of peripheral interactions in the precise structural organization of the active site. Here, we use functional studies, in conjunction with published structural information, to determine the effect of perturbation of a peripheral metal ion binding site on catalysis in a well-characterized catalytic RNA, the Tetrahymena thermophila group I ribozyme. We perturbed the metal ion binding site by site-specifically introducing a phosphorothioate substitution in the ribozyme's backbone, replacing the native ligands (the pro-R (P) oxygen atoms at positions 307 and 308) with sulfur atoms. Our data reveal that these perturbations affect several reaction steps, including the chemical step, despite the absence of direct contacts of this metal ion with the atoms involved in the chemical transformation. As structural probing with hydroxyl radicals did not reveal significant change in the three-dimensional structure upon phosphorothioate substitution, the effects are likely transmitted through local, rather subtle conformational rearrangements. Addition of Cd(2+), a thiophilic metal ion, rescues some reaction steps but has deleterious effects on other steps. These results suggest that native interactions in the active site may have been aligned by the naturally occurring peripheral residues and interactions to optimize the overall catalytic cycle.

Novel Autophosphorylation Sites of Src Family Kinases Regulate Kinase Activity and SH2 Domain Binding Capacity

PubMed Central

Weir, Marion E.; Mann, Jacqueline E.; Corwin, Thomas; Fulton, Zachary W.; Hao, Jennifer M.; Maniscalco, Jeanine F.; Kenney, Marie C.; Roque, Kristal M. Roman; Chapdelaine, Elizabeth F.; Stelzl, Ulrich; Deming, Paula B.; Ballif, Bryan A.; Hinkle, Karen L.

2016-01-01

Src family tyrosine kinases (SFKs) are critical players in normal and aberrant biological processes. While phosphorylation importantly-regulates SFKs at two known tyrosines, large-scale phosphoproteomics have revealed four additional tyrosines commonly-phosphorylated in SFKs. We found these novel tyrosines to be autophosphorylation sites. Mimicking phosphorylation at the site C-terminal to the activation loop decreased Fyn activity. Phosphomimetics and direct phosphorylation at the three SH2 domain sites increased Fyn activity while reducing phosphotyrosine-dependent interactions. While 68% of human SH2 domains exhibit conservation of at least one of these tyrosines, few have been found phosphorylated except when found in cis to a kinase domain. PMID:27001024

Analysis of the activation of acetylcholinesterase by carbon nanoparticles using a monolithic immobilized enzyme microreactor: role of the water molecules in the active site gorge.

PubMed

Ibrahim, Firas; Andre, Claire; Iutzeler, Anne; Guillaume, Yves Claude

2013-10-01

A biochromatographic system was used to study the direct effect of carbon nanoparticles (CNPs) on the acetylcholinesterase (AChE) activity. The AChE enzyme was covalently immobilized on a monolithic CIM-disk via its NH2 residues. Our results showed an increase in the AChE activity in presence of CNPs. The catalytic constant (k(cat)) was increased while the Michaelis constant (K(m)) was slightly decreased. This indicated an increase in the enzyme efficiency with increase of the substrate affinity to the active site. The thermodynamic data of the activation mechanism of the enzyme, i.e. ΔH* and ΔS*, showed no change in the substrate interaction mechanism with the anionic binding site. The increase of the enthalpy (ΔH*) and the entropy (ΔS*) with decrease in the free energy of activation (Ea) was related to structural conformation change in the active site gorge. This affected the stability of water molecules in the active site gorge and facilitated water displacement by substrate for entering to the active site of the enzyme.

Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage*

PubMed Central

Acevedo, Julyana; Yan, Shan; Michael, W. Matthew

2016-01-01

A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245

Low dielectric response in enzyme active site

PubMed Central

Mertz, Edward L.; Krishtalik, Lev I.

2000-01-01

The kinetics of charge transfer depend crucially on the dielectric reorganization of the medium. In enzymatic reactions that involve charge transfer, atomic dielectric response of the active site and of its surroundings determines the efficiency of the protein as a catalyst. We report direct spectroscopic measurements of the reorganization energy associated with the dielectric response in the active site of α-chymotrypsin. A chromophoric inhibitor of the enzyme is used as a spectroscopic probe. We find that water strongly affects the dielectric reorganization in the active site of the enzyme in solution. The reorganization energy of the protein matrix in the vicinity of the active site is similar to that of low-polarity solvents. Surprisingly, water exhibits an anomalously high dielectric response that cannot be described in terms of the dielectric continuum theory. As a result, sequestering the active site from the aqueous environment inside low-dielectric enzyme body dramatically reduces the dielectric reorganization. This reduction is particularly important for controlling the rate of enzymatic reactions. PMID:10681440

Selective Enrichment and Direct Analysis of Protein S-Palmitoylation Sites.

PubMed

Thinon, Emmanuelle; Fernandez, Joseph P; Molina, Henrik; Hang, Howard C

2018-05-04

S-Fatty-acylation is the covalent attachment of long chain fatty acids, predominately palmitate (C16:0, S-palmitoylation), to cysteine (Cys) residues via a thioester linkage on proteins. This post-translational and reversible lipid modification regulates protein function and localization in eukaryotes and is important in mammalian physiology and human diseases. While chemical labeling methods have improved the detection and enrichment of S-fatty-acylated proteins, mapping sites of modification and characterizing the endogenously attached fatty acids are still challenging. Here, we describe the integration and optimization of fatty acid chemical reporter labeling with hydroxylamine-mediated enrichment of S-fatty-acylated proteins and direct tagging of modified Cys residues to selectively map lipid modification sites. This afforded improved enrichment and direct identification of many protein S-fatty-acylation sites compared to previously described methods. Notably, we directly identified the S-fatty-acylation sites of IFITM3, an important interferon-stimulated inhibitor of virus entry, and we further demonstrated that the highly conserved Cys residues are primarily modified by palmitic acid. The methods described here should facilitate the direct analysis of protein S-fatty-acylation sites and their endogenously attached fatty acids in diverse cell types and activation states important for mammalian physiology and diseases.

An Introduction to "My Environmental Education Evaluation Resource Assistant" (MEERA), a Web-Based Resource for Self-Directed Learning about Environmental Education Program Evaluation

ERIC Educational Resources Information Center

Zint, Michaela

2010-01-01

My Environmental Education Evaluation Resource Assistant or "MEERA" is a web-site designed to support environmental educators' program evaluation activities. MEERA has several characteristics that set it apart from other self-directed learning evaluation resources. Readers are encouraged to explore the site and to reflect on the role that…

Behaviour of oceanic 137Cs following the Fukushima Daiichi Nuclear Power Plant accident for four years simulated numerically by a regional ocean model

NASA Astrophysics Data System (ADS)

Tsumune, D.; Tsubono, T.; Aoyama, M.; Misumi, K.; Tateda, Y.

2015-12-01

A series of accidents at the Fukushima Dai-ichi Nuclear Power Plant (1F NPP) following the earthquake and tsunami of 11 March 2011 resulted in the release of radioactive materials to the ocean by two major pathways, direct release from the accident site and atmospheric deposition.We reconstructed spatiotemporal variability of 137Cs activity in the regional ocean for four years by numerical model, such as a regional scale and the North Pacific scale oceanic dispersion models, an atmospheric transport model, a sediment transport model, a dynamic biological compartment model for marine biota and river runoff model. Direct release rate of 137Cs were estimated for four years after the accident by comparing simulated results and observed activities very close to the site. The estimated total amounts of directly release was 3.6±0.7 PBq. Directly release rate of 137Cs decreased exponentially with time by the end of December 2012 and then, was almost constant. Decrease rate were quite small after 2013. The daily release rate of 137Cs was estimated to be the order of magnitude of 1010 Bq/day by the end of March 2015. The activity of directly released 137Cs was detectable only in the coastal zone after December 2012. Simulated 137Cs activities attributable to direct release were in good agreement with observed activities, a result that implies the estimated direct release rate was reasonable. There is no observed data of 137Cs activity in the ocean from 11 to 21 March 2011. Observed data of marine biota should reflect the history of 137Cs activity in this early period. We reconstructed the history of 137Cs activity in this early period by considering atmospheric deposition, river input, rain water runoff from the 1F NPP site. The comparisons between simulated 137Cs activity of marine biota by a dynamic biological compartment and observed data also suggest that simulated 137Cs activity attributable to atmospheric deposition was underestimated in this early period. The simulated river flux of 137Cs to the ocean did not effect on 137Cs activity in the ocean even if the parameters in this simulation have uncertainties because of the lack of observed data in rivers in the earlier period.

Behaviour of oceanic 137Cs following the Fukushima Daiichi Nuclear Power Plant accident for four years simulated numerically by a regional ocean model

NASA Astrophysics Data System (ADS)

Torn, M. S.; Koven, C. D.; Riley, W. J.; Zhu, B.; Hicks Pries, C.; Phillips, C. L.

2014-12-01

A series of accidents at the Fukushima Dai-ichi Nuclear Power Plant (1F NPP) following the earthquake and tsunami of 11 March 2011 resulted in the release of radioactive materials to the ocean by two major pathways, direct release from the accident site and atmospheric deposition.We reconstructed spatiotemporal variability of 137Cs activity in the regional ocean for four years by numerical model, such as a regional scale and the North Pacific scale oceanic dispersion models, an atmospheric transport model, a sediment transport model, a dynamic biological compartment model for marine biota and river runoff model. Direct release rate of 137Cs were estimated for four years after the accident by comparing simulated results and observed activities very close to the site. The estimated total amounts of directly release was 3.6±0.7 PBq. Directly release rate of 137Cs decreased exponentially with time by the end of December 2012 and then, was almost constant. Decrease rate were quite small after 2013. The daily release rate of 137Cs was estimated to be the order of magnitude of 1010 Bq/day by the end of March 2015. The activity of directly released 137Cs was detectable only in the coastal zone after December 2012. Simulated 137Cs activities attributable to direct release were in good agreement with observed activities, a result that implies the estimated direct release rate was reasonable. There is no observed data of 137Cs activity in the ocean from 11 to 21 March 2011. Observed data of marine biota should reflect the history of 137Cs activity in this early period. We reconstructed the history of 137Cs activity in this early period by considering atmospheric deposition, river input, rain water runoff from the 1F NPP site. The comparisons between simulated 137Cs activity of marine biota by a dynamic biological compartment and observed data also suggest that simulated 137Cs activity attributable to atmospheric deposition was underestimated in this early period. The simulated river flux of 137Cs to the ocean did not effect on 137Cs activity in the ocean even if the parameters in this simulation have uncertainties because of the lack of observed data in rivers in the earlier period.

Molecular dynamics explorations of active site structure in designed and evolved enzymes.

PubMed

Osuna, Sílvia; Jiménez-Osés, Gonzalo; Noey, Elizabeth L; Houk, K N

2015-04-21

This Account describes the use of molecular dynamics (MD) simulations to reveal how mutations alter the structure and organization of enzyme active sites. As proposed by Pauling about 70 years ago and elaborated by many others since then, biocatalysis is efficient when functional groups in the active site of an enzyme are in optimal positions for transition state stabilization. Changes in mechanism and covalent interactions are often critical parts of enzyme catalysis. We describe our explorations of the dynamical preorganization of active sites using MD, studying the fluctuations between active and inactive conformations normally concealed to static crystallography. MD shows how the various arrangements of active site residues influence the free energy of the transition state and relates the populations of the catalytic conformational ensemble to the enzyme activity. This Account is organized around three case studies from our laboratory. We first describe the importance of dynamics in evaluating a series of computationally designed and experimentally evolved enzymes for the Kemp elimination, a popular subject in the enzyme design field. We find that the dynamics of the active site is influenced not only by the original sequence design and subsequent mutations but also by the nature of the ligand present in the active site. In the second example, we show how microsecond MD has been used to uncover the role of remote mutations in the active site dynamics and catalysis of a transesterase, LovD. This enzyme was evolved by Tang at UCLA and Codexis, Inc., and is a useful commercial catalyst for the production of the drug simvastatin. X-ray analysis of inactive and active mutants did not reveal differences in the active sites, but relatively long time scale MD in solution showed that the active site of the wild-type enzyme preorganizes only upon binding of the acyl carrier protein (ACP) that delivers the natural acyl group to the active site. In the absence of bound ACP, a noncatalytic arrangement of the catalytic triad is dominant. Unnatural truncated substrates are inactive because of the lack of protein-protein interactions provided by the ACP. Directed evolution is able to gradually restore the catalytic organization of the active site by motion of the protein backbone that alters the active site geometry. In the third case, we demonstrate the key role of MD in combination with crystallography to identify the origins of substrate-dependent stereoselectivities in a number of Codexis-engineered ketoreductases, one of which is used commercially for the production of the antibiotic sulopenem. Here, mutations alter the shape of the active site as well as the accessibility of water to different regions of it. Each of these examples reveals something different about how mutations can influence enzyme activity and shows that directed evolution, like natural evolution, can increase catalytic activity in a variety of remarkable and often subtle ways.

The HTLV-I tax protein transcriptionally modulates OX40 antigen expression.

PubMed

Pankow, R; Dürkop, H; Latza, U; Krause, H; Kunzendorf, U; Pohl, T; Bulfone-Paus, S

2000-07-01

OX40 is a member of the TNF receptor family, expressed on activated T cells. It is the only costimulatory T cell molecule known to be specifically up-regulated in human T cell leukemia virus type-I (HTLV-I)-producing cells. In a T cell line, OX40 surface expression was shown to be induced by HTLV-I Tax alone. To understand molecular mechanisms of OX40 gene regulation and modulation by HTLV-I Tax, we have cloned the human OX40 gene and analyzed its 5'-flanking region. By reporter gene analysis with progressive 5' deletions from nucleotides -1259 to -64, we have defined a 157-bp DNA fragment as a minimal promoter for constitutive expression. In addition, we show that in the OX40+ cell line, Co, Tax is able to further increase OX40 surface expression. Up-regulation of OX40 promoter activity by Tax requires two upstream NF-kappaB sites, which are not active in the constitutive OX40 expression. Their deletion abrogates Tax responsiveness in reporter gene analysis. The site-directed mutagenesis of each NF-kappaB site demonstrates that cooperative NF-kappaB binding is a prerequisite for Tax-directed activity as neither site alone is sufficient for a full Tax responsiveness of the OX40 promoter. Upon Tax expression, both sites bind p65 and c-Rel. These data provide new insight into the direct regulation of OX40 by Tax and add to our understanding of the possible role of the OX40/OX40 ligand system in the proliferation of HTLV-I+ T cells.

Wnt-Mediated Repression via Bipartite DNA Recognition by TCF in the Drosophila Hematopoietic System

PubMed Central

Zhang, Chen U.; Blauwkamp, Timothy A.; Burby, Peter E.; Cadigan, Ken M.

2014-01-01

The Wnt/β-catenin signaling pathway plays many important roles in animal development, tissue homeostasis and human disease. Transcription factors of the TCF family mediate many Wnt transcriptional responses, promoting signal-dependent activation or repression of target gene expression. The mechanism of this specificity is poorly understood. Previously, we demonstrated that for activated targets in Drosophila, TCF/Pangolin (the fly TCF) recognizes regulatory DNA through two DNA binding domains, with the High Mobility Group (HMG) domain binding HMG sites and the adjacent C-clamp domain binding Helper sites. Here, we report that TCF/Pangolin utilizes a similar bipartite mechanism to recognize and regulate several Wnt-repressed targets, but through HMG and Helper sites whose sequences are distinct from those found in activated targets. The type of HMG and Helper sites is sufficient to direct activation or repression of Wnt regulated cis-regulatory modules, and protease digestion studies suggest that TCF/Pangolin adopts distinct conformations when bound to either HMG-Helper site pair. This repressive mechanism occurs in the fly lymph gland, the larval hematopoietic organ, where Wnt/β-catenin signaling controls prohemocytic differentiation. Our study provides a paradigm for direct repression of target gene expression by Wnt/β-catenin signaling and allosteric regulation of a transcription factor by DNA. PMID:25144371

Novel autophosphorylation sites of Src family kinases regulate kinase activity and SH2 domain-binding capacity.

PubMed

Weir, Marion E; Mann, Jacqueline E; Corwin, Thomas; Fulton, Zachary W; Hao, Jennifer M; Maniscalco, Jeanine F; Kenney, Marie C; Roman Roque, Kristal M; Chapdelaine, Elizabeth F; Stelzl, Ulrich; Deming, Paula B; Ballif, Bryan A; Hinkle, Karen L

2016-04-01

Src family tyrosine kinases (SFKs) are critical players in normal and aberrant biological processes. While phosphorylation importantly regulates SFKs at two known tyrosines, large-scale phosphoproteomics have revealed four additional tyrosines commonly phosphorylated in SFKs. We found these novel tyrosines to be autophosphorylation sites. Mimicking phosphorylation at the C-terminal site to the activation loop decreased Fyn activity. Phosphomimetics and direct phosphorylation at the three SH2 domain sites increased Fyn activity while reducing phosphotyrosine-dependent interactions. While 68% of human SH2 domains exhibit conservation of at least one of these tyrosines, few have been found phosphorylated except when found in cis to a kinase domain. © 2016 Federation of European Biochemical Societies.

Mechanism of reactant and product dissociation from the anthrax edema factor: a locally enhanced sampling and steered molecular dynamics study.

PubMed

Martínez, Leandro; Malliavin, Thérèse E; Blondel, Arnaud

2011-05-01

The anthrax edema factor is a toxin overproducing damaging levels of cyclic adenosine monophosphate (cAMP) and pyrophosphate (PPi) from ATP. Here, mechanisms of dissociation of ATP and products (cAMP, PPi) from the active site are studied using locally enhanced sampling (LES) and steered molecular dynamics simulations. Various substrate conformations and ionic binding modes found in crystallographic structures are considered. LES simulations show that PPi and cAMP dissociate through different solvent accessible channels, while ATP dissociation requires significant active site exposure to solvent. The ionic content of the active site directly affects the dissociation of ATP and products. Only one ion dissociates along with ATP in the two-Mg(2+) binding site, suggesting that the other ion binds EF prior to ATP association. Dissociation of reaction products cAMP and PPi is impaired by direct electrostatic interactions between products and Mg(2+) ions. This provides an explanation for the inhibitory effect of high Mg(2+) concentrations on EF enzymatic activity. Breaking of electrostatic interactions is dependent on a competitive binding of water molecules to the ions, and thus on the solvent accessibility of the active site. Consequently, product dissociation seems to be a two-step process. First, ligands are progressively solvated while preserving the most important electrostatic interactions, in a process that is dependent on the flexibility of the active site. Second, breakage of the electrostatic bonds follows, and ligands diffuse into solvent. In agreement with this mechanism, product protonation facilitates dissociation.

New Electrocatalysts for Direct Oxidation of Organic Fuels

DTIC Science & Technology

2009-06-12

ambient temperature . [28,29] While 13C-NMR provides information on the nature of the adsorbate and the electronic environment at the active surface of...our study to unsupported electrocatalysts that are of greater interest for direct methanol and direct ethanol fuel cells. We have developed a new in...coverage, and type of surface site on the relative adsorption rate and electrooxidative activity of the electrocatalyst. Figure 2 shows sample

Remote site-selective C–H activation directed by a catalytic bifunctional template

PubMed Central

Zhang, Zhipeng; Tanaka, Keita; Yu, Jin-Quan

2017-01-01

Converting C–H bonds directly into carbon-carbon and carbon-heteroatom bonds can significantly improve step-economy in synthesis by providing alternative disconnections to traditional functional group manipulations. In this context, directed C–H activation reactions have been extensively explored for regioselective functionalization1-5. Though applicability can be severely curtailed by distance from the directing group and the shape of the molecule, a number of approaches have been developed to overcome this limitation6-12. For instance, recognition of the distal and geometric relationship between an existing functional group and multiple C–H bonds has recently been exploited to achieve meta-selective C–H activation by use of a covalently attached U-shaped template13-17. However, stoichiometric installation of the template is not feasible in the absence of an appropriate functional group handle. Here we report the design of a catalytic, bifunctional template that binds heterocyclic substrate via reversible coordination instead of covalent linkage, allowing remote site-selective C–H olefination of heterocycles. The two metal centers coordinated to this template play different roles; anchoring substrates to the proximity of catalyst and cleaving the remote C–H bonds respectively. Using this strategy, we demonstrate remote site-selective C–H olefination of heterocyclic substrates which do not have functional group handles for covalently attaching templates. PMID:28273068

Structural evidence for a copper-bound carbonate intermediate in the peroxidase and dismutase activities of superoxide dismutase.

PubMed

Strange, Richard W; Hough, Michael A; Antonyuk, Svetlana V; Hasnain, S Samar

2012-01-01

Copper-zinc superoxide dismutase (SOD) is of fundamental importance to our understanding of oxidative damage. Its primary function is catalysing the dismutation of superoxide to O(2) and H(2)O(2). SOD also reacts with H(2)O(2), leading to the formation of a strong copper-bound oxidant species that can either inactivate the enzyme or oxidise other substrates. In the presence of bicarbonate (or CO(2)) and H(2)O(2), this peroxidase activity is enhanced and produces the carbonate radical. This freely diffusible reactive oxygen species is proposed as the agent for oxidation of large substrates that are too bulky to enter the active site. Here, we provide direct structural evidence, from a 2.15 Å resolution crystal structure, of (bi)carbonate captured at the active site of reduced SOD, consistent with the view that a bound carbonate intermediate could be formed, producing a diffusible carbonate radical upon reoxidation of copper. The bound carbonate blocks direct access of substrates to Cu(I), suggesting that an adjunct to the accepted mechanism of SOD catalysed dismutation of superoxide operates, with Cu(I) oxidation by superoxide being driven via a proton-coupled electron transfer mechanism involving the bound carbonate rather than the solvent. Carbonate is captured in a different site when SOD is oxidised, being located in the active site channel adjacent to the catalytically important Arg143. This is the probable route of diffusion from the active site following reoxidation of the copper. In this position, the carbonate is poised for re-entry into the active site and binding to the reduced copper.

Structural Evidence for a Copper-Bound Carbonate Intermediate in the Peroxidase and Dismutase Activities of Superoxide Dismutase

PubMed Central

Strange, Richard W.; Hough, Michael A.; Antonyuk, Svetlana V.; Hasnain, S. Samar

2012-01-01

Copper-zinc superoxide dismutase (SOD) is of fundamental importance to our understanding of oxidative damage. Its primary function is catalysing the dismutation of superoxide to O2 and H2O2. SOD also reacts with H2O2, leading to the formation of a strong copper-bound oxidant species that can either inactivate the enzyme or oxidise other substrates. In the presence of bicarbonate (or CO2) and H2O2, this peroxidase activity is enhanced and produces the carbonate radical. This freely diffusible reactive oxygen species is proposed as the agent for oxidation of large substrates that are too bulky to enter the active site. Here, we provide direct structural evidence, from a 2.15 Å resolution crystal structure, of (bi)carbonate captured at the active site of reduced SOD, consistent with the view that a bound carbonate intermediate could be formed, producing a diffusible carbonate radical upon reoxidation of copper. The bound carbonate blocks direct access of substrates to Cu(I), suggesting that an adjunct to the accepted mechanism of SOD catalysed dismutation of superoxide operates, with Cu(I) oxidation by superoxide being driven via a proton-coupled electron transfer mechanism involving the bound carbonate rather than the solvent. Carbonate is captured in a different site when SOD is oxidised, being located in the active site channel adjacent to the catalytically important Arg143. This is the probable route of diffusion from the active site following reoxidation of the copper. In this position, the carbonate is poised for re-entry into the active site and binding to the reduced copper. PMID:22984565

Direct activation of a notochord cis-regulatory module by Brachyury and FoxA in the ascidian Ciona intestinalis.

PubMed

Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna

2009-11-01

The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.

Direct accessibility of mixed-metal (III/II) acid sites through the rational synthesis of porous metal carboxylates.

PubMed

Wongsakulphasatch, S; Nouar, F; Rodriguez, J; Scott, L; Le Guillouzer, C; Devic, T; Horcajada, P; Grenèche, J-M; Llewellyn, P L; Vimont, A; Clet, G; Daturi, M; Serre, C

2015-06-25

The scalable and environmentally-friendly synthesis of mixed Fe(III)/M(II) (M = Ni, Co, Mg) polycarboxylate porous MOFs based on the Secondary Building Unit approach is reported. A combination of in situ infrared spectroscopy, (57)Fe Mössbauer spectrometry and adsorption microcalorimetry confirms the direct accessibility of the iron(III) and metal(II) sites under low temperature activation conditions.

Crystal structures of yellowtail ascites virus VP4 protease: trapping an internal cleavage site trans acyl-enzyme complex in a native Ser/Lys dyad active site.

PubMed

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-05-03

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala(716)) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser(633) as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water.

Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

PubMed

Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James

2008-04-11

The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of hemoglobinopathies using single copy vectors.

Direct atomic-level insight into the active sites of a high-performance PGM-free ORR catalyst

NASA Astrophysics Data System (ADS)

Chung, Hoon T.; Cullen, David A.; Higgins, Drew; Sneed, Brian T.; Holby, Edward F.; More, Karren L.; Zelenay, Piotr

2017-08-01

Platinum group metal-free (PGM-free) metal-nitrogen-carbon catalysts have emerged as a promising alternative to their costly platinum (Pt)-based counterparts in polymer electrolyte fuel cells (PEFCs) but still face some major challenges, including (i) the identification of the most relevant catalytic site for the oxygen reduction reaction (ORR) and (ii) demonstration of competitive PEFC performance under automotive-application conditions in the hydrogen (H2)-air fuel cell. Herein, we demonstrate H2-air performance gains achieved with an iron-nitrogen-carbon catalyst synthesized with two nitrogen precursors that developed hierarchical porosity. Current densities recorded in the kinetic region of cathode operation, at fuel cell voltages greater than ~0.75 V, were the same as those obtained with a Pt cathode at a loading of 0.1 milligram of Pt per centimeter squared. The proposed catalytic active site, carbon-embedded nitrogen-coordinated iron (FeN4), was directly visualized with aberration-corrected scanning transmission electron microscopy, and the contributions of these active sites associated with specific lattice-level carbon structures were explored computationally.

Structure of Bacillus subtilis γ-glutamyltranspeptidase in complex with acivicin: diversity of the binding mode of a classical and electrophilic active-site-directed glutamate analogue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ida, Tomoyo; Suzuki, Hideyuki; Fukuyama, Keiichi

2014-02-01

The binding modes of acivicin, a classical and an electrophilic active-site-directed glutamate analogue, to bacterial γ-glutamyltranspeptidases were found to be diverse. γ-Glutamyltranspeptidase (GGT) is an enzyme that plays a central role in glutathione metabolism, and acivicin is a classical inhibitor of GGT. Here, the structure of acivicin bound to Bacillus subtilis GGT determined by X-ray crystallography to 1.8 Å resolution is presented, in which it binds to the active site in a similar manner to that in Helicobacter pylori GGT, but in a different binding mode to that in Escherichia coli GGT. In B. subtilis GGT, acivicin is bound covalentlymore » through its C3 atom with sp{sup 2} hybridization to Thr403 O{sup γ}, the catalytic nucleophile of the enzyme. The results show that acivicin-binding sites are common, but the binding manners and orientations of its five-membered dihydroisoxazole ring are diverse in the binding pockets of GGTs.« less

Direct atomic-level insight into the active sites of a high-performance PGM-free ORR catalyst

DOE PAGES

Chung, Hoon T.; Cullen, David A.; Higgins, Drew; ...

2017-08-04

Platinum group metal–free (PGM-free) metal-nitrogen-carbon catalysts have emerged as a promising alternative to their costly platinum (Pt)–based counterparts in polymer electrolyte fuel cells (PEFCs) but still face some major challenges, including (i) the identification of the most relevant catalytic site for the oxygen reduction reaction (ORR) and (ii) demonstration of competitive PEFC performance under automotive-application conditions in the hydrogen (H 2)–air fuel cell. We demonstrate H 2-air performance gains achieved with an iron-nitrogen-carbon catalyst synthesized with two nitrogen precursors that developed hierarchical porosity. In current densities recorded in the kinetic region of cathode operation, at fuel cell voltages greater thanmore » ~0.75 V, were the same as those obtained with a Pt cathode at a loading of 0.1 milligram of Pt per centimeter squared. The catalytic active site we proposed, carbon-embedded nitrogen-coordinated iron (FeN 4), was directly visualized with aberration-corrected scanning transmission electron microscopy, and the contributions of these active sites associated with specific lattice-level carbon structures were explored computationally.« less

Directly converting CO2 into a gasoline fuel

PubMed Central

Wei, Jian; Ge, Qingjie; Yao, Ruwei; Wen, Zhiyong; Fang, Chuanyan; Guo, Lisheng; Xu, Hengyong; Sun, Jian

2017-01-01

The direct production of liquid fuels from CO2 hydrogenation has attracted enormous interest for its significant roles in mitigating CO2 emissions and reducing dependence on petrochemicals. Here we report a highly efficient, stable and multifunctional Na–Fe3O4/HZSM-5 catalyst, which can directly convert CO2 to gasoline-range (C5–C11) hydrocarbons with selectivity up to 78% of all hydrocarbons while only 4% methane at a CO2 conversion of 22% under industrial relevant conditions. It is achieved by a multifunctional catalyst providing three types of active sites (Fe3O4, Fe5C2 and acid sites), which cooperatively catalyse a tandem reaction. More significantly, the appropriate proximity of three types of active sites plays a crucial role in the successive and synergetic catalytic conversion of CO2 to gasoline. The multifunctional catalyst, exhibiting a remarkable stability for 1,000 h on stream, definitely has the potential to be a promising industrial catalyst for CO2 utilization to liquid fuels. PMID:28462925

Directly converting CO2 into a gasoline fuel.

PubMed

Wei, Jian; Ge, Qingjie; Yao, Ruwei; Wen, Zhiyong; Fang, Chuanyan; Guo, Lisheng; Xu, Hengyong; Sun, Jian

2017-05-02

The direct production of liquid fuels from CO 2 hydrogenation has attracted enormous interest for its significant roles in mitigating CO 2 emissions and reducing dependence on petrochemicals. Here we report a highly efficient, stable and multifunctional Na-Fe 3 O 4 /HZSM-5 catalyst, which can directly convert CO 2 to gasoline-range (C 5 -C 11 ) hydrocarbons with selectivity up to 78% of all hydrocarbons while only 4% methane at a CO 2 conversion of 22% under industrial relevant conditions. It is achieved by a multifunctional catalyst providing three types of active sites (Fe 3 O 4 , Fe 5 C 2 and acid sites), which cooperatively catalyse a tandem reaction. More significantly, the appropriate proximity of three types of active sites plays a crucial role in the successive and synergetic catalytic conversion of CO 2 to gasoline. The multifunctional catalyst, exhibiting a remarkable stability for 1,000 h on stream, definitely has the potential to be a promising industrial catalyst for CO 2 utilization to liquid fuels.

Direct Push supported geotechnical and hydrogeological characterisation of an active sinkhole area

NASA Astrophysics Data System (ADS)

Tippelt, Thomas; Vienken, Thomas; Kirsch, Reinhard; Dietrich, Peter; Werban, Ulrike

2017-04-01

Sinkholes represent a natural geologic hazard in areas where soluble layers are present in the subsurface. A detailed knowledge of the composition of the subsurface and its hydrogeological and geotechnical properties is essential for the understanding of sinkhole formation and propagation. This serves as base for risk evaluation and the development of an early warning system. However, site models often depend on data from drillings and surface geophysical surveys that in many cases cannot resolve the spatial distribution of relevant hydrogeological and geotechnical parameters sufficiently. Therefore, an active sinkhole area in Münsterdorf, Northern Germany, was investigated in detail using Direct Push technology, a minimally invasive sounding method. The obtained vertical high-resolution profiles of geotechnical and hydrogeological characteristics, in combination with Direct Push based sampling and surface geophysical measurements lead to a strong improvement of the geologic site model. The conceptual site model regarding sinkhole formation and propagation will then be tested based on the gathered data and, if necessary, adapted accordingly.

Hanford Site Environmental Report for Calendar Year 2005

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poston, Ted M.; Hanf, Robert W.; Dirkes, Roger L.

This report, published annually since 1958, includes information and summary analytical data that (1) provide an overview of activities at the Hanford Site during calendar year 2005; (2) demonstrate the site's compliance with applicable federal, state, and local environmental laws and regulations, executive orders, and U.S. Department of Energy (DOE) policies and directives; (3) characterize Hanford Site environmental management performance; and (4) highlight significant environmental programs.

Hanford Site Environmental Report for Calendar Year 2004

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poston, Ted M.; Hanf, Robert W.; Dirkes, Roger L.

This report, published annually since 1958, includes information and summary analytical data that (1) provide an overview of activities at the Hanford Site during calendar year 2003; (2) demonstrate the site's compliance with applicable federal, state, and local environmental laws and regulations, executive orders, and U.S. Department of Energy (DOE) policies and directives; (3) characterize Hanford Site environmental management performance; and (4) highlight significant environmental programs.

Catalysis-dependent selenium incorporation and migration in the nitrogenase active site iron-molybdenum cofactor.

PubMed

Spatzal, Thomas; Perez, Kathryn A; Howard, James B; Rees, Douglas C

2015-12-16

Dinitrogen reduction in the biological nitrogen cycle is catalyzed by nitrogenase, a two-component metalloenzyme. Understanding of the transformation of the inert resting state of the active site FeMo-cofactor into an activated state capable of reducing dinitrogen remains elusive. Here we report the catalysis dependent, site-selective incorporation of selenium into the FeMo-cofactor from selenocyanate as a newly identified substrate and inhibitor. The 1.60 Å resolution structure reveals selenium occupying the S2B site of FeMo-cofactor in the Azotobacter vinelandii MoFe-protein, a position that was recently identified as the CO-binding site. The Se2B-labeled enzyme retains substrate reduction activity and marks the starting point for a crystallographic pulse-chase experiment of the active site during turnover. Through a series of crystal structures obtained at resolutions of 1.32-1.66 Å, including the CO-inhibited form of Av1-Se2B, the exchangeability of all three belt-sulfur sites is demonstrated, providing direct insights into unforeseen rearrangements of the metal center during catalysis.

Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

PubMed

Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

2015-07-22

Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

PubMed

Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

2012-05-01

Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.

mTOR kinase structure, mechanism and regulation by the rapamycin-binding domain

PubMed Central

Yang, Haijuan; Rudge, Derek G.; Koos, Joseph D.; Vaidialingam, Bhamini; Yang, Hyo J.; Pavletich, Nikola P.

2015-01-01

The mammalian target of rapamycin (mTOR), a phosphoinositide 3-kinase related protein kinase, controls cell growth in response to nutrients and growth factors and is frequently deregulated in cancer. Here we report co-crystal structures of a truncated mTOR-mLST8 complex with an ATP transition state mimic and with ATP-site inhibitors. The structures reveal an intrinsically active kinase conformation, with catalytic residues and mechanism remarkably similar to canonical protein kinases. The active site is highly recessed due to the FKBP12-Rapamycin binding (FRB) domain and an inhibitory helix protruding from the catalytic cleft. mTOR activating mutations map to the structural framework that holds these elements in place, indicating the kinase is controlled by restricted access. In vitro biochemistry indicates that the FRB domain acts as a gatekeeper, with its rapamycin-binding site interacting with substrates to grant them access to the restricted active site. FKBP12-rapamycin inhibits by directly blocking substrate recruitment and by further restricting active site access. The structures also reveal active site residues and conformational changes that underlie inhibitor potency and specificity. PMID:23636326

Specific phospholipid binding to Na,K-ATPase at two distinct sites.

PubMed

Habeck, Michael; Kapri-Pardes, Einat; Sharon, Michal; Karlish, Steven J D

2017-03-14

Membrane protein function can be affected by the physical state of the lipid bilayer and specific lipid-protein interactions. For Na,K-ATPase, bilayer properties can modulate pump activity, and, as observed in crystal structures, several lipids are bound within the transmembrane domain. Furthermore, Na,K-ATPase activity depends on phosphatidylserine (PS) and cholesterol, which stabilize the protein, and polyunsaturated phosphatidylcholine (PC) or phosphatidylethanolamine (PE), known to stimulate Na,K-ATPase activity. Based on lipid structural specificity and kinetic mechanisms, specific interactions of both PS and PC/PE have been inferred. Nevertheless, specific binding sites have not been identified definitively. We address this question with native mass spectrometry (MS) and site-directed mutagenesis. Native MS shows directly that one molecule each of 18:0/18:1 PS and 18:0/20:4 PC can bind specifically to purified human Na,K-ATPase (α 1 β 1 ). By replacing lysine residues at proposed phospholipid-binding sites with glutamines, the two sites have been identified. Mutations in the cytoplasmic αL8-9 loop destabilize the protein but do not affect Na,K-ATPase activity, whereas mutations in transmembrane helices (TM), αTM2 and αTM4, abolish the stimulation of activity by 18:0/20:4 PC but do not affect stability. When these data are linked to crystal structures, the underlying mechanism of PS and PC/PE effects emerges. PS (and cholesterol) bind between αTM 8, 9, 10, near the FXYD subunit, and maintain topological integrity of the labile C terminus of the α subunit (site A). PC/PE binds between αTM2, 4, 6, and 9 and accelerates the rate-limiting E 1 P-E 2 P conformational transition (site B). We discuss the potential physiological implications.

Ligand-accelerated non-directed C-H functionalization of arenes.

PubMed

Wang, Peng; Verma, Pritha; Xia, Guoqin; Shi, Jun; Qiao, Jennifer X; Tao, Shiwei; Cheng, Peter T W; Poss, Michael A; Farmer, Marcus E; Yeung, Kap-Sun; Yu, Jin-Quan

2017-11-22

The directed activation of carbon-hydrogen bonds (C-H) is important in the development of synthetically useful reactions, owing to the proximity-induced reactivity and selectivity that is enabled by coordinating functional groups. Palladium-catalysed non-directed C-H activation could potentially enable further useful reactions, because it can reach more distant sites and be applied to substrates that do not contain appropriate directing groups; however, its development has faced substantial challenges associated with the lack of sufficiently active palladium catalysts. Currently used palladium catalysts are reactive only with electron-rich arenes, unless an excess of arene is used, which limits synthetic applications. Here we report a 2-pyridone ligand that binds to palladium and accelerates non-directed C-H functionalization with arene as the limiting reagent. This protocol is compatible with a broad range of aromatic substrates and we demonstrate direct functionalization of advanced synthetic intermediates, drug molecules and natural products that cannot be used in excessive quantities. We also developed C-H olefination and carboxylation protocols, demonstrating the applicability of our methodology to other transformations. The site selectivity in these transformations is governed by a combination of steric and electronic effects, with the pyridone ligand enhancing the influence of sterics on the selectivity, thus providing complementary selectivity to directed C-H functionalization.

Ligand-accelerated non-directed C-H functionalization of arenes

NASA Astrophysics Data System (ADS)

Wang, Peng; Verma, Pritha; Xia, Guoqin; Shi, Jun; Qiao, Jennifer X.; Tao, Shiwei; Cheng, Peter T. W.; Poss, Michael A.; Farmer, Marcus E.; Yeung, Kap-Sun; Yu, Jin-Quan

2017-11-01

The directed activation of carbon-hydrogen bonds (C-H) is important in the development of synthetically useful reactions, owing to the proximity-induced reactivity and selectivity that is enabled by coordinating functional groups. Palladium-catalysed non-directed C-H activation could potentially enable further useful reactions, because it can reach more distant sites and be applied to substrates that do not contain appropriate directing groups; however, its development has faced substantial challenges associated with the lack of sufficiently active palladium catalysts. Currently used palladium catalysts are reactive only with electron-rich arenes, unless an excess of arene is used, which limits synthetic applications. Here we report a 2-pyridone ligand that binds to palladium and accelerates non-directed C-H functionalization with arene as the limiting reagent. This protocol is compatible with a broad range of aromatic substrates and we demonstrate direct functionalization of advanced synthetic intermediates, drug molecules and natural products that cannot be used in excessive quantities. We also developed C-H olefination and carboxylation protocols, demonstrating the applicability of our methodology to other transformations. The site selectivity in these transformations is governed by a combination of steric and electronic effects, with the pyridone ligand enhancing the influence of sterics on the selectivity, thus providing complementary selectivity to directed C-H functionalization.

Evidence by site-directed mutagenesis that arginine 203 of thermolysin and arginine 717 of neprilysin (neutral endopeptidase) play equivalent critical roles in substrate hydrolysis and inhibitor binding.

PubMed

Marie-Claire, C; Ruffet, E; Antonczak, S; Beaumont, A; O'Donohue, M; Roques, B P; Fournié-Zaluski, M C

1997-11-11

Neprilysin (neutral endopeptidase-24.11, EC 3.4.24.11) is a mammalian zinc-endopeptidase involved in the degradation of biologically active peptides. Although no atomic structure is available for this enzyme, site-directed mutagenesis studies have shown that its active site resembles closely that of the bacterial zinc-endopeptidase, thermolysin (EC 3.4.24.27). One active site residue of thermolysin, Arg-203, is involved in inhibitor binding by forming hydrogen bonds with the carbonyl group of a residue in the P1 position and also participates in a hydrogen bond network involving Asp-170. Sequence alignment data shows that Arg-717 of neprilysin could play a similar role to Arg-203 of thermolysin. This was investigated by site-directed mutagenesis with Arg-203 of thermolysin and Arg-717 of neprilysin being replaced by methionine residues. This led, in both cases, to decreases in kcat/Km values, of 122-fold for neprilysin and 2300-fold for thermolysin, essentially due to changes in kcat. The Ki values of several inhibitors were also increased for the mutated enzymes. In addition, the replacement of Asp-170 of thermolysin by Ala residue resulted in a decrease in kcat/Km of 220-fold. The results, coupled with a molecular modeling study, suggest that Arg-717 of neprilysin corresponds to Arg-203 of thermolysin and that in both enzymes a hydrogen bond network exists, involving His-142, Asp-170, and Arg-203 in thermolysin and His-583, Asp-650, and Arg-717 in neprilysin, which is crucial for hydrolytic activity.

Direct Epoxidation of Propylene over Stabilized Cu + Surface Sites on Ti Modified Cu 2O

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, X.; Kattel, S.; Xiong, K.

2015-07-17

Direct propylene epoxidation by O 2 is a challenging reaction because of the strong tendency for complete combustion. Results from the current study demonstrate the feasibility to tune the epoxidation selectivity by generating highly dispersed and stabilized Cu + active sites in a TiCuO x mixed oxide. The TiCuO x surface anchors the key surface intermediate, oxametallacycle, leading to higher selectivity for epoxidation of propylene.

Differential 3-bromopyruvate inhibition of cytosolic and mitochondrial human serine hydroxymethyltransferase isoforms, key enzymes in cancer metabolic reprogramming.

PubMed

Paiardini, Alessandro; Tramonti, Angela; Schirch, Doug; Guiducci, Giulia; di Salvo, Martino Luigi; Fiascarelli, Alessio; Giorgi, Alessandra; Maras, Bruno; Cutruzzolà, Francesca; Contestabile, Roberto

2016-11-01

The cytosolic and mitochondrial isoforms of serine hydroxymethyltransferase (SHMT1 and SHMT2, respectively) are well-recognized targets of cancer research, since their activity is critical for purine and pyrimidine biosynthesis and because of their prominent role in the metabolic reprogramming of cancer cells. Here we show that 3-bromopyruvate (3BP), a potent novel anti-tumour agent believed to function primarily by blocking energy metabolism, differentially inactivates human SHMT1 and SHMT2. SHMT1 is completely inhibited by 3BP, whereas SHMT2 retains a significant fraction of activity. Site directed mutagenesis experiments on SHMT1 demonstrate that selective inhibition relies on the presence of a cysteine residue at the active site of SHMT1 (Cys204) that is absent in SHMT2. Our results show that 3BP binds to SHMT1 active site, forming an enzyme-3BP complex, before reacting with Cys204. The physiological substrate l-serine is still able to bind at the active site of the inhibited enzyme, although catalysis does not occur. Modelling studies suggest that alkylation of Cys204 prevents a productive binding of l-serine, hampering interaction between substrate and Arg402. Conversely, the partial inactivation of SHMT2 takes place without the formation of a 3BP-enzyme complex. The introduction of a cysteine residue in the active site of SHMT2 by site directed mutagenesis (A206C mutation), at a location corresponding to that of Cys204 in SHMT1, yields an enzyme that forms a 3BP-enzyme complex and is completely inactivated. This work sets the basis for the development of selective SHMT1 inhibitors that target Cys204, starting from the structure and reactivity of 3BP. Copyright © 2016 Elsevier B.V. All rights reserved.

Frataxin Directly Stimulates Mitochondrial Cysteine Desulfurase by Exposing Substrate-binding Sites, and a Mutant Fe-S Cluster Scaffold Protein with Frataxin-bypassing Ability Acts Similarly*♦

PubMed Central

Pandey, Alok; Gordon, Donna M.; Pain, Jayashree; Stemmler, Timothy L.; Dancis, Andrew; Pain, Debkumar

2013-01-01

For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the “buried” substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation. PMID:24217246

Frataxin directly stimulates mitochondrial cysteine desulfurase by exposing substrate-binding sites, and a mutant Fe-S cluster scaffold protein with frataxin-bypassing ability acts similarly.

PubMed

Pandey, Alok; Gordon, Donna M; Pain, Jayashree; Stemmler, Timothy L; Dancis, Andrew; Pain, Debkumar

2013-12-27

For iron-sulfur (Fe-S) cluster synthesis in mitochondria, the sulfur is derived from the amino acid cysteine by the cysteine desulfurase activity of Nfs1. The enzyme binds the substrate cysteine in the pyridoxal phosphate-containing site, and a persulfide is formed on the active site cysteine in a manner depending on the accessory protein Isd11. The persulfide is then transferred to the scaffold Isu, where it combines with iron to form the Fe-S cluster intermediate. Frataxin is implicated in the process, although it is unclear where and how, and deficiency causes Friedreich ataxia. Using purified proteins and isolated mitochondria, we show here that the yeast frataxin homolog (Yfh1) directly and specifically stimulates cysteine binding to Nfs1 by exposing substrate-binding sites. This novel function of frataxin does not require iron, Isu1, or Isd11. Once bound to Nfs1, the substrate cysteine is the source of the Nfs1 persulfide, but this step is independent of frataxin and strictly dependent on Isd11. Recently, a point mutation in Isu1 was found to bypass many frataxin functions. The data presented here show that the Isu1 suppressor mimics the frataxin effects on Nfs1, explaining the bypassing activity. We propose a regulatory mechanism for the Nfs1 persulfide-forming activity. Specifically, at least two separate conformational changes must occur in the enzyme for optimum activity as follows: one is mediated by frataxin interaction that exposes the "buried" substrate-binding sites, and the other is mediated by Isd11 interaction that brings the bound substrate cysteine and the active site cysteine in proximity for persulfide formation.

Communication between Thiamin Cofactors in the Escherichia coli Pyruvate Dehydrogenase Complex E1 Component Active Centers EVIDENCE FOR A DIRECT PATHWAY BETWEEN THE 4′-AMINOPYRIMIDINE N1′ ATOMS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nemeria, Natalia S; Arjunan, Palaniappa; Chandrasekhar, Krishnamoorthy

2010-11-03

Kinetic, spectroscopic, and structural analysis tested the hypothesis that a chain of residues connecting the 4{prime}-aminopyrimidine N1{prime} atoms of thiamin diphosphates (ThDPs) in the two active centers of the Escherichia coli pyruvate dehydrogenase complex E1 component provides a signal transduction pathway. Substitution of the three acidic residues (Glu{sup 571}, Glu{sup 235}, and Glu{sup 237}) and Arg{sup 606} resulted in impaired binding of the second ThDP, once the first active center was filled, suggesting a pathway for communication between the two ThDPs. (1) Steady-state kinetic and fluorescence quenching studies revealed that upon E571A, E235A, E237A, and R606A substitutions, ThDP binding inmore » the second active center was affected. (2) Analysis of the kinetics of thiazolium C2 hydrogen/deuterium exchange of enzyme-bound ThDP suggests half-of-the-sites reactivity for the E1 component, with fast (activated site) and slow exchanging sites (dormant site). The E235A and E571A variants gave no evidence for the slow exchanging site, indicating that only one of two active sites is filled with ThDP. (3) Titration of the E235A and E237A variants with methyl acetylphosphonate monitored by circular dichroism suggested that only half of the active sites were filled with a covalent predecarboxylation intermediate analog. (4) Crystal structures of E235A and E571A in complex with ThDP revealed the structural basis for the spectroscopic and kinetic observations and showed that either substitution affects cofactor binding, despite the fact that Glu{sup 235} makes no direct contact with the cofactor. The role of the conserved Glu{sup 571} residue in both catalysis and cofactor orientation is revealed by the combined results for the first time.« less

Computer-aided active-site-directed modeling of the Herpes Simplex Virus 1 and human thymidine kinase

NASA Astrophysics Data System (ADS)

Folkers, Gerd; Trumpp-Kallmeyer, Susanne; Gutbrod, Oliver; Krickl, Sabine; Fetzer, Jürgen; Keil, Günther M.

1991-10-01

Thymidine kinase (TK), which is induced by Herpes Simplex Virus 1 (HSV1), plays a key role in the antiviral activity of guanine derivatives such as aciclovir (ACV). In contrast, ACV shows only low affinity to the corresponding host cell enzyme. In order to define the differences in substrate binding of the two enzymes on molecular level, models for the three-dimensional (3-D) structures of the active sites of HSV1-TK and human TK were developed. The reconstruction of the active sites started from primary and secondary structure analysis of various kinases. The results were validated to homologous enzymes with known 3-D structures. The models predict that both enzymes consist of a central core β-sheet structure, connected by loops and α-helices very similar to the overall structure of other nucleotide binding enzymes. The phosphate binding is made up of a highly conserved glycine-rich loop at the N-terminus of the proteins and a conserved region at the C-terminus. The thymidine recognition site was found about 100 amino acids downstream from the phosphate binding loop. The differing substrate specificity of human and HSV1-TK can be explained by amino-acid substitutions in the homologous regions. To achieve a better understanding of the structure of the active site and how the thymidine kinase proteins interact with their substrates, the corresponding complexes of thymidine and dihydroxypropoxyguanine (DHPG) with HSV1 and human TK were built. For the docking of the guanine derivative, the X-ray structure of Elongation Factor Tu (EF-Tu), co-crystallized with guanosine diphosphate, was taken as reference. Fitting of thymidine into the active sites was done with respect to similar interactions found in thymidylate kinase. To complement the analysis of the 3-D structures of the two kinases and the substrate enzyme interactions, site-directed mutagenesis of the thymidine recognition site of HSV1-TK has been undertaken, changing Asp162 in the thymidine recognition site into Asn. First investigations reveal that the enzymatic activity of the mutant protein is destroyed.

Influence of phosphorylation of THR-3, SER-11, and SER-15 on deoxycytidine kinase activity and stability.

PubMed

Smal, C; Ntamashimikiro, S; Arts, A; Van Den Neste, E; Bontemps, F

2010-06-01

Deoxycytidine kinase (dCK) is a key enzyme in the salvage of deoxyribonucleosides and in the activation of several anticancer and antiviral nucleoside analogues. We have recently shown that dCK is a phosphoprotein. Four in vivo phosphorylation sites were identified: Thr-3, Ser-11, Ser-15, and Ser-74. Site-directed mutagenesis demonstrated that phosphorylation of Ser-74, the major phosphorylated residue, strongly influences dCK activity in eucaryotic cells. Here, we show that phosphorylation of the three other sites, located in the N-terminal extremity of the protein, does not significantly modify dCK activity, but phosphorylation of Thr-3 could promote dCK stability.

FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons

PubMed Central

Gilley, Jonathan; Coffer, Paul J.; Ham, Jonathan

2003-01-01

Developing sympathetic neurons die by apoptosis when deprived of NGF. BIM, a BH3-only member of the BCL-2 family, is induced after NGF withdrawal in these cells and contributes to NGF withdrawal–induced death. Here, we have investigated the involvement of the Forkhead box, class O (FOXO) subfamily of Forkhead transcription factors in the regulation of BIM expression by NGF. We find that overexpression of FOXO transcription factors induces BIM expression and promotes death of sympathetic neurons in a BIM-dependent manner. In addition, we find that FKHRL1 (FOXO3a) directly activates the bim promoter via two conserved FOXO binding sites and that mutation of these sites abolishes bim promoter activation after NGF withdrawal. Finally, we show that FOXO activity contributes to the NGF deprivation–induced death of sympathetic neurons. PMID:12913110

Isopentenyldiphosphate:dimethylallyldiphosphate isomerase: Construction of a high-level heterologous expression system for the gene from Saccharomyces cerevisiae and identification of an active-site nucleophile

DOE Office of Scientific and Technical Information (OSTI.GOV)

Street, I.P.; Poulter, C.D.

1990-08-14

Isopentenyldiphosphate:dimethylallyldiphosphate isomerase (IPP isomerase) is an enzyme in isoprene metabolism which catalyzes the interconversion of the fundamental five-carbon homoallylic and allylic diphosphate building blocks for the pathway. The gene encoding IPP isomerase has recently been isolated from Saccharomyces cerevisiae. A heterologous expression system was constructed for the gene and used to overexpress IPP isomerase in Escherichia coli. In transformants carrying the expression vector, IPP isomerase activity was increased by over 100,000-fold relative to that of the untransformed host strain. The overexpressed enzyme constitutes 30-35% of the total soluble cell protein and can be purified to homogeneity in two steps. Recombinantmore » IPP isomerase was indistinguishable from that purified from yeast. 3-(Fluoromethyl)-3-butenyl diphosphate (FIPP) is a specific active-site-directed inhibitor of IPP isomerase from Claviceps purpurea. Inactivation of yeast IPP isomerase by FIPP was active-site-directed, and inhibition resulted in formation of a stoichiometric enzyme-inhibitor complex. The site of covalent attachment in the enzyme-inhibitor complex was determined by inactivating IPP isomerase with (4-{sup 3}H)FIPP, followed by digestion of the labeled enzyme with trypsin and purification of the resulting radioactive peptides by reversed-phase high-performance liquid chromatography. The primary site of attachment was Cys-139.« less

Transition Metal Ions in Zeolites: Coordination and activation of O2

PubMed Central

Smeets, Pieter J.; Woertink, Julia S.; Sels, Bert F.; Solomon, Edward I.; Schoonheydt, Robert A.

2010-01-01

Zeolites containing transition metal ions (TMI) often show promising activity as heterogeneous catalysts in pollution abatement and selective oxidation reactions. In this paper, two aspects of research on the TMI Cu, Co and Fe in zeolites are discussed: (i) coordination to the lattice and (ii) activated oxygen species. At low loading, TMI preferably occupy exchange sites in six-membered oxygen rings (6MR) where the TMI preferentially coordinate with the oxygen atoms of Al tetrahedra. High TMI loadings result in a variety of TMI species formed at the zeolite surface. Removal of the extra-lattice oxygens during high temperature pretreatments can result in auto-reduction. Oxidation of reduced TMI sites often results in the formation of highly reactive oxygen species. In Cu-ZSM-5, calcination with O2 results in the formation of a species, which was found to be a crucial intermediate in both the direct decomposition of NO and N2O and the selective oxidation of methane into methanol. An activated oxygen species, called α-oxygen, is formed in Fe-ZSM5 and reported to be the active site in the partial oxidation of methane and benzene into methanol and phenol, respectively. However, this reactive α-oxygen can only be formed with N2O, not with O2. O2 activated Co intermediates in Faujasite (FAU) zeolites can selectively oxidize α-pinene and epoxidize styrene. In Co-FAU, CoIII superoxo and peroxo complexes are suggested to be the active cores, whereas in Cu and Fe-ZSM-5 various monomeric and dimeric sites have been proposed, but no consensus has been obtained. Very recently, the active site in Cu-ZSM-5 was identified as a bent [Cu-O-Cu]2+ core (Proc. Natl. Acad. Sci. USA 2009, 106, 18908-18913). Overall, O2 activation depends on the interplay of structural factors such as type of zeolite, size of the channels and cages and chemical factors such as Si/Al ratio and the nature, charge and distribution of the charge balancing cations. The presence of several different TMI sites hinders the direct study of the spectroscopic features of the active site. Spectroscopic techniques capable of selectively probing these sites, even if they only constitute a minor fraction of the total amount of TMI sites, are thus required. Fundamental knowledge of the geometric and electronic structure of the reactive active site can help in the design of novel selective oxidation catalysts. PMID:20380459

A Conserved Surface Loop in Type I Dehydroquinate Dehydratases Positions an Active Site Arginine and Functions in Substrate Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Light, Samuel H.; Minasov, George; Shuvalova, Ludmilla

2012-04-18

Dehydroquinate dehydratase (DHQD) catalyzes the third step in the biosynthetic shikimate pathway. We present three crystal structures of the Salmonella enterica type I DHQD that address the functionality of a surface loop that is observed to close over the active site following substrate binding. Two wild-type structures with differing loop conformations and kinetic and structural studies of a mutant provide evidence of both direct and indirect mechanisms of involvement of the loop in substrate binding. In addition to allowing amino acid side chains to establish a direct interaction with the substrate, closure of the loop necessitates a conformational change ofmore » a key active site arginine, which in turn positions the substrate productively. The absence of DHQD in humans and its essentiality in many pathogenic bacteria make the enzyme a target for the development of nontoxic antimicrobials. The structures and ligand binding insights presented here may inform the design of novel type I DHQD inhibiting molecules.« less

Systematic Functional Analysis of Active-Site Residues in l-Threonine Dehydrogenase from Thermoplasma volcanium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desjardins, Morgan; Mak, Wai Shun; O’Brien, Terrence E.

Enzymes have been through millions of years of evolution during which their active-site microenvironments are fine-tuned. Active-site residues are commonly conserved within protein families, indicating their importance for substrate recognition and catalysis. In this work, we systematically mutated active-site residues of l-threonine dehydrogenase from Thermoplasma volcanium and characterized the mutants against a panel of substrate analogs. Our results demonstrate that only a subset of these residues plays an essential role in substrate recognition and catalysis and that the native enzyme activity can be further enhanced roughly 4.6-fold by a single point mutation. Kinetic characterization of mutants on substrate analogs showsmore » that l-threonine dehydrogenase possesses promiscuous activities toward other chemically similar compounds not previously observed. Quantum chemical calculations on the hydride-donating ability of these substrates also reveal that this enzyme did not evolve to harness the intrinsic substrate reactivity for enzyme catalysis. Our analysis provides insights into connections between the details of enzyme active-site structure and specific function. Finally, these results are directly applicable to rational enzyme design and engineering.« less

Systematic Functional Analysis of Active-Site Residues in l-Threonine Dehydrogenase from Thermoplasma volcanium

DOE PAGES

Desjardins, Morgan; Mak, Wai Shun; O’Brien, Terrence E.; ...

2017-07-07

Enzymes have been through millions of years of evolution during which their active-site microenvironments are fine-tuned. Active-site residues are commonly conserved within protein families, indicating their importance for substrate recognition and catalysis. In this work, we systematically mutated active-site residues of l-threonine dehydrogenase from Thermoplasma volcanium and characterized the mutants against a panel of substrate analogs. Our results demonstrate that only a subset of these residues plays an essential role in substrate recognition and catalysis and that the native enzyme activity can be further enhanced roughly 4.6-fold by a single point mutation. Kinetic characterization of mutants on substrate analogs showsmore » that l-threonine dehydrogenase possesses promiscuous activities toward other chemically similar compounds not previously observed. Quantum chemical calculations on the hydride-donating ability of these substrates also reveal that this enzyme did not evolve to harness the intrinsic substrate reactivity for enzyme catalysis. Our analysis provides insights into connections between the details of enzyme active-site structure and specific function. Finally, these results are directly applicable to rational enzyme design and engineering.« less

Deep Sequencing of Random Mutant Libraries Reveals the Active Site of the Narrow Specificity CphA Metallo-β-Lactamase is Fragile to Mutations.

PubMed

Sun, Zhizeng; Mehta, Shrenik C; Adamski, Carolyn J; Gibbs, Richard A; Palzkill, Timothy

2016-09-12

CphA is a Zn(2+)-dependent metallo-β-lactamase that efficiently hydrolyzes only carbapenem antibiotics. To understand the sequence requirements for CphA function, single codon random mutant libraries were constructed for residues in and near the active site and mutants were selected for E. coli growth on increasing concentrations of imipenem, a carbapenem antibiotic. At high concentrations of imipenem that select for phenotypically wild-type mutants, the active-site residues exhibit stringent sequence requirements in that nearly all residues in positions that contact zinc, the substrate, or the catalytic water do not tolerate amino acid substitutions. In addition, at high imipenem concentrations a number of residues that do not directly contact zinc or substrate are also essential and do not tolerate substitutions. Biochemical analysis confirmed that amino acid substitutions at essential positions decreased the stability or catalytic activity of the CphA enzyme. Therefore, the CphA active - site is fragile to substitutions, suggesting active-site residues are optimized for imipenem hydrolysis. These results also suggest that resistance to inhibitors targeted to the CphA active site would be slow to develop because of the strong sequence constraints on function.

Catalytic and reactive polypeptides and methods for their preparation and use

DOEpatents

Schultz, Peter

1994-01-01

Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like.

Molecular Docking and Site-directed Mutagenesis of a Bacillus thuringiensis Chitinase to Improve Chitinolytic, Synergistic Lepidopteran-larvicidal and Nematicidal Activities

PubMed Central

Ni, Hong; Zeng, Siquan; Qin, Xu; Sun, Xiaowen; Zhang, Shan; Zhao, Xiuyun; Yu, Ziniu; Li, Lin

2015-01-01

Bacterial chitinases are useful in the biocontrol of agriculturally important pests and fungal pathogens. However, the utility of naturally occurring bacterial chitinases is often limited by their low enzyme activity. In this study, we constructed mutants of a Bacillus thuringiensis chitinase with enhanced activity based on homology modeling, molecular docking, and the site-directed mutagenesis of target residues to modify spatial positions, steric hindrances, or hydrophilicity/hydrophobicity. We first identified a gene from B. thuringiensis YBT-9602 that encodes a chitinase (Chi9602) belonging to glycosyl hydrolase family 18 with conserved substrate-binding and substrate-catalytic motifs. We constructed a structural model of a truncated version of Chi9602 (Chi960235-459) containing the substrate-binding domain using the homologous 1ITX protein of Bacillus circulans as the template. We performed molecular docking analysis of Chi960235-459 using di-N-acetyl-D-glucosamine as the ligand. We then selected 10 residues of interest from the docking area for the site-directed mutagenesis experiments and expression in Escherichia coli. Assays of the chitinolytic activity of the purified chitinases revealed that the three mutants exhibited increased chitinolytic activity. The ChiW50A mutant exhibited a greater than 60 % increase in chitinolytic activity, with similar pH, temperature and metal ion requirements, compared to wild-type Chi9602. Furthermore, ChiW50A exhibited pest-controlling activity and antifungal activity. Remarkable synergistic effects of this mutant with B. thuringiensis spore-crystal preparations against Helicoverpa armigera and Caenorhabditis elegans larvae and obvious activity against several plant-pathogenic fungi were observed. PMID:25678849

Policy Impacts on Pedagogical Practice and ICT Use: An Exploration of the Results from Sites 2006

ERIC Educational Resources Information Center

Law, N.; Lee, M. W.; Chan, A.

2010-01-01

The Second Information Technology in Education Study (SITES) 2006 results reveal that principals' perceived presence of lifelong learning-related pedagogical activities in their schools had changed markedly since the same data was collected in 1998 in SITES-M1. More intriguing was the fact that the directions of the changes were quite different…

An att site-based recombination reporter system for genome engineering and synthetic DNA assembly.

PubMed

Bland, Michael J; Ducos-Galand, Magaly; Val, Marie-Eve; Mazel, Didier

2017-07-14

Direct manipulation of the genome is a widespread technique for genetic studies and synthetic biology applications. The tyrosine and serine site-specific recombination systems of bacteriophages HK022 and ΦC31 are widely used for stable directional exchange and relocation of DNA sequences, making them valuable tools in these contexts. We have developed site-specific recombination tools that allow the direct selection of recombination events by embedding the attB site from each system within the β-lactamase resistance coding sequence (bla). The HK and ΦC31 tools were developed by placing the attB sites from each system into the signal peptide cleavage site coding sequence of bla. All possible open reading frames (ORFs) were inserted and tested for recombination efficiency and bla activity. Efficient recombination was observed for all tested ORFs (3 for HK, 6 for ΦC31) as shown through a cointegrate formation assay. The bla gene with the embedded attB site was functional for eight of the nine constructs tested. The HK/ΦC31 att-bla system offers a simple way to directly select recombination events, thus enhancing the use of site-specific recombination systems for carrying out precise, large-scale DNA manipulation, and adding useful tools to the genetics toolbox. We further show the power and flexibility of bla to be used as a reporter for recombination.

Steroid Sulfatase Inhibition by Aryl Sulfamates: Clinical Progress, Mechanism and Future Prospects.

PubMed

Potter, Barry V L

2018-04-04

Steroid sulfatase is an emerging drug target for the endocrine therapy of hormone-dependent diseases, catalyzing estrogen sulfate hydrolysis to estrogen. Drug discovery, developing the core aryl O-sulfamate pharmacophore, has led to steroidal and non-steroidal drugs entering numerous clinical trials, with promising results in oncology and women's health. Steroidal estrogen sulfamate derivatives were the first irreversible active-site-directed inhibitors and one was developed clinically as an oral estradiol pro-drug and for endometriosis applications. This review summarizes work leading to the therapeutic concept of sulfatase inhibition, clinical trials executed to date and new insights into the mechanism of inhibition of steroid sulfatase. To date the non-steroidal sulfatase inhibitor Irosustat has been evaluated clinically in breast cancer, alone and in combination, in endometrial cancer and in prostate cancer. The versatile core pharmacophore both imbues attractive pharmaceutical properties and functions via three distinct mechanisms of action, as a pro-drug, an enzyme active site-modifying motif, likely through direct sulfamoyl group transfer, and as a structural component augmenting activity, for example by enhancing interactions at the colchicine binding site of tubulin. Preliminary new structural data on the Pseudomonas aeruginosa arylsulfatase enzyme suggest two possible sulfamate-based adducts with active site hydrated formylglycine as candidates for the inhibition end product via sulfamoyl group transfer, and a speculative choice is suggested. The clinical status of sulfatase inhibition is surveyed and how it might develop in the future. Also discussed are dual-targeting approaches, development of 2-substituted steroidal sulfamates and nonsteroidal derivatives as multi-targeting agents for hormone-independent tumours with other emerging directions.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Bipartite functions of the CREB co-activators selectively direct alternative splicing or transcriptional activation

PubMed Central

Amelio, Antonio L; Caputi, Massimo; Conkright, Michael D

2009-01-01

The CREB regulated transcription co-activators (CRTCs) regulate many biological processes by integrating and converting environmental inputs into transcriptional responses. Although the mechanisms by which CRTCs sense cellular signals are characterized, little is known regarding how CRTCs contribute to the regulation of cAMP inducible genes. Here we show that these dynamic regulators, unlike other co-activators, independently direct either pre-mRNA splice-site selection or transcriptional activation depending on the cell type or promoter context. Moreover, in other scenarios, the CRTC co-activators coordinately regulate transcription and splicing. Mutational analyses showed that CRTCs possess distinct functional domains responsible for regulating either pre-mRNA splicing or transcriptional activation. Interestingly, the CRTC1–MAML2 oncoprotein lacks the splicing domain and is incapable of altering splice-site selection despite robustly activating transcription. The differential usage of these distinct domains allows CRTCs to selectively mediate multiple facets of gene regulation, indicating that co-activators are not solely restricted to coordinating alternative splicing with increase in transcriptional activity. PMID:19644446

Embedded with Facebook: DoD Faces Risks from Social Media

DTIC Science & Technology

2011-06-01

appropriate conduct. Embedded with Social Media Today Facebook is the world’s dominant social network site . Facebook boasts over 600 million active users...billion minutes on the site each month [4]. Facebook is also the most popular social network site for DoD personnel. Using our techniques for correlating...media sites [6], directing that the Non-classified Internet Protocol Router Network (NIPRNET) be configured to allow access to social media, e-mail

Competitive Inhibition Mechanism of Acetylcholinesterase without Catalytic Active Site Interaction: Study on Functionalized C60 Nanoparticles via in Vitro and in Silico Assays.

PubMed

Liu, Yanyan; Yan, Bing; Winkler, David A; Fu, Jianjie; Zhang, Aiqian

2017-06-07

Acetylcholinesterase (AChE) activity regulation by chemical agents or, potentially, nanomaterials is important for both toxicology and pharmacology. Competitive inhibition via direct catalytic active sites (CAS) binding or noncompetitive inhibition through interference with substrate and product entering and exiting has been recognized previously as an AChE-inhibition mechanism for bespoke nanomaterials. The competitive inhibition by peripheral anionic site (PAS) interaction without CAS binding remains unexplored. Here, we proposed and verified the occurrence of a presumed competitive inhibition of AChE without CAS binding for hydrophobically functionalized C 60 nanoparticles (NPs) by employing both experimental and computational methods. The kinetic inhibition analysis distinguished six competitive inhibitors, probably targeting the PAS, from the pristine and hydrophilically modified C 60 NPs. A simple quantitative nanostructure-activity relationship (QNAR) model relating the pocket accessible length of substituent to inhibition capacity was then established to reveal how the geometry of the surface group decides the NP difference in AChE inhibition. Molecular docking identified the PAS as the potential binding site interacting with the NPs via a T-shaped plug-in mode. Specifically, the fullerene core covered the enzyme gorge as a lid through π-π stacking with Tyr72 and Trp286 in the PAS, while the hydrophobic ligands on the fullerene surface inserted into the AChE active site to provide further stability for the complexes. The modeling predicted that inhibition would be severely compromised by Tyr72 and Trp286 deletions, and the subsequent site-directed mutagenesis experiments proved this prediction. Our results demonstrate AChE competitive inhibition of NPs without CAS participation to gain further understanding of both the neurotoxicity and the curative effect of NPs.

XIAP inhibits caspase-3 and -7 using two binding sites: evolutionarily conserved mechanism of IAPs

PubMed Central

Scott, Fiona L; Denault, Jean-Bernard; Riedl, Stefan J; Shin, Hwain; Renatus, Martin; Salvesen, Guy S

2005-01-01

The X-linked inhibitor of apoptosis protein (XIAP) uses its second baculovirus IAP repeat domain (BIR2) to inhibit the apoptotic executioner caspase-3 and -7. Structural studies have demonstrated that it is not the BIR2 domain itself but a segment N-terminal to it that directly targets the activity of these caspases. These studies failed to demonstrate a role of the BIR2 domain in inhibition. We used site-directed mutagenesis of BIR2 and its linker to determine the mechanism of executioner caspase inhibition by XIAP. We show that the BIR2 domain contributes substantially to inhibition of executioner caspases. A surface groove on BIR2, which also binds to Smac/DIABLO, interacts with a neoepitope generated at the N-terminus of the caspase small subunit following activation. Therefore, BIR2 uses a two-site interaction mechanism to achieve high specificity and potency for inhibition. Moreover, for caspase-7, the precise location of the activating cleavage is critical for subsequent inhibition. Since apical caspases utilize this cleavage site differently, we predict that the origin of the death stimulus should dictate the efficiency of inhibition by XIAP. PMID:15650747

Lysine Methylation of Nuclear Co-repressor Receptor Interacting Protein 140

PubMed Central

Huq, MD Mostaqul; Ha, Sung Gil; Barcelona, Helene; Wei, Li-Na

2009-01-01

Receptor interacting protein 140 (RIP140) undergoes extensive posttranslational modifications (PTMs), including phosphorylation, acetylation, arginine methylation, and pyridoxylation. PTMs affect its sub-cellular distribution, protein-protein interaction, and biological activity in adipocyte differentiation. Arginine methylation on Arg240, Arg650, and Arg948 suppresses the repressive activity of RIP140. Here we find that endogenous RIP140 in differentiated 3T3-L1 cells is also modified by lysine methylation. Three lysine residues, Lys591, Lys653, and Lys757 are mapped as potential methylation sites by mass spectrometry. Site-directed mutagenesis study shows that lysine methylation enhances its gene repressive activity. Mutation of lysine methylation sites enhances arginine methylation, while mutation on arginine methylation sites has little effect on its lysine methylation, suggesting a relationship between lysine methylation and arginine methylation. Kinetic analysis of PTMs of endogenous RIP140 in differentiated 3T3-L1 cells demonstrates sequential modifications on RIP140, initiated from constitutive lysine methylation, followed by increased arginine methylation later in differentiation. This study reveals a potential hierarchy of modifications, at least for lysine and arginine methylation, which bi-directionally regulate the functionality of a non-histone protein. PMID:19216533

Multiple nucleotide preferences determine cleavage-site recognition by the HIV-1 and M-MuLV RNases H.

PubMed

Schultz, Sharon J; Zhang, Miaohua; Champoux, James J

2010-03-19

The RNase H activity of reverse transcriptase is required during retroviral replication and represents a potential target in antiviral drug therapies. Sequence features flanking a cleavage site influence the three types of retroviral RNase H activity: internal, DNA 3'-end-directed, and RNA 5'-end-directed. Using the reverse transcriptases of HIV-1 (human immunodeficiency virus type 1) and Moloney murine leukemia virus (M-MuLV), we evaluated how individual base preferences at a cleavage site direct retroviral RNase H specificity. Strong test cleavage sites (designated as between nucleotide positions -1 and +1) for the HIV-1 and M-MuLV enzymes were introduced into model hybrid substrates designed to assay internal or DNA 3'-end-directed cleavage, and base substitutions were tested at specific nucleotide positions. For internal cleavage, positions +1, -2, -4, -5, -10, and -14 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV significantly affected RNase H cleavage efficiency, while positions -7 and -12 for HIV-1 and positions -4, -9, and -11 for M-MuLV had more modest effects. DNA 3'-end-directed cleavage was influenced substantially by positions +1, -2, -4, and -5 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV. Cleavage-site distance from the recessed end did not affect sequence preferences for M-MuLV reverse transcriptase. Based on the identified sequence preferences, a cleavage site recognized by both HIV-1 and M-MuLV enzymes was introduced into a sequence that was otherwise resistant to RNase H. The isolated RNase H domain of M-MuLV reverse transcriptase retained sequence preferences at positions +1 and -2 despite prolific cleavage in the absence of the polymerase domain. The sequence preferences of retroviral RNase H likely reflect structural features in the substrate that favor cleavage and represent a novel specificity determinant to consider in drug design. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Molecular dynamics simulation studies and in vitro site directed mutagenesis of avian beta-defensin Apl_AvBD2

PubMed Central

2010-01-01

Background Defensins comprise a group of antimicrobial peptides, widely recognized as important elements of the innate immune system in both animals and plants. Cationicity, rather than the secondary structure, is believed to be the major factor defining the antimicrobial activity of defensins. To test this hypothesis and to improve the activity of the newly identified avian β-defensin Apl_AvBD2 by enhancing the cationicity, we performed in silico site directed mutagenesis, keeping the predicted secondary structure intact. Molecular dynamics (MD) simulation studies were done to predict the activity. Mutant proteins were made by in vitro site directed mutagenesis and recombinant protein expression, and tested for antimicrobial activity to confirm the results obtained in MD simulation analysis. Results MD simulation revealed subtle, but critical, structural variations between the wild type Apl_AvBD2 and the more cationic in silico mutants, which were not detected in the initial structural prediction by homology modelling. The C-terminal cationic 'claw' region, important in antimicrobial activity, which was intact in the wild type, showed changes in shape and orientation in all the mutant peptides. Mutant peptides also showed increased solvent accessible surface area and more number of hydrogen bonds with the surrounding water molecules. In functional studies, the Escherichia coli expressed, purified recombinant mutant proteins showed total loss of antimicrobial activity compared to the wild type protein. Conclusion The study revealed that cationicity alone is not the determining factor in the microbicidal activity of antimicrobial peptides. Factors affecting the molecular dynamics such as hydrophobicity, electrostatic interactions and the potential for oligomerization may also play fundamental roles. It points to the usefulness of MD simulation studies in successful engineering of antimicrobial peptides for improved activity and other desirable functions. PMID:20122244

A gratuitous β-Lactamase inducer uncovers hidden active site dynamics of the Staphylococcus aureus BlaR1 sensor domain.

PubMed

Frederick, Thomas E; Peng, Jeffrey W

2018-01-01

Increasing evidence shows that active sites of proteins have non-trivial conformational dynamics. These dynamics include active site residues sampling different local conformations that allow for multiple, and possibly novel, inhibitor binding poses. Yet, active site dynamics garner only marginal attention in most inhibitor design efforts and exert little influence on synthesis strategies. This is partly because synthesis requires a level of atomic structural detail that is frequently missing in current characterizations of conformational dynamics. In particular, while the identity of the mobile protein residues may be clear, the specific conformations they sample remain obscure. Here, we show how an appropriate choice of ligand can significantly sharpen our abilities to describe the interconverting binding poses (conformations) of protein active sites. Specifically, we show how 2-(2'-carboxyphenyl)-benzoyl-6-aminopenicillanic acid (CBAP) exposes otherwise hidden dynamics of a protein active site that binds β-lactam antibiotics. When CBAP acylates (binds) the active site serine of the β-lactam sensor domain of BlaR1 (BlaRS), it shifts the time scale of the active site dynamics to the slow exchange regime. Slow exchange enables direct characterization of inter-converting protein and bound ligand conformations using NMR methods. These methods include chemical shift analysis, 2-d exchange spectroscopy, off-resonance ROESY of the bound ligand, and reduced spectral density mapping. The active site architecture of BlaRS is shared by many β-lactamases of therapeutic interest, suggesting CBAP could expose functional motions in other β-lactam binding proteins. More broadly, CBAP highlights the utility of identifying chemical probes common to structurally homologous proteins to better expose functional motions of active sites.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN

Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less

Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme.

PubMed

Brown, Breann L; Kardon, Julia R; Sauer, Robert T; Baker, Tania A

2018-04-03

5-Aminolevulinic acid synthase (ALAS) catalyzes the first step in heme biosynthesis. We present the crystal structure of a eukaryotic ALAS from Saccharomyces cerevisiae. In this homodimeric structure, one ALAS subunit contains covalently bound cofactor, pyridoxal 5'-phosphate (PLP), whereas the second is PLP free. Comparison between the subunits reveals PLP-coupled reordering of the active site and of additional regions to achieve the active conformation of the enzyme. The eukaryotic C-terminal extension, a region altered in multiple human disease alleles, wraps around the dimer and contacts active-site-proximal residues. Mutational analysis demonstrates that this C-terminal region that engages the active site is important for ALAS activity. Our discovery of structural elements that change conformation upon PLP binding and of direct contact between the C-terminal extension and the active site thus provides a structural basis for investigation of disruptions in the first step of heme biosynthesis and resulting human disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.

Direct repeat sequences in the Streptomyces chitinase-63 promoter direct both glucose repression and chitin induction

PubMed Central

Ni, Xiangyang; Westpheling, Janet

1997-01-01

The chi63 promoter directs glucose-sensitive, chitin-dependent transcription of a gene involved in the utilization of chitin as carbon source. Analysis of 5′ and 3′ deletions of the promoter region revealed that a 350-bp segment is sufficient for wild-type levels of expression and regulation. The analysis of single base changes throughout the promoter region, introduced by random and site-directed mutagenesis, identified several sequences to be important for activity and regulation. Single base changes at −10, −12, −32, −33, −35, and −37 upstream of the transcription start site resulted in loss of activity from the promoter, suggesting that bases in these positions are important for RNA polymerase interaction. The sequences centered around −10 (TATTCT) and −35 (TTGACC) in this promoter are, in fact, prototypical of eubacterial promoters. Overlapping the RNA polymerase binding site is a perfect 12-bp direct repeat sequence. Some base changes within this direct repeat resulted in constitutive expression, suggesting that this sequence is an operator for negative regulation. Other base changes resulted in loss of glucose repression while retaining the requirement for chitin induction, suggesting that this sequence is also involved in glucose repression. The fact that cis-acting mutations resulted in glucose resistance but not inducer independence rules out the possibility that glucose repression acts exclusively by inducer exclusion. The fact that mutations that affect glucose repression and chitin induction fall within the same direct repeat sequence module suggests that the direct repeat sequence facilitates both chitin induction and glucose repression. PMID:9371809

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Chloromethane to olefins over H-SAPO-34: Probing the hydrocarbon pool mechanism

DOE PAGES

Fickel, Dustin W.; Sabnis, Kaiwalya D.; Li, Luanyi; ...

2016-09-09

In this paper, by means of in situ FTIR and ex situ 13C NMR studies, the initial periods of the chloromethane-to-olefins (CTO) reaction over SAPO-34 were probed in order to investigate the activation period of the reaction and to elucidate the formation of the catalyst active site. A methylated benzene species has been observed to form during the initial activation period of the reaction, and a direct positive correlation was constructed between the formation of this species and the catalytic activity. The data thus indicate that these methylated benzene species contribute to the formation of active sites within SAPO-34 formore » the CTO reaction. This is the first known report identifying a direct semi-quantitative correlation between the catalyst activity and growth of a methylated benzene active species, during the activation period of the chloromethane to olefins reaction. Finally, the findings here in correspond well to those reported for the methanol to olefins reaction, suggesting that a similar ‘hydrocarbon pool’ mechanism may be responsible for the formation of light olefins in CTO chemistry as well.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fickel, Dustin W.; Sabnis, Kaiwalya D.; Li, Luanyi

In this paper, by means of in situ FTIR and ex situ 13C NMR studies, the initial periods of the chloromethane-to-olefins (CTO) reaction over SAPO-34 were probed in order to investigate the activation period of the reaction and to elucidate the formation of the catalyst active site. A methylated benzene species has been observed to form during the initial activation period of the reaction, and a direct positive correlation was constructed between the formation of this species and the catalytic activity. The data thus indicate that these methylated benzene species contribute to the formation of active sites within SAPO-34 formore » the CTO reaction. This is the first known report identifying a direct semi-quantitative correlation between the catalyst activity and growth of a methylated benzene active species, during the activation period of the chloromethane to olefins reaction. Finally, the findings here in correspond well to those reported for the methanol to olefins reaction, suggesting that a similar ‘hydrocarbon pool’ mechanism may be responsible for the formation of light olefins in CTO chemistry as well.« less

Systems-level identification of PKA-dependent signaling in epithelial cells.

PubMed

Isobe, Kiyoshi; Jung, Hyun Jun; Yang, Chin-Rang; Claxton, J'Neka; Sandoval, Pablo; Burg, Maurice B; Raghuram, Viswanathan; Knepper, Mark A

2017-10-17

G protein stimulatory α-subunit (G αs )-coupled heptahelical receptors regulate cell processes largely through activation of protein kinase A (PKA). To identify signaling processes downstream of PKA, we deleted both PKA catalytic subunits using CRISPR-Cas9, followed by a "multiomic" analysis in mouse kidney epithelial cells expressing the G αs -coupled V2 vasopressin receptor. RNA-seq (sequencing)-based transcriptomics and SILAC (stable isotope labeling of amino acids in cell culture)-based quantitative proteomics revealed a complete loss of expression of the water-channel gene Aqp2 in PKA knockout cells. SILAC-based quantitative phosphoproteomics identified 229 PKA phosphorylation sites. Most of these PKA targets are thus far unannotated in public databases. Surprisingly, 1,915 phosphorylation sites with the motif x-(S/T)-P showed increased phosphooccupancy, pointing to increased activity of one or more MAP kinases in PKA knockout cells. Indeed, phosphorylation changes associated with activation of ERK2 were seen in PKA knockout cells. The ERK2 site is downstream of a direct PKA site in the Rap1GAP, Sipa1l1, that indirectly inhibits Raf1. In addition, a direct PKA site that inhibits the MAP kinase kinase kinase Map3k5 (ASK1) is upstream of JNK1 activation. The datasets were integrated to identify a causal network describing PKA signaling that explains vasopressin-mediated regulation of membrane trafficking and gene transcription. The model predicts that, through PKA activation, vasopressin stimulates AQP2 exocytosis by inhibiting MAP kinase signaling. The model also predicts that, through PKA activation, vasopressin stimulates Aqp2 transcription through induction of nuclear translocation of the acetyltransferase EP300, which increases histone H3K27 acetylation of vasopressin-responsive genes (confirmed by ChIP-seq).

Monocopper active site for partial methane oxidation in Cu-exchanged 8MR zeolites

DOE PAGES

Kulkarni, Ambarish R.; Zhao, Zhi -Jian; Siahrostami, Samira; ...

2016-08-17

Direct conversion of methane to methanol using oxygen is experiencing renewed interest owing to the availability of new natural gas resources. Copper-exchanged zeolites such as mordenite and ZSM-5 have shown encouraging results, and di- and tri-copper species have been suggested as active sites. Recently, small eight-membered ring (8MR) zeolites including SSZ-13, -16, and -39 have been shown to be active for methane oxidation, but the active sites and reaction mechanisms in these 8MR zeolites are not known. In this work, we use density functional theory (DFT) calculations to systematically evaluate monocopper species as active sites for the partial methane oxidationmore » reaction in Cu-exchanged SSZ-13. On the basis of kinetic and thermodynamic arguments, we suggest that [Cu IIOH] + species in the 8MR are responsible for the experimentally observed activity. Furthermore, our results successfully explain the available spectroscopic data and experimental observations including (i) the necessity of water for methanol extraction and (ii) the effect of Si/Al ratio on the catalyst activity. Monocopper species have not yet been suggested as an active site for the partial methane oxidation reaction, and our results suggest that [Cu IIOH] + active site may provide complementary routes for methane activation in zeolites in addition to the known [Cu–O–Cu] 2+ and Cu 3O 3 motifs.« less

Synthetic biology for the directed evolution of protein biocatalysts: navigating sequence space intelligently

PubMed Central

Currin, Andrew; Swainston, Neil; Day, Philip J.

2015-01-01

The amino acid sequence of a protein affects both its structure and its function. Thus, the ability to modify the sequence, and hence the structure and activity, of individual proteins in a systematic way, opens up many opportunities, both scientifically and (as we focus on here) for exploitation in biocatalysis. Modern methods of synthetic biology, whereby increasingly large sequences of DNA can be synthesised de novo, allow an unprecedented ability to engineer proteins with novel functions. However, the number of possible proteins is far too large to test individually, so we need means for navigating the ‘search space’ of possible protein sequences efficiently and reliably in order to find desirable activities and other properties. Enzymologists distinguish binding (K d) and catalytic (k cat) steps. In a similar way, judicious strategies have blended design (for binding, specificity and active site modelling) with the more empirical methods of classical directed evolution (DE) for improving k cat (where natural evolution rarely seeks the highest values), especially with regard to residues distant from the active site and where the functional linkages underpinning enzyme dynamics are both unknown and hard to predict. Epistasis (where the ‘best’ amino acid at one site depends on that or those at others) is a notable feature of directed evolution. The aim of this review is to highlight some of the approaches that are being developed to allow us to use directed evolution to improve enzyme properties, often dramatically. We note that directed evolution differs in a number of ways from natural evolution, including in particular the available mechanisms and the likely selection pressures. Thus, we stress the opportunities afforded by techniques that enable one to map sequence to (structure and) activity in silico, as an effective means of modelling and exploring protein landscapes. Because known landscapes may be assessed and reasoned about as a whole, simultaneously, this offers opportunities for protein improvement not readily available to natural evolution on rapid timescales. Intelligent landscape navigation, informed by sequence-activity relationships and coupled to the emerging methods of synthetic biology, offers scope for the development of novel biocatalysts that are both highly active and robust. PMID:25503938

Interactions of the GM2 activator protein with phosphatidylcholine bilayers: a site-directed spin-labeling power saturation study.

PubMed

Mathias, Jordan D; Ran, Yong; Carter, Jeffery D; Fanucci, Gail E

2009-09-02

The GM2 activator protein (GM2AP) is an accessory protein that is an essential component in the catabolism of the ganglioside GM2. A function of GM2AP is to bind and extract GM2 from intralysosomal vesicles, forming a soluble protein-lipid complex, which interacts with the hydrolase Hexosaminidase A, the enzyme that cleaves the terminal sugar group of GM2. Here, we used site-directed spin labeling with power saturation electron paramagnetic resonance to determine the surface-bound orientation of GM2AP upon phosphatidylcholine vesicles. Because GM2AP extracts lipid ligands from the vesicle and is undergoing exchange on and off the vesicle surface, we utilized a nickel-chelating lipid to localize the paramagnetic metal collider to the lipid bilayer-aqueous interface. Spin-labeled sites that collide with the lipid-bound metal relaxing agent provide a means for mapping sites of the protein that interact with the lipid bilayer interface. Results show that GM2AP binds to lipid bilayers such that the residues lining the lipid-binding cavity lie on the vesicle surface. This orientation creates a favorable microenvironment that can allow for the lipid tails to flip out of the bilayer directly into the hydrophobic pocket of GM2AP.

Active site nanospace of aminoacyl tRNA synthetase: difference between the class I and class II synthetases.

PubMed

Dutta, Saheb; Choudhury, Kaberi; Banik, Sindrila Dutta; Nandi, Nilashis

2014-03-01

The present work is aimed at understanding the origin of the difference in the molecular organization of the active site nanospaces of the class I and class II aminoacyl tRNA synthetases (aaRSs) which are tunnel-like structures. The active site encloses the cognate amino acid (AA) and the adenosine triphosphate (ATP) to carry out aminoacylation reaction. Comparison of the structures of the active site of the class I and class II (aaRSs) shows that the nanodimensional tunnels are curved in opposite directions in the two classes. We investigated the origin of this difference using quantum mechanical computation of electrostatic potential (ESP) of substrates, surrounding residues and ions, using Atoms in Molecule (AIM) Theory and charge population analysis. We show that the difference is principally due to the variation in the spatial charge distribution of ATP in the two classes which correspond to extended and bent conformations of ATP. The present computation shows that the most feasible pathway for nucleophilic attack to alphaP is oppositely directed for class I and class II aaRSs. The available crystal structures show that the cognate AA is indeed located along the channel favorable for nucleophilic attack as predicted by the ESP analysis. It is also shown that the direction of the channel changes its orientation when the orientation of ATP is changed from extended to a bent like structure. We further used the AIM theory to confirm the direction of the approach of AA in each case and the results corroborate the results from the ESP analysis. The opposite curvatures of the active site nanospaces in class I and class II aaRSs are related with the influence of the charge distributions of the extended and bent conformations of ATP, respectively. The results of the computation of electrostatic potential by successive addition of active site residues show that their roles on the reaction are similar in both classes despite the difference in the organization of the active sites of class I and class II aaRSs. The difference in mechanism in two classes as pointed out in recent study (S. Dutta Banik and N. Nandi, J. Biomol. Struct. Dyn. 30, 701 (2012)) is related with the fact that the relative arrangement of the ATP with respect to the AA is opposite in class I and class II aaRSs as explained in the present work. The charge population difference between the reacting centers (which are the alphaP atom of ATP (q(p)) and the attacking oxygen atom of carboxylic acid group (q(o)), respectively) denoted by delta(q), is a measure of the propensity of nucleophilic attack. The population analysis of the substrate AA shows that a non-negligible difference exists between the attacking oxygens of AA in class I (syn) and in class II (anti) which is one reason for the lower value of delta(q) in class II relative to class I. The population analysis of the AA, ATP, Mg+2 ions and active site residues shows that the difference in delta(q) values of the two classes is substantially reduced. When ions and residues are considered. Thus, the bent state of ATP, Mg+2 ions and active site residues complements it cognate AA to carry out the nucleophilic reaction in class I as efficiently as occurs in class I (with the extended state of ATP, single Mg+2 ion and active site residues). This could be one reason for the two different conformations of ATP in the two classes. The mutual arrangements of AA and ATP in each aaRS are guided by the spatial charge distribution of ATP (extended and bent). The present work shows that the construction of nanospace complements the arrangement of the substrate (AA and ATP).

Site-directed immobilization of a genetically engineered anti-methotrexate antibody via an enzymatically introduced biotin label significantly increases the binding capacity of immunoaffinity columns.

PubMed

Davenport, Kaitlynn R; Smith, Christopher A; Hofstetter, Heike; Horn, James R; Hofstetter, Oliver

2016-05-15

In this study, the effect of random vs. site-directed immobilization techniques on the performance of antibody-based HPLC columns was investigated using a single-domain camelid antibody (VHH) directed against methotrexate (MTX) as a model system. First, the high flow-through support material POROS-OH was activated with disuccinimidyl carbonate (DSC), and the VHH was bound in a random manner via amines located on the protein's surface. The resulting column was characterized by Frontal Affinity Chromatography (FAC). Then, two site-directed techniques were explored to increase column efficiency by immobilizing the antibody via its C-terminus, i.e., away from the antigen-binding site. In one approach, a tetra-lysine tail was added, and the antibody was immobilized onto DSC-activated POROS. In the second site-directed approach, the VHH was modified with the AviTag peptide, and a biotin-residue was enzymatically incorporated at the C-terminus using the biotin ligase BirA. The biotinylated antibody was subsequently immobilized onto NeutrAvidin-derivatized POROS. A comparison of the FAC analyses, which for all three columns showed excellent linearity (R(2)>0.999), revealed that both site-directed approaches yield better results than the random immobilization; the by far highest efficiency, however, was determined for the immunoaffinity column based on AviTag-biotinylated antibody. As proof of concept, all three columns were evaluated for quantification of MTX dissolved in phosphate buffered saline (PBS). Validation using UV-detection showed excellent linearity in the range of 0.04-12μM (R(2)>0.993). The lower limit of detection (LOD) and lower limit of quantification (LLOQ) were found to be independent of the immobilization strategy and were 40nM and 132nM, respectively. The intra- and inter-day precision was below 11.6%, and accuracy was between 90.7% and 112%. To the best of our knowledge, this is the first report of the AviTag-system in chromatography, and the first application of immunoaffinity chromatography for the analysis of MTX. Copyright © 2016 Elsevier B.V. All rights reserved.

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

The Receptor-Binding Site of the Measles Virus Hemagglutinin Protein Itself Constitutes a Conserved Neutralizing Epitope

PubMed Central

Ohno, Shinji; Sakai, Kouji; Ito, Yuri; Fukuhara, Hideo; Komase, Katsuhiro; Brindley, Melinda A.; Rota, Paul A.; Plemper, Richard K.; Maenaka, Katsumi; Takeda, Makoto

2013-01-01

Here, we provide direct evidence that the receptor-binding site of measles virus (MV) hemagglutinin protein itself forms an effective conserved neutralizing epitope (CNE). Several receptor-interacting residues constitute the CNE. Thus, viral escape from neutralization has to be associated with loss of receptor-binding activity. Since interactions with both the signaling lymphocyte activation molecule (SLAM) and nectin4 are critical for MV pathogenesis, its escape, which results from loss of receptor-binding activity, should not occur in nature. PMID:23283964

Site-directed mutagenesis of the conserved Asp-443 and Asp-498 carboxy-terminal residues of HIV-1 reverse transcriptase.

PubMed Central

Mizrahi, V; Usdin, M T; Harington, A; Dudding, L R

1990-01-01

Substitution of the conserved Asp-443 residue of HIV-1 reverse transcriptase by asparagine specifically suppressed the ribonuclease H activity of the enzyme without affecting the reverse transcriptase activity, suggesting involvement of this ionizable residue at the ribonuclease H active site. An analogous asparagine substitution of the Asp-498 residue yielded an unstable enzyme that was difficult to enzymatically characterize. However, the instability caused by the Asn-498 mutation was relieved by the introduction of a second distal Asn-443 substitution, yielding an enzyme with wild type reverse transcriptase activity, but lacking ribonuclease H activity. Images PMID:1699202

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Demonstration of muscarinic and nicotinic receptor binding activities of distigmine to treat detrusor underactivity.

PubMed

Harada, Taketsugu; Fushimi, Kazumi; Kato, Aya; Ito, Yoshihiko; Nishijima, Saori; Sugaya, Kimio; Yamada, Shizuo

2010-01-01

The present study was undertaken to examine whether distigmine, a therapeutic agent used to treat detrusor underactivity, binds directly to muscarinic and nicotinic receptors. We used radioreceptor binding assays and compared the effects of distigmine with those of neostigmine and donepedil. The inhibitory effect of distigmine on the blood acetylcholinesterase (AChE) activity was significantly weaker than that of neostigmine. Distigmine, neostigmine, and donepezil competed for specific binding sites of [N-methyl-(3)H]scopolamine methyl chloride ([(3)H]NMS ) and [(3)H]oxotremorine-M in the bladder, submaxillary gland and cerebral cortex of rats in a concentration-dependent manner, indicating significant binding activity of muscarinic receptors. Distigmine displayed significantly higher affinity for binding sites of [(3)H]oxotremorine-M compared with those of [(3)H]NMS as revealed by large ratios of its K(i) value for [(3)H]NMS to that for [(3)H]oxotremorine-M, suggesting that it has preferential affinity for agonist sites of muscarinic receptors. Distigmine seemed to bind to the agonist sites of muscarinic receptors in a competitive manner. Repeated oral administration of distigmine caused a significant decrease in the maximal number of binding sites (B(max)) for [(3)H]NMS in the bladder and submaxillary gland but not cerebral cortex. Distigmine also bound to nicotinic receptors in the rat cerebral cortex. In conclusion, distigmine shows direct binding to muscarinic receptors in the rat bladder, and repeated oral administration of distigmine causes downregulation of muscarinic receptors in the rat bladder. The observed direct interaction of distigmine with the bladder muscarinic receptors may partly contribute to the therapeutic and/or side effects seen in the treatment of detrusor underactivity.

[Substrate specificities of bile salt hydrolase 1 and its mutants from Lactobacillus salivarius].

PubMed

Bi, Jie; Fang, Fang; Qiu, Yuying; Yang, Qingli; Chen, Jian

2014-03-01

In order to analyze the correlation between critical residues in the catalytic centre of BSH and the enzyme substrate specificity, seven mutants of Lactobacillus salivarius bile salt hydrolase (BSH1) were constructed by using the Escherichia coli pET-20b(+) gene expression system, rational design and site-directed mutagenesis. These BSH1 mutants exhibited different hydrolytic activities against various conjugated bile salts through substrate specificities comparison. Among the residues being tested, Cys2 and Thr264 were deduced as key sites for BSH1 to catalyze taurocholic acid and glycocholic acid, respectively. Moreover, Cys2 and Thr264 were important for keeping the catalytic activity of BSH1. The high conservative Cys2 was not the only active site, other mutant amino acid sites were possibly involved in substrate binding. These mutant residues might influence the space and shape of the substrate-binding pockets or the channel size for substrate passing through and entering active site of BSH1, thus, the hydrolytic activity of BSH1 was changed to different conjugated bile salt.

Control of Recombination Directionality by the Listeria Phage A118 Protein Gp44 and the Coiled-Coil Motif of Its Serine Integrase.

PubMed

Mandali, Sridhar; Gupta, Kushol; Dawson, Anthony R; Van Duyne, Gregory D; Johnson, Reid C

2017-06-01

The serine integrase of phage A118 catalyzes integrative recombination between attP on the phage and a specific attB locus on the chromosome of Listeria monocytogenes , but it is unable to promote excisive recombination between the hybrid attL and attR sites found on the integrated prophage without assistance by a recombination directionality factor (RDF). We have identified and characterized the phage-encoded RDF Gp44, which activates the A118 integrase for excision and inhibits integration. Gp44 binds to the C-terminal DNA binding domain of integrase, and we have localized the primary binding site to be within the mobile coiled-coil (CC) motif but distinct from the distal tip of the CC that is required for recombination. This interaction is sufficient to inhibit integration, but a second interaction involving the N-terminal end of Gp44 is also required to activate excision. We provide evidence that these two contacts modulate the trajectory of the CC motifs as they extend out from the integrase core in a manner dependent upon the identities of the four att sites. Our results support a model whereby Gp44 shapes the Int-bound complexes to control which att sites can synapse and recombine. IMPORTANCE Serine integrases mediate directional recombination between bacteriophage and bacterial chromosomes. These highly regulated site-specific recombination reactions are integral to the life cycle of temperate phage and, in the case of Listeria monocytogenes lysogenized by A118 family phage, are an essential virulence determinant. Serine integrases are also utilized as tools for genetic engineering and synthetic biology because of their exquisite unidirectional control of the DNA exchange reaction. Here, we identify and characterize the recombination directionality factor (RDF) that activates excision and inhibits integration reactions by the phage A118 integrase. We provide evidence that the A118 RDF binds to and modulates the trajectory of the long coiled-coil motif that extends from the large carboxyl-terminal DNA binding domain and is postulated to control the early steps of recombination site synapsis. Copyright © 2017 American Society for Microbiology.

The resilience of postglacial hunter-gatherers to abrupt climate change.

PubMed

Blockley, Simon; Candy, Ian; Matthews, Ian; Langdon, Pete; Langdon, Cath; Palmer, Adrian; Lincoln, Paul; Abrook, Ashley; Taylor, Barry; Conneller, Chantal; Bayliss, Alex; MacLeod, Alison; Deeprose, Laura; Darvill, Chris; Kearney, Rebecca; Beavan, Nancy; Staff, Richard; Bamforth, Michael; Taylor, Maisie; Milner, Nicky

2018-05-01

Understanding the resilience of early societies to climate change is an essential part of exploring the environmental sensitivity of human populations. There is significant interest in the role of abrupt climate events as a driver of early Holocene human activity, but there are very few well-dated records directly compared with local climate archives. Here, we present evidence from the internationally important Mesolithic site of Star Carr showing occupation during the early Holocene, which is directly compared with a high-resolution palaeoclimate record from neighbouring lake beds. We show that-once established-there was intensive human activity at the site for several hundred years when the community was subject to multiple, severe, abrupt climate events that impacted air temperatures, the landscape and the ecosystem of the region. However, these results show that occupation and activity at the site persisted regardless of the environmental stresses experienced by this society. The Star Carr population displayed a high level of resilience to climate change, suggesting that postglacial populations were not necessarily held hostage to the flickering switch of climate change. Instead, we show that local, intrinsic changes in the wetland environment were more significant in determining human activity than the large-scale abrupt early Holocene climate events.

40 CFR 165.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

.... Establishment means any site where a pesticidal product, active ingredient, or device is produced, regardless of... one direction and no flow in the opposite direction, thus allowing the withdrawal of material from, but not the introduction of material into, a container. Operator means any person in control of, or...

Site-directed mutagenesis of α-L-rhamnosidase from Alternaria sp. L1 to enhance synthesis yield of reverse hydrolysis based on rational design.

PubMed

Xu, Li; Liu, Xiaohong; Yin, Zhenhao; Liu, Qian; Lu, Lili; Xiao, Min

2016-12-01

The α-L-rhamnosidase catalyzes the hydrolytic release of rhamnose from polysaccharides and glycosides and is widely used due to its applications in a variety of industrial processes. Our previous work reported that a wild-type α-L-rhamnosidase (RhaL1) from Alternaria sp. L1 could synthesize rhamnose-containing chemicals (RCCs) though reverse hydrolysis reaction with inexpensive rhamnose as glycosyl donor. To enhance the yield of reverse hydrolysis reaction and to determine the amino acid residues essential for the catalytic activity of RhaL1, site-directed mutagenesis of 11 residues was performed in this study. Through rationally designed mutations, the critical amino acid residues which may form direct or solvent-mediated hydrogen bonds with donor rhamnose (Asp 252 , Asp 257 , Asp 264 , Glu 530 , Arg 548 , His 553 , and Trp 555 ) and may form the hydrophobic pocket in stabilizing donor (Trp 261 , Tyr 302 , Tyr 316 , and Trp 369 ) in active-site of RhaL1 were analyzed, and three positive mutants (W261Y, Y302F, and Y316F) with improved product yield stood out. From the three positive variants, mutant W261Y accelerated the reverse hydrolysis with a prominent increase (43.7 %) in relative yield compared to the wild-type enzyme. Based on the 3D structural modeling, we supposed that the improved yield of mutant W261Y is due to the adjustment of the spatial position of the putative catalytic acid residue Asp 257 . Mutant W261Y also exhibited a shift in the pH-activity profile in hydrolysis reaction, indicating that introducing of a polar residue in the active site cavity may affect the catalysis behavior of the enzyme.

Non-competitive inhibition by active site binders.

PubMed

Blat, Yuval

2010-06-01

Classical enzymology has been used for generations to understand the interactions of inhibitors with their enzyme targets. Enzymology tools enabled prediction of the biological impact of inhibitors as well as the development of novel, more potent, ones. Experiments designed to examine the competition between the tested inhibitor and the enzyme substrate(s) are the tool of choice to identify inhibitors that bind in the active site. Competition between an inhibitor and a substrate is considered a strong evidence for binding of the inhibitor in the active site, while the lack of competition suggests binding to an alternative site. Nevertheless, exceptions to this notion do exist. Active site-binding inhibitors can display non-competitive inhibition patterns. This unusual behavior has been observed with enzymes utilizing an exosite for substrate binding, isomechanism enzymes, enzymes with multiple substrates and/or products and two-step binding inhibitors. In many of these cases, the mechanisms underlying the lack of competition between the substrate and the inhibitor are well understood. Tools like alternative substrates, testing the enzyme reaction in the reverse direction and monitoring inhibition time dependence can be applied to enable distinction between 'badly behaving' active site binders and true exosite inhibitors.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

2005-01-01

The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

Discovery of novel STAT3 small molecule inhibitors via in silico site-directed fragment-based drug design.

PubMed

Yu, Wenying; Xiao, Hui; Lin, Jiayuh; Li, Chenglong

2013-06-13

Constitutive activation of signal transducer and activator of transcription 3 (STAT3) has been validated as an attractive therapeutic target for cancer therapy. To stop both STAT3 activation and dimerization, a viable strategy is to design inhibitors blocking its SH2 domain phosphotyrosine binding site that is responsible for both actions. A new fragment-based drug design (FBDD) strategy, in silico site-directed FBDD, was applied in this study. A designed novel compound, 5,8-dioxo-6-(pyridin-3-ylamino)-5,8-dihydronaphthalene-1-sulfonamide (LY5), was confirmed to bind to STAT3 SH2 by fluorescence polarization assay. In addition, four out of the five chosen compounds have IC50 values lower than 5 μM for the U2OS cancer cells. 8 (LY5) has an IC50 range in 0.5-1.4 μM in various cancer cell lines. 8 also suppresses tumor growth in an in vivo mouse model. This study has demonstrated the utility of this approach and could be used to other drug targets in general.

Role of the conserved amino acids of the 'SDN' loop (Ser130, Asp131 and Asn132) in a class A beta-lactamase studied by site-directed mutagenesis.

PubMed

Jacob, F; Joris, B; Lepage, S; Dusart, J; Frère, J M

1990-10-15

Ser130, Asp131 and Asn132 ('SDN') are highly conserved residues in class A beta-lactamases forming one wall of the active-site cavity. All three residues of the SDN loop in Streptomyces albus G beta-lactamase were modified by site-directed mutagenesis. The mutant proteins were expressed in Streptomyces lividans, purified from culture supernatants and their kinetic parameters were determined for several substrates. Ser130 was substituted by Asn, Ala and Gly. The first modification yielded an almost totally inactive protein, whereas the smaller-side-chain mutants (A and G) retained some activity, but were less stable than the wild-type enzyme. Ser130 might thus be involved in maintaining the structure of the active-site cavity. Mutations of Asp131 into Glu and Gly proved to be highly detrimental to enzyme stability, reflecting significant structural perturbations. Mutation of Asn132 into Ala resulted in a dramatically decreased enzymic activity (more than 100-fold) especially toward cephalosporin substrates, kcat. being the most affected parameter, which would indicate a role of Asn132 in transition-state stabilization rather than in ground-state binding. Comparison of the N132A and the previously described N132S mutant enzymes underline the importance of an H-bond-forming residue at position 132 for the catalytic process.

Identification and clarification of the role of key active site residues in bacterial glutathione S-transferase zeta/maleylpyruvate isomerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Ti; Li, De-Feng; Zhou, Ning-Yi, E-mail: n.zhou@pentium.whiov.ac.cn

2011-07-08

Highlights: {yields} Application of site-directed mutagenesis to probe the active site residues of glutathione-dependent maleylpyruvate isomerase. {yields} Two conserved residues, Arg8 and Arg176, in zeta class glutathione S-transferases are critical for maleylpyruvate orientation and enolization. {yields} Arg109, found exclusively in NagL, participates in k{sub cat} regulation. {yields} The T11A mutant exhibited a significantly decreased K{sub m} value for glutathione with little impact on maleylpyruvate kinetics. {yields} The Thr11 residue appears to have significance in the evolution of glutathione S-transferase classes. -- Abstract: The maleylpyruvate isomerase NagL from Ralstonia sp. strain U2, which has been structurally characterized previously, catalyzes the isomerizationmore » of maleylpyruvate to fumarylpyruvate. It belongs to the class zeta glutathione S-transferases (GSTZs), part of the cytosolic GST family (cGSTs). In this study, site-directed mutagenesis was conducted to probe the functions of 13 putative active site residues. Steady-state kinetic information for mutants in the reduced glutathione (GSH) binding site, suggested that (a) Gln64 and Asp102 interact directly with the glutamyl moiety of glutathione, (b) Gln49 and Gln64 are involved in a potential electron-sharing network that influences the ionization of the GSH thiol. The information also suggests that (c) His38, Asn108 and Arg109 interact with the GSH glycine moiety, (d) His104 has a role in the ionization of the GSH sulfur and the stabilization of the maleyl terminal carboxyl group in the reaction intermediate and (e) Arg110 influences the electron distribution in the active site and therefore the ionization of the GSH thiolate. Kinetic data for mutants altered in the substrate-binding site imply that (a) Arg8 and Arg176 are critical for maleylpyruvate orientation and enolization, and (b) Arg109 (exclusive to NagL) participates in k{sub cat} regulation. Surprisingly, the T11A mutant had a decreased GSH K{sub m} value, whereas little impact on maleylpyruvate kinetics was observed, suggesting that this residue plays an important role in GSH binding. An evolutionary trend in this residue appears to have developed not only in prokaryotic and eukaryotic GSTZs, but also among the wider class of cGSTs.« less

Analysis of the Mutations in the Active Site of the RNA-Dependent RNA Polymerase of Human Parainfluenza Virus Type 3 (HPIV3)

PubMed Central

Malur, Achut G.; Gupta, Neera K.; De, Bishnu P.; Banerjee, Amiya K.

2002-01-01

The large protein (L) of the human parainfluenza virus type 3 (HPIV3) is the functional RNA-dependent RNA polymerase, which possesses highly conserved residues QGDNQ located within motif C of domain III comprising the putative polymerase active site. We have characterized the role of the QGDNQ residues as well as the residues flanking this region in the polymerase activity of the L protein by site-directed mutagenesis and examining the polymerase activity of the wild-type and mutant L proteins by an in vivo minigenome replication assay and an in vitro mRNA transcription assay. All mutations in the QGDNQ residues abolished transcription while mutations in the flanking residues gave rise to variable polymerase activities. These observations support the contention that the QGDNQ sequence is absolutely required for the polymerase activity of the HPIV3 RNA-dependent RNA polymerase. PMID:12064576

Site-directed mutagenesis reveals a novel catalytic mechanism of Mycobacterium tuberculosis alkylhydroperoxidase C.

PubMed Central

Chauhan, Radha; Mande, Shekhar C

2002-01-01

Mycobacterium tuberculosis alkylhydroperoxidase C (AhpC) belongs to the peroxiredoxin family, but unusually contains three cysteine residues in its active site. It is overexpressed in isoniazid-resistant strains of M. tuberculosis. We demonstrate that AhpC is capable of acting as a general antioxidant by protecting a range of substrates including supercoiled DNA. Active-site Cys to Ala mutants show that all three cysteine residues are important for activity. Cys-61 plays a central role in activity and Cys-174 also appears to be crucial. Interestingly, the C174A mutant is inactive, but double mutant C174/176A shows significant revertant activity. Kinetic parameters indicate that the C176A mutant is active, although much less efficient. We suggest that M. tuberculosis AhpC therefore belongs to a novel peroxiredoxin family and might follow a unique disulphide-relay reaction mechanism. PMID:12084012

Thiol Versus Hydroxamate as Zinc Binding Group In HDAC Inhibition: An Ab Initio QM/MM Molecular Dynamics Study

PubMed Central

Gong, Wenjing; Wu, Ruibo; Zhang, Yingkai

2015-01-01

Zinc-dependent histone deacetylases (HDACs) play a critical role in transcriptional repression and gene silencing, and are among the most attractive targets for the development of new therapeutics against cancer and various other diseases. Two HDAC inhibitors have been approved by FDA as anti-cancer drugs: one is SAHA whose hydroxamate is directly bound to zinc, the other is FK228 whose active form may use thiol as the zinc binding group. In spite of extensive studies, it remains to be ambiguous regarding how thiol and hydroxamate are bound to the zinc active site of HDACs. In this work, our computational approaches center on Born-Oppenheimer ab initio quantum mechanical/molecular mechanical (QM/MM) molecular dynamics with umbrella sampling, which allow for modeling of the zinc active site with reasonable accuracy while properly including dynamics and effects of protein environment. Meanwhile, an improved short-long effective function (SLEF2) to describe non-bonded interactions between zinc and other atoms has been employed in initial MM equilibrations. Our ab initio QM/MM MD simulations have confirmed that hydroxamate is neutral when it is bound to HDAC8, and found that thiol is deprotonated when directly bound to zinc in the HDAC active site. By comparing thiol and hydroxamate, our results elucidated the differences in their binding environment in the HDAC active sites, and emphasized the importance of the linker design to achieve more specific binding towards class IIa HDACs. PMID:26452222

Thiol versus hydroxamate as zinc binding group in HDAC inhibition: An ab initio QM/MM molecular dynamics study.

PubMed

Gong, Wenjing; Wu, Ruibo; Zhang, Yingkai

2015-11-15

Zinc-dependent histone deacetylases (HDACs) play a critical role in transcriptional repression and gene silencing, and are among the most attractive targets for the development of new therapeutics against cancer and various other diseases. Two HDAC inhibitors have been approved by FDA as anti-cancer drugs: one is SAHA whose hydroxamate is directly bound to zinc, the other is FK228 whose active form may use thiol as the zinc binding group. In spite of extensive studies, it remains to be ambiguous regarding how thiol and hydroxamate are bound to the zinc active site of HDACs. In this work, our computational approaches center on Born-Oppenheimer ab initio quantum mechanical/molecular mechanical (QM/MM) molecular dynamics with umbrella sampling, which allow for modeling of the zinc active site with reasonable accuracy while properly including dynamics and effects of protein environment. Meanwhile, an improved short-long effective function (SLEF2) to describe non-bonded interactions between zinc and other atoms has been employed in initial MM equilibrations. Our ab initio QM/MM MD simulations have confirmed that hydroxamate is neutral when it is bound to HDAC8, and found that thiol is deprotonated when directly bound to zinc in the HDAC active site. By comparing thiol and hydroxamate, our results elucidated the differences in their binding environment in the HDAC active sites, and emphasized the importance of the linker design to achieve more specific binding toward class IIa HDACs. © 2015 Wiley Periodicals, Inc.

Hanford Site Environmental Report for Calendar Year 2010

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poston, Ted M.; Duncan, Joanne P.; Dirkes, Roger L.

The Hanford Site environmental report is prepared annually for the U.S. Department of Energy (DOE) in accordance with regulatory requirements. The report provides an overview of activities at the Hanford Site; demonstrates the status of the site's compliance with applicable federal, state, and local environmental laws and regulations, executive orders, and DOE policies and directives; and summarizes environmental data that characterize Hanford Site environmental management performance. The report also highlights significant environmental and public protection programs and efforts. Some historical and early 2011 information is included where appropriate.

Tanshinones that selectively block the collagenase activity of cathepsin K provide a novel class of ectosteric antiresorptive agents for bone.

PubMed

Panwar, Preety; Law, Simon; Jamroz, Andrew; Azizi, Pouya; Zhang, Dongwei; Ciufolini, Marco; Brömme, Dieter

2018-03-01

Attempts to generate active site-directed cathepsin K (CatK) inhibitors for the treatment of osteoporosis have failed because of side effects. We have previously shown that an ectosteric tanshinone CatK inhibitor isolated from Salvia miltiorrhiza blocked, selectively, the collagenase activity of CatK, without affecting the active site and demonstrated its bone-preserving activity in vivo. Here, we have characterize the antiresorptive potential of other tanshinones, which may provide a scaffold for side effect-free CatK inhibitors. Thirty-one tanshinones were tested for their activity against CatK in enzymic and cell-based assays. The inhibitory potency against triple helical and fibrillar collagen degradation was determined in enzymic assays, by scanning electron microscopy and mechanical strength measurements. Human osteoclast assays were used to determine the effects of the inhibitors on bone resorption, its reversibility and osteoclastogenesis. Binding sites were characterized by molecular docking. Twelve compounds showed highly effective anti-collagenase activity and protected collagen against destruction and mechanical instability without inhibiting the hydrolysis of non-collagenous substrates. Six compounds were highly effective in osteoclast bone resorption assays with IC 50 values of <500 nM. None of these tanshinones had effects on cell viability, reversibility of bone resorption inhibition and osteoclastogenesis. The core pharmacophore of the tanshinones appears to be the three-ring system with either a para- or ortho-quinone entity. Our study identified several potent ectosteric antiresorptive CatK inhibitors from the medicinal plant, S. miltiorrhiza, which may avoid side effects seen with active site-directed inhibitors in clinical trials. © 2017 The British Pharmacological Society.

Enhancement of the catalytic activity of ferulic acid decarboxylase from Enterobacter sp. Px6-4 through random and site-directed mutagenesis.

PubMed

Lee, Hyunji; Park, Jiyoung; Jung, Chaewon; Han, Dongfei; Seo, Jiyoung; Ahn, Joong-Hoon; Chong, Youhoon; Hur, Hor-Gil

2015-11-01

The enzyme ferulic acid decarboxylase (FADase) from Enterobacter sp. Px6-4 catalyzes the decarboxylation reaction of lignin monomers and phenolic compounds such as p-coumaric acid, caffeic acid, and ferulic acid into their corresponding 4-vinyl derivatives, that is, 4-vinylphenol, 4-vinylcatechol, and 4-vinylguaiacol, respectively. Among various ferulic acid decarboxylase enzymes, we chose the FADase from Enterobacter sp. Px6-4, whose crystal structure is known, and produced mutants to enhance its catalytic activity by random and site-directed mutagenesis. After three rounds of sequential mutations, FADase(F95L/D112N/V151I) showed approximately 34-fold higher catalytic activity than wild-type for the production of 4-vinylguaiacol from ferulic acid. Docking analyses suggested that the increased activity of FADase(F95L/D112N/V151I) could be due to formation of compact active site compared with that of the wild-type FADase. Considering the amount of phenolic compounds such as lignin monomers in the biomass components, successfully bioengineered FADase(F95L/D112N/V151I) from Enterobacter sp. Px6-4 could provide an ecofriendly biocatalytic tool for producing diverse styrene derivatives from biomass.

Enhanced enzyme stability through site-directed covalent immobilization.

PubMed

Wu, Jeffrey Chun Yu; Hutchings, Christopher Hayden; Lindsay, Mark Jeffrey; Werner, Christopher James; Bundy, Bradley Charles

2015-01-10

Breakthroughs in enzyme immobilization have enabled increased enzyme recovery and reusability, leading to significant decreases in the cost of enzyme use and fueling biocatalysis growth. However, current enzyme immobilization techniques suffer from leaching, enzyme stability, and recoverability and reusability issues. Moreover, these techniques lack the ability to control the orientation of the immobilized enzymes. To determine the impact of orientation on covalently immobilized enzyme activity and stability, we apply our PRECISE (Protein Residue-Explicit Covalent Immobilization for Stability Enhancement) system to a model enzyme, T4 lysozyme. The PRECISE system uses non-canonical amino acid incorporation and the Huisgen 1,3-dipolar cycloaddition "click" reaction to enable directed enzyme immobilization at rationally chosen residues throughout an enzyme. Unlike previous site-specific systems, the PRECISE system is a truly covalent immobilization method. Utilizing this system, enzymes immobilized at proximate and distant locations from the active site were tested for activity and stability under denaturing conditions. Our results demonstrate that orientation control of covalently immobilized enzymes can provide activity and stability benefits exceeding that of traditional random covalent immobilization techniques. PRECISE immobilized enzymes were 50 and 73% more active than randomly immobilized enzymes after harsh freeze-thaw and chemical denaturant treatments. Copyright © 2014 Elsevier B.V. All rights reserved.

Effects of industrial and investigator disturbance on Arctic-nesting geese

USGS Publications Warehouse

Meixell, Brandt W.; Flint, Paul L.

2017-01-01

Oil and gas development on the Arctic Coastal Plain (ACP) of Alaska, USA may have effects on Arctic-nesting birds. To estimate effects of industrial activity and investigator disturbance on avian productivity, we monitored nests of greater white-fronted geese (Anser albifrons) with digital cameras and periodic nest visits during 2013–2014 at 2 sites on the ACP. A disturbed site was adjacent to human-made infrastructure and industrial clean-up activities initiated at the onset of the study and a control site was >2 km from sources of industrial disturbance. We assessed variation in estimates of incubation constancy, nest survival, and predator behavior relative to site, year, and distance from industrial activity using nest photographs obtained at 1-minute intervals. We compared analysis of hourly nest survival informed by intensive monitoring with cameras to analysis of daily nest survival informed by traditional nest visit data obtained at intervals of 5–7 days to assess how method and time scale of sampling affect ecological inference. Geese in both sites exhibited high levels of nest attendance and initiated incubation breaks less than once per day. Observer-caused incubation breaks associated with nest visits ( = 37.8 min) were longer than other types of incubation breaks ( = 8.7 min), demonstrating a differential response by nesting geese to direct human encroachment versus indirect vehicular and aircraft traffic. During both years, geese were absent from nests more frequently in the disturbed ( = 0.9 breaks/day) than control ( = 0.6 breaks/day) site, and this break frequency was slightly higher for nests closer to industrial activity. In the year with high rates of depredation, nest survival was positively related to distance from industrial activity and abandoned infrastructure, consistent with predictions of industry-caused effects. This relationship, however, was not evident in the year with reduced predation pressure, likely because of annual variation in arctic fox (Vulpes lagopus) behavior. Analysis of nest survival probability informed by camera data allowed for detection of detailed patterns of variation that were not supported when using only visit data for the same nests. Observer visits were responsible for reductions of 7–35% in nest survival probability, highlighting the importance of minimizing, and controlling for, observer effects in studies of avian productivity. Indirect vehicular and aircraft disturbance posed less risk to nest survival than direct encroachment by observers at nest sites. Therefore, effects of industrial activities on avian productivity in the Arctic can be minimized through practices that limit direct encounters with nests. 

Dual role of Zn2+ in maintaining structural integrity and suppressing deacetylase activity of SIRT1.

PubMed

Chen, Lei; Feng, Yu; Zhou, Yinqiu; Zhu, Weiliang; Shen, Xu; Chen, Kaixian; Jiang, Hualiang; Liu, Dongxiang

2010-02-01

Zn(2+) directly participates in catalysis of histone deacetylase (HDAC) Classes I, II, IV enzymes while its role in HDAC Class III activity is not well established. Herein we investigated the effects of Zn(2+) on the deacetylase activity of sirtuin 1 (silent mating type information regulation 2 homolog 1, SIRT1). We found that the inherent Zn(2+) at the zinc-finger motif of SIRT1 is essential for the structural integrity and the deacetylase activity of SIRT1, whereas the exogenous Zn(2+) strongly inhibits the deacetylase activity with an IC(50) of 0.82muM for Zn(Gly)(2). SIRT1 activity suppressed by the exogenous Zn(2+) can be fully recovered by the metal chelator EDTA but not by the activator resveratrol. We also identified Zn(2+) as a noncompetitive inhibitor for the substrates of NAD(+) and the acetyl peptide P53-AMC. The 8-anilino-1-naphthalenesulfonic acid (ANS) fluorescence titration experiments and site-directed mutagenesis study suggested that the exogenous Zn(2+) binds to SIRT1 but not at the zinc-finger motif. These results indicate that Zn(2+) plays a dual role in SIRT1 activity. Inherent Zn(2+) at the zinc-finger motif is structurally related and essential for SIRT1 activity. On the other hand, Zn(2+) may also bind to another site different from the zinc-finger motif or the binding sites for the substrates or resveratrol and act as a potent inhibitor of SIRT1.

Chloride sensing by WNK1 kinase involves inhibition of autophosphorylation

PubMed Central

Piala, Alexander T.; Moon, Thomas M.; Akella, Radha; He, Haixia; Cobb, Melanie H.; Goldsmith, Elizabeth J.

2014-01-01

WNK1 [with no lysine (K)] is a serine-threonine kinase associated with a form of familial hypertension. WNK1 is at the top of a kinase cascade leading to phosphorylation of several cotransporters, in particular those transporting sodium, potassium, and chloride (NKCC), sodium and chloride (NCC), and potassium and chloride (KCC). The responsiveness of NKCC, NCC, and KCC to changes in extracellular chloride parallels their phosphorylation state, provoking the proposal that these transporters are controlled by a chloride-sensitive protein kinase. Here, we found that chloride stabilizes the inactive conformation of WNK1, preventing kinase autophosphorylation and activation. Crystallographic studies of inactive WNK1 in the presence of chloride revealed that chloride binds directly to the catalytic site, providing a basis for the unique position of the catalytic lysine. Mutagenesis of the chloride binding site rendered the kinase less sensitive to inhibition of autophosphorylation by chloride, validating the binding site. Thus, these data suggest that WNK1 functions as a chloride sensor through direct binding of a regulatory chloride ion to the active site, which inhibits autophosphorylation. PMID:24803536

A 44 bp intestine-specific hermaphrodite-specific enhancer from the C. elegans vit-2 vitellogenin gene is directly regulated by ELT-2, MAB-3, FKH-9 and DAF-16 and indirectly regulated by the germline, by daf-2/insulin signaling and by the TGF-β/Sma/Mab pathway.

PubMed

Goszczynski, Barbara; Captan, Vasile V; Danielson, Alicia M; Lancaster, Brett R; McGhee, James D

2016-05-01

The Caenorhabditis elegans vitellogenin genes are transcribed in the intestine of adult hermaphrodites but not of males. A 44-bp region from the vit-2 gene promoter is able largely to reconstitute this tissue-, stage- and sex-specific-expression. This "enhancer" contains a binding site for the DM-domain factor MAB-3, the male-specific repressor of vitellogenesis, as well as an activator site that we show is the direct target of the intestinal GATA factor ELT-2. We further show that the enhancer is directly activated by the winged-helix/forkhead-factor FKH-9, (whose gene has been shown by others to be a direct target of DAF-16), by an unknown activator binding to the MAB-3 site, and by the full C. elegans TGF-β/Sma/Mab pathway acting within the intestine. The vit-2 gene has been shown by others to be repressed by the daf-2/daf-16 insulin signaling pathway, which so strongly influences aging and longevity in C. elegans. We show that the activity of the 44 bp vit-2 enhancer is abolished by loss of daf-2 but is restored by simultaneous loss of daf-16. DAF-2 acts from outside of the intestine but DAF-16 acts both from outside of the intestine and from within the intestine where it binds directly to the same non-canonical target site that interacts with FKH-9. Activity of the 44 bp vit-2 enhancer is also inhibited by loss of the germline, in a manner that is only weakly influenced by DAF-16 but that is strongly influenced by KRI-1, a key downstream effector in the pathway by which germline loss increases C. elegans lifespan. The complex behavior of this enhancer presumably allows vitellogenin gene transcription to adjust to demands of body size, germline proliferation and nutritional state but we suggest that the apparent involvement of this enhancer in aging and longevity "pathways" could be incidental. Copyright © 2016 Elsevier Inc. All rights reserved.

Non-active site mutation (Q123A) in New Delhi metallo-β-lactamase (NDM-1) enhanced its enzyme activity.

PubMed

Ali, Abid; Azam, Mohd W; Khan, Asad U

2018-06-01

New Delhi metallo β-lactamase-1 is one of the carbapenemases, causing hydrolysis of almost all β-lactamase antibiotics. Seventeen different NDM variants have been reported so far, they varied in their sequences either by single or multiple amino acid substitutions. Hence, it is important to understand its structural and functional relation. In the earlier studies role of active site residues has been studied but non-active site residues has not studied in detail. Therefore, we have initiated to further comprehend its structure and function relation by mutating some of its non-active site residues. A laboratory mutant of NDM-1 was generated by PCR-based site-directed mutagenesis, replacing Q to A at 123 position. The MICs of imipenem and meropenem for NDM-1 Q123A were found increased by 2 fold as compare to wild type and so the hydrolytic activity was enhanced (Kcat/Km) as compared to NDM-1 wild type. GOLD fitness scores were also found in favour of kinetics data. Secondary structure for α-helical content was determined by Far-UV circular dichroism (CD), which showed significant conformational changes. We conclude a noteworthy role of non-active-site amino acid residues in the catalytic activity of NDM-1. This study also provides an insight of emergence of new variants through natural evolution. Copyright © 2018 Elsevier B.V. All rights reserved.

The co-crystal structure of ubiquitin carboxy-terminal hydrolase L1 (UCHL1) with a tripeptide fluoromethyl ketone (Z-VAE(OMe)-FMK)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davies, Christopher W.; Chaney, Joseph; Korbel, Gregory

2012-07-25

UCHL1 is a 223 amino acid member of the UCH family of deubiquitinating enzymes (DUBs), found abundantly and exclusively expressed in neurons and the testis in normal tissues. Two naturally occurring variants of UCHL1 are directly involved in Parkinson's disease (PD). Not only has UCHL1 been linked to PD, but it has oncogenic properties, having been found abnormally expressed in lung, pancreatic, and colorectal cancers. Although inhibitors of UCHL1 have been described previously the co-crystal structure of the enzyme bound to any inhibitor has not been reported. Herein, we report the X-ray structure of UCHL1 co-crystallized with a peptide-based fluoromethylketonemore » inhibitor, Z-VAE(OMe)-FMK (VAEFMK) at 2.35 {angstrom} resolution. The co-crystal structure reveals that the inhibitor binds in the active-site cleft, irreversibly modifying the active-site cysteine; however, the catalytic histidine is still misaligned as seen in the native structure, suggesting that the inhibitor binds to an inactive form of the enzyme. Our structure also reveals that the inhibitor approaches the active-site cleft from the opposite side of the crossover loop as compared to the direction of approach of ubiquitin's C-terminal tail, thereby occupying the P1{prime} (leaving group) site, a binding site perhaps used by the unknown C-terminal extension of ubiquitin in the actual in vivo substrate(s) of UCHL1. This structure provides a view of molecular contacts at the active-site cleft between the inhibitor and the enzyme as well as furnishing structural information needed to facilitate further design of inhibitors targeted to UCHL1 with high selectivity and potency.« less

Site-directed removal of N-glycosylation sites in BST-1/CD157: effects on molecular and functional heterogeneity.

PubMed Central

Yamamoto-Katayama, S; Sato, A; Ariyoshi, M; Suyama, M; Ishihara, K; Hirano, T; Nakamura, H; Morikawa, K; Jingami, H

2001-01-01

Cyclic ADP ribose (cADPR) is a novel second messenger that releases calcium from intracellular calcium stores, but works independently of inositol 1,4,5-trisphosphate. In mammals ADP-ribosyl cyclase function is found in two membrane proteins, CD38 and bone marrow stromal cell antigen 1 (BST-1)/CD157. These enzymes are exposed extracellularly and also possess cADPR hydrolase activity, but an intracellular soluble ADP-ribosyl cyclase has been reported in human T-cells. Previously, a soluble form of BST-1/CD157 (sBST-1), which lacked the glycosylphosphatidylinositol-anchored portion, was expressed by a baculovirus-insect-cell system. In this study, we have purified the sBST-1, and it migrated as two major bands by SDS/PAGE, suggesting that it is post-translationally modified. BST-1 contains four putative N-glycosylation sites. Tunicamycin treatment reduced sBST-1 expression in the culture medium, indicating that N-glycosylation is essential for secretion. Site-directed mutagenesis was performed to generate sBST-1 mutants (N1-N4), each preserving a single N-glycosylation site. N1, N3 and N4 were well secreted into the medium, and were each detected as a single band. Although N3 and N4 retained the ADP-ribosyl cyclase activity, the cADPR-hydrolase activity was retained only in N4. We conclude that N-glycosylation of sBST-1 facilitates the folding of the nascent polypeptide chain into a conformation that is conductive for intracellular transport and enzymic activity. Furthermore a crystal has been obtained using the N4 mutant, but not the wild-type sBST-1. Thus the artificial engineering of N-glycosylation sites could be an effective method to generate homogeneous material for structural studies. PMID:11439087

Catalytic efficiency and thermostability improvement of Suc2 invertase through rational site-directed mutagenesis.

PubMed

Mohandesi, Nooshin; Haghbeen, Kamahldin; Ranaei, Omid; Arab, Seyed Shahriar; Hassani, Sorour

2017-01-01

Engineering of invertases has come to attention because of increasing demand for possible applications of invertases in various industrial processes. Due to the known physicochemical properties, invertases from micro-organisms such as Saccharomyces cerevisiae carrying SUC2 gene are considered as primary models. To improve thermostability and catalytic efficiency of SUC2 invertase (SInv), six influential residues with Relative Solvent Accessibility<5% were selected through multiple-sequence alignments, molecular modelling, structural and computational analyses. Consequently, SInv and 5 mutants including three mutants with single point substitution [Mut1=P152V, Mut2=S85V and Mut3=K153F)], one mutant with two points [Mut4=S305V-N463V] and one mutant with three points [Mut5=S85V-K153F-T271V] were developed via site-directed mutagenesis and produced using Pichia pastoris as the host. Physicochemical studies on these enzymes indicated that the selected amino acids which were located in the active site region mainly influenced catalytic efficiency. The best improvement belonged to Mut1 (54% increase in K cat /K m ) and Mut3 exhibited the worst effect (90% increase in K m ). These results suggest that Pro152 and Lys153 play key role in preparation of the right substrate lodging in the active site of SInv. The best thermostability improvement (16%) was observed for Mut4 in which two hydrophilic residues located on the loops, far from the active site, were replaced by Valines. These results suggest that tactful simultaneous substitution of influential hydrophilic residues in both active site region and peripheral loops with hydrophobic amino acids could result in more thermostable invertases with enhanced catalytic efficiency. Copyright © 2016 Elsevier Inc. All rights reserved.

Direct Activation of Epac by Sulfonylurea is Isoform Selective

PubMed Central

Herbst, Katie J.; Coltharp, Carla; Amzel, L. Mario; Zhang, Jin

2011-01-01

Summary Commonly used as a treatment for Type II diabetes, sulfonylureas (SUs) stimulate insulin secretion from pancreatic β cells by binding to sulfonylurea receptors. Recently, SUs have been shown to also activate exchange protein directly activated by cAMP 2 (Epac2), however little is known about this molecular action. Using biosensor imaging and biochemical analysis, we show that SUs activate Epac2 and the downstream signaling via direct binding to Epac2. We further identify R447 of Epac2 to be critically involved in SU binding. This distinct binding site from cAMP points to a new mode of allosteric activation of Epac2. We also show that SUs selectively activate Epac2 isoform, but not the closely related Epac1, further establishing SUs as a new class of isoform-selective enzyme activators. PMID:21338921

NGA West 2 | Pacific Earthquake Engineering Research Center

Science.gov Websites

, multi-year research program to improve Next Generation Attenuation models for active tectonic regions earthquake engineering, including modeling of directivity and directionality; verification of NGA-West models epistemic uncertainty; and evaluation of soil amplification factors in NGA models versus NEHRP site factors

Ancient Regulatory Role of Lysine Acetylation in Central Metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakayasu, Ernesto S.; Burnet, Meagan C.; Walukiewicz, Hanna E.

ABSTRACT Lysine acetylation is a common protein post-translational modification in bacteria and eukaryotes. Unlike phosphorylation, whose functional role in signaling has been established, it is unclear what regulatory mechanism acetylation plays and whether it is conserved across evolution. By performing a proteomic analysis of 48 phylogenetically distant bacteria, we discovered conserved acetylation sites on catalytically essential lysine residues that are invariant throughout evolution. Lysine acetylation removes the residue’s charge and changes the shape of the pocket required for substrate or cofactor binding. Two-thirds of glycolytic and tricarboxylic acid (TCA) cycle enzymes are acetylated at these critical sites. Our data suggestmore » that acetylation may play a direct role in metabolic regulation by switching off enzyme activity. We propose that protein acetylation is an ancient and widespread mechanism of protein activity regulation. IMPORTANCEPost-translational modifications can regulate the activity and localization of proteins inside the cell. Similar to phosphorylation, lysine acetylation is present in both eukaryotes and prokaryotes and modifies hundreds to thousands of proteins in cells. However, how lysine acetylation regulates protein function and whether such a mechanism is evolutionarily conserved is still poorly understood. Here, we investigated evolutionary and functional aspects of lysine acetylation by searching for acetylated lysines in a comprehensive proteomic data set from 48 phylogenetically distant bacteria. We found that lysine acetylation occurs in evolutionarily conserved lysine residues in catalytic sites of enzymes involved in central carbon metabolism. Moreover, this modification inhibits enzymatic activity. Our observations suggest that lysine acetylation is an evolutionarily conserved mechanism of controlling central metabolic activity by directly blocking enzyme active sites.« less

Ancient Regulatory Role of Lysine Acetylation in Central Metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakayasu, Ernesto S.; Burnet, Meagan C.; Walukiewicz, Hanna E.

ABSTRACT Lysine acetylation is a common protein post-translational modification in bacteria and eukaryotes. Unlike phosphorylation, whose functional role in signaling has been established, it is unclear what regulatory mechanism acetylation plays and whether it is conserved across evolution. By performing a proteomic analysis of 48 phylogenetically distant bacteria, we discovered conserved acetylation sites on catalytically essential lysine residues that are invariant throughout evolution. Lysine acetylation removes the residue’s charge and changes the shape of the pocket required for substrate or cofactor binding. Two-thirds of glycolytic and tricarboxylic acid (TCA) cycle enzymes are acetylated at these critical sites. Our data suggestmore » that acetylation may play a direct role in metabolic regulation by switching off enzyme activity. We propose that protein acetylation is an ancient and widespread mechanism of protein activity regulation. IMPORTANCE Post-translational modifications can regulate the activity and localization of proteins inside the cell. Similar to phosphorylation, lysine acetylation is present in both eukaryotes and prokaryotes and modifies hundreds to thousands of proteins in cells. However, how lysine acetylation regulates protein function and whether such a mechanism is evolutionarily conserved is still poorly understood. Here, we investigated evolutionary and functional aspects of lysine acetylation by searching for acetylated lysines in a comprehensive proteomic data set from 48 phylogenetically distant bacteria. We found that lysine acetylation occurs in evolutionarily conserved lysine residues in catalytic sites of enzymes involved in central carbon metabolism. Moreover, this modification inhibits enzymatic activity. Our observations suggest that lysine acetylation is an evolutionarily conserved mechanism of controlling central metabolic activity by directly blocking enzyme active sites.« less

Ancient Regulatory Role of Lysine Acetylation in Central Metabolism

DOE PAGES

Nakayasu, Ernesto S.; Burnet, Meagan C.; Walukiewicz, Hanna E.; ...

2017-11-28

ABSTRACT Lysine acetylation is a common protein post-translational modification in bacteria and eukaryotes. Unlike phosphorylation, whose functional role in signaling has been established, it is unclear what regulatory mechanism acetylation plays and whether it is conserved across evolution. By performing a proteomic analysis of 48 phylogenetically distant bacteria, we discovered conserved acetylation sites on catalytically essential lysine residues that are invariant throughout evolution. Lysine acetylation removes the residue’s charge and changes the shape of the pocket required for substrate or cofactor binding. Two-thirds of glycolytic and tricarboxylic acid (TCA) cycle enzymes are acetylated at these critical sites. Our data suggestmore » that acetylation may play a direct role in metabolic regulation by switching off enzyme activity. We propose that protein acetylation is an ancient and widespread mechanism of protein activity regulation. IMPORTANCE Post-translational modifications can regulate the activity and localization of proteins inside the cell. Similar to phosphorylation, lysine acetylation is present in both eukaryotes and prokaryotes and modifies hundreds to thousands of proteins in cells. However, how lysine acetylation regulates protein function and whether such a mechanism is evolutionarily conserved is still poorly understood. Here, we investigated evolutionary and functional aspects of lysine acetylation by searching for acetylated lysines in a comprehensive proteomic data set from 48 phylogenetically distant bacteria. We found that lysine acetylation occurs in evolutionarily conserved lysine residues in catalytic sites of enzymes involved in central carbon metabolism. Moreover, this modification inhibits enzymatic activity. Our observations suggest that lysine acetylation is an evolutionarily conserved mechanism of controlling central metabolic activity by directly blocking enzyme active sites.« less

Site-directed mutagenesis and PBAN activation of the Helicoverpa zea PBAN-receptor

USDA-ARS?s Scientific Manuscript database

Insect neuropeptides are produced in the central or peripheral nerve tissues, and released to regulate various physiological and behavioral actions during development and reproduction. Pheromone biosynthesis-activating neuropeptide (PBAN)/Pyrokinin is a major neuropeptide family characterized with a...

DOE Office of Scientific and Technical Information (OSTI.GOV)

B Akabayov; C Richardson

Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstratemore » that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.« less

Mutations close to a hub residue affect the distant active site of a GH1 β-glucosidase.

PubMed

Souza, Valquiria P; Ikegami, Cecília M; Arantes, Guilherme M; Marana, Sandro R

2018-01-01

The tertiary structure of proteins has been represented as a network, in which residues are nodes and their contacts are edges. Protein structure networks contain residues, called hubs or central, which are essential to form short connection pathways between any pair of nodes. Hence hub residues may effectively spread structural perturbations through the protein. To test whether modifications nearby to hub residues could affect the enzyme active site, mutations were introduced in the β-glycosidase Sfβgly (PDB-ID: 5CG0) directed to residues that form an α-helix (260-265) and a β-strand (335-337) close to one of its main hub residues, F251, which is approximately 14 Å from the Sfβgly active site. Replacement of residues A263 and A264, which side-chains project from the α-helix towards F251, decreased the rate of substrate hydrolysis. Mutation A263F was shown to weaken noncovalent interactions involved in transition state stabilization within the Sfβgly active site. Mutations placed on the opposite side of the same α-helix did not show these effects. Consistently, replacement of V336, which side-chain protrudes from a β-strand face towards F251, inactivated Sfβgly. Next to V336, mutation S337F also caused a decrease in noncovalent interactions involved in transition state stabilization. Therefore, we suggest that mutations A263F, A264F, V336F and S337F may directly perturb the position of the hub F251, which could propagate these perturbations into the Sfβgly active site through short connection pathways along the protein network.

Structure of Thermotoga maritima Stationary Phase Survival Protein SurE: A Novel Acid Phosphatase

PubMed Central

Zhang, R.-G.; Skarina, T.; Katz, J.E.; Beasley, S.; Khachatryan, A.; Vyas, S.; Arrowsmith, C.H.; Clarke, S.; Edwards, A.; Joachimiak, A.; Savchenko, A.

2009-01-01

Summary Background The rpoS, nlpD, pcm, and surE genes are among many whose expression is induced during the stationary phase of bacterial growth. rpoS codes for the stationary-phase RNA polymerase σ subunit, and nlpD codes for a lipoprotein. The pcm gene product repairs damaged proteins by converting the atypical isoaspartyl residues back to L-aspartyls. The physiological and biochemical functions of surE are unknown, but its importance in stress is supported by the duplication of the surE gene in E. coli subjected to high-temperature growth. The pcm and surE genes are highly conserved in bacteria, archaea, and plants. Results The structure of SurE from Thermotoga maritima was determined at 2.0 Å. The SurE monomer is composed of two domains; a conserved N-terminal domain, a Rossman fold, and a C-terminal oligomerization domain, a new fold. Monomers form a dimer that assembles into a tetramer. Biochemical analysis suggests that SurE is an acid phosphatase, with an optimum pH of 5.5–6.2. The active site was identified in the N-terminal domain through analysis of conserved residues. Structure-based site-directed point mutations abolished phosphatase activity. T. maritima SurE intra- and inter-subunit salt bridges were identified that may explain the SurE thermostability. Conclusions The structure of SurE provided information about the protein’s fold, oligomeric state, and active site. The protein possessed magnesium-dependent acid phosphatase activity, but the physiologically relevant substrate(s) remains to be identified. The importance of three of the assigned active site residues in catalysis was confirmed by site-directed mutagenesis. PMID:11709173

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

Critical Amino Acids in the Active Site of Meprin Metalloproteinases for Substrate and Peptide Bond Specificity*

PubMed Central

Villa, James P.; Bertenshaw, Greg P.; Bond, Judith S.

2008-01-01

SUMMARY The protease domains of the evolutionarily-related α and ß subunits of meprin metalloproteases are approximately 55% identical at the amino acid level, however, their substrate and peptide bond specificities differ markedly. The meprin ß subunit favors acidic residues proximal to the scissile bond, while the α subunit prefers small or aromatic amino acids flanking the scissile bond. Thus gastrin, a peptide that contains a string of five Glu residues, is an excellent substrate for meprin ß while it is not hydrolyzed by meprin α. Work herein aimed to identify critical amino acids in the meprin active sites that determine the substrate specificity differences. Sequence alignments and homology models, based on the crystal structure of the crayfish astacin, showed electrostatic differences within the meprin active sites. Site-directed mutagenesis of active site residues demonstrated that replacement of a hydrophobic residue by a basic amino acid enabled the meprin α protease to cleave gastrin. The meprin αY199K mutant was most effective; the corresponding mutation of meprin ßK185Y resulted in decreased activity toward gastrin. Peptide cleavage site determinations and kinetic analyses using a variety of peptides extended evidence that meprin αTyr199/ßLys185 are substrate specificity determinants in meprin active sites. These studies shed light on the molecular basis for the substrate specificity differences of astacin metalloproteinases. PMID:12888571

The crystal structure of dihydrodipicolinate synthase from Escherichia coli with bound pyruvate and succinic acid semialdehyde: unambiguous resolution of the stereochemistry of the condensation product.

PubMed

Boughton, Berin A; Dobson, Renwick C J; Hutton, Craig A

2012-08-01

The crystal structure of Escherichia coli dihydrodipicolinate synthase with pyruvate and substrate analogue succinic acid semialdehyde condensed with the active site lysine-161 was solved to a resolution of 2.3 Å. Comparative analysis to a previously reported structure both resolves the configuration at the aldol addition center, where the final addition product clearly displays the (S)-configuration, and the final conformation of the adduct within the active site. Direct comparison to two other crystal structures found in the Protein Data Bank, 1YXC, and 3DU0, demonstrates significant similarity between the active site residues of these structures. Copyright © 2012 Wiley Periodicals, Inc.

A divide-and-conquer approach to determine the Pareto frontier for optimization of protein engineering experiments.

PubMed

He, Lu; Friedman, Alan M; Bailey-Kellogg, Chris

2012-03-01

In developing improved protein variants by site-directed mutagenesis or recombination, there are often competing objectives that must be considered in designing an experiment (selecting mutations or breakpoints): stability versus novelty, affinity versus specificity, activity versus immunogenicity, and so forth. Pareto optimal experimental designs make the best trade-offs between competing objectives. Such designs are not "dominated"; that is, no other design is better than a Pareto optimal design for one objective without being worse for another objective. Our goal is to produce all the Pareto optimal designs (the Pareto frontier), to characterize the trade-offs and suggest designs most worth considering, but to avoid explicitly considering the large number of dominated designs. To do so, we develop a divide-and-conquer algorithm, Protein Engineering Pareto FRontier (PEPFR), that hierarchically subdivides the objective space, using appropriate dynamic programming or integer programming methods to optimize designs in different regions. This divide-and-conquer approach is efficient in that the number of divisions (and thus calls to the optimizer) is directly proportional to the number of Pareto optimal designs. We demonstrate PEPFR with three protein engineering case studies: site-directed recombination for stability and diversity via dynamic programming, site-directed mutagenesis of interacting proteins for affinity and specificity via integer programming, and site-directed mutagenesis of a therapeutic protein for activity and immunogenicity via integer programming. We show that PEPFR is able to effectively produce all the Pareto optimal designs, discovering many more designs than previous methods. The characterization of the Pareto frontier provides additional insights into the local stability of design choices as well as global trends leading to trade-offs between competing criteria. Copyright © 2011 Wiley Periodicals, Inc.

Direct activation of the olfactory cyclic nucleotide-gated channel through modification of sulfhydryl groups by NO compounds.

PubMed

Broillet, M C; Firestein, S

1996-02-01

The activation of a cyclic nucleotide-gated channel is the final step in sensory transduction in olfaction. Normally, this channel is opened by the intracellular cyclic nucleotide second messenger cAMP or cGMP. However, in single channel recordings we found that donors of nitric oxide, a putative intercellular messenger, could directly activate the native olfactory neuron channel. Its action was independent of the presence of the normal ligand and did not involve the cyclic nucleotide binding site, suggesting an alternate site on the molecule that is critical in channel gating. The biochemical pathway appears to utilize nitric oxide in one of its alternate redox states, the nitrosonium ion, transnitrosylating a free sulfhydryl group belonging to a cysteine residue tentatively identified as being in the region linking the S6 transmembrane domain to the ligand binding domain.

Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

PubMed Central

Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

2013-01-01

Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

Direct electrical stimulation of human cortex evokes high gamma activity that predicts conscious somatosensory perception

NASA Astrophysics Data System (ADS)

Muller, Leah; Rolston, John D.; Fox, Neal P.; Knowlton, Robert; Rao, Vikram R.; Chang, Edward F.

2018-04-01

Objective. Direct electrical stimulation (DES) is a clinical gold standard for human brain mapping and readily evokes conscious percepts, yet the neurophysiological changes underlying these percepts are not well understood. Approach. To determine the neural correlates of DES, we stimulated the somatosensory cortex of ten human participants at frequency-amplitude combinations that both elicited and failed to elicit conscious percepts, meanwhile recording neural activity directly surrounding the stimulation site. We then compared the neural activity of perceived trials to that of non-perceived trials. Main results. We found that stimulation evokes distributed high gamma activity, which correlates with conscious perception better than stimulation parameters themselves. Significance. Our findings suggest that high gamma activity is a reliable biomarker for perception evoked by both natural and electrical stimuli.

Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

PubMed Central

Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

1994-01-01

Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

Local entrainment of oscillatory activity induced by direct brain stimulation in humans

PubMed Central

Amengual, Julià L.; Vernet, Marine; Adam, Claude; Valero-Cabré, Antoni

2017-01-01

In a quest for direct evidence of oscillation entrainment, we analyzed intracerebral electroencephalographic recordings obtained during intracranial electrical stimulation in a cohort of three medication-resistant epilepsy patients tested pre-surgically. Spectral analyses of non-epileptogenic cerebral sites stimulated directly with high frequency electrical bursts yielded episodic local enhancements of frequency-specific rhythmic activity, phase-locked to each individual pulse. These outcomes reveal an entrainment of physiological oscillatory activity within a frequency band dictated by the rhythm of the stimulation source. Our results support future uses of rhythmic stimulation to elucidate the causal contributions of synchrony to specific aspects of human cognition and to further develop the therapeutic manipulation of dysfunctional rhythmic activity subtending the symptoms of some neuropsychiatric conditions. PMID:28256510

Locally induced neuronal synchrony precisely propagates to specific cortical areas without rhythm distortion.

PubMed

Toda, Haruo; Kawasaki, Keisuke; Sato, Sho; Horie, Masao; Nakahara, Kiyoshi; Bepari, Asim K; Sawahata, Hirohito; Suzuki, Takafumi; Okado, Haruo; Takebayashi, Hirohide; Hasegawa, Isao

2018-05-16

Propagation of oscillatory spike firing activity at specific frequencies plays an important role in distributed cortical networks. However, there is limited evidence for how such frequency-specific signals are induced or how the signal spectra of the propagating signals are modulated during across-layer (radial) and inter-areal (tangential) neuronal interactions. To directly evaluate the direction specificity of spectral changes in a spiking cortical network, we selectively photostimulated infragranular excitatory neurons in the rat primary visual cortex (V1) at a supra-threshold level with various frequencies, and recorded local field potentials (LFPs) at the infragranular stimulation site, the cortical surface site immediately above the stimulation site in V1, and cortical surface sites outside V1. We found a significant reduction of LFP powers during radial propagation, especially at high-frequency stimulation conditions. Moreover, low-gamma-band dominant rhythms were transiently induced during radial propagation. Contrastingly, inter-areal LFP propagation, directed to specific cortical sites, accompanied no significant signal reduction nor gamma-band power induction. We propose an anisotropic mechanism for signal processing in the spiking cortical network, in which the neuronal rhythms are locally induced/modulated along the radial direction, and then propagate without distortion via intrinsic horizontal connections for spatiotemporally precise, inter-areal communication.

Unprecedented access of phenolic substrates to the heme active site of a catalase: substrate binding and peroxidase-like reactivity of Bacillus pumilus catalase monitored by X-ray crystallography and EPR spectroscopy.

PubMed

Loewen, Peter C; Villanueva, Jacylyn; Switala, Jacek; Donald, Lynda J; Ivancich, Anabella

2015-05-01

Heme-containing catalases and catalase-peroxidases catalyze the dismutation of hydrogen peroxide as their predominant catalytic activity, but in addition, individual enzymes support low levels of peroxidase and oxidase activities, produce superoxide, and activate isoniazid as an antitubercular drug. The recent report of a heme enzyme with catalase, peroxidase and penicillin oxidase activities in Bacillus pumilus and its categorization as an unusual catalase-peroxidase led us to investigate the enzyme for comparison with other catalase-peroxidases, catalases, and peroxidases. Characterization revealed a typical homotetrameric catalase with one pentacoordinated heme b per subunit (Tyr340 being the axial ligand), albeit in two orientations, and a very fast catalatic turnover rate (kcat  = 339,000 s(-1) ). In addition, the enzyme supported a much slower (kcat  = 20 s(-1) ) peroxidatic activity utilizing substrates as diverse as ABTS and polyphenols, but no oxidase activity. Two binding sites, one in the main access channel and the other on the protein surface, accommodating pyrogallol, catechol, resorcinol, guaiacol, hydroquinone, and 2-chlorophenol were identified in crystal structures at 1.65-1.95 Å. A third site, in the heme distal side, accommodating only pyrogallol and catechol, interacting with the heme iron and the catalytic His and Arg residues, was also identified. This site was confirmed in solution by EPR spectroscopy characterization, which also showed that the phenolic oxygen was not directly coordinated to the heme iron (no low-spin conversion of the Fe(III) high-spin EPR signal upon substrate binding). This is the first demonstration of phenolic substrates directly accessing the heme distal side of a catalase. © 2015 Wiley Periodicals, Inc.

Constitutive expression of human gastric lipase in Pichia pastoris and site-directed mutagenesis of key lid-stabilizing residues.

PubMed

Sams, Laura; Amara, Sawsan; Chakroun, Almahdi; Coudre, Sébastien; Paume, Julie; Giallo, Jacqueline; Carrière, Frédéric

2017-10-01

The cDNA encoding human gastric lipase (HGL) was integrated into the genome of Pichia pastoris using the pGAPZα A transfer vector. The HGL signal peptide was replaced by the yeast α-factor to achieve an efficient secretion. Active rHGL was produced by the transformed yeast but its levels and stability were dependent on the pH. The highest activity was obtained upon buffering the culture medium at pH5, a condition that allowed preserving enzyme activity over time. A large fraction (72±2%) of secreted rHGL remained however bound to the yeast cells, and was released by washing the cell pellet with an acid glycine-HCl buffer (pH2.2). This procedure allowed establishing a first step of purification that was completed by size exclusion chromatography. N-terminal sequencing and MALDI-ToF mass spectrometry revealed that rHGL was produced in its mature form, with a global mass of 50,837±32Da corresponding to a N-glycosylated form of HGL polypeptide (43,193Da). rHGL activity was characterized as a function of pH, various substrates and in the presence of bile salts and pepsin, and was found similar to native HGL, except for slight changes in pH optima. We then studied by site-directed mutagenesis the role of three key residues (K4, E225, R229) involved in salt bridges stabilizing the lid domain that controls the access to the active site and is part of the interfacial recognition site. Their substitution has an impact on the pH-dependent activity of rHGL and its relative activities on medium and long chain triglycerides. Copyright © 2017 Elsevier B.V. All rights reserved.

Nitric oxide is not permissive for cutaneous active vasodilatation in humans.

PubMed

Wilkins, Brad W; Holowatz, Lacy A; Wong, Brett J; Minson, Christopher T

2003-05-01

The precise role of nitric oxide (NO) in cutaneous active vasodilatation in humans is unknown. We tested the hypothesis that NO is necessary to permit the action of an unknown vasodilator. Specifically, we investigated whether a low-dose infusion of exogenous NO, in the form of sodium nitroprusside (SNP), would fully restore vasodilatation in an area of skin in which endogenous NO was inhibited during hyperthermia. This finding would suggest a 'permissive' role for NO in active vasodilatation. Eight subjects were instrumented with three microdialysis fibres in forearm skin. Sites were randomly assigned to (1) Site A: control site; (2) Site B: NO synthase (NOS) inhibition during established hyperthermia; or (3) Site C: NOS inhibition throughout the protocol. Red blood cell flux was measured using laser-Doppler flowmetry (LDF) and cutaneous vascular conductance (CVC; LDF/mean arterial pressure) was normalized to maximal vasodilatation at each site. In Site B, NG-nitro-L-arginine methyl ester (L-NAME) infusion during hyperthermia reduced CVC by approximately 32 % (65 +/- 4 % CVCmax vs. 45 +/- 4 % CVCmax; P < 0.05). Vasodilatation was not restored to pre-NOS inhibition values in this site following low-dose SNP infusion (55 +/- 4 % CVCmax vs. 65 +/- 4 % CVCmax; P < 0.05). CVC remained significantly lower than the control site with low-dose SNP infusion in Site C (P < 0.05). The rise in CVC with low-dose SNP (deltaCVC) was significantly greater in Site B and Site C during hyperthermia compared to normothermia (P < 0.05). No difference in deltaCVC was observed between hyperthermia and normothermia in the control site (Site A). Thus, NO does not act permissively in cutaneous active vasodilatation in humans but may directly mediate vasodilatation and enhance the effect of an unknown active vasodilator.

Thioredoxin-1 Negatively Modulates ADAM17 Activity Through Direct Binding and Indirect Reductive Activity.

PubMed

Granato, Daniela C; E Costa, Rute A P; Kawahara, Rebeca; Yokoo, Sami; Aragão, Annelize Z; Domingues, Romênia R; Pauletti, Bianca A; Honorato, Rodrigo V; Fattori, Juliana; Figueira, Ana Carolina M; Oliveira, Paulo S L; Consonni, Silvio R; Fernandes, Denise; Laurindo, Francisco; Hansen, Hinrich P; Paes Leme, Adriana F

2018-02-27

A disintegrin and metalloprotease 17 (ADAM17) modulates signaling events by releasing surface protein ectodomains such as TNFa and the EGFR-ligands. We have previously characterized cytoplasmic thioredoxin-1 (Trx-1) as a partner of ADAM17 cytoplasmic domain. Still, the mechanism of ADAM17 regulation by Trx-1 is unknown, and it has become of paramount importance to assess the degree of influence that Trx-1 has on metalloproteinase ADAM17. Combining discovery and targeted proteomic approaches, we uncovered that Trx-1 negatively regulates ADAM17 by direct and indirect effect. We performed cell-based assays with synthetic peptides and site-directed mutagenesis, and we demonstrated that the interaction interface of Trx-1 and ADAM17 is important for the negative regulation of ADAM17 activity. However, both Trx-1 K72A and catalytic site mutant Trx-1 C32/35S rescued ADAM17 activity, although the interaction with Trx-1 C32/35S was unaffected, suggesting an indirect effect of Trx-1. We confirmed that the Trx-1 C32/35S mutant showed diminished reductive capacity, explaining this indirect effect on increasing ADAM17 activity through oxidant levels. Interestingly, Trx-1 K72A mutant showed similar oxidant levels to Trx-1 C32/35S , even though its catalytic site was preserved. We further demonstrated that the general reactive oxygen species inhibitor, Nacetylcysteine (NAC), maintained the regulation of ADAM17 dependent of Trx-1 reductase activity levels; whereas the electron transport chain modulator, rotenone, abolished Trx-1 effect on ADAM17 activity. We show for the first time that the mechanism of ADAM17 regulation, Trx-1 dependent, can be by direct interaction and indirect effect, bringing new insights into the cross-talk between isomerases and mammalian metalloproteinases. This unexpected Trx-1 K72A behavior was due to more dimer formation and, consequently, the reduction of its Trx-1 reductase activity, evaluated through dimer verification, by gel filtration and mass spectrometry analysis. Antioxid. Redox Signal. 00, 000-000.

Glucocorticoids suppress tumor necrosis factor-alpha expression by human monocytic THP-1 cells by suppressing transactivation through adjacent NF-kappa B and c-Jun-activating transcription factor-2 binding sites in the promoter.

PubMed

Steer, J H; Kroeger, K M; Abraham, L J; Joyce, D A

2000-06-16

Glucocorticoid drugs suppress tumor necrosis factor-alpha (TNF-alpha) synthesis by activated monocyte/macrophages, contributing to an anti-inflammatory action in vivo. In lipopolysaccharide (LPS)-activated human monocytic THP-1 cells, glucocorticoids acted primarily on the TNF-alpha promoter to suppress a burst of transcriptional activity that occurred between 90 min and 3 h after LPS exposure. LPS increased nuclear c-Jun/ATF-2, NF-kappaB(1)/Rel-A, and Rel-A/C-Rel transcription factor complexes, which bound specifically to oligonucleotide sequences from the -106 to -88 base pair (bp) region of the promoter. The glucocorticoid, dexamethasone, suppressed nuclear binding activity of these complexes prior to and during the critical phase of TNF-alpha transcription. Site-directed mutagenesis in TNF-alpha promoter-luciferase reporter constructs showed that the adjacent c-Jun/ATF-2 (-106 to -99 bp) and NF-kappaB (-97 to -88 bp) binding sites each contributed to the LPS-stimulated expression. Mutating both sites largely prevented dexamethasone from suppressing TNF-alpha promoter-luciferase reporters. LPS exposure also increased nuclear Egr-1 and PU.1 abundance. The Egr-1/Sp1 (-172 to -161 bp) binding sites and the PU.1-binding Ets site (-116 to -110 bp) each contributed to the LPS-stimulated expression but not to glucocorticoid response. Dexamethasone suppressed the abundance of the c-Fos/c-Jun complex in THP-1 cell nuclei, but there was no direct evidence for c-Fos/c-Jun transactivation through sites in the -172 to -52 bp region. Small contributions to glucocorticoid response were attributable to promoter sequences outside the -172 to -88 bp region and to sequences in the TNF-alpha 3'-untranslated region. We conclude that glucocorticoids suppress LPS-stimulated secretion of TNF-alpha from human monocytic cells largely through antagonizing transactivation by c-Jun/ATF-2 and NF-kappaB complexes at binding sites in the -106 to -88 bp region of the TNF-alpha promoter.

Active-site solvent replenishment observed during human carbonic anhydrase II catalysis.

PubMed

Kim, Jin Kyun; Lomelino, Carrie L; Avvaru, Balendu Sankara; Mahon, Brian P; McKenna, Robert; Park, SangYoun; Kim, Chae Un

2018-01-01

Human carbonic anhydrase II (hCA II) is a zinc metalloenzyme that catalyzes the reversible hydration/dehydration of CO 2 /HCO 3 - . Although hCA II has been extensively studied to investigate the proton-transfer process that occurs in the active site, its underlying mechanism is still not fully understood. Here, ultrahigh-resolution crystallographic structures of hCA II cryocooled under CO 2 pressures of 7.0 and 2.5 atm are presented. The structures reveal new intermediate solvent states of hCA II that provide crystallographic snapshots during the restoration of the proton-transfer water network in the active site. Specifically, a new intermediate water (W I ') is observed next to the previously observed intermediate water W I , and they are both stabilized by the five water molecules at the entrance to the active site (the entrance conduit). Based on these structures, a water network-restructuring mechanism is proposed, which takes place at the active site after the nucleophilic attack of OH - on CO 2 . This mechanism explains how the zinc-bound water (W Zn ) and W1 are replenished, which are directly responsible for the reconnection of the His64-mediated proton-transfer water network. This study provides the first 'physical' glimpse of how a water reservoir flows into the hCA II active site during its catalytic activity.

Revealing the Double-Edged Sword Role of Graphene on Boosted Charge Transfer versus Active Site Control in TiO2 Nanotube Arrays@RGO/MoS2 Heterostructure.

PubMed

Quan, Quan; Xie, Shunji; Weng, Bo; Wang, Ye; Xu, Yi-Jun

2018-05-01

Charge separation/transfer is generally believed to be the most key factor affecting the efficiency of photocatalysis, which however will be counteracted if not taking the active site engineering into account for a specific photoredox reaction. Here, a 3D heterostructure composite is designed consisting of MoS 2 nanoplatelets decorated on reduced graphene oxide-wrapped TiO 2 nanotube arrays (TNTAs@RGO/MoS 2 ). Such a cascade configuration renders a directional migration of charge carriers and controlled immobilization of active sites, thereby showing much higher photoactivity for water splitting to H 2 than binary TNTAs@RGO and TNTAs/MoS 2 . The photoactivity comparison and mechanistic analysis reveal the double-edged sword role of RGO on boosted charge separation/transfer versus active site control in this composite system. The as-observed inconsistency between boosted charge transfer and lowered photoactivity over TNTAs@RGO is attributed to the decrease of active sites for H 2 evolution, which is significantly different from the previous reports in literature. The findings of the intrinsic relationship of balanced benefits from charge separation/transfer and active site control could promote the rational optimization of photocatalyst design by cooperatively manipulating charge flow and active site control, thereby improving the efficiency of photocatalysis for target photoredox processes. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structural Insights into l-Tryptophan Dehydrogenase from a Photoautotrophic Cyanobacterium, Nostoc punctiforme.

PubMed

Wakamatsu, Taisuke; Sakuraba, Haruhiko; Kitamura, Megumi; Hakumai, Yuichi; Fukui, Kenji; Ohnishi, Kouhei; Ashiuchi, Makoto; Ohshima, Toshihisa

2017-01-15

l-Tryptophan dehydrogenase from Nostoc punctiforme NIES-2108 (NpTrpDH), despite exhibiting high amino acid sequence identity (>30%)/homology (>50%) with NAD(P) + -dependent l-Glu/l-Leu/l-Phe/l-Val dehydrogenases, exclusively catalyzes reversible oxidative deamination of l-Trp to 3-indolepyruvate in the presence of NAD + Here, we determined the crystal structure of the apo form of NpTrpDH. The structure of the NpTrpDH monomer, which exhibited high similarity to that of l-Glu/l-Leu/l-Phe dehydrogenases, consisted of a substrate-binding domain (domain I, residues 3 to 133 and 328 to 343) and an NAD + /NADH-binding domain (domain II, residues 142 to 327) separated by a deep cleft. The apo-NpTrpDH existed in an open conformation, where domains I and II were apart from each other. The subunits dimerized themselves mainly through interactions between amino acid residues around the β-1 strand of each subunit, as was observed in the case of l-Phe dehydrogenase. The binding site for the substrate l-Trp was predicted by a molecular docking simulation and validated by site-directed mutagenesis. Several hydrophobic residues, which were located in the active site of NpTrpDH and possibly interacted with the side chain of the substrate l-Trp, were arranged similarly to that found in l-Leu/l-Phe dehydrogenases but fairly different from that of an l-Glu dehydrogenase. Our crystal structure revealed that Met-40, Ala-69, Ile-74, Ile-110, Leu-288, Ile-289, and Tyr-292 formed a hydrophobic cluster around the active site. The results of the site-directed mutagenesis experiments suggested that the hydrophobic cluster plays critical roles in protein folding, l-Trp recognition, and catalysis. Our results provide critical information for further characterization and engineering of this enzyme. In this study, we determined the three-dimensional structure of l-Trp dehydrogenase, analyzed its various site-directed substitution mutants at residues located in the active site, and obtained the following informative results. Several residues in the active site form a hydrophobic cluster, which may be a part of the hydrophobic core essential for protein folding. To our knowledge, there is no previous report demonstrating that a hydrophobic cluster in the active site of any l-amino acid dehydrogenase may have a critical impact on protein folding. Furthermore, our results suggest that this hydrophobic cluster could strictly accommodate l-Trp. These studies show the structural characteristics of l-Trp dehydrogenase and hence would facilitate novel applications of l-Trp dehydrogenase. Copyright © 2016 American Society for Microbiology.

Deletion of loop fragment adjacent to active site diminishes the stability and activity of exo-inulinase.

PubMed

Arjomand, Maryam Rezaei; Habibi-Rezaei, Mehran; Ahmadian, Gholamreza; Hassanzadeh, Malihe; Karkhane, Ali Asghar; Asadifar, Mandana; Amanlou, Massoud

2016-11-01

Inulinases are classified as hydrolases and widely used in the food and medical industries. Here, we report the deletion of a six-membered adjacent active site loop fragment ( 74 YGSDVT 79 sequence) from third Ω-loop of the exo-inulinase containing aspartate residue from Aspergillus niger to study its structural and functional importance. Site-directed mutagenesis was used to create the mutant of the exo-inulinase (Δ6SL). To investigate the stability of the region spanning this loop, MD simulations were performed 80ns for 20-85 residues. Molecular docking was performed to compare the interactions in the active sites of enzymes with fructose as a ligand. Accordingly, the functional thermostability of the exo-inulinase was significantly decreased upon loop fragment deletion. Evaluation of the kinetics parameters (V max , K m , k cat and, k cat /K m ) and activation energy (E a ) of the catalysis of enzymes indicated the importance of the deleted sequence on the catalytic performance of the enzyme. In conclusion, six-membered adjacent active site loop fragment not only plays a crucial role in the stability of the enzyme, but also it involves in the enzyme catalysis through lowering the activation energy of the catalysis and effective improving the catalytic performance. Copyright © 2016. Published by Elsevier B.V.

Direct Visualization of Catalytically Active Sites at the FeO–Pt(111) Interface

DOE PAGES

Kudernatsch, Wilhelmine; Peng, Guowen; Zeuthen, Helene; ...

2015-05-31

Within the area of surface science, one of the “holy grails” is to directly visualize a chemical reaction at the atomic scale. Whereas this goal has been reached by high-resolution scanning tunneling microscopy (STM) in a number of cases for reactions occurring at flat surfaces, such a direct view is often inhibited for reaction occurring at steps and interfaces. Here we have studied the CO oxidation reaction at the interface between ultrathin FeO islands and a Pt(111) support by in situ STM and density functional theory (DFT) calculations. Time-lapsed STM imaging on this inverse model catalyst in O 2 andmore » CO environments revealed catalytic activity occurring at the FeO–Pt(111) interface and directly showed that the Fe-edges host the catalytically most active sites for the CO oxidation reaction. This is an important result since previous evidence for the catalytic activity of the FeO–Pt(111) interface is essentially based on averaging techniques in conjunction with DFT calculations. As a result, the presented STM results are in accord with DFT+U calculations, in which we compare possible CO oxidation pathways on oxidized Fe-edges and O-edges. We found that the CO oxidation reaction is more favorable on the oxidized Fe-edges, both thermodynamically and kinetically.« less

Extensive site-directed mutagenesis reveals interconnected functional units in the alkaline phosphatase active site

PubMed Central

Sunden, Fanny; Peck, Ariana; Salzman, Julia; Ressl, Susanne; Herschlag, Daniel

2015-01-01

Enzymes enable life by accelerating reaction rates to biological timescales. Conventional studies have focused on identifying the residues that have a direct involvement in an enzymatic reaction, but these so-called ‘catalytic residues’ are embedded in extensive interaction networks. Although fundamental to our understanding of enzyme function, evolution, and engineering, the properties of these networks have yet to be quantitatively and systematically explored. We dissected an interaction network of five residues in the active site of Escherichia coli alkaline phosphatase. Analysis of the complex catalytic interdependence of specific residues identified three energetically independent but structurally interconnected functional units with distinct modes of cooperativity. From an evolutionary perspective, this network is orders of magnitude more probable to arise than a fully cooperative network. From a functional perspective, new catalytic insights emerge. Further, such comprehensive energetic characterization will be necessary to benchmark the algorithms required to rationally engineer highly efficient enzymes. DOI: http://dx.doi.org/10.7554/eLife.06181.001 PMID:25902402

Active site-directed double mutants of dihydrofolate reductase.

PubMed

Ercikan-Abali, E A; Mineishi, S; Tong, Y; Nakahara, S; Waltham, M C; Banerjee, D; Chen, W; Sadelain, M; Bertino, J R

1996-09-15

Variants of dihydrofolate reductase (DHFR), which confer resistance to antifolates, are used as dominant selectable markers in vitro and in vivo and may be useful in the context of gene therapy. To identify improved mutant human DHFRs with increased catalytic efficiency and decreased binding to methotrexate, we constructed by site-directed mutagenesis four variants with substitutions at both Leu22 and Phe31 (i.e., Phe22-Ser31, Tyr22-Ser31, Phe22-Gly31, and Tyr22-Gly31). Antifolate resistance has been observed previously when individual changes are made at these active-site residues. Substrate and antifolate binding properties of these "double" mutants revealed that each have greatly diminished affinity for antifolates (> 10,000-fold) yet only slightly reduced substrate affinity. Comparison of in vitro measured properties with those of single-residue variants indicates that double mutants are indeed significantly superior. This was verified for one of the double mutants that provided high-level methotrexate resistance following retrovirus-mediated gene transfer in NIH3T3 cells.

Extensive site-directed mutagenesis reveals interconnected functional units in the alkaline phosphatase active site

DOE PAGES

Sunden, Fanny; Peck, Ariana; Salzman, Julia; ...

2015-04-22

Enzymes enable life by accelerating reaction rates to biological timescales. Conventional studies have focused on identifying the residues that have a direct involvement in an enzymatic reaction, but these so-called ‘catalytic residues’ are embedded in extensive interaction networks. Although fundamental to our understanding of enzyme function, evolution, and engineering, the properties of these networks have yet to be quantitatively and systematically explored. We dissected an interaction network of five residues in the active site of Escherichia coli alkaline phosphatase. Analysis of the complex catalytic interdependence of specific residues identified three energetically independent but structurally interconnected functional units with distinct modesmore » of cooperativity. From an evolutionary perspective, this network is orders of magnitude more probable to arise than a fully cooperative network. From a functional perspective, new catalytic insights emerge. Further, such comprehensive energetic characterization will be necessary to benchmark the algorithms required to rationally engineer highly efficient enzymes.« less

Crystal Structures of Yellowtail Ascites Virus VP4 Protease

PubMed Central

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-01-01

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala716) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser633 as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637

Probing electrostatic interactions and ligand binding in aspartyl-tRNA synthetase through site-directed mutagenesis and computer simulations.

PubMed

Thompson, Damien; Lazennec, Christine; Plateau, Pierre; Simonson, Thomas

2008-05-15

Faithful genetic code translation requires that each aminoacyl-tRNA synthetase recognise its cognate amino acid ligand specifically. Aspartyl-tRNA synthetase (AspRS) distinguishes between its negatively-charged Asp substrate and two competitors, neutral Asn and di-negative succinate, using a complex network of electrostatic interactions. Here, we used molecular dynamics simulations and site-directed mutagenesis experiments to probe these interactions further. We attempt to decrease the Asp/Asn binding free energy difference via single, double and triple mutations that reduce the net positive charge in the active site of Escherichia coli AspRS. Earlier, Glutamine 199 was changed to a negatively-charged glutamate, giving a computed reduction in Asp affinity in good agreement with experiment. Here, Lysine 198 was changed to a neutral leucine; then, Lys198 and Gln199 were mutated simultaneously. Both mutants are predicted to have reduced Asp binding and improved Asn binding, but the changes are insufficient to overcome the initial, high specificity of the native enzyme, which retains a preference for Asp. Probing the aminoacyl-adenylation reaction through pyrophosphate exchange experiments, we found no detectable activity for the mutant enzymes, indicating weaker Asp binding and/or poorer transition state stabilization. The simulations show that the mutations' effect is partly offset by proton uptake by a nearby histidine. Therefore, we performed additional simulations where the nearby Histidines 448 and 449 were mutated to neutral or negative residues: (Lys198Leu, His448Gln, His449Gln), and (Lys198Leu, His448Glu, His449Gln). This led to unexpected conformational changes and loss of active site preorganization, suggesting that the AspRS active site has a limited structural tolerance for electrostatic modifications. The data give insights into the complex electrostatic network in the AspRS active site and illustrate the difficulty in engineering charged-to-neutral changes of the preferred ligand. 2007 Wiley-Liss, Inc.

Litter type affects the activity of aerobic decomposers in a boreal peatland more than site nutrient and water level regimes

NASA Astrophysics Data System (ADS)

Straková, P.; Niemi, R. M.; Freeman, C.; Peltoniemi, K.; Toberman, H.; Heiskanen, I.; Fritze, H.; Laiho, R.

2011-02-01

Peatlands are carbon (C) storage ecosystems sustained by a high water level (WL). High WL creates anoxic conditions that suppress the activity of aerobic decomposers and provide conditions for peat accumulation. Peatland function can be dramatically affected by WL drawdown caused by land-use and/or climate change. Aerobic decomposers are directly affected by WL drawdown through environmental factors such as increased oxygenation and nutrient availability. Additionally, they are indirectly affected via changes in plant community composition and litter quality. We studied the relative importance of direct and indirect effects of WL drawdown on aerobic decomposer activity in plant litter. We did this by profiling 11 extracellular enzymes involved in the mineralization of organic C, nitrogen, phosphorus and sulphur. Our study sites represented a three-stage chronosequence from pristine (undrained) to short-term (years) and long-term (decades) WL drawdown conditions under two nutrient regimes. The litter types included reflected the prevalent vegetation, i.e., Sphagnum mosses, graminoids, shrubs and trees. WL drawdown had a direct and positive effect on microbial activity. Enzyme allocation shifted towards C acquisition, which caused an increase in the rate of decomposition. However, litter type overruled the direct effects of WL drawdown and was the main factor shaping microbial activity patterns. Our results imply that changes in plant community composition in response to persistent WL drawdown will strongly affect the C dynamics of peatlands.

Dual Active Site in the Endolytic Transglycosylase gp144 of Bacteriophage phiKZ.

PubMed

Chertkov, O V; Armeev, G A; Uporov, I V; Legotsky, S A; Sykilinda, N N; Shaytan, A K; Klyachko, N L; Miroshnikov, K A

2017-01-01

Lytic transglycosylases are abundant peptidoglycan lysing enzymes that degrade the heteropolymers of bacterial cell walls in metabolic processes or in the course of a bacteriophage infection. The conventional catalytic mechanism of transglycosylases involves only the Glu or Asp residue. Endolysin gp144 of Pseudomonas aeruginosa bacteriophage phiKZ belongs to the family of Gram-negative transglycosylases with a modular composition and C -terminal location of the catalytic domain. Glu115 of gp144 performs the predicted role of a catalytic residue. However, replacement of this residue does not completely eliminate the activity of the mutant protein. Site-directed mutagenesis has revealed the participation of Tyr197 in the catalytic mechanism, as well as the presence of a second active site involving Glu178 and Tyr147. The existence of the dual active site was supported by computer modeling and monitoring of the molecular dynamics of the changes in the conformation and surface charge distribution as a consequence of point mutations.

Active sites for CO 2 hydrogenation to methanol on Cu/ZnO catalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kattel, Shyam; Ramírez, Pedro J.; Chen, Jingguang G.

The active sites over commercial copper/zinc oxide/aluminum oxide (Cu/ZnO/Al 2O 3) catalysts for carbon dioxide (CO 2) hydrogenation to methanol, the Zn-Cu bimetallic sites or ZnO-Cu interfacial sites, have recently been the subject of intense debate. Here, we report a direct comparison between the activity of ZnCu and ZnO/Cu model catalysts for methanol synthesis. By combining x-ray photoemission spectroscopy, density functional theory, and kinetic Monte Carlo simulations, we can identify and characterize the reactivity of each catalyst. Both experimental and theoretical results agree that ZnCu undergoes surface oxidation under the reaction conditions so that surface Zn transforms into ZnO andmore » allows ZnCu to reach the activity of ZnO/Cu with the same Zn coverage. These results highlight a synergy of Cu and ZnO at the interface that facilitates methanol synthesis via formate intermediates.« less

Active sites for CO 2 hydrogenation to methanol on Cu/ZnO catalysts

DOE PAGES

Kattel, Shyam; Ramírez, Pedro J.; Chen, Jingguang G.; ...

2017-03-23

The active sites over commercial copper/zinc oxide/aluminum oxide (Cu/ZnO/Al 2O 3) catalysts for carbon dioxide (CO 2) hydrogenation to methanol, the Zn-Cu bimetallic sites or ZnO-Cu interfacial sites, have recently been the subject of intense debate. Here, we report a direct comparison between the activity of ZnCu and ZnO/Cu model catalysts for methanol synthesis. By combining x-ray photoemission spectroscopy, density functional theory, and kinetic Monte Carlo simulations, we can identify and characterize the reactivity of each catalyst. Both experimental and theoretical results agree that ZnCu undergoes surface oxidation under the reaction conditions so that surface Zn transforms into ZnO andmore » allows ZnCu to reach the activity of ZnO/Cu with the same Zn coverage. These results highlight a synergy of Cu and ZnO at the interface that facilitates methanol synthesis via formate intermediates.« less

The BMP pathway acts to directly regulate Tbx20 in the developing heart

PubMed Central

Mandel, Elizabeth M.; Kaltenbrun, Erin; Callis, Thomas E.; Zeng, Xin-Xin I.; Marques, Sara R.; Yelon, Deborah; Wang, Da-Zhi; Conlon, Frank L.

2010-01-01

TBX20 has been shown to be essential for vertebrate heart development. Mutations within the TBX20 coding region are associated with human congenital heart disease, and the loss of Tbx20 in a wide variety of model systems leads to cardiac defects and eventually heart failure. Despite the crucial role of TBX20 in a range of cardiac cellular processes, the signal transduction pathways that act upstream of Tbx20 remain unknown. Here, we have identified and characterized a conserved 334 bp Tbx20 cardiac regulatory element that is directly activated by the BMP/SMAD1 signaling pathway. We demonstrate that this element is both necessary and sufficient to drive cardiac-specific expression of Tbx20 in Xenopus, and that blocking SMAD1 signaling in vivo specifically abolishes transcription of Tbx20, but not that of other cardiac factors, such as Tbx5 and MHC, in the developing heart. We further demonstrate that activation of Tbx20 by SMAD1 is mediated by a set of novel, non-canonical, high-affinity SMAD-binding sites located within this regulatory element and that phospho-SMAD1 directly binds a non-canonical SMAD1 site in vivo. Finally, we show that these non-canonical sites are necessary and sufficient for Tbx20 expression in Xenopus, and that reporter constructs containing these sites are expressed in a cardiac-specific manner in zebrafish and mouse. Collectively, our findings define Tbx20 as a direct transcriptional target of the BMP/SMAD1 signaling pathway during cardiac maturation. PMID:20460370

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

DNA Supercoiling and the Lrp Protein Determine the Directionality of fim Switch DNA Inversion in Escherichia coli K-12

PubMed Central

Kelly, Arlene; Conway, Colin; Ó Cróinín, Tadhg; Smith, Stephen G. J.; Dorman, Charles J.

2006-01-01

Site-specific recombinases of the integrase family usually require cofactors to impart directionality in the recombination reactions that they catalyze. The FimB integrase inverts the Escherichia coli fim switch (fimS) in the on-to-off and off-to-on directions with approximately equal efficiency. Inhibiting DNA gyrase with novobiocin caused inversion to become biased in the off-to-on direction. This directionality was not due to differential DNA topological distortion of fimS in the on and off phases by the activity of its resident PfimA promoter. Instead, the leucine-responsive regulatory (Lrp) protein was found to determine switching outcomes. Knocking out the lrp gene or abolishing Lrp binding sites 1 and 2 within fimS completely reversed the response of the switch to DNA relaxation. Inactivation of either Lrp site alone resulted in mild on-to-off bias, showing that they act together to influence the response of the switch to changes in DNA supercoiling. Thus, Lrp is not merely an architectural element organizing the fim invertasome, it collaborates with DNA supercoiling to determine the directionality of the DNA inversion event. PMID:16855224

Active site electrostatics protect genome integrity by blocking abortive hydrolysis during DNA recombination

PubMed Central

Ma, Chien-Hui; Rowley, Paul A; Macieszak, Anna; Guga, Piotr; Jayaram, Makkuni

2009-01-01

Water, acting as a rogue nucleophile, can disrupt transesterification steps of important phosphoryl transfer reactions in DNA and RNA. We have unveiled this risk, and identified safeguards instituted against it, during strand cleavage and joining by the tyrosine site-specific recombinase Flp. Strand joining is threatened by a latent Flp endonuclease activity (type I) towards the 3′-phosphotyrosyl intermediate resulting from strand cleavage. This risk is not alleviated by phosphate electrostatics; neutralizing the negative charge on the scissile phosphate through methylphosphonate (MeP) substitution does not stimulate type I endonuclease. Rather, protection derives from the architecture of the recombination synapse and conformational dynamics within it. Strand cleavage is protected against water by active site electrostatics. Replacement of the catalytic Arg-308 of Flp by alanine, along with MeP substitution, elicits a second Flp endonuclease activity (type II) that directly targets the scissile phosphodiester bond in DNA. MeP substitution, combined with appropriate active site mutations, will be useful in revealing anti-hydrolytic mechanisms engendered by systems that mediate DNA relaxation, DNA transposition, site-specific recombination, telomere resolution, RNA splicing and retrohoming of mobile introns. PMID:19440204

Direct and indirect trophic effects of predator depletion on basal trophic levels.

PubMed

Chen, Huili; Hagerty, Steven; Crotty, Sinead M; Bertness, Mark D

2016-02-01

Human population growth and development have heavily degraded coastal ecosystems with cascading impacts across multiple trophic levels. Understanding both the direct and indirect trophic effects of human activities is important for coastal conservation. In New England, recreational overfishing has triggered a regional trophic cascade. Predator depletion releases the herbivorous purple marsh crab from consumer control and leads to overgrazing of marsh cordgrass and salt marsh die-off. The direct and indirect trophic effects of predator depletion on basal trophic levels, however, are not understood. Using observational and experimental data, we examined the hypotheses that (1) direct trophic effects of predator depletion decrease meiofaunal abundance by releasing deposit feeding fiddler crabs from consumer control, and/or (2) indirect trophic effects of predator depletion increase meiofaunal abundance by releasing blue carbon via the erosion of centuries of accreted marsh peat. Experimental deposit feeder removal led to 23% higher meiofaunal density at die-off than at healthy sites, while reciprocally transplanting sediment from die-off and healthy sites revealed that carbon-rich die-off sediment increased meiofauna density by over 164%: six times stronger than direct trophic effects. Recovering sites had both carbon-rich sediment and reduced deposit feeding leading to higher meiofauna densities than both die-off and healthy sites. This suggests that consequences of the trophic downgrading of coastal habitats can be driven by both direct and indirect trophic mechanisms that may vary in direction and magnitude, making their elucidation dependent on experimental manipulations.

New insights into the interaction between pyrrolyl diketoacids and HIV-1 integrase active site and comparison with RNase H.

PubMed

Corona, Angela; di Leva, Francesco Saverio; Rigogliuso, Giuseppe; Pescatori, Luca; Madia, Valentina Noemi; Subra, Frederic; Delelis, Olivier; Esposito, Francesca; Cadeddu, Marta; Costi, Roberta; Cosconati, Sandro; Novellino, Ettore; di Santo, Roberto; Tramontano, Enzo

2016-10-01

HIV-1 integrase (IN) inhibitors are one of the most recent innovations in the treatment of HIV infection. The selection of drug resistance viral strains is however a still open issue requiring constant efforts to identify new anti-HIV-1 drugs. Pyrrolyl diketo acid (DKA) derivatives inhibit HIV-1 replication by interacting with the Mg 2+ cofactors within the HIV-1 IN active site or within the HIV-1 reverse-transcriptase associated ribonuclease H (RNase H) active site. While the interaction mode of pyrrolyl DKAs with the RNase H active site has been recently reported and substantiated by mutagenesis experiments, their interaction within the IN active site still lacks a detailed understanding. In this study, we investigated the binding mode of four pyrrolyl DKAs to the HIV-1 IN active site by molecular modeling coupled with site-directed mutagenesis studies showing that the DKA pyrrolyl scaffold primarily interacts with the IN amino residues P145, Q146 and Q148. Importantly, the tested DKAs demonstrated good effectiveness against HIV-1 Raltegravir resistant Y143A and N155H INs, thus showing an interaction pattern with relevant differences if compared with the first generation IN inhibitors. These data provide precious insights for the design of new HIV inhibitors active on clinically selected Raltegravir resistant variants. Furthermore, this study provides new structural information to modulate IN and RNase H inhibitory activities for development of dual-acting anti-HIV agents. Copyright © 2016 Elsevier B.V. All rights reserved.

Naringin directly activates inwardly rectifying potassium channels at an overlapping binding site to tertiapin-Q

PubMed Central

Yow, Tin T; Pera, Elena; Absalom, Nathan; Heblinski, Marika; Johnston, Graham AR; Hanrahan, Jane R; Chebib, Mary

2011-01-01

BACKGROUND G protein-coupled inwardly rectifying potassium (KIR3) channels are important proteins that regulate numerous physiological processes including excitatory responses in the CNS and the control of heart rate. Flavonoids have been shown to have significant health benefits and are a diverse source of compounds for identifying agents with novel mechanisms of action. EXPERIMENTAL APPROACH The flavonoid glycoside, naringin, was evaluated on recombinant human KIR3.1–3.4 and KIR3.1–3.2 expressed in Xenopus oocytes using two-electrode voltage clamp methods. In addition, we evaluated the activity of naringin alone and in the presence of the KIR3 channel blocker tertiapin-Q (0.5 nM, 1 nM and 3 nM) at recombinant KIR3.1–3.4 channels. Site-directed mutagenesis was used to identify amino acids within the M1–M2 loop of the KIR3.1F137S mutant channel important for naringin's activity. KEY RESULTS Naringin (100 µM) had minimal effect on uninjected oocytes but activated KIR3.1–3.4 and KIR3.1–3.2 channels. The activation by naringin of KIR3.1–3.4 channels was inhibited by tertiapin-Q in a competitive manner. An alanine-scan performed on the KIR3.1F137S mutant channel, replacing one by one aromatic amino acids within the M1–M2 loop, identified tyrosines 148 and 150 to be significantly contributing to the affinity of naringin as these mutations reduced the activity of naringin by 20- and 40-fold respectively. CONCLUSIONS AND IMPLICATIONS These results show that naringin is a direct activator of KIR3 channels and that tertiapin-Q shares an overlapping binding site on the KIR3.1–3.4. This is the first example of a ligand that activates KIR3 channels by binding to the extracellular M1–M2 linker of the channel. PMID:21391982

Semisynthetic Enzymes by Protein-Peptide Site-Directed Covalent Conjugation: Methods and Applications.

PubMed

Palomo, Jose M

2017-01-01

This chapter describes the rational design and synthesis of semisynthetic lipases by site-directed incorporation of tailor-made peptides on the lipase-lid site to improve its activity, specificity, and enantioselectivity in specific biotransformations. Cysteine was genetically introduced at a particular point of the oligopeptide lid of the enzyme, and cysteine-containing peptides, complementary to the amino acid sequence on the lid site of Geobacillus thermocatenulatus lipase (BTL), were covalently attached on the lid of two different cysteine-BTL variants based on a fast thiol-disulfide exchange ligation followed by desulfurization. The BTL variants were initially immobilized on solid support to introduce the advantages of solid-state chemistry, such as quantitative transformations, easy purification, and recyclability. In the two different immobilized variants BTL-A193C and BTL-L230C, the cysteine was then activated with 2-dipyridyldisulfide to help the disulfide exchange with the peptide, generating the semisynthetic enzyme in high yield. Excellent results of improvement of activity and selectivity were obtained. For example, the peptide-BTL conjugate (at position 193) was 40-fold more active than the corresponding unmodified enzyme for the hydrolysis of per-acetylated thymidine at pH 5, or fourfold in the desymmetrization of dimethyl-3-phenylglutarate at pH 7. The new enzyme also exhibited excellent enantioselectivity in the desymmetrization reaction with enantiomeric excess (ee) of >99% when compared to that of the unmodified enzyme (ee=78%). © 2017 Elsevier Inc. All rights reserved.

Probing the effect of the non-active-site mutation Y229W in New Delhi metallo-β-lactamase-1 by site-directed mutagenesis, kinetic studies, and molecular dynamics simulations.

PubMed

Chen, Jiao; Chen, Hui; Shi, Yun; Hu, Feng; Lao, Xingzhen; Gao, Xiangdong; Zheng, Heng; Yao, Wenbing

2013-01-01

New Delhi metallo-β-lactamase-1 (NDM-1) has attracted extensive attention for its high catalytic activities of hydrolyzing almost all β-lactam antibiotics. NDM-1 shows relatively higher similarity to subclass B1 metallo-β-lactamases (MβLs), but its residue at position 229 is identical to that of B2/B3 MβLs, which is a Tyr instead of a B1-MβL-conserved Trp. To elucidate the possible role of Y229 in the bioactivity of NDM-1, we performed mutagenesis study and molecular dynamics (MD) simulations. Although residue Y229 is spatially distant from the active site and not contacting directly with the substrate or zinc ions, the Y229W mutant was found to have higher kcat and Km values than those of wild-type NDM-1, resulting in 1 ∼ 7 fold increases in k(cat) /K(m) values against tested antibiotics. In addition, our MD simulations illustrated the enhanced flexibility of Loop 2 upon Y229W mutation, which could increase the kinetics of both substrate entrance (kon) and product egress (koff). The enhanced flexibility of Loop 2 might allow the enzyme to adjust the geometry of its active site to accommodate substrates with different structures, broadening its substrate spectrum. This study indicated the possible role of the residue at position 229 in the evolution of NDM-1.

Remote site-selective C-H activation directed by a catalytic bifunctional template.

PubMed

Zhang, Zhipeng; Tanaka, Keita; Yu, Jin-Quan

2017-03-23

In chemical syntheses, the activation of carbon-hydrogen (C-H) bonds converts them directly into carbon-carbon or carbon-heteroatom bonds without requiring any prior functionalization. C-H activation can thus substantially reduce the number of steps involved in a synthesis. A single specific C-H bond in a substrate can be activated by using a 'directing' (usually a functional) group to obtain the desired product selectively. The applicability of such a C-H activation reaction can be severely curtailed by the distance of the C-H bond in question from the directing group, and by the shape of the substrate, but several approaches have been developed to overcome these limitations. In one such approach, an understanding of the distal and geometric relationships between the functional groups and C-H bonds of a substrate has been exploited to achieve meta-selective C-H activation by using a covalently attached, U-shaped template. However, stoichiometric installation of this template has not been feasible in the absence of an appropriate functional group on which to attach it. Here we report the design of a catalytic, bifunctional nitrile template that binds a heterocyclic substrate via a reversible coordination instead of a covalent linkage. The two metal centres coordinated to this template have different roles: one reversibly anchors substrates near the catalyst, and the other cleaves remote C-H bonds. Using this strategy, we demonstrate remote, site-selective C-H olefination of heterocyclic substrates that do not have the necessary functional groups for covalently attaching templates.

CASEIN KINASE-MEDIATED PHOSPHORYLATION OF SERINE 839 IS NECESSARY FOR BASOLATERAL LOCALIZATION OF THE Ca2+-ACTIVATED NON-SELECTIVE CATION CHANNEL TRPM4

PubMed Central

Cerda, Oscar; Cáceres, Mónica; Park, Kang-Sik; Leiva-Salcedo, Elías; Romero, Aníbal; Varela, Diego

2014-01-01

TRPM4 is a Ca2+-activated non-selective cation channel expressed in a wide range of human tissues. TRPM4 participates in a variety of physiological processes such as T cell activation, myogenic vasoconstriction and allergic reactions. TRPM4 Ca2+ sensitivity is enhanced by calmodulin (CaM) and phosphathydilinositol 4, 5-biphosphate (PI(4,5)P2) binding, as well as, under certain conditions, PKC activation. However, information as to the mechanisms of modulation of this channel remain unknown, including direct identification of phosphorylation sites on TRPM4 and their role in channel features. Here, we use mass-spectrometric-based proteomic approaches (immunoprecipitation and tandem mass spectrometry), to unambiguously identify S839 as a phosphorylation site present on human TRPM4 expressed in a human cell line. Site-directed mutagenesis employing a serine to alanine mutation to eliminate phosphorylation, and a phospho-mimetic aspartate mutation, as well as biochemical and immunocytochemical experiments, revealed a role for S839 phosphorylation in the basolateral expression of TRPM4 channels in epithelial cells. Moreover, we demonstrated that casein kinase 1 (CK1) phosphorylates S839 and is responsible for the basolateral localization of TRPM4. PMID:25231975

Casein kinase-mediated phosphorylation of serine 839 is necessary for basolateral localization of the Ca²⁺-activated non-selective cation channel TRPM4.

PubMed

Cerda, Oscar; Cáceres, Mónica; Park, Kang-Sik; Leiva-Salcedo, Elías; Romero, Aníbal; Varela, Diego; Trimmer, James S; Stutzin, Andrés

2015-08-01

Transient receptor potential melastatin-like 4 (TRPM4) is a Ca(2+)-activated non-selective cation channel expressed in a wide range of human tissues. TRPM4 participates in a variety of physiological processes such as T cell activation, myogenic vasoconstriction, and allergic reactions. TRPM4 Ca(2+) sensitivity is enhanced by calmodulin (CaM) and phosphathydilinositol 4, 5-bisphosphate (PI(4,5)P2) binding, as well as, under certain conditions, PKC activation. However, information as to the mechanisms of modulation of this channel remains unknown, including direct identification of phosphorylation sites on TRPM4 and their role in channel features. Here, we use mass-spectrometric-based proteomic approaches (immunoprecipitation and tandem mass spectrometry) to unambiguously identify S839 as a phosphorylation site present on human TRPM4 expressed in a human cell line. Site-directed mutagenesis employing a serine to alanine mutation to eliminate phosphorylation, and a phospho-mimetic aspartate mutation, as well as biochemical and immunocytochemical experiments, revealed a role for S839 phosphorylation in the basolateral expression of TRPM4 channels in epithelial cells. Moreover, we demonstrated that casein kinase 1 (CK1) phosphorylates S839 and is responsible for the basolateral localization of TRPM4.

Editing of misaligned 3'-termini by an intrinsic 3'-5' exonuclease activity residing in the PHP domain of a family X DNA polymerase.

PubMed

Baños, Benito; Lázaro, José M; Villar, Laurentino; Salas, Margarita; de Vega, Miguel

2008-10-01

Bacillus subtilis gene yshC encodes a family X DNA polymerase (PolX(Bs)), whose biochemical features suggest that it plays a role during DNA repair processes. Here, we show that, in addition to the polymerization activity, PolX(Bs) possesses an intrinsic 3'-5' exonuclease activity specialized in resecting unannealed 3'-termini in a gapped DNA substrate. Biochemical analysis of a PolX(Bs) deletion mutant lacking the C-terminal polymerase histidinol phosphatase (PHP) domain, present in most of the bacterial/archaeal PolXs, as well as of this separately expressed protein region, allow us to state that the 3'-5' exonuclease activity of PolX(Bs) resides in its PHP domain. Furthermore, site-directed mutagenesis of PolX(Bs) His339 and His341 residues, evolutionary conserved in the PHP superfamily members, demonstrated that the predicted metal binding site is directly involved in catalysis of the exonucleolytic reaction. The implications of the unannealed 3'-termini resection by the 3'-5' exonuclease activity of PolX(Bs) in the DNA repair context are discussed.

Hanford Site Environmental Report for Calendar Year 2008

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poston, Ted M.; Duncan, Joanne P.; Dirkes, Roger L.

The Hanford Site environmental report is prepared annually for the U.S. Department of Energy (DOE) in accordance with regulatory requirements. The report provides an overview of activities at the Hanford Site; demonstrates the status of the site’s compliance with applicable federal, state, and local environmental laws and regulations, executive orders, and DOE policies and directives; and summarizes environmental data that characterize Hanford Site environmental management performance. The report also highlights significant environmental and public protection programs and efforts. Some historical and early 2009 information is included where appropriate.

Hanford Site Environmental Report for Calendar Year 2009

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poston, Ted M.; Duncan, Joanne P.; Dirkes, Roger L.

The Hanford Site environmental report is prepared annually for the U.S. Department of Energy (DOE) in accordance with regulatory requirements. The report provides an overview of activities at the Hanford Site; demonstrates the status of the site’s compliance with applicable federal, state, and local environmental laws and regulations, executive orders, and DOE policies and directives; and summarizes environmental data that characterize Hanford Site environmental management performance. The report also highlights significant environmental and public protection programs and efforts. Some historical and early 2010 information is included where appropriate.

Hanford Site Environmental Report for Calendar Year 2007

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poston, Ted M.; Duncan, Joanne P.; Dirkes, Roger L.

The Hanford Site environmental report is prepared annually for the U.S. Department of Energy (DOE) in accordance with regulatory requirements. The report provides an overview of activities at the site; demonstrates the status of the site’s compliance with applicable federal, state, and local environmental laws and regulations, executive orders, and DOE policies and directives; and summarizes environmental data that characterize Hanford Site environmental management performance. The report also highlights signifi cant environmental and public protection programs and efforts. Some historical and early 2008 information is included where appropriate.

Meteorology Online.

ERIC Educational Resources Information Center

Kahl, Jonathan D. W.

2001-01-01

Describes an activity to learn about meteorology and weather using the internet. Discusses the National Weather Service (NWS) internet site www.weather.gov. Students examine maximum and minimum daily temperatures, wind speed, and direction. (SAH)

Site Environmental Report for Calendar Year 2000. DOE Operations at The Boeing Company, Rocketdyne Propulsion & Power

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rutherford, Phil; Samuels, Sandy; Lee, Majelle

2001-09-01

This Annual Site Environmental Report (ASER) for 2000 describes the environmental conditions related to work performed for the Department of Energy (DOE) at Area IV of the Rocketdyne Santa Susana Field Laboratory (SSFL). In the past, these operations included development, fabrication, and disassembly of nuclear reactors, reactor fuel, and other radioactive materials, under the former Atomics International (AI) Division. Other activities included the operation of large-scale liquid metal facilities for testing of liquid metal fast breeder components at the Energy Technology Engineering Center (ETEC), a government-owned company-operated, test facility within Area IV. All nuclear work was terminated in 1988, andmore » subsequently, all radiological work has been directed toward decontamination and decommissioning (D&D) of the previously used nuclear facilities and associated site areas. Large-scale D&D activities of the sodium test facilities began in 1996. Results of the radiological monitoring program for the calendar year of 2000 continue to indicate no significant releases of radioactive material from Rocketdyne sites. All potential exposure pathways are sampled and/or monitored, including air, soil, surface water, groundwater, direct radiation, transfer of property (land, structures, waste), and recycling. All radioactive wastes are processed for disposal at DOE disposal sites and other sites approved by DOE and licensed for radioactive waste. Liquid radioactive wastes are not released into the environment and do not constitute an exposure pathway.« less

The identity of the active site of oxalate decarboxylase and the importance of the stability of active-site lid conformations1

PubMed Central

Just, Victoria J.; Burrell, Matthew R.; Bowater, Laura; McRobbie, Iain; Stevenson, Clare E. M.; Lawson, David M.; Bornemann, Stephen

2007-01-01

Oxalate decarboxylase (EC 4.1.1.2) catalyses the conversion of oxalate into carbon dioxide and formate. It requires manganese and, uniquely, dioxygen for catalysis. It forms a homohexamer and each subunit contains two similar, but distinct, manganese sites termed sites 1 and 2. There is kinetic evidence that only site 1 is catalytically active and that site 2 is purely structural. However, the kinetics of enzymes with mutations in site 2 are often ambiguous and all mutant kinetics have been interpreted without structural information. Nine new site-directed mutants have been generated and four mutant crystal structures have now been solved. Most mutants targeted (i) the flexibility (T165P), (ii) favoured conformation (S161A, S164A, D297A or H299A) or (iii) presence (Δ162–163 or Δ162–164) of a lid associated with site 1. The kinetics of these mutants were consistent with only site 1 being catalytically active. This was particularly striking with D297A and H299A because they disrupted hydrogen bonds between the lid and a neighbouring subunit only when in the open conformation and were distant from site 2. These observations also provided the first evidence that the flexibility and stability of lid conformations are important in catalysis. The deletion of the lid to mimic the plant oxalate oxidase led to a loss of decarboxylase activity, but only a slight elevation in the oxalate oxidase side reaction, implying other changes are required to afford a reaction specificity switch. The four mutant crystal structures (R92A, E162A, Δ162–163 and S161A) strongly support the hypothesis that site 2 is purely structural. PMID:17680775

Structure and Activity of the Flagellar Rotor Protein FliY

PubMed Central

Sircar, Ria; Greenswag, Anna R.; Bilwes, Alexandrine M.; Gonzalez-Bonet, Gabriela; Crane, Brian R.

2013-01-01

Rotating flagella propel bacteria toward favorable environments. Sense of rotation is determined by the intracellular response regulator CheY, which when phosphorylated (CheY-P) interacts directly with the flagellar motor. In many different types of bacteria, the CheC/CheX/FliY (CXY) family of phosphatases terminates the CheY-P signal. Unlike CheC and CheX, FliY is localized in the flagellar switch complex, which also contains the stator-coupling protein FliG and the target of CheY-P, FliM. The 2.5 Å resolution crystal structure of the FliY catalytic domain from Thermotoga maritima bears strong resemblance to the middle domain of FliM. Regions of FliM that mediate contacts within the rotor compose the phosphatase active sites in FliY. Despite the similarity between FliY and FliM, FliY does not bind FliG and thus is unlikely to be a substitute for FliM in the center of the switch complex. Solution studies indicate that FliY dimerizes through its C-terminal domains, which resemble the Escherichia coli switch complex component FliN. FliY differs topologically from the E. coli chemotaxis phosphatase CheZ but appears to utilize similar structural motifs for CheY dephosphorylation in close analogy to CheX. Recognition properties and phosphatase activities of site-directed mutants identify two pseudosymmetric active sites in FliY (Glu35/Asn38 and Glu132/Asn135), with the second site (Glu132/Asn135) being more active. A putative N-terminal CheY binding domain conserved with FliM is not required for binding CheY-P or phosphatase activity. PMID:23532838

Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Feng; Stanevich, Vitali; Wlodarchak, Nathan

Proper activation of protein phosphatase 2A (PP2A) catalytic subunit is central for the complex PP2A regulation and is crucial for broad aspects of cellular function. The crystal structure of PP2A bound to PP2A phosphatase activator (PTPA) and ATPγS reveals that PTPA makes broad contacts with the structural elements surrounding the PP2A active site and the adenine moiety of ATP. PTPA-binding stabilizes the protein fold of apo-PP2A required for activation, and orients ATP phosphoryl groups to bind directly to the PP2A active site. This allows ATP to modulate the metal-binding preferences of the PP2A active site and utilize the PP2A activemore » site for ATP hydrolysis. In vitro, ATP selectively and drastically enhances binding of endogenous catalytic metal ions, which requires ATP hydrolysis and is crucial for acquisition of pSer/Thr-specific phosphatase activity. Furthermore, both PP2A- and ATP-binding are required for PTPA function in cell proliferation and survival. Our results suggest novel mechanisms of PTPA in PP2A activation with structural economy and a unique ATP-binding pocket that could potentially serve as a specific therapeutic target.« less

Integration of Inhibition Kinetics and Molecular Dynamics Simulations: A Urea-Mediated Folding Study on Acetaldehyde Dehydrogenase 1.

PubMed

Xu, Yingying; Lee, Jinhyuk; Lü, Zhi-Rong; Mu, Hang; Zhang, Qian; Park, Yong-Doo

2016-07-01

Understanding the mechanism of acetaldehyde dehydrogenase 1 (ALDH1) folding is important because this enzyme is directly involved in several types of cancers and other diseases. We investigated the urea-mediated unfolding of ALDH1 by integrating kinetic inhibition studies with computational molecular dynamics (MD) simulations. Conformational changes in the enzyme structure were also analyzed using intrinsic and 1-anilinonaphthalene-8-sulfonate (ANS)-binding fluorescence measurements. Kinetic studies revealed that the direct binding of urea to ALDH1 induces inactivation of ALDH1 in a manner of mixed-type inhibition. Tertiary structural changes associated with regional hydrophobic exposure of the active site were observed. The urea binding regions on ALDH1 were predicted by docking simulations and were partly shared with active site residues of ALDH1 and with interface residues of the oligomerization domain for tetramer formation. The docking results suggest that urea prevents formation of the ALDH1 normal shape for the tetramer state as well as entrance of the substrate into the active site. Our study provides insight into the structural changes that accompany urea-mediated unfolding of ALDH1 and the catalytic role associated with conformational changes.

Preparation of epigallocatechin gallate-loaded nanoparticles and characterization of their inhibitory effects on Helicobacter pylori growth in vitro and in vivo

NASA Astrophysics Data System (ADS)

Lin, Yu-Hsin; Feng, Chun-Lung; Lai, Chih-Ho; Lin, Jui-Hsiang; Chen, Hao-Yun

2014-08-01

A variety of approaches have been proposed for overcoming the unpleasant side effects associated with antibiotics treatment of Helicobacter pylori (H. pylori) infections. Research has shown that epigallocatechin-3-gallate (EGCG), a major ingredient in green tea, has antibacterial activity for antiurease activity against H. pylori. Oral EGCG is not good because of its digestive instability and the fact that it often cannot reach the targeted site of antibacterial activity. To localize EGCG to H. pylori infection site, this study developed a fucose-chitosan/gelatin nanoparticle to encapsulate EGCG at the target and make direct contact with the region of microorganisms on the gastric epithelium. Analysis of a simulated gastrointestinal medium indicated that the proposed in vitro nanocarrier system effectively controls the release of EGCG, which interacts directly with the intercellular space at the site of H. pylori infection. Meanwhile, results of in vivo clearance assays indicated that our prepared fucose-chitosan/gelatin/EGCG nanoparticles had a significantly greater H. pylori clearance effect and more effectively reduced H. pylori-associated gastric inflammation in the gastric-infected mouse model than the EGCG solution alone.

Molecular Dynamics Analysis Reveals Structural Insights into Mechanism of Nicotine N-Demethylation Catalyzed by Tobacco Cytochrome P450 Mono-Oxygenase

PubMed Central

Wang, Shan; Yang, Shuo; An, Baiyi; Wang, Shichen; Yin, Yuejia; Lu, Yang; Xu, Ying; Hao, Dongyun

2011-01-01

CYP82E4, a cytochrome P450 monooxygenase, has nicotine N-demethylase (NND) activity, which mediates the bioconversion of nicotine into nornicotine in senescing tobacco leaves. Nornicotine is a precursor of the carcinogen, tobacco-specific nitrosamine. CYP82E3 is an ortholog of CYP82E4 with 95% sequence identity, but it lacks NND activity. A recent site-directed mutagenesis study revealed that a single amino acid substitution, i.e., cysteine to tryptophan at the 330 position in the middle of protein, restores the NND activity of CYP82E3 entirely. However, the same amino acid change caused the loss of the NND activity of CYP82E4. To determine the mechanism of the functional turnover of the two molecules, four 3D structures, i.e., the two molecules and their corresponding cys–trp mutants were modeled. The resulting structures exhibited that the mutation site is far from the active site, which suggests that no direct interaction occurs between the two sites. Simulation studies in different biological scenarios revealed that the mutation introduces a conformation drift with the largest change at the F-G loop. The dynamics trajectories analysis using principal component analysis and covariance analysis suggests that the single amino acid change causes the opening and closing of the transfer channels of the substrates, products, and water by altering the motion of the F-G and B-C loops. The motion of helix I is also correlated with the motion of both the F-G loop and the B-C loop and; the single amino acid mutation resulted in the curvature of helix I. These results suggest that the single amino acid mutation outside the active site region may have indirectly mediated the flexibility of the F-G and B-C loops through helix I, causing a functional turnover of the P450 monooxygenase. PMID:21858078

78 FR 16864 - Agency Information Collection Activities: Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-19

... eruptions Description of Respondents: Individuals affected by a volcanic ash fall events each year (if an...: 1028-NEW Abstract: The USGS provides warnings and notification to the public of volcanic activity in.... Users browsing the AVO Web site during eruptions will be directed towards a web form allowing them to...

Elimination of a ligand gating site generates a supersensitive olfactory receptor.

PubMed

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

2016-06-21

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

Elimination of a ligand gating site generates a supersensitive olfactory receptor

PubMed Central

Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

2016-01-01

Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

Predicting Catalytic Activity of Nanoparticles by a DFT-Aided Machine-Learning Algorithm.

PubMed

Jinnouchi, Ryosuke; Asahi, Ryoji

2017-09-07

Catalytic activities are often dominated by a few specific surface sites, and designing active sites is the key to realize high-performance heterogeneous catalysts. The great triumphs of modern surface science lead to reproduce catalytic reaction rates by modeling the arrangement of surface atoms with well-defined single-crystal surfaces. However, this method has limitations in the case for highly inhomogeneous atomic configurations such as on alloy nanoparticles with atomic-scale defects, where the arrangement cannot be decomposed into single crystals. Here, we propose a universal machine-learning scheme using a local similarity kernel, which allows interrogation of catalytic activities based on local atomic configurations. We then apply it to direct NO decomposition on RhAu alloy nanoparticles. The proposed method can efficiently predict energetics of catalytic reactions on nanoparticles using DFT data on single crystals, and its combination with kinetic analysis can provide detailed information on structures of active sites and size- and composition-dependent catalytic activities.

Reconstruction of 137Cs activity in the ocean following the Fukushima Daiichi Nuclear Power Plant Accident

NASA Astrophysics Data System (ADS)

Tsumune, Daisuke; Aoyama, Michio; Tsubono, Takaki; Tateda, Yutaka; Misumi, Kazuhiro; Hayami, Hiroshi; Toyoda, Yasuhiro; Maeda, Yoshiaki; Yoshida, Yoshikatsu; Uematsu, Mitsuo

2014-05-01

A series of accidents at the Fukushima Dai-ichi Nuclear Power Plant following the earthquake and tsunami of 11 March 2011 resulted in the release of radioactive materials to the ocean by two major pathways, direct release from the accident site and atmospheric deposition. We reconstructed spatiotemporal variability of 137Cs activity in the ocean by the comparison model simulations and observed data. We employed a regional scale and the North Pacific scale oceanic dispersion models, an atmospheric transport model, a sediment transport model, a dynamic biological compartment model for marine biota and river runoff model to investigate the oceanic contamination. Direct releases of 137Cs were estimated for more than 2 years after the accident by comparing simulated results and observed activities very close to the site. The estimated total amounts of directly released 137Cs was 3.6±0.7 PBq. Directly release rate of 137Cs decreased exponentially with time by the end of December 2012 and then, was almost constant. The daily release rate of 137Cs was estimated to be 3.0 x 1010 Bq day-1 by the end of September 2013. The activity of directly released 137Cs was detectable only in the coastal zone after December 2012. Simulated 137Cs activities attributable to direct release were in good agreement with observed activities, a result that implies the estimated direct release rate was reasonable, while simulated 137Cs activities attributable to atmospheric deposition were low compared to measured activities. The rate of atmospheric deposition onto the ocean was underestimated because of a lack of measurements of dose rate and air activity of 137Cs over the ocean when atmospheric deposition rates were being estimated. Observed 137Cs activities attributable to atmospheric deposition in the ocean helped to improve the accuracy of simulated atmospheric deposition rates. Although there is no observed data of 137Cs activity in the ocean from 11 to 21 March 2011, observed data of marine biota should reflect the history of 137Cs activity in this early period. The comparisons between simulated 137Cs activity of marine biota by a dynamic biological compartment and observed data also suggest that simulated 137Cs activity attributable to atmospheric deposition was underestimated in this early period. In addition, river runoff model simulations suggest that the river flux of 137Cs to the ocean was effective to the 137Cs activity in the ocean in this early period. The sediment transport model simulations suggests that the inventory of 137Cs in sediment was less than 10

Improved design of hammerhead ribozyme for selective digestion of target RNA through recognition of site-specific adenosine-to-inosine RNA editing

PubMed Central

Fukuda, Masatora; Kurihara, Kei; Yamaguchi, Shota; Oyama, Yui; Deshimaru, Masanobu

2014-01-01

Adenosine-to-inosine (A-to-I) RNA editing is an endogenous regulatory mechanism involved in various biological processes. Site-specific, editing-state–dependent degradation of target RNA may be a powerful tool both for analyzing the mechanism of RNA editing and for regulating biological processes. Previously, we designed an artificial hammerhead ribozyme (HHR) for selective, site-specific RNA cleavage dependent on the A-to-I RNA editing state. In the present work, we developed an improved strategy for constructing a trans-acting HHR that specifically cleaves target editing sites in the adenosine but not the inosine state. Specificity for unedited sites was achieved by utilizing a sequence encoding the intrinsic cleavage specificity of a natural HHR. We used in vitro selection methods in an HHR library to select for an extended HHR containing a tertiary stabilization motif that facilitates HHR folding into an active conformation. By using this method, we successfully constructed highly active HHRs with unedited-specific cleavage. Moreover, using HHR cleavage followed by direct sequencing, we demonstrated that this ribozyme could cleave serotonin 2C receptor (HTR2C) mRNA extracted from mouse brain, depending on the site-specific editing state. This unedited-specific cleavage also enabled us to analyze the effect of editing state at the E and C sites on editing at other sites by using direct sequencing for the simultaneous quantification of the editing ratio at multiple sites. Our approach has the potential to elucidate the mechanism underlying the interdependencies of different editing states in substrate RNA with multiple editing sites. PMID:24448449

New insights into the catalytic mechanism of Bombyx mori prostaglandin E synthase gained from structure–function analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp; Suzuki, Mamoru; Higashiura, Akifumi

2013-11-01

Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolutionmore » of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.« less

7-Methoxytacrine-adamantylamine heterodimers as cholinesterase inhibitors in Alzheimer's disease treatment--synthesis, biological evaluation and molecular modeling studies.

PubMed

Spilovska, Katarina; Korabecny, Jan; Kral, Jan; Horova, Anna; Musilek, Kamil; Soukup, Ondrej; Drtinova, Lucie; Gazova, Zuzana; Siposova, Katarina; Kuca, Kamil

2013-02-20

A structural series of 7-MEOTA-adamantylamine thioureas was designed, synthesized and evaluated as inhibitors of human acetylcholinesterase (hAChE) and human butyrylcholinesterase (hBChE). The compounds were prepared based on the multi-target-directed ligand strategy with different linker lengths (n = 2-8) joining the well-known NMDA antagonist adamantine and the hAChE inhibitor 7-methoxytacrine (7-MEOTA). Based on in silico studies, these inhibitors proved dual binding site character capable of simultaneous interaction with the peripheral anionic site (PAS) of hAChE and the catalytic active site (CAS). Clearly, these structural derivatives exhibited very good inhibitory activity towards hBChE resulting in more selective inhibitors of this enzyme. The most potent cholinesterase inhibitor was found to be thiourea analogue 14 (with an IC₅₀ value of 0.47 µM for hAChE and an IC₅₀ value of 0.11 µM for hBChE, respectively). Molecule 14 is a suitable novel lead compound for further evaluation proving that the strategy of dual binding site inhibitors might be a promising direction for development of novel AD drugs.

Biological role of site-specific O-glycosylation in cell adhesion activity and phosphorylation of osteopontin.

PubMed

Oyama, Midori; Kariya, Yoshinobu; Kariya, Yukiko; Matsumoto, Kana; Kanno, Mayumi; Yamaguchi, Yoshiki; Hashimoto, Yasuhiro

2018-05-09

Osteopontin (OPN) is an extracellular glycosylated phosphoprotein that promotes cell adhesion by interacting with several integrin receptors. We previously reported that an OPN mutant lacking five O-glycosylation sites (Thr 134 /Thr 138 /Thr 143 /Thr 147 /Thr 152 ) in the threonine/proline-rich region increased cell adhesion activity and phosphorylation compared with the wild type. However, the role of O-glycosylation in cell adhesion activity and phosphorylation of OPN remains to be clarified. Here, we show that site-specific O-glycosylation in the threonine/proline-rich region of OPN affects its cell adhesion activity and phosphorylation independently and/or synergistically. Using site-directed mutagenesis, we found that OPN mutants with substitution sets of Thr 134 /Thr 138 or Thr 143 /Thr 147 /Thr 152 had decreased and increased cell adhesion activity, respectively. In contrast, the introduction of a single mutation into the O-glycosylation sites had no effect on OPN cell adhesion activity. An adhesion assay using function-blocking antibodies against αvβ3 and β1 integrins, as well as αvβ3 integrin-overexpressing A549 cells, revealed that site-specific O-glycosylation affected the association of OPN with the two integrins. Phosphorylation analyses using phos-tag and LC-MS/MS indicated that phosphorylation levels and sites were influenced by the O-glycosylation status, although the number of O-glycosylation sites was not correlated with the phosphorylation level in OPN. Furthermore, a correlation analysis between phosphorylation level and cell adhesion activity in OPN mutants with the site-specific O-glycosylation showed that they were not always correlated. These results provide conclusive evidence of a novel regulatory mechanism of cell adhesion activity and phosphorylation of OPN by site-specific O-glycosylation. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Evaluating differences in the active-site electronics of supported Au nanoparticle catalysts using Hammett and DFT studies

NASA Astrophysics Data System (ADS)

Kumar, Gaurav; Tibbitts, Luke; Newell, Jaclyn; Panthi, Basu; Mukhopadhyay, Ahana; Rioux, Robert M.; Pursell, Christopher J.; Janik, Michael; Chandler, Bert D.

2018-03-01

Supported metal catalysts, which are composed of metal nanoparticles dispersed on metal oxides or other high-surface-area materials, are ubiquitous in industrially catalysed reactions. Identifying and characterizing the catalytic active sites on these materials still remains a substantial challenge, even though it is required to guide rational design of practical heterogeneous catalysts. Metal-support interactions have an enormous impact on the chemistry of the catalytic active site and can determine the optimum support for a reaction; however, few direct probes of these interactions are available. Here we show how benzyl alcohol oxidation Hammett studies can be used to characterize differences in the catalytic activity of Au nanoparticles hosted on various metal-oxide supports. We combine reactivity analysis with density functional theory calculations to demonstrate that the slope of experimental Hammett plots is affected by electron donation from the underlying oxide support to the Au particles.

Stereodivergent synthesis with a programmable molecular machine

NASA Astrophysics Data System (ADS)

Kassem, Salma; Lee, Alan T. L.; Leigh, David A.; Marcos, Vanesa; Palmer, Leoni I.; Pisano, Simone

2017-09-01

It has been convincingly argued that molecular machines that manipulate individual atoms, or highly reactive clusters of atoms, with Ångström precision are unlikely to be realized. However, biological molecular machines routinely position rather less reactive substrates in order to direct chemical reaction sequences, from sequence-specific synthesis by the ribosome to polyketide synthases, where tethered molecules are passed from active site to active site in multi-enzyme complexes. Artificial molecular machines have been developed for tasks that include sequence-specific oligomer synthesis and the switching of product chirality, a photo-responsive host molecule has been described that is able to mechanically twist a bound molecular guest, and molecular fragments have been selectively transported in either direction between sites on a molecular platform through a ratchet mechanism. Here we detail an artificial molecular machine that moves a substrate between different activating sites to achieve different product outcomes from chemical synthesis. This molecular robot can be programmed to stereoselectively produce, in a sequential one-pot operation, an excess of any one of four possible diastereoisomers from the addition of a thiol and an alkene to an α,β-unsaturated aldehyde in a tandem reaction process. The stereodivergent synthesis includes diastereoisomers that cannot be selectively synthesized through conventional iminium-enamine organocatalysis. We anticipate that future generations of programmable molecular machines may have significant roles in chemical synthesis and molecular manufacturing.

Theoretical Investigation of Methane Hydroxylation over Isoelectronic [FeO]2+- and [MnO]+-Exchanged Zeolites Activated by N2O.

PubMed

Mahyuddin, M Haris; Shiota, Yoshihito; Staykov, Aleksandar; Yoshizawa, Kazunari

2017-09-05

While the most likely structure of the active site in iron-containing zeolites has been recently identified as [FeO] 2+ (Snyder et al. Nature 2016, 536, 317-321), the mechanism for the direct conversion of methane to methanol over this active species is still debatable between the direct-radical-rebound or nonradical (concerted) mechanism. Using density functional theory on periodic systems, we calculated the two reaction mechanisms over two d 4 isoelectronic systems, [FeO] 2+ and [MnO] + zeolites. We found that [FeO] 2+ zeolites favor the direct-radical-rebound mechanism with low CH 4 activation energies, while [MnO] + zeolites prefer the nonradical mechanism with higher CH 4 activation energies. These contrasts, despite their isoelectronic structures, are mainly due to the differences in the metal coordination number and O α (oxo) spin density. Moreover, molecular orbital analyses suggest that the zeolite steric hindrance further degrades the reactivity of [MnO] + zeolites toward methane. Two types of zeolite frameworks, i.e., medium-pore ZSM-5 (MFI framework) and small-pore SSZ-39 (AEI framework) zeolites, were evaluated, but no significant differences in the reactivity were found. The rate-determining reaction step is found to be methanol desorption instead of methane activation. Careful examination of the most stable sites hosting the active species and calculation for N 2 O decomposition over [Fe] 2+ -MFI and -AEI zeolites were also performed.

[Expression of human-mouse chimeric antibody directed against Chikungunya virus with site-specific integration system].

PubMed

Li, Jian-min; Chen, Wei; Jia, Xiu-jie; An, Xiao-ping; Li, Bing; Fan, Ying-ru; Tong, Yi-gang

2005-05-01

To obtain CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site and to express human-mouse chimeric antibody directed against Chikungunya Virus by using the cell line. The fusion gene of FRT and HBsAg was constructed by PCR and cloned into the MCS of pCI-neo to construct pCI-FRT-HBsAg. The pCI-FRT-HBsAg was transfected into CHO/dhfr(-) cells and cell clones with high expression of HBsAg were screened by detecting the amount of HBsAg with ELISA. A CHO cell clone with the highest expression was chosen and named as CHO/dhfr(-) FRT(+). pAFRT HFLF, a expression plasmid of chimeric antibody with RFT sequence was transfected into CHO/dhfr(-) FRT(+) cells and cell clones with high expression of the chimeric antibody were screened by increasing concentration of MTX. A CHO cell clone with high expression of the chimeric antibody was cultured in large scale and supernatant was collected from which the chimeric antibody was purified. The purified chimeric antibody was analyzed by SDS-PAGE, Western blot and IFA. A CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site was obtained successfully. A cell clone with yield of 5 mg/L of chimeric antibody was obtained, as compared with routine CHO cell expression system with a yield of 2 mg/L. A cell line with integrated FRT sequence in the chromosome transcription active site was obtained and with it human-mouse chimeric antibody directed against Chikungunya virus was expressed. This system lays a solid foundation which can be used for expressing antibodies and other proteins.

Enhancement of oxidative stability of the subtilisin nattokinase by site-directed mutagenesis expressed in Escherichia coli.

PubMed

Weng, MeiZhi; Zheng, ZhongLiang; Bao, Wei; Cai, YongJun; Yin, Yan; Zou, GuoLin; Zou, GouLin

2009-11-01

Nattokinase (subtilisin NAT, NK) is a bacterial serine protease with strong fibrinolytic activity and it is a potent cardiovascular drug. In medical and commercial applications, however, it is susceptible to chemical oxidation, and subsequent inactivation or denaturation. Here we show that the oxidative stability of NK was substantially increased by optimizing the amino acid residues Thr(220) and Met(222), which were in the vicinity of the catalytic residue Ser(221) of the enzyme. Two nonoxidative amino acids (Ser and Ala) were introduced at these sites using site-directed mutagenesis. Active enzymes were successfully expressed in Escherichia coli with periplasmic secretion and enzymes were purified to homogeneity. The purified enzymes were analyzed with respect to oxidative stability, kinetic parameters, fibrinolytic activity and thermal stability. M222A mutant was found to have a greatly increased oxidative stability compared with wild-type enzyme and it was resistant to inactivation by more than 1 M H(2)O(2), whereas the wild-type enzyme was inactivated by 0.1 M H(2)O(2) (t(1/2) approximately 11.6 min). The other mutant (T220S) also showed an obvious increase in antioxidative ability. Molecular dynamic simulations on wild-type and T220S mutant proteins suggested that a hydrogen bond was formed between Ser(220) and Asn(155), and the spatial structure of Met(222) was changed compared with the wild-type. The present study demonstrates the feasibility of improving oxidative stability of NK by site-directed mutagenesis and shows successful protein engineering cases to improve stability of NK as a potent therapeutic agent.

Human T-lymphotropic virus type I tax regulates the expression of the human lymphotoxin gene.

PubMed

Tschachler, E; Böhnlein, E; Felzmann, S; Reitz, M S

1993-01-01

Human T-lymphotropic virus type-I (HTLV-I)-infected T-cell lines constitutively produce high levels of lymphotoxin (LT). To analyze the mechanisms that lead to the expression of LT in HTLV-I-infected cell lines, we studied regulatory regions of the human LT promoter involved in the activation of the human LT gene. As determined by deletional analysis, sequences between +137 and -116 (relative to the transcription initiation site) are sufficient to direct expression of a reporter gene in the HTLV-I-infected cell line MT-2. Site-directed mutation of a of the single kappa B-like motif present in the LT promoter region (positions -99 to -89) completely abrogated LT promoter activity in MT-2 cells, suggesting that this site plays a critical role in the activation of the human LT gene. Transfection of LT constructs into HTLV-I-uninfected and -unstimulated Jurkat and U937 cell lines showed little to no activity of the LT promoter. Cotransfection of the same constructs with a tax expression plasmid into Jurkat cells led to detectable promoter activity, which could be significantly increased by stimulation of the cells with phorbol myristate acetate (PMA). Similarly, cotransfection of the LT promoter constructs and the tax expression plasmid into U937 cells led to significant promoter activity upon stimulation with PMA. These data suggest that HTLV-I tax is involved in the upregulation of LT gene expression in HTLV-I-infected cells.

Characterization of Missouri surface waters near point sources of pollution reveals potential novel atmospheric route of exposure for bisphenol A and wastewater hormonal activity pattern.

PubMed

Kassotis, Christopher D; Alvarez, David A; Taylor, Julia A; vom Saal, Frederick S; Nagel, Susan C; Tillitt, Donald E

2015-08-15

Surface water contamination by chemical pollutants increasingly threatens water quality around the world. Among the many contaminants found in surface water, there is growing concern regarding endocrine disrupting chemicals, based on their ability to interfere with some aspect of hormone action in exposed organisms, including humans. This study assessed water quality at several sites across Missouri (near wastewater treatment plants and airborne release sites of bisphenol A) based on hormone receptor activation potencies and chemical concentrations present in the surface water. We hypothesized that bisphenol A and ethinylestradiol would be greater in water near permitted airborne release sites and wastewater treatment plant inputs, respectively, and that these two compounds would be responsible for the majority of activities in receptor-based assays conducted with water collected near these sites. Concentrations of bisphenol A and ethinylestradiol were compared to observed receptor activities using authentic standards to assess contribution to total activities, and quantitation of a comprehensive set of wastewater compounds was performed to better characterize each site. Bisphenol A concentrations were found to be elevated in surface water near permitted airborne release sites, raising questions that airborne releases of BPA may influence nearby surface water contamination and may represent a previously underestimated source to the environment and potential for human exposure. Estrogen and androgen receptor activities of surface water samples were predictive of wastewater input, although the lower sensitivity of the ethinylestradiol ELISA relative to the very high sensitivity of the bioassay approaches did not allow a direct comparison. Wastewater-influenced sites also had elevated anti-estrogenic and anti-androgenic equivalence, while sites without wastewater discharges exhibited no antagonist activities. Published by Elsevier B.V.

Characterization of Missouri surface waters near point sources of pollution reveals potential novel atmospheric route of exposure for bisphenol A and wastewater hormonal activity pattern

USGS Publications Warehouse

Kassotis, Christopher D.; Alvarez, David A.; Taylor, Julia A.; vom Saal, Frederick S.; Nagel, Susan C.; Tillitt, Donald E.

2015-01-01

Surface water contamination by chemical pollutants increasingly threatens water quality around the world. Among the many contaminants found in surface water, there is growing concern regarding endocrine disrupting chemicals, based on their ability to interfere with some aspect of hormone action in exposed organisms, including humans. This study assessed water quality at several sites across Missouri (near wastewater treatment plants and airborne release sites of bisphenol A) based on hormone receptor activation potencies and chemical concentrationspresent in the surface water. We hypothesized that bisphenol A and ethinylestradiol would be greater in water near permitted airborne release sites and wastewater treatment plant inputs, respectively, and that these two compounds would be responsible for the majority of activities in receptor-based assays conducted with water collected near these sites. Concentrations of bisphenol A and ethinylestradiol were compared to observed receptor activities using authentic standards to assess contribution to total activities, and quantitation of a comprehensive set of wastewater compounds was performed to better characterize each site. Bisphenol A concentrations were found to be elevated in surface water near permitted airborne release sites, raising questions that airborne releases of BPA may influence nearby surface water contamination and may represent a previously underestimated source to the environment and potential for human exposure. Estrogen and androgen receptor activities of surface water samples were predictive of wastewater input, although the lower sensitivity of the ethinylestradiol ELISA relative to the very high sensitivity of the bioassay approaches did not allow a direct comparison. Wastewater-influenced sites also had elevated anti-estrogenic and anti-androgenic equivalence, while sites without wastewater discharges exhibited no antagonist activities.

Directing reaction pathways by catalyst active-site selection using self-assembled monolayers.

PubMed

Pang, Simon H; Schoenbaum, Carolyn A; Schwartz, Daniel K; Medlin, J Will

2013-01-01

One key route for controlling reaction selectivity in heterogeneous catalysis is to prepare catalysts that exhibit only specific types of sites required for desired product formation. Here we show that alkanethiolate self-assembled monolayers with varying surface densities can be used to tune selectivity to desired hydrogenation and hydrodeoxygenation products during the reaction of furfural on supported palladium catalysts. Vibrational spectroscopic studies demonstrate that the selectivity improvement is achieved by controlling the availability of specific sites for the hydrogenation of furfural on supported palladium catalysts through the selection of an appropriate alkanethiolate. Increasing self-assembled monolayer density by controlling the steric bulk of the organic tail ligand restricts adsorption on terrace sites and dramatically increases selectivity to desired products furfuryl alcohol and methylfuran. This technique of active-site selection simultaneously serves both to enhance selectivity and provide insight into the reaction mechanism.

RCRA/UST, Superfund, and EPCRA hotline training module. Introduction to superfund community involvement. Directive

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1996-03-01

This module covers EPA`s Superfund community involvement program, a set of requirements under the National Contingency Plan (NCP) designed to ensure that public is informed about site conditions and given the opportunity to comment on the proposed remedy of a Superfund site. The NCP serves to uphold the public`s right to voice opinions and express concerns about Superfund site activities. EPA must involve communities throughout Superfund process - particularly at critical decision-making steps in the process.

In vitro activation of NAD-dependent alcohol dehydrogenases by Nudix hydrolases is more widespread than assumed.

PubMed

Ochsner, Andrea M; Müller, Jonas E N; Mora, Carlos A; Vorholt, Julia A

2014-08-25

In the Gram-positive methylotroph Bacillus methanolicus, methanol oxidation is catalyzed by an NAD-dependent methanol dehydrogenase (Mdh) that belongs to the type III alcohol dehydrogenase (Adh) family. It was previously shown that the in vitro activity of B. methanolicus Mdh is increased by the endogenous activator protein Act, a Nudix hydrolase. Here we show that this feature is not unique, but more widespread among type III Adhs in combination with Act or other Act-like Nudix hydrolases. In addition, we studied the effect of site directed mutations in the predicted active site of Mdh and two other type III Adhs with regard to activity and activation by Act. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Template-directed covalent conjugation of DNA to native antibodies, transferrin and other metal-binding proteins

NASA Astrophysics Data System (ADS)

Rosen, Christian B.; Kodal, Anne L. B.; Nielsen, Jesper S.; Schaffert, David H.; Scavenius, Carsten; Okholm, Anders H.; Voigt, Niels V.; Enghild, Jan J.; Kjems, Jørgen; Tørring, Thomas; Gothelf, Kurt V.

2014-09-01

DNA-protein conjugates are important in bioanalytical chemistry, molecular diagnostics and bionanotechnology, as the DNA provides a unique handle to identify, functionalize or otherwise manipulate proteins. To maintain protein activity, conjugation of a single DNA handle to a specific location on the protein is often needed. However, preparing such high-quality site-specific conjugates often requires genetically engineered proteins, which is a laborious and technically challenging approach. Here we demonstrate a simpler method to create site-selective DNA-protein conjugates. Using a guiding DNA strand modified with a metal-binding functionality, we directed a second DNA strand to the vicinity of a metal-binding site of His6-tagged or wild-type metal-binding proteins, such as serotransferrin, where it subsequently reacted with lysine residues at that site. This method, DNA-templated protein conjugation, facilitates the production of site-selective protein conjugates, and also conjugation to IgG1 antibodies via a histidine cluster in the constant domain.

Using mass spectrometry to study the photo-affinity labeling of protein tyrosine phosphatase 1B

NASA Astrophysics Data System (ADS)

Leriche, Tammy; Skorey, Kathryn; Roy, Patrick; McKay, Dan; Bateman, Kevin P.

2004-11-01

Protein tyrosine phosphatase 1B (PTP1B) is a potential target for the treatment of Type II diabetes and several companies are developing small molecule inhibitors of this enzyme. Part of the characterization of these compounds as PTP1B inhibitors is the understanding of how they bind in the enzyme active site. The use of photo-activated inhibitors that target the active site can provide such insight. This paper describes the characterization of a photoprobe directed at the active site of PTP1B. Mass spectrometry revealed the specific binding of the probe to the intact protein. Digestion of the labeled protein followed by LC-MS and LC-MS/MS was used to show that the photoprobe binds to a specific active site amino acid. This was confirmed by comparison with the X-ray structure of PTP1B with a PTP1B inhibitor. The probe labels a conserved acidic residue (Asp) that is required for catalytic activity. This photoprobe may prove to be a useful tool for the development of a PTP1B inhibitor or for the study of PTPs in general.

Measuring Physical Activity Intensity

MedlinePlus Videos and Cool Tools

... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search the CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit ...

Paleomagnetic Results From the Mid-Tertiary Cripple Creek Diatreme Complex

NASA Astrophysics Data System (ADS)

Rampe, J. S.; Geissman, J. W.; Melker, M.

2001-12-01

The Cripple Creek diatreme complex, located about 30 km southwest of Pikes Peak, Colorado, is host to gold and high grade telluride deposits associated with mid-Tertiary alkaline magmatism. Formation of the diatreme took place between about 32.5 and 28.7 Ma, based on previously reported ArAr age determinations. The complex consists of breccia (the primary rock type), that was subsequently intruded by aphanitic phonolite, porphyritic phonolite, phonotephrite, and finally lamprophyre. Rocks presently at the surface were emplaced within a few kilometers of the paleosurface, followed by hydrothermal activity resulting in pervasive K metasomatism and gold mineralization. Mineralized deposits within the diatreme are currently being mined in an open pit fashion allowing for fresh three dimensional exposures of all representative rock types in the district. The Front Fange of Colorado, since cessation of northeast-directed Laramide compression, is characterized by east-west Rio Grande rift extension. Determining Laramide and younger deformation in the Front Range of Colorado is diffucult due to the dominance of Laramide structures and exposed Precambrian rocks with complex structural histories. Structures that affect the Cripple Creek diatreme complex and host Precambrian crystalline rocks clearly were active after intrusive activity and therefore reflect tectonism in the Front Range since early diatreme formation. Over 100 sites have been collected from all representative rock types in the district, with eight to ten oriented samples per site. Results indicate that the materials are capable of carrying geologically stable magnetizations and generally reveal excellent magnetization behavior using both AF and thermal methods. Many sites are associated with contact and breccia tests. Site mean directions are of both normal (D = 5.0° , I = 67.5° , α 95 = 6.4, κ = 89.2), N = 7 and reverse polarity (D = 162.2° , I = -67.3° , α 95 = 4.2, κ = 61.1) N =13; with site mean directions steeper than the expected mid-Tertiary polarity direction. Also, some sites exhibit multiple component behavior with both normal and reverse polarity magnetizations that are well defined (D = 29.7° , I = 72.5° , α 95 = 9.2, κ = 28.4) N = 10 and (D = 173.6° , I = -64.1° , α 95 = 3.1, κ = 594.8) N = 5, in aphanitic phonolite site CC89. We interpret these results to indicate that diatreme formation took place over at least one magnetic reversal and that the diatreme was modestly deformed resulting in north-side down tilting.

Atomic substitution reveals the structural basis for substrate adenine recognition and removal by adenine DNA glycosylase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Seongmin; Verdine, Gregory L.; Harvard)

2010-01-14

Adenine DNA glycosylase catalyzes the glycolytic removal of adenine from the promutagenic A {center_dot} oxoG base pair in DNA. The general features of DNA recognition by an adenine DNA glycosylase, Bacillus stearothermophilus MutY, have previously been revealed via the X-ray structure of a catalytically inactive mutant protein bound to an A:oxoG-containing DNA duplex. Although the structure revealed the substrate adenine to be, as expected, extruded from the DNA helix and inserted into an extrahelical active site pocket on the enzyme, the substrate adenine engaged in no direct contacts with active site residues. This feature was paradoxical, because other glycosylases havemore » been observed to engage their substrates primarily through direct contacts. The lack of direct contacts in the case of MutY suggested that either MutY uses a distinctive logic for substrate recognition or that the X-ray structure had captured a noncatalytically competent state in lesion recognition. To gain further insight into this issue, we crystallized wild-type MutY bound to DNA containing a catalytically inactive analog of 2'-deoxyadenosine in which a single 2'-H atom was replaced by fluorine. The structure of this fluorinated lesion-recognition complex (FLRC) reveals the substrate adenine buried more deeply into the active site pocket than in the prior structure and now engaged in multiple direct hydrogen bonding and hydrophobic interactions. This structure appears to capture the catalytically competent state of adenine DNA glycosylases, and it suggests a catalytic mechanism for this class of enzymes, one in which general acid-catalyzed protonation of the nucleobase promotes glycosidic bond cleavage.« less

Lower layers in the motor cortex are more effective targets for penetrating microelectrodes in cortical prostheses

NASA Astrophysics Data System (ADS)

Parikh, Hirak; Marzullo, Timothy C.; Kipke, Daryl R.

2009-04-01

Improving cortical prostheses requires the development of recording neural interfaces that are efficient in terms of providing maximal control information with minimal interface complexity. While the typical approaches have targeted neurons in the motor cortex with multiple penetrating shanks, an alternative approach is to determine an efficient distribution of electrode sites within the layers of the cortex with fewer penetrating shanks. The objective of this study was to compare unit activity in the upper and lower layers of the cortex with respect to movement and direction in order to inform the design of penetrating microelectrodes. Four rats were implanted bilaterally with multi-site single-shank silicon microelectrode arrays in the neck/shoulder region of the motor cortex. We simultaneously recorded unit activity across all layers of the motor cortex while the animal was engaged in a movement direction task. Localization of the electrode array within the different layers of the cortex was determined by histology. We denoted units from layers 2 and 3 and units as upper layer units, and units from layers 5 and 6 as lower layer units. Analysis of unit spiking activity demonstrated that both the upper and lower layers encode movement and direction information. Unit responses in either cortical layer of the cortex were not preferentially associated with contralateral or ipsilateral movement. Aggregate analysis (633 neurons) and best session analysis (75 neurons) indicated that units in the lower layers (layers 5, 6) are more likely to encode direction information when compared to units in the upper layers (layers 2, 3) (p< 0.05). These results suggest that electrode sites clustered in the lower layers provide access to more salient control information for cortical neuroprostheses.

An Evaluation of Semiempirical Models for Partitioning Photosynthetically Active Radiation Into Diffuse and Direct Beam Components

NASA Astrophysics Data System (ADS)

Oliphant, Andrew J.; Stoy, Paul C.

2018-03-01

Photosynthesis is more efficient under diffuse than direct beam photosynthetically active radiation (PAR) per unit PAR, but diffuse PAR is infrequently measured at research sites. We examine four commonly used semiempirical models (Erbs et al., 1982, https://doi.org/10.1016/0038-092X(82)90302-4; Gu et al., 1999, https://doi.org/10.1029/1999JD901068; Roderick, 1999, https://doi.org/10.1016/S0168-1923(99)00028-3; Weiss & Norman, 1985, https://doi.org/10.1016/0168-1923(85)90020-6) that partition PAR into diffuse and direct beam components based on the negative relationship between atmospheric transparency and scattering of PAR. Radiation observations at 58 sites (140 site years) from the La Thuille FLUXNET data set were used for model validation and coefficient testing. All four models did a reasonable job of predicting the diffuse fraction of PAR (ϕ) at the 30 min timescale, with site median r2 values ranging between 0.85 and 0.87, model efficiency coefficients (MECs) between 0.62 and 0.69, and regression slopes within 10% of unity. Model residuals were not strongly correlated with astronomical or standard meteorological variables. We conclude that the Roderick (1999, https://doi.org/10.1016/S0168-1923(99)00028-3) and Gu et al. (1999, https://doi.org/10.1029/1999JD901068) models performed better overall than the two older models. Using the basic form of these models, the data set was used to find both individual site and universal model coefficients that optimized predictive accuracy. A new universal form of the model is presented in section 5 that increased site median MEC to 0.73. Site-specific model coefficients increased median MEC further to 0.78, indicating usefulness of local/regional training of coefficients to capture the local distributions of aerosols and cloud types.

Biodiversity loss in seagrass meadows due to local invertebrate fisheries and harbour activities

NASA Astrophysics Data System (ADS)

Nordlund, Lina Mtwana; Gullström, Martin

2013-12-01

Seagrass meadows provide a wide variety of ecosystem services, but their distribution and health are adversely affected by man. In the present study, we examined the influence of coastal exploitation in terms of invertebrate harvesting and harbour activity on invertebrate community composition in subtropical seagrass meadows at Inhaca Island, Mozambique, in the Western Indian Ocean. There was a fivefold higher invertebrate density and biomass, and clearly higher invertebrate species richness, in the protected (control) site compared to the two exploited sites. The causes for the clear differences between protected and exploited sites were probably a result of (1) the directional outtake of large edible or saleable invertebrates (mostly molluscs) and the absence of boat traffic in the harvested site, and (2) harbour activities. Invertebrate community composition in the two exploited sites also differed (although less clear), which was likely due to inherent distinction in type of disturbance. Our findings revealed that protection of seagrass habitat is necessary and that disturbances of different origin might require different forms of management and conservation. Designing protected areas is however a complex process due to competition for use and space with activities such as invertebrate harvesting and harbours.

High-resolution physical and functional mapping of the template adjacent DNA binding site in catalytically active telomerase.

PubMed

Romi, Erez; Baran, Nava; Gantman, Marina; Shmoish, Michael; Min, Bosun; Collins, Kathleen; Manor, Haim

2007-05-22

Telomerase is a cellular reverse transcriptase, which utilizes an integral RNA template to extend single-stranded telomeric DNA. We used site-specific photocrosslinking to map interactions between DNA primers and the catalytic protein subunit (tTERT) of Tetrahymena thermophila telomerase in functional enzyme complexes. Our assays reveal contact of the single-stranded DNA adjacent to the primer-template hybrid and tTERT residue W187 at the periphery of the N-terminal domain. This contact was detected in complexes with three different registers of template in the active site, suggesting that it is maintained throughout synthesis of a complete telomeric repeat. Substitution of nearby residue Q168, but not W187, alters the K(m) for primer elongation, implying that it plays a role in the DNA recognition. These findings are the first to directly demonstrate the physical location of TERT-DNA contacts in catalytically active telomerase and to identify amino acid determinants of DNA binding affinity. Our data also suggest a movement of the TERT active site relative to the template-adjacent single-stranded DNA binding site within a cycle of repeat synthesis.

Site environmental report for Calendar Year 1994 on radiological and nonradiological parameters

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1995-06-30

Battelle Memorial Institute`s nuclear research facilities are currently being maintained in a surveillance and maintenance (S&M) mode with continual decontamination and decommissioning (D&D) activities being conducted under Department of Energy (DOE) Contract W-7405-ENG-92. These activities are referred to under the Contract as the Battelle Columbus Laboratories Decommissioning Project (BCLDP). Operations referenced in this report are performed in support of S&M and D&D activities. Battelle`s King Avenue facility is not considered in this report to the extent that the West Jefferson facility is. The source term at the King Avenue site is a small fraction of the source term at themore » West Jefferson site. Off site levels of radionuclides that could be attributed to the west Jefferson and King Avenue nuclear operations wereindistinguishable from background levels at specific locations where air, water, and direct radiation measurements were performed. Environmental monitoring continued to demonstrate compliance by Battelle with federal, state and local regulations. Routine, nonradiological activities performed include monitoring liquid effluents and monitoring the ground water system for the West Jefferson North site. Samples of various environmental media including air, water, grass, fish, field and garden crops, sediment and soil were collected from the region surrounding the two sites and analyzed.« less

Multitargeting by curcumin as revealed by molecular interaction studies

PubMed Central

Gupta, Subash C.; Prasad, Sahdeo; Kim, Ji Hye; Patchva, Sridevi; Webb, Lauren J.; Priyadarsini, Indira K.

2012-01-01

Curcumin (diferuloylmethane), the active ingredient in turmeric (Curcuma longa), is a highly pleiotropic molecule with anti-inflammatory, anti-oxidant, chemopreventive, chemosensitization, and radiosensitization activities. The pleiotropic activities attributed to curcumin come from its complex molecular structure and chemistry, as well as its ability to influence multiple signaling molecules. Curcumin has been shown to bind by multiple forces directly to numerous signaling molecules, such as inflammatory molecules, cell survival proteins, protein kinases, protein reductases, histone acetyltransferase, histone deacetylase, glyoxalase I, xanthine oxidase, proteasome, HIV1 integrase, HIV1 protease, sarco (endo) plasmic reticulum Ca2+ ATPase, DNA methyltransferases 1, FtsZ protofilaments, carrier proteins, and metal ions. Curcumin can also bind directly to DNA and RNA. Owing to its β-diketone moiety, curcumin undergoes keto–enol tautomerism that has been reported as a favorable state for direct binding. The functional groups on curcumin found suitable for interaction with other macromolecules include the α, β-unsaturated β-diketone moiety, carbonyl and enolic groups of the β-diketone moiety, methoxy and phenolic hydroxyl groups, and the phenyl rings. Various biophysical tools have been used to monitor direct interaction of curcumin with other proteins, including absorption, fluorescence, Fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy, surface plasmon resonance, competitive ligand binding, Forster type fluorescence resonance energy transfer (FRET), radiolabeling, site-directed mutagenesis, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS), immunoprecipitation, phage display biopanning, electron microscopy, 1-anilino-8-naphthalene-sulfonate (ANS) displacement, and co-localization. Molecular docking, the most commonly employed computational tool for calculating binding affinities and predicting binding sites, has also been used to further characterize curcumin’s binding sites. Furthermore, the ability of curcumin to bind directly to carrier proteins improves its solubility and bioavailability. In this review, we focus on how curcumin directly targets signaling molecules, as well as the different forces that bind the curcumin–protein complex and how this interaction affects the biological properties of proteins. We will also discuss various analogues of curcumin designed to bind selective targets with increased affinity. PMID:21979811

How oxygen reacts with oxygen-tolerant respiratory [NiFe]-hydrogenases.

PubMed

Wulff, Philip; Day, Christopher C; Sargent, Frank; Armstrong, Fraser A

2014-05-06

An oxygen-tolerant respiratory [NiFe]-hydrogenase is proven to be a four-electron hydrogen/oxygen oxidoreductase, catalyzing the reaction 2 H2 + O2 = 2 H2O, equivalent to hydrogen combustion, over a sustained period without inactivating. At least 86% of the H2O produced by Escherichia coli hydrogenase-1 exposed to a mixture of 90% H2 and 10% O2 is accounted for by a direct four-electron pathway, whereas up to 14% arises from slower side reactions proceeding via superoxide and hydrogen peroxide. The direct pathway is assigned to O2 reduction at the [NiFe] active site, whereas the side reactions are an unavoidable consequence of the presence of low-potential relay centers that release electrons derived from H2 oxidation. The oxidase activity is too slow to be useful in removing O2 from the bacterial periplasm; instead, the four-electron reduction of molecular oxygen to harmless water ensures that the active site survives to catalyze sustained hydrogen oxidation.

Structure and activity of the Cas3 HD nuclease MJ0384, an effector enzyme of the CRISPR interference

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beloglazova, Natalia; Petit, Pierre; Flick, Robert

Clustered regularly interspaced short palindromic repeats (CRISPRs) and Cas proteins represent an adaptive microbial immunity system against viruses and plasmids. Cas3 proteins have been proposed to play a key role in the CRISPR mechanism through the direct cleavage of invasive DNA. Here, we show that the Cas3 HD domain protein MJ0384 from Methanocaldococcus jannaschii cleaves endonucleolytically and exonucleolytically (3'-5') single-stranded DNAs and RNAs, as well as 3'-flaps, splayed arms, and R-loops. The degradation of branched DNA substrates by MJ0384 is stimulated by the Cas3 helicase MJ0383 and ATP. The crystal structure of MJ0384 revealed the active site with two boundmore » metal cations and together with site-directed mutagenesis suggested a catalytic mechanism. Our studies suggest that the Cas3 HD nucleases working together with the Cas3 helicases can completely degrade invasive DNAs through the combination of endo- and exonuclease activities.« less

How oxygen reacts with oxygen-tolerant respiratory [NiFe]-hydrogenases

PubMed Central

Wulff, Philip; Day, Christopher C.; Sargent, Frank; Armstrong, Fraser A.

2014-01-01

An oxygen-tolerant respiratory [NiFe]-hydrogenase is proven to be a four-electron hydrogen/oxygen oxidoreductase, catalyzing the reaction 2 H2 + O2 = 2 H2O, equivalent to hydrogen combustion, over a sustained period without inactivating. At least 86% of the H2O produced by Escherichia coli hydrogenase-1 exposed to a mixture of 90% H2 and 10% O2 is accounted for by a direct four-electron pathway, whereas up to 14% arises from slower side reactions proceeding via superoxide and hydrogen peroxide. The direct pathway is assigned to O2 reduction at the [NiFe] active site, whereas the side reactions are an unavoidable consequence of the presence of low-potential relay centers that release electrons derived from H2 oxidation. The oxidase activity is too slow to be useful in removing O2 from the bacterial periplasm; instead, the four-electron reduction of molecular oxygen to harmless water ensures that the active site survives to catalyze sustained hydrogen oxidation. PMID:24715724

A mixed ecologic-cohort comparison of physical activity & weight among young adults from five populations of African origin.

PubMed

Luke, Amy; Bovet, Pascal; Plange-Rhule, Jacob; Forrester, Terrence E; Lambert, Estelle V; Schoeller, Dale A; Dugas, Lara R; Durazo-Arvizu, Ramon A; Shoham, David A; Cao, Guichan; Brage, Soren; Ekelund, Ulf; Cooper, Richard S

2014-04-24

Examination of patterns and intensity of physical activity (PA) across cultures where obesity prevalence varies widely provides insight into one aspect of the ongoing epidemiologic transition. The primary hypothesis being addressed is whether low levels of PA are associated with excess weight and adiposity. We recruited young adults from five countries (500 per country, 2500 total, ages 25-45 years), spanning the range of obesity prevalence. Men and women were recruited from a suburb of Chicago, Illinois, USA; urban Jamaica; rural Ghana; peri-urban South Africa; and the Seychelles. PA was measured using accelerometry and expressed as minutes per day of moderate-to-vigorous activity or sedentary behavior. Obesity (BMI ≥ 30) prevalence ranged from 1.4% (Ghanaian men) to 63.8% (US women). South African men were the most active, followed by Ghanaian men. Relatively small differences were observed across sites among women; however, women in Ghana accumulated the most activity. Within site-gender sub-groups, the correlation of activity with BMI and other measures of adiposity was inconsistent; the combined correlation across sites was -0.17 for men and -0.11 for women. In the ecological analysis time spent in moderate-to-vigorous activity was inversely associated with BMI (r = -0.71). These analyses suggest that persons with greater adiposity tend to engage in less PA, although the associations are weak and the direction of causality cannot be inferred because measurements are cross-sectional. Longitudinal data will be required to elucidate direction of association.

Arabidopsis thaliana dehydroascorbate reductase 2: Conformational flexibility during catalysis

NASA Astrophysics Data System (ADS)

Bodra, Nandita; Young, David; Astolfi Rosado, Leonardo; Pallo, Anna; Wahni, Khadija; de Proft, Frank; Huang, Jingjing; van Breusegem, Frank; Messens, Joris

2017-02-01

Dehydroascorbate reductase (DHAR) catalyzes the glutathione (GSH)-dependent reduction of dehydroascorbate and plays a direct role in regenerating ascorbic acid, an essential plant antioxidant vital for defense against oxidative stress. DHAR enzymes bear close structural homology to the glutathione transferase (GST) superfamily of enzymes and contain the same active site motif, but most GSTs do not exhibit DHAR activity. The presence of a cysteine at the active site is essential for the catalytic functioning of DHAR, as mutation of this cysteine abolishes the activity. Here we present the crystal structure of DHAR2 from Arabidopsis thaliana with GSH bound to the catalytic cysteine. This structure reveals localized conformational differences around the active site which distinguishes the GSH-bound DHAR2 structure from that of DHAR1. We also unraveled the enzymatic step in which DHAR releases oxidized glutathione (GSSG). To consolidate our structural and kinetic findings, we investigated potential conformational flexibility in DHAR2 by normal mode analysis and found that subdomain mobility could be linked to GSH binding or GSSG release.

Arabidopsis thaliana dehydroascorbate reductase 2: Conformational flexibility during catalysis

PubMed Central

Bodra, Nandita; Young, David; Astolfi Rosado, Leonardo; Pallo, Anna; Wahni, Khadija; De Proft, Frank; Huang, Jingjing; Van Breusegem, Frank; Messens, Joris

2017-01-01

Dehydroascorbate reductase (DHAR) catalyzes the glutathione (GSH)-dependent reduction of dehydroascorbate and plays a direct role in regenerating ascorbic acid, an essential plant antioxidant vital for defense against oxidative stress. DHAR enzymes bear close structural homology to the glutathione transferase (GST) superfamily of enzymes and contain the same active site motif, but most GSTs do not exhibit DHAR activity. The presence of a cysteine at the active site is essential for the catalytic functioning of DHAR, as mutation of this cysteine abolishes the activity. Here we present the crystal structure of DHAR2 from Arabidopsis thaliana with GSH bound to the catalytic cysteine. This structure reveals localized conformational differences around the active site which distinguishes the GSH-bound DHAR2 structure from that of DHAR1. We also unraveled the enzymatic step in which DHAR releases oxidized glutathione (GSSG). To consolidate our structural and kinetic findings, we investigated potential conformational flexibility in DHAR2 by normal mode analysis and found that subdomain mobility could be linked to GSH binding or GSSG release. PMID:28195196

Analysis of Web Site Activity and Technology Transfer Accomplishments

Treesearch

Daniel L. Schmoldt; Matthew F. Winn; Philip A. Araman

1997-01-01

Government research activities are coming under increased scrutiny to justify their research direction, and to validate research project existence. One way to justify research is to pay closer attention to research clientele, their needs and their willingness and ability to adopt new technologies. Because many research products are informational rather than tangible,...

Newly identified essential amino acid residues affecting ^8-sphingolipid desaturase activity revealed by site-directed mutagenesis

USDA-ARS?s Scientific Manuscript database

In order to identify amino acid residues crucial for the enzymatic activity of ^8-sphingolipid desaturases, a sequence comparison was performed among ^8-sphingolipid desaturases and ^6-fatty acid desaturase from various plants. In addition to the known conserved cytb5 (cytochrome b5) HPGG motif and...

Identification of essential active-site residues in the cyanogenic beta-glucosidase (linamarase) from cassava (Manihot esculenta Crantz) by site-directed mutagenesis.

PubMed Central

Keresztessy, Z; Brown, K; Dunn, M A; Hughes, M A

2001-01-01

The coding sequence of the mature cyanogenic beta-glucosidase (beta-glucoside glucohydrolase, EC 3.2.1.21; linamarase) was cloned into the vector pYX243 modified to contain the SUC2 yeast secretion signal sequence and expressed in Saccharomyces cerevisiae. The recombinant enzyme is active, glycosylated and showed similar stability to the plant protein. Michaelis constants for hydrolysis of the natural substrate, linamarin (K(m)=1.06 mM) and the synthetic p-nitrophenyl beta-D-glucopyranoside (PNP-Glc; K(m)=0.36 mM), as well as apparent pK(a) values of the free enzyme and the enzyme-substrate complexes (pK(E)(1)=4.4-4.8, pK(E)(2)=6.7-7.2, pK(ES)(1)=3.9-4.4, pK(ES)(2)=8.3) were very similar to those of the plant enzyme. Site-directed mutagenesis was carried out to study the function of active-site residues based on a homology model generated for the enzyme using the MODELLER program. Changing Glu-413 to Gly destroyed enzyme activity, consistent with it being the catalytic nucleophile. The Gln-339Glu mutation also abolished activity, confirming a function in positioning the catalytic diad. The Ala-201Val mutation shifted the pK(a) of the acid/base catalyst Glu-198 from 7.22 to 7.44, reflecting a change in its hydrophobic environment. A Phe-269Asn change increased K(m) for linamarin hydrolysis 16-fold (16.1 mM) and that for PNP-Glc only 2.5-fold (0.84 mM), demonstrating that Phe-269 contributes to the cyanogenic specificity of the cassava beta-glucosidase. PMID:11139381

Evolution of flavone synthase I from parsley flavanone 3beta-hydroxylase by site-directed mutagenesis.

PubMed

Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan

2007-07-01

Flavanone 3beta-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the beta-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction).

The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase

NASA Astrophysics Data System (ADS)

Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy

2016-04-01

Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.

Crew/Robot Coordinated Planetary EVA Operations at a Lunar Base Analog Site

NASA Technical Reports Server (NTRS)

Diftler, M. A.; Ambrose, R. O.; Bluethmann, W. J.; Delgado, F. J.; Herrera, E.; Kosmo, J. J.; Janoiko, B. A.; Wilcox, B. H.; Townsend, J. A.; Matthews, J. B.;

Direct-push geochemical profiling for assessment of inorganic chemical heterogeneity in aquifers

USGS Publications Warehouse

Schulmeister, M.K.; Healey, J.M.; Butler, J.J.; McCall, G.W.

2004-01-01

Discrete-depth sampling of inorganic groundwater chemistry is essential for a variety of site characterization activities. Although the mobility and rapid sampling capabilities of direct-push techniques have led to their widespread use for evaluating the distribution of organic contaminants, complementary methods for the characterization of spatial variations in geochemical conditions have not been developed. In this study, a direct-push-based approach for high-resolution inorganic chemical profiling was developed at a site where sharp chemical contrasts and iron-reducing conditions had previously been observed. Existing multilevel samplers (MLSs) that span a fining-upward alluvial sequence were used for comparison with the direct-push profiling. Chemical profiles obtained with a conventional direct-push exposed-screen sampler differed from those obtained with an adjacent MLS because of sampler reactivity and mixing with water from previous sampling levels. The sampler was modified by replacing steel sampling components with stainless-steel and heat-treated parts, and adding an adapter that prevents mixing. Profiles obtained with the modified approach were in excellent agreement with those obtained from an adjacent MLS for all constituents and parameters monitored (Cl, NO3, Fe, Mn, DO, ORP, specific conductance and pH). Interpretations of site redox conditions based on field-measured parameters were supported by laboratory analysis of dissolved Fe. The discrete-depth capability of this approach allows inorganic chemical variations to be described at a level of detail that has rarely been possible. When combined with the mobility afforded by direct-push rigs and on-site methods of chemical analysis, the new approach is well suited for a variety of interactive site-characterization endeavors. ?? 2003 Elsevier B.V. All rights reserved.

Environmental Measurement-While-Drilling System and Horizontal Directional Drilling Technology Demonstration, Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, C.V.; Lockwood, G.J.; Normann, R.A.

1999-06-01

The Environmental Measurement-While-Drilling (EMWD) system and Horizontal Directional Drilling (HDD) were successfully demonstrated at the Mock Tank Leak Simulation Site and the Drilling Technology Test Site, Hanford, Washington. The use of directional drilling offers an alternative to vertical drilling site characterization. Directional drilling can develop a borehole under a structure, such as a waste tank, from an angled entry and leveling off to horizontal at the desired depth. The EMWD system represents an innovative blend of new and existing technology that provides the capability of producing real-time environmental and drill bit data during drilling operations. The technology demonstration consisted ofmore » the development of one borehole under a mock waste tank at a depth of {approximately} {minus}8 m ({minus}27 ft.), following a predetermined drill path, tracking the drill path to within a radius of {approximately}1.5 m (5 ft.), and monitoring for zones of radiological activity using the EMWD system. The purpose of the second borehole was to demonstrate the capability of drilling to a depth of {approximately} {minus}21 m ({minus}70 ft.), the depth needed to obtain access under the Hanford waste tanks, and continue drilling horizontally. This report presents information on the HDD and EMWD technologies, demonstration design, results of the demonstrations, and lessons learned.« less

Analysis of the promoter of the cudA gene reveals novel mechanisms of Dictyostelium cell type differentiation.

PubMed

Fukuzawa, M; Williams, J G

2000-06-01

The cudA gene encodes a nuclear protein that is essential for normal multicellular development. At the slug stage cudA is expressed in the prespore cells and in a sub-region of the prestalk zone. We show that cap site distal promoter sequences direct cudA expression in prespore cells, while proximal sequences direct expression in the prestalk sub-region. The promoter domain that directs prespore-specific transcription consists of a positively acting region, that has the potential to direct expression in all cells within the slug, and a negatively acting region that prevents expression in the prestalk cells. Dd-STATa is the STAT protein that regulates commitment to stalk cell gene expression, where it is known to function as a transcriptional repressor. We show that Dd-STATa binds in vitro to the positively acting part of the prespore domain of the cudA promoter. However, Dd-STATa cannot be utilised for this purpose in vivo, because analysis of a Dd-STATa null mutant strain shows that Dd-STATa is not necessary for cudA transcription in prespore cells. In contrast, the part of the cudA promoter that directs prestalk-specific expression contains a binding site for Dd-STATa that is essential for its biological activity. Dd-STATa appears therefore to serve as a direct activator of cudA transcription in prestalk cells, while a protein with a DNA binding specificity highly related to that of Dd-STATa is utilised to activate cudA transcription in prespore cells.

Allosteric modulation of Ras positions Q61 for a direct role in catalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buhrman, Greg; Holzapfel, Genevieve; Fetics, Susan

2010-11-03

Ras and its effector Raf are key mediators of the Ras/Raf/MEK/ERK signal transduction pathway. Mutants of residue Q61 impair the GTPase activity of Ras and are found prominently in human cancers. Yet the mechanism through which Q61 contributes to catalysis has been elusive. It is thought to position the catalytic water molecule for nucleophilic attack on the {gamma}-phosphate of GTP. However, we previously solved the structure of Ras from crystals with symmetry of the space group R32 in which switch II is disordered and found that the catalytic water molecule is present. Here we present a structure of wild-type Rasmore » with calcium acetate from the crystallization mother liquor bound at a site remote from the active site and likely near the membrane. This results in a shift in helix 3/loop 7 and a network of H-bonding interactions that propagates across the molecule, culminating in the ordering of switch II and placement of Q61 in the active site in a previously unobserved conformation. This structure suggests a direct catalytic role for Q61 where it interacts with a water molecule that bridges one of the {gamma}-phosphate oxygen atoms to the hydroxyl group of Y32 to stabilize the transition state of the hydrolysis reaction. We propose that Raf together with the binding of Ca{sup 2+} and a negatively charged group mimicked in our structure by the acetate molecule induces the ordering of switch I and switch II to complete the active site of Ras.« less

Diurnal variations in personal care products in seawater and mussels at three Mediterranean coastal sites.

PubMed

Picot-Groz, Marina; Fenet, Hélène; Martinez Bueno, Maria Jesus; Rosain, David; Gomez, Elena

2018-03-01

The presence of personal care products (PCPs) in the marine environment is of major concern. PCPs, UV filters, and musks can enter the marine environment indirectly through wastewater or directly via recreational activities. We conducted this study to document patterns in the occurrence of seven PCPs at three coastal sites impacted by recreational activities during 1 day. The study focused on diurnal variations in these seven PCPs in seawater and indigenous mussels. In seawater, UV filters showed diurnal variations that mirrored variations in recreational activities at the sites. Ethylhexyl methoxycinnamate (EHMC) and octocrylene (OC) water concentrations increased from under the limit of quantification in the morning to 106 and 369 ng/L, respectively, when recreational activities were the highest. In mussels, diurnal variations in OC were observed, with the lowest concentrations recorded in the morning and then increasing throughout the day. As Mytilus spp. are widely used as sentinels in coastal pollution monitoring programs (mussel watch), our findings on diurnal variations could enhance sampling recommendations for recreational sites impacted by PCPs.

Exploring the Active Site of the Tungsten, Iron-Sulfur Enzyme Acetylene Hydratase▿ †

PubMed Central

tenBrink, Felix; Schink, Bernhard; Kroneck, Peter M. H.

2011-01-01

The soluble tungsten, iron-sulfur enzyme acetylene hydratase (AH) from mesophilic Pelobacter acetylenicus is a member of the dimethyl sulfoxide (DMSO) reductase family. It stands out from its class as it catalyzes a nonredox reaction, the addition of H2O to acetylene (H—C☰C—H) to form acetaldehyde (CH3CHO). Caught in its active W(IV) state, the high-resolution three-dimensional structure of AH offers an excellent starting point to tackle its unique chemistry and to identify catalytic amino acid residues within the active site cavity: Asp13 close to W(IV) coordinated to two molybdopterin-guanosine-dinucleotide ligands, Lys48 which couples the [4Fe-4S] cluster to the W site, and Ile142 as part of a hydrophobic ring at the end of the substrate access channel designed to accommodate the substrate acetylene. A protocol was developed to express AH in Escherichia coli and to produce active-site variants which were characterized with regard to activity and occupancy of the tungsten and iron-sulfur centers. By this means, fusion of the N-terminal chaperone binding site of the E. coli nitrate reductase NarG to the AH gene improved the yield and activity of AH and its variants significantly. Results from site-directed mutagenesis of three key residues, Asp13, Lys48, and Ile142, document their important role in catalysis of this unusual tungsten enzyme. PMID:21193613

2016 Annual Inspection and Radiological Survey Results for the Piqua, Ohio, Decommissioned Reactor Site, July 2016

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zimmerman, Brian; Miller, Michele

This report presents the findings of the annual inspection and radiological survey of the Piqua, Ohio, Decommissioned Reactor Site (site). The decommissioned nuclear power demonstration facility was inspected and surveyed on April 15, 2016. The site, located on the east bank of the Great Miami River in Piqua, Ohio, was in fair physical condition. There is no requirement for a follow-up inspection, partly because City of Piqua (City) personnel participated in a March 2016 meeting to address reoccurring safety concerns. Radiological survey results from 104 locations revealed no removable contamination. One direct beta activity reading in a floor drain onmore » the 56-foot level (1674 disintegrations per minute [dpm]/100 square centimeters [cm2]) exceeded the minimum detectable activity (MDA). Beta activity has been detected in the past at this floor drain. The reading was well below the action level of 5000 dpm/100 cm2.« less

Structure of a Clostridium botulinum C143S thiaminase I/thiamin complex reveals active site architecture .

PubMed

Sikowitz, Megan D; Shome, Brateen; Zhang, Yang; Begley, Tadhg P; Ealick, Steven E

2013-11-05

Thiaminases are responsible for the degradation of thiamin and its metabolites. Two classes of thiaminases have been identified based on their three-dimensional structures and their requirements for a nucleophilic second substrate. Although the reactions of several thiaminases have been characterized, the physiological role of thiamin degradation is not fully understood. We have determined the three-dimensional X-ray structure of an inactive C143S mutant of Clostridium botulinum (Cb) thiaminase I with bound thiamin at 2.2 Å resolution. The C143S/thiamin complex provides atomic level details of the orientation of thiamin upon binding to Cb-thiaminase I and the identity of active site residues involved in substrate binding and catalysis. The specific roles of active site residues were probed by using site directed mutagenesis and kinetic analyses, leading to a detailed mechanism for Cb-thiaminase I. The structure of Cb-thiaminase I is also compared to the functionally similar but structurally distinct thiaminase II.

Interactions and phosphorylation of postsynaptic density 93 (PSD-93) by extracellular signal-regulated kinase (ERK).

PubMed

Guo, Ming-Lei; Xue, Bing; Jin, Dao-Zhong; Mao, Li-Min; Wang, John Q

2012-07-17

Postsynaptic density 93 (PSD-93) is a protein enriched at postsynaptic sites. As a key scaffolding protein, PSD-93 forms complexes with the clustering of various synaptic proteins to construct postsynaptic signaling networks and control synaptic transmission. Extracellular signal-regulated kinase (ERK) is a prototypic member of a serine/threonine protein kinase family known as mitogen-activated protein kinase (MAPK). This kinase, especially ERK2 isoform, noticeably resides in peripheral structures of neurons, such as dendritic spines and postsynaptic density areas, in addition to its distribution in the cytoplasm and nucleus, although little is known about specific substrates of ERK at synaptic sites. In this study, we found that synaptic PSD-93 is a direct target of ERK. This was demonstrated by direct protein-protein interactions between purified ERK2 and PSD-93 in vitro. The accurate ERK2-binding region seems to locate at an N-terminal region of PSD-93. In adult rat striatal neurons in vivo, native ERK from synaptosomal fractions also associated with PSD-93. In phosphorylation assays, active ERK2 phosphorylated PSD-93. An accurate phosphorylation site was identified at a serine site (S323). In striatal neurons, immunoprecipitated PSD-93 showed basal phosphorylation at an ERK-sensitive site. Our data provide evidence supporting PSD-93 as a new substrate of the synaptic species of ERK. ERK2 possesses the ability to interact with PSD-93 and phosphorylate PSD-93 at a specific site. Published by Elsevier B.V.

Distinct Involvement of the Gab1 and Grb2 Adaptor Proteins in Signal Transduction by the Related Receptor Tyrosine Kinases RON and MET

PubMed Central

Chaudhuri, Amitabha; Xie, Ming-Hong; Yang, Becky; Mahapatra, Kaushiki; Liu, Jinfeng; Marsters, Scot; Bodepudi, Sweta; Ashkenazi, Avi

2011-01-01

Although the signal transduction mechanisms of the receptor tyrosine kinase MET are well defined, less is known about its close relative RON. MET initiates intracellular signaling by autophosphorylation on specific cytoplasmic tyrosines that form docking sites for the adaptor proteins Grb2 and Gab1. Grb2 binds directly and is essential for all of the biological activities of MET. Gab1 docks either directly or indirectly via Grb2 and controls only a subset of MET functions. Because MET and RON possess similar adaptor binding sites, it was anticipated that their adaptor interactions would be conserved. Here we show that in contrast to MET, RON relies primarily on Gab1 for signal transmission. Surprisingly, disruption of the Grb2 docking site of RON or Grb2 depletion augments activity, whereas enhancement of Grb2 binding attenuates Gab1 recruitment and signaling. Hence, RON and MET differ in their adaptor interactions; furthermore, Grb2 performs a novel antagonistic role in the context of RON signaling. PMID:21784853

Structural and biochemical characterisation of Archaeoglobus fulgidus esterase reveals a bound CoA molecule in the vicinity of the active site.

PubMed

Sayer, Christopher; Finnigan, William; Isupov, Michail N; Levisson, Mark; Kengen, Servé W M; van der Oost, John; Harmer, Nicholas J; Littlechild, Jennifer A

2016-05-10

A new carboxyl esterase, AF-Est2, from the hyperthermophilic archaeon Archaeoglobus fulgidus has been cloned, over-expressed in Escherichia coli and biochemically and structurally characterized. The enzyme has high activity towards short- to medium-chain p-nitrophenyl carboxylic esters with optimal activity towards the valerate ester. The AF-Est2 has good solvent and pH stability and is very thermostable, showing no loss of activity after incubation for 30 min at 80 °C. The 1.4 Å resolution crystal structure of AF-Est2 reveals Coenzyme A (CoA) bound in the vicinity of the active site. Despite the presence of CoA bound to the AF-Est2 this enzyme has no CoA thioesterase activity. The pantetheine group of CoA partially obstructs the active site alcohol pocket suggesting that this ligand has a role in regulation of the enzyme activity. A comparison with closely related α/β hydrolase fold enzyme structures shows that the AF-Est2 has unique structural features that allow CoA binding. A comparison of the structure of AF-Est2 with the human carboxyl esterase 1, which has CoA thioesterase activity, reveals that CoA is bound to different parts of the core domain in these two enzymes and approaches the active site from opposite directions.

Structural and biochemical characterisation of Archaeoglobus fulgidus esterase reveals a bound CoA molecule in the vicinity of the active site

PubMed Central

Sayer, Christopher; Finnigan, William; Isupov, Michail N.; Levisson, Mark; Kengen, Servé W. M.; van der Oost, John; Harmer, Nicholas J.; Littlechild, Jennifer A.

2016-01-01

A new carboxyl esterase, AF-Est2, from the hyperthermophilic archaeon Archaeoglobus fulgidus has been cloned, over-expressed in Escherichia coli and biochemically and structurally characterized. The enzyme has high activity towards short- to medium-chain p-nitrophenyl carboxylic esters with optimal activity towards the valerate ester. The AF-Est2 has good solvent and pH stability and is very thermostable, showing no loss of activity after incubation for 30 min at 80 °C. The 1.4 Å resolution crystal structure of AF-Est2 reveals Coenzyme A (CoA) bound in the vicinity of the active site. Despite the presence of CoA bound to the AF-Est2 this enzyme has no CoA thioesterase activity. The pantetheine group of CoA partially obstructs the active site alcohol pocket suggesting that this ligand has a role in regulation of the enzyme activity. A comparison with closely related α/β hydrolase fold enzyme structures shows that the AF-Est2 has unique structural features that allow CoA binding. A comparison of the structure of AF-Est2 with the human carboxyl esterase 1, which has CoA thioesterase activity, reveals that CoA is bound to different parts of the core domain in these two enzymes and approaches the active site from opposite directions. PMID:27160974

Human Activity Helps Prey Win the Predator-Prey Space Race

PubMed Central

Muhly, Tyler B.; Semeniuk, Christina; Massolo, Alessandro; Hickman, Laura; Musiani, Marco

2011-01-01

Predator-prey interactions, including between large mammalian wildlife species, can be represented as a “space race”, where prey try to minimize and predators maximize spatial overlap. Human activity can also influence the distribution of wildlife species. In particular, high-human disturbance can displace large carnivore predators, a trait-mediated direct effect. Predator displacement by humans could then indirectly benefit prey species by reducing predation risk, a trait-mediated indirect effect of humans that spatially decouples predators from prey. The purpose of this research was to test the hypothesis that high-human activity was displacing predators and thus indirectly creating spatial refuge for prey species, helping prey win the “space race”. We measured the occurrence of eleven large mammal species (including humans and cattle) at 43 camera traps deployed on roads and trails in southwest Alberta, Canada. We tested species co-occurrence at camera sites using hierarchical cluster and nonmetric multidimensional scaling (NMS) analyses; and tested whether human activity, food and/or habitat influenced predator and prey species counts at camera sites using regression tree analysis. Cluster and NMS analysis indicated that at camera sites humans co-occurred with prey species more than predator species and predator species had relatively low co-occurrence with prey species. Regression tree analysis indicated that prey species were three times more abundant on roads and trails with >32 humans/day. However, predators were less abundant on roads and trails that exceeded 18 humans/day. Our results support the hypothesis that high-human activity displaced predators but not prey species, creating spatial refuge from predation. High-human activity on roads and trails (i.e., >18 humans/day) has the potential to interfere with predator-prey interactions via trait-mediated direct and indirect effects. We urge scientist and managers to carefully consider and quantify the trait-mediated indirect effects of humans, in addition to direct effects, when assessing human impacts on wildlife and ecosystems. PMID:21399682

Biomimicry enhances sequential reactions of tethered glycolytic enzymes, TPI and GAPDHS.

PubMed

Mukai, Chinatsu; Gao, Lizeng; Bergkvist, Magnus; Nelson, Jacquelyn L; Hinchman, Meleana M; Travis, Alexander J

2013-01-01

Maintaining activity of enzymes tethered to solid interfaces remains a major challenge in developing hybrid organic-inorganic devices. In nature, mammalian spermatozoa have overcome this design challenge by having glycolytic enzymes with specialized targeting domains that enable them to function while tethered to a cytoskeletal element. As a step toward designing a hybrid organic-inorganic ATP-generating system, we implemented a biomimetic site-specific immobilization strategy to tether two glycolytic enzymes representing different functional enzyme families: triose phosphoisomerase (TPI; an isomerase) and glyceraldehyde 3-phosphate dehydrogenase (GAPDHS; an oxidoreductase). We then evaluated the activities of these enzymes in comparison to when they were tethered via classical carboxyl-amine crosslinking. Both enzymes show similar surface binding regardless of immobilization method. Remarkably, specific activities for both enzymes were significantly higher when tethered using the biomimetic, site-specific immobilization approach. Using this biomimetic approach, we tethered both enzymes to a single surface and demonstrated their function in series in both forward and reverse directions. Again, the activities in series were significantly higher in both directions when the enzymes were coupled using this biomimetic approach versus carboxyl-amine binding. Our results suggest that biomimetic, site-specific immobilization can provide important functional advantages over chemically specific, but non-oriented attachment, an important strategic insight given the growing interest in recapitulating entire biological pathways on hybrid organic-inorganic devices.

Biomimicry Enhances Sequential Reactions of Tethered Glycolytic Enzymes, TPI and GAPDHS

PubMed Central

Mukai, Chinatsu; Gao, Lizeng; Bergkvist, Magnus; Nelson, Jacquelyn L.; Hinchman, Meleana M.; Travis, Alexander J.

2013-01-01

Maintaining activity of enzymes tethered to solid interfaces remains a major challenge in developing hybrid organic-inorganic devices. In nature, mammalian spermatozoa have overcome this design challenge by having glycolytic enzymes with specialized targeting domains that enable them to function while tethered to a cytoskeletal element. As a step toward designing a hybrid organic-inorganic ATP-generating system, we implemented a biomimetic site-specific immobilization strategy to tether two glycolytic enzymes representing different functional enzyme families: triose phosphoisomerase (TPI; an isomerase) and glyceraldehyde 3-phosphate dehydrogenase (GAPDHS; an oxidoreductase). We then evaluated the activities of these enzymes in comparison to when they were tethered via classical carboxyl-amine crosslinking. Both enzymes show similar surface binding regardless of immobilization method. Remarkably, specific activities for both enzymes were significantly higher when tethered using the biomimetic, site-specific immobilization approach. Using this biomimetic approach, we tethered both enzymes to a single surface and demonstrated their function in series in both forward and reverse directions. Again, the activities in series were significantly higher in both directions when the enzymes were coupled using this biomimetic approach versus carboxyl-amine binding. Our results suggest that biomimetic, site-specific immobilization can provide important functional advantages over chemically specific, but non-oriented attachment, an important strategic insight given the growing interest in recapitulating entire biological pathways on hybrid organic-inorganic devices. PMID:23626684

Using a simple apparatus to measure direct and diffuse photosynthetically active radiation at remote locations.

PubMed

Cruse, Michael J; Kucharik, Christopher J; Norman, John M

2015-01-01

Plant canopy interception of photosynthetically active radiation (PAR) drives carbon dioxide (CO2), water and energy cycling in the soil-plant-atmosphere system. Quantifying intercepted PAR requires accurate measurements of total incident PAR above canopies and direct beam and diffuse PAR components. While some regional data sets include these data, e.g. from Atmospheric Radiation Measurement (ARM) Program sites, they are not often applicable to local research sites because of the variable nature (spatial and temporal) of environmental variables that influence incoming PAR. Currently available instrumentation that measures diffuse and direct beam radiation separately can be cost prohibitive and require frequent adjustments. Alternatively, generalized empirical relationships that relate atmospheric variables and radiation components can be used but require assumptions that increase the potential for error. Our goal here was to construct and test a cheaper, highly portable instrument alternative that could be used at remote field sites to measure total, diffuse and direct beam PAR for extended time periods without supervision. The apparatus tested here uses a fabricated, solar powered rotating shadowband and other commercially available parts to collect continuous hourly PAR data. Measurements of total incident PAR had nearly a one-to-one relationship with total incident radiation measurements taken at the same research site by an unobstructed point quantum sensor. Additionally, measurements of diffuse PAR compared favorably with modeled estimates from previously published data, but displayed significant differences that were attributed to the important influence of rapidly changing local environmental conditions. The cost of the system is about 50% less than comparable commercially available systems that require periodic, but not continual adjustments. Overall, the data produced using this apparatus indicates that this instrumentation has the potential to support ecological research via a relatively inexpensive method to collect continuous measurements of total, direct beam and diffuse PAR in remote locations.

Using a Simple Apparatus to Measure Direct and Diffuse Photosynthetically Active Radiation at Remote Locations

PubMed Central

Cruse, Michael J.; Kucharik, Christopher J.; Norman, John M.

2015-01-01

Plant canopy interception of photosynthetically active radiation (PAR) drives carbon dioxide (CO2), water and energy cycling in the soil-plant-atmosphere system. Quantifying intercepted PAR requires accurate measurements of total incident PAR above canopies and direct beam and diffuse PAR components. While some regional data sets include these data, e.g. from Atmospheric Radiation Measurement (ARM) Program sites, they are not often applicable to local research sites because of the variable nature (spatial and temporal) of environmental variables that influence incoming PAR. Currently available instrumentation that measures diffuse and direct beam radiation separately can be cost prohibitive and require frequent adjustments. Alternatively, generalized empirical relationships that relate atmospheric variables and radiation components can be used but require assumptions that increase the potential for error. Our goal here was to construct and test a cheaper, highly portable instrument alternative that could be used at remote field sites to measure total, diffuse and direct beam PAR for extended time periods without supervision. The apparatus tested here uses a fabricated, solar powered rotating shadowband and other commercially available parts to collect continuous hourly PAR data. Measurements of total incident PAR had nearly a one-to-one relationship with total incident radiation measurements taken at the same research site by an unobstructed point quantum sensor. Additionally, measurements of diffuse PAR compared favorably with modeled estimates from previously published data, but displayed significant differences that were attributed to the important influence of rapidly changing local environmental conditions. The cost of the system is about 50% less than comparable commercially available systems that require periodic, but not continual adjustments. Overall, the data produced using this apparatus indicates that this instrumentation has the potential to support ecological research via a relatively inexpensive method to collect continuous measurements of total, direct beam and diffuse PAR in remote locations. PMID:25668208

The hppA gene of Helicobacter pylori encodes the class C acid phosphatase precursor.

PubMed

Godlewska, Renata; Bujnicki, Janusz M; Ostrowski, Jerzy; Jagusztyn-Krynicka, Elzbieta K

2002-08-14

Screening of the Helicobacter pylori genomic library with sera from infected humans and from immunized rabbits resulted in identification of the 25 kDa protein cell envelope (HppA) which exhibits acid phosphatase activity. Enzyme activity was demonstrated by specific enzymatic assays with whole-cell protein preparations of H. pylori strain N6 and from Escherichia coli carrying the hppA gene (pUWM192). HppA showed optimum activity at pH 5.6 and was resistant to inhibition by EDTA. Bioinformatics analysis and site-directed mutagenesis of two putative active site residues (D73 and D192) provide further insight into the sequence-structure-function relationships of HppA as a member of the DDDD phosphohydrolase superfamily.

Crystal structure of an avian influenza polymerase PA[subscript N] reveals an endonuclease active site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yuan, Puwei; Bartlam, Mark; Lou, Zhiyong

2009-11-10

The heterotrimeric influenza virus polymerase, containing the PA, PB1 and PB2 proteins, catalyses viral RNA replication and transcription in the nucleus of infected cells. PB1 holds the polymerase active site and reportedly harbours endonuclease activity, whereas PB2 is responsible for cap binding. The PA amino terminus is understood to be the major functional part of the PA protein and has been implicated in several roles, including endonuclease and protease activities as well as viral RNA/complementary RNA promoter binding. Here we report the 2.2 angstrom (A) crystal structure of the N-terminal 197 residues of PA, termed PA(N), from an avian influenzamore » H5N1 virus. The PA(N) structure has an alpha/beta architecture and reveals a bound magnesium ion coordinated by a motif similar to the (P)DX(N)(D/E)XK motif characteristic of many endonucleases. Structural comparisons and mutagenesis analysis of the motif identified in PA(N) provide further evidence that PA(N) holds an endonuclease active site. Furthermore, functional analysis with in vivo ribonucleoprotein reconstitution and direct in vitro endonuclease assays strongly suggest that PA(N) holds the endonuclease active site and has critical roles in endonuclease activity of the influenza virus polymerase, rather than PB1. The high conservation of this endonuclease active site among influenza strains indicates that PA(N) is an important target for the design of new anti-influenza therapeutics.« less

Cloning and characterization of microbial activated Aedes aegypti MEK4 (AaMEK4): influences of noncatalytic domains on enzymatic activity.

PubMed

Wu, R C-C; Cho, W-L

2014-10-01

Protein kinases are known to be involved in a number of signal transduction cascades. Both the stress-activated Jun N-terminal kinase (JNK) and mitogen-activated protein kinase (MAPK) p38 pathways have been shown to correlate with the insect immune response to microbial infection. MAP kinase kinase 4 (MEK4) is an upstream kinase of JNK and p38 kinase. The cDNA of AaMEK4 was cloned and characterized. AaMEK4 was activated by microbial lysates of Gram-positive, Gram-negative bacteria and yeast. The conserved lysine (K112 ) and the putative phosphorylation sites (S238 and T242 ) were shown to be important for kinase activity by site-directed mutagenesis. A common MAPK docking site (MAPK_dsA) was found and in addition, a new nearby docking site, MAPK_dsB, was identified in the N-terminal noncatalytic domain of AaMEK4. MAPK_dsB was shown to be a unique element in the MEK4 family. In this study, both MAPK_dsA and _dsB were demonstrated to be important to AaMEK4 enzymatic activity for the downstream protein kinase, Aap38. © 2014 The Royal Entomological Society.

Cation-exchanged zeolites for the selective oxidation of methane to methanol

DOE PAGES

Kulkarni, Ambarish R.; Zhao, Zhi-Jian; Siahrostami, Samira; ...

2017-10-19

Motivated by the increasing availability of cheap natural gas resources, considerable experimental and computational research efforts have focused on identifying selective catalysts for the direct conversion of methane to methanol. One promising class of catalysts are cation-exchanged zeolites, which have steadily increased in popularity over the past decade. Here, in this article, we first present a broad overview of this field from a conceptual perspective, and highlight the role of theory in developing a molecular-level understanding of the reaction. Next, by performing and analyzing a large database of density functional theory (DFT) calculations for a wide range of transition metalmore » cations, zeolite topologies and active site motifs, we present a unifying picture of the methane activation process in terms of active site stability, C–H bond activation and methanol extraction. Based on the trade-offs of active site stability and reactivity, we propose a framework for identifying new, promising active site motifs in these systems. Further, we show that the high methanol selectivity arises due to the strong binding nature of the C–H activation products. Lastly, using the atomistic and mechanistic insight obtained from these analyses, we summarize the key challenges and future strategies for improving the performance of cation-exchanged zeolites for this industrially relevant conversion.« less

Cation-exchanged zeolites for the selective oxidation of methane to methanol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kulkarni, Ambarish R.; Zhao, Zhi-Jian; Siahrostami, Samira

Motivated by the increasing availability of cheap natural gas resources, considerable experimental and computational research efforts have focused on identifying selective catalysts for the direct conversion of methane to methanol. One promising class of catalysts are cation-exchanged zeolites, which have steadily increased in popularity over the past decade. Here, in this article, we first present a broad overview of this field from a conceptual perspective, and highlight the role of theory in developing a molecular-level understanding of the reaction. Next, by performing and analyzing a large database of density functional theory (DFT) calculations for a wide range of transition metalmore » cations, zeolite topologies and active site motifs, we present a unifying picture of the methane activation process in terms of active site stability, C–H bond activation and methanol extraction. Based on the trade-offs of active site stability and reactivity, we propose a framework for identifying new, promising active site motifs in these systems. Further, we show that the high methanol selectivity arises due to the strong binding nature of the C–H activation products. Lastly, using the atomistic and mechanistic insight obtained from these analyses, we summarize the key challenges and future strategies for improving the performance of cation-exchanged zeolites for this industrially relevant conversion.« less

Aviation Emissions Impact Ambient Ultrafine Particle Concentrations in the Greater Boston Area.

PubMed

Hudda, N; Simon, M C; Zamore, W; Brugge, D; Durant, J L

2016-08-16

Ultrafine particles are emitted at high rates by jet aircraft. To determine the possible impacts of aviation activities on ambient ultrafine particle number concentrations (PNCs), we analyzed PNCs measured from 3 months to 3.67 years at three sites within 7.3 km of Logan International Airport (Boston, MA). At sites 4.0 and 7.3 km from the airport, average PNCs were 2- and 1.33-fold higher, respectively, when winds were from the direction of the airport compared to other directions, indicating that aviation impacts on PNC extend many kilometers downwind of Logan airport. Furthermore, PNCs were positively correlated with flight activity after taking meteorology, time of day and week, and traffic volume into account. Also, when winds were from the direction of the airport, PNCs increased with increasing wind speed, suggesting that buoyant aircraft exhaust plumes were the likely source. Concentrations of other pollutants [CO, black carbon (BC), NO, NO2, NOx, SO2, and fine particulate matter (PM2.5)] decreased with increasing wind speed when winds were from the direction of the airport, indicating a different dominant source (likely roadway traffic emissions). Except for oxides of nitrogen, other pollutants were not correlated with flight activity. Our findings point to the need for PNC exposure assessment studies to take aircraft emissions into consideration, particularly in populated areas near airports.

Identification of the Doublesex protein binding sites that activate expression of lozenge in the female genital disc in Drosophila melanogaster.

PubMed

Wagamitsu, Shunsuke; Takase, Dan; Aoki, Fugaku; Suzuki, Masataka G

2017-02-01

Normal sexual differentiation in the genital organs is essential for the animal species that use sexual reproduction. Although it is known that doublesex (dsx) is required for the sexual development of the genitalia in various insect species, the direct target genes responsible for the sexual differentiation of the genitalia have not been identified. The lozenge (lz) gene is expressed in the female genital disc and is essential for developments of spermathecae and accessory glands in Drosophila melanogaster. The female-specific isoform of DSX (DSXF) is required for activating lz expression in the female genital disc. However, it still remains unclear whether the DSXF directly activates the transcription of lz in the female genital disc. In this study, we found two sequences (lz-DBS1 and lz-DBS2) within lz locus that showed high homoloty to the DSX binding motif identified previously. Competition assays using recombinant DSX DNA-binding domain (DSX-DBD) protein verified that the DSX-DBD protein bound to lz-DBS1 and lz-DBS2 in a sequence-specific manner with lower affinity than to the known DSX binding site in the bric-à-brac 1 (bab1) gene. Reporter gene analyses revealed that a 2.5-kbp lz genomic fragment containing lz-DBS1 and lz-DBS2 drove reporter gene (EGFP) expression in a manner similar to endogenous lz expression in the female genital disc. Mutations in lz-DBS1 alone significantly reduced the area of EGFP-expressing region, while EGFP expression in the female genital disc was abolished when both sites were mutated. These results demonstrated that DSX directly activates female-specific lz expression in the genital disc through lz-DBS1 and lz-DBS2. Copyright © 2017 Elsevier B.V. All rights reserved.

Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

PubMed Central

Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

1998-01-01

Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

Applying the Brakes to Multi-Site SR Protein Phosphorylation: Substrate-Induced Effects on the Splicing Kinase SRPK1†

PubMed Central

Aubol, Brandon E.; Adams, Joseph A.

2011-01-01

To investigate how a protein kinase interacts with its protein substrate during extended, multi-site phosphorylation, the kinetic mechanism of a protein kinase involved in mRNA splicing control was investigated using rapid quench flow techniques. The protein kinase SRPK1 phosphorylates approximately 10 serines in the arginine-serine-rich domain (RS domain) of the SR protein SRSF1 in a C-to-N-terminal direction, a modification that directs this essential splicing factor from the cytoplasm to the nucleus. Transient-state kinetic experiments illustrate that the first phosphate is added rapidly onto the RS domain of SRSF1 (t1/2 = 0.1 sec) followed by slower, multi-site phosphorylation at the remaining serines (t1/2 = 15 sec). Mutagenesis experiments suggest that efficient phosphorylation rates are maintained by an extensive hydrogen bonding and electrostatic network between the RS domain of the SR protein and the active site and docking groove of the kinase. Catalytic trapping and viscosometric experiments demonstrate that while the phosphoryl transfer step is fast, ADP release limits multi-site phosphorylation. By studying phosphate incorporation into selectively pre-phosphorylated forms of the enzyme-substrate complex, the kinetic mechanism for site-specific phosphorylation along the reaction coordinate was assessed. The binding affinity of the SR protein, the phosphoryl transfer rate and ADP exchange rate were found to decline significantly as a function of progressive phosphorylation in the RS domain. These findings indicate that the protein substrate actively modulates initiation, extension and termination events associated with prolonged, multi-site phosphorylation. PMID:21728354

Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

PubMed

Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

2018-03-28

Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

Direct induction of T lymphocyte-specific gene expression by the mammalian Notch signaling pathway

PubMed Central

Reizis, Boris; Leder, Philip

2002-01-01

The Notch signaling pathway regulates the commitment and early development of T lymphocytes. We studied Notch-mediated induction of the pre-T cell receptor α (pTa) gene, a T-cell-specific transcriptional target of Notch. The pTa enhancer was activated by Notch signaling and contained binding sites for its nuclear effector, CSL. Mutation of the CSL-binding sites abolished enhancer induction by Notch and delayed the up-regulation of pTa transgene expression during T cell lineage commitment. These results show a direct mechanism of stage- and tissue-specific gene induction by the mammalian Notch/CSL signaling pathway. PMID:11825871

Transmutation of human glutathione transferase A2-2 with peroxidase activity into an efficient steroid isomerase.

PubMed

Pettersson, Par L; Johansson, Ann-Sofie; Mannervik, Bengt

2002-08-16

A major goal in protein engineering is the tailor-making of enzymes for specified chemical reactions. Successful attempts have frequently been based on directed molecular evolution involving libraries of random mutants in which variants with desired properties were identified. For the engineering of enzymes with novel functions, it would be of great value if the necessary changes of the active site could be predicted and implemented. Such attempts based on the comparison of similar structures with different substrate selectivities have previously met with limited success. However, the present work shows that the knowledge-based redesign restricted to substrate-binding residues in human glutathione transferase A2-2 can introduce high steroid double-bond isomerase activity into the enzyme originally characterized by glutathione peroxidase activity. Both the catalytic center activity (k(cat)) and catalytic efficiency (k(cat)/K(m)) match the values of the naturally evolved glutathione transferase A3-3, the most active steroid isomerase known in human tissues. The substrate selectivity of the mutated glutathione transferase was changed 7000-fold by five point mutations. This example demonstrates the functional plasticity of the glutathione transferase scaffold as well as the potential of rational active-site directed mutagenesis as a complement to DNA shuffling and other stochastic methods for the redesign of proteins with novel functions.

Environmental and individual PAH exposures near rural natural gas extraction.

PubMed

Paulik, L Blair; Hobbie, Kevin A; Rohlman, Diana; Smith, Brian W; Scott, Richard P; Kincl, Laurel; Haynes, Erin N; Anderson, Kim A

2018-05-29

Natural gas extraction (NGE) has expanded rapidly in the United States in recent years. Despite concerns, there is little information about the effects of NGE on air quality or personal exposures of people living or working nearby. Recent research suggests NGE emits polycyclic aromatic hydrocarbons (PAHs) into air. This study used low-density polyethylene passive samplers to measure concentrations of PAHs in air near active (n = 3) and proposed (n = 2) NGE sites. At each site, two concentric rings of air samplers were placed around the active or proposed well pad location. Silicone wristbands were used to assess personal PAH exposures of participants (n = 19) living or working near the sampling sites. All samples were analyzed for 62 PAHs using GC-MS/MS, and point sources were estimated using the fluoranthene/pyrene isomer ratio. ∑PAH was significantly higher in air at active NGE sites (Wilcoxon rank sum test, p < 0.01). PAHs in air were also more petrogenic (petroleum-derived) at active NGE sites. This suggests that PAH mixtures at active NGE sites may have been affected by direct emissions from petroleum sources at these sites. ∑PAH was also significantly higher in wristbands from participants who had active NGE wells on their properties than from participants who did not (Wilcoxon rank sum test, p < 0.005). There was a significant positive correlation between ∑PAH in participants' wristbands and ∑PAH in air measured closest to participants' homes or workplaces (simple linear regression, p < 0.0001). These findings suggest that living or working near an active NGE well may increase personal PAH exposure. This work also supports the utility of the silicone wristband to assess personal PAH exposure. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Editing of misaligned 3′-termini by an intrinsic 3′–5′ exonuclease activity residing in the PHP domain of a family X DNA polymerase

PubMed Central

Baños, Benito; Lázaro, José M.; Villar, Laurentino; de Vega, Miguel

2008-01-01

Bacillus subtilis gene yshC encodes a family X DNA polymerase (PolXBs), whose biochemical features suggest that it plays a role during DNA repair processes. Here, we show that, in addition to the polymerization activity, PolXBs possesses an intrinsic 3′–5′ exonuclease activity specialized in resecting unannealed 3′-termini in a gapped DNA substrate. Biochemical analysis of a PolXBs deletion mutant lacking the C-terminal polymerase histidinol phosphatase (PHP) domain, present in most of the bacterial/archaeal PolXs, as well as of this separately expressed protein region, allow us to state that the 3′–5′ exonuclease activity of PolXBs resides in its PHP domain. Furthermore, site-directed mutagenesis of PolXBs His339 and His341 residues, evolutionary conserved in the PHP superfamily members, demonstrated that the predicted metal binding site is directly involved in catalysis of the exonucleolytic reaction. The implications of the unannealed 3′-termini resection by the 3′–5′ exonuclease activity of PolXBs in the DNA repair context are discussed. PMID:18776221

Reactivation of oxidized PTP1B and PTEN by Thioredoxin 1

PubMed Central

Schwertassek, Ulla; Haque, Aftabul; Krishnan, Navasona; Greiner, Romy; Weingarten, Lars; Dick, Tobias P.; Tonks, Nicholas K.

2014-01-01

The transient inactivation of protein phosphatases contributes to the efficiency and temporal control of kinase-dependent signal transduction. In particular, members of the protein tyrosine phosphatase family are known to undergo reversible oxidation of their active site cysteine. The thiol oxidation step requires activation of co-localized NADPH oxidases and is mediated by locally produced ROS, in particular H2O2. How oxidized phosphatases are returned to the reduced active state is less well studied. Both major thiol reductive systems, the thioredoxin and the glutathione systems, have been implicated in the reactivation of phosphatases. Here, we show that the protein tyrosine phosphatase PTP1B and the dual-specificity phosphatase PTEN are preferentially reactivated by the thioredoxin system. We show that inducible depletion of TRX1 slows down PTEN re-activation in intact living cells. Finally, using a mechanism-based trapping approach we demonstrate direct thiol disulfide exchange between the active sites of thioredoxin and either phosphatase. The application of thioredoxin trapping mutants represents a complementary approach to direct assays of PTP oxidation in elucidating the significance of redox regulation of PTP function in the control of cell signaling. PMID:24976139

Geophysic data interperetation of Passo della Morte landslide: Eastern Italian Alps

NASA Astrophysics Data System (ADS)

Zoppe', G.; Costa, G.; Marcato, G.; Forte, E.

2012-04-01

The Passo della Morte block-slide covers a relative large area in the Carnic Alps, along the left side of the Tagliamento River, between Forni di Sotto and Ampezzo (N-E of Italy). The high seismicity and the presence of the landslide increase the risk associated to the interest area. Moreover the large volume of material involved in the landslide (a few million of cubic meters), the presence of important infrastructure such as the road and two tunnels which cross the landslide, as well as the presence of the Tagliamento River that flow at the foot of the landslide, make the area very vulnerable. This study concerns with the western part of the Deep Seated Gravitational Slope Deformation (DSGSD). It focuses on the potential instability of a rock slope (crossed by road tunnels) and its connection with the DSGSD activity. The main objectives of this study are: monitoring the rock mass movement, studying the seismic site effect and defining the stratigraphic and geological characteristics of involved materials. Two vibration sensors have been installed inside the potential landslide: a short-period seismometer and a piezoelectric transducer. The microseismic activity recorded by the sensors has been analyzed, with particular regard to periods characterized by rapid changes in recorded seismic signals, and then correlated with the precipitation trend to evaluate the existence of a possible correlation between these phenomena. The microseismic activity study has highlighted the existence of a close link between microseisms and acoustic emissions recorded respectively by the seismometer and by the piezoelectric transducer. In addition, the comparison with the rainfall pattern has shown a direct relationship between different rainfall events and the sharp increase of microseismic activity detected by the two instruments. The correlation is good, even if acoustic emissions appear to be more sensitive than microseisms to short duration and low intensity rainfall events. The seismic site effects and the directivity in seismic site response of the rock mass have been investigated through the use of Nakamura (1989) method. In particular have been estimated the resonance frequencies and the polarization directions of seismic energy in three selected sites. All sites have shown a clear evidence of polarization in the direction of N/NW-S/SE and E/NE-W/SW, compatible with the maximum slope inclination and with the limestone stratification direction outcropping in this area. In order to define the stratigraphic and geological characteristics of the materials involved, have been performed a GPR investigation and an active seismic survey. The first has been useful to identify vertical and horizontal variations of the lithotypes present, most associated with different degrees of rock fracturing and fluid content. The seismic investigation has permitted to identify a reflective layer and to determine the propagation velocity of compression and shear waves of the two layers found.

Understanding Which Residues of the Active Site and Loop Structure of a Tyrosine Aminomutase Define Its Mutase and Lyase Activities.

PubMed

Attanayake, Gayanthi; Walter, Tyler; Walker, Kevin D

2018-05-30

Site-directed mutations and substrate analogues were used to gain insights into the branch-point reaction of the 3,5-dihydro-5-methylidene-4 H-imidazol-4-one (MIO)-tyrosine aminomutase from Oryza sativa ( OsTAM). Exchanging the active residues of OsTAM (Y125C/N446K) for those in a phenylalanine aminomutase TcPAM altered its substrate specificity from tyrosine to phenylalanine. The aminomutase mechanism of OsTAM surprisingly changed almost exclusively to that of an ammonia lyase making cinnamic acid (>95%) over β-phenylalanine [Walter, T., et al. (2016) Biochemistry 55, 3497-3503]. We hypothesized that the missing electronics or sterics on the aryl ring of the phenylalanine substrate, compared with the sizable electron-donating hydroxyl of the natural tyrosine substrate, influenced the unexpected lyase reactivity of the OsTAM mutant. The double mutant was incubated with 16 α-phenylalanine substituent analogues of varying electronic strengths and sterics. The mutant converted each analogue principally to its acrylate with ∼50% conversion of the p-Br substrate, making only a small amount of the β-amino acid. The inner loop structure over the entrance to the active site was also mutated to assess how the lyase and mutase activities are affected. An OsTAM loop mutant, matching the loop residues of TcPAM, still chiefly made >95% of the acrylate from each substrate. A combined active site:loop mutant was most reactive but remained a lyase, making 10-fold more acrylates than other mutants did. While mutations within the active site changed the substrate specificity of OsTAM, continued exploration is needed to fully understand the interplay among the inner loop, the substrate, and the active site in defining the mutase and lyase activities.

Actin filaments target the oligomeric maturation of the dynamin GTPase Drp1 to mitochondrial fission sites

PubMed Central

Ji, Wei-ke; Hatch, Anna L; Merrill, Ronald A; Strack, Stefan; Higgs, Henry N

2015-01-01

While the dynamin GTPase Drp1 plays a critical role during mitochondrial fission, mechanisms controlling its recruitment to fission sites are unclear. A current assumption is that cytosolic Drp1 is recruited directly to fission sites immediately prior to fission. Using live-cell microscopy, we find evidence for a different model, progressive maturation of Drp1 oligomers on mitochondria through incorporation of smaller mitochondrially-bound Drp1 units. Maturation of a stable Drp1 oligomer does not forcibly lead to fission. Drp1 oligomers also translocate directionally along mitochondria. Ionomycin, a calcium ionophore, causes rapid mitochondrial accumulation of actin filaments followed by Drp1 accumulation at the fission site, and increases fission rate. Inhibiting actin polymerization, myosin IIA, or the formin INF2 reduces both un-stimulated and ionomycin-induced Drp1 accumulation and mitochondrial fission. Actin filaments bind purified Drp1 and increase GTPase activity in a manner that is synergistic with the mitochondrial protein Mff, suggesting a role for direct Drp1/actin interaction. We propose that Drp1 is in dynamic equilibrium on mitochondria in a fission-independent manner, and that fission factors such as actin filaments target productive oligomerization to fission sites. DOI: http://dx.doi.org/10.7554/eLife.11553.001 PMID:26609810

On the suitability of refractory bricks from a mediaeval brass melting and working site near Dinant (Belgium) as geomagnetic field recorders

NASA Astrophysics Data System (ADS)

Hus, J.; Geeraerts, R.; Plumier, J.

2004-11-01

Directional field archaeomagnetic data from two oval shaped kilns, of which still one was lined with refractory bricks, unearthed in a brass melting and working site in Bouvignes-sur-Meuse in Belgium, confirm the archaeologic dating as 14-15th century A.D. for the main site activities. The archaeomagnetic dates, obtained using reference secular variation curves of the geomagnetic field direction for France and Great Britain, lead to better time constraints for the cessation of kiln operations. Refractory bricks (firebricks) that are used for their chemical and thermal properties, and in particular for their resistance to high temperatures and temperature changes, are not unusual in metal melting and working sites. The firebricks from the examined site are coarse-grained and very porous inside but possess a very stable remanent magnetisation and revealed to be suitable magnetic field recorders. Although the firebricks have a single-component remanent magnetization, non-random deviations in remanence direction in function of the relative azimuth from the centre of the kiln or with the position of the bricks in the kiln wall, were observed. Several hypotheses for the origin of the deviations were considered: anisotropy, refraction, magnetic interaction, magnetic field distortion and the presence of a local disturbing magnetic source.

The PBX1 lupus susceptibility gene regulates CD44 expression

PubMed Central

Niu, Yuxin; Sengupta, Mayami; Titov, Anton A.; Choi, Seung-Chul; Morel, Laurence

2017-01-01

PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4+ T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and show that the lupus-associated isoform PBX1-d has unique molecular functions. PMID:28257976

Introducing transgalactosylation activity into a family 42 β-galactosidase.

PubMed

Strazzulli, Andrea; Cobucci-Ponzano, Beatrice; Carillo, Sara; Bedini, Emiliano; Corsaro, Maria Michela; Pocsfalvi, Gabriella; Withers, Stephen G; Rossi, Mosè; Moracci, Marco

2017-05-01

Chemo-enzymatic synthesis of oligosaccharides exploits the diversity of glycosidases and their ability to promote transglycosylation reactions in parallel with hydrolysis. Methods to increase the transglycosylation/hydrolysis ratio include site-directed mutagenesis and medium modification. The former approach was successful in several cases and has provided the best synthetic yields with glycosynthases-mutants at the catalytic nucleophile position that promote transglycosylation with high efficiency, but do not hydrolyze the oligosaccharide products. Several glycosidases have proven recalcitrant to this conversion, thus alternative methods to increase the transglycosylation/hydrolysis ratio by mutation would be very useful. Here we show that a mutant of a β-galactosidase from Alicyclobacillus acidocaldarius in an invariant residue in the active site of the enzymes of this family (glutamic acid 361) carries out efficient transglycosylation reactions on different acceptors only in the presence of external ions with yields up to 177-fold higher than that of the wild type. This is the first case in which sodium azide and sodium formate in combination with site-directed mutagenesis have been used to introduce transglycosylation activity into a glycosidase. These observations will hopefully guide further efforts to generate useful synthases. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Blood tolerant laccase by directed evolution.

PubMed

Mate, Diana M; Gonzalez-Perez, David; Falk, Magnus; Kittl, Roman; Pita, Marcos; De Lacey, Antonio L; Ludwig, Roland; Shleev, Sergey; Alcalde, Miguel

2013-02-21

High-redox potential laccases are powerful biocatalysts with a wide range of applications in biotechnology. We have converted a thermostable laccase from a white-rot fungus into a blood tolerant laccase. Adapting the fitness of this laccase to the specific composition of human blood (above neutral pH, high chloride concentration) required several generations of directed evolution in a surrogate complex blood medium. Our evolved laccase was tested in both human plasma and blood, displaying catalytic activity while retaining a high redox potential at the T1 copper site. Mutations introduced in the second coordination sphere of the T1 site shifted the pH activity profile and drastically reduced the inhibitory effect of chloride. This proof of concept that laccases can be adapted to function in extreme conditions opens an array of opportunities for implantable nanobiodevices, chemical syntheses, and detoxification. Copyright © 2013 Elsevier Ltd. All rights reserved.

Testing a structural model for viral DNA packaging motor function by optical tweezers measurements, site directed mutagenesis, and molecular dynamics calculations

NASA Astrophysics Data System (ADS)

Keller, Nicholas A.; Migliori, Amy D.; Arya, Gaurav; Rao, Venigalla B.; Smith, Douglas E.

2013-09-01

Many double-stranded DNA viruses employ a molecular motor to package DNA into preformed capsid shells. Based on structures of phage T4 motor proteins determined by X-ray crystallography and cryo-electron microscopy, Rao, Rossmann and coworkers recently proposed a structural model for motor function. They proposed that DNA is ratcheted by a large conformational change driven by electrostatic interactions between charged residues at an interface between two globular domains of the motor protein. We have conducted experiments to test this model by studying the effect on packaging under applied load of site-directed changes altering these residues. We observe significant impairment of packaging activity including reductions in packaging rate, percent time packaging, and time active under high load. We show that these measured impairments correlate well with alterations in free energies associated with the conformational change predicted by molecular dynamics simulations.

Structure-function studies on the active site of the coelenterazine-dependent luciferase from Renilla.

PubMed

Woo, Jongchan; Howell, Matthew H; von Arnim, Albrecht G

2008-04-01

Renilla luciferase (RLUC) is a versatile tool for gene expression assays and in vivo biosensor applications, but its catalytic mechanism remains to be elucidated. RLUC is evolutionarily related to the alpha/beta hydrolase family. Its closest known homologs are bacterial dehalogenases, raising the question of how a protein with a hydrolase fold can function as a decarboxylating oxygenase. Molecular docking simulations with the coelenterazine substrate against an RLUC homology model as well as a recently determined RLUC crystal structure were used to build hypotheses to identify functionally important residues, which were subsequently tested by site-directed mutagenesis, heterologous expression, and bioluminescence emission spectroscopy. The data highlighted two triads of residues that are critical for catalysis. The putative catalytic triad residues D120, E144, and H285 bear only limited resemblance to those found in the active site of aequorin, a coelenterazine-utilizing photoprotein, suggesting that the reaction scheme employed by RLUC differs substantially from the one established for aequorin. The role of H285 in catalysis was further supported by inhibition using diethylpyrocarbonate. Multiple substitutions of N53, W121, and P220--three other residues implicated in product binding in the homologous dehalogenase Sphingomonas LinB--also supported their involvement in catalysis. Together with luminescence spectra, our data lead us to propose that the conserved catalytic triad of RLUC is directly involved in the decarboxylation reaction of coelenterazine to produce bioluminescence, while the other active-site residues are used for binding of the substrate.

Roles of s3 site residues of nattokinase on its activity and substrate specificity.

PubMed

Wu, Shuming; Feng, Chi; Zhong, Jin; Huan, Liandong

2007-09-01

Nattokinase (Subtilisin NAT, NK) is a bacterial serine protease with high fibrinolytic activity. To probe their roles on protease activity and substrate specificity, three residues of S3 site (Gly(100), Ser(101) and Leu(126)) were mutated by site-directed mutagenesis. Kinetics parameters of 20 mutants were measured using tetrapeptides as substrates, and their fibrinolytic activities were determined by fibrin plate method. Results of mutation analysis showed that Gly(100) and Ser(101) had reverse steric and electrostatic effects. Residues with bulky or positively charged side chains at position 100 decreased the substrate binding and catalytic activity drastically, while residues with the same characters at position 101 could obviously enhance protease and fibrinolytic activity of NK. Mutation of Leu(126) might impair the structure of the active cleft and drastically decreased the activity of NK. Kinetics studies of the mutants showed that S3 residues were crucial to keep protease activity while they moderately affected substrate specificity of NK. The present study provided some original insight into the P3-S3 interaction in NK and other subtilisins, as well as showed successful protein engineering cases to improve NK as a potential therapeutic agent.

Septal cholinergic neuromodulation tunes the astrocyte-dependent gating of hippocampal NMDA receptors to wakefulness

PubMed Central

Papouin, Thomas; Dunphy, Jaclyn; Tolman, Michaela; Dineley, Kelly T.; Haydon, Philip G.

2017-01-01

Summary The activation of the N-methyl D-aspartate receptor (NMDAR) is controlled by a glutamate-binding site and a distinct, independently regulated, co-agonist-binding site. In most brain regions, the NMDAR co-agonist is the astrocyte-derived gliotransmitter D-serine. We found that D-serine levels oscillate in mouse hippocampus as a function of wakefulness, in vitro and in vivo. This causes a full saturation of the NMDAR co-agonist site in the dark (active)-phase that dissipates to sub-saturating levels during the light (sleep)-phase, and influences learning performance throughout the day. We demonstrate that hippocampal astrocytes sense the wakefulness-dependent activity of septal cholinergic fibers through the α7-nicotinic acetylcholine receptor (α7nAChR), whose activation drives D-serine release. We conclude that astrocytes tune the gating of synaptic NMDARs to the vigilance state and demonstrate that this is directly relevant to schizophrenia, a disorder characterized by NMDAR and cholinergic hypofunctions. Indeed, bypassing cholinergic activity with a clinically-tested α7nAChR agonist successfully enhances NMDARs activation. PMID:28479102

The role of an active site Mg(2+) in HDV ribozyme self-cleavage: insights from QM/MM calculations.

PubMed

Mlýnský, Vojtěch; Walter, Nils G; Šponer, Jiří; Otyepka, Michal; Banáš, Pavel

2015-01-07

The hepatitis delta virus (HDV) ribozyme is a catalytic RNA motif embedded in the human pathogenic HDV RNA. It catalyzes self-cleavage of its sugar-phosphate backbone with direct participation of the active site cytosine C75. Biochemical and structural data support a general acid role of C75. Here, we used hybrid quantum mechanical/molecular mechanical (QM/MM) calculations to probe the reaction mechanism and changes in Gibbs energy along the ribozyme's reaction pathway with an N3-protonated C75H(+) in the active site, which acts as the general acid, and a partially hydrated Mg(2+) ion with one deprotonated, inner-shell coordinated water molecule that acts as the general base. We followed eight reaction paths with a distinct position and coordination of the catalytically important active site Mg(2+) ion. For six of them, we observed feasible activation barriers ranging from 14.2 to 21.9 kcal mol(-1), indicating that the specific position of the Mg(2+) ion in the active site is predicted to strongly affect the kinetics of self-cleavage. The deprotonation of the U-1(2'-OH) nucleophile and the nucleophilic attack of the resulting U-1(2'-O(-)) on the scissile phosphodiester are found to be separate steps, as deprotonation precedes the nucleophilic attack. This sequential mechanism of the HDV ribozyme differs from the concerted nucleophilic activation and attack suggested for the hairpin ribozyme. We estimate the pKa of the U-1(2'-OH) group to range from 8.8 to 11.2, suggesting that it is lowered by several units from that of a free ribose, comparable to and most likely smaller than the pKa of the solvated active site Mg(2+) ion. Our results thus support the notion that the structure of the HDV ribozyme, and particularly the positioning of the active site Mg(2+) ion, facilitate deprotonation and activation of the 2'-OH nucleophile.

Constitutively active mutants of the alpha 1B-adrenergic receptor: role of highly conserved polar amino acids in receptor activation.

PubMed Central

Scheer, A; Fanelli, F; Costa, T; De Benedetti, P G; Cotecchia, S

1996-01-01

Site-directed mutagenesis and molecular dynamics simulations of the alpha 1B-adrenergic receptor (AR) were combined to explore the potential molecular changes correlated with the transition from R (inactive state) to R (active state). Using molecular dynamics analysis we compared the structural/dynamic features of constitutively active mutants with those of the wild type and of an inactive alpha 1B-AR to build a theoretical model which defines the essential features of R and R. The results of site-directed mutagenesis were in striking agreement with the predictions of the model supporting the following hypothesis. (i) The equilibrium between R and R depends on the equilibrium between the deprotonated and protonated forms, respectively, of D142 of the DRY motif. In fact, replacement of D142 with alanine confers high constitutive activity to the alpha 1B-AR. (ii) The shift of R143 of the DRY sequence out of a conserved 'polar pocket' formed by N63, D91, N344 and Y348 is a feature common to all the active structures, suggesting that the role of R143 is fundamental for mediating receptor activation. Disruption of these intramolecular interactions by replacing N63 with alanine constitutively activates the alpha 1B-AR. Our findings might provide interesting generalities about the activation process of G protein-coupled receptors. Images PMID:8670860

Ternary structure reveals mechanism of a membrane diacylglycerol kinase

PubMed Central

Li, Dianfan; Stansfeld, Phillip J.; Sansom, Mark S. P.; Keogh, Aaron; Vogeley, Lutz; Howe, Nicole; Lyons, Joseph A.; Aragao, David; Fromme, Petra; Fromme, Raimund; Basu, Shibom; Grotjohann, Ingo; Kupitz, Christopher; Rendek, Kimberley; Weierstall, Uwe; Zatsepin, Nadia A.; Cherezov, Vadim; Liu, Wei; Bandaru, Sateesh; English, Niall J.; Gati, Cornelius; Barty, Anton; Yefanov, Oleksandr; Chapman, Henry N.; Diederichs, Kay; Messerschmidt, Marc; Boutet, Sébastien; Williams, Garth J.; Marvin Seibert, M.; Caffrey, Martin

2015-01-01

Diacylglycerol kinase catalyses the ATP-dependent conversion of diacylglycerol to phosphatidic acid in the plasma membrane of Escherichia coli. The small size of this integral membrane trimer, which has 121 residues per subunit, means that available protein must be used economically to craft three catalytic and substrate-binding sites centred about the membrane/cytosol interface. How nature has accomplished this extraordinary feat is revealed here in a crystal structure of the kinase captured as a ternary complex with bound lipid substrate and an ATP analogue. Residues, identified as essential for activity by mutagenesis, decorate the active site and are rationalized by the ternary structure. The γ-phosphate of the ATP analogue is positioned for direct transfer to the primary hydroxyl of the lipid whose acyl chain is in the membrane. A catalytic mechanism for this unique enzyme is proposed. The active site architecture shows clear evidence of having arisen by convergent evolution. PMID:26673816

Ternary structure reveals mechanism of a membrane diacylglycerol kinase

NASA Astrophysics Data System (ADS)

Li, Dianfan; Stansfeld, Phillip J.; Sansom, Mark S. P.; Keogh, Aaron; Vogeley, Lutz; Howe, Nicole; Lyons, Joseph A.; Aragao, David; Fromme, Petra; Fromme, Raimund; Basu, Shibom; Grotjohann, Ingo; Kupitz, Christopher; Rendek, Kimberley; Weierstall, Uwe; Zatsepin, Nadia A.; Cherezov, Vadim; Liu, Wei; Bandaru, Sateesh; English, Niall J.; Gati, Cornelius; Barty, Anton; Yefanov, Oleksandr; Chapman, Henry N.; Diederichs, Kay; Messerschmidt, Marc; Boutet, Sébastien; Williams, Garth J.; Marvin Seibert, M.; Caffrey, Martin

2015-12-01

Diacylglycerol kinase catalyses the ATP-dependent conversion of diacylglycerol to phosphatidic acid in the plasma membrane of Escherichia coli. The small size of this integral membrane trimer, which has 121 residues per subunit, means that available protein must be used economically to craft three catalytic and substrate-binding sites centred about the membrane/cytosol interface. How nature has accomplished this extraordinary feat is revealed here in a crystal structure of the kinase captured as a ternary complex with bound lipid substrate and an ATP analogue. Residues, identified as essential for activity by mutagenesis, decorate the active site and are rationalized by the ternary structure. The γ-phosphate of the ATP analogue is positioned for direct transfer to the primary hydroxyl of the lipid whose acyl chain is in the membrane. A catalytic mechanism for this unique enzyme is proposed. The active site architecture shows clear evidence of having arisen by convergent evolution.

Microstructure-scaled active sites imaging of a solid oxide fuel cell composite cathode

NASA Astrophysics Data System (ADS)

Nagasawa, Tsuyoshi; Hanamura, Katsunori

2017-11-01

Active sites for oxygen reduction reaction in strontium-doped lanthanum manganite (LSM)/scandia-stabilized zirconia (ScSZ) composite cathode of solid oxide fuel cell (SOFC) is visualized in microstructure scale by oxygen isotope labeling. In order to quench a reaction, a SOFC power generation equipment with a nozzle for direct helium gas impinging jet to the cell is prepared. A typical electrolyte-supported cell is operated by supplying 18O2 at 1073 K and abruptly quenched to room temperature. During the quench, the temperature of the cell is decreased from 1073 K to 673 K in 1 s. The 18O concentration distribution in the cross section of the quenched cathode is obtained by secondary ion mass spectrometry (SIMS) with a spatial resolution of 50 nm. The obtained 18O mapping gives the first visualization of highly distributed active sites in the composite cathode both in macroscopic and particle scales.

Evolution of a designed retro-aldolase leads to complete active site remodeling

PubMed Central

Giger, Lars; Caner, Sami; Obexer, Richard; Kast, Peter; Baker, David; Ban, Nenad; Hilvert, Donald

2013-01-01

Evolutionary advances are often fueled by unanticipated innovation. Directed evolution of a computationally designed enzyme suggests that dramatic molecular changes can also drive the optimization of primitive protein active sites. The specific activity of an artificial retro-aldolase was boosted >4,400 fold by random mutagenesis and screening, affording catalytic efficiencies approaching those of natural enzymes. However, structural and mechanistic studies reveal that the engineered catalytic apparatus, consisting of a reactive lysine and an ordered water molecule, was unexpectedly abandoned in favor of a new lysine residue in a substrate binding pocket created during the optimization process. Structures of the initial in silico design, a mechanistically promiscuous intermediate, and one of the most evolved variants highlight the importance of loop mobility and supporting functional groups in the emergence of the new catalytic center. Such internal competition between alternative reactive sites may have characterized the early evolution of many natural enzymes. PMID:23748672

Activation of Latent Dihydroorotase from Aquifex aeolicus by Pressure*

PubMed Central

Hervé, Guy; Evans, Hedeel Guy; Fernado, Roshini; Patel, Chandni; Hachem, Fatme; Evans, David R.

2017-01-01

Elevated hydrostatic pressure was used to probe conformational changes of Aquifex aeolicus dihydroorotase (DHO), which catalyzes the third step in de novo pyrimidine biosynthesis. The isolated protein, a 45-kDa monomer, lacks catalytic activity but becomes active upon formation of a dodecameric complex with aspartate transcarbamoylase (ATC). X-ray crystallographic studies of the isolated DHO and of the complex showed that association induces several major conformational changes in the DHO structure. In the isolated DHO, a flexible loop occludes the active site blocking the access of substrates. The loop is mostly disordered but is tethered to the active site region by several electrostatic and hydrogen bonds. This loop becomes ordered and is displaced from the active site upon formation of DHO-ATC complex. The application of pressure to the complex causes its time-dependent dissociation and the loss of both DHO and ATC activities. Pressure induced irreversible dissociation of the obligate ATC trimer, and as a consequence the DHO is also inactivated. However, moderate hydrostatic pressure applied to the isolated DHO subunit mimics the complex formation and reversibly activates the isolated subunit in the absence of ATC, suggesting that the loop has been displaced from the active site. This effect of pressure is explained by the negative volume change associated with the disruption of ionic interactions and exposure of ionized amino acids to the solvent (electrostriction). The interpretation that the loop is relocated by pressure was validated by site-directed mutagenesis and by inhibition by small peptides that mimic the loop residues. PMID:27746403

A Measure of the Broad Substrate Specificity of Enzymes Based on ‘Duplicate’ Catalytic Residues

PubMed Central

Chakraborty, Sandeep; Ásgeirsson, Bjarni; Rao, Basuthkar J.

2012-01-01

The ability of an enzyme to select and act upon a specific class of compounds with unerring precision and efficiency is an essential feature of life. Simultaneously, these enzymes often catalyze the reaction of a range of similar substrates of the same class, and also have promiscuous activities on unrelated substrates. Previously, we have established a methodology to quantify promiscuous activities in a wide range of proteins. In the current work, we quantitatively characterize the active site for the ability to catalyze distinct, yet related, substrates (BRASS). A protein with known structure and active site residues provides the framework for computing ‘duplicate’ residues, each of which results in slightly modified replicas of the active site scaffold. Such spatial congruence is supplemented by Finite difference Poisson Boltzmann analysis which filters out electrostatically unfavorable configurations. The congruent configurations are used to compute an index (BrassIndex), which reflects the broad substrate profile of the active site. We identify an acetylhydrolase and a methyltransferase as having the lowest and highest BrassIndex, respectively, from a set of non-homologous proteins extracted from the Catalytic Site Atlas. The acetylhydrolase, a regulatory enzyme, is known to be highly specific for platelet-activating factor. In the methyltransferase (PDB: 1QAM), various combinations of glycine (Gly38/40/42), asparagine (Asn101/11) and glutamic acid (Glu59/36) residues having similar spatial and electrostatic profiles with the specified scaffold (Gly38, Asn101 and Glu59) exemplifies the broad substrate profile such an active site may provide. ‘Duplicate’ residues identified by relaxing the spatial and/or electrostatic constraints can be the target of directed evolution methodologies, like saturation mutagenesis, for modulating the substrate specificity of proteins. PMID:23166637

Zn-BTC MOFs with active metal sites synthesized via a structure-directing approach for highly efficient carbon conversion.

PubMed

Huang, Xianqiang; Chen, Yifa; Lin, Zhengguo; Ren, Xiaoqian; Song, Yuna; Xu, Zhenzhu; Dong, Xinmei; Li, Xingguo; Hu, Changwen; Wang, Bo

2014-03-11

Three zinc-trimesic acid (Zn-BTC) MOFs, BIT-101, BIT-102 and BIT-103, have been synthesized via a structure-directing strategy. Interestingly, BIT-102 and -103 exhibit extraordinary catalytic performance (up to Conv. 100% and Sele. 95.2%) in the cycloaddition of CO2 under solvent- and halogen-free conditions without any additives or co-catalysts.

Analysis of the Binding Moiety Mediating the Interaction between Monocarboxylate Transporters and Carbonic Anhydrase II*

PubMed Central

Noor, Sina Ibne; Dietz, Steffen; Heidtmann, Hella; Boone, Christopher D.; McKenna, Robert; Deitmer, Joachim W.; Becker, Holger M.

2015-01-01

Proton-coupled monocarboxylate transporters (MCTs) mediate the exchange of high energy metabolites like lactate between different cells and tissues. We have reported previously that carbonic anhydrase II augments transport activity of MCT1 and MCT4 by a noncatalytic mechanism, while leaving transport activity of MCT2 unaltered. In the present study, we combined electrophysiological measurements in Xenopus oocytes and pulldown experiments to analyze the direct interaction between carbonic anhydrase II (CAII) and MCT1, MCT2, and MCT4, respectively. Transport activity of MCT2-WT, which lacks a putative CAII-binding site, is not augmented by CAII. However, introduction of a CAII-binding site into the C terminus of MCT2 resulted in CAII-mediated facilitation of MCT2 transport activity. Interestingly, introduction of three glutamic acid residues alone was not sufficient to establish a direct interaction between MCT2 and CAII, but the cluster had to be arranged in a fashion that allowed access to the binding moiety in CAII. We further demonstrate that functional interaction between MCT4 and CAII requires direct binding of the enzyme to the acidic cluster 431EEE in the C terminus of MCT4 in a similar fashion as previously shown for binding of CAII to the cluster 489EEE in the C terminus of MCT1. In CAII, binding to MCT1 and MCT4 is mediated by a histidine residue at position 64. Taken together, our results suggest that facilitation of MCT transport activity by CAII requires direct binding between histidine 64 in CAII and a cluster of glutamic acid residues in the C terminus of the transporter that has to be positioned in surroundings that allow access to CAII. PMID:25561737

The transcription factor p53: Not a repressor, solely an activator

PubMed Central

Fischer, Martin; Steiner, Lydia; Engeland, Kurt

2014-01-01

The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

Insights into GATA-1 Mediated Gene Activation versus Repression via Genome-wide Chromatin Occupancy Analysis

PubMed Central

Yu, Ming; Riva, Laura; Xie, Huafeng; Schindler, Yocheved; Moran, Tyler B.; Cheng, Yong; Yu, Duonan; Hardison, Ross; Weiss, Mitchell J; Orkin, Stuart H.; Bernstein, Bradley E.; Fraenkel, Ernest; Cantor, Alan B.

2009-01-01

Summary The transcription factor GATA-1 is required for terminal erythroid maturation and functions as an activator or repressor depending on gene context. Yet its in vivo site selectivity and ability to distinguish between activated versus repressed genes remain incompletely understood. In this study, we performed GATA-1 ChIP-seq in erythroid cells and compared it to GATA-1 induced gene expression changes. Bound and differentially expressed genes contain a greater number of GATA binding motifs, a higher frequency of palindromic GATA sites, and closer occupancy to the transcriptional start site versus non-differentially expressed genes. Moreover, we show that the transcription factor Zbtb7a occupies GATA-1 bound regions of some direct GATA-1 target genes, that the presence of SCL/TAL1 helps distinguish transcriptional activation versus repression, and that Polycomb Repressive Complex 2 (PRC2) is involved in epigenetic silencing of a subset of GATA-1 repressed genes. These data provide insights into GATA-1 mediated gene regulation in vivo. PMID:19941827

Crystallographic structure of a small molecule SIRT1 activator-enzyme complex

NASA Astrophysics Data System (ADS)

Dai, Han; Case, April W.; Riera, Thomas V.; Considine, Thomas; Lee, Jessica E.; Hamuro, Yoshitomo; Zhao, Huizhen; Jiang, Yong; Sweitzer, Sharon M.; Pietrak, Beth; Schwartz, Benjamin; Blum, Charles A.; Disch, Jeremy S.; Caldwell, Richard; Szczepankiewicz, Bruce; Oalmann, Christopher; Yee Ng, Pui; White, Brian H.; Casaubon, Rebecca; Narayan, Radha; Koppetsch, Karsten; Bourbonais, Francis; Wu, Bo; Wang, Junfeng; Qian, Dongming; Jiang, Fan; Mao, Cheney; Wang, Minghui; Hu, Erding; Wu, Joe C.; Perni, Robert B.; Vlasuk, George P.; Ellis, James L.

2015-07-01

SIRT1, the founding member of the mammalian family of seven NAD+-dependent sirtuins, is composed of 747 amino acids forming a catalytic domain and extended N- and C-terminal regions. We report the design and characterization of an engineered human SIRT1 construct (mini-hSIRT1) containing the minimal structural elements required for lysine deacetylation and catalytic activation by small molecule sirtuin-activating compounds (STACs). Using this construct, we solved the crystal structure of a mini-hSIRT1-STAC complex, which revealed the STAC-binding site within the N-terminal domain of hSIRT1. Together with hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis using full-length hSIRT1, these data establish a specific STAC-binding site and identify key intermolecular interactions with hSIRT1. The determination of the interface governing the binding of STACs with human SIRT1 facilitates greater understanding of STAC activation of this enzyme, which holds significant promise as a therapeutic target for multiple human diseases.

Retrotransposon Tf1 is targeted to pol II promoters by transcription activators

PubMed Central

Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.

2008-01-01

SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330

Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.

PubMed

Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L

2008-04-11

The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.

Low Dose Sarin Leads To Murine Cardiac Dysfunction

DTIC Science & Technology

2010-03-01

work directly supported a grant held by Wright State University, grant # GW060050, from the United States Army Medical Research Acquisition Activity ...GB), acts as an irreversible AChE inhibitor. Sarin reacts with the serine hydroxyl residue in the active site of AChE to form a phosphate or...United States Air Force has become increasingly engaged with terrorist groups and other elusive enemies. As these activities increase, the potential for

Considering Traditional Ecological Knowledge (TEK) During the Cleanup Process

EPA Pesticide Factsheets

This memorandum provides direction to improve the decision-making process as it relates to site assessment, characterization, and cleanup activities, to ensure EPA's Office of Land and Emergency Management is considering TEK when tribes provide it to EPA.

Cyberhunt.

ERIC Educational Resources Information Center

Mills, Chris

2001-01-01

Presents an online activity designed to teach middle- and upper-level elementary school students about the skeletal system. Students are given several questions about the human skeleton, then directed to several online science sites to find the answers. A student reproducible page is included. (SM)

NMR Crystallography of Enzyme Active Sites: Probing Chemically-Detailed, Three-Dimensional Structure in Tryptophan Synthase

PubMed Central

Dunn, Michael F.

2013-01-01

Conspectus NMR crystallography – the synergistic combination of X-ray diffraction, solid-state NMR spectroscopy, and computational chemistry – offers unprecedented insight into three-dimensional, chemically-detailed structure. From its initial role in refining diffraction data of organic and inorganic solids, NMR crystallography is now being developed for application to active sites in biomolecules, where it reveals chemically-rich detail concerning the interactions between enzyme site residues and the reacting substrate that is not achievable when X-ray, NMR, or computational methodologies are applied in isolation. For example, typical X-ray crystal structures (1.5 to 2.5 Å resolution) of enzyme-bound intermediates identify possible hydrogen-bonding interactions between site residues and substrate, but do not directly identify the protonation state of either. Solid-state NMR can provide chemical shifts for selected atoms of enzyme-substrate complexes, but without a larger structural framework in which to interpret them, only empirical correlations with local chemical structure are possible. Ab initio calculations and molecular mechanics can build models for enzymatic processes, but rely on chemical details that must be specified. Together, however, X-ray diffraction, solid-state NMR spectroscopy, and computational chemistry can provide consistent and testable models for structure and function of enzyme active sites: X-ray crystallography provides a coarse framework upon which models of the active site can be developed using computational chemistry; these models can be distinguished by comparison of their calculated NMR chemical shifts with the results of solid-state NMR spectroscopy experiments. Conceptually, each technique is a puzzle piece offering a generous view of the big picture. Only when correctly pieced together, however, can they reveal the big picture at highest resolution. In this Account, we detail our first steps in the development of NMR crystallography for application to enzyme catalysis. We begin with a brief introduction to NMR crystallography and then define the process that we have employed to probe the active site in the β-subunit of tryptophan synthase with unprecedented atomic-level resolution. This approach has resulted in a novel structural hypothesis for the protonation state of the quinonoid intermediate in tryptophan synthase and its surprising role in directing the next step in the catalysis of L-Trp formation. PMID:23537227

Site-directed mutagenesis of serine 158 demonstrates its role in spinach leaf sucrose-phosphate synthase modulation

NASA Technical Reports Server (NTRS)

Toroser, D.; McMichael, R. Jr; Krause, K. P.; Kurreck, J.; Sonnewald, U.; Stitt, M.; Huber, S. C.; Davies, E. (Principal Investigator)

1999-01-01

Site-directed mutagenesis of spinach sucrose-phosphate synthase (SPS) was performed to investigate the role of Ser158 in the modulation of spinach leaf SPS. Tobacco plants expressing the spinach wild-type (WT), S158A, S158T and S157F/S158E SPS transgenes were produced. Expression of transgenes appeared not to reduce expression of the tobacco host SPS. SPS activity in the WT and the S158T SPS transgenics showed light/dark modulation, whereas the S158A and S157F/S158E mutants were not similarly light/dark modulated: the S158A mutant enzyme was not inactivated in the dark, and the S157F/S158E was not activated in the light. The inability to modulate the activity of the S158A mutant enzyme by protein phosphorylation was demonstrated in vitro. The WT spinach enzyme immunopurified from dark transgenic tobacco leaves had a low initial activation state, and could be activated by PP2A and subsequently inactivated by SPS-kinase plus ATP. Rapid purification of the S158A mutant enzyme from dark leaves of transgenic plants using spinach-specific monoclonal antibodies yielded enzyme that had a high initial activation state, and pre-incubation with leaf PP2A or ATP plus SPS-kinase (the PKIII enzyme) caused little modulation of activity. The results demonstrate the regulatory significance of Ser158 as the major site responsible for dark inactivation of spinach SPS in vivo, and indicate that the significance of phosphorylation is the introduction of a negative charge at the Ser158 position.

A macroinvertebrate assessment of Ozark streams located in lead-zinc mining areas of the Viburnum Trend in southeastern Missouri, USA

USGS Publications Warehouse

Poulton, Barry C.; Allert, Ann L.; Besser, John M.; Schmitt, Christopher J.; Brumbaugh, William G.; Fairchild, James F.

2010-01-01

The Viburnum Trend lead-zinc mining subdistrict is located in the southeast Missouri portion of the Ozark Plateau. In 2003 and 2004, we assessed the ecological effects of mining in several watersheds in the region. We included macroinvertebrate surveys, habitat assessments, and analysis of metals in sediment, pore water, and aquatic biota. Macroinvertebrates were sampled at 21 sites to determine aquatic life impairment status (full, partial, or nonsupport) and relative biotic condition scores. Macroinvertebrate biotic condition scores were significantly correlated with cadmium, nickel, lead, zinc, and specific conductance in 2003 (r = -0.61 to -0.68) and with cadmium, lead, and pore water toxic units in 2004 (r = -0.55 to -0.57). Reference sites were fully supporting of aquatic life and had the lowest metals concentrations and among the highest biotic condition scores in both years. Sites directly downstream from mining and related activities were partially supporting, with biotic condition scores 10% to 58% lower than reference sites. Sites located greater distances downstream from mining activities had intermediate scores and concentrations of metals. Results indicate that elevated concentrations of metals originating from mining activities were the underlying cause of aquatic life impairment in several of the streams studied. There was general concurrence among the adversely affected sites in how the various indicators responded to mining activities during the overall study.

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

PubMed Central

Burkhart, Deborah L.; Wirt, Stacey E.; Zmoos, Anne-Flore; Kareta, Michael S.; Sage, Julien

2010-01-01

The retinoblastoma tumor suppressor (Rb) is a potent and ubiquitously expressed cell cycle regulator, but patients with a germline Rb mutation develop a very specific tumor spectrum. This surprising observation raises the possibility that mechanisms that compensate for loss of Rb function are present or activated in many cell types. In particular, p107, a protein related to Rb, has been shown to functionally overlap for loss of Rb in several cellular contexts. To investigate the mechanisms underlying this functional redundancy between Rb and p107 in vivo, we used gene targeting in embryonic stem cells to engineer point mutations in two consensus E2F binding sites in the endogenous p107 promoter. Analysis of normal and mutant cells by gene expression and chromatin immunoprecipitation assays showed that members of the Rb and E2F families directly bound these two sites. Furthermore, we found that these two E2F sites controlled both the repression of p107 in quiescent cells and also its activation in cycling cells, as well as in Rb mutant cells. Cell cycle assays further indicated that activation of p107 transcription during S phase through the two E2F binding sites was critical for controlled cell cycle progression, uncovering a specific role for p107 to slow proliferation in mammalian cells. Direct transcriptional repression of p107 by Rb and E2F family members provides a molecular mechanism for a critical negative feedback loop during cell cycle progression and tumorigenesis. These experiments also suggest novel therapeutic strategies to increase the p107 levels in tumor cells. PMID:20585628

The surface plasmon-induced hot carrier effect on the catalytic activity of CO oxidation on a Cu2O/hexoctahedral Au inverse catalyst.

PubMed

Lee, Si Woo; Hong, Jong Wook; Lee, Hyunhwa; Wi, Dae Han; Kim, Sun Mi; Han, Sang Woo; Park, Jeong Young

2018-06-14

The intrinsic correlation between an enhancement of catalytic activity and the flow of hot electrons generated at metal-oxide interfaces suggests an intriguing way to control catalytic reactions and is a significant subject in heterogeneous catalysis. Here, we show surface plasmon-induced catalytic enhancement by the peculiar nanocatalyst design of hexoctahedral (HOH) Au nanocrystals (NCs) with Cu2O clusters. We found that this inverse catalyst comprising a reactive oxide for the catalytic portion and a metal as the source of electrons by localized surface plasmon resonance (localized SPR) exhibits a change in catalytic activity by direct hot electron transfer or plasmon-induced resonance energy transfer (PIRET) when exposed to light. We prepared two types of inverse catalysts, Cu2O at the vertex sites of HOH Au NCs (Cu2O/Au vertex site) and a HOH Au NC-Cu2O core-shell structure (HOH Au@Cu2O), to test the structural effect on surface plasmons. Under broadband light illumination, the Cu2O/Au vertex site catalyst showed 30-90% higher catalytic activity and the HOH Au@Cu2O catalyst showed 10-30% higher catalytic activity than when in the dark. Embedding thin SiO2 layers between the HOH Au NCs and the Cu2O verified that the dominant mechanism for the catalytic enhancement is direct hot electron transfer from the HOH Au to the Cu2O. Finite-difference time domain calculations show that a much stronger electric field was formed on the vertex sites after growing the Cu2O on the HOH Au NCs. These results imply that the catalytic activity is enhanced when hot electrons, created from photon absorption on the HOH Au metal and amplified by the presence of surface plasmons, are transferred to the reactive Cu2O.

Seismic anisotropy around the Gulf of Corinth, Greece, deduced from three-component seismograms of local earthquakes and its relationship with crustal strain

NASA Astrophysics Data System (ADS)

Bouin, Marie-Paule; TéLlez, Julia; Bernard, Pascal

1996-03-01

Several thousand three-component seismograms from local earthquakes recorded during two field experiments in August 1991 and November 1992 in the Gulf of Corinth have been analyzed to detect shear wave splitting. After a first selection of the events located in the S window of the considered stations, a second very strict selection of the records is applied in order to avoid the effect of scattered or converted phases which can mimic the behavior of shear wave splitting. Two main directions of fast S wave polarization have been detected: one oriented N105°E-N120°E, the other N55°E-N75°E. The first one is perpendicular to the main direction of extension of the Gulf provided by focal mechanism, Global Positioning System measurements, and tectonic studies, and is thus consistent with the extensive-dilatancy anisotropy (EDA) model. The second direction is subparallel to the direction of the active normal fault closest to the sites. This suggests a local control of the anisotropy by these active faults, either by a local rotation of the total stress field, in which case the EDA model may still explain the anisotropy, or by the existence of a specific microstructure or macrostructure generated by the long-term fault activity (set of secondary fault planes parallel to the major one), in which case the anisotropy direction would be significantly rotated from the stress direction (about 50°). The anisotropic signature does not seem to be affected by the geology of the site (pre-Tertiary limestone and Pleistocene sediments), except for a station located on the thick Plio-Quaternary deposits of a delta, where the time delay is significantly larger.

A role for catalase-peroxidase large loop 2 revealed by deletion mutagenesis: control of active site water and ferric enzyme reactivity.

PubMed

Kudalkar, Shalley N; Njuma, Olive J; Li, Yongjiang; Muldowney, Michelle; Fuanta, N Rene; Goodwin, Douglas C

2015-03-03

Catalase-peroxidases (KatGs), the only catalase-active members of their superfamily, all possess a 35-residue interhelical loop called large loop 2 (LL2). It is essential for catalase activity, but little is known about its contribution to KatG function. LL2 shows weak sequence conservation; however, its length is nearly identical across KatGs, and its apex invariably makes contact with the KatG-unique C-terminal domain. We used site-directed and deletion mutagenesis to interrogate the role of LL2 and its interaction with the C-terminal domain in KatG structure and catalysis. Single and double substitutions of the LL2 apex had little impact on the active site heme [by magnetic circular dichroism or electron paramagnetic resonance (EPR)] and activity (catalase or peroxidase). Conversely, deletion of a single amino acid from the LL2 apex reduced catalase activity by 80%. Deletion of two or more apex amino acids or all of LL2 diminished catalase activity by 300-fold. Peroxide-dependent but not electron donor-dependent kcat/KM values for deletion variant peroxidase activity were reduced 20-200-fold, and kon for cyanide binding diminished by 3 orders of magnitude. EPR spectra for deletion variants were all consistent with an increase in the level of pentacoordinate high-spin heme at the expense of hexacoordinate high-spin states. Together, these data suggest a shift in the distribution of active site waters, altering the reactivity of the ferric state, toward, among other things, compound I formation. These results identify the importance of LL2 length conservation for maintaining an intersubunit interaction that is essential for an active site water distribution that facilitates KatG catalytic activity.

NMDA-induced potentiation of mGluR5 is mediated by activation of protein phosphatase 2B/calcineurin

PubMed Central

Alagarsamy, Sudar; Saugstad, Julie; Warren, Lee; Mansuy, Isabelle M.; Gereau, Robert W.; Conn, P. Jeffrey

2010-01-01

Previous reports have shown that activation of N-methyl-D-aspartate (NMDA) receptors potentiates responses to activation of the group I metabotropic glutamate receptor mGluR5 by reversing PKC-mediated desensitization of this receptor. NMDA-induced reversal of mGluR5 desensitization is dependent on activation of protein phosphatases. However, the specific protein phosphatase involved and the precise mechanism by which NMDA receptor activation reduces mGluR desensitization are not known. We have performed a series of molecular, biochemical, and genetic studies to show that NMDA-induced regulation of mGluR5 is dependent on activation of calcium-dependent protein phosphatase 2B/calcineurin (PP2B/CaN). Furthermore, we report that purified calcineurin directly dephosphorylates the C-terminal tail of mGluR5 at sites that are phosphorylated by PKC. Finally, immunoprecipitation and GST fusion protein pull-down experiments reveal that calcineurin interacts with mGluR5, suggesting that these proteins could be colocalized in a signaling complex. Taken together with previous studies, these data suggest that activation of NMDA receptors leads to activation of calcineurin and that calcineurin modulates mGluR5 function by directly dephosphorylating mGluR5 at PKC sites that are involved in desensitization of this receptor. 2005 Elsevier Ltd. All rights reserved. PMID:16005030

Plasmacytoid dendritic cells induce NK cell-dependent, tumor antigen-specific T cell cross-priming and tumor regression in mice.

PubMed

Liu, Chengwen; Lou, Yanyan; Lizée, Gregory; Qin, Hong; Liu, Shujuan; Rabinovich, Brian; Kim, Grace J; Wang, Yi-Hong; Ye, Yang; Sikora, Andrew G; Overwijk, Willem W; Liu, Yong-Jun; Wang, Gang; Hwu, Patrick

2008-03-01

A prerequisite for strong adaptive antiviral immunity is the robust initial activation of the innate immune system, which is frequently mediated by TLR-activated plasmacytoid DCs (pDCs). Natural antitumor immunity is often comparatively weak, potentially due to the lack of TLR-mediated activation signals within the tumor microenvironment. To assess whether pDCs are capable of directly facilitating effective antitumor immune responses, mice bearing established subcutaneous B16 melanoma tumors were administered TLR9-activated pDCs directly into the tumor. We found that TLR9-activated pDCs induced robust, spontaneous CTL cross-priming against multiple B16 tumor antigens, leading to the regression of both treated tumors and untreated tumors at distant contralateral sites. This T cell cross-priming was mediated by conventional DCs (cDCs) and was completely dependent upon the early recruitment and activation of NK cells at the tumor site. NK cell recruitment was mediated by CCR5 via chemokines secreted by pDCs, and optimal IFN-gamma production by NK cells was mediated by OX40L expressed by pDCs. Our data thus demonstrated that activated pDCs are capable of initiating effective and systemic antitumor immunity through the orchestration of an immune cascade involving the sequential activation of NK cells, cDCs, and CD8(+) T cells.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Tingting; Chang, Chin -Yuan; Lohman, Jeremy R.

Comparative analysis of the enediyne biosynthetic gene clusters revealed sets of conserved genes serving as outstanding candidates for the enediyne core. Here we report the crystal structures of SgcJ and its homologue NCS-Orf16, together with gene inactivation and site-directed mutagenesis studies, to gain insight into enediyne core biosynthesis. Gene inactivation in vivo establishes that SgcJ is required for C-1027 production in Streptomyces globisporus. SgcJ and NCS-Orf16 share a common structure with the nuclear transport factor 2-like superfamily of proteins, featuring a putative substrate binding or catalytic active site. Site-directed mutagenesis of the conserved residues lining this site allowed us tomore » propose that SgcJ and its homologues may play a catalytic role in transforming the linear polyene intermediate, along with other enediyne polyketide synthase-associated enzymes, into an enzyme-sequestered enediyne core intermediate. In conclusion, these findings will help formulate hypotheses and design experiments to ascertain the function of SgcJ and its homologues in nine-membered enediyne core biosynthesis.« less

Site characterization progress report: Yucca Mountain, Nevada, October 1, 1994--March 31, 1995, Number 12. Nuclear Waste Policy Act (Section 113)

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1995-08-01

During the first half of fiscal year 1995, most activities at the Yucca Mountain Site Characterization Project were directed at implementing the Program Plan developed by the Office of Civilian Radioactive Waste Management. The Plan is designed to enable the Office to make measurable and significant progress toward key objectives over the next five years within the financial resources that can be realistically expected. Activities this period focused on the immediate goal of determining by 1998 whether Yucca Mountain, Nevada, is technically suitable as a possible site for a geologic repository for the permanent disposal of spent nuclear fuel andmore » high-level radioactive waste. Work on the Project advanced in several critical areas, including programmatic activities such as issuing the Program Plan, completing the first technical basis report to support the assessment of three 10 CFR 960 guidelines, developing the Notice of Intent for the Environmental Impact Statement, submitting the License Application Annotated Outline, and beginning a rebaselining effort to conform with the goals of the Program Plan. Scientific investigation and analysis of the site and design and construction activities to support the evaluation of the technical suitability of the site also advanced. Specific details relating to all Project activities and reports generated are presented in this report.« less

Computational active site analysis of molecular pathways to improve functional classification of enzymes.

PubMed

Ozyurt, A Sinem; Selby, Thomas L

2008-07-01

This study describes a method to computationally assess the function of homologous enzymes through small molecule binding interaction energy. Three experimentally determined X-ray structures and four enzyme models from ornithine cyclo-deaminase, alanine dehydrogenase, and mu-crystallin were used in combination with nine small molecules to derive a function score (FS) for each enzyme-model combination. While energy values varied for a single molecule-enzyme combination due to differences in the active sites, we observe that the binding energies for the entire pathway were proportional for each set of small molecules investigated. This proportionality of energies for a reaction pathway appears to be dependent on the amino acids in the active site and their direct interactions with the small molecules, which allows a function score (FS) to be calculated to assess the specificity of each enzyme. Potential of mean force (PMF) calculations were used to obtain the energies, and the resulting FS values demonstrate that a measurement of function may be obtained using differences between these PMF values. Additionally, limitations of this method are discussed based on: (a) larger substrates with significant conformational flexibility; (b) low homology enzymes; and (c) open active sites. This method should be useful in accurately predicting specificity for single enzymes that have multiple steps in their reactions and in high throughput computational methods to accurately annotate uncharacterized proteins based on active site interaction analysis. 2008 Wiley-Liss, Inc.

Structural analysis of substrate-mimicking inhibitors in complex with Neisseria meningitidis 3-deoxy-d-arabino-heptulosonate 7-phosphate synthase - The importance of accommodating the active site water.

PubMed

Heyes, Logan C; Reichau, Sebastian; Cross, Penelope J; Jameson, Geoffrey B; Parker, Emily J

2014-12-01

3-Deoxy-d-arabino-heptulosonate 7-phosphate synthase (DAH7PS) catalyses the first committed step of the shikimate pathway, which produces the aromatic amino acids as well as many other aromatic metabolites. DAH7PS catalyses an aldol-like reaction between phosphoenolpyruvate and erythrose 4-phosphate. Three phosphoenolpyruvate mimics, (R)-phospholactate, (S)-phospholactate and vinyl phosphonate [(E)-2-methyl-3-phosphonoacrylate], were found to competitively inhibit DAH7PS from Neisseria meningitidis, which is the pathogen responsible for bacterial meningitis. The most potent inhibitor was the vinyl phosphonate with a Ki value of 3.9±0.4μM. We report for the first time crystal structures of these compounds bound in the active site of a DAH7PS enzyme which reveals that the inhibitors bind to the active site of the enzyme in binding modes that mimic those of the predicted oxocarbenium and tetrahedral intermediates of the enzyme-catalysed reaction. Furthermore, the inhibitors accommodate the binding of a key active site water molecule. Together, these observations provide strong evidence that this active site water participates directly in the DAH7PS reaction, enabling the facial selectivity of the enzyme-catalysed reaction sequence to be delineated. Copyright © 2014 Elsevier Inc. All rights reserved.

Path to Collagenolysis

PubMed Central

Prior, Stephen H.; Byrne, Todd S.; Tokmina-Roszyk, Dorota; Fields, Gregg B.

2016-01-01

Collagenolysis is essential in extracellular matrix homeostasis, but its structural basis has long been shrouded in mystery. We have developed a novel docking strategy guided by paramagnetic NMR that positions a triple-helical collagen V mimic (synthesized with nitroxide spin labels) in the active site of the catalytic domain of matrix metalloproteinase-12 (MMP-12 or macrophage metalloelastase) primed for catalysis. The collagenolytically productive complex forms by utilizing seven distinct subsites that traverse the entire length of the active site. These subsites bury ∼1,080 Å2 of surface area, over half of which is contributed by the trailing strand of the synthetic collagen V mimic, which also appears to ligate the catalytic zinc through the glycine carbonyl oxygen of its scissile G∼VV triplet. Notably, the middle strand also occupies the full length of the active site where it contributes extensive interfacial contacts with five subsites. This work identifies, for the first time, the productive and specific interactions of a collagen triple helix with an MMP catalytic site. The results uniquely demonstrate that the active site of the MMPs is wide enough to accommodate two strands from collagen triple helices. Paramagnetic relaxation enhancements also reveal an extensive array of encounter complexes that form over a large part of the catalytic domain. These transient complexes could possibly facilitate the formation of collagenolytically active complexes via directional Brownian tumbling. PMID:26887942

Remote site-selective C-H activation directed by a catalytic bifunctional template

NASA Astrophysics Data System (ADS)

Zhang, Zhipeng; Tanaka, Keita; Yu, Jin-Quan

2017-03-01

In chemical syntheses, the activation of carbon-hydrogen (C-H) bonds converts them directly into carbon-carbon or carbon-heteroatom bonds without requiring any prior functionalization. C-H activation can thus substantially reduce the number of steps involved in a synthesis. A single specific C-H bond in a substrate can be activated by using a ‘directing’ (usually a functional) group to obtain the desired product selectively. The applicability of such a C-H activation reaction can be severely curtailed by the distance of the C-H bond in question from the directing group, and by the shape of the substrate, but several approaches have been developed to overcome these limitations. In one such approach, an understanding of the distal and geometric relationships between the functional groups and C-H bonds of a substrate has been exploited to achieve meta-selective C-H activation by using a covalently attached, U-shaped template. However, stoichiometric installation of this template has not been feasible in the absence of an appropriate functional group on which to attach it. Here we report the design of a catalytic, bifunctional nitrile template that binds a heterocyclic substrate via a reversible coordination instead of a covalent linkage. The two metal centres coordinated to this template have different roles: one reversibly anchors substrates near the catalyst, and the other cleaves remote C-H bonds. Using this strategy, we demonstrate remote, site-selective C-H olefination of heterocyclic substrates that do not have the necessary functional groups for covalently attaching templates.

cAMP-dependent kinase does not modulate the Slack sodium-activated potassium channel.

PubMed

Nuwer, Megan O; Picchione, Kelly E; Bhattacharjee, Arin

2009-09-01

The Slack gene encodes a Na(+)-activated K(+) channel and is expressed in many different types of neurons. Like the prokaryotic Ca(2+)-gated K(+) channel MthK, Slack contains two 'regulator of K(+) conductance' (RCK) domains within its carboxy terminal, domains likely involved in Na(+) binding and channel gating. It also contains multiple consensus protein kinase C (PKC) and protein kinase A (PKA) phosphorylation sites and although regulated by protein kinase C (PKC) phosphorylation, modulation by PKA has not been determined. To test if PKA directly regulates Slack, nystatin-perforated patch whole-cell currents were recorded from a human embryonic kidney (HEK-293) cell line stably expressing Slack. Bath application of forskolin, an adenylate cyclase activator, caused a rapid and complete inhibition of Slack currents however, the inactive homolog of forskolin, 1,9-dideoxyforskolin caused a similar effect. In contrast, bath application of 8-bromo-cAMP did not affect the amplitude nor the activation kinetics of Slack currents. In excised inside-out patch recordings, direct application of the PKA catalytic subunit to patches did not affect the open probability of Slack channels nor was open probability affected by direct application of protein phosphatase 2B. Preincubation of cells with the protein kinase A inhibitor KT5720 also did not change current density. Finally, mutating the consensus phosphorylation site located between RCK domain 1 and domain 2 from serine to glutamate did not affect current activation kinetics. We conclude that unlike PKC, phosphorylation by PKA does not acutely modulate the function and gating activation kinetics of Slack channels.

Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex*

PubMed Central

Douglas, Max E.

2016-01-01

Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly (“G1-like”) and high affinity recruitment when CMG assembly takes place (“S-phase-like”). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. PMID:26719337

Design, synthesis and evaluation of rivastigmine and curcumin hybrids as site-activated multitarget-directed ligands for Alzheimer's disease therapy.

PubMed

Li, Yujie; Peng, Peng; Tang, Li; Hu, Yunzhen; Hu, Yongzhou; Sheng, Rong

2014-09-01

A series of novel 2-methoxy-phenyl dimethyl-carbamate derivatives were designed, synthesized and evaluated as site-activated MTDLs based on rivastigmine and curcumin. Most of them exhibited good to excellent AChE and BuChE inhibitory activities with sub-micromolar IC50 values. Among all the compounds, 6a demonstrated the most potent AChE inhibition with IC50 value of 0.097μM, which is about 20-fold than that of rivastigmine. In addition, the three selected compounds 5a, 6a and 6e demonstrated inhibitory activity against Aβ self-aggregation similar to cucurmin in TEM assay, which is obviously different from the weak activity of rivastigmine. Moreover, the hydrolysate of 6a (compound 7) also showed potent ABTS(+) scavenging and moderate copper ion chelating activity in vitro. Copyright © 2014 Elsevier Ltd. All rights reserved.

Satellite Power System (SPS) laser studies. Volume 2: Meteorological effects on laser beam propagation and direct solar pumped lasers for the SPS

NASA Technical Reports Server (NTRS)

Beverly, R. E., III

1980-01-01

The primary emphasis of this research activity was to investigate the effect of the environment on laser power transmission/reception from space to ground. Potential mitigation techniques to minimize the environment effect by a judicious choice of laser operating parameters was investigated. Using these techniques, the availability of power at selected sites was determined using statistical meteorological data for each site.

Nanostructured nonprecious metal catalysts for oxygen reduction reaction.

PubMed

Wu, Gang; Zelenay, Piotr

2013-08-20

Platinum-based catalysts represent a state of the art in the electrocatalysis of oxygen reduction reaction (ORR) from the point of view of their activity and durability in harnessing the chemical energy via direct electrochemical conversion. However, because platinum is both expensive and scarce, its widespread implementation in such clean energy applications is limited. Recent breakthroughs in the synthesis of high-performance nonprecious metal catalysts (NPMCs) make replacement of Pt in ORR electrocatalysts with earth-abundant elements, such as Fe, Co, N, and C, a realistic possibility. In this Account, we discuss how we can obtain highly promising M-N-C (M: Fe and/or Co) catalysts by simultaneously heat-treating precursors of nitrogen, carbon, and transition metals at 800-1000 °C. The activity and durability of resulting catalysts depend greatly on the selection of precursors and synthesis chemistry. In addition, they correlate quite well with the catalyst nanostructure. While chemists have presented no conclusive description of the active catalytic site for this class of NPMCs, they have developed a designed approach to making active and durable materials, focusing on the catalyst nanostructure. The approach consists of nitrogen doping, in situ carbon graphitization, and the usage of graphitic structures (possibly graphene and graphene oxides) as carbon precursors. Various forms of nitrogen, particularly pyridinic and quaternary, can act as n-type carbon dopants in the M-N-C catalysts, assisting in the formation of disordered carbon nanostructures and donating electrons to the carbon. The CNx structures are likely a crucial part of the ORR active site(s). Noteworthy, the ORR activity is not necessarily governed by the amount of nitrogen, but by how the nitrogen is incorporated into the nanostructures. Apart from the possibility of a direct participation in the active site, the transition metal often plays an important role in the in situ formation of various carbon nanostructures by catalyzing the decomposition of the nitrogen/carbon precursor. We can control the formation of different nanostructures during the synthesis of M-N-C catalysts. For example, in situ formed nitrogen-doped graphene-sheets can only be derived from polyaniline (PANI), probably due to structural similarities between the aromatic structures of PANI and graphene. Highly-graphitized carbon nanostructures may serve as a matrix for the formation of ORR-active groups with improved catalytic activity and durability, containing nitrogen and most probably also metal atoms. In the future, we will likely focus NPMC synthesis approaches on precise control of interactions between precursors of the metal and carbon/nitrogen during the heat treatment. The main purposes will be to maximize the number of active sites, optimize nitrogen doping levels, and generate morphologies capable of hosting active and stable ORR sites.

Science@NASA: Direct to People!

NASA Technical Reports Server (NTRS)

Koczor, Ronald J.; Adams, Mitzi; Gallagher, Dennis; Whitaker, Ann (Technical Monitor)

2002-01-01

Science@NASA is a science communication effort sponsored by NASA's Marshall Space Flight Center. It is the result of a four year research project between Marshall, the University of Florida College of Journalism and Communications and the internet communications company, Bishop Web Works. The goals of Science@NASA are to inform, inspire, and involve people in the excitement of NASA science by bringing that science directly to them. We stress not only the reporting of the facts of a particular topic, but also the context and importance of the research. Science@NASA involves several levels of activity from academic communications research to production of content for 6 websites, in an integrated process involving all phases of production. A Science Communications Roundtable Process is in place that includes scientists, managers, writers, editors, and Web technical experts. The close connection between the scientists and the writers/editors assures a high level of scientific accuracy in the finished products. The websites each have unique characters and are aimed at different audience segments: 1. http://science.nasa.gov. (SNG) Carries stories featuring various aspects of NASA science activity. The site carries 2 or 3 new stories each week in written and audio formats for science-attentive adults. 2. http://liftoff.msfc.nasa.gov. Features stories from SNG that are recast for a high school level audience. J-Track and J-Pass applets for tracking satellites are our most popular product. 3. http://kids. msfc.nasa.gov. This is the Nursemaids site and is aimed at a middle school audience. The NASAKids Club is a new feature at the site. 4. http://www.thursdaysclassroom.com . This site features lesson plans and classroom activities for educators centered around one of the science stories carried on SNG. 5. http://www.spaceweather.com. This site gives the status of solar activity and its interactions with the Earth's ionosphere and magnetosphere.

Seismic response of soft deposits due to landslide: The Mission Peak, California, landslide

USGS Publications Warehouse

Hartzell, Stephen; Leeds, Alena L.; Jibson, Randall W.

2017-01-01

The seismic response of active and intermittently active landslides is an important issue to resolve to determine if such landslides present an elevated hazard in future earthquakes. To study the response of landslide deposits, seismographs were placed on the Mission Peak landslide in the eastern San Francisco Bay region for a period of one year. Numerous local and near‐regional earthquakes were recorded that reveal a complexity of seismic response phenomena using the horizontal‐to‐vertical spectral ratio method. At lower frequencies, a clear spectral peak is observed at 0.5 Hz common to all four stations in the array and is attributed to a surface topographic effect. At higher frequencies, other spectral peaks occur that are interpreted in terms of local deposits and structures. Site amplification from the standard reference site method shows the minimum amplification with a factor of 2, comparing a site on and off the landslide. A site located on relatively homogeneous deposits of loose soils shows a clear spectral peak associated with the thickness of the deposit. Another site on a talus‐filled graben near the headscarp shows possible 2D or 3D effects from subsurface topography or scattering within and between buried sandstone blocks. A third site on a massive partially detached block below the crown of the headscarp shows indications of resonance caused by the reverberation of shear waves within the block. The varied seismic response of different parts of this complex landslide is consistent with other studies which found that, although landslide response is commonly enhanced in the downslope direction of landslide movement, such a response does not occur uniformly or consistently. When it does occur, enhanced site response parallel to the direction of landslide movement would contribute to landslide reactivation during significant earthquakes.

A Combined Probe-Molecule, Mössbauer, Nuclear Resonance Vibrational Spectroscopy, and Density Functional Theory Approach for Evaluation of Potential Iron Active Sites in an Oxygen Reduction Reaction Catalyst

DOE PAGES

Kneebone, Jared L.; Daifuku, Stephanie L.; Kehl, Jeffrey A.; ...

2017-07-06

While non-precious metal M-N-C (M = Fe or Co) catalysts have been developed that are effective for the oxygen reduction reaction in polymer electrolyte fuel cells, no consensus has yet been reached regarding the nature of the M sites in these heterogeneous catalysts that are responsible for reaction with dioxygen (O 2). While multiple studies have developed correlations between Fe distributions in as-prepared catalysts and ORR activity, the direct identification of sites reactive towards O 2 or O 2-analog molecules remains a significant challenge. In the present study, we demonstrate a new approach to identifying and characterizing potential Fe activemore » sites in complex ORR catalysts that combines an effective probe molecule (NO (g)) Mössbauer spectroscopy and nuclear resonance vibrational spectroscopy (NRVS) with density functional theory (DFT) calculations. Mössbauer spectroscopic studies demonstrate that NO (g) treatment of electrochemically reduced PANI-57Fe-C leads to selective reaction with only a sub-set of the Fe species present. Nuclear resonance vibrational spectroscopic studies identified new Fe-ligand vibrations associated with the site reactive towards NO (g). DFT calculations of vibrational properties of a small selection of previously proposed active site structures suggest that graphene zig-zag edge hosted Fe-N structures may be responsible for the observed vibrational behavior with NO (g) probe molecules. Moreover, such sites are likely also reactive to O 2, possibly serving as the ORR active sites in the synthesized materials.« less

A Combined Probe-Molecule, Mössbauer, Nuclear Resonance Vibrational Spectroscopy, and Density Functional Theory Approach for Evaluation of Potential Iron Active Sites in an Oxygen Reduction Reaction Catalyst

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kneebone, Jared L.; Daifuku, Stephanie L.; Kehl, Jeffrey A.

While non-precious metal M-N-C (M = Fe or Co) catalysts have been developed that are effective for the oxygen reduction reaction in polymer electrolyte fuel cells, no consensus has yet been reached regarding the nature of the M sites in these heterogeneous catalysts that are responsible for reaction with dioxygen (O 2). While multiple studies have developed correlations between Fe distributions in as-prepared catalysts and ORR activity, the direct identification of sites reactive towards O 2 or O 2-analog molecules remains a significant challenge. In the present study, we demonstrate a new approach to identifying and characterizing potential Fe activemore » sites in complex ORR catalysts that combines an effective probe molecule (NO (g)) Mössbauer spectroscopy and nuclear resonance vibrational spectroscopy (NRVS) with density functional theory (DFT) calculations. Mössbauer spectroscopic studies demonstrate that NO (g) treatment of electrochemically reduced PANI-57Fe-C leads to selective reaction with only a sub-set of the Fe species present. Nuclear resonance vibrational spectroscopic studies identified new Fe-ligand vibrations associated with the site reactive towards NO (g). DFT calculations of vibrational properties of a small selection of previously proposed active site structures suggest that graphene zig-zag edge hosted Fe-N structures may be responsible for the observed vibrational behavior with NO (g) probe molecules. Moreover, such sites are likely also reactive to O 2, possibly serving as the ORR active sites in the synthesized materials.« less

DSOD Procedures for Seismic Hazard Analysis

NASA Astrophysics Data System (ADS)

Howard, J. K.; Fraser, W. A.

2005-12-01

DSOD, which has jurisdiction over more than 1200 dams in California, routinely evaluates their dynamic stability using seismic shaking input ranging from simple pseudostatic coefficients to spectrally matched earthquake time histories. Our seismic hazard assessments assume maximum earthquake scenarios of nearest active and conditionally active seismic sources. Multiple earthquake scenarios may be evaluated depending on sensitivity of the design analysis (e.g., to certain spectral amplitudes, duration of shaking). Active sources are defined as those with evidence of movement within the last 35,000 years. Conditionally active sources are those with reasonable expectation of activity, which are treated as active until demonstrated otherwise. The Division's Geology Branch develops seismic hazard estimates using spectral attenuation formulas applicable to California. The formulas were selected, in part, to achieve a site response model similar to the 2000 IBC's for rock, soft rock, and stiff soil sites. The level of dynamic loading used in the stability analysis (50th, 67th, or 84th percentile ground shaking estimates) is determined using a matrix that considers consequence of dam failure and fault slip rate. We account for near-source directivity amplification along such faults by adjusting target response spectra and developing appropriate design earthquakes for analysis of structures sensitive to long-period motion. Based on in-house studies, the orientation of the dam analysis section relative to the fault-normal direction is considered for strike-slip earthquakes, but directivity amplification is assumed in any orientation for dip-slip earthquakes. We do not have probabilistic standards, but we evaluate the probability of our ground shaking estimates using hazard curves constructed from the USGS Interactive De-Aggregation website. Typically, return periods for our design loads exceed 1000 years. Excessive return periods may warrant a lower design load. Minimum shaking levels are provided for sites far from active faulting. Our procedures and standards are presented at the DSOD website http://damsafety.water.ca.gov/. We review our methods and tools periodically under the guidance of our Consulting Board for Earthquake Analysis (and expect to make changes pending NGA completion), mindful that frequent procedural changes can interrupt design evaluations.

The archaeo-eukaryotic primase of plasmid pRN1 requires a helix bundle domain for faithful primer synthesis

PubMed Central

Beck, Kirsten; Vannini, Alessandro; Cramer, Patrick; Lipps, Georg

2010-01-01

The plasmid pRN1 encodes for a multifunctional replication protein with primase, DNA polymerase and helicase activity. The minimal region required for primase activity encompasses amino-acid residues 40–370. While the N-terminal part of that minimal region (residues 47–247) folds into the prim/pol domain and bears the active site, the structure and function of the C-terminal part (residues 248–370) is unknown. Here we show that the C-terminal part of the minimal region folds into a compact domain with six helices and is stabilized by a disulfide bond. Three helices superimpose well with the C-terminal domain of the primase of the bacterial broad host range plasmid RSF1010. Structure-based site-directed mutagenesis shows that the C-terminal helix of the helix bundle domain is required for primase activity although it is distant to the active site in the crystallized conformation. Furthermore, we identified mutants of the C-terminal domain, which are defective in template binding, dinucleotide formation and conformation change prior to DNA extension. PMID:20511586

Structure-Function Studies with the Unique Hexameric Form II Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) from Rhodopseudomonas palustris*

PubMed Central

Satagopan, Sriram; Chan, Sum; Perry, L. Jeanne; Tabita, F. Robert

2014-01-01

The first x-ray crystal structure has been solved for an activated transition-state analog-bound form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco). This enzyme, from Rhodopseudomonas palustris, assembles as a unique hexamer with three pairs of catalytic large subunit homodimers around a central 3-fold symmetry axis. This oligomer arrangement is unique among all known Rubisco structures, including the form II homolog from Rhodospirillum rubrum. The presence of a transition-state analog in the active site locked the activated enzyme in a “closed” conformation and revealed the positions of critical active site residues during catalysis. Functional roles of two form II-specific residues (Ile165 and Met331) near the active site were examined via site-directed mutagenesis. Substitutions at these residues affect function but not the ability of the enzyme to assemble. Random mutagenesis and suppressor selection in a Rubisco deletion strain of Rhodobacter capsulatus identified a residue in the amino terminus of one subunit (Ala47) that compensated for a negative change near the active site of a neighboring subunit. In addition, substitution of the native carboxyl-terminal sequence with the last few dissimilar residues from the related R. rubrum homolog increased the enzyme's kcat for carboxylation. However, replacement of a longer carboxyl-terminal sequence with termini from either a form III or a form I enzyme, which varied both in length and sequence, resulted in complete loss of function. From these studies, it is evident that a number of subtle interactions near the active site and the carboxyl terminus account for functional differences between the different forms of Rubiscos found in nature. PMID:24942737

Structure-function studies with the unique hexameric form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) from Rhodopseudomonas palustris.

PubMed

Satagopan, Sriram; Chan, Sum; Perry, L Jeanne; Tabita, F Robert

2014-08-01

The first x-ray crystal structure has been solved for an activated transition-state analog-bound form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco). This enzyme, from Rhodopseudomonas palustris, assembles as a unique hexamer with three pairs of catalytic large subunit homodimers around a central 3-fold symmetry axis. This oligomer arrangement is unique among all known Rubisco structures, including the form II homolog from Rhodospirillum rubrum. The presence of a transition-state analog in the active site locked the activated enzyme in a "closed" conformation and revealed the positions of critical active site residues during catalysis. Functional roles of two form II-specific residues (Ile(165) and Met(331)) near the active site were examined via site-directed mutagenesis. Substitutions at these residues affect function but not the ability of the enzyme to assemble. Random mutagenesis and suppressor selection in a Rubisco deletion strain of Rhodobacter capsulatus identified a residue in the amino terminus of one subunit (Ala(47)) that compensated for a negative change near the active site of a neighboring subunit. In addition, substitution of the native carboxyl-terminal sequence with the last few dissimilar residues from the related R. rubrum homolog increased the enzyme's kcat for carboxylation. However, replacement of a longer carboxyl-terminal sequence with termini from either a form III or a form I enzyme, which varied both in length and sequence, resulted in complete loss of function. From these studies, it is evident that a number of subtle interactions near the active site and the carboxyl terminus account for functional differences between the different forms of Rubiscos found in nature. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Crystal structure of Escherichia coli diaminopropionate ammonia-lyase reveals mechanism of enzyme activation and catalysis.

PubMed

Bisht, Shveta; Rajaram, Venkatesan; Bharath, Sakshibeedu R; Kalyani, Josyula Nitya; Khan, Farida; Rao, Appaji N; Savithri, Handanahal S; Murthy, Mathur R N

2012-06-08

Pyridoxal 5'-phosphate (PLP)-dependent enzymes utilize the unique chemistry of a pyridine ring to carry out diverse reactions involving amino acids. Diaminopropionate (DAP) ammonia-lyase (DAPAL) is a prokaryotic PLP-dependent enzyme that catalyzes the degradation of d- and l-forms of DAP to pyruvate and ammonia. Here, we report the first crystal structure of DAPAL from Escherichia coli (EcDAPAL) in tetragonal and monoclinic forms at 2.0 and 2.2 Å resolutions, respectively. Structures of EcDAPAL soaked with substrates were also determined. EcDAPAL has a typical fold type II PLP-dependent enzyme topology consisting of a large and a small domain with the active site at the interface of the two domains. The enzyme is a homodimer with a unique biological interface not observed earlier. Structure of the enzyme in the tetragonal form had PLP bound at the active site, whereas the monoclinic structure was in the apo-form. Analysis of the apo and holo structures revealed that the region around the active site undergoes transition from a disordered to ordered state and assumes a conformation suitable for catalysis only upon PLP binding. A novel disulfide was found to occur near a channel that is likely to regulate entry of ligands to the active site. EcDAPAL soaked with dl-DAP revealed density at the active site appropriate for the reaction intermediate aminoacrylate, which is consistent with the observation that EcDAPAL has low activity under crystallization conditions. Based on the analysis of the structure and results of site-directed mutagenesis, a two-base mechanism of catalysis involving Asp(120) and Lys(77) is suggested.

Phosphorylation of ORF1p is required for L1 retrotransposition.

PubMed

Cook, Pamela R; Jones, Charles E; Furano, Anthony V

2015-04-07

Although members of the L1 (LINE-1) clade of non-LTR retrotransposons can be deleterious, the L1 clade has remained active in most mammals for ∼100 million years and generated almost 40% of the human genome. The details of L1-host interaction are largely unknown, however. Here we report that L1 activity requires phosphorylation of the protein encoded by the L1 ORF1 (ORF1p). Critical phospho-acceptor residues (two serines and two threonines) reside in four conserved proline-directed protein kinase (PDPK) target sites. The PDPK family includes mitogen-activated protein kinases and cyclin-dependent kinases. Mutation of any PDPK phospho-acceptor inhibits L1 retrotransposition. The phosphomimetic aspartic acid can restore activity at the two serine sites, but not at either threonine site, where it is strongly inhibitory. ORF1p also contains conserved PDPK docking sites, which promote specific interaction of PDPKs with their targets. As expected, mutations in these sites also inhibit L1 activity. PDPK mutations in ORF1p that inactivate L1 have no significant effect on the ability of ORF1p to anneal RNA in vitro, an important biochemical property of the protein. We show that phosphorylated PDPK sites in ORF1p are required for an interaction with the peptidyl prolyl isomerase 1 (Pin1), a critical component of PDPK-mediated regulation. Pin1 acts via isomerization of proline side chains at phosphorylated PDPK motifs, thereby affecting substrate conformation and activity. Our demonstration that L1 activity is dependent on and integrated with cellular phosphorylation regulatory cascades significantly increases our understanding of interactions between L1 and its host.

The relationship of storm severity to directionally resolved radio emissions

NASA Technical Reports Server (NTRS)

Johnson, R. O.; Bushman, M. L.; Sherrill, W. M.

1980-01-01

Directionally resolved atmospheric radio frequency emission data were acquired from thunderstorms occurring in the central and southwestern United States. In addition, RF sferic tracking data were obtained from hurricanes and tropical depressions occurring in the Gulf of Mexico. The data were acquired using a crossed baseline phase interferometer operating at a frequency of 2.001 MHz. The received atmospherics were tested for phase linearity across the array, and azimuth/elevation angles of arrival were computed in real time. A histogram analysis of sferic burst count versus azimuth provided lines of bearing to centers of intense electrical activity. Analysis indicates a consistent capability of the phase linear direction finder to detect severe meteorological activity to distances of 2000 km from the receiving site. The technique evidences the ability to discriminate severe storms from nonsevere storms coexistent in large regional scale thunderstorm activity.

Active-site monovalent cations revealed in a 1.55-Å-resolution hammerhead ribozyme structure.

PubMed

Anderson, Michael; Schultz, Eric P; Martick, Monika; Scott, William G

2013-10-23

We have obtained a 1.55-Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni under conditions that permit detailed observations of Na(+) ion binding in the ribozyme's active site. At least two such Na(+) ions are observed. The first Na(+) ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical with that previously observed for divalent cations. A second Na(+) ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with that of previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na(+), but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na(+) directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active-site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest-resolution ribozyme structure in the Protein Data Bank. Copyright © 2013 Elsevier Ltd. All rights reserved.

Probing Conformational Changes and Interfacial Recognition Site of Lipases With Surfactants and Inhibitors.

PubMed

Mateos-Diaz, E; Amara, S; Roussel, A; Longhi, S; Cambillau, C; Carrière, F

2017-01-01

Structural studies on lipases by X-ray crystallography have revealed conformational changes occurring in the presence of surfactants/inhibitors and the pivotal role played by a molecular "lid" of variable size and structure depending on the enzyme. Besides controlling the access to the enzyme active site, the lid is involved in lipase activation, formation of the interfacial recognition site (IRS), and substrate docking within the active site. The combined use of surfactants and inhibitors has been critical for a better understanding of lipase structure-function relationships. An overview of crystal structures of lipases in complex with surfactants and inhibitors reveals common structural features and shows how surfactants monomers interact with the lid in its open conformation. The location of surfactants, inhibitors, and hydrophobic residues exposed upon lid opening provides insights into the IRS of lipases. The mechanism by which surfactants promote the lid opening can be further investigated in solution by site-directed spin labeling of lipase coupled to electron paramagnetic resonance spectroscopy. These experimental approaches are illustrated here by results obtained with mammalian digestive lipases, fungal lipases, and cutinases. © 2017 Elsevier Inc. All rights reserved.

Roles of the redox-active disulfide and histidine residues forming a catalytic dyad in reactions catalyzed by 2-ketopropyl coenzyme M oxidoreductase/carboxylase.

PubMed

Kofoed, Melissa A; Wampler, David A; Pandey, Arti S; Peters, John W; Ensign, Scott A

2011-09-01

NADPH:2-ketopropyl-coenzyme M oxidoreductase/carboxylase (2-KPCC), an atypical member of the disulfide oxidoreductase (DSOR) family of enzymes, catalyzes the reductive cleavage and carboxylation of 2-ketopropyl-coenzyme M [2-(2-ketopropylthio)ethanesulfonate; 2-KPC] to form acetoacetate and coenzyme M (CoM) in the bacterial pathway of propylene metabolism. Structural studies of 2-KPCC from Xanthobacter autotrophicus strain Py2 have revealed a distinctive active-site architecture that includes a putative catalytic triad consisting of two histidine residues that are hydrogen bonded to an ordered water molecule proposed to stabilize enolacetone formed from dithiol-mediated 2-KPC thioether bond cleavage. Site-directed mutants of 2-KPCC were constructed to test the tenets of the mechanism proposed from studies of the native enzyme. Mutagenesis of the interchange thiol of 2-KPCC (C82A) abolished all redox-dependent reactions of 2-KPCC (2-KPC carboxylation or protonation). The air-oxidized C82A mutant, as well as wild-type 2-KPCC, exhibited the characteristic charge transfer absorbance seen in site-directed variants of other DSOR enzymes but with a pK(a) value for C87 (8.8) four units higher (i.e., four orders of magnitude less acidic) than that for the flavin thiol of canonical DSOR enzymes. The same higher pK(a) value was observed in native 2-KPCC when the interchange thiol was alkylated by the CoM analog 2-bromoethanesulfonate. Mutagenesis of the flavin thiol (C87A) also resulted in an inactive enzyme for steady-state redox-dependent reactions, but this variant catalyzed a single-turnover reaction producing a 0.8:1 ratio of product to enzyme. Mutagenesis of the histidine proximal to the ordered water (H137A) led to nearly complete loss of redox-dependent 2-KPCC reactions, while mutagenesis of the distal histidine (H84A) reduced these activities by 58 to 76%. A redox-independent reaction of 2-KPCC (acetoacetate decarboxylation) was not decreased for any of the aforementioned site-directed mutants. We interpreted and rationalized these results in terms of a mechanism of catalysis for 2-KPCC employing a unique hydrophobic active-site architecture promoting thioether bond cleavage and enolacetone formation not seen for other DSOR enzymes. Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Nanoscale electrochemical patterning reveals the active sites for catechol oxidation at graphite surfaces.

PubMed

Patel, Anisha N; McKelvey, Kim; Unwin, Patrick R

2012-12-19

Graphite-based electrodes (graphite, graphene, and nanotubes) are used widely in electrochemistry, and there is a long-standing view that graphite step edges are needed to catalyze many reactions, with the basal surface considered to be inert. In the present work, this model was tested directly for the first time using scanning electrochemical cell microscopy reactive patterning and shown to be incorrect. For the electro-oxidation of dopamine as a model process, the reaction rate was measured at high spatial resolution across a surface of highly oriented pyrolytic graphite. Oxidation products left behind in a pattern defined by the scanned electrochemical cell served as surface-site markers, allowing the electrochemical activity to be correlated directly with the graphite structure on the nanoscale. This process produced tens of thousands of electrochemical measurements at different locations across the basal surface, unambiguously revealing it to be highly electrochemically active, with step edges providing no enhanced activity. This new model of graphite electrodes has significant implications for the design of carbon-based biosensors, and the results are additionally important for understanding electrochemical processes on related sp(2)-hybridized materials such as pristine graphene and nanotubes.

Tetramethylpyrazine-Inducible Promoter Region from Rhodococcus jostii TMP1.

PubMed

Stanislauskienė, Rūta; Kutanovas, Simonas; Kalinienė, Laura; Bratchikov, Maksim; Meškys, Rolandas

2018-06-25

An inducible promoter region, P TTMP (tetramethylpyrazine [TTMP]), has been identified upstream of the tpdABC operon, which contains the genes required for the initial degradation of 2,3,5,6-tetramethylpyrazine in Rhodococcus jostii TMP1 bacteria. In this work, the promoter region was fused with the gene for the enhanced green fluorescent protein (EGFP) to investigate the activity of P TTMP by measuring the fluorescence of bacteria. The highest promoter activity was observed when bacteria were grown in a nutrient broth (NB) medium supplemented with 5 mM 2,3,5,6-tetramethylpyrazine for 48 h. Using a primer extension reaction, two transcriptional start sites for tpdA were identified, and the putative −35 and −10 promoter motifs were determined. The minimal promoter along with two 15 bp long direct repeats and two 7 bp inverted sequences were identified. Also, the influence of the promoter elements on the activity of P TTMP were determined using site-directed mutagenesis. Furthermore, P TTMP was shown to be induced by pyrazine derivatives containing methyl groups in the 2- and 5-positions of the heterocyclic ring, in the presence of the LuxR family transcriptional activator TpdR.

Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface*

PubMed Central

Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei

2016-01-01

Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. PMID:26912659

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

25 CFR 900.113 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-04-01

... contract. This does not involve construction project management as defined in paragraph (d) of this section...) Construction project management means direct responsibility for the construction project through day-to-day on-site management and administration of the project. Activities may include cost management, project...

Genetic engineering of microbial pesticides

Treesearch

Bruce C. Carlton

1985-01-01

Recent advances in genetics and molecular biology make possible the cloning and genetic manipulation of genes for insecticidal activities from natural insect pathogens. Using recombinant DNA methods and site-directed mutagenesis of specific gene regions, production of new and improved biorationals should be possible.

Rediscovering the wound haematoma as a site of haemostasis during major arterial haemorrhage

PubMed Central

White, N.J.; Mehic, E.; Wang, X.; Chien, D.; Lim, E.; St. John, A.E.; Stern, S.A.; Mourad, P.D.; Rieger, M.; Fries, D.; Martinowitz, U.

2015-01-01

Background Treatments for major internal bleeding after injury include permissive hypotension to decrease the rate of blood loss, intravenous infusion of plasma or clotting factors to improve clot formation, and rapid surgical haemostasis or arterial embolization to control bleeding vessels. Yet, little is known regarding major internal arterial haemostasis, or how these commonly-used treatments might influence haemostasis. Objectives (1) Use a swine model of femoral artery bleeding to understand the perivascular haemostatic response to contained arterial haemorrhage. (2) Directly confirm the association between hemodynamics and bleeding velocity. (3) Observe the feasibility of delivering an activated clotting factor directly to internal sites of bleeding using a simplified angiographic approach. Methods Ultrasound was used to measure bleeding velocity and in vivo clot formation by elastography in a swine model of contained femoral artery bleeding with fluid resuscitation. A swine model of internal pelvic and axillary artery haemorrhage was also used to demonstrate feasibility of local delivery of an activated clotting factor. Results In this model, clots formed slowly within the peri-wound hematoma , but eventually containing the bleeding. Central hemodynamics correlated positively with bleeding velocity. Infusion of recombinant human activated Factor VII into the injured artery nearby the site of major internal haemorrhage in the pelvis and axillae was feasible. Conclusions We rediscover that clot formation within the peri-wound haematoma is an integral component of haemostasis and a feasible target for treatment of major internal bleeding using activated clotting factors delivered using a simplified angiographic approach. PMID:26414624

Purification and Kinetics of Higher Plant NADH:Nitrate Reductase.

PubMed

Campbell, W H; Smarrelli, J

1978-04-01

Squash cotyledon (Cucurbita pepo L.) NADH:nitrate reductase (NR) was purified 150-fold with 50% recovery by a single step procedure based on the affinity of the NR for blue-Sepharose. Blue-Sepharose, which is prepared by direct coupling of Cibacron blue to Sepharose, appears to bind squash NR at the NADH site. The NR can be purified in 2 to 3 hours to a specific activity of 2 mumol of NADH oxidized/minute * milligram of protein. Corn (Zea mays L.) leaf NR was also purified to a specific activity of 6.9 mumol of NADH oxidized/minute * milligram of protein using a blue-Sepharose affinity step. The blue-Sepharose method offers the advantages of a rapid purification of plant NR to a high specific activity with reasonable recovery of total activity.The kinetic mechanism of higher plant NR was investigated using these highly purified squash and corn NR preparations. Based on initial velocity and product inhibition studies utilizing both enzymes, a two-site ping-pong mechanism is proposed for NR. This kinetic mechanism incorporates the concept of the reduced NR transferring electrons from the NADH site to a physically separated nitrate site.

Crystal Structure of Toxoplasma gondii Porphobilinogen Synthase

PubMed Central

Jaffe, Eileen K.; Shanmugam, Dhanasekaran; Gardberg, Anna; Dieterich, Shellie; Sankaran, Banumathi; Stewart, Lance J.; Myler, Peter J.; Roos, David S.

2011-01-01

Porphobilinogen synthase (PBGS) is essential for heme biosynthesis, but the enzyme of the protozoan parasite Toxoplasma gondii (TgPBGS) differs from that of its human host in several important respects, including subcellular localization, metal ion dependence, and quaternary structural dynamics. We have solved the crystal structure of TgPBGS, which contains an octamer in the crystallographic asymmetric unit. Crystallized in the presence of substrate, each active site contains one molecule of the product porphobilinogen. Unlike prior structures containing a substrate-derived heterocycle directly bound to an active site zinc ion, the product-bound TgPBGS active site contains neither zinc nor magnesium, placing in question the common notion that all PBGS enzymes require an active site metal ion. Unlike human PBGS, the TgPBGS octamer contains magnesium ions at the intersections between pro-octamer dimers, which are presumed to function in allosteric regulation. TgPBGS includes N- and C-terminal regions that differ considerably from previously solved crystal structures. In particular, the C-terminal extension found in all apicomplexan PBGS enzymes forms an intersubunit β-sheet, stabilizing a pro-octamer dimer and preventing formation of hexamers that can form in human PBGS. The TgPBGS structure suggests strategies for the development of parasite-selective PBGS inhibitors. PMID:21383008

Continuous directed evolution of aminoacyl-tRNA synthetases

PubMed Central

Bryson, David I.; Fan, Chenguang; Guo, Li-Tao; Miller, Corwin; Söll, Dieter; Liu, David R.

2017-01-01

Directed evolution of orthogonal aminoacyl-tRNA synthetases (AARSs) enables site-specific installation of non-canonical amino acids (ncAAs) into proteins. Traditional evolution techniques typically produce AARSs with greatly reduced activity and selectivity compared to their wild-type counterparts. We designed phage-assisted continuous evolution (PACE) selections to rapidly produce highly active and selective orthogonal AARSs through hundreds of generations of evolution. PACE of a chimeric Methanosarcina spp. pyrrolysyl-tRNA synthetase (PylRS) improved its enzymatic efficiency (kcat/KMtRNA) 45-fold compared to the parent enzyme. Transplantation of the evolved mutations into other PylRS-derived synthetases improved yields of proteins containing non-canonical residues up to 9.7-fold. Simultaneous positive and negative selection PACE over 48 h greatly improved the selectivity of a promiscuous Methanocaldococcus jannaschii tyrosyl-tRNA synthetase variant for site-specific incorporation of p-iodo-L-phenylalanine. These findings offer new AARSs that increase the utility of orthogonal translation systems and establish the capability of PACE to efficiently evolve orthogonal AARSs with high activity and amino acid specificity. PMID:29035361

Vegetation dynamics in Bishrampur collieries of northern Chhattisgarh, India: eco-restoration and management perspectives.

PubMed

Kumar, A; Jhariya, M K; Yadav, D K; Banerjee, A

2017-08-01

Phytosociological study in and around reclaimed coal mine site is an essential requirement for judging restoration impact on a disturbed site. Various studies have been aimed towards assessing the impact of different restoration practices on coal mine wastelands. Plantation scheme in a scientific way is the most suitable approach in this context. During the present investigation, an effort have been made to assess the vegetation dynamics through structure, composition, diversity, and forest floor biomass analysis in and around Bishrampur collieries, Sarguja division, northern Chhattisgarh, India. We have tried to develop strategies for eco-restoration and habitat management of the concerned study sites. Four sites were randomly selected in different directions of the study area. We classified the vegetation community of the study sites into various strata on the basis of height. Two hundred forty quadrats were laid down in various directions of the study area to quantify vegetation under different strata. During our investigation, we found eight different tree species representing four families in the different study sites. The density of the various tree species ranged between 40 and 160 individuals ha -1 . The density of sapling, seedling, shrub, and herb ranged between 740 and 1620; 2000 and 6000; 1200 and 2000; and 484,000 and 612,000 individuals ha -1 , respectively, in different directions. The diversity indices of the tree reflected highest Shannon index value of 1.91. Simpsons index ranged between 0.28 and 0.50, species richness ranged between 0.27 and 0.61, equitability up to 1.44, and Beta diversity ranged between 2.00 and 4.00. Total forest floor biomass ranged between 4.20 and 5.65 t/ha among the study sites. Highest forest floor biomass occurred in the south direction and lowest at east direction. Total forest floor biomass declined by 6.19% in west, 13.10% in north, and 25.66% in east direction, respectively. The mining activities resulted significant damage to natural vegetation and its dynamics. The study indicated that Acacia mangium, Cassia siamea, and Dalbergia sissoo can be recommended for effective eco-restoration of the concerned sites due to cosmopolitan distribution, high regeneration potential, as well as existence in the form of various girth classes with stable population structure.

Novel multitarget-directed ligands (MTDLs) with acetylcholinesterase (AChE) inhibitory and serotonergic subtype 4 receptor (5-HT4R) agonist activities as potential agents against Alzheimer's disease: the design of donecopride.

PubMed

Rochais, Christophe; Lecoutey, Cédric; Gaven, Florence; Giannoni, Patrizia; Hamidouche, Katia; Hedou, Damien; Dubost, Emmanuelle; Genest, David; Yahiaoui, Samir; Freret, Thomas; Bouet, Valentine; Dauphin, François; Sopkova de Oliveira Santos, Jana; Ballandonne, Céline; Corvaisier, Sophie; Malzert-Fréon, Aurélie; Legay, Remi; Boulouard, Michel; Claeysen, Sylvie; Dallemagne, Patrick

2015-04-09

In this work, we describe the synthesis and in vitro evaluation of a novel series of multitarget-directed ligands (MTDL) displaying both nanomolar dual-binding site (DBS) acetylcholinesterase inhibitory effects and partial 5-HT4R agonist activity, among which donecopride was selected for further in vivo evaluations in mice. The latter displayed procognitive and antiamnesic effects and enhanced sAPPα release, accounting for a potential symptomatic and disease-modifying therapeutic benefit in the treatment of Alzheimer's disease.

Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

2012-10-24

This plan incorporates U.S. Department of Energy (DOE) Office of Legacy Management (LM) standard operating procedures (SOPs) into environmental monitoring activities and will be implemented at all sites managed by LM. This document provides detailed procedures for the field sampling teams so that samples are collected in a consistent and technically defensible manner. Site-specific plans (e.g., long-term surveillance and maintenance plans, environmental monitoring plans) document background information and establish the basis for sampling and monitoring activities. Information will be included in site-specific tabbed sections to this plan, which identify sample locations, sample frequencies, types of samples, field measurements, and associatedmore » analytes for each site. Additionally, within each tabbed section, program directives will be included, when developed, to establish additional site-specific requirements to modify or clarify requirements in this plan as they apply to the corresponding site. A flowchart detailing project tasks required to accomplish routine sampling is displayed in Figure 1. LM environmental procedures are contained in the Environmental Procedures Catalog (LMS/PRO/S04325), which incorporates American Society for Testing and Materials (ASTM), DOE, and U.S. Environmental Protection Agency (EPA) guidance. Specific procedures used for groundwater and surface water monitoring are included in Appendix A. If other environmental media are monitored, SOPs used for air, soil/sediment, and biota monitoring can be found in the site-specific tabbed sections in Appendix D or in site-specific documents. The procedures in the Environmental Procedures Catalog are intended as general guidance and require additional detail from planning documents in order to be complete; the following sections fulfill that function and specify additional procedural requirements to form SOPs. Routine revision of this Sampling and Analysis Plan will be conducted annually at the beginning of each fiscal year when attachments in Appendix D, including program directives and sampling location/analytical tables, will be reviewed by project personnel and updated. The sampling location/analytical tables in Appendix D, however, may have interim updates according to project direction that are not reflected in this plan. Deviations from location/analytical tables in Appendix D prior to sampling will be documented in project correspondence (e.g., startup letters). If significant changes to other aspects of this plan are required before the annual update, then the plan will be revised as needed.« less

Study of a metallurgical site in Tuscany (Italy) by radiocarbon dating

NASA Astrophysics Data System (ADS)

Cartocci, A.; Fedi, M. E.; Taccetti, F.; Benvenuti, M.; Chiarantini, L.; Guideri, S.

2007-06-01

Tuscany represents one of the most important ancient mining districts of Italy. Metalworking activities have been present in the area since ancient times and several mining centres have been active in the region since the Etruscan period. Two of the more notable mining locations are the island of Elba and the towns of Populonia and Massa Marittima. In order to reconstruct the development of metallurgical techniques in the past, a multi-disciplinary approach is required, involving both archaeological study and archaeometric analysis of the sites of interest. One of the most complex problems is establishing the chronological history of metallurgical exploitation in ancient sites: archaeological remains are sometimes incomplete and the stratigraphy of archaeological horizons might have been deeply altered. Thus, direct dating of metallurgical slags and other remains of mining and metalworking activities using radiocarbon measurements is particularly useful for developing site chronologies. Charcoal samples from a recent excavation in Populonia were dated by AMS radiocarbon in order to reconstruct the chronological evolution of ancient metallurgical production; results reported here are consistent with archaeological observations.

Driving Protein Conformational Changes with Light: Photoinduced Structural Rearrangement in a Heterobimetallic Oxidase.

PubMed

Maugeri, Pearson T; Griese, Julia J; Branca, Rui M; Miller, Effie K; Smith, Zachary R; Eirich, Jürgen; Högbom, Martin; Shafaat, Hannah S

2018-01-31

The heterobimetallic R2lox protein binds both manganese and iron ions in a site-selective fashion and activates oxygen, ultimately performing C-H bond oxidation to generate a tyrosine-valine cross-link near the active site. In this work, we demonstrate that, following assembly, R2lox undergoes photoinduced changes to the active site geometry and metal coordination motif. Through spectroscopic, structural, and mass spectrometric characterization, the photoconverted species is found to consist of a tyrosinate-bound iron center following light-induced decarboxylation of a coordinating glutamate residue and cleavage of the tyrosine-valine cross-link. This process occurs with high quantum efficiencies (Φ = 3%) using violet and near-ultraviolet light, suggesting that the photodecarboxylation is initiated via ligand-to-metal charge transfer excitation. Site-directed mutagenesis and structural analysis suggest that the cross-linked tyrosine-162 is the coordinating residue. One primary product is observed following irradiation, indicating potential use of this class of proteins, which contains a putative substrate channel, for controlled photoinduced decarboxylation processes, with relevance for in vivo functionality of R2lox as well as application in environmental remediation.

Identification of Bacteria Synthesizing Ribosomal RNA in Response to Uranium Addition During Biostimulation at the Rifle, CO Integrated Field Research Site

PubMed Central

McGuinness, Lora R.; Wilkins, Michael J.; Williams, Kenneth H.; Long, Philip E.; Kerkhof, Lee J.

2015-01-01

Understanding which organisms are capable of reducing uranium at historically contaminated sites provides crucial information needed to evaluate treatment options and outcomes. One approach is determination of the bacteria which directly respond to uranium addition. In this study, uranium amendments were made to groundwater samples from a site of ongoing biostimulation with acetate. The active microbes in the planktonic phase were deduced by monitoring ribosomes production via RT-PCR. The results indicated several microorganisms were synthesizing ribosomes in proportion with uranium amendment up to 2 μM. Concentrations of U (VI) >2 μM were generally found to inhibit ribosome synthesis. Two active bacteria responding to uranium addition in the field were close relatives of Desulfobacter postgateii and Geobacter bemidjiensis. Since RNA content often increases with growth rate, our findings suggest it is possible to rapidly elucidate active bacteria responding to the addition of uranium in field samples and provides a more targeted approach to stimulate specific populations to enhance radionuclide reduction in contaminated sites. PMID:26382047

Postirradiation Testing Laboratory (327 Building)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kammenzind, D.E.

A Standards/Requirements Identification Document (S/RID) is the total list of the Environment, Safety and Health (ES and H) requirements to be implemented by a site, facility, or activity. These requirements are appropriate to the life cycle phase to achieve an adequate level of protection for worker and public health and safety, and the environment during design, construction, operation, decontamination and decommissioning, and environmental restoration. S/RlDs are living documents, to be revised appropriately based on change in the site`s or facility`s mission or configuration, a change in the facility`s life cycle phase, or a change to the applicable standards/requirements. S/RIDs encompassmore » health and safety, environmental, and safety related safeguards and security (S and S) standards/requirements related to the functional areas listed in the US Department of Energy (DOE) Environment, Safety and Health Configuration Guide. The Fluor Daniel Hanford (FDH) Contract S/RID contains standards/requirements, applicable to FDH and FDH subcontractors, necessary for safe operation of Project Hanford Management Contract (PHMC) facilities, that are not the direct responsibility of the facility manager (e.g., a site-wide fire department). Facility S/RIDs contain standards/requirements applicable to a specific facility that are the direct responsibility of the facility manager. S/RlDs are prepared by those responsible for managing the operation of facilities or the conduct of activities that present a potential threat to the health and safety of workers, public, or the environment, including: Hazard Category 1 and 2 nuclear facilities and activities, as defined in DOE 5480.23. Selected Hazard Category 3 nuclear, and Low Hazard non-nuclear facilities and activities, as agreed upon by RL. The Postirradiation Testing Laboratory (PTL) S/RID contains standards/ requirements that are necessary for safe operation of the PTL facility, and other building/areas that are the direct responsibility of the specific facility manager. The specific DOE Orders, regulations, industry codes/standards, guidance documents and good industry practices that serve as the basis for each element/subelement are identified and aligned with each subelement.« less

Superfund Site Information

EPA Pesticide Factsheets

This asset includes a number of individual data sets related to site-specific information for Superfund, which is governed under the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) of 1980, which was amended by the Superfund Amendments and Reauthorization Act (SARA) in 1986. The Superfund Enterprise Management System (SEMS) contains basic site description, location, schedule of activities, enforcement and settlement data, contaminants and selected remedy and much more, as well as the records that clearly document site decisions. This asset also includes sampling data and lab results (CLPSS, EDDs), redevelopment and technical assistance case studies, site reuse and land revitalization information, EPAOSC.net information, Superfund Technical Assistance Grants information, site management information records (RODs, Remediation plans, cleanup directives), contract management information, and more.Superfund site management information can also be found in agency wide systems such as EAS and COMPASS.

In silico investigation into the interactions between murine 5-HT3 receptor and the principle active compounds of ginger (Zingiber officinale).

PubMed

Lohning, Anna E; Marx, Wolfgang; Isenring, Liz

2016-11-01

Gingerols and shogaols are the primary non-volatile actives within ginger (Zingiber officinale). These compounds have demonstrated in vitro to exert 5-HT 3 receptor antagonism which could benefit chemotherapy-induced nausea and vomiting (CINV). The site and mechanism of action by which these compounds interact with the 5-HT 3 receptor is not fully understood although research indicates they may bind to a currently unidentified allosteric binding site. Using in silico techniques, such as molecular docking and GRID analysis, we have characterized the recently available murine 5-HT 3 receptor by identifying sites of strong interaction with particular functional groups at both the orthogonal (serotonin) site and a proposed allosteric binding site situated at the interface between the transmembrane region and the extracellular domain. These were assessed concurrently with the top-scoring poses of the docked ligands and included key active gingerols, shogaols and dehydroshogaols as well as competitive antagonists (e.g. setron class of pharmacologically active drugs), serotonin and its structural analogues, curcumin and capsaicin, non-competitive antagonists and decoys. Unexpectedly, we found that the ginger compounds and their structural analogs generally outscored other ligands at both sites. Our results correlated well with previous site-directed mutagenesis studies in identifying key binding site residues. We have identified new residues important for binding the ginger compounds. Overall, the results suggest that the ginger compounds and their structural analogues possess a high binding affinity to both sites. Notwithstanding the limitations of such theoretical analyses, these results suggest that the ginger compounds could act both competitively or non-competitively as has been shown for palonosetron and other modulators of CYS loop receptors. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of essential histidine residues in the active site of Escherichia coli xylose (glucose) isomerase.

PubMed Central

Batt, C A; Jamieson, A C; Vandeyar, M A

1990-01-01

Two conserved histidine residues (His-101 and His-271) appear to be essential components in the active site of the enzyme xylose (glucose) isomerase (EC 5.3.1.5). These amino acid residues were targeted for mutagenesis on the basis of sequence homology among xylose isomerases isolated from Escherichia coli, Bacillus subtilis, Ampullariella sp. strain 3876, and Streptomyces violaceus-niger. Each residue was selectively replaced by site-directed mutagenesis and shown to be essential for activity. No measurable activity was observed for any mutations replacing either His-101 or His-271. Circular dichroism measurements revealed no significant change in the overall conformation of the mutant enzymes, and all formed dimers similar to the wild-type enzyme. Mutations at His-271 could be distinguished from those at His-101, since the former resulted in a thermolabile protein whereas no significant change in heat stability was observed for the latter. Based upon these results and structural data recently reported, we speculate that His-101 is the catalytic base mediating the reaction. Replacement of His-271 may render the enzyme thermolabile, since this residue appears to be a ligand for one of the metal ions in the active site of the enzyme. Images PMID:2405386

The 3'-5' exonuclease of DNA polymerase I of Escherichia coli: contribution of each amino acid at the active site to the reaction.

PubMed Central

Derbyshire, V; Grindley, N D; Joyce, C M

1991-01-01

We have used site-directed mutagenesis to change amino acid side chains that have been shown crystallographically to be in close proximity to a DNA 3' terminus bound at the 3'-5' exonuclease active site of Klenow fragment. Exonuclease assays of the resulting mutant proteins indicate that the largest effects on exonuclease activity result from mutations in a group of carboxylate side chains (Asp355, Asp424 and Asp501) anchoring two divalent metal ions that are essential for exonuclease activity. Another carboxylate (Glu357) within this cluster seems to be less important as a metal ligand, but may play a separate role in catalysis of the exonuclease reaction. A second group of residues (Leu361, Phe473 and Tyr497), located around the terminal base and ribose positions, plays a secondary role, ensuring correct positioning of the substrate in the active site and perhaps also facilitating melting of a duplex DNA substrate by interacting with the frayed 3' terminus. The pH-dependence of the 3'-5' exonuclease reaction is consistent with a mechanism in which nucleophilic attack on the terminal phosphodiester bond is initiated by a hydroxide ion coordinated to one of the enzyme-bound metal ions. PMID:1989882

Site-directed mutagenesis of the regulatory light-chain Ca2+/Mg2+ binding site and its role in hybrid myosins

NASA Astrophysics Data System (ADS)

Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John

1986-07-01

The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.

Direct photoaffinity labeling of an allosteric site on subunit protein M1 of mouse ribonucleotide reductase by dTTP.

PubMed Central

Eriksson, S; Caras, I W; Martin, D W

1982-01-01

The protein M1 subunit of ribonucleotide reductase contains at least two allosteric nucleotide binding sites that control the capacity of the enzyme to reduce ribonucleotides to the deoxyribonucleotides required for DNA synthesis. Direct photoaffinity labeling of partially purified protein M1 from mouse T-lymphoma (S49) cells was observed after UV irradiation in the presence of dTTP at 0 degrees C. The relative molar incorporation of nucleotide per subunit was 4-8%. Competition experiments showed that the dTTP was bound to an allosteric domain genetically and kinetically defined as the substrate specificity site of the enzyme. An altered protein M1 isolated from a thymidine-resistant mutant cell line showed significantly decreased photoincorporation of dTTP, consistent with the fact that its CDP reductase activity is resistant to feedback inhibition by dTTP. Specific photolabeling of several other proteins with pyrimidine and purine nucleotides was also found, indicating the general usefulness of direct photoaffinity labeling in the study of enzymes involved in nucleotide and nucleic acid metabolism. Images PMID:7033963

Structural and functional determination of homologs of the Mycobacterium tuberculosisN-acetylglucosamine-6-phosphate deacetylase (NagA).

PubMed

Ahangar, Mohd Syed; Furze, Christopher M; Guy, Collette S; Cooper, Charlotte; Maskew, Kathryn S; Graham, Ben; Cameron, Alexander D; Fullam, Elizabeth

2018-05-04

The Mycobacterium tuberculosis (Mtb) pathogen encodes an N -acetylglucosamine-6-phosphate deacetylase enzyme, NagA (Rv3332), that belongs to the amidohydrolase superfamily. NagA enzymes catalyze the deacetylation of N -acetylglucosamine-6-phosphate (GlcNAc6P) to glucosamine-6-phosphate (GlcN6P). NagA is a potential anti-tubercular drug target because it represents the key enzymatic step in the generation of essential amino-sugar precursors required for Mtb cell wall biosynthesis and also influences recycling of cell wall peptidoglycan fragments. Here, we report the structural and functional characterization of NagA from Mycobacterium smegmatis (MSNagA) and Mycobacterium marinum (MMNagA), close relatives of Mtb Using a combination of X-ray crystallography, site-directed mutagenesis, and biochemical and biophysical assays, we show that these mycobacterial NagA enzymes are selective for GlcNAc6P. Site-directed mutagenesis studies revealed crucial roles of conserved residues in the active site that underpin stereo-selective recognition, binding, and catalysis of substrates. Moreover, we report the crystal structure of MSNagA in both ligand-free form and in complex with the GlcNAc6P substrate at 2.6 Å and 2.0 Å resolutions, respectively. The GlcNAc6P-complex structure disclosed the precise mode of GlcNAc6P binding and the structural framework of the active site, including two divalent metals located in the α/β binuclear site. Furthermore, we observed a cysteine residue located on a flexible loop region that occludes the active site. This cysteine is unique to mycobacteria and may represent a unique subsite for targeting mycobacterial NagA enzymes. Our results provide critical insights into the structural and mechanistic properties of mycobacterial NagA enzymes having an essential role in amino-sugar and nucleotide metabolism in mycobacteria. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Research on homology modeling, molecular docking of the cellulase and highly expression of the key enzyme (Bgl) in Pichia pastoris.

PubMed

Tang, Zizhong; Jin, Weiqiong; Tang, Yujia; Wang, Yinsheng; Wang, Chang; Zheng, Xi; Sun, Wenjun; Liu, Moyang; Zheng, Tianrun; Chen, Hui; Wu, Qi; Shan, Zhi; Bu, Tongliang; Li, Chenglei

2018-08-01

Cellulose is the most abundant and renewable biological resource on earth. As nonrenewable resources are becoming scarce, cellulose is expected to become a major raw material for food, energy, fuel and other products. 1,4-β-glucosidase (Bgl), as a kind of cellulose, can be degraded cellulose into industrial available glucose. In this study, we constructed mutants of Bgl with enhanced activity based on homology modeling, molecular docking, and the site-directed mutagenesis of target residues to modify spatial positions, steric hindrances, or hydrophilicity/hydrophobicity. On the basis of the high-activity mutations were got (N347S and G235 M) by using site-directed mutagenesis and screening methods and introduced in the Pichia pastoris expression system, the enzymatic properties of mutant enzymes were analysed. Assays of the activity of the purified Bgl revealed that the two mutants exhibited increased activity. The pPICZαA-G235 M and pPICZαA-N347S mutants exhibited a >33.4% and 44.8% increase in specific activity respectively, with similar pH, temperature and metal ion requirements, compared to wild-type Bgl. These findings would be good foundation for improving production properties of Bgl in the future. Copyright © 2018 Elsevier B.V. All rights reserved.

Magnesium-adenosine diphosphate binding sites in wild-type creatine kinase and in mutants: role of aromatic residues probed by Raman and infrared spectroscopies.

PubMed

Hagemann, H; Marcillat, O; Buchet, R; Vial, C

2000-08-08

Two distinct methods were used to investigate the role of Trp residues during Mg-ADP binding to cytosolic creatine kinase (CK) from rabbit muscle: (1) Raman spectroscopy, which is very sensitive to the environment of aromatic side-chain residues, and (2) reaction-induced infrared difference spectroscopy (RIDS) and photolabile substrate (ADP[Et(PhNO(2))]), combined with site-directed mutagenesis on the four Trp residues of CK. Our Raman results indicated that the environment of Trp and of Tyr were not affected during Mg-ADP binding to CK. Analysis of RIDS of wild-type CK, inactive W227Y, and active W210,217,272Y mutants suggested that Trp227 was not involved in the stacking interactions. Results are consistent with Trp227 being essential to prevent water molecules from entering in the active site [as suggested by Gross, M., Furter-Graves, E. M., Wallimann, T., Eppenberger, H. M., and Furter, R. (1994) Protein Sci. 3, 1058-1068] and that another Trp could in addition help to steer the nucleotide in the binding site, although it is not essential for the activity of CK. Raman and infrared spectra indicated that Mg-ADP binding does not involve large secondary structure changes. Only 3-4 residues absorbing in the amide I region are directly implicated in the Mg-ADP binding (corresponding to secondary structure changes less than 1%), suggesting that movement of protein domains due to Mg-nucleotide binding do not promote large secondary structure changes.

Noninvasive cardiac activation imaging of ventricular arrhythmias during drug-induced QT prolongation in the rabbit heart.

PubMed

Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; Zhou, Zhaoye; He, Bin

2013-10-01

Imaging myocardial activation from noninvasive body surface potentials promises to aid in both cardiovascular research and clinical medicine. To investigate the ability of a noninvasive 3-dimensional cardiac electrical imaging technique for characterizing the activation patterns of dynamically changing ventricular arrhythmias during drug-induced QT prolongation in rabbits. Simultaneous body surface potential mapping and 3-dimensional intracardiac mapping were performed in a closed-chest condition in 8 rabbits. Data analysis was performed on premature ventricular complexes, couplets, and torsades de pointes (TdP) induced during intravenous administration of clofilium and phenylephrine with combinations of various infusion rates. The drug infusion led to a significant increase in the QT interval (from 175 ± 7 to 274 ± 31 ms) and rate-corrected QT interval (from 183 ± 5 to 262 ± 21 ms) during the first dose cycle. All the ectopic beats initiated by a focal activation pattern. The initial beat of TdPs arose at the focal site, whereas the subsequent beats were due to focal activity from different sites or 2 competing focal sites. The imaged results captured the dynamic shift of activation patterns and were in good correlation with the simultaneous measurements, with a correlation coefficient of 0.65 ± 0.02 averaged over 111 ectopic beats. Sites of initial activation were localized to be ~5 mm from the directly measured initiation sites. The 3-dimensional cardiac electrical imaging technique could localize the origin of activation and image activation sequence of TdP during QT prolongation induced by clofilium and phenylephrine in rabbits. It offers the potential to noninvasively investigate the proarrhythmic effects of drug infusion and assess the mechanisms of arrhythmias on a beat-to-beat basis. © 2013 Heart Rhythm Society. All rights reserved.

Active chemisorption sites in functionalized ionic liquids for carbon capture.

PubMed

Cui, Guokai; Wang, Jianji; Zhang, Suojiang

2016-07-25

Development of novel technologies for the efficient and reversible capture of CO2 is highly desired. In the last decade, CO2 capture using ionic liquids has attracted intensive attention from both academia and industry, and has been recognized as a very promising technology. Recently, a new approach has been developed for highly efficient capture of CO2 by site-containing ionic liquids through chemical interaction. This perspective review focuses on the recent advances in the chemical absorption of CO2 using site-containing ionic liquids, such as amino-based ionic liquids, azolate ionic liquids, phenolate ionic liquids, dual-functionalized ionic liquids, pyridine-containing ionic liquids and so on. Other site-containing liquid absorbents such as amine-based solutions, switchable solvents, and functionalized ionic liquid-amine blends are also investigated. Strategies have been discussed for how to activate the existent reactive sites and develop novel reactive sites by physical and chemical methods to enhance CO2 absorption capacity and reduce absorption enthalpy. The carbon capture mechanisms of these site-containing liquid absorbents are also presented. Particular attention has been paid to the latest progress in CO2 capture in multiple-site interactions by amino-free anion-functionalized ionic liquids. In the last section, future directions and prospects for carbon capture by site-containing ionic liquids are outlined.

Locomotor activity influences muscle architecture and bone growth but not muscle attachment site morphology.

PubMed

Rabey, Karyne N; Green, David J; Taylor, Andrea B; Begun, David R; Richmond, Brian G; McFarlin, Shannon C

2015-01-01

The ability to make behavioural inferences from skeletal remains is critical to understanding the lifestyles and activities of past human populations and extinct animals. Muscle attachment site (enthesis) morphology has long been assumed to reflect muscle strength and activity during life, but little experimental evidence exists to directly link activity patterns with muscle development and the morphology of their attachments to the skeleton. We used a mouse model to experimentally test how the level and type of activity influences forelimb muscle architecture of spinodeltoideus, acromiodeltoideus, and superficial pectoralis, bone growth rate and gross morphology of their insertion sites. Over an 11-week period, we collected data on activity levels in one control group and two experimental activity groups (running, climbing) of female wild-type mice. Our results show that both activity type and level increased bone growth rates influenced muscle architecture, including differences in potential muscular excursion (fibre length) and potential force production (physiological cross-sectional area). However, despite significant influences on muscle architecture and bone development, activity had no observable effect on enthesis morphology. These results suggest that the gross morphology of entheses is less reliable than internal bone structure for making inferences about an individual's past behaviour. Copyright © 2014 Elsevier Ltd. All rights reserved.

Locomotor activity influences muscle architecture and bone growth but not muscle attachment site morphology

PubMed Central

Rabey, Karyne N.; Green, David J.; Taylor, Andrea B.; Begun, David R.; Richmond, Brian G.; McFarlin, Shannon C.

2014-01-01

The ability to make behavioural inferences from skeletal remains is critical to understanding the lifestyles and activities of past human populations and extinct animals. Muscle attachment site (enthesis) morphology has long been assumed to reflect muscle strength and activity during life, but little experimental evidence exists to directly link activity patterns with muscle development and the morphology of their attachments to the skeleton. We used a mouse model to experimentally test how the level and type of activity influences forelimb muscle architecture of spinodeltoideus, acromiodeltoideus, and superficial pectoralis, bone growth rate and gross morphology of their insertion sites. Over an 11-week period, we collected data on activity levels in one control group and two experimental activity groups (running, climbing) of female wild-type mice. Our results show that both activity type and level increased bone growth rates influenced muscle architecture, including differences in potential muscular excursion (fibre length) and potential force production (physiological cross-sectional area). However, despite significant influences on muscle architecture and bone development, activity had no observable effect on enthesis morphology. These results suggest that the gross morphology of entheses is less reliable than internal bone structure for making inferences about an individual’s past behaviour. PMID:25467113

A lesson for site-selective C-H functionalization on 2-pyridones: radical, organometallic, directing group and steric controls.

PubMed

Hirano, Koji; Miura, Masahiro

2018-01-07

A 2-pyridone ring is a frequently occurring subunit in natural products, biologically active compounds, and pharmaceutical targets. Thus, the selective synthesis of substituted 2-pyridone derivatives through decoration and/or formation of pyridone rings has been one of the important longstanding subjects in organic synthetic chemistry. This minireview focuses on recent advances in site-selective C-H functionalization on 2-pyridone. The reported procedures are categorized according to the site selectivity that is achieved, and the substrate scope, limitations, mechanism, and controlling factors are briefly summarized.

A lesson for site-selective C–H functionalization on 2-pyridones: radical, organometallic, directing group and steric controls

PubMed Central

2017-01-01

A 2-pyridone ring is a frequently occurring subunit in natural products, biologically active compounds, and pharmaceutical targets. Thus, the selective synthesis of substituted 2-pyridone derivatives through decoration and/or formation of pyridone rings has been one of the important longstanding subjects in organic synthetic chemistry. This minireview focuses on recent advances in site-selective C–H functionalization on 2-pyridone. The reported procedures are categorized according to the site selectivity that is achieved, and the substrate scope, limitations, mechanism, and controlling factors are briefly summarized. PMID:29629070

REGULATORY PROGRAMS. USEPA PERSPECTIVE ON THE REMEDIATION OF CONTAMINATED WOOD PRESERVING SITES.

EPA Science Inventory

Since the enactment of the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) and the Resource Conservation and Recovery Act (RCRA), as amended, many directives and initiatives have been established which govern various aspects of remedial activities at...

42 CFR 485.703 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-10-01

.... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

42 CFR 485.703 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-10-01

.... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

42 CFR 485.703 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

.... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

42 CFR 485.703 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-10-01

.... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

42 CFR 485.703 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-10-01

.... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

Solar System Number-Crunching.

ERIC Educational Resources Information Center

Albrecht, Bob; Firedrake, George

1997-01-01

Defines terrestrial and Jovian planets and provides directions to obtain planetary data from the National Space Science Data Center Web sites. Provides "number-crunching" activities for the terrestrial planets using Texas Instruments TI-83 graphing calculators: computing volumetric mean radius and volume, density, ellipticity, speed,…

Litter type affects the activity of aerobic decomposers in a boreal peatland more than site nutrient and water table regimes

NASA Astrophysics Data System (ADS)

Straková, P.; Niemi, R. M.; Freeman, C.; Peltoniemi, K.; Toberman, H.; Heiskanen, I.; Fritze, H.; Laiho, R.

2011-09-01

Peatlands are carbon (C) storage ecosystems sustained by a high water table (WT). High WT creates anoxic conditions that suppress the activity of aerobic decomposers and provide conditions for peat accumulation. Peatland function can be dramatically affected by WT drawdown caused by climate and/or land-use change. Aerobic decomposers are directly affected by WT drawdown through environmental factors such as increased oxygenation and nutrient availability. Additionally, they are indirectly affected via changes in plant community composition and litter quality. We studied the relative importance of direct and indirect effects of WT drawdown on aerobic decomposer activity in plant litter at two stages of decomposition (incubated in the field for 1 or 2 years). We did this by profiling 11 extracellular enzymes involved in the mineralization of organic C, nitrogen (N), phosphorus (P) and sulphur. Our study sites represented a three-stage chronosequence from pristine to short-term (years) and long-term (decades) WT drawdown conditions under two nutrient regimes (bog and fen). The litter types included reflected the prevalent vegetation: Sphagnum mosses, graminoids, shrubs and trees. Litter type was the main factor shaping microbial activity patterns and explained about 30 % of the variation in enzyme activities and activity allocation. Overall, enzyme activities were higher in vascular plant litters compared to Sphagnum litters, and the allocation of enzyme activities towards C or nutrient acquisition was related to the initial litter quality (chemical composition). Direct effects of WT regime, site nutrient regime and litter decomposition stage (length of incubation period) summed to only about 40 % of the litter type effect. WT regime alone explained about 5 % of the variation in enzyme activities and activity allocation. Generally, enzyme activity increased following the long-term WT drawdown and the activity allocation turned from P and N acquisition towards C acquisition. This caused an increase in the rate of litter decomposition. The effects of the short-term WT drawdown were minor compared to those of the long-term WT drawdown: e.g., the increase in the activity of C-acquiring enzymes was up to 120 % (bog) or 320 % (fen) higher after the long-term WT drawdown compared to the short-term WT drawdown. In general, the patterns of microbial activity as well as their responses to WT drawdown depended on peatland type: e.g., the shift in activity allocation to C-acquisition was up to 100 % stronger at the fen compared to the bog. Our results imply that changes in plant community composition in response to persistent WT drawdown will strongly affect the C dynamics of peatlands. The predictions of decomposer activity under changing climate and/or land-use thus cannot be based on the direct effects of the changed environment only, but need to consider the indirect effects of environmental changes: the changes in plant community composition, their dependence on peatland type, and their time scale.

Hanford Site National Environmental Policy Act (NEPA) Characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, Joanne P.; Burk, Kenneth W.; Chamness, Mickie A.

2007-09-27

This document describes the U.S. Department of Energy’s (DOE) Hanford Site environment. It is intended to provide a consistent description of the Hanford Site for the many environmental documents being prepared by DOE contractors concerning the National Environmental Policy Act (NEPA). No statements regarding significance or environmental consequences are provided. This year’s report is the eighteen revision of the original document published in 1988 and is (until replaced by the nineteenth revision) the only version that is relevant for use in the preparation of Hanford NEPA, State Environmental Policy Act (SEPA), and Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA)more » documents. Two chapters are included in this document (Chapters 4 and 6), numbered to correspond to chapters typically presented in environmental impact statements (EISs) and other Hanford Site NEPA or CERCLA documentation. Chapter 4.0 (Affected Environment) describes Hanford Site climate and meteorology; air quality; geology; hydrology; ecology; cultural, archaeological, and historical resources; socioeconomics; noise; and occupational health and safety. Sources for extensive tabular data related to these topics are provided in the chapter. When possible, subjects are divided into a general description of the characteristics of the Hanford Site, followed by site-specific information, where available, for the 100, 200, 300 and other areas. This division allows the reader to go directly to those sections of particular interest. When specific information on each of these separate areas is not complete or available, the general Hanford Site description should be used. Chapter 6.0 (Statutory and Regulatory Requirements) describes federal and state laws and regulations, DOE directives and permits, and presidential executive orders that are applicable to NEPA documents prepared for Hanford Site activities. Information in Chapter 6 can be adapted and supplemented with specific information covering statutory and regulatory requirements for use in an environmental assessment or environmental impact statement. When preparing environmental assessments and EISs, authors should consult Recommendations for the Preparation of Environmental Assessments and Environmental Impact Statements published by the DOE Office of NEPA Oversight (DOE 2004). Additional direction and guidance on the preparation of DOE NEPA documents can be found at http://tis.eh.doe.gov/nepa/guidance.html. Individuals seeking baseline data on the Hanford Site and its past activities may also use the information contained in this document to evaluate projected activities and their impacts. Pacific Northwest National Laboratory (PNNL) staff prepared individual sections of this document, with input from other Hanford Site contractors with the best available information through May 2007. More detailed data are available from reference sources cited or from the authors. For this 2007 revision, the following sections of the document were reviewed by the authors and updated with the best available information through May 2005: Climate and Meteorology Air Quality Geology – Seismicity section only Hydrology – Flow charts for the Columbia and Yakima rivers only Ecology – Threatened and Endangered Species subsection only Socioeconomics Occupational Safety All of Chapter 6.« less

Carbinolamine Formation and Dehydration in a DNA Repair Enzyme Active Site

PubMed Central

Dodson, M. L.; Walker, Ross C.; Lloyd, R. Stephen

2012-01-01

In order to suggest detailed mechanistic hypotheses for the formation and dehydration of a key carbinolamine intermediate in the T4 pyrimidine dimer glycosylase (T4PDG) reaction, we have investigated these reactions using steered molecular dynamics with a coupled quantum mechanics–molecular mechanics potential (QM/MM). We carried out simulations of DNA abasic site carbinolamine formation with and without a water molecule restrained to remain within the active site quantum region. We recovered potentials of mean force (PMF) from thirty replicate reaction trajectories using Jarzynski averaging. We demonstrated feasible pathways involving water, as well as those independent of water participation. The water–independent enzyme–catalyzed reaction had a bias–corrected Jarzynski–average barrier height of approximately for the carbinolamine formation reaction and ) for the reverse reaction at this level of representation. When the proton transfer was facilitated with an intrinsic quantum water, the barrier height was approximately in the forward (formation) reaction and for the reverse. In addition, two modes of unsteered (free dynamics) carbinolamine dehydration were observed: in one, the quantum water participated as an intermediate proton transfer species, and in the other, the active site protonated glutamate hydrogen was directly transferred to the carbinolamine oxygen. Water–independent unforced proton transfer from the protonated active site glutamate carboxyl to the unprotonated N–terminal amine was also observed. In summary, complex proton transfer events, some involving water intermediates, were studied in QM/MM simulations of T4PDG bound to a DNA abasic site. Imine carbinolamine formation was characterized using steered QM/MM molecular dynamics. Dehydration of the carbinolamine intermediate to form the final imine product was observed in free, unsteered, QM/MM dynamics simulations, as was unforced acid-base transfer between the active site carboxylate and the N–terminal amine. PMID:22384015

Health Risks to Ecological Workers on Contaminated Sites - the Department of Energy as a Case Study

PubMed Central

Burger, Joanna; Gochfeld, Michael

2016-01-01

Background At most contaminated sites the risk to workers focuses on those ‘hazardous waste workers’ directly exposed to chemicals or radionuclides, and to the elaborate approaches implemented to protecting their health and safety. Ecological workers generally are not considered. Objectives To explore the risks to the health and safety of ecological workers on sites with potential chemical and radiological exposures before, during or after remediation of contamination. To use the U.S. Department of Energy as a case study, and to develop concepts that apply generally to sites contaminated with hazardous or nuclear wastes, Methods Develop categories of ecological workers, describe their usual jobs, and provide information on the kinds of risks they face. Ecological activities include continued surveillance and monitoring work on any sites with residual contamination, subject to institutional controls and engineered barriers following closure as well as the restoration. Results The categories of ecological workers and their tasks include 1) Ecological characterization, mapping and monitoring, 2) biodiversity studies, 2) Contaminant fate and transport, 3) On-going industrial activities 4) Remediation activities (environmental management), 5) Environmental restoration, 6) Post-cleanup surveillance and monitoring, and 7) Post-closure future site activities. There are a set of functional activities that can occur with different frequencies and intensities, including visual inspection, collecting biological samples, collecting media physical samples, collecting biological debris, restoration planting, and maintaining ecosystems. Conclusions Ecological workers face different exposures and risks than other environmental cleanup workers. Many of their tasks mimic shift work with long hours leading to fatigue, and they are exposed to biological as well as chemical/radiological hazards. DOE and other entities need to examine the risks to ecological workers on site with an eye to risk reduction. PMID:27668128

Activity screening of environmental metagenomic libraries reveals novel carboxylesterase families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popovic, Ana; Hai, Tran; Tchigvintsev, Anatoly

Metagenomics has made accessible an enormous reserve of global biochemical diversity. In order to tap into this vast resource of novel enzymes, we have screened over one million clones from metagenome DNA libraries derived from sixteen different environments for carboxylesterase activity and identified 714 positive hits. Here, we validated the esterase activity of 80 selected genes, which belong to 17 different protein families including unknown and cyclase-like proteins. Three metagenomic enzymes exhibited lipase activity, and seven proteins showed polyester depolymerization activity against polylactic acid and polycaprolactone. Detailed biochemical characterization of four new enzymes revealed their substrate preference, whereas their catalyticmore » residues were identified using site-directed mutagenesis. The crystal structure of the metal-ion dependent esterase MGS0169 from the amidohydrolase superfamily revealed a novel active site with a bound unknown ligand. Thus, activity-centered metagenomics has revealed diverse enzymes and novel families of microbial carboxylesterases, whose activity could not have been predicted using bioinformatics tools.« less

Activity screening of environmental metagenomic libraries reveals novel carboxylesterase families

DOE PAGES

Popovic, Ana; Hai, Tran; Tchigvintsev, Anatoly; ...

2017-03-08

Metagenomics has made accessible an enormous reserve of global biochemical diversity. In order to tap into this vast resource of novel enzymes, we have screened over one million clones from metagenome DNA libraries derived from sixteen different environments for carboxylesterase activity and identified 714 positive hits. Here, we validated the esterase activity of 80 selected genes, which belong to 17 different protein families including unknown and cyclase-like proteins. Three metagenomic enzymes exhibited lipase activity, and seven proteins showed polyester depolymerization activity against polylactic acid and polycaprolactone. Detailed biochemical characterization of four new enzymes revealed their substrate preference, whereas their catalyticmore » residues were identified using site-directed mutagenesis. The crystal structure of the metal-ion dependent esterase MGS0169 from the amidohydrolase superfamily revealed a novel active site with a bound unknown ligand. Thus, activity-centered metagenomics has revealed diverse enzymes and novel families of microbial carboxylesterases, whose activity could not have been predicted using bioinformatics tools.« less

Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sultatos, L.G.; Kaushik, R.

2008-08-01

The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

Visual Sexual Stimulation and Erection, a Brief Review with New fMRI Data.

PubMed

Wu, Sharon L; Chow, Maggie S M; L, Jiang Y; Yang, Jingjin; Zhou, Hao; Yew, David T

2017-05-31

This review examines brain sites involved in sexual stimulation. New data on brain activation sites in individuals having erections concomitant with visual erotic stimulation were documented. The activation was chiefly at the midbrain around the cerebral peduncle, and in the pons centering on the tegmentum, they are indicated by blood oxygenation level dependent (BOLD) images captured by functional magnetic resonance imaging (fMRI). The cerebellum and inferior temporal lobe were activated more extensively in individuals viewing pornographic movie with a concomitant erection than those without. Similarly, individuals with erection had activations in the midbrain and pons, while drug addicts had neither erections nor any of these brainstem active sites. From our observation in the new data, we deduced three possible transmitters might be involved in erection: i) cholinergic neurons forming descending pathways and associated with motor activity ii) gamma-aminobutyric acid (GABA), directly or indirectly via decreasing pathways, modulating autonomic vascular responses in the penile vasculature causing the filling of blood iii) GABA decreases to stimulate dopamine increase in ventral tegmentum of the brain, leading to euphoric responses. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Evolution of Flavone Synthase I from Parsley Flavanone 3β-Hydroxylase by Site-Directed Mutagenesis1[W][OA

PubMed Central

Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan

2007-01-01

Flavanone 3β-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the β-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction). PMID:17535823

Acetylene hydratase: a non-redox enzyme with tungsten and iron-sulfur centers at the active site.

PubMed

Kroneck, Peter M H

2016-03-01

In living systems, tungsten is exclusively found in microbial enzymes coordinated by the pyranopterin cofactor, with additional metal coordination provided by oxygen and/or sulfur, and/or selenium atoms in diverse arrangements. Prominent examples are formate dehydrogenase, formylmethanofuran dehydrogenase, and aldehyde oxidoreductase all of which catalyze redox reactions. The bacterial enzyme acetylene hydratase (AH) stands out of its class as it catalyzes the conversion of acetylene to acetaldehyde, clearly a non-redox reaction and a reaction distinct from the reduction of acetylene to ethylene by nitrogenase. AH harbors two pyranopterins bound to W, and a [4Fe-4S] cluster. W is coordinated by four dithiolene sulfur atoms, one cysteine sulfur, and one oxygen ligand. AH activity requires a strong reductant suggesting W(IV) as the active oxidation state. Two different types of reaction pathways have been proposed. The 1.26 Å structure reveals a water molecule coordinated to W which could gain a partially positive net charge by the adjacent protonated Asp-13, enabling a direct attack of C2H2. To access the W-Asp site, a substrate channel was evolved distant from where it is found in other members of the DMSOR family. Computational studies of this second shell mechanism led to unrealistically high energy barriers, and alternative pathways were proposed where C2H2 binds directly to W. The architecture of the catalytic cavity, the specificity for C2H2 and the results from site-directed mutagenesis do not support this first shell mechanism. More investigations including structural information on the binding of C2H2 are needed to present a conclusive answer.

Curcumin interacts directly with the Cysteine 259 residue of STAT3 and induces apoptosis in H-Ras transformed human mammary epithelial cells.

PubMed

Hahn, Young-Il; Kim, Su-Jung; Choi, Bu-Young; Cho, Kyung-Cho; Bandu, Raju; Kim, Kwang Pyo; Kim, Do-Hee; Kim, Wonki; Park, Joon Sung; Han, Byung Woo; Lee, Jeewoo; Na, Hye-Kyung; Cha, Young-Nam; Surh, Young-Joon

2018-04-23

Signal transducer and activator of transcription 3 (STAT3) is a transcription factor that is latent but constitutively activated in many types of cancers. It is well known that STAT3 plays a key role in inflammation-associated tumorigenesis. Curcumin is an anti-inflammatory natural compound isolated from the turmeric (Curcuma longa L., Zingiberaceae) that has been extensively used in a traditional medicine over the centuries. In the present study, we have found that curcumin inhibits STAT3 signaling that is persistently overactivated in H-Ras transformed breast epithelial cells (H-Ras MCF10A). Specific cysteine residues present in STAT3 appear to be critical for the activity as well as conformation of this transcription factor. We identified the cysteine residue 259 of STAT3 as a putative site for curcumin binding. Site-directed mutation of this cysteine residue abolished curcumin-induced inactivation of STAT3 and apoptosis in H-Ras MCF10A cells. The α,β-unsaturated carbonyl moiety of curcumin appears to be essential in its binding to STAT3 in H-Ras MCF10A cells. Tetrahydrocurcumin that lacks such electrophilic moiety failed to interact with STAT3 and to induce apoptosis in the same cell line. Taken together, our findings suggest that curcumin can abrogate aberrant activation of STAT3 through direct interaction, thereby inhibiting STAT3-mediated mammary carcinogenesis.

Paleomagnetism and Paleosecular Variation Study of the Mt. Cameroon Volcanics (0.0 to 0.25 Ma), West Africa

NASA Astrophysics Data System (ADS)

Ubangoh, R. U.; Herrero-Bervera, E.; Valet, J.

2002-12-01

We have conducted a paleomagnetic study of 94 samples drilled from 13 lava flows in Mount Cameroon (0.0. to 0.25 Ma). Mt Cameroon (4075m) is a large volcanic horst which belongs to the Cameroon Volcanic Line (CVL) and is one of Africa's largest volcanoes. Many recent volcanic cones found on the mountain are aligned SW-NE, as is the general morphology of the massif. This mountain is presently the only active volcano on the CVL, with eight eruptions this century, the most recent being in 2000. At least 8 samples from each site were demagnetized by means of a.f. and thermal methods. The characteristic remanent magnetism (ChRM) was calculated using principal component analysis for the demagnetization diagrams with a well-defined component trending towards the origin. No bias or systematic departure from the origin was accepted, and in all cases the ChRM relies on a minimum of seven successive directions isolated during stepwise demagnetization. In parallel, at least three samples per site were used for absolute paleointensity studies with the hope of documenting the full vector and not restraining the data to directions only. In addition, low-field susceptibility versus temperature (k-T) and SIRM experiments were performed on at least one sample per site. As a result of such tests, we were able to identify magnetite (575oC) but also sites characterized by low-temperature mineral phases (e.g. 100-200 and 300-400oC), reflecting the presence of titanomagnetite with low Ti content as suggested by the large susceptibility. Successful mean paleomagnetic directions were obtained for all the 13 sites. The final site mean directions were calculated from at least 7 samples per site. Three sites with inclinations significantly away from the axial dipole were discarded. Thus a total of 10 sites have been retained with a mean declination of 354.2o and mean inclination of 4.8o (k=13, alpha 95=12.1) this direction belongs to rocks which have been dated by K-Ar and range in age from 0.0 to 0.25 Ma. The angular standard deviation of the VGPs was found to be 13.91o around the mean pole. This last value is slightly higher than the PSV model `G" values.

Predictability of dune activity in real dune fields under unidirectional wind regimes

NASA Astrophysics Data System (ADS)

Barchyn, Thomas E.; Hugenholtz, Chris H.

2015-02-01

We present an analysis of 10 dune fields to test a model-derived hypothesis of dune field activity. The hypothesis suggests that a quantifiable threshold exists for stabilization in unidirectional wind regimes: active dunes have slipface deposition rates that exceed the vegetation deposition tolerance, and stabilizing dunes have the opposite. We quantified aeolian sand flux, slipface geometry, and vegetation deposition tolerance to directly test the hypothesis at four dune fields (Bigstick, White Sands Stable, White Sands Active, and Cape Cod). We indirectly tested the hypothesis at six additional dune fields with limited vegetation data (Hanford, Año Nuevo, Skagen Odde, Salton Sea, Oceano Stable, and Oceano Active, "inverse calculation sites"). We used digital topographic data and estimates of aeolian sand flux to approximate the slipface deposition rates prior to stabilization. Results revealed a distinct, quantifiable, and consistent pattern despite diverse environmental conditions: the modal peak of prestabilization slipface deposition rates was 80% of the vegetation deposition tolerance at stabilized or stabilizing dune fields. Results from inverse calculation sites indicate deposition rates at stabilized sites were near a hypothesized maximum vegetation deposition tolerance (1 m a-1), and active sites had slipface deposition rates much higher. Overall, these results confirm the hypothesis and provide evidence of a globally applicable, simple, and previously unidentified predictor for the dynamics of vegetation cover in dune fields under unidirectional wind regimes.

Control of peroxisome proliferator-activated receptor gamma2 stability and activity by SUMOylation.

PubMed

Floyd, Z Elizabeth; Stephens, Jacqueline M

2004-06-01

To determine whether small ubiquitin-related modifier (SUMO)ylation of lysine 107 plays a role in regulating the activity of peroxisome proliferator-activated receptor gamma (PPARgamma). Transient expression of wild-type and K107R-PPARgamma2 in the NIH 3T3 fibroblast cell line was carried out in conjunction with half-life studies, luciferase activity assays, and indirect immunofluorescence localization studies. Additional in vitro analysis was carried out using recombinant SUMOylation pathway proteins along with in vitro transcribed and translated wild-type or K107R-PPARgamma2 to examine the SUMO-1 modification state of wild-type and SUMO-deficient K107R-PPARgamma2. While examining PPARgamma2 for potential ubiquitylation sites, we identified a strong consensus site for SUMO modification that contains lysine 107. In vitro, SUMOylation studies showed that lysine 107 of PPARgamma2 is a major SUMOylation site and that at least one other SUMOylation site is present in PPARgamma. In addition, our results demonstrated that SUMO-1 affects PPARgamma stability and transcriptional activity but not the nuclear localization of PPARgamma. These results indicated that SUMOylation plays a role in regulating PPARgamma, both indirectly and directly by modification of lysine 107. Because PPARgamma is regulated in numerous animal models of obesity, understanding the covalent modifications of PPARgamma may enhance our understanding of the metabolic syndrome.

Survival and enumeration of the fecal indicators Bifidobacterium adolescentis and Escherichia coli in a tropical rain forest watershed.

PubMed Central

Carrillo, M; Estrada, E; Hazen, T C

1985-01-01

The density of Bifidobacterium spp., fecal coliforms, Escherichia coli, and total anaerobic bacteria, acridine orange direct counts, percentages of total bacterial community activity and respiration, and 12 physical and chemical parameters were measured simultaneously at six sites for 12 months in the Mameyes River rain forest watershed, Puerto Rico. The densities of all bacteria were higher than those reported for uncontaminated temperate rivers, even though other water quality parameters would indicate that all uncontaminated sites were oligotrophic. The highest densities for all indicator bacteria were at the site receiving sewage effluent; however, the highest elevation site in the watershed had the next highest densities. Correlations between bacterial densities, nitrates, temperature, phosphates, and total phosphorus indicated that all viable counts were related to nutrient levels, regardless of the site sampled. In situ diffusion chamber studies at two different sites indicated that E. coli could survive, remain physiologically active, and regrow at rates that were dependent on nutrient levels of the ambient waters. Bifidobacterium adolescentis did not survive at either site but did show different rates of decline and physiological activity at the two sites. Bifidobacteria show promise as a better indicator of recent fecal contamination in tropical freshwaters than E. coli or fecal coliforms; however, the YN-6 medium did not prove to be effective for enumeration of bifidobacteria. The coliform maximum contaminant levels for assessing water usability for drinking and recreation appear to be unworkable in tropical freshwaters. PMID:3901921

Water in the Active Site of Ketosteroid Isomerase

PubMed Central

Hanoian, Philip; Hammes-Schiffer, Sharon

2011-01-01

Classical molecular dynamics simulations were utilized to investigate the structural and dynamical properties of water in the active site of ketosteroid isomerase (KSI) to provide insight into the role of these water molecules in the enzyme-catalyzed reaction. This reaction is thought to proceed via a dienolate intermediate that is stabilized by hydrogen bonding with residues Tyr16 and Asp103. A comparative study was performed for the wild-type (WT) KSI and the Y16F, Y16S, and Y16F/Y32F/Y57F (FFF) mutants. These systems were studied with three different bound ligands: equilenin, which is an intermediate analog, and the intermediate states of two steroid substrates. Several distinct water occupation sites were identified in the active site of KSI for the WT and mutant systems. Three additional sites were identified in the Y16S mutant that were not occupied in WT KSI or the other mutants studied. The number of water molecules directly hydrogen bonded to the ligand oxygen was approximately two waters in the Y16S mutant, one water in the Y16F and FFF mutants, and intermittent hydrogen bonding of one water molecule in WT KSI. The molecular dynamics trajectories of the Y16F and FFF mutants reproduced the small conformational changes of residue 16 observed in the crystal structures of these two mutants. Quantum mechanical/molecular mechanical calculations of 1H NMR chemical shifts of the protons in the active site hydrogen-bonding network suggest that the presence of water in the active site does not prevent the formation of short hydrogen bonds with far-downfield chemical shifts. The molecular dynamics simulations indicate that the active site water molecules exchange much more frequently for WT KSI and the FFF mutant than for the Y16F and Y16S mutants. This difference is most likely due to the hydrogen-bonding interaction between Tyr57 and an active site water molecule that is persistent in the Y16F and Y16S mutants but absent in the FFF mutant and significantly less probable in WT KSI. PMID:21710970

Water in the active site of ketosteroid isomerase.

PubMed

Hanoian, Philip; Hammes-Schiffer, Sharon

2011-08-09

Classical molecular dynamics simulations were utilized to investigate the structural and dynamical properties of water in the active site of ketosteroid isomerase (KSI) to provide insight into the role of these water molecules in the enzyme-catalyzed reaction. This reaction is thought to proceed via a dienolate intermediate that is stabilized by hydrogen bonding with residues Tyr16 and Asp103. A comparative study was performed for the wild-type (WT) KSI and the Y16F, Y16S, and Y16F/Y32F/Y57F (FFF) mutants. These systems were studied with three different bound ligands: equilenin, which is an intermediate analog, and the intermediate states of two steroid substrates. Several distinct water occupation sites were identified in the active site of KSI for the WT and mutant systems. Three additional sites were identified in the Y16S mutant that were not occupied in WT KSI or the other mutants studied. The number of water molecules directly hydrogen bonded to the ligand oxygen was approximately two in the Y16S mutant and one in the Y16F and FFF mutants, with intermittent hydrogen bonding of one water molecule in WT KSI. The molecular dynamics trajectories of the Y16F and FFF mutants reproduced the small conformational changes of residue 16 observed in the crystal structures of these two mutants. Quantum mechanical/molecular mechanical calculations of (1)H NMR chemical shifts of the protons in the active site hydrogen-bonding network suggest that the presence of water in the active site does not prevent the formation of short hydrogen bonds with far-downfield chemical shifts. The molecular dynamics simulations indicate that the active site water molecules exchange much more frequently for WT KSI and the FFF mutant than for the Y16F and Y16S mutants. This difference is most likely due to the hydrogen-bonding interaction between Tyr57 and an active site water molecule that is persistent in the Y16F and Y16S mutants but absent in the FFF mutant and significantly less probable in WT KSI. © 2011 American Chemical Society

Ames expedited site characterization demonstration at the former manufactured gas plant site, Marshalltown, Iowa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bevolo, A.J.; Kjartanson, B.H.; Wonder, J.D.

1996-03-01

The goal of the Ames Expedited Site Characterization (ESC) project is to evaluate and promote both innovative technologies (IT) and state-of-the-practice technologies (SOPT) for site characterization and monitoring. In April and May 1994, the ESC project conducted site characterization, technology comparison, and stakeholder demonstration activities at a former manufactured gas plant (FMGP) owned by Iowa Electric Services (IES) Utilities, Inc., in Marshalltown, Iowa. Three areas of technology were fielded at the Marshalltown FMGP site: geophysical, analytical and data integration. The geophysical technologies are designed to assess the subsurface geological conditions so that the location, fate and transport of the targetmore » contaminants may be assessed and forecasted. The analytical technologies/methods are designed to detect and quantify the target contaminants. The data integration technology area consists of hardware and software systems designed to integrate all the site information compiled and collected into a conceptual site model on a daily basis at the site; this conceptual model then becomes the decision-support tool. Simultaneous fielding of different methods within each of the three areas of technology provided data for direct comparison of the technologies fielded, both SOPT and IT. This document reports the results of the site characterization, technology comparison, and ESC demonstration activities associated with the Marshalltown FMGP site. 124 figs., 27 tabs.« less

Probing the Role of Active Site Water in the Sesquiterpene Cyclization Reaction Catalyzed by Aristolochene Synthase.

PubMed

Chen, Mengbin; Chou, Wayne K W; Al-Lami, Naeemah; Faraldos, Juan A; Allemann, Rudolf K; Cane, David E; Christianson, David W

2016-05-24

Aristolochene synthase (ATAS) is a high-fidelity terpenoid cyclase that converts farnesyl diphosphate exclusively into the bicyclic hydrocarbon aristolochene. Previously determined crystal structures of ATAS complexes revealed trapped active site water molecules that could potentially interact with catalytic intermediates: water "w" hydrogen bonds with S303 and N299, water molecules "w1" and "w2" hydrogen bond with Q151, and a fourth water molecule coordinates to the Mg(2+)C ion. There is no obvious role for water in the ATAS mechanism because the enzyme exclusively generates a hydrocarbon product. Thus, these water molecules are tightly controlled so that they cannot react with carbocation intermediates. Steady-state kinetics and product distribution analyses of eight ATAS mutants designed to perturb interactions with active site water molecules (S303A, S303H, S303D, N299A, N299L, N299A/S303A, Q151H, and Q151E) indicate relatively modest effects on catalysis but significant effects on sesquiterpene product distributions. X-ray crystal structures of S303A, N299A, N299A/S303A, and Q151H mutants reveal minimal perturbation of active site solvent structure. Seven of the eight mutants generate farnesol and nerolidol, possibly resulting from addition of the Mg(2+)C-bound water molecule to the initially formed farnesyl cation, but no products are generated that would suggest enhanced reactivity of other active site water molecules. However, intermediate germacrene A tends to accumulate in these mutants. Thus, apart from the possible reactivity of Mg(2+)C-bound water, active site water molecules in ATAS are not directly involved in the chemistry of catalysis but instead contribute to the template that governs the conformation of the flexible substrate and carbocation intermediates.

Impact of intertidal oyster trestle cultivation on the Ecological Status of benthic habitats.

PubMed

Forde, James; O'Beirn, Francis X; O'Carroll, Jack Pj; Patterson, Adrian; Kennedy, Robert

2015-06-15

A considerable number of Ireland's shellfish production areas co-occur with or are adjacent to Natura 2000 sites which are protected under European legislation. To investigate the general interaction between trestle oyster cultivation and the surrounding intertidal environment, six sites were selected within designated Natura 2000 sites. At each trestle site three Treatment areas were sampled. One Treatment area corresponded to potential impacts associated with cultivation activities occurring at trestle structures (designated the Trestle Treatment) while one Treatment area corresponded to potential impacts due to cultivation activities occurring along access routes (the Access Treatment). An area not subject to any known anthropogenic activity was used as a control (the Control Treatment). Potential impacts associated with Trestle Treatment areas included changes in sediment total organic matter (TOM) levels underneath trestles due to the bio-deposition of faecal/pseudofaecal material while the predominant impact associated with Access Treatment areas was compaction of sediments due to heavy vehicle traffic. In this study, macrobenthic communities at the sites were highly variable and exhibited low levels of diversity which prevented the detection of general effects of cultivation activity on community structure, diversity and secondary production. To overcome this variability, the Infaunal Quality Index (IQI) was used to assess impacts on Ecological Status (ES) of benthic communities (sensu Water Framework Directive). Relative to Control and Trestle Treatment areas, activities occurring at Access Treatment areas had a significant negative impact on ES. This study highlights the potential of the IQI for the management of aquaculture activity and provides validation for the use of the IQI in Irish intertidal environments. This study also highlights the IQI as a potential tool for assessing the conservation status of designated habitats in Natura 2000 sites. Copyright © 2015 Elsevier Ltd. All rights reserved.

Direct Conversion of Methane to Methanol on Ni-Ceria Surfaces: Metal-Support Interactions and Water-enabled Catalytic Conversion by Site Blocking

DOE PAGES

Lustemberg, Pablo G.; Palomino, Robert M.; Gutierrez, Ramon A.; ...

2018-05-28

The transformation of methane into methanol or higher alcohols at moderate temperature and pressure conditions is of great environmental interest and remains a challenge despite many efforts. Extended surfaces of metallic nickel are inactive for a direct CH 4 → CH 3OH conversion. This experimental and computational study provides clear evidence that low Ni loadings on a CeO 2(111) support can perform a direct catalytic cycle for the generation of methanol at low temperature using oxygen and water as reactants, with a higher selectivity than ever reported for ceria-based catalysts. On the basis of ambient pressure X-ray photoemission spectroscopy andmore » density functional theory calculations, we demonstrate that water plays a crucial role in blocking catalyst sites where methyl species could fully decompose, an essential factor for diminishing the production of CO and CO 2, and in generating sites on which methoxy species and ultimately methanol can form. In addition to water-site blocking, one needs the effects of metal-support interactions to bind and activate methane and water. Lastly, these findings should be considered when designing metal/oxide catalysts for converting methane to value-added chemicals and fuels.« less

Direct Conversion of Methane to Methanol on Ni-Ceria Surfaces: Metal-Support Interactions and Water-enabled Catalytic Conversion by Site Blocking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lustemberg, Pablo G.; Palomino, Robert M.; Gutierrez, Ramon A.

The transformation of methane into methanol or higher alcohols at moderate temperature and pressure conditions is of great environmental interest and remains a challenge despite many efforts. Extended surfaces of metallic nickel are inactive for a direct CH 4 → CH 3OH conversion. This experimental and computational study provides clear evidence that low Ni loadings on a CeO 2(111) support can perform a direct catalytic cycle for the generation of methanol at low temperature using oxygen and water as reactants, with a higher selectivity than ever reported for ceria-based catalysts. On the basis of ambient pressure X-ray photoemission spectroscopy andmore » density functional theory calculations, we demonstrate that water plays a crucial role in blocking catalyst sites where methyl species could fully decompose, an essential factor for diminishing the production of CO and CO 2, and in generating sites on which methoxy species and ultimately methanol can form. In addition to water-site blocking, one needs the effects of metal-support interactions to bind and activate methane and water. Lastly, these findings should be considered when designing metal/oxide catalysts for converting methane to value-added chemicals and fuels.« less

Collective rotations of active particles interacting with obstacles

NASA Astrophysics Data System (ADS)

Mokhtari, Zahra; Aspelmeier, Timo; Zippelius, Annette

2017-10-01

We consider active particles in a heterogeneous medium, modeled by static, random obstacles. In accordance with the known tendency of active particles to cluster, we observe accumulation and crystallization of active particles around the obstacles which serve as nucleation sites. In the limit of high activity, the crystals start to rotate spontaneously, resembling a rotating rigid body. We trace the occurrence of these oscillations to the enhanced attraction of particles whose orientation points along the rotational velocity as compared to those whose orientation points in the opposite direction.

Silver-coated nylon dressing plus active DC microcurrent for healing of autogenous skin donor sites.

PubMed

Malin, Edward W; Galin, Chaya M; Lairet, Kimberley F; Huzar, Todd F; Williams, James F; Renz, Evan M; Wolf, Steven E; Cancio, Leopoldo C

2013-11-01

Burn wounds are a significant cause of morbidity and mortality, and improved outcomes are demonstrated with early closure of both primary burn wounds and skin donor sites. Thus, technology that decreases the healing time of burns and donor sites would be potentially lifesaving. We present the results of a single-center, prospective, double-blinded, randomized controlled trial to evaluate the efficacy of silver-coated dressing with active microcurrent in comparison to silver-coated dressing with sham microcurrent on wound-closure time for autogenous skin donor sites. Four hundred five patients were screened for treatment of their donor sites using a silver-coated nylon dressing with either sham or active microcurrent stimulation. Thirty patients were enrolled in the study and then randomized. Of these, 5 patients were removed from analysis due to protocol deviations. Differences in time-to-closure were analyzed using Kaplan-Meier analysis and the proportional hazard regression model. Subjective verbal pain rating scores (0-10; 0, no pain; 10, worst pain) were also recorded. All devices were blinded and programmed at an outside facility, so that every patient had either an active or sham device. The study was unblinded only after the final patient's donor site had healed. All patients achieved donor-site healing before postoperative day 20. The 14 patients in the active microcurrent group [mean, 10.8 (2.9) days; range, 7-15 days] experienced no difference in time to wound healing as compared to the remaining patients in the sham microcurrent group [mean, 11.1 (2.0) days; range, 8-14 days; P = 0.75]. There were no differences in pain from one group compared to the other. None of the donor sites exhibited clinical signs of infection. In a sample size of 25 burn patients, the addition of direct microcurrent to silver-nylon dressings did not decrease time to wound closure of skin donor sites, and it did not show a difference in reported pain levels.

Contracts and management services site support program plan WBS 6.10.14

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knoll, J.M. Jr.

1994-09-01

Contracts and Management Services is recognized as the central focal point for programs having company or sitewide application in pursuit of the Hanford Missions`s financial and operational objectives. Contracts and Management Services actively pursues cost savings and operational efficiencies through: Management Standards by ensuring all employees have an accessible, integrated system of clear, complete, accurate, timely, and useful management control policies and procedures; Contract Reform by restructuring the contract, organization, and cost accounting systems to refocus Hanford contract activities on output products; Systems and Operations Evaluation by directing the Cost Reduction program, Great Ideas, and Span of Management activities; Programmore » Administration by enforcing conditions of Accountability (whether DEAR-based or FAR-based) for WHC, BCSR, ICF KH, and BHI; Contract Performance activities; chairing the WHC Cost Reduction Review Board; and analyzing companywide Performance Measures; Data Standards and Administration by establishing and directing the company data management program; giving direction to the major RL programs and mission areas for implementation of cost-effective and efficient data management practices; directing all operations, application, and interfaces contained within the Hanford PeopleCore System; directing accomplishment and delivery of TPA data management milestones; and directing the sitewide data management processes for Data Standards and the Data Directory.« less

Intramural activation and repolarization sequences in canine ventricles. Experimental and simulation studies.

PubMed

Taccardi, Bruno; Punske, Bonnie B; Sachse, Frank; Tricoche, Xavier; Colli-Franzone, Piero; Pavarino, Luca F; Zabawa, Christine

2005-10-01

There are no published data showing the three-dimensional sequence of repolarization and the associated potential fields in the ventricles. Knowledge of the sequence of repolarization has medical relevance because high spatial dispersion of recovery times and action potential durations favors cardiac arrhythmias. In this study we describe measured and simulated 3-D excitation and recovery sequences and activation-recovery intervals (ARIs) (measured) or action potential durations (APDs) (simulated) in the ventricular walls. We recorded from 600 to 1400 unipolar electrograms from canine ventricular walls during atrial and ventricular pacing at 350-450 ms cycle length. Measured excitation and recovery times and ARIs were displayed as 2-D maps in transmural planes or 3-D maps in the volume explored, using specially developed software. Excitation and recovery sequences and APD distributions were also simulated in parallelepipedal slabs using anisotropic monodomain or bidomain models based on the Lou-Rudy version 1 model with homogeneous membrane properties. Simulations showed that in the presence of homogeneous membrane properties, the sequence of repolarization was similar but not identical to the excitation sequence. In a transmural plane perpendicular to epicardial fiber direction, both activation and recovery pathways starting from an epicardial pacing site returned toward the epicardium at a few cm distance from the pacing site. However, APDs were not constant, but had a dispersion of approximately 14 ms in the simulated domain. The maximum APD value was near the pacing site and two minima appeared along a line perpendicular to fiber directions, passing through the pacing site. Electrical measurements in dog ventricles showed that, for short cycle lengths, both excitation and recovery pathways, starting from an epicardial pacing site, returned toward the epicardium. For slower pacing rates, pathways of recovery departed from the pathway of excitation. Highest ARI values were observed near the pacing site in part of the experiments. In addition, maps of activation-recovery intervals showed mid-myocardial clusters with activation-recovery intervals that were slightly longer than ARIs closer to the epi- or endocardium, suggesting the presence of M cells in those areas. Transmural dispersion of measured ARIs was on the order of 20-25 ms. Potential distributions during recovery were less affected by myocardial anisotropy than were excitation potentials.

Construction and Quantitative Validation of Chicken CXCR4 Expression Reporter.

PubMed

Es-Haghi, Masoumeh; Bassami, Mohammadreza; Dehghani, Hesam

2016-03-01

Site directional migration is an important biological event and an essential behavior for latent migratory cells. A migratory cell maintains its motility, survival, and proliferation abilities by a network of signaling pathways where CXCR4/SDF signaling route plays crucial role for directed homing of a polarized cell. The chicken embryo due to its specific vasculature modality has been used as a valuable model for organogenesis, migration, cancer, and metastasis. In this research, the regulatory regions of chicken CXCR4 gene have been characterized in a chicken hematopoietic lymphoblast cell line (MSB1). A region extending from -2000 bp upstream of CXCR4 gene to +68 after its transcriptional start site, in addition to two other mutant fragments were constructed and cloned in a promoter-less reporter vector. Promoter activity was analyzed by quantitative real-time RT-PCR and flow cytometry techniques. Our findings show that the full sequence from -2000 to +68 bp of CXCR4 regulatory region is required for maximum promoter functionality, while the mutant CXCR4 promoter fragments show a partial promoter activity. The chicken CXCR4 promoter validated in this study could be used for characterization of directed migratory cells in chicken development and disease models.

Nevada Test Site-Directed Research, Development, and Demonstration. FY2005 report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis, Will

2006-09-01

The Nevada Test Site-Directed Research, Development, and Demonstration (SDRD) program completed a very successful year of research and development activities in FY 2005. Fifty new projects were selected for funding this year, and five FY 2004 projects were brought to conclusion. The total funds expended by the SDRD program were $5.4 million, for an average per project cost of just under $100,000. Two external audits of SDRD accounting practices were conducted in FY 2005. Both audits found the program's accounting practices consistent with the requirements of DOE Order 413.2A, and one included the observation that the NTS contractor ''did anmore » exceptional job in planning and executing year-start activities.'' Highlights for the year included: the filing of 18 invention disclosures for intellectual property generated by FY 2005 projects; programmatic adoption of 17 FY 2004 SDRD-developed technologies; participation in the tri-lab Laboratory Directed Research and Development (LDRD) and SDRD program review that was broadly attended by NTS, NNSA, LDRD, and U.S. Department of Homeland Security representatives; peer reviews of all FY 2005 projects; and the successful completion of 55 R&D projects, as presented in this report.« less

Protein disulfide isomerase acts as an injury response signal that enhances fibrin generation via tissue factor activation

PubMed Central

Reinhardt, Christoph; von Brühl, Marie-Luise; Manukyan, Davit; Grahl, Lenka; Lorenz, Michael; Altmann, Berid; Dlugai, Silke; Hess, Sonja; Konrad, Ildiko; Orschiedt, Lena; Mackman, Nigel; Ruddock, Lloyd; Massberg, Steffen; Engelmann, Bernd

2008-01-01

The activation of initiator protein tissue factor (TF) is likely to be a crucial step in the blood coagulation process, which leads to fibrin formation. The stimuli responsible for inducing TF activation are largely undefined. Here we show that the oxidoreductase protein disulfide isomerase (PDI) directly promotes TF-dependent fibrin production during thrombus formation in vivo. After endothelial denudation of mouse carotid arteries, PDI was released at the injury site from adherent platelets and disrupted vessel wall cells. Inhibition of PDI decreased TF-triggered fibrin formation in different in vivo murine models of thrombus formation, as determined by intravital fluorescence microscopy. PDI infusion increased — and, under conditions of decreased platelet adhesion, PDI inhibition reduced — fibrin generation at the injury site, indicating that PDI can directly initiate blood coagulation. In vitro, human platelet–secreted PDI contributed to the activation of cryptic TF on microvesicles (microparticles). Mass spectrometry analyses indicated that part of the extracellular cysteine 209 of TF was constitutively glutathionylated. Mixed disulfide formation contributed to maintaining TF in a state of low functionality. We propose that reduced PDI activates TF by isomerization of a mixed disulfide and a free thiol to an intramolecular disulfide. Our findings suggest that disulfide isomerases can act as injury response signals that trigger the activation of fibrin formation following vessel injury. PMID:18274674

Protein disulfide isomerase acts as an injury response signal that enhances fibrin generation via tissue factor activation.

PubMed

Reinhardt, Christoph; von Brühl, Marie-Luise; Manukyan, Davit; Grahl, Lenka; Lorenz, Michael; Altmann, Berid; Dlugai, Silke; Hess, Sonja; Konrad, Ildiko; Orschiedt, Lena; Mackman, Nigel; Ruddock, Lloyd; Massberg, Steffen; Engelmann, Bernd

2008-03-01

The activation of initiator protein tissue factor (TF) is likely to be a crucial step in the blood coagulation process, which leads to fibrin formation. The stimuli responsible for inducing TF activation are largely undefined. Here we show that the oxidoreductase protein disulfide isomerase (PDI) directly promotes TF-dependent fibrin production during thrombus formation in vivo. After endothelial denudation of mouse carotid arteries, PDI was released at the injury site from adherent platelets and disrupted vessel wall cells. Inhibition of PDI decreased TF-triggered fibrin formation in different in vivo murine models of thrombus formation, as determined by intravital fluorescence microscopy. PDI infusion increased - and, under conditions of decreased platelet adhesion, PDI inhibition reduced - fibrin generation at the injury site, indicating that PDI can directly initiate blood coagulation. In vitro, human platelet-secreted PDI contributed to the activation of cryptic TF on microvesicles (microparticles). Mass spectrometry analyses indicated that part of the extracellular cysteine 209 of TF was constitutively glutathionylated. Mixed disulfide formation contributed to maintaining TF in a state of low functionality. We propose that reduced PDI activates TF by isomerization of a mixed disulfide and a free thiol to an intramolecular disulfide. Our findings suggest that disulfide isomerases can act as injury response signals that trigger the activation of fibrin formation following vessel injury.

Catalytic and reactive polypeptides and methods for their preparation and use

DOEpatents

Schultz, Peter

1994-01-01

Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like. This invention was made with Government support under Grant Contract No. AI-24695, awarded by the Department of health and Human Services, and under Grant Contract No. N 00014-87-K-0256, awarded by the Office of Naval Research. The Government has certain rights in this invention.

2015 Site Environmental Report Fernald Preserve

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hertel, Bill; Hooten, Gwen

The Fernald Preserve 2015 Site Environmental Report provides stakeholders with the results from the Fernald, Ohio, Site’s environmental monitoring programs for 2015; a summary of the U.S. Department of Energy’s (DOE’s) activities conducted onsite; and a summary of the Fernald Preserve’s compliance with the various environmental regulations, compliance agreements, and DOE policies that govern site activities. This report has been prepared in accordance with the “Integrated Environmental Monitoring Plan,” which is Attachment D of the Comprehensive Legacy Management and Institutional Controls Plan (LMICP) (DOE 2016). Remediation of the Fernald Preserve has been successfully completed with the exception of the groundwater.more » During 2015, activities at the Fernald Preserve included: environmental monitoring activities related to direct radiation, groundwater, and surface water; ecological restoration monitoring and maintenance as well as inspections, care, and monitoring of the site and the OSDF to ensure that provisions of the LMICP are fully implemented; OSDF leak detection monitoring and collection, monitoring, and treatment of leachate from the OSDF; extraction, monitoring, and treatment of contaminated groundwater from the Great Miami Aquifer (Operable Unit 5); ongoing operation of the Fernald Preserve Visitors Center, associated outreach, and educational activities; and monitoring as specified in the site’s National Pollutant Discharge Elimination System (NPDES) permit. Environmental monitoring programs were developed to ensure that the remedy remains protective of the environment. The requirements of these programs are described in detail in the LMICP and reported in this Site Environmental Report.« less

Expanding the Nucleotide and Sugar 1-Phosphate Promiscuity of Nucleotidyltransferase RmlA via Directed Evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moretti, Rocco; Chang, Aram; Peltier-Pain, Pauline

2012-03-15

Directed evolution is a valuable technique to improve enzyme activity in the absence of a priori structural knowledge, which can be typically enhanced via structure-guided strategies. In this study, a combination of both whole-gene error-prone polymerase chain reaction and site-saturation mutagenesis enabled the rapid identification of mutations that improved RmlA activity toward non-native substrates. These mutations have been shown to improve activities over 10-fold for several targeted substrates, including non-native pyrimidine- and purine-based NTPs as well as non-native d- and l-sugars (both a- and b-isomers). This study highlights the first broadly applicable high throughput sugar-1-phosphate nucleotidyltransferase screen and the firstmore » proof of concept for the directed evolution of this enzyme class toward the identification of uniquely permissive RmlA variants.« less

Regulatory elements involved in constitutive and phorbol ester-inducible expression of the plasminogen activator inhibitor type 2 gene promoter.

PubMed Central

Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K

1991-01-01

Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454

Crystal structure of a suicidal DNA repair protein: the Ada O6-methylguanine-DNA methyltransferase from E. coli.

PubMed

Moore, M H; Gulbis, J M; Dodson, E J; Demple, B; Moody, P C

1994-04-01

The mutagenic and carcinogenic effects of simple alkylating agents are mainly due to methylation at the O6 position of guanine in DNA. O6-methylguanine directs the incorporation of either thymine or cytosine without blocking DNA replication, resulting in GC to AT transition mutations. In prokaryotic and eukaryotic cells antimutagenic repair is effected by direct reversal of this DNA damage. A suicidal methyltransferase repair protein removes the methyl group from DNA to one of its own cysteine residues. The resulting self-methylation of the active site cysteine renders the protein inactive. Here we report the X-ray structure of the 19 kDa C-terminal domain of the Escherichia coli ada gene product, the prototype of these suicidal methyltransferases. In the crystal structure the active site cysteine is buried. We propose a model for the significant conformational change that the protein must undergo in order to bind DNA and effect methyl transfer.

GATA-1 directly regulates Nanog in mouse embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

2015-09-25

Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

Optocontrol of glutamate receptor activity by single side-chain photoisomerization

PubMed Central

Klippenstein, Viktoria; Hoppmann, Christian; Ye, Shixin; Wang, Lei; Paoletti, Pierre

2017-01-01

Engineering light-sensitivity into proteins has wide ranging applications in molecular studies and neuroscience. Commonly used tethered photoswitchable ligands, however, require solvent-accessible protein labeling, face structural constrains, and are bulky. Here, we designed a set of optocontrollable NMDA receptors by directly incorporating single photoswitchable amino acids (PSAAs) providing genetic encodability, reversibility, and site tolerance. We identified several positions within the multi-domain receptor endowing robust photomodulation. PSAA photoisomerization at the GluN1 clamshell hinge is sufficient to control glycine sensitivity and activation efficacy. Strikingly, in the pore domain, flipping of a M3 residue within a conserved transmembrane cavity impacts both gating and permeation properties. Our study demonstrates the first detection of molecular rearrangements in real-time due to the reversible light-switching of single amino acid side-chains, adding a dynamic dimension to protein site-directed mutagenesis. This novel approach to interrogate neuronal protein function has general applicability in the fast expanding field of optopharmacology. DOI: http://dx.doi.org/10.7554/eLife.25808.001 PMID:28534738

Site Environmental Report for Calendar Year 2013. DOE Operations at The Boeing Company, Santa Susana Field Laboratory, Area IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

2014-06-30

This Annual Site Environmental Report (ASER) for 2013 describes the environmental conditions related to work performed for the Department of Energy (DOE) at Area IV of the Santa Susana Field Laboratory (SSFL). The Energy Technology Engineering Center (ETEC), a government-owned, company-operated test facility, was located in Area IV. The operations in Area IV included development, fabrication, operation and disassembly of nuclear reactors, reactor fuel, and other radioactive materials. Other activities in the area involved the operation of large-scale liquid metal facilities that were used for testing non-nuclear liquid metal fast breeder reactor components. All nuclear work was terminated in 1988,more » and all subsequent radiological work has been directed toward environmental restoration and decontamination and decommissioning (D&D) of the former nuclear facilities and their associated sites. Liquid metal research and development ended in 2002. Since May 2007, the D&D operations in Area IV have been suspended by the DOE, but the environmental monitoring and characterization programs have continued. Results of the radiological monitoring program for the calendar year 2013 continue to indicate that there are no significant releases of radioactive material from Area IV of SSFL. All potential exposure pathways are sampled and/or monitored, including air, soil, surface water, groundwater, direct radiation, transfer of property (land, structures, waste), and recycling. Due to the suspension of D&D activities in Area IV, no effluents were released into the atmosphere during 2013. Therefore, the potential radiation dose to the general public through airborne release was zero. Similarly, the radiation dose to an offsite member of the public (maximally exposed individual) due to direct radiation from SSFL is indistinguishable from background. All radioactive wastes are processed for disposal at DOE disposal sites and/or other licensed sites approved by DOE for radioactive waste disposal. No liquid radioactive wastes were released into the environment in 2013.« less

Phosphorylated Nuclear Receptor CAR Forms a Homodimer To Repress Its Constitutive Activity for Ligand Activation

PubMed Central

Shizu, Ryota; Osabe, Makoto; Perera, Lalith; Moore, Rick; Sueyoshi, Tatsuya

2017-01-01

ABSTRACT The nuclear receptor CAR (NR1I3) regulates hepatic drug and energy metabolism as well as cell fate. Its activation can be a critical factor in drug-induced toxicity and the development of diseases, including diabetes and tumors. CAR inactivates its constitutive activity by phosphorylation at threonine 38. Utilizing receptor for protein kinase 1 (RACK1) as the regulatory subunit, protein phosphatase 2A (PP2A) dephosphorylates threonine 38 to activate CAR. Here we demonstrate that CAR undergoes homodimer-monomer conversion to regulate this dephosphorylation. By coexpression of two differently tagged CAR proteins in Huh-7 cells, mouse primary hepatocytes, and mouse livers, coimmunoprecipitation and two-dimensional gel electrophoresis revealed that CAR can form a homodimer in a configuration in which the PP2A/RACK1 binding site is buried within its dimer interface. Epidermal growth factor (EGF) was found to stimulate CAR homodimerization, thus constraining CAR in its inactive form. The agonistic ligand CITCO binds directly to the CAR homodimer and dissociates phosphorylated CAR into its monomers, exposing the PP2A/RACK1 binding site for dephosphorylation. Phenobarbital, which is not a CAR ligand, binds the EGF receptor, reversing the EGF signal to monomerize CAR for its indirect activation. Thus, the homodimer-monomer conversion is the underlying molecular mechanism that regulates CAR activation, by placing phosphorylated threonine 38 as the common target for both direct and indirect activation of CAR. PMID:28265001

Bioinformatic prediction of gene functions regulated by quorum sensing in the bioleaching bacterium Acidithiobacillus ferrooxidans.

PubMed

Banderas, Alvaro; Guiliani, Nicolas

2013-08-16

The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process.

Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans

PubMed Central

Banderas, Alvaro; Guiliani, Nicolas

2013-01-01

The biomining bacterium Acidithiobacillus ferrooxidans oxidizes sulfide ores and promotes metal solubilization. The efficiency of this process depends on the attachment of cells to surfaces, a process regulated by quorum sensing (QS) cell-to-cell signalling in many Gram-negative bacteria. At. ferrooxidans has a functional QS system and the presence of AHLs enhances its attachment to pyrite. However, direct targets of the QS transcription factor AfeR remain unknown. In this study, a bioinformatic approach was used to infer possible AfeR direct targets based on the particular palindromic features of the AfeR binding site. A set of Hidden Markov Models designed to maintain palindromic regions and vary non-palindromic regions was used to screen for putative binding sites. By annotating the context of each predicted binding site (PBS), we classified them according to their positional coherence relative to other putative genomic structures such as start codons, RNA polymerase promoter elements and intergenic regions. We further used the Multiple EM for Motif Elicitation algorithm (MEME) to further filter out low homology PBSs. In summary, 75 target-genes were identified, 34 of which have a higher confidence level. Among the identified genes, we found afeR itself, zwf, genes encoding glycosyltransferase activities, metallo-beta lactamases, and active transport-related proteins. Glycosyltransferases and Zwf (Glucose 6-phosphate-1-dehydrogenase) might be directly involved in polysaccharide biosynthesis and attachment to minerals by At. ferrooxidans cells during the bioleaching process. PMID:23959118

An unconventional origin of metal-ion rescue and inhibition in the Tetrahymena group I ribozyme reaction.

PubMed Central

Shan, S O; Herschlag, D

2000-01-01

The presence of catalytic metal ions in RNA active sites has often been inferred from metal-ion rescue of modified substrates and sometimes from inhibitory effects of alternative metal ions. Herein we report that, in the Tetrahymena group I ribozyme reaction, the deleterious effect of a thio substitution at the pro-Sp position of the reactive phosphoryl group is rescued by Mn2+. However, analysis of the reaction of this thio substrate and of substrates with other modifications strongly suggest that this rescue does not stem from a direct Mn2+ interaction with the Sp sulfur. Instead, the apparent rescue arises from a Mn2+ ion interacting with the residue immediately 3' of the cleavage site, A(+1), that stabilizes the tertiary interactions between the oligonucleotide substrate (S) and the active site. This metal site is referred to as site D herein. We also present evidence that a previously observed Ca2+ ion that inhibits the chemical step binds to metal site D. These and other observations suggest that, whereas the interactions of Mn2+ at site D are favorable for the chemical reaction, the Ca2+ at site D exerts its inhibitory effect by disrupting the alignment of the substrates within the active site. These results emphasize the vigilance necessary in the design and interpretation of metal-ion rescue and inhibition experiments. Conversely, in-depth mechanistic analysis of the effects of site-specific substrate modifications can allow the effects of specific metal ion-RNA interactions to be revealed and the properties of individual metal-ion sites to be probed, even within the sea of metal ions bound to RNA. PMID:10864040

Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex.

PubMed

Douglas, Max E; Diffley, John F X

2016-03-11

Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly ("G1-like") and high affinity recruitment when CMG assembly takes place ("S-phase-like"). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Neurotoxicity and other pharmacological activities of the snake venom phospholipase A2 OS2: The N-terminal region is more important than enzymatic activity

PubMed Central

Rouault, Morgane; Rash, Lachlan D.; Escoubas, Pierre; Boilard, Eric; Bollinger, James; Lomonte, Bruno; Maurin, Thomas; Guillaume, Carole; Canaan, Stéphane; Deregnaucourt, Christiane; Schrével, Joseph; Doglio, Alain; Gutiérrez, José María; Lazdunski, Michel; Gelb, Michael H.; Lambeau, Gérard

2009-01-01

Several snake venom secreted phospholipases A2 (sPLA2s) including OS2 exert a variety of pharmacological effects ranging from central neurotoxicity to anti-HIV activity by mechanisms that are not yet fully understood. To conclusively address the role of enzymatic activity and map the key structural elements of OS2 responsible for its pharmacological properties, we have prepared single point OS2 mutants at the catalytic site and large chimeras between OS2 and OS1, an homologous but non toxic sPLA2. Most importantly, we found that the enzymatic activity of the active site mutant H48Q is 500-fold lower than that of the wild-type protein, while central neurotoxicity is only 16-fold lower, providing convincing evidence that catalytic activity is at most a minor factor that determines central neurotoxicity. The chimera approach has identified the N-terminal region (residues 1–22) of OS2, but not the central one (residues 58–89), as crucial for both enzymatic activity and pharmacological effects. The C-terminal region of OS2 (residues 102–119) was found to be critical for enzymatic activity, but not for central neurotoxicity and anti-HIV activity, allowing us to further dissociate enzymatic activity and pharmacological effects. Finally, direct binding studies with the C-terminal chimera which poorly binds to phospholipids while it is still neurotoxic, led to the identification of a subset of brain N-type receptors which may be directly involved in central neurotoxicity. PMID:16669624

Structural Basis of the Induced-Fit Mechanism of 1,4-Dihydroxy-2-Naphthoyl Coenzyme A Synthase from the Crotonase Fold Superfamily

PubMed Central

Li, Jie; Li, Yan; Jiang, Ming; Zhou, Jiahai; Guo, Zhihong

2013-01-01

1, 4-Dihydroxy-2-naphthoyl coenzyme A (DHNA-CoA) synthase is a typical crotonase fold enzyme with an implicated role of conformational changes in catalysis. We have identified these conformational changes by determining the structures of its Escherichia coli and Synechocystis sp. PCC6803 orthologues in complex with a product analog. The structural changes include the folding of an active-site loop into a β-hairpin and significant reorientation of a helix at the carboxy terminus. Interestingly, a new interface is formed between the ordered loop and the reoriented helix, both of which also form additional interactions with the coenzyme A moiety of the ligand. Site-directed mutation of the amino acid residues involved in these ligand-induced interactions significantly diminishes the enzyme activity. These results suggest a catalytically essential induced-fit that is likely initiated by the enzyme-ligand interactions at the active site. PMID:23658663

Ternary structure reveals mechanism of a membrane diacylglycerol kinase

DOE PAGES

Li, Dianfan; Stansfeld, Phillip J.; Sansom, Mark S. P.; ...

2015-12-17

Diacylglycerol kinase catalyses the ATP-dependent conversion of diacylglycerol to phosphatidic acid in the plasma membrane of Escherichia coli. The small size of this integral membrane trimer, which has 121 residues per subunit, means that available protein must be used economically to craft three catalytic and substrate-binding sites centred about the membrane/cytosol interface. How nature has accomplished this extraordinary feat is revealed here in a crystal structure of the kinase captured as a ternary complex with bound lipid substrate and an ATP analogue. Residues, identified as essential for activity by mutagenesis, decorate the active site and are rationalized by the ternarymore » structure. The γ-phosphate of the ATP analogue is positioned for direct transfer to the primary hydroxyl of the lipid whose acyl chain is in the membrane. A catalytic mechanism for this unique enzyme is proposed. As a result, the active site architecture shows clear evidence of having arisen by convergent evolution.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kersten, Roland D.; Diedrich, Jolene K.; Yates, III, John R.

Terpenes are ubiquitous natural chemicals with diverse biological functions spanning all three domains of life. In specialized metabolism, the active sites of terpene synthases (TPSs) evolve in shape and reactivity to direct the biosynthesis of a myriad of chemotypes for organismal fitness. As most terpene biosynthesis mechanistically involves highly reactive carbocationic intermediates, the protein surfaces catalyzing these cascade reactions possess reactive regions possibly prone to premature carbocation capture and potentially enzyme inactivation. Here, we show using proteomic and X-ray crystallographic analyses that cationic intermediates undergo capture by conserved active site residues leading to inhibitory self-alkylation. Furthermore, the level of cation-mediatedmore » inactivation increases with mutation of the active site, upon changes in the size and structure of isoprenoid diphosphate substrates, and alongside increases in reaction temperatures. TPSs that individually synthesize multiple products are less prone to self-alkylation then TPSs possessing relatively high product specificity. In total, the results presented suggest that mechanism-based alkylation represents an overlooked mechanistic pressure during the evolution of cation-derived terpene biosynthesis.« less

The EuroSITES network: Integrating and enhancing fixed-point open ocean observatories around Europe

NASA Astrophysics Data System (ADS)

Lampitt, Richard S.; Larkin, Kate E.; EuroSITES Consortium

2010-05-01

EuroSITES is a 3 year (2008-2011) EU collaborative project (3.5MEuro) with the objective to integrate and enhance the nine existing open ocean fixed point observatories around Europe (www.eurosites.info). These observatories are primarily composed of full depth moorings and make multidisciplinary in situ observations within the water column as the European contribution to the global array OceanSITES (www.oceansites.org). In the first 18 months, all 9 observatories have been active and integration has been significant through the maintenance and enhancement of observatory hardware. Highlights include the enhancement of observatories with sensors to measure O2, pCO2, chlorophyll, and nitrate in near real-time from the upper 1000 m. In addition, some seafloor missions are also actively supported. These include seafloor platforms currently deployed in the Mediterranean, one for tsunami detection and one to monitor fluid flow related to seismic activity and slope stability. Upcoming seafloor science missions in 2010 include monitoring benthic biological communities and associated biogeochemistry as indicators of climate change in both the Northeast Atlantic and Mediterranean. EuroSITES also promotes the development of innovative sensors and samplers in order to progress capability to measure climate-relevant properties of the ocean. These include further developing current technologies for autonomous long-term monitoring of oxygen consumption in the mesopelagic, pH and mesozooplankton abundance. Many of these science missions are directly related to complementary activities in other European projects such as EPOCA, HYPOX and ESONET. In 2010 a direct collaboration including in situ field work will take place between ESONET and EuroSITES. The demonstration mission MODOO (funded by ESONET) will be implemented in 2010 at the EuroSITES PAP observatory. Field work will include deployment of a seafloor lander system with various sensors which will send data to shore in real time via the EuroSITES water column infrastructure. EuroSITES Data management is led by NOCS, UK with CORIOLIS, France as one of the Global Data assembly centre (GDAC) for both EuroSITES and OceanSITES. EuroSITES maintains the OceanSITES and GEO philosophy of open access to data in near real-time. With a common data policy and standardised data formats (OceanSITES NetCDF) EuroSITES is increasing the potential users of in situ ocean datasets and the societal benefit of these data. For instance, CORIOLIS is central to the ever increasing contribution of EuroSITES as an upstream data provider to the GMES project MyOcean (both real-time and delayed-mode data). Outreach and knowledge transfer of EuroSITES activities and results are also a key component to the project with a dedicated outreach website, Fact Sheet, cruise diaries and educational tools being developed in the first 18 months. In 2010 a film will be released to represent the network and this will be distributed to a wide audience through the European network of aquaria and at other outreach events. In addition, the EuroSITES project and it's relevance to global ocean observation initiatives continues to be actively promoted at both scientific and non-specialist meetings and events. By the end of EuroSITES in April 2011, the 9 core ocean observatories will be well integrated. Each observatory will have enhanced infrastructure to include both physical and biogeoechemical sensors. Science missions in the ocean interior and seafloor/subseafloor will have progressed European ocean observational capability significantly. Collaborations will have taken place or will be at an advanced stage of planning with related European and international projects including ESONET FP6 NoE and the NSF funded Ocean Observatories Initiative (OOI) (400M over 5 years). EuroSITES will continue to develop it's contribution to the ocean component of the Group on Earth Observations (GEO) through task AR-09-03c 'Global Ocean Observing Systems' and related societal benefit areas.

Activation of CO2 by supported Cu clusters.

PubMed

Iyemperumal, Satish Kumar; Deskins, N Aaron

2017-11-01

Catalytic reduction of carbon dioxide to useful chemicals is a potent way to mitigate this greenhouse gas, but the challenge lies in finding active reduction catalysts. Using density functional theory we studied CO 2 activation over TiO 2 -supported Cu clusters of size 1-4 atoms. The linear to bent transformation of CO 2 is necessary for activation, and we found that all the clusters stabilized bent CO 2 , along with a significant gain of electrons on the CO 2 (indicative of activation). On all the TiO 2 supported Cu clusters, the interfacial sites were found to stabilize the bent CO 2 adsorption, where the active site of adsorption on Cu dimer, trimer and tetramer was on the Cu atom farthest away from the TiO 2 surface. Particularly, the Cu dimer stabilized bent CO 2 very strongly, although this species was found to be unstable on the surface. A synthesis technique that could stabilize the Cu dimer could therefore lead to a very active catalyst. Furthermore we found (using vibrational and charge analysis) that the active sites for the CO 2 activation predominantly had 0 and +1 oxidation states; the oxidation state of Cu is known to directly affect CO 2 reduction activity. Our study shows TiO 2 -supported small Cu clusters can be active catalysts for CO 2 reduction and also provides further motivation for theoretical and experimental studies of metal clusters.

Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the -111 kb-Myf5 enhancer.

PubMed

Daubas, Philippe; Buckingham, Margaret E

2013-04-15

The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.

Influence of a multidimensional measure of attitudes on motives to use social networking sites.

PubMed

Krishnan, Archana; Hunt, Daniel Scot

2015-03-01

Positive attitudes toward a new communication technology tend to be a significant motivator in subsequent adoption and use. The recent spurt in the adoption of social media tools such as social networking sites (SNSs) demands the examination of attitudinal variables on motives to use these Web sites. This study explicated a multidimensional measure of attitudes toward SNSs and tested a theoretical model to examine the effect of attitudes on motives to use SNSs and SNS activity. Participants (N=674) completed a cross-sectional survey consisting of measures of attitudes toward SNSs, motives of SNS use, and level of activity. Results showed support for a revised model in which attitudinal variables-ease of use, self-disclosure, and social connection-strongly predicted motives of SNS use such as passing time, information/entertainment, social conformity, and, most importantly, socialization. The motive of using SNSs as a social tool superseded the direct effect of other motives on SNS activity, suggesting that users' primary activity on SNSs was for socialization and for relational development and maintenance.

The pimeloyl-CoA synthetase BioW defines a new fold for adenylate-forming enzymes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Estrada, Paola; Manandhar, Miglena; Dong, Shi-Hui

Reactions that activate carboxylates through acyl-adenylate intermediates are found throughout biology and include acyl- and aryl-CoA synthetases and tRNA synthetases. Here we describe the characterization of Aquifex aeolicus BioW, which represents a new protein fold within the superfamily of adenylating enzymes. Substrate-bound structures identified the enzyme active site and elucidated the mechanistic strategy for conjugating CoA to the seven-carbon α,ω-dicarboxylate pimelate, a biotin precursor. Proper position of reactive groups for the two half-reactions is achieved solely through movements of active site residues, as confirmed by site-directed mutational analysis. The ability of BioW to hydrolyze adenylates of noncognate substrates is reminiscentmore » of pre-transfer proofreading observed in some tRNA synthetases, and we show that this activity can be abolished by mutation of a single residue. These studies illustrate how BioW can carry out three different biologically prevalent chemical reactions (adenylation, thioesterification, and proofreading) in the context of a new protein fold.« less

Lens-Specific Gene Recruitment of ζ-Crystallin through Pax6, Nrl-Maf, and Brain Suppressor Sites

PubMed Central

Sharon-Friling, Ronit; Richardson, Jill; Sperbeck, Sally; Lee, Douglas; Rauchman, Michael; Maas, Richard; Swaroop, Anand; Wistow, Graeme

1998-01-01

ζ-Crystallin is a taxon-specific crystallin, an enzyme which has undergone direct gene recruitment as a structural component of the guinea pig lens through a Pax6-dependent mechanism. Tissue specificity arises through a combination of effects involving three sites in the lens promoter. The Pax6 site (ZPE) itself shows specificity for an isoform of Pax6 preferentially expressed in lens cells. High-level expression of the promoter requires a second site, identical to an αCE2 site or half Maf response element (MARE), adjacent to the Pax6 site. A promoter fragment containing Pax6 and MARE sites gives lens-preferred induction of a heterologous promoter. Complexes binding the MARE in lens nuclear extracts are antigenically related to Nrl, and cotransfection with Nrl elevates ζ-crystallin promoter activity in lens cells. A truncated ζ promoter containing Nrl-MARE and Pax6 sites has a high level of expression in lens cells in transgenic mice but is also active in the brain. Suppression of the promoter in the brain requires sequences between −498 and −385, and a site in this region forms specific complexes in brain extract. A three-level model for lens-specific Pax6-dependent expression and gene recruitment is suggested: (i) binding of a specific isoform of Pax6; (ii) augmentation of expression through binding of Nrl or a related factor; and (iii) suppression of promoter activity in the central nervous system by an upstream negative element in the brain but not in the lens. PMID:9528779

Metal–organic and covalent organic frameworks as single-site catalysts

PubMed Central

Rogge, S. M. J.; Bavykina, A.; Hajek, J.; Garcia, H.; Olivos-Suarez, A. I.; Sepúlveda-Escribano, A.; Vimont, A.; Clet, G.; Bazin, P.; Kapteijn, F.

2017-01-01

Heterogeneous single-site catalysts consist of isolated, well-defined, active sites that are spatially separated in a given solid and, ideally, structurally identical. In this review, the potential of metal–organic frameworks (MOFs) and covalent organic frameworks (COFs) as platforms for the development of heterogeneous single-site catalysts is reviewed thoroughly. In the first part of this article, synthetic strategies and progress in the implementation of such sites in these two classes of materials are discussed. Because these solids are excellent playgrounds to allow a better understanding of catalytic functions, we highlight the most important recent advances in the modelling and spectroscopic characterization of single-site catalysts based on these materials. Finally, we discuss the potential of MOFs as materials in which several single-site catalytic functions can be combined within one framework along with their potential as powerful enzyme-mimicking materials. The review is wrapped up with our personal vision on future research directions. PMID:28338128

Implementation of a DOD ELAP Conforming Quality System at a FUSRAP Site Field Temporary Radiological Screening Laboratory - 13500

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winters, M.S.; McElheny, G.; Houston, L.M.

2013-07-01

A case study is presented on specific program elements that supported the transition of a temporary field radiological screening lab to an accredited operation capable of meeting client quality objectives for definitive results data. The temporary field lab is located at the Formerly Utilized Sites Remedial Action Program Linde Site in Tonawanda, NY. The site is undergoing remediation under the direction of the United States Army Corps of Engineers - Buffalo District, with Cabrera Services Inc. as the remediation contractor and operator of the on-site lab. Analysis methods employed in the on-site lab include gross counting of alpha and betamore » particle activity on swipes and air filters and gamma spectroscopy of soils and other solid samples. A discussion of key program elements and lessons learned may help other organizations considering pursuit of accreditation for on-site screening laboratories. (authors)« less

Quantum mechanical calculation of electric fields and vibrational Stark shifts at active site of human aldose reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Xianwei; State Key Laboratory of Precision Spectroscopy, Institute of Theoretical and Computational Science, East China Normal University, Shanghai 200062; Zhang, John Z. H.

2015-11-14

Recent advance in biophysics has made it possible to directly measure site-specific electric field at internal sites of proteins using molecular probes with C = O or C≡N groups in the context of vibrational Stark effect. These measurements directly probe changes of electric field at specific protein sites due to, e.g., mutation and are very useful in protein design. Computational simulation of the Stark effect based on force fields such as AMBER and OPLS, while providing good insight, shows large errors in comparison to experimental measurement due to inherent difficulties associated with point charge based representation of force fields. Inmore » this study, quantum mechanical calculation of protein’s internal electrostatic properties and vibrational Stark shifts was carried out by using electrostatically embedded generalized molecular fractionation with conjugate caps method. Quantum calculated change of mutation-induced electric field and vibrational Stark shift is reported at the internal probing site of enzyme human aldose reductase. The quantum result is in much better agreement with experimental data than those predicted by force fields, underscoring the deficiency of traditional point charge models describing intra-protein electrostatic properties.« less

Catalytic zinc site and mechanism of the metalloenzyme PR-AMP cyclohydrolase.

PubMed

D'Ordine, Robert L; Linger, Rebecca S; Thai, Carolyn J; Davisson, V Jo

2012-07-24

The enzyme N(1)-(5'-phosphoribosyl) adenosine-5'-monophosphate cyclohydrolase (PR-AMP cyclohydrolase) is a Zn(2+) metalloprotein encoded by the hisI gene. It catalyzes the third step of histidine biosynthesis, an uncommon ring-opening of a purine heterocycle for use in primary metabolism. A three-dimensional structure of the enzyme from Methanobacterium thermoautotrophicum has revealed that three conserved cysteine residues occur at the dimer interface and likely form the catalytic site. To investigate the functions of these cysteines in the enzyme from Methanococcus vannielii, a series of biochemical studies were pursued to test the basic hypothesis regarding their roles in catalysis. Inactivation of the enzyme activity by methyl methane thiosulfonate (MMTS) or 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) also compromised the Zn(2+) binding properties of the protein inducing loss of up to 90% of the metal. Overall reaction stoichiometry and the potassium cyanide (KCN) induced cleavage of the protein suggested that all three cysteines were modified in the process. The enzyme was protected from DTNB-induced inactivation by inclusion of the substrate N(1)-(5'-phosphoribosyl)adenosine 5'-monophosphate; (PR-AMP), while Mg(2+), a metal required for catalytic activity, enhanced the rate of inactivation. Site-directed mutations of the conserved C93, C109, C116 and the double mutant C109/C116 were prepared and analyzed for catalytic activity, Zn(2+) content, and reactivity with DTNB. Substitution of alanine for each of the conserved cysteines showed no measurable catalytic activity, and only the C116A was still capable of binding Zn(2+). Reactions of DTNB with the C109A/C116A double mutant showed that C93 is completely modified within 0.5 s. A model consistent with these data involves a DTNB-induced mixed disulfide linkage between C93 and C109 or C116, followed by ejection of the active site Zn(2+) and provides further evidence that the Zn(2+) coordination site involves the three conserved cysteine residues. The C93 reactivity is modulated by the presence of the Zn(2+) and Mg(2+) and substantiates the role of this residue as a metal ligand. In addition, Mg(2+) ligand binding site(s) indicated by the structural analysis were probed by site-directed mutagenesis of three key aspartate residues flanking the conserved C93 which were shown to have a functional impact on catalysis, cysteine activation, and metal (zinc) binding capacity. The unique amino acid sequence, the dynamic properties of the cysteine ligands involved in Zn(2+) coordination, and the requirement for a second metal (Mg(2+)) are discussed in the context of their roles in catalysis. The results are consistent with a Zn(2+)-mediated activation of H(2)O mechanism involving histidine as a general base that has features similar to but distinct from those of previously characterized purine and pyrimidine deaminases.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

An aerial radiological survey of the Robert Emmett Ginna Nuclear Power Plant and surrounding area, Ontario, New York

DOE Office of Scientific and Technical Information (OSTI.GOV)

Proctor, A.E.

1997-06-01

Terrestrial radioactivity surrounding the Robert Emmett Ginna Nuclear Power Plant was measured using aerial radiological surveying techniques. The purpose of this survey was to document exposure rates near the plant and to identify unexpected, man-made radiation sources within the survey area. The surveyed area included land areas within a three-mile radius of the plant site. Data were acquired using an airborne detection system that employed sodium iodide, thallium-activated detectors. Exposure-rate and photopeak counts were computed from these data and plotted on aerial photographs of the survey area. Several ground-based exposure measurements were made for comparison with the aerial survey results.more » Exposure rates in the area surrounding the plant site varied from 6 to 10 microroentgens per hour. Man-made radiation (cobalt-60 within the plant site and cesium-1 37 directly over the reactor) was found at the plant site. In addition, small areas of suspected cesium-137 activity were found within the survey areas. Other than these small sites, the survey area was free of man-made radioac- tivity.« less

Statistical analysis of $sup 239-240$Pu and $sup 241$Am contamination of soil and vegetation on NAEG study sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilbert, R.O.; Eberhardt, L.L.; Fowler, E.B.

Reported here are results of the statistical design and analysis work conducted during Calendar Year 1974 for the Nevada Applied Ecology Group (NAEG) at plutonium study sites on the Nevada Test Site (NTS) and the Tonopah Test Range (TTR). Estimates of $sup 239-240$Pu inventory in surface soil (0 to 5-cm depth) are given for each of the NAEG intensive study sites, together with activity maps based on FIDLER surveys showing the field areas to which these estimates apply. There is evidence of a preliminary nature to suggest that the plutonium present in surface soil may be covered by a thinmore » (less than 2.5 cm) layer of soil whose alpha activity is considerably less than that directly below. Computer-drawn $sup 239-240$Pu concentration contours and three-dimensional surfaces in soil and vegetation are given for Area 13 and GMX as a first attempt at estimating the geographical distribution of $sup 239-240$Pu at these sites. (CH)« less

Adding Value to the Health Care System: Identifying Value-Added Systems Roles for Medical Students.

PubMed

Gonzalo, Jed D; Graaf, Deanna; Johannes, Bobbie; Blatt, Barbara; Wolpaw, Daniel R

To catalyze learning in Health Systems Science and add value to health systems, education programs are seeking to incorporate students into systems roles, which are not well described. The authors sought to identify authentic roles for students within a range of clinical sites and explore site leaders' perceptions of the value of students performing these roles. From 2013 to 2015, site visits and interviews with leadership from an array of clinical sites (n = 30) were conducted. Thematic analysis was used to identify tasks and benefits of integrating students into interprofessional care teams. Types of systems roles included direct patient benefit activities, including monitoring patient progress with care plans and facilitating access to resources, and clinic benefit activities, including facilitating coordination and improving clinical processes. Perceived benefits included improved value of the clinical mission and enhanced student education. These results elucidate a framework for student roles that enhance learning and add value to health systems.

The PBX1 lupus susceptibility gene regulates CD44 expression.

PubMed

Niu, Yuxin; Sengupta, Mayami; Titov, Anton A; Choi, Seung-Chul; Morel, Laurence

2017-05-01

PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4 + T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and shows that the lupus-associated isoform PBX1-d has unique molecular functions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Reengineered glucose oxidase for amperometric glucose determination in diabetes analytics.

PubMed

Arango Gutierrez, Erik; Mundhada, Hemanshu; Meier, Thomas; Duefel, Hartmut; Bocola, Marco; Schwaneberg, Ulrich

2013-12-15

Glucose oxidase is an oxidoreductase exhibiting a high β-D-glucose specificity and high stability which renders glucose oxidase well-suited for applications in diabetes care. Nevertheless, GOx activity is highly oxygen dependent which can lead to inaccuracies in amperometric β-D-glucose determinations. Therefore a directed evolution campaign with two rounds of random mutagenesis (SeSaM followed by epPCR), site saturation mutagenesis studies on individual positions, and one simultaneous site saturation library (OmniChange; 4 positions) was performed. A diabetes care well suited mediator (quinone diimine) was selected and the GOx variant (T30V I94V) served as starting point. For directed GOx evolution a microtiter plate detection system based on the quinone diimine mediator was developed and the well-known ABTS-assay was applied in microtiter plate format to validate oxygen independency of improved GOx variants. Two iterative rounds of random diversity generation and screening yielded to two subsets of amino acid positions which mainly improved activity (A173, A332) and oxygen independency (F414, V560). Simultaneous site saturation of all four positions with a reduced subset of amino acids using the OmniChange method yielded finally variant V7 with a 37-fold decreased oxygen dependency (mediator activity: 7.4 U/mg WT, 47.5 U/mg V7; oxygen activity: 172.3 U/mg WT, 30.1 U/mg V7). V7 is still highly β-D-glucose specific, highly active with the quinone diimine mediator and thermal resistance is retained (prerequisite for GOx coating of diabetes test stripes). The latter properties and V7's oxygen insensitivity make V7 a very promising candidate to replace standard GOx in diabetes care applications. Copyright © 2013 Elsevier B.V. All rights reserved.

Residual herbicide study on selected Hanford Site roadsides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, J.L.; Kemp, C.J.; Sackschewsky, M.R.

Westinghouse Hanford Company routinely treats roadsides with herbicides to control undesirable plant growth. An experiment was conducted to test perennial grass germination in soils adjacent to roadways of the Hanford Site. The primary variable was the distance from the roadside. A simple germination test was executed in a controlled-environment chamber to determine the residual effects of these applications. As expected, the greatest herbicide activity was found directly adjacent to the roadway, approximately 0 to 20 ft (0 to 6.3 m) from the roadway.

Site Environmental Report for 2010, Volumes 1 & 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baskin, David; Bauters, Tim; Borglin, Ned

2011-09-01

LBNL is a multiprogram scientific facility operated by the UC for the DOE. LBNL’s research is directed toward the physical, biological, environmental, and computational sciences, in order to deliver scientific knowledge and discoveries pertinent to DOE’s missions. This annual Site Environmental Report covers activities conducted in CY 2010. The format and content of this report satisfy the requirements of DOE Order 231.1A, Environment, Safety, and Health Reporting,1 and the operating contract between UC and DOE

A binding site for non-steroidal anti-inflammatory drugs in FAAH

PubMed Central

Bertolacci, Laura; Romeo, Elisa; Veronesi, Marina; Magotti, Paola; Albani, Clara; Dionisi, Mauro; Lambruschini, Chiara; Scarpelli, Rita; Cavalli, Andrea; Vivo, Marco De; Piomelli, Daniele; Garau, Gianpiero

2013-01-01

In addition to inhibiting the cyclooxygenasemediated biosynthesis of prostanoids, various widely used non-steroidal anti-inflammatory drugs (NSAIDs) enhance endocannabinoid signaling by blocking the anandamidedegrading membrane enzyme, fatty acid amide hydrolase (FAAH). The X-ray structure of FAAH in complex with the NSAID carprofen, along with studies of site-directed mutagenesis, enzyme activity assays, and nuclear magnetic resonance, now reveal the molecular details of this interaction, providing information that may guide the design of dual FAAH-cyclooxygenase inhibitors with superior analgesic efficacy. PMID:23240907

Crystal structure of SgcJ, an NTF2-like superfamily protein involved in biosynthesis of the nine-membered enediyne antitumor antibiotic C-1027

DOE PAGES

Huang, Tingting; Chang, Chin -Yuan; Lohman, Jeremy R.; ...

2016-10-01

Comparative analysis of the enediyne biosynthetic gene clusters revealed sets of conserved genes serving as outstanding candidates for the enediyne core. Here we report the crystal structures of SgcJ and its homologue NCS-Orf16, together with gene inactivation and site-directed mutagenesis studies, to gain insight into enediyne core biosynthesis. Gene inactivation in vivo establishes that SgcJ is required for C-1027 production in Streptomyces globisporus. SgcJ and NCS-Orf16 share a common structure with the nuclear transport factor 2-like superfamily of proteins, featuring a putative substrate binding or catalytic active site. Site-directed mutagenesis of the conserved residues lining this site allowed us tomore » propose that SgcJ and its homologues may play a catalytic role in transforming the linear polyene intermediate, along with other enediyne polyketide synthase-associated enzymes, into an enzyme-sequestered enediyne core intermediate. In conclusion, these findings will help formulate hypotheses and design experiments to ascertain the function of SgcJ and its homologues in nine-membered enediyne core biosynthesis.« less

Sequences downstream of AAUAAA signals affect pre-mRNA cleavage and polyadenylation in vitro both directly and indirectly.

PubMed Central

Ryner, L C; Takagaki, Y; Manley, J L

1989-01-01

To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911

Rediscovering the wound hematoma as a site of hemostasis during major arterial hemorrhage.

PubMed

White, N J; Mehic, E; Wang, X; Chien, D; Lim, E; St John, A E; Stern, S A; Mourad, P D; Rieger, M; Fries, D; Martinowitz, U

2015-12-01

Treatments for major internal bleeding after injury include permissive hypotension to decrease the rate of blood loss, intravenous infusion of plasma or clotting factors to improve clot formation, and rapid surgical hemostasis or arterial embolization to control bleeding vessels. Yet, little is known regarding major internal arterial hemostasis, or how these commonly used treatments might influence hemostasis. (i) To use a swine model of femoral artery bleeding to understand the perivascular hemostatic response to contained arterial hemorrhage. (ii) To directly confirm the association between hemodynamics and bleeding velocity. (iii) To observe the feasibility of delivering an activated clotting factor directly to internal sites of bleeding using a simplified angiographic approach. Ultrasound was used to measure bleeding velocity and in vivo clot formation by elastography in a swine model of contained femoral artery bleeding with fluid resuscitation. A swine model of internal pelvic and axillary artery hemorrhage was also used to demonstrate the feasibility of local delivery of an activated clotting factor. In this model, clots formed slowly within the peri-wound hematoma, but eventually contained the bleeding. Central hemodynamics correlated positively with bleeding velocity. Infusion of recombinant human activated factor VII into the injured artery near the site of major internal hemorrhage in the pelvis and axillae was feasible. We rediscovered that clot formation within the peri-wound hematoma is an integral component of hemostasis and a feasible target for the treatment of major internal bleeding using activated clotting factors delivered using a simplified angiographic approach. © 2015 International Society on Thrombosis and Haemostasis.

Jumping to (fatal) conclusions? An analysis of video film on a social networking web site of recreational jumping from height into water.

PubMed

Moran, Kevin

2014-01-01

In high-income countries, death as a consequence of recreational jumping into water from height has not been well investigated partly because it traditionally has been a covert activity within youth culture. An observational study of video recordings posted on the YouTube web site was used to gather data on the nature of jumping activity in New Zealand and Australia. An analytical framework was developed to identify site- participant- social characteristics (10 variables) and online feedback (4 variables). Of the 389 videos recorded in New Zealand (n = 210) and Australia (n = 179), 929 jumpers were observed, and rivers were the most frequently reported site of jumping activity (New Zealand 47%; Australia 35%). One fifth (20%) of the jumps in New Zealand and one third (33%) in Australia were from heights estimated to be more than 12 m. The YouTube website portraying jumps from height were visited almost half a million times (495,686 hits). Ways of reducing recreational jumping risk via targeted education interventions may be best directed at young male adults. Use of social network sites to foster safe behaviours may be an effective way to educate young people of the inherent risks of jumping from height into water.

Allosteric Partial Inhibition of Monomeric Proteases. Sulfated Coumarins Induce Regulation, not just Inhibition, of Thrombin

PubMed Central

Verespy III, Stephen; Mehta, Akul Y.; Afosah, Daniel; Al-Horani, Rami A.; Desai, Umesh R.

2016-01-01

Allosteric partial inhibition of soluble, monomeric proteases can offer major regulatory advantages, but remains a concept on paper to date; although it has been routinely documented for receptors and oligomeric proteins. Thrombin, a key protease of the coagulation cascade, displays significant conformational plasticity, which presents an attractive opportunity to discover small molecule probes that induce sub-maximal allosteric inhibition. We synthesized a focused library of some 36 sulfated coumarins to discover two agents that display sub-maximal efficacy (~50%), high potency (<500 nM) and high selectivity for thrombin (>150-fold). Michaelis-Menten, competitive inhibition, and site-directed mutagenesis studies identified exosite 2 as the site of binding for the most potent sulfated coumarin. Stern-Volmer quenching of active site-labeled fluorophore suggested that the allosteric regulators induce intermediate structural changes in the active site as compared to those that display ~80–100% efficacy. Antithrombin inactivation of thrombin was impaired in the presence of the sulfated coumarins suggesting that allosteric partial inhibition arises from catalytic dysfunction of the active site. Overall, sulfated coumarins represent first-in-class, sub-maximal inhibitors of thrombin. The probes establish the concept of allosteric partial inhibition of soluble, monomeric proteins. This concept may lead to a new class of anticoagulants that are completely devoid of bleeding. PMID:27053426

Chemical rescue of the post-translationally carboxylated lysine mutant of allantoinase and dihydroorotase by metal ions and short-chain carboxylic acids.

PubMed

Ho, Ya-Yeh; Huang, Yen-Hua; Huang, Cheng-Yang

2013-04-01

Bacterial allantoinase (ALLase) and dihydroorotase (DHOase) are members of the cyclic amidohydrolase family. ALLase and DHOase possess similar binuclear metal centers in the active site in which two metals are bridged by a post-translationally carboxylated lysine. In this study, we determined the effects of carboxylated lysine and metal binding on the activities of ALLase and DHOase. Although DHOase is a metalloenzyme, purified DHOase showed high activity without additional metal supplementation in a reaction mixture or bacterial culture. However, unlike DHOase, ALLase had no activity unless some specific metal ions were added to the reaction mixture or culture. Substituting the metal binding sites H59, H61, K146, H186, H242, or D315 with alanine completely abolished the activity of ALLase. However, the K146C, K146D and K146E mutants of ALLase were still active with about 1-6% activity of the wild-type enzyme. These ALLase K146 mutants were found to have 1.4-1.7 mol metal per mole enzyme subunit, which may indicate that they still contained the binuclear metal center in the active site. The activity of the K146A mutant of the ALLase and the K103A mutant of DHOase can be chemically rescued by short-chain carboxylic acids, such as acetic, propionic, and butyric acids, but not by ethanol, propan-1-ol, and imidazole, in the presence of Co2+ or Mn2+ ions. However, the activity was still ~10-fold less than that of wild-type ALLase. Overall, these results indicated that the 20 natural basic amino acid residues were not sufficiently able to play the role of lysine. Accordingly, we proposed that during evolution, the post-translational modification of carboxylated lysine in the cyclic amidohydrolase family was selected for promoting binuclear metal center self-assembly and increasing the nucleophilicity of the hydroxide at the active site for enzyme catalysis. This kind of chemical rescue combined with site-directed mutagenesis may also be used to identify a binuclear metal center in the active site for other metalloenzymes.

A contact photo-cross-linking investigation of the active site of the 8-17 deoxyribozyme.

PubMed

Liu, Yong; Sen, Dipankar

2008-09-12

The small RNA-cleaving 8-17 deoxyribozyme (DNAzyme) has been the subject of extensive mechanistic and structural investigation, including a number of recent single-molecule studies of its global folding. Little detailed insight exists, however, into this DNAzyme's active site; for instance, the identity of specific nucleotides that are proximal to or in contact with the scissile site in the substrate. Here, we report a systematic replacement of a number of bases within the magnesium-folded DNAzyme-substrate complex with thio- and halogen-substituted base analogues, which were then photochemically activated to generate contact cross-links within the complex. Mapping of the cross-links revealed a striking pattern of DNAzyme-substrate cross-links but an absence of significant intra-DNAzyme cross-links. Notably, the two nucleotides directly flanking the scissile phosphodiester cross-linked strongly with functionally important elements within the DNAzyme, the thymine of a G.T wobble base pair, a WCGR bulge loop, and a terminal AGC loop. Mutation of the wobble base pair to a G-C pair led to a significant folding instability of the DNAzyme-substrate complex. The cross-linking patterns obtained were used to generate a model for the DNAzyme's active site that had the substrate's scissile phosphodiester sandwiched between the DNAzyme's wobble thymine and its AGC and WCGR loops.

Negative impact of surface Ti3+ defects on the photocatalytic hydrogen evolution activity of SrTiO3

NASA Astrophysics Data System (ADS)

Chen, Haidong; Zhang, Feng; Zhang, Weifeng; Du, Yingge; Li, Guoqiang

2018-01-01

Defects play an important and in many cases dominant role in the physical and chemical properties of many oxide materials. In this work, we show that the surface Ti3+ defects in SrTiO3 (STO), characterized by electron paramagnetic resonance and X-ray photoelectron spectroscopy, directly impact the photocatalytic activity of STO. O2 species are found to absorb preferentially on Ti3+ defect sites. Hydrogen evolution under ambient air diminishes with the increase in the concentration of surface Ti3+. This is explained by the over-accumulation of Pt cocatalysts on the site of surface Ti3+ defects after the removal of adsorbed O2.

Expression, purification and molecular structure modeling of thioredoxin (Trx) and thioredoxin reductase (TrxR) from Acidithiobacillus ferrooxidans.

PubMed

Wang, Yiping; Zhang, Xiaojian; Liu, Qing; Ai, Chenbing; Mo, Hongyu; Zeng, Jia

2009-07-01

The thioredoxin system consists of thioredoxin (Trx), thioredoxin reductase (TrxR) and NADPH, which plays several key roles in maintaining the redox environment of the cell. In Acidithiobacillus ferrooxidans, thioredoxin system may play important functions in the activity regulation of periplasmic proteins and energy metabolism. Here, we cloned thioredoxin (trx) and thioredoxin reductase (trxR) genes from Acidithiobacillus ferrooxidans, and expressed the genes in Escherichia coli. His-Trx and His-TrxR were purified to homogeneity with one-step Ni-NTA affinity column chromatography. Site-directed mutagenesis results confirmed that Cys33, Cys36 of thioredoxin, and Cys142, Cys145 of thioredoxin reductase were active-site residues.

The structure of Pseudomonas P51 Cl-muconate lactonizing enzyme: Co-evolution of structure and dynamics with the dehalogenation function

PubMed Central

Kajander, Tommi; Lehtiö, Lari; Schlömann, Michael; Goldman, Adrian

2003-01-01

Bacterial muconate lactonizing enzymes (MLEs) catalyze the conversion of cis,cis-muconate as a part of the β-ketoadipate pathway, and some MLEs are also able to dehalogenate chlorinated muconates (Cl-MLEs). The basis for the Cl-MLEs dehalogenating activity is still unclear. To further elucidate the differences between MLEs and Cl-MLEs, we have solved the structure of Pseudomonas P51 Cl-MLE at 1.95 Å resolution. Comparison of Pseudomonas MLE and Cl-MLE structures reveals the presence of a large cavity in the Cl-MLEs. The cavity may be related to conformational changes on substrate binding in Cl-MLEs, at Gly52. Site-directed mutagenesis on Pseudomonas MLE core positions to the equivalent Cl-MLE residues showed that the variant Thr52Gly was rather inactive, whereas the Thr52Gly-Phe103Ser variant had regained part of the activity. These residues form a hydrogen bond in the Cl-MLEs. The Cl-MLE structure, as a result of the Thr-to-Gly change, is more flexible than MLE: As a mobile loop closes over the active site, a conformational change at Gly52 is observed in Cl-MLEs. The loose packing and structural motions in Cl-MLE may be required for the rotation of the lactone ring in the active site necessary for the dehalogenating activity of Cl-MLEs. Furthermore, we also suggest that differences in the active site mobile loop sequence between MLEs and Cl-MLEs result in lower active site polarity in Cl-MLEs, possibly affecting catalysis. These changes could result in slower product release from Cl-MLEs and make it a better enzyme for dehalogenation of substrate. PMID:12930985

Designing small molecules to target cryptic pockets yields both positive and negative allosteric modulators

PubMed Central

Moeder, Katelyn E.; Ho, Chris M. W.; Zimmerman, Maxwell I.; Frederick, Thomas E.; Bowman, Gregory R.

2017-01-01

Allosteric drugs, which bind to proteins in regions other than their main ligand-binding or active sites, make it possible to target proteins considered “undruggable” and to develop new therapies that circumvent existing resistance. Despite growing interest in allosteric drug discovery, rational design is limited by a lack of sufficient structural information about alternative binding sites in proteins. Previously, we used Markov State Models (MSMs) to identify such “cryptic pockets,” and here we describe a method for identifying compounds that bind in these cryptic pockets and modulate enzyme activity. Experimental tests validate our approach by revealing both an inhibitor and two activators of TEM β-lactamase (TEM). To identify hits, a library of compounds is first virtually screened against either the crystal structure of a known cryptic pocket or an ensemble of structures containing the same cryptic pocket that is extracted from an MSM. Hit compounds are then screened experimentally and characterized kinetically in individual assays. We identify three hits, one inhibitor and two activators, demonstrating that screening for binding to allosteric sites can result in both positive and negative modulation. The hit compounds have modest effects on TEM activity, but all have higher affinities than previously identified inhibitors, which bind the same cryptic pocket but were found, by chance, via a computational screen targeting the active site. Site-directed mutagenesis of key contact residues predicted by the docking models is used to confirm that the compounds bind in the cryptic pocket as intended. Because hit compounds are identified from docking against both the crystal structure and structures from the MSM, this platform should prove suitable for many proteins, particularly targets whose crystal structures lack obvious druggable pockets, and for identifying both inhibitory and activating small-molecule modulators. PMID:28570708

Mass spectrometry-based methods for detection and differentiation of botulinum neurotoxins

DOEpatents

Schmidt, Jurgen G [Los Alamos, NM; Boyer, Anne E [Atlanta, GA; Kalb, Suzanne R [Atlanta, GA; Moura, Hercules [Tucker, GA; Barr, John R [Suwannee, GA; Woolfitt, Adrian R [Atlanta, GA

2009-11-03

The present invention is directed to a method for detecting the presence of clostridial neurotoxins in a sample by mixing a sample with a peptide that can serve as a substrate for proteolytic activity of a clostridial neurotoxin; and measuring for proteolytic activity of a clostridial neurotoxin by a mass spectroscopy technique. In one embodiment, the peptide can have an affinity tag attached at two or more sites.

Regulatory elements involved in tax-mediated transactivation of the HTLV-I LTR.

PubMed

Seeler, J S; Muchardt, C; Podar, M; Gaynor, R B

1993-10-01

HTLV-I is the etiologic agent of adult T-cell leukemia. In this study, we investigated the regulatory elements and cellular transcription factors which function in modulating HTLV-I gene expression in response to the viral transactivator protein, tax. Transfection experiments into Jurkat cells of a variety of site-directed mutants in the HTLV-1 LTR indicated that each of the three motifs A, B, and C within the 21-bp repeats, the binding sites for the Ets family of proteins, and the TATA box all influenced the degree of tax-mediated activation. Tax is also able to activate gene expression of other viral and cellular promoters. Tax activation of the IL-2 receptor and the HIV-1 LTR is mediated through NF-kappa B motifs. Interestingly, sequences in the 21-bp repeat B and C motifs contain significant homology with NF-kappa B regulatory elements. We demonstrated that an NF-kappa B binding protein, PRDII-BF1, but not the rel protein, bound to the B and C motifs in the 21-bp repeat. PRDII-BF1 was also able to stimulate activation of HTLV-I gene expression by tax. The role of the Ets proteins on modulating tax activation was also studied. Ets 1 but not Ets 2 was capable of increasing the degree of tax activation of the HTLV-I LTR. These results suggest that tax activates gene expression by either direct or indirect interaction with several cellular transcription factors that bind to the HTLV-I LTR.

Expression of Bacillus protease (Protease BYA) from Bacillus sp. Y in Bacillus subtilis and enhancement of its specific activity by site-directed mutagenesis-improvement in productivity of detergent enzyme-.

PubMed

Tobe, Seiichi; Shimogaki, Hisao; Ohdera, Motoyasu; Asai, Yoshio; Oba, Kenkichi; Iwama, Masanori; Irie, Masachika

2006-01-01

An attempt was made to express protease BYA produced by an alkalophilic Bacillus sp. Y in Bacillus subtilis by gene engineering methods. The gene encoding protease BYA was cloned from Bacillus sp. Y, and expression vector pTA71 was constructed from the amylase promoter of Bacillus licheniformis, DNA fragments encoding the open reading frame of protease BYA, and pUB110. Protease BYA was secreted at an activity level of 5100 APU/ml in the common industrial culture medium of Bacillus subtilis transformed with pTA71. We then attempted to increase the specific activity of protease BYA by site-directed mutagenesis. Amino acid residue Ala29 next to catalytic Asp30 was replaced by one of three uncharged amino acid residues (Val29, Leu29, Ile29), and each mutant enzyme was expressed and isolated from the culture medium. Val29 mutant enzyme was secreted at an activity level of greater than 7000 APU/ml in culture medium, and its specific activity was 1.5-fold higher than that of the wild-type enzyme. Other mutant enzymes had specific activity similar to that of the original one and were less stabile than the wild-type enzyme. It can be thought that the substitution at amino acid residue 29 affects the level of activity and stability of protease BYA.

Probing the Role of N-Linked Glycans in the Stability and Activity of Fungal Cellobiohydrolases by Mutational Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adney, W. S.; Jeoh, T.; Beckham, G. T.

2009-01-01

The filamentous fungi Trichoderma reesei and Penicillium funiculosum produce highly effective enzyme mixtures that degrade the cellulose and hemicellulose components of plant cell walls. Many fungal species produce a glycoside hydrolase family 7 (Cel7A) cellobiohydrolase, a class of enzymes that catalytically process from the reducing end of cellulose. A direct amino acid comparison of these two enzymes shows that they not only have high amino acid homology, but also contain analogous N-linked glycosylation sites on the catalytic domain. We have previously shown (Jeoh et al. in Biotechnol Biofuels, 1:10, 2008) that expression of T. reesei cellobiohydrolase I in a commonlymore » used industrial expression host, Aspergillus niger var. awamori, results in an increase in the amount of N-linked glycosylation of the enzyme, which negatively affects crystalline cellulose degradation activity as well as thermal stability. This complementary study examines the significance of individual N-linked glycans on the surface of the catalytic domain of Cel7A cellobiohydrolases from T. reesei and P. funiculosum by genetically adding or removing N-linked glycosylation motifs using site directed mutagenesis. Modified enzymes, expressed in A. niger var. awamori, were tested for activity and thermal stability. It was concluded that N-linked glycans in peptide loops that form part of the active site tunnel have the greatest impact on both thermal stability and enzymatic activity on crystalline cellulose for both the T. reesei and P. funiculosum Cel7A enzymes. Specifically, for the Cel7A T. reesei enzyme expressed in A. niger var. awamori, removal of the N384 glycosylation site yields a mutant with 70% greater activity after 120 h compared to the heterologously expressed wild type T. reesei enzyme. In addition, similar activity improvements were found to be associated with the addition of a new glycosylation motif at N194 in P. funiculosum. This mutant also exhibits 70% greater activity after 120 h compared to the wild type P. funiculosum enzyme expressed in A. niger var. awamori. Overall, this study demonstrates that 'tuning' enzyme glycosylation for expression from heterologous expression hosts is essential for generating engineered enzymes with optimal stability and activity.« less

A direct link between the global regulator PhoP and the Csr regulon in Y. pseudotuberculosis through the small regulatory RNA CsrC.

PubMed

Nuss, Aaron M; Schuster, Franziska; Kathrin Heroven, Ann; Heine, Wiebke; Pisano, Fabio; Dersch, Petra

2014-01-01

In this study we investigated the influence of the global response regulator PhoP on the complex regulatory cascade controlling expression of early stage virulence genes of Yersinia pseudotuberculosis via the virulence regulator RovA. Our analysis revealed the following novel features: (1) PhoP activates expression of the CsrC RNA in Y. pseudotuberculosis, leading to activation of RovA synthesis through the CsrABC-RovM cascade, (2) activation of csrC transcription is direct and PhoP is shown to bind to two separate PhoP box-like sites, (3) PhoP-mediated activation results in transcription from two different promoters closely downstream of the PhoP binding sites, leading to two distinct CsrC RNAs, and (4) the stability of the CsrC RNAs differs significantly between the Y. pseudotuberculosis strains YPIII and IP32953 due to a 20 nucleotides insertion in CsrC(IP32953), which renders the transcript more susceptible to degradation. In summary, our study showed that PhoP-mediated influence on the regulatory cascade controlling the Csr system and RovA in Y. pseudotuberculosis varies within the species, suggesting that the Csr system is a focal point to readjust and adapt the genus to different hosts and reservoirs.

CD56 Is a Pathogen Recognition Receptor on Human Natural Killer Cells.

PubMed

Ziegler, Sabrina; Weiss, Esther; Schmitt, Anna-Lena; Schlegel, Jan; Burgert, Anne; Terpitz, Ulrich; Sauer, Markus; Moretta, Lorenzo; Sivori, Simona; Leonhardt, Ines; Kurzai, Oliver; Einsele, Hermann; Loeffler, Juergen

2017-07-21

Aspergillus (A.) fumigatus is an opportunistic fungal mold inducing invasive aspergillosis (IA) in immunocompromised patients. Although antifungal activity of human natural killer (NK) cells was shown in previous studies, the underlying cellular mechanisms and pathogen recognition receptors (PRRs) are still unknown. Using flow cytometry we were able to show that the fluorescence positivity of the surface receptor CD56 significantly decreased upon fungal contact. To visualize the interaction site of NK cells and A. fumigatus we used SEM, CLSM and dSTORM techniques, which clearly demonstrated that NK cells directly interact with A. fumigatus via CD56 and that CD56 is re-organized and accumulated at this interaction site time-dependently. The inhibition of the cytoskeleton showed that the receptor re-organization was an active process dependent on actin re-arrangements. Furthermore, we could show that CD56 plays a role in the fungus mediated NK cell activation, since blocking of CD56 surface receptor reduced fungal mediated NK cell activation and reduced cytokine secretion. These results confirmed the direct interaction of NK cells and A. fumigatus, leading to the conclusion that CD56 is a pathogen recognition receptor. These findings give new insights into the functional role of CD56 in the pathogen recognition during the innate immune response.

Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody Inhibitors Directed to the Src Homology 2 (SH2)-Kinase Interface.

PubMed

Wojcik, John; Lamontanara, Allan Joaquim; Grabe, Grzegorz; Koide, Akiko; Akin, Louesa; Gerig, Barbara; Hantschel, Oliver; Koide, Shohei

2016-04-15

Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodies inhibited Bcr-Abl kinase activity in vitro and in cells, and they potently induced cell death in chronic myelogenous leukemia cell lines. This work provides strong evidence for the SH2-kinase interface as a pharmacologically tractable site for allosteric inhibition of Bcr-Abl. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Stream Phosphorus Dynamics Along a Suburbanizing Gradient in Southern Ontario, Canada

NASA Astrophysics Data System (ADS)

Duval, T. P.

2017-12-01

While it is well known that urban streams are subject to impaired water quality relative to natural analogues, far less research has been directed at stream water quality during the process of (sub-) urbanization. This study determines the role of housing construction activities in Brampton, Canada on the concentration and flux of phosphorus (P) of a headwater stream. Prior to development the stream was engineered with a riffle-pool sequence, riparian plantings, and a floodplain corridor that was lined with sediment fencing. Stream sites were sampled daily over a period of six months at locations representing varying stages of subdivision completion (upper site -active construction; middle site -finished construction and natural vegetation; lower site -finished construction and active construction). A nearby urban stream site developed ten years prior to this study was selected as a reference site. There were no differences in total phosphorus (TP) levels or flux between the suburbanizing and urban streams; however, the forms of P differed between sites. The urban stream TP load was dominated by particulate phosphorus (PP) while suburbanizing stream P was mainly in the dissolved organic phosphorus (DOP) form. The importance of DOP to TP flux increased with the onset of the growing season. TP levels in all stream segments frequently exceeded provincial water quality guidelines during storm events but were generally low during baseflow conditions. During storm events PP and total suspended solid levels in the suburbanizing stream reached levels of the urban stream due to sediment fence failure at several locations along the construction-hillslope interface. Along the suburbanizing gradient, the hydrological connection to a mid-reach zone of no-construction activity / fallow field and native forest resulted in significantly lower P levels than the upper suburbanizing stream site. This suggests that stream channel design features as well as timing of construction activities and the hydrological connection between the stream and construction projects all contribute to downstream export of nutrients and ultimately stream water quality.

Eurasian beaver activity increases water storage, attenuates flow and mitigates diffuse pollution from intensively-managed grasslands.

PubMed

Puttock, Alan; Graham, Hugh A; Cunliffe, Andrew M; Elliott, Mark; Brazier, Richard E

2017-01-15

Beavers are the archetypal keystone species, which can profoundly alter ecosystem structure and function through their ecosystem engineering activity, most notably the building of dams. This can have a major impact upon water resource management, flow regimes and water quality. Previous research has predominantly focused on the activities of North American beaver (Castor canadensis) located in very different environments, to the intensive lowland agricultural landscapes of the United Kingdom and elsewhere in Europe. Two Eurasian beavers (Castor fiber) were introduced to a wooded site, situated on a first order tributary, draining from intensively managed grassland. The site was monitored to understand impacts upon water storage, flow regimes and water quality. Results indicated that beaver activity, primarily via the creation of 13 dams, has increased water storage within the site (holding ca. 1000m 3 in beaver ponds) and beavers were likely to have had a significant flow attenuation impact, as determined from peak discharges (mean 30±19% reduction), total discharges (mean 34±9% reduction) and peak rainfall to peak discharge lag times (mean 29±21% increase) during storm events. Event monitoring of water entering and leaving the site showed lower concentrations of suspended sediment, nitrogen and phosphate leaving the site (e.g. for suspended sediment; average entering site: 112±72mgl -1 , average leaving site: 39±37mgl -1 ). Combined with attenuated flows, this resulted in lower diffuse pollutant loads in water downstream. Conversely, dissolved organic carbon concentrations and loads downstream were higher. These observed changes are argued to be directly attributable to beaver activity at the site which has created a diverse wetland environment, reducing downstream hydrological connectivity. Results have important implications for beaver reintroduction programs which may provide nature based solutions to the catchment-scale water resource management issues that are faced in agricultural landscapes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

A novel Death Defying Domain in Met entraps the active site of Caspase-3 and blocks apoptosis in hepatocytes

PubMed Central

Ma, Jihong; Zou, Chunbin; Guo, Lida; Seneviratne, Danushka S.; Tan, Xinping; Kwon, Yong-Kook; An, Jiyan; Bowser, Robert; DeFrances, Marie C.; Zarnegar, Reza

2013-01-01

Met, the transmembrane tyrosine kinase receptor for hepatocyte growth factor (HGF) is known to function as a potent anti-apoptotic mediator in normal and neoplastic cells. Herein we report that intracellular cytoplasmic tail of Met has evolved to harbor a tandem pair of Caspase-3 cleavage sites, which bait, trap and disable the active site of Caspase-3, thereby blocking the execution of apoptosis. We call this Caspase-3 cleavage motif the ‘Death Defying Domain’ (DDD). This site consists of the following sequence: DNAD-DEVD-T (where the hyphens denote caspase cleavage sites). Through functional and mechanistic studies, we show that upon DDD cleavage by Caspase-3, the resulting DEVD-T peptide acts as a competitive inhibitor and entraps the active site of Caspase-3 akin to DEVD-CHO, which is a potent, synthetic inhibitor of Caspase-3 activity. By gain and loss-of-function studies using restoration of DDD expression in DDD deficient hepatocytic cells, we found that both Caspase-3 sites in DDD are necessary for inhibition of Caspase-3 and promotion of cell survival. Employing mutagenesis studies, we show that DDD could operate independently of Met’s enzymatic activity as determined by using kinase-dead human Met mutant constructs. Studies of both human liver cancer tissues and cell lines uncovered that DDD cleavage and entrapment of Caspase-3 by DDD occur in vivo, further proving that this site has physiological and pathophysiological relevance. Conclusion Our findings show that Met can directly inhibit Caspase-3 via a novel mechanism and promote hepato-cyte survival. Results presented here will further our understanding of the mechanisms that control not only normal tissue homeostasis but also abnormal tissue growth such as cancer and degenerative diseases in which apoptotic caspases are at play. PMID:24122846

Single-Atom Catalyst of Platinum Supported on Titanium Nitride for Selective Electrochemical Reactions.

PubMed

Yang, Sungeun; Kim, Jiwhan; Tak, Young Joo; Soon, Aloysius; Lee, Hyunjoo

2016-02-05

As a catalyst, single-atom platinum may provide an ideal structure for platinum minimization. Herein, a single-atom catalyst of platinum supported on titanium nitride nanoparticles were successfully prepared with the aid of chlorine ligands. Unlike platinum nanoparticles, the single-atom active sites predominantly produced hydrogen peroxide in the electrochemical oxygen reduction with the highest mass activity reported so far. The electrocatalytic oxidation of small organic molecules, such as formic acid and methanol, also exhibited unique selectivity on the single-atom platinum catalyst. A lack of platinum ensemble sites changed the reaction pathway for the oxygen-reduction reaction toward a two-electron pathway and formic acid oxidation toward direct dehydrogenation, and also induced no activity for the methanol oxidation. This work demonstrates that single-atom platinum can be an efficient electrocatalyst with high mass activity and unique selectivity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

U.S. Geological Survey research in radioactive waste disposal - Fiscal years 1983, 1984, and 1985

USGS Publications Warehouse

Dinwiddie, G.A.; Trask, N.J.

1986-01-01

The report summarizes progress on geologic and hydrologic research related to the disposal of radioactive wastes. The research is described according to whether it is related most directly to: (1) high-level and transuranic wastes, (2) low-level wastes, or (3) uranium mill tailings. Included is research applicable to the identification and geohydrologic characterization of waste-disposal sites, to investigations of specific sites where wastes have been stored, and to studies of regions or environments where waste-disposal sites might be located. A significant part of the activity is concerned with techniques and methods for characterizing disposal sites and studies of geologic and hydrologic processes related to the transport and (or) retention of waste radionuclides.

Human 15-LOX-1 active site mutations alter inhibitor binding and decrease potency.

PubMed

Armstrong, Michelle; van Hoorebeke, Christopher; Horn, Thomas; Deschamps, Joshua; Freedman, J Cody; Kalyanaraman, Chakrapani; Jacobson, Matthew P; Holman, Theodore

2016-11-01

Human 15-lipoxygenase-1 (h15-LOX-1 or h12/15-LOX) reacts with polyunsaturated fatty acids and produces bioactive lipid derivatives that are implicated in many important human diseases. One such disease is stroke, which is the fifth leading cause of death and the first leading cause of disability in America. The discovery of h15-LOX-1 inhibitors could potentially lead to novel therapeutics in the treatment of stroke, however, little is known about the inhibitor/active site interaction. This study utilizes site-directed mutagenesis, guided in part by molecular modeling, to gain a better structural understanding of inhibitor interactions within the active site. We have generated eight mutants (R402L, R404L, F414I, F414W, E356Q, Q547L, L407A, I417A) of h15-LOX-1 to determine whether these active site residues interact with two h15-LOX-1 inhibitors, ML351 and an ML094 derivative, compound 18. IC 50 values and steady-state inhibition kinetics were determined for the eight mutants, with four of the mutants affecting inhibitor potency relative to wild type h15-LOX-1 (F414I, F414W, E356Q and L407A). The data indicate that ML351 and compound 18, bind in a similar manner in the active site to an aromatic pocket close to F414 but have subtle differences in their specific binding modes. This information establishes the binding mode for ML094 and ML351 and will be leveraged to develop next-generation inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

PubMed Central

van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

2015-01-01

The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

Physician Activities During Time Out of the Examination Room

PubMed Central

Gilchrist, Valerie; McCord, Gary; Schrop, Susan Labuda; King, Bridget D.; McCormick, Kenelm F.; Oprandi, Allison M.; Selius, Brian A.; Cowher, Michael; Maheshwary, Rishi; Patel, Falguni; Shah, Ami; Tsai, Bonny; Zaharna, Mia

2005-01-01

PURPOSE Comprehensive medical care requires direct physician-patient contact, other office-based medical activities, and medical care outside of the office. This study was a systematic investigation of family physician office-based activities outside of the examination room. METHODS In the summer of 2000, 6 medical students directly observed and recorded the office-based activities of 27 northeastern Ohio community-based family physicians during 1 practice day. A checklist was used to record physician activity every 20 seconds outside of the examination room. Observation excluded medical care provided at other sites. Physicians were also asked to estimate how they spent their time on average and on the observed day. RESULTS The average office day was 8 hours 8 minutes. On average, 20.1 patients were seen and physicians spent 17.5 minutes per patient in direct contact time. Office-based time outside of the examination room averaged 3 hours 8 minutes or 39% of the office practice day; 61% of that time was spent in activities related to medical care. Charting (32.9 minutes per day) and dictating (23.4 minutes per day) were the most common medical activities. Physicians overestimated the time they spent in direct patient care and medical activities. None of the participating practices had electronic medical records. CONCLUSIONS If office-based, medically related activities were averaged over the number of patients seen in the office that day, the average office visit time per patient would increase by 7 minutes (40%). Care delivery extends beyond direct patient contact. Models of health care delivery need to recognize this component of care. PMID:16338912

The basic helix-loop-helix differentiation factor Nex1/MATH-2 functions as a key activator of the GAP-43 gene

PubMed Central

Uittenbogaard, Martine; Martinka, Debra L.; Chiaramello, Anne

2006-01-01

Nex1/MATH-2 is a neurogenic basic Helix-Loop-Helix (bHLH) transcription factor that belongs to the NeuroD subfamily. Its expression parallels that of the GAP-43 gene and peaks during brain development, when neurite outgrowth and synaptogenesis are highly active. We previously observed a direct correlation between the levels of expression of Nex1 and GAP-43 proteins, which resulted in extensive neurite outgrowth and neuronal differentiation of PC12 cells in the absence of nerve growth factor. Since the GAP-43 gene is a target for bHLH regulation, we investigated whether Nex1 could regulate the activity of the GAP-43 promoter. We found that among the members of the NeuroD subfamily, Nex1 promoted maximal activity of the GAP-43 promoter. The Nex1-mediated activity is restricted to the conserved E1–E2 cluster located near the major transcription start sites. By electrophoretic mobility shift assay and site-directed mutagenesis, we showed that Nex1 binds as homodimers and that the E1 E-box is a high affinity binding site. We further found that Nex1 released the ME1 E-protein-mediated repression in a concentration dependent manner. Thus, the E1–E2 cluster has a dual function: it can mediate activation or repression depending on the interacting bHLH proteins. Finally, a series of N-terminal and C-terminal deletions revealed that Nex1 transcriptional activity is linked to two distinct transactivation domains, TAD1 and TAD2, with TAD1 being unique to Nex1. Together, our results suggest that Nex1 may engage in selective interactions with components of the core transcriptional machinery whose assembly is dictated by the architecture of the GAP-43 promoter and cellular environment. PMID:12562512

Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

PubMed Central

Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

2012-01-01

Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Two Active Site Divalent Ions in the Crystal Structure of the Hammerhead Ribozyme Bound to a Transition State Analogue.

PubMed

Mir, Aamir; Golden, Barbara L

2016-02-02

The crystal structure of the hammerhead ribozyme bound to the pentavalent transition state analogue vanadate reveals significant rearrangements relative to the previously determined structures. The active site contracts, bringing G10.1 closer to the cleavage site and repositioning a divalent metal ion such that it could, ultimately, interact directly with the scissile phosphate. This ion could also position a water molecule to serve as a general acid in the cleavage reaction. A second divalent ion is observed coordinated to O6 of G12. This metal ion is well-placed to help tune the pKA of G12. On the basis of this crystal structure as well as a wealth of biochemical studies, we propose a mechanism in which G12 serves as the general base and a magnesium-bound water serves as a general acid.

Expansion of Protein Farnesyltransferase Specificity Using “Tunable” Active Site Interactions

PubMed Central

Hougland, James L.; Gangopadhyay, Soumyashree A.; Fierke, Carol A.

2012-01-01

Post-translational modifications play essential roles in regulating protein structure and function. Protein farnesyltransferase (FTase) catalyzes the biologically relevant lipidation of up to several hundred cellular proteins. Site-directed mutagenesis of FTase coupled with peptide selectivity measurements demonstrates that molecular recognition is determined by a combination of multiple interactions. Targeted randomization of these interactions yields FTase variants with altered and, in some cases, bio-orthogonal selectivity. We demonstrate that FTase specificity can be “tuned” using a small number of active site contacts that play essential roles in discriminating against non-substrates in the wild-type enzyme. This tunable selectivity extends in vivo, with FTase variants enabling the creation of bioengineered parallel prenylation pathways with altered substrate selectivity within a cell. Engineered FTase variants provide a novel avenue for probing both the selectivity of prenylation pathway enzymes and the effects of prenylation pathway modifications on the cellular function of a protein. PMID:22992747

SbnG, a Citrate Synthase in Staphylococcus aureus

PubMed Central

Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; Heinrichs, David E.; Murphy, Michael E. P.

2014-01-01

In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. PMID:25336653

Two active site divalent ions in the crystal structure of the hammerhead ribozyme bound to a transition state analogue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mir, Aamir; Golden, Barbara L.

2015-11-09

The crystal structure of the hammerhead ribozyme bound to the pentavalent transition state analogue vanadate reveals significant rearrangements relative to the previously determined structures. The active site contracts, bringing G10.1 closer to the cleavage site and repositioning a divalent metal ion such that it could, ultimately, interact directly with the scissile phosphate. This ion could also position a water molecule to serve as a general acid in the cleavage reaction. A second divalent ion is observed coordinated to O6 of G12. This metal ion is well-placed to help tune the p K A of G12. Finally, on the basis ofmore » this crystal structure as well as a wealth of biochemical studies, in this paper we propose a mechanism in which G12 serves as the general base and a magnesium-bound water serves as a general acid.« less

Mechanism of O2 diffusion and reduction in FeFe hydrogenases

NASA Astrophysics Data System (ADS)

Kubas, Adam; Orain, Christophe; de Sancho, David; Saujet, Laure; Sensi, Matteo; Gauquelin, Charles; Meynial-Salles, Isabelle; Soucaille, Philippe; Bottin, Hervé; Baffert, Carole; Fourmond, Vincent; Best, Robert B.; Blumberger, Jochen; Léger, Christophe

2017-01-01

FeFe hydrogenases are the most efficient H2-producing enzymes. However, inactivation by O2 remains an obstacle that prevents them being used in many biotechnological devices. Here, we combine electrochemistry, site-directed mutagenesis, molecular dynamics and quantum chemical calculations to uncover the molecular mechanism of O2 diffusion within the enzyme and its reactions at the active site. We propose that the partial reversibility of the reaction with O2 results from the four-electron reduction of O2 to water. The third electron/proton transfer step is the bottleneck for water production, competing with formation of a highly reactive OH radical and hydroxylated cysteine. The rapid delivery of electrons and protons to the active site is therefore crucial to prevent the accumulation of these aggressive species during prolonged O2 exposure. These findings should provide important clues for the design of hydrogenase mutants with increased resistance to oxidative damage.

10 CFR 73.55 - Requirements for physical protection of licensed activities in nuclear power reactors against...

Code of Federal Regulations, 2011 CFR

2011-01-01

... integration of systems, technologies, programs, equipment, supporting processes, and implementing procedures...-in-depth methodologies to minimize the potential for an insider to adversely affect, either directly... protection of digital computer and communication systems and networks. (ii) Site-specific conditions that...

Prototype solar heating and combined heating and cooling systems

NASA Technical Reports Server (NTRS)

1977-01-01

System analysis activities were directed toward refining the heating system parameters. Trade studies were performed to support hardware selections for all systems and for the heating only operational test sites in particular. The heating system qualification tests were supported by predicting qualification test component performance prior to conducting the test.

Coupling interactions between voltage sensors of the sodium channel as revealed by site-specific measurements.

PubMed

Chanda, Baron; Asamoah, Osei Kwame; Bezanilla, Francisco

2004-03-01

The voltage-sensing S4 segments in the sodium channel undergo conformational rearrangements in response to changes in the electric field. However, it remains unclear whether these structures move independently or in a coordinated manner. Previously, site-directed fluorescence measurements were shown to track S4 transitions in each of the four domains. Here, using a similar technique, we provide direct evidence of coupling interactions between voltage sensors in the sodium channel. Pairwise interactions between S4s were evaluated by comparing site-specific conformational changes in the presence and absence of a gating perturbation in a distal domain. Reciprocity of effect, a fundamental property of thermodynamically coupled systems, was measured by generating converse mutants. The magnitude of a local gating perturbation induced by a remote S4 mutation depends on the coupling strength and the relative equilibrium positions of the two voltage sensors. In general, our data indicates that the movement of all four voltage sensors in the sodium channel are coupled to a varying extent. Moreover, a gating perturbation in S4-DI has the largest effect on the activation of S4-DIV and vice versa, demonstrating an energetic linkage between S4-DI and S4-DIV. This result suggests a physical mechanism by which the activation and inactivation process may be coupled in voltage-gated sodium channels. In addition, we propose that cooperative interactions between voltage sensors may be the mechanistic basis for the fast activation kinetics of the sodium channel.

Biological Characterization of an Improved Pyrrole-Based Colchicine Site Agent Identified through Structure-Based Design

PubMed Central

Rohena, Cristina C.; Telang, Nakul S.; Da, Chenxiao; Risinger, April L.; Sikorski, James A.; Kellogg, Glen E.; Gupton, John T.

2016-01-01

A refined model of the colchicine site on tubulin was used to design an improved analog of the pyrrole parent compound, JG-03-14. The optimized compound, NT-7-16, was evaluated in biological assays that confirm that it has potent activities as a new colchicine site microtubule depolymerizer. NT-7-16 exhibits antiproliferative and cytotoxic activities against multiple cancer cell lines, with IC50 values of 10–16 nM, and it is able to overcome drug resistance mediated by the expression of P-glycoprotein and the βIII isotype of tubulin. NT-7-16 initiated the concentration-dependent loss of cellular microtubules and caused the formation of abnormal mitotic spindles, leading to mitotic accumulation. The direct interaction of NT-7-16 with purified tubulin was confirmed, and it was more potent than combretastatin A-4 in these assays. Binding studies verified that NT-7-16 binds to tubulin within the colchicine site. The antitumor effects of NT-7-16 were evaluated in an MDA-MB-435 xenograft model and it had excellent activity at concentrations that were not toxic. A second compound, NT-9-21, which contains dichloro moieties in place of the 3,5-dibromo substituents of NT-7-16, had a poorer fit within the colchicine site as predicted by modeling and the Hydropathic INTeractions score. Biological evaluations showed that NT-9-21 has 10-fold lower potency than NT-7-16, confirming the modeling predictions. These studies highlight the value of the refined colchicine-site model and identify a new pyrrole-based colchicine-site agent with potent in vitro activities and promising in vivo antitumor actions. PMID:26655304

Requirement for transient metal ions revealed through computational analysis for DNA polymerase going in reverse

PubMed Central

Perera, Lalith; Freudenthal, Bret D.; Beard, William A.; Shock, David D.; Pedersen, Lee G.; Wilson, Samuel H.

2015-01-01

DNA polymerases facilitate faithful insertion of nucleotides, a central reaction occurring during DNA replication and repair. DNA synthesis (forward reaction) is “balanced,” as dictated by the chemical equilibrium by the reverse reaction of pyrophosphorolysis. Two closely spaced divalent metal ions (catalytic and nucleotide-binding metals) provide the scaffold for these reactions. The catalytic metal lowers the pKa of O3′ of the growing primer terminus, and the nucleotide-binding metal facilitates substrate binding. Recent time-lapse crystallographic studies of DNA polymerases have identified an additional metal ion (product metal) associated with pyrophosphate formation, leading to the suggestion of its possible involvement in the reverse reaction. Here, we establish a rationale for a role of the product metal using quantum mechanical/molecular mechanical calculations of the reverse reaction in the confines of the DNA polymerase β active site. Additionally, site-directed mutagenesis identifies essential residues and metal-binding sites necessary for pyrophosphorolysis. The results indicate that the catalytic metal site must be occupied by a magnesium ion for pyrophosphorolysis to occur. Critically, the product metal site is occupied by a magnesium ion early in the pyrophosphorolysis reaction path but must be removed later. The proposed dynamic nature of the active site metal ions is consistent with crystallographic structures. The transition barrier for pyrophosphorolysis was estimated to be significantly higher than that for the forward reaction, consistent with kinetic activity measurements of the respective reactions. These observations provide a framework to understand how ions and active site changes could modulate the internal chemical equilibrium of a reaction that is central to genome stability. PMID:26351676