Science.gov

Sample records for active site groove

  1. Targeting the cyclin-binding groove site to inhibit the catalytic activity of CDK2/cyclin A complex using p27(KIP1)-derived peptidomimetic inhibitors.

    PubMed

    Karthiga, Arumugasamy; Tripathi, Sunil Kumar; Shanmugam, Ramasamy; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar

    2015-01-01

    Functionally activated cyclin-dependent kinase 2 (CDK2)/cyclin A complex has been validated as an interesting therapeutic target to develop the efficient antineoplastic drug based on the cell cycle arrest. Cyclin A binds to CDK2 and activates the kinases as well as recruits the substrate and inhibitors using a hydrophobic cyclin-binding groove (CBG). Blocking the cyclin substrate recruitment on CBG is an alternative approach to override the specificity hurdle of the currently available ATP site targeting CDK2 inhibitors. Greater understanding of the interaction of CDK2/cyclin A complex with p27 (negative regulator) reveals that the Leu-Phe-Gly (LFG) motif region of p27 binds with the CBG site of cyclin A to arrest the malignant cell proliferation that induces apoptosis. In the present study, Replacement with Partial Ligand Alternatives through Computational Enrichment (REPLACE) drug design strategies have been applied to acquire LFG peptide-derived peptidomimetics library. The peptidomimetics function is equivalent with respect to substrate p27 protein fashion but does not act as an ATP antagonist. The combined approach of molecular docking, molecular dynamics (MD), and molecular electrostatic potential and ADME/T prediction were carried out to evaluate the peptidomimetics. Resultant interaction and electrostatic potential maps suggested that smaller substituent is desirable at the position of phenyl ring to interact with Trp217, Arg250, and Gln254 residues in the active site. The best docked poses were refined by the MD simulations which resulted in conformational changes. After equilibration, the structure of the peptidomimetic and receptor complex was stable. The results revealed that the various substrate protein-derived peptidomimetics could serve as perfect leads against CDK2 protein. PMID:25584078

  2. The Role of Groove Periodicity in the Formation of Site-Controlled Quantum Dot Chains.

    PubMed

    Schramm, Andreas; Hakkarainen, Teemu V; Tommila, Juha; Guina, Mircea

    2015-12-01

    Structural and optical properties of InAs quantum dot (QD) chains formed in etched GaAs grooves having different periods from 200 to 2000 nm in [010] orientation are reported. The site-controlled QDs were fabricated by molecular beam epitaxy on soft UV-nanoimprint lithography-patterned GaAs(001) surfaces. Increasing the groove periods decreases the overall QD density but increases the QD size and the linear density along the groove direction. The effect of the increased QD size with larger periods is reflected in ensemble photoluminescence measurements as redshift of the QD emission. Furthermore, we demonstrate the photoluminescence emission from single QD chains. PMID:26058509

  3. Topoisomerase I-Mediated DNA Cleavage Induced by the Minor Groove-Directed Binding of Bibenzimidazoles to a Distal Site

    PubMed Central

    Khan, Qasim A.; Pilch, Daniel S.

    2007-01-01

    Summary Many agents (e.g., camptothecins, indolocarbazoles, indenoisoquinolines, and dibenzonaphthyridines) stimulate topoisomerase I-mediated DNA cleavage (a behavior termed topoisomerase I poisoning) by interacting with both the DNA and the enzyme at the site of cleavage (typically by intercalation between the −1 and +1 base pairs). The bibenzimidazoles, which include Hoechst 33258 and 33342, are a family of DNA minor groove-directed agents that also stimulate topoisomerase I-mediated DNA cleavage. However, the molecular mechanism by which these ligands poison TOP1 is poorly understood. Toward this goal, we have used a combination of mutational, footprinting, and DNA binding affinity analyses to define the DNA binding site for Hoechst 33258 and a related derivative that results in optimal induction of TOP1-mediated DNA cleavage. We show that this DNA binding site is located downstream from the site of DNA cleavage, encompassing the base pairs from position +4 to +8. The distal nature of this binding site relative to the site of DNA cleavage suggests that minor groove-directed agents like the bibenzimidazoles poison TOP1 via a mechanism distinct from compounds like the camptothecins, which interact at the site of cleavage. PMID:17095016

  4. Safety Grooving

    NASA Technical Reports Server (NTRS)

    1985-01-01

    Safety grooving, the cutting of grooves in concrete to increase traction and prevent injury, was first developed to reduce aircraft accidents on wet runways. Represented by the International Grooving and Grinding Association (IG&GA), the industry expanded into highway and pedestrian applications. The technique originated at Langley, which assisted in testing the grooving at airports and on highways. Skidding was reduced, stopping distance decreased, and a vehicle's cornering ability on curves was increased. The process has been extended to animal holding pens, steps, parking lots and other potentially slippery surfaces.

  5. Co-Conserved MAPK Features Couple D-Domain Docking Groove to Distal Allosteric Sites via the C-Terminal Flanking Tail

    PubMed Central

    Nguyen, Tuan; Ruan, Zheng; Oruganty, Krishnadev; Kannan, Natarajan

    2015-01-01

    Mitogen activated protein kinases (MAPKs) form a closely related family of kinases that control critical pathways associated with cell growth and survival. Although MAPKs have been extensively characterized at the biochemical, cellular, and structural level, an integrated evolutionary understanding of how MAPKs differ from other closely related protein kinases is currently lacking. Here, we perform statistical sequence comparisons of MAPKs and related protein kinases to identify sequence and structural features associated with MAPK functional divergence. We show, for the first time, that virtually all MAPK-distinguishing sequence features, including an unappreciated short insert segment in the β4-β5 loop, physically couple distal functional sites in the kinase domain to the D-domain peptide docking groove via the C-terminal flanking tail (C-tail). The coupling mediated by MAPK-specific residues confers an allosteric regulatory mechanism unique to MAPKs. In particular, the regulatory αC-helix conformation is controlled by a MAPK-conserved salt bridge interaction between an arginine in the αC-helix and an acidic residue in the C-tail. The salt-bridge interaction is modulated in unique ways in individual sub-families to achieve regulatory specificity. Our study is consistent with a model in which the C-tail co-evolved with the D-domain docking site to allosterically control MAPK activity. Our study provides testable mechanistic hypotheses for biochemical characterization of MAPK-conserved residues and new avenues for the design of allosteric MAPK inhibitors. PMID:25799139

  6. Resolution of mixed site DNA complexes with dimer-forming minor groove binders by using electrospray ionization mass spectrometry: Compound structure and DNA sequence effects

    PubMed Central

    Laughlin, Sarah; Wang, Siming; Kumar, Arvind; Farahat, Abdelbasset A.; Boykin, David W.; Wilson, W. David

    2015-01-01

    Small molecule targeting of the DNA minor groove is a promising approach to modulate genomic processes necessary for normal cellular function. For instance, dicationic diamindines, a well-known class of minor groove binding compounds, have been shown to inhibit interactions of transcription factors binding to genomic DNA. The applications of these compounds could be significantly expanded if we understand sequence-specific recognition of DNA better and could use the information to design more sequence-specific compounds. Aside from polyamides, minor groove binders typically recognize DNA at A-tract or alternating AT base pair sites. Targeting sites with GC base pairs, referred to here as mixed base pair sequences, is much more difficult than those rich in AT base pairs. Compound 1 is the first dicationic diamidine reported to recognize a mixed base pair site. It binds in the minor groove of ATGA sequences as a dimer with positive cooperativity. Due to the well-characterized behavior of 1 with ATGA and AT rich sequences, it provides a paradigm for understanding the elements that are key for recognition of mixed sequence sites. Electrospray ionization mass spectrometry (ESI-MS) is a powerful method to screen DNA complexes formed by analogs of 1 for specific recognition. We also report a novel approach to determine patterns of recognition by 1 for cognate ATGA and ATGA-mutant sequences. We found that functional group modifications and mutating the DNA target site significantly affect binding and stacking, respectively. Both compound conformation and DNA sequence directionality are crucial for recognition. PMID:25703690

  7. Simulation of the cytoskeletal response of cells on grooved or patterned substrates

    PubMed Central

    Vigliotti, A.; McMeeking, R. M.; Deshpande, V. S.

    2015-01-01

    We analyse the response of osteoblasts on grooved substrates via a model that accounts for the cooperative feedback between intracellular signalling, focal adhesion development and stress fibre contractility. The grooved substrate is modelled as a pattern of alternating strips on which the cell can adhere and strips on which adhesion is inhibited. The coupled modelling scheme is shown to capture some key experimental observations including (i) the observation that osteoblasts orient themselves randomly on substrates with groove pitches less than about 150 nm but they align themselves with the direction of the grooves on substrates with larger pitches and (ii) actin fibres bridge over the grooves on substrates with groove pitches less than about 150 nm but form a network of fibres aligned with the ridges, with nearly no fibres across the grooves, for substrates with groove pitches greater than about 300 nm. Using the model, we demonstrate that the degree of bridging of the stress fibres across the grooves, and consequently the cell orientation, is governed by the diffusion of signalling proteins activated at the focal adhesion sites on the ridges. For large groove pitches, the signalling proteins are dephosphorylated before they can reach the regions of the cell above the grooves and hence stress fibres cannot form in those parts of the cell. On the other hand, the stress fibre activation signal diffuses to a reasonably spatially homogeneous level on substrates with small groove pitches and hence stable stress fibres develop across the grooves in these cases. The model thus rationalizes the responsiveness of osteoblasts to the topography of substrates based on the complex feedback involving focal adhesion formation on the ridges, the triggering of signalling pathways by these adhesions and the activation of stress fibre networks by these signals. PMID:25762648

  8. Terrain types and local-scale stratigraphy of grooved terrain on ganymede

    NASA Technical Reports Server (NTRS)

    Murchie, Scott L.; Head, James W.; Helfenstein, Paul; Plescia, Jeffrey B.

    1986-01-01

    Grooved terrain is subdivided on the basis of pervasive morphology into: (1) groove lanes - elongate parallel groove bands, (2) grooved polygons - polygonal domains of parallel grooves, (3) reticulate terrain - polygonal domains of orthogonal grooves, and (4) complex grooved terrain - polygons with several complexly cross-cutting groove sets. Detailed geologic mapping of select areas, employing previously established conventions for determining relative age relations, reveals a general three-stage sequence of grooved terrain emplacement: first, dissection of the lithosphere by throughgoing grooves, and pervasive deformation of intervening blocks; second, extensive flooding and continued deformation of the intervening blocks; third, repeated superposition of groove lanes concentrated at sites of initial throughgoing grooves. This sequence is corroborated by crater-density measurements. Dominant orientations of groove sets are parallel to relict zones of weakness that probably were reactivated during grooved terrain formation. Groove lane morphology and development consistent with that predicted for passive rifts suggests a major role of global expansion in grooved terrain formation.

  9. hsDNA groove binding, photocatalytic activity, and in vitro breast and colon cancer cell reducing function of greener SeNPs.

    PubMed

    Pansare, Amol V; Kulal, Dnyaneshwar K; Shedge, Amol A; Patil, Vishwanath R

    2016-07-26

    Selenium nanoparticles (SeNPs) have attracted great attention because of their superior optical properties and wide utilization in biological and biomedical studies. This paper reports an environmentally benign procedure of greener monodispersible SeNP synthesis using the reducing power of Trigonella foenum-graecum extract, characterization and their protective effect against unfolded (Herring sperm DNA) hsDNA. We investigated the anti-cancer activity of SeNPs against MCF-7, MDA MB 435 and COLO-205 cells. The photocatalytic activity of SeNPs was investigated for the degradation of a Sunset Yellow FCF (SYFCF) dye using ultraviolet-B light. The reduction of the Se ion to SeNPs was monitored by ultraviolet-visible spectroscopy (UV-vis). The size and morphology of the SeNPs were characterized by high resolution transmission electron microscopy (HRTEM), X-ray diffraction (XRD), and Dynamic Light Scattering (DLS). The SeNPs were stable, and the diameter was homogeneous at around 5-12 nm. Interactions of various concentrations of SeNPs with hsDNA were systematically investigated by UV-vis, fluorescence, circular dichroism (CD), polarimetry and FTIR spectroscopy under physiological conditions. The results from fluorescence spectroscopy indicated that SeNPs quenched the fluorescence intensity of hsDNA with increasing concentrations. The modified Stern-Volmer quenching rate constant Ksv, binding constant K and binding sites n at different temperatures and the corresponding thermodynamic parameters ΔH°, ΔG° and ΔS° were calculated. Hoechst 33258 and methyl green (MG) site markers, melting experiment (Tm), viscosity measurements and sequence specificity verification by DNA bases clarified that SeNPs bind to hsDNA via a groove site. The rate of photocatalytic degradation of the SYFCF dye in the presence and absence of photocatalysts (SeNPs) was studied using UV-vis, the results showed appreciable degradation of the SYFCF dye. Our results suggested that nano Se can be used

  10. Minor groove site coordination of adenine by platinum group metal ions: effects on basicity, base pairing, and electronic structure.

    PubMed

    Amantia, David; Price, Clayton; Shipman, Michelle A; Elsegood, Mark R J; Clegg, William; Houlton, Andrew

    2003-05-01

    Dithioether- or diamine-tethered adenine derivatives react with Pt(II), Pd(II), and Rh(III) ions to give N3-coordinated complexes of the types [MCl(SSN)](+) (M = Pt or Pd), [RhCl(3)(SSN)], or [RhCl(3)(NNN)] (where SSN = 1-(N9-adenine)-3,6-dithia-heptane or 1-(N9-adenine)-4,7-dithia-octane; NNN = ethylenediamine-N,9-ethyladenine). Single-crystal X-ray analysis confirms the nature of the metal-nucleobase interaction and highlights a conserved intermolecular hydrogen-bonding motif for all the complexes, irrespective of the metal-ion geometry. Coordination significantly reduces the basicity of the adeninyl group, as indicated by a pK(a) value of -0.16 for [PtCl(N3-1-(N9-adenine)-3,6-dithia-heptane)]BF(4), compared to a pK(a) value of 4.2 for 9-ethyladenine. The site of proton binding, N1 or N7, could not be unambiguously assigned from the (1)H NMR data, because of the similar effect on the chemical shifts of the H2 and H8 protons. Density functional calculations at the BP-LACVP level suggest N1 as the site of protonation for this type of complex. This is in contrast to the N7-protonation reported for [Pt(dien)(N3-6,6',9-trimethyladenine)](2+), as reported elsewhere (Meiser et al., Chem.-Eur. J. 1997, 3, 388). However, further electronic structure calculations in the gas phase reveal that the preferred site for protonation for N3-bound complexes is conformationally dependent. N3 coordination was also found to reduce the extent of base pairing between adenine and thymine in dimethylsulfoxide for the self-complementary complex [PtCl(L3)](+) (L3 = 1-(N9-adenine)-3,6-dithia-9-(N1-thymine)nonane), compared to that for the uncomplexed ligand. PMID:12716200

  11. Groove refinishing tool

    DOEpatents

    Kellogg, Harvey J.; Holm, Robert O.

    1983-01-01

    A groove refinishing tool which utilizes a finishing wheel which is controlled by an air grinder motor. The air grinder motor is mounted on a main body section which is pivotally attached to a shoe element. The shoe element contains guide pins which guide the shoe element on the groove to be refinished. Application of pressure on the main body element compresses a weight counterbalance spring to extend the finishing wheel through the shoe element to refinish the groove surface. A window is provided for viewing the refinishing operation. Milling operations can also be performed by replacing the finishing wheel with a milling wheel.

  12. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P

    1998-01-01

    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  13. Salt site performance assessment activities

    SciTech Connect

    Kircher, J.F.; Gupta, S.K.

    1983-01-01

    During this year the first selection of the tools (codes) for performance assessments of potential salt sites have been tentatively selected and documented; the emphasis has shifted from code development to applications. During this period prior to detailed characterization of a salt site, the focus is on bounding calculations, sensitivity and with the data available. The development and application of improved methods for sensitivity and uncertainty analysis is a focus for the coming years activities and the subject of a following paper in these proceedings. Although the assessments to date are preliminary and based on admittedly scant data, the results indicate that suitable salt sites can be identified and repository subsystems designed which will meet the established criteria for protecting the health and safety of the public. 36 references, 5 figures, 2 tables.

  14. 11. TIP TOP MINE. DETAIL OF TONGUE AND GROOVE INTERIOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. TIP TOP MINE. DETAIL OF TONGUE AND GROOVE INTERIOR SIDING IN LIVING QUARTERS. CAMERA POINTED EAST. - Florida Mountain Mining Sites, Tip Top Mine, West face Florida Mountain, approximately 150 feet below summit, Silver City, Owyhee County, ID

  15. EDM Electrode for Internal Grooves

    NASA Technical Reports Server (NTRS)

    Ramani, V.; Werner, A.

    1985-01-01

    Electroerosive process inexpensive alternative to broaching. Hollow brass electrodes, soldered at one end to stainless-steel holding ring, held in grooves in mandrel. These electrodes used to machine grooves electrically in stainless-steel tube three-eights inch (9.5 millimeters) in diameter. Tool used on tubes already in place in equipment.

  16. Radiolytic and cellular reduction of a novel hypoxia-activated cobalt(III) prodrug of a chloromethylbenzindoline DNA minor groove alkylator.

    PubMed

    Ahn, G-One; Botting, K Jane; Patterson, Adam V; Ware, David C; Tercel, Moana; Wilson, William R

    2006-06-14

    Metabolic reduction can be used to activate prodrugs in hypoxic regions of tumours, but reduction by ionising radiation is also theoretically attractive. Previously, we showed that a cobalt(III) complex containing 8-hydroxyquinoline (8-HQ) and cyclen ligands releases 8-HQ efficiently on irradiation in hypoxic solutions [Ahn G-O, Ware DC, Denny WA, Wilson WR. Optimization of the auxiliary ligand shell of cobalt(III)(8-hydroxyquinoline) complexes as model hypoxia-selective radiation-activated prodrugs. Radiat Res 2004;162:315-25]. Here we investigate an analogous Co(III) complex containing the potent DNA minor groove alkylator azachloromethylbenzindoline (azaCBI, 1) to determine whether it releases 1 on radiolytic and/or enzymatic reduction under hypoxia. Monitoring by HPLC, the azaCBI ligand in the Co(III)(cyclen)(azaCBI) complex (2) slowly hydrolysed in aqueous solution, in contrast to the free ligand 1 which readily converted to its reactive cyclopropyl form. Irradiation of 2 (30-50 microM) in hypoxic solutions released 1 with yields of 0.57 micromol/J in formate buffer and 0.13 micromol/J in human plasma. Using bioassay methods, cytotoxic activation by irradiation of 2 at 1 microM in hypoxic plasma was readily detectable at clinically relevant doses (> or = 1 Gy), with a estimated yield of 1 of 0.075 micromol/J. Release of 1 from 2 was also observed in hypoxic HT29 cultures without radiation, with subsequent conversion of 1 to its O-glucuronide. Surprisingly, overexpression of human cytochrome P450 reductase in A549 cells did not increase the rate of metabolic reduction of 2, suggesting that other reductases and/or non-enzymatic reductants are responsible. Thus the cobalt(III) complex 2 is a promising prodrug capable of being activated to release a very potent cytotoxin when reduced by either ionising radiation or cells under hypoxic conditions. PMID:16620789

  17. Hall thruster with grooved walls

    SciTech Connect

    Li Hong; Ning Zhongxi; Yu Daren

    2013-02-28

    Axial-oriented and azimuthal-distributed grooves are formed on channel walls of a Hall thruster after the engine undergoes a long-term operation. Existing studies have demonstrated the relation between the grooves and the near-wall physics, such as sheath and electron near-wall transport. The idea to optimize the thruster performance with such grooves was also proposed. Therefore, this paper is devoted to explore the effects of wall grooves on the discharge characteristics of a Hall thruster. With experimental measurements, the variations on electron conductivity, ionization distribution, and integrated performance are obtained. The involved physical mechanisms are then analyzed and discussed. The findings help to not only better understand the working principle of Hall thruster discharge but also establish a physical fundamental for the subsequent optimization with artificial grooves.

  18. Fabrication of star grooves and rhombus grooves micro heat pipe

    NASA Astrophysics Data System (ADS)

    Kang, Shung-Wen; Huang, Derlin

    2002-09-01

    With the development of miniaturized and high power electronic devices in recent years, electronic heat dissipating apparatus has become important. The concept of micro heat pipe (MHP) was first proposed in 1984 with the application background of electronic cooling. Since that time, numerous theoretical analyses and experimental tests were proposed, and the cross section of the MHP is either rectangular or triangular. But the capillarity of these grooves is low and restricts heat transfer limitation. In this study, star grooves MHP and rhombus grooves MHP were fabricated. Heat transfer performance of the MHP was enhanced due to better capillarity provided by more acute angles and micro gaps. Star grooves MHP and rhombus grooves MHP were fabricated by bulk micro machining on 4 inch (100) silicon wafers. Finally, the MHP structure was bonded by employing eutectic bonding technique. Testing has been conducted to evaluate the performance over a range of working fluid volumes and heat fluxes. We glue the heater on the evaporator section of the heat pipe, infuse cold water through a copper pipe in the condenser section and paste K-type thermocouples on the MHP in the direction of the length. Then we join the thermocouples to a data acquisition system and adopt Fourier's law to calculate effective thermal conductivity. The best thermal conductivities of star grooves MHP and rhombus grooves MHP are 277.9 W m-1K-1 and 289.4 W m-1K-1, respectively.

  19. Dithiocarbamate/piperazine bridged pyrrolobenzodiazepines as DNA-minor groove binders: synthesis, DNA-binding affinity and cytotoxic activity.

    PubMed

    Kamal, Ahmed; Sreekanth, Kokkonda; Shankaraiah, Nagula; Sathish, Manda; Nekkanti, Shalini; Srinivasulu, Vunnam

    2015-04-01

    A new series of C8-linked dithiocarbamate/piperazine bridged pyrrolo[2,1-c][1,4]benzodiazepine conjugates (5a-c, 6a,b) have been synthesized and evaluated for their cytotoxic potential and DNA-binding ability. The representative conjugates 5a and 5b have been screened for their cytotoxicity against a panel of 60 human cancer cell lines. Compound 5a has shown promising cytotoxic activity on selected cancer cell lines that display melanoma, leukemia, CNS, ovarian, breast and renal cancer phenotypes. The consequence of further replacement of the 3-cyano-3,3-diphenylpropyl 1-piperazinecarbodithioate in 5b and 5c with 4-methylpiperazine-1-carbodithioate yielded new conjugates 6a and 6b respectively. In addition, the compounds 5c and 6a,b have been evaluated for their in vitro cytotoxicity on some of the selected human cancer cell lines and these conjugates have exhibited significant cytotoxic activity. Further, the DNA-binding ability of these new conjugates has been evaluated by using thermal denaturation (ΔTm) studies. The correlation between structure and DNA-binding ability has been investigated by molecular modeling studies which predicted that 6b exhibits superior DNA-binding ability and these are in agreement with the experimental DNA-binding studies. PMID:25665519

  20. Groove growth by surface subdiffusion

    NASA Astrophysics Data System (ADS)

    Abu Hamed, M.; Nepomnyashchy, A. A.

    2015-04-01

    The investigation of the grain-boundary groove growth by normal surface diffusion was first done by Mullins. However, the diffusion on a solid surface is often anomalous. Recently, the groove growth in the case of surface superdiffusion has been analyzed. In the present paper, the problem of the groove growth is solved in the case of the surface subdiffusion. An exact self-similar solution is obtained and represented in terms of the Fox H-function. Basic properties of the solution are described.

  1. Micrometer for Measuring Trepanned Grooves

    NASA Technical Reports Server (NTRS)

    Bird, S. K.

    1983-01-01

    Special micrometer measures diameter of circular groove on face of large part, while part is mounted in lathe chuck. Tool has curved frame so it can reach around obstruction on centerline of part. At one end of frame is blade/ micrometer spindle for reaching into groove to be measured; this type of spindle does not rotate when micrometer thimble is turned in taking measurement. Other end of frame has sliding foot with blade.

  2. Synthesis and Characterization of DNA Minor Groove Binding Alkylating Agents

    PubMed Central

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K.; Mascara, Gerard P.; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W.; Bobola, Michael S.; Silber, John R.; Gold, Barry

    2012-01-01

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases the N-terminus was appended with a O-methyl sulfonate ester while the C-terminus group was varied with non-polar and polar sidechains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) vs. major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is > 10-fold higher than the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells over-expressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  3. Synthesis and characterization of DNA minor groove binding alkylating agents.

    PubMed

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization. PMID:23234400

  4. 30 CFR 56.19012 - Grooved drums.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Grooved drums. 56.19012 Section 56.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... § 56.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size and...

  5. 30 CFR 56.19012 - Grooved drums.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Grooved drums. 56.19012 Section 56.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... § 56.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size and...

  6. 30 CFR 57.19012 - Grooved drums.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Grooved drums. 57.19012 Section 57.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Hoists § 57.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size...

  7. 30 CFR 56.19012 - Grooved drums.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Grooved drums. 56.19012 Section 56.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... § 56.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size and...

  8. 30 CFR 57.19012 - Grooved drums.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Grooved drums. 57.19012 Section 57.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Hoists § 57.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size...

  9. 30 CFR 56.19012 - Grooved drums.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Grooved drums. 56.19012 Section 56.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... § 56.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size and...

  10. 30 CFR 57.19012 - Grooved drums.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Grooved drums. 57.19012 Section 57.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Hoists § 57.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size...

  11. 30 CFR 56.19012 - Grooved drums.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Grooved drums. 56.19012 Section 56.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... § 56.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size and...

  12. 30 CFR 57.19012 - Grooved drums.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Grooved drums. 57.19012 Section 57.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Hoists § 57.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size...

  13. 30 CFR 57.19012 - Grooved drums.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Grooved drums. 57.19012 Section 57.19012 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Hoists § 57.19012 Grooved drums. Where grooved drums are used, the grooves shall be of suitable size...

  14. The Measles Virus Hemagglutinin β-Propeller Head β4-β5 Hydrophobic Groove Governs Functional Interactions with Nectin-4 and CD46 but Not Those with the Signaling Lymphocytic Activation Molecule

    PubMed Central

    Mateo, Mathieu; Navaratnarajah, Chanakha K.; Syed, Sabriya

    2013-01-01

    Wild-type measles virus (MV) strains use the signaling lymphocytic activation molecule (SLAM; CD150) and the adherens junction protein nectin-4 (poliovirus receptor-like 4 [PVRL4]) as receptors. Vaccine MV strains have adapted to use ubiquitous membrane cofactor protein (MCP; CD46) in addition. Recently solved cocrystal structures of the MV attachment protein (hemagglutinin [H]) with each receptor indicate that all three bind close to a hydrophobic groove located between blades 4 and 5 (β4-β5 groove) of the H protein β-propeller head. We used this structural information to focus our analysis of the functional footprints of the three receptors on vaccine MV H. We mutagenized this protein and tested the ability of individual mutants to support cell fusion through each receptor. The results highlighted a strong overlap between the functional footprints of nectin-4 and CD46 but not those of SLAM. A soluble form of nectin-4 abolished vaccine MV entry in nectin-4- and CD46-expressing cells but only reduced entry through SLAM. Analyses of the binding kinetics of an H mutant with the three receptors revealed that a single substitution in the β4-β5 groove drastically reduced nectin-4 and CD46 binding while minimally altering SLAM binding. We also generated recombinant viruses and analyzed their infections in cells expressing individual receptors. Introduction of a single substitution into the hydrophobic pocket affected entry through both nectin-4 and CD46 but not through SLAM. Thus, while nectin-4 and CD46 interact functionally with the H protein β4-β5 hydrophobic groove, SLAM merely covers it. This has implications for vaccine and antiviral strategies. PMID:23760251

  15. The effect of shoe sole tread groove depth on the friction coefficient with different tread groove widths, floors and contaminants.

    PubMed

    Li, Kai Way; Wu, Horng Huei; Lin, Yu-Chang

    2006-11-01

    Slipping and falling are common phenomena in both workplaces and our daily activities. The risks associated with slipping and falling are related to the materials of footwear/floor, contamination condition, and geometric design of the sole. Shoe soles of various tread design are very common. Tread pattern of the shoe affects friction especially under liquid-contaminated conditions. Verification of the effects of tread groove depth is significant in assisting designers in designing proper footwear for workers exposed to slippery floor conditions. In this study, we measured the friction coefficients using the Neolite footwear pads on the terrazzo, steel, and vinyl floors under three liquid-contaminated conditions. A Brungraber Mark II slipmeter was used. The footwear pads had tread grooves with a width of either 3 or 9mm. The depth of the tread grooves ranged from 1 to 5mm. The results showed that tread groove depth affected the friction coefficients significantly. Higher friction values were recorded for footwear pads with deeper tread grooves on wet and water-detergent-contaminated floors. The averaged coefficient of friction (COF) gain per tread groove depth increase in millimeter under these two surface conditions ranged from 0.018 to 0.108, depending on the tread groove width, floor, and contaminant. PMID:16427022

  16. Active Sites Environmental Monitoring Program: Program plan

    SciTech Connect

    Ashwood, T.L.; Wickliff, D.S.; Morrissey, C.M.

    1990-10-01

    DOE Order 5820.2A requires that low-level waste (LLW) disposal sites active on or after September 1988 and all transuranic (TRU) waste storage sites be monitored periodically to assure that radioactive contamination does not escape from the waste sites and pose a threat to the public or to the environment. This plan describes such a monitoring program for the active LLW disposal sites in SWSA 6 and the TRU waste storage sites in SWSA 5 North. 14 refs., 8 figs.

  17. Axially grooved heat pipe study

    NASA Technical Reports Server (NTRS)

    1977-01-01

    A technology evaluation study on axially grooved heat pipes is presented. The state-of-the-art is reviewed and present and future requirements are identified. Analytical models, the Groove Analysis Program (GAP) and a closed form solution, were developed to facilitate parametric performance evaluations. GAP provides a numerical solution of the differential equations which govern the hydrodynamic flow. The model accounts for liquid recession, liquid/vapor shear interaction, puddle flow as well as laminar and turbulent vapor flow conditions. The closed form solution was developed to reduce computation time and complexity in parametric evaluations. It is applicable to laminar and ideal charge conditions, liquid/vapor shear interaction, and an empirical liquid flow factor which accounts for groove geometry and liquid recession effects. The validity of the closed form solution is verified by comparison with GAP predictions and measured data.

  18. Origin of the grooves on Phobos

    NASA Technical Reports Server (NTRS)

    Thomas, P.; Veverka, J.; Duxbury, T.

    1978-01-01

    The age, surface density, and association with the 10-km crater Stickney of the grooves (long linear depression) on Phobos are investigated, and the results support the cratering hypothesis of groove formation and seem to rule out a tidal mechanism. The appearance of the grooves is described. The age of the grooves is estimated from the density of superimposed impact craters; the density of impact craters within the grooves is compared with the average value for all of Phobos. The old age of the grooves as well as their evident association with the crater Stickney are considered to be inconsistent with the tidal hypothesis.

  19. Autoactivation by a Candida glabrata copper metalloregulatory transcription factor requires critical minor groove interactions.

    PubMed Central

    Koch, K A; Thiele, D J

    1996-01-01

    Rapid transcriptional autoactivation of the Candida glabrata AMT1 copper metalloregulatory transcription factor gene is essential for survival in the presence of high extracellular copper concentrations. Analysis of the interactions between purified recombinant AMT1 protein and the AMT1 promoter metal regulatory element was carried out by a combination of missing-nucleoside analysis, ethylation interference, site-directed mutagenesis, and quantitative in vitro DNA binding studies. The results of these experiments demonstrate that monomeric AMT1 binds the metal regulatory element with very high affinity and utilizes critical contacts in both the major and minor grooves. A single adenosine residue in the minor groove, conserved in all known yeast Cu metalloregulatory transcription factor DNA binding sites, plays a critical role in both AMT1 DNA binding in vitro and Cu-responsive AMT1 gene transcription in vivo. Furthermore, a mutation in the AMT1 Cu-activated DNA binding domain which converts a single arginine, found in a conserved minor groove binding domain, to lysine markedly reduces AMT1 DNA binding affinity in vitro and results in a severe defect in the ability of C. glabrata cells to mount a protective response against Cu toxicity. PMID:8552101

  20. Discovery of Grooves on Gaspra

    USGS Publications Warehouse

    Veverka, J.; Thomas, P.; Simonelli, D.; Belton, M.J.S.; Carr, M.; Chapman, C.; Davies, M.E.; Greeley, R.; Greenberg, R.; Head, J.; Klaasen, K.; Johnson, T.V.; Morrison, D.; Neukum, G.

    1994-01-01

    We report the discovery of grooves in Galileo high-resolution images of Gaspra. These features, previously seen only on Mars' satellite Phobos, are most likely related to severe impacts. Grooves on Gaspra occur as linear and pitted depressions, typically 100-200 m wide, 0.8 to 2.5 km long, and 10-20 m deep. Most occur in two major groups, one of which trends approximately parallel to the asteroid's long axis, but is offset by some 15??; the other is approximately perpendicular to this trend. The first of these directions falls along a family of planes which parallel three extensive flat facets identified by Thomas et al., Icarus 107. The occurrence of grooves on Gaspra is consistent with other indications (irregular shape, cratering record) that this asteroid has evolved through a violent collisional history. The bodywide congruence of major groove directions and other structural elements suggests that present-day Gaspra is a globally coherent body. ?? 1994 Academic Press. All rights reserved.

  1. One School, One Groove.

    ERIC Educational Resources Information Center

    Thomas, Lamar R., Sr.

    1999-01-01

    A Pennsylvania district's Student/Community Enrichment Activity Program involves students in both after-school and cocurricular activities in multicultural programs that continue the educational process. Programs such as American History Profiles, the American Landscape, Motown Night, and Poetry Night were carefully planned by students and their…

  2. Educational Activity Sites for High School Students

    ERIC Educational Resources Information Center

    Troutner, Joanne

    2005-01-01

    Finding quality Internet resources for high school students is a continuing challenge. Several high-quality web sites are presented for educators and students. These sites offer activities to learn how an art conservator looks at paintings, create a newspaper, research and develop an end product, build geometry and physics skills, explore science…

  3. Spectral analysis of groove spacing on Ganymede

    NASA Astrophysics Data System (ADS)

    Grimm, R. E.; Squyres, S. W.

    1985-02-01

    A quantitative analysis of groove spacing on Ganymede is described. Fourier transforms of a large number of photometric profiles across groove sets are calculated and the resulting power spectra are examined for the position and strength of peaks representing topographic periodicities. The geographic and global statistical distribution of groove wavelengths are examined, and these data are related to models of groove tectonism. It is found that groove spacing on Ganymede shows an approximately long-normal distribution with a minimum of about 3.5 km, a maximum of about 17 km, and a mean of 8.4 km. Groove spacing tends to be quite regular within a single groove set but can vary substantially from one groove set to another within a single geographic region.

  4. A novel minor groove binding reagent designed to serve as a "truck" to carry DNA modifying moieties into the major groove.

    PubMed

    Xue, T; Browne, K A; Bruice, T C

    1995-01-01

    A site selective DNA minor groove binding tripyrrole peptide has been synthesized as a "truck" to place chemical functionalities into the major groove which are capable of physically modifying DNA, acting as catalysts to hydrolyze DNA, or effectively protecting DNA from various DNA modifying enzymes. The equilibrium dissociation constants for the binding of this peptide to an A3T3 dsDNA binding site have been determined to be nanomolar, and they are compared to the constants for other minor groove binding agents. PMID:7711109

  5. Domain Collapse in Grooved Magnetic Garnet Material

    NASA Technical Reports Server (NTRS)

    Peredo, J.; Fedyunin, Y.; Patterson, G.

    1995-01-01

    Domain collapse fields in grooved garnet material were investigated by experimental observation and numerical simulation. The results indicate that the change in domain collapse field is largely due to magnetostatic effects produced by the groove edge. A simplified model based on the effective field produced at a groove edge, and local changes in the material thickness explain the observed trends very well.!.

  6. Refinery ring groove cracking experience

    SciTech Connect

    Ehmke, E.F.

    1982-05-01

    This paper presents the results of a questionnaire on the problem of ring groove cracking in reactors. The results were found to be inconclusive in providing any information on correcting the problem. One report pertaining to a ring groove crack on a 24-inch reactor nozzle served as a warning that cracks may progress beyond the overlay, through it is not known if the base metal can easily crack at low temperatures. The results did not indicate at what point the cracks occurred, but what was common to almost all cracks was that the flange had been in high-temperature, high-pressure hydrogen suggesting that dissolved hydrogen or environmental hydrogen assisted the cracking. The type of stress that contributes in the cracking has not been determined. It is indicated that many cracks were found after the questionnaire was done.

  7. Low dielectric response in enzyme active site

    PubMed Central

    Mertz, Edward L.; Krishtalik, Lev I.

    2000-01-01

    The kinetics of charge transfer depend crucially on the dielectric reorganization of the medium. In enzymatic reactions that involve charge transfer, atomic dielectric response of the active site and of its surroundings determines the efficiency of the protein as a catalyst. We report direct spectroscopic measurements of the reorganization energy associated with the dielectric response in the active site of α-chymotrypsin. A chromophoric inhibitor of the enzyme is used as a spectroscopic probe. We find that water strongly affects the dielectric reorganization in the active site of the enzyme in solution. The reorganization energy of the protein matrix in the vicinity of the active site is similar to that of low-polarity solvents. Surprisingly, water exhibits an anomalously high dielectric response that cannot be described in terms of the dielectric continuum theory. As a result, sequestering the active site from the aqueous environment inside low-dielectric enzyme body dramatically reduces the dielectric reorganization. This reduction is particularly important for controlling the rate of enzymatic reactions. PMID:10681440

  8. Grooved backing structure for CMUTs.

    PubMed

    Chapagain, Kamal Raj; Rønnekleiv, Arne

    2013-11-01

    Capacitive micromachined ultrasonic transducers (CMUTs) manufactured on silicon substrates need an acoustic backing to suppress substrate ringing when such transducers are in operation. The acoustic backing most often used for ultrasound transducers is a composite of epoxy and tungsten powder. To absorb the acoustic energy, the backing of a CMUT should have an acoustic impedance that matches that of the silicon substrate and it should be lossy. If the backing is thick enough, it will absorb the acoustic wave in the backing without reflecting it back to the transducer, and thus will not create any trailing echoes. However, if we intend to use the transducer in applications in which there is no room for a thick backing, for example in intravascular ultrasound (IVUS), a grooved backing structure might be used. The grooves at the bottom of the backing provide extra attenuation by scattering the waves in different directions so that a thinner backing is sufficient. The scattering removes power from the specular reflection from the back surface which otherwise degrades the image quality. It has been shown that this type of structure reduces the specular reflection for a range of frequencies. When CMUTs are used in practical applications, the propagation of waves from a fluid medium into the backing or vice versa is blocked to some degree by total reflection, except for a range of steering angles around broadside. This is due to the difference in acoustic velocities of silicon and the fluid medium. This blocking is accompanied by the generation of surface waves in the silicon substrate, which also may impact the imaging and therefore must be controlled. In this paper, we investigate the acoustic signal transmitted into the backing relative to the signal transmitted into the fluid medium when CMUT arrays on top of the silicon substrate are excited. Furthermore, the performance of the grooved backing structure is studied for the waves traveling in normal as well as in

  9. Active site specificity of plasmepsin II.

    PubMed Central

    Westling, J.; Cipullo, P.; Hung, S. H.; Saft, H.; Dame, J. B.; Dunn, B. M.

    1999-01-01

    Members of the aspartic proteinase family of enzymes have very similar three-dimensional structures and catalytic mechanisms. Each, however, has unique substrate specificity. These distinctions arise from variations in amino acid residues that line the active site subsites and interact with the side chains of the amino acids of the peptides that bind to the active site. To understand the unique binding preferences of plasmepsin II, an enzyme of the aspartic proteinase class from the malaria parasite, Plasmodium falciparum, chromogenic octapeptides having systematic substitutions at various positions in the sequence were analyzed. This enabled the design of new, improved substrates for this enzyme (Lys-Pro-Ile-Leu-Phe*Nph-Ala/Glu-Leu-Lys, where * indicates the cleavage point). Additionally, the crystal structure of plasmepsin II was analyzed to explain the binding characteristics. Specific amino acids (Met13, Ser77, and Ile287) that were suspected of contributing to active site binding and specificity were chosen for site-directed mutagenesis experiments. The Met13Glu and Ile287Glu single mutants and the Met13Glu/Ile287Glu double mutant gain the ability to cleave substrates containing Lys residues. PMID:10548045

  10. Capillary flow in irregular surface grooves

    SciTech Connect

    Rye, R.R.; Yost, F.G.; O`Toole, E.J.

    1998-07-07

    1-Heptanol flow in irregularly shaped surface grooves in Pd-coated Cu is shown to be an example of Poiseuille flow with simple Washburn kinetics of the form z{sup 2} = C({gamma}/{mu})t, where {gamma} is the liquid surface tension, {mu} is the viscosity, and C is a function of the groove dimensions and the contact angle {theta}. A shape independent expression is derived for the geometric factor, C(S,{omega},{theta}) = (S cos({theta}) {minus} {omega})/4{pi}, where {omega} is the width of the groove at the surface and S is the arc length, or total length of groove surface in a plane perpendicular to the groove axis. This expression is general for any groove shape and reduces to the form derived previously for V-shaped grooves. Along with scanning electron microscopy, three different techniques, stylus profilometry, laser profilometry, and optical interferometry, were used to characterize the groove geometry, especially to determine S and {omega}. While reasonable agreement is obtained between literature values of {gamma}/{mu} and values obtained from the experimental kinetics, the main conclusion is that measurement of the groove dimensions is the main limitation to experimental verification of the form of C and to the use of the kinetics of groove flow as an absolute measure of the factor {gamma}/{mu}. However, the authors show that if C is calibrated for a specific groove with a known liquid, the kinetics of capillary flow in open surface grooves furnishes a simple, easily applied method for measurement of the surface tension-to-viscosity ratio, {gamma}/{mu}.

  11. Influence of musical groove on postural sway.

    PubMed

    Ross, Jessica M; Warlaumont, Anne S; Abney, Drew H; Rigoli, Lillian M; Balasubramaniam, Ramesh

    2016-03-01

    Timescales of postural fluctuation reflect underlying neuromuscular processes in balance control that are influenced by sensory information and the performance of concurrent cognitive and motor tasks. An open question is how postural fluctuations entrain to complex environmental rhythms, such as in music, which also vary on multiple timescales. Musical groove describes the property of music that encourages auditory-motor synchronization and is used to study voluntary motor entrainment to rhythmic sounds. The influence of groove on balance control mechanisms remains unexplored. We recorded fluctuations in center of pressure (CoP) of standing participants (N = 40) listening to low and high groove music and during quiet stance. We found an effect of musical groove on radial sway variability, with the least amount of variability in the high groove condition. In addition, we observed that groove influenced postural sway entrainment at various temporal scales. For example, with increasing levels of groove, we observed more entrainment to shorter, local timescale rhythmic musical occurrences. In contrast, we observed more entrainment to longer, global timescale features of the music, such as periodicity, with decreasing levels of groove. Finally, musical experience influenced the amount of postural variability and entrainment at local and global timescales. We conclude that groove in music and musical experience can influence the neural mechanisms that govern balance control, and discuss implications of our findings in terms of multiscale sensorimotor coupling. (PsycINFO Database Record PMID:26727019

  12. Crystal Structures of Pseudomonas aeruginosa GIM-1: Active-Site Plasticity in Metallo-β-Lactamases

    PubMed Central

    Borra, Pardha Saradhi; Samuelsen, Ørjan; Spencer, James; Walsh, Timothy R.; Lorentzen, Marit Sjo

    2013-01-01

    Metallo-β-lactamases (MBLs) have rapidly disseminated worldwide among clinically important Gram-negative bacteria and have challenged the therapeutic use of β-lactam antibiotics, particularly carbapenems. The blaGIM-1 gene, encoding one such enzyme, was first discovered in a Pseudomonas aeruginosa isolate from 2002 and has more recently been reported in Enterobacteriaceae. Here, we present crystal structures of GIM-1 in the apo-zinc (metal-free), mono-zinc (where Cys221 was found to be oxidized), and di-zinc forms, providing nine independently refined views of the enzyme. GIM-1 is distinguished from related MBLs in possessing a narrower active-site groove defined by aromatic side chains (Trp228 and Tyr233) at positions normally occupied by hydrophilic residues in other MBLs. Our structures reveal considerable flexibility in two loops (loop 1, residues 60 to 66; loop 2, residues 223 to 242) adjacent to the active site, with open and closed conformations defined by alternative hydrogen-bonding patterns involving Trp228. We suggest that this capacity for rearrangement permits GIM-1 to hydrolyze a wide range of β-lactams in spite of possessing a more constrained active site. Our results highlight the structural diversity within the MBL enzyme family. PMID:23208706

  13. Modulation of osteogenic, adipogenic and myogenic differentiation of mesenchymal stem cells by submicron grooved topography.

    PubMed

    Wang, Peng-Yuan; Li, Wen-Tyng; Yu, Jiashing; Tsai, Wei-Bor

    2012-12-01

    Topographic cues have been recognized crucial on the modulation of cell behavior, and subsequent important for the design of implants, cell-based biomedical devices and tissue-engineered products. Grooved topography direct cells to align anisotropically on the substrates, resulting in an obvious morphological difference compared with the flat and the other topographies. This study aimed at investigating the effects of grooved topography on the differentiation of mesenchymal stem cells (MSCs) into osteoblasts, adipocytes and myoblasts. A series of submicron-grooved polystyrene substrates with equal groove-to-ridge ratio but different width and depth (width/depth (nm): 450/100, 450/350, 900/100, and 900/550) were fabricated based on electron beam lithography and soft lithography techniques. Primary rat MSCs (rMSCs) were cultured on these substrates without induction for differentiation for 6 days, and then subjected to induction for osteogenesis, adipogenesis and myogenesis. While the alignment of rMSCs strongly complied with the direction of the grooves and increased with groove depths, cell attachment on day 1 (~1.5 × 10(4)/cm(2)) and cell proliferation after 6 days of culture (~5 × 10(4)/cm(2)) were not significantly affected by substrate types. Osteogenesis, indicated by alkaline phosphatase activities and calcium deposit, was not significantly modulated by the grooved substrates, compared with the flat control, suggesting that cell alignment may not determine osteoinduction of rMSCs. On the other hand, adipogenesis, indicated by lipid production, was significantly enhanced by the grooved substrates compared with the flat surface (P < 0.001). On the other hand, myogenesis, indicated by desmin and MHC staining, was enhanced by the grooves in a time- and groove size-dependent manner compared with the flat control. The results suggested that grooved topography has an in-depth potential for modulating the commitment of the stem cell lineages, which could benefit

  14. Interproximal grooving in the Atapuerca-SH hominid dentitions.

    PubMed

    Bermúdez de Castro, J M; Arsuaga, J L; Pérez, P J

    1997-03-01

    The dental sample recovered from the Sima de los Huesos (SH) Middle Pleistocene cave site of the Sierra de Atapuerca (Spain) includes 296 specimens. Interproximal wear grooves have been observed in 20 maxillary and mandibular posterior teeth belonging to at least five of the 32 individuals identified so far in the SH hypodigm. Interproximal grooving affected only the adults, and at an age between 25 and 40 years. The appearance, morphology, and location pattern of the SH wear grooves are similar to those reported in other fossil hominids and in more recent human populations. Two alternative proposals, the toothpicking and the fiber or sinew processing hypotheses, compete for explaining the formation of this anomalous wear. The characteristics observed in the wear grooves of the SH teeth are compatible only with the habitual probing of interdental spaces by means of hard and inflexible objects. Dietary grit may also have contributed to the abrasion of the root walls during the motion of the dental probes. PMID:9098505

  15. Corrosion Research And Web Site Activities

    NASA Technical Reports Server (NTRS)

    Heidersbach, Robert H.

    2001-01-01

    This report covers corrosion-related activities at the NASA Kennedy Space Center during the summer of 2000. The NASA Kennedy Space Center's corrosion web site, corrosion.ksc.nasa.gov, was updated with new information based on feedback over the past two years. The methodology for a two-year atmospheric exposure testing program to study the effectiveness of commercial chemicals sold for rinsing aircraft and other equipment was developed and some preliminary laboratory chemical analyses are presented.

  16. Corrosion Research and Web Site Activities

    NASA Technical Reports Server (NTRS)

    Heidersbach, Robert H.

    2002-01-01

    This report covers corrosion-related activities at the NASA Kennedy Space Center during the summer of 2000. The NASA Kennedy Space Center's corrosion web site, corrosion.ksc.nasa.gov, was updated with new information based on feedback over the past two years. The methodology for a two-year atmospheric exposure testing program to study the effectiveness of commercial chemicals sold for rinsing aircraft and other equipment was developed and some preliminary laboratory chemical analyses are presented.

  17. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    SciTech Connect

    Fagan, P A

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I{center_dot}C base pairs are functional analogs of A{center_dot}T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1 ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.

  18. DNA minor groove-binding ligands: a different class of mammalian DNA topoisomerase I inhibitors.

    PubMed Central

    Chen, A Y; Yu, C; Gatto, B; Liu, L F

    1993-01-01

    A number of DNA minor groove-binding ligands (MGBLs) are known to exhibit antitumor and antimicrobial activities. We show that DNA topoisomerase (Topo) I may be a pharmacological target of MGBLs. In the presence of calf thymus Topo I, MGBLs induced limited but highly specific single-strand DNA breaks. The 3' ends of the broken DNA strands are covalently linked to Topo I polypeptides. Protein-linked DNA breaks are readily reversed by a brief heating to 65 degrees C or the addition of 0.5 M NaCl. These results suggest that MGBLs, like camptothecin, abort Topo I reactions by trapping reversible cleavable complexes. The sites of cleavage induced by MGBLs are distinctly different from those induced by camptothecin. Two of the major cleavage sites have been sequenced and shown to be highly A + T-rich, suggesting the possible involvement of a Topo I-drug-DNA ternary complex at the sites of cleavage. Different MGBLs also exhibit varying efficiency in inducing Topo I-cleavable complexes, and the order of efficiency is as follows: Hoechst 33342 and 33258 >> distamycin A > berenil > netropsin. The lack of correlation between DNA binding and cleavage efficiency suggest that, in addition to binding to the minor grooves of DNA, MGBLs must also interact with Topo I in trapping Topo I-cleavable complexes. Images Fig. 2 Fig. 4 Fig. 5 Fig. 6 PMID:7690143

  19. Functional significance of the TATA element major groove in transcription initiation by RNA polymerase II.

    PubMed Central

    Lee, D K; Wang, K C; Roeder, R G

    1997-01-01

    The binding of TFIID to the TATA element initiates assembly of a preinitiation complex and thus represents one of the most important steps for transcriptional regulation. The fact that the TATA binding protein (TBP), a subunit of TFIID, exclusively contacts the minor groove of the TATA element led us to ask whether the major groove of the TATA element plays any role in transcription initiation or its regulation. Our results show that modifications of the major groove of the TATA element in the adenovirus major late promoter have no effect on TFIID binding affinity or on transcription in a cell-free system reconstituted with purified factors. However, major groove modifications do decrease the levels of both basal and activator-mediated transcription in unfractionated nuclear extracts, indicating that the intact structure of the major groove of the TATA element is functionally important for transcription initiation in a more physiological context. PMID:9336466

  20. Identification of an activation site in Bak and mitochondrial Bax triggered by antibodies

    PubMed Central

    Iyer, Sweta; Anwari, Khatira; Alsop, Amber E.; Yuen, Wai Shan; Huang, David C. S.; Carroll, John; Smith, Nicholas A.; Smith, Brian J.; Dewson, Grant; Kluck, Ruth M.

    2016-01-01

    During apoptosis, Bak and Bax are activated by BH3-only proteins binding to the α2–α5 hydrophobic groove; Bax is also activated via a rear pocket. Here we report that antibodies can directly activate Bak and mitochondrial Bax by binding to the α1–α2 loop. A monoclonal antibody (clone 7D10) binds close to α1 in non-activated Bak to induce conformational change, oligomerization, and cytochrome c release. Anti-FLAG antibodies also activate Bak containing a FLAG epitope close to α1. An antibody (clone 3C10) to the Bax α1–α2 loop activates mitochondrial Bax, but blocks translocation of cytosolic Bax. Tethers within Bak show that 7D10 binding directly extricates α1; a structural model of the 7D10 Fab bound to Bak reveals the formation of a cavity under α1. Our identification of the α1–α2 loop as an activation site in Bak paves the way to develop intrabodies or small molecules that directly and selectively regulate these proteins. PMID:27217060

  1. Identification of an activation site in Bak and mitochondrial Bax triggered by antibodies.

    PubMed

    Iyer, Sweta; Anwari, Khatira; Alsop, Amber E; Yuen, Wai Shan; Huang, David C S; Carroll, John; Smith, Nicholas A; Smith, Brian J; Dewson, Grant; Kluck, Ruth M

    2016-01-01

    During apoptosis, Bak and Bax are activated by BH3-only proteins binding to the α2-α5 hydrophobic groove; Bax is also activated via a rear pocket. Here we report that antibodies can directly activate Bak and mitochondrial Bax by binding to the α1-α2 loop. A monoclonal antibody (clone 7D10) binds close to α1 in non-activated Bak to induce conformational change, oligomerization, and cytochrome c release. Anti-FLAG antibodies also activate Bak containing a FLAG epitope close to α1. An antibody (clone 3C10) to the Bax α1-α2 loop activates mitochondrial Bax, but blocks translocation of cytosolic Bax. Tethers within Bak show that 7D10 binding directly extricates α1; a structural model of the 7D10 Fab bound to Bak reveals the formation of a cavity under α1. Our identification of the α1-α2 loop as an activation site in Bak paves the way to develop intrabodies or small molecules that directly and selectively regulate these proteins. PMID:27217060

  2. Tectonic framework of grooved terrain on Ganymede

    SciTech Connect

    Bianchi, R.; Casacchia, R.; Lanciano, P.; Pozio, S.; Strom, R.G.

    1986-08-01

    The Ganymede surface is distinct in that predominant surface features are grooves that all but obliterate the impact craters common to other objects in the solar system. The orientations of all grooves detected on the Ganymede surface with Voyager imagery were examined to find any regional or global patterns. The analysis was performed by plotting azimuthal frequency diagrams for the groove orientations. The database drew on images of 7200 grooves and 2600 prominent structures covering 35 percent of the Ganymede surface. Predominant NE-SW and NW-SE orientations of the grooves fit in with a global tectonic framework of great circles inclined 35-40 deg to the equatorial plane. The stress pattern could have been caused by rising and falling convection plumes. The limited amount of the surface imaged, however, will constrain models of the underlying tectonic evolution until the Galileo probe acquires more data. 20 references.

  3. Active site of ribulosebisphosphate carboxylase/oxygenase

    SciTech Connect

    Hartman, F.C.; Stringer, C.D.; Milanez, S.; Lee, E.H.

    1985-01-01

    Previous affinity labeling studies and comparative sequence analyses have identified two different lysines at the active site of ribulosebisphosphate carboxylase/oxygenase and have suggested their essentiality to function. The essential lysines occupy positions 166 and 329 in the Rhodospirillum rubrum enzyme and positions 175 and 334 in the spinach enzyme. Based on the pH-dependencies of inactivations of the two enzymes by trinitrobenzene sulfonate, Lys-166 (R. rubrum enzyme) exhibits a pK/sub a/ of 7.9 and Lys-334 (spinach enzyme) exhibits a pK/sub a/ of 9.0. These low pK/sub a/ values as well as the enhanced nucleophilicities of the lysyl residues argue that both are important to catalysis rather than to substrate binding. Lys-166 may correspond to the essential base that initiates catalysis and that displays a pK/sub a/ of 7.5 in the pH-curve for V/sub max//K/sub m/. Cross-linking experiments with 4,4'-diisothiocyano-2,2'-disulfonate stilbene demonstrate that the two active-site lysines are within 12 A. 50 refs., 7 figs., 1 tab.

  4. Filling and wetting transitions at grooved substrates.

    PubMed

    Malijevský, Alexandr

    2013-11-01

    The wetting and filling properties of a fluid adsorbed on a solid grooved substrate are studied by means of a microscopic density functional theory. The grooved substrates are modelled using a solid slab, interacting with the fluid particles via long-range dispersion forces, to which a one-dimensional array of infinitely long rectangular grooves is sculpted. By investigating the effect of the groove periodicity and the width of the grooves and the ridges, a rich variety of different wetting morphologies is found. In particular, we show that for a saturated ambient gas, the adsorbent can occur in one of four wetting states characterized by (i) empty grooves, (ii) filled grooves, (iii) a formation of mesoscopic hemispherical caps (iv) a macroscopically wet surface. The character of the transition between particular regimes, that also extend off-coexistence, sensitively depends on the model geometry. The temperature at which the system becomes completely wet is considerably higher than that for a flat wall. PMID:24067670

  5. Active Sites Environmental Monitoring Program: Program plan

    SciTech Connect

    Ashwood, T.L.; Wickliff, D.S.; Morrissey, C.M.

    1992-02-01

    The Active Sites Environmental Monitoring Program (ASEMP), initiated in 1989, provides early detection and performance monitoring of transuranic (TRU) waste and active low-level waste (LLW) facilities at Oak Ridge National Laboratory (ORNL) in accordance with US Department of Energy (DOE) Order 5820.2A. Active LLW facilities in Solid Waste Storage Area (SWSA) 6 include Tumulus I and Tumulus II, the Interim Waste Management Facility (IWMF), LLW silos, high-range wells, asbestos silos, and fissile wells. The tumulus pads and IWMF are aboveground, high-strength concrete pads on which concrete vaults containing metal boxes of LLW are placed; the void space between the boxes and vaults is filled with grout. Eventually, these pads and vaults will be covered by an engineered multilayered cap. All other LLW facilities in SWSA 6 are below ground. In addition, this plan includes monitoring of the Hillcut Disposal Test Facility (HDTF) in SWSA 6, even though this facility was completed prior to the data of the DOE order. In SWSA 5 North, the TRU facilities include below-grade engineered caves, high-range wells, and unlined trenches. All samples from SWSA 6 are screened for alpha and beta activity, counted for gamma-emitting isotopes, and analyzed for tritium. In addition to these analytes, samples from SWSA 5 North are analyzed for specific transuranic elements.

  6. Crystal structures of human tissue kallikrein 4: activity modulation by a specific zinc binding site.

    PubMed

    Debela, Mekdes; Magdolen, Viktor; Grimminger, Valerie; Sommerhoff, Christian; Messerschmidt, Albrecht; Huber, Robert; Friedrich, Rainer; Bode, Wolfram; Goettig, Peter

    2006-10-01

    Human tissue kallikrein 4 (hK4) belongs to a 15-member family of closely related serine proteinases. hK4 is predominantly expressed in prostate, activates hK3/PSA, and is up-regulated in prostate and ovarian cancer. We have identified active monomers of recombinant hK4 besides inactive oligomers in solution. hK4 crystallised in the presence of zinc, nickel, and cobalt ions in three crystal forms containing cyclic tetramers and octamers. These structures display a novel metal site between His25 and Glu77 that links the 70-80 loop with the N-terminal segment. Micromolar zinc as present in prostatic fluid inhibits the enzymatic activity of hK4 against fluorogenic substrates. In our measurements, wild-type hK4 exhibited a zinc inhibition constant (IC50) of 16 microM including a permanent residual activity, in contrast to the zinc-independent mutants H25A and E77A. Since the Ile16 N terminus of wild-type hK4 becomes more accessible for acetylating agents in the presence of zinc, we propose that zinc affects the hK4 active site via the salt-bridge formed between the N terminus and Asp194 required for a functional active site. hK4 possesses an unusual 99-loop that creates a groove-like acidic S2 subsite. These findings explain the observed specificity of hK4 for the P1 to P4 substrate residues. Moreover, hK4 shows a negatively charged surface patch, which may represent an exosite for prime-side substrate recognition. PMID:16950394

  7. Covalent Inhibition of Ubc13 Affects Ubiquitin Signaling and Reveals Active Site Elements Important for Targeting

    PubMed Central

    Hodge, Curtis D.; Edwards, Ross A.; Markin, Craig J.; McDonald, Darin; Pulvino, Mary; Huen, Michael S. Y.; Zhao, Jiyong; Spyracopoulos, Leo; Hendzel, Michael J.; Glover, J.N. Mark

    2015-01-01

    Ubc13 is an E2 ubiquitin conjugating enzyme that functions in nuclear DNA damage signaling and cytoplasmic NF-κB signaling. Here we present the structures of complexes of Ubc13 with two inhibitors, NSC697923 and BAY 11-7082, which inhibit DNA damage and NF-κB signaling in human cells. NSC697923 and BAY 11-7082 both inhibit Ubc13 by covalent adduct formation through a Michael addition at the Ubc13 active site cysteine. The resulting adducts of both compounds exploit a binding groove unique to Ubc13. We developed a Ubc13 mutant which resists NSC697923 inhibition and, using this mutant, we show that the inhibition of cellular DNA damage and NF-κB signaling by NSC697923 is largely due to specific Ubc13 inhibition. We propose that unique structural features near the Ubc13 active site could provide a basis for the rational development and design of specific Ubc13 inhibitors. PMID:25909880

  8. Covalent Inhibition of Ubc13 Affects Ubiquitin Signaling and Reveals Active Site Elements Important for Targeting.

    PubMed

    Hodge, Curtis D; Edwards, Ross A; Markin, Craig J; McDonald, Darin; Pulvino, Mary; Huen, Michael S Y; Zhao, Jiyong; Spyracopoulos, Leo; Hendzel, Michael J; Glover, J N Mark

    2015-07-17

    Ubc13 is an E2 ubiquitin conjugating enzyme that functions in nuclear DNA damage signaling and cytoplasmic NF-κB signaling. Here, we present the structures of complexes of Ubc13 with two inhibitors, NSC697923 and BAY 11-7082, which inhibit DNA damage and NF-κB signaling in human cells. NSC697923 and BAY 11-7082 both inhibit Ubc13 by covalent adduct formation through a Michael addition at the Ubc13 active site cysteine. The resulting adducts of both compounds exploit a binding groove unique to Ubc13. We developed a Ubc13 mutant which resists NSC697923 inhibition and, using this mutant, we show that the inhibition of cellular DNA damage and NF-κB signaling by NSC697923 is largely due to specific Ubc13 inhibition. We propose that unique structural features near the Ubc13 active site could provide a basis for the rational development and design of specific Ubc13 inhibitors. PMID:25909880

  9. Grooves and Craters on Ganymede

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Grooved terrain in this area of Nippur Sulcus on Jupiter's moon Ganymede is composed of ridges and troughs spaced 1 to 2 kilometers (0.6 to 1.2 miles) apart. North is to the top. A few broad (4 to 5 kilometer (2.5 to 3.1 mile) wide) ridges such as those in the northeast and southwest corners have smaller ridges on top of them. A 12 kilometer (7 mile) diameter impact crater is superimposed on these ridges. A dark ring at the base of the crater walls may be due to a collection of dark material at the base of the steep slopes. The image is 49 by 41 kilometers (30 by 25 miles) with a resolution of 200 meters (656 feet) per picture element (pixel). This image was obtained on September 6, 1996 by the Solid State Imaging (CCD) system aboard NASA's Galileo spacecraft.

    The Jet Propulsion Laboratory, Pasadena, CA manages the Galileo mission for NASA's Office of Space Science, Washington, DC. JPL is an operating division of California Institute of Technology (Caltech).

    This image and other images and data received from Galileo are posted on the World Wide Web, on the Galileo mission home page at URL http://galileo.jpl.nasa.gov. Background information and educational context for the images can be found at URL http://www.jpl.nasa.gov/galileo/sepo

  10. L2′ loop is critical for caspase-7 active site formation

    PubMed Central

    Witkowski, Witold A; Hardy, Jeanne A

    2009-01-01

    The active sites of caspases are composed of four mobile loops. A loop (L2) from one half of the dimer interacts with a loop (L2′) from the other half of the dimer to bind substrate. In an inactive form, the two L2′ loops form a cross-dimer hydrogen-bond network over the dimer interface. Although the L2′ loop has been implicated as playing a central role in the formation of the active-site loop bundle, its precise role in catalysis has not been shown. A detailed understanding of the active and inactive conformations is essential to control the caspase function. We have interrogated the contributions of the residues in the L2′ loop to catalytic function and enzyme stability. In wild-type and all mutants, active-site binding results in substantial stabilization of the complex. One mutation, P214A, is significantly destabilized in the ligand-free conformation, but is as stable as wild type when bound to substrate, indicating that caspase-7 rests in different conformations in the absence and presence of substrate. Residues K212 and I213 in the L2′ loop are shown to be essential for substrate-binding and thus proper catalytic function of the caspase. In the crystal structure of I213A, the void created by side-chain deletion is compensated for by rearrangement of tyrosine 211 to fill the void, suggesting that the requirements of substrate-binding are sufficiently strong to induce the active conformation. Thus, although the L2′ loop makes no direct contacts with substrate, it is essential for buttressing the substrate-binding groove and is central to native catalytic efficiency. PMID:19530232

  11. Selective anti-malarial minor groove binders.

    PubMed

    Scott, Fraser J; Khalaf, Abedawn I; Duffy, Sandra; Avery, Vicky M; Suckling, Colin J

    2016-07-15

    A set of 31 DNA minor groove binders (MGBs) with diverse structural features relating to both physical chemical properties and DNA binding sequence preference has been evaluated as potential drugs to treat Plasmodium falciparum infections using a chloroquine sensitive strain (3D7) and a chloroquine resistant strain (Dd2) in comparison with human embryonic kidney (HEK) cells as an indicator of mammalian cell toxicity. MGBs with an alkene link between the two N-terminal building blocks were demonstrated to be most active with IC50 values in the range 30-500nM and therapeutic ratios in the range 10->500. Many active compounds contained a C-alkylthiazole building block. Active compounds with logD7.4 values of approximately 3 or 7 were identified. Importantly the MGBs tested were essentially equally effective against both chloroquine sensitive and resistant strains. The results show that suitably designed MGBs have the potential for development into clinical candidates for antimalarial drugs effective against resistant strains of Plasmodia. PMID:27212070

  12. Two pad axially grooved hydrostatic bearing

    NASA Technical Reports Server (NTRS)

    San Andres, Luis A. (Inventor)

    1995-01-01

    A hydrostatic bearing having two axial grooves on opposite sides of the bearing for breaking the rotational symmetry in the dynamic force coefficients thus reducing the whirl frequency ratio and increasing the damping and stiffness of the hydrostatic bearing.

  13. BH3-in-groove dimerization initiates and helix 9 dimerization expands Bax pore assembly in membranes.

    PubMed

    Zhang, Zhi; Subramaniam, Sabareesh; Kale, Justin; Liao, Chenyi; Huang, Bo; Brahmbhatt, Hetal; Condon, Samson G F; Lapolla, Suzanne M; Hays, Franklin A; Ding, Jingzhen; He, Feng; Zhang, Xuejun C; Li, Jianing; Senes, Alessandro; Andrews, David W; Lin, Jialing

    2016-01-18

    Pro-apoptotic Bax induces mitochondrial outer membrane permeabilization (MOMP) by forming oligomers through a largely undefined process. Using site-specific disulfide crosslinking, compartment-specific chemical labeling, and mutational analysis, we found that activated integral membrane Bax proteins form a BH3-in-groove dimer interface on the MOM surface similar to that observed in crystals. However, after the α5 helix was released into the MOM, the remaining interface with α2, α3, and α4 helices was rearranged. Another dimer interface was formed inside the MOM by two intersected or parallel α9 helices. Combinations of these interfaces generated oligomers in the MOM. Oligomerization was initiated by BH3-in-groove dimerization, without which neither the other dimerizations nor MOMP occurred. In contrast, α9 dimerization occurred downstream and was required for release of large but not small proteins from mitochondria. Moreover, the release of large proteins was facilitated by α9 insertion into the MOM and localization to the pore rim. Therefore, the BH3-in-groove dimerization on the MOM nucleates the assembly of an oligomeric Bax pore that is enlarged by α9 dimerization at the rim. PMID:26702098

  14. Spurs and grooves revisited: construction versus erosion, Looe Key Reef, Florida

    USGS Publications Warehouse

    Shinn, E.A.; Hudson, J.H.; Robbin, Daniel M.; Lidz, Barbara H.

    1982-01-01

    Six of 12 core holes drilled at Looe Key Reef (24°37'18"N. 81°24'24"W) by a diver-operated coring device penetrated a spur and groove system. Drilling indicated that: (II the spurs and grooves formed over at least 5 m of carbonate reef sand: (2) the underlying Pleistocene surface is essentially flat and therefore could not control or initiate spacing of spurs or grooves; (3) only the thin seaward ends of spurs are rooted on underlying bedrock: and (4) the interior of the Millepora-encrusted spurs is composed primarily of Acropora palmata. a species no longer abundant on this reef. From the drilling of Looe Key Reef and from other observations along the reef tract, we propose that most shallow spurs and grooves in active coral reef areas of the Caribbean are constructional in origin and not initiated or controlled by bedrock topography. Spurs and grooves in non-coral reef areas adjacent to shorelines, however. are clearly of erosional origin and have a close spacing distinctly different from spurs and grooves known to be of constructional origin. These observations indicate that spurs and grooves in deeper (> 15 m) fore-reef areas off Florida, which have the same geometry as the shoreline features. are erosional in origin and therefore formed on a shoreline during a lower stand of sea level.

  15. Effects of Longitudinal Grooves on the Stability of Channel Flow

    NASA Astrophysics Data System (ADS)

    Moradi, H. Vafadar; Floryan, Jerzy M.

    2014-11-01

    The travelling wave instability in a channel with small-amplitude longitudinal grooves of arbitrary shape has been studied. The disturbance velocity field is always three-dimensional with disturbances which connect to the two-dimensional waves in the limit of zero groove amplitude playing the critical role. The presence of grooves destabilizes the flow if the groove wave number β is larger than βtran ~ 4 . 22 , but stabilizes the flow for smaller β. It has been found that βtran does not depend on the groove amplitude. The dependence of the critical Reynolds number on the groove amplitude and wave number has been determined. Special attention has been paid to the drag-reducing long wavelength grooves, including the optimal grooves. It has been demonstrated that such grooves slightly increase the critical Reynolds number, i.e., such grooves do not cause an early breakdown into turbulence.

  16. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis

    SciTech Connect

    Stella, Stefano; Cascio, Duilio; Johnson, Reid C.

    2010-06-21

    The bacterial nucleoid-associated protein Fis regulates diverse reactions by bending DNA and through DNA-dependent interactions with other control proteins and enzymes. In addition to dynamic nonspecific binding to DNA, Fis forms stable complexes with DNA segments that share little sequence conservation. Here we report the first crystal structures of Fis bound to high- and low-affinity 27-base-pair DNA sites. These 11 structures reveal that Fis selects targets primarily through indirect recognition mechanisms involving the shape of the minor groove and sequence-dependent induced fits over adjacent major groove interfaces. The DNA shows an overall curvature of {approx}65{sup o}, and the unprecedented close spacing between helix-turn-helix motifs present in the apodimer is accommodated by severe compression of the central minor groove. In silico DNA structure models show that only the roll, twist, and slide parameters are sufficient to reproduce the changes in minor groove widths and recreate the curved Fis-bound DNA structure. Models based on naked DNA structures suggest that Fis initially selects DNA targets with intrinsically narrow minor grooves using the separation between helix-turn-helix motifs in the Fis dimer as a ruler. Then Fis further compresses the minor groove and bends the DNA to generate the bound structure.

  17. The Sec1/Munc18 Protein Groove Plays a Conserved Role in Interaction with Sec9p/SNAP-25.

    PubMed

    Weber-Boyvat, Marion; Chernov, Konstantin G; Aro, Nina; Wohlfahrt, Gerd; Olkkonen, Vesa M; Jäntti, Jussi

    2016-02-01

    The Sec1/Munc18 (SM) proteins constitute a conserved family with essential functions in SNARE-mediated membrane fusion. Recently, a new protein-protein interaction site in Sec1p, designated the groove, was proposed. Here, we show that a sec1 groove mutant yeast strain, sec1(w24), displays temperature-sensitive growth and secretion defects. The yeast Sec1p and mammalian Munc18-1 grooves were shown to play an important role in the interaction with the SNAREs Sec9p and SNAP-25b, respectively. Incubation of SNAP-25b with the Munc18-1 groove mutant resulted in a lag in the kinetics of SNARE complex assembly in vitro when compared with wild-type Munc18-1. The SNARE regulator SRO7 was identified as a multicopy suppressor of sec1(w24) groove mutant and an intact Sec1p groove was required for the plasma membrane targeting of Sro7p-SNARE complexes. Simultaneous inactivation of Sec1p groove and SRO7 resulted in reduced levels of exocytic SNARE complexes. Our results identify the groove as a conserved interaction surface in SM proteins. The results indicate that this structural element is important for interactions with Sec9p/SNAP-25 and participates, in concert with Sro7p, in the initial steps of SNARE complex assembly. PMID:26572066

  18. Local-scale stratigraphy of grooved terrain on Ganymede

    NASA Technical Reports Server (NTRS)

    Murchie, Scott L.; Head, James W.; Helfenstein, Paul; Plescia, Jeffrey B.

    1987-01-01

    The surface of the Jovian satellite, Ganymede, is divided into two main units, dark terrain cut by arcuate and subradial furrows, and light terrain consisting largely of areas with pervasive U-shaped grooves. The grooved terrain may be subdivided on the basis of pervasive morphology of groove domains into four terrain types: (1) elongate bands of parallel grooves (groove lanes); (2) polygonal domains of parallel grooves (grooved polygons); (3) polygonal domains of two orthogonal groove sets (reticulate terrain); and (4) polygons having two to several complexly cross-cutting groove sets (complex grooved terrain). Reticulate terrain is frequently dark and not extensively resurfaced, and grades to a more hummocky terrain type. The other three grooved terrain types have almost universally been resurfaced by light material during their emplacement. The sequence of events during grooved terrain emplacement has been investigated. An attempt is made to integrate observed geologic and tectonic patterns to better constrain the relative ages and styles of emplacement of grooved terrain types. A revised model of grooved terrain emplacement is proposed and is tested using detailed geologic mapping and measurement of crater density.

  19. Grooved surfaces on InP

    NASA Technical Reports Server (NTRS)

    Bailey, Sheila G.; Fatemi, Navid S.; Landis, Geoffrey A.; Jenkins, Phillip P.

    1991-01-01

    Formation of a textured or grooved front surface on a solar cell can increase the efficiency in several ways, including enhanced absorption and light trapping. In III-IV materials the (111) plane is chemically different form the (1'1'1') plane, and both etching and epitaxial deposition behave differently on these surfaces. The current state of profile etching in InP is summarized. Data are presented on novel geometries attainable as a function of etchant temperature and composition, substrate orientation and carrier concentration, and the oxide thickness between the substrate and the photoresist. Depending on dopant concentration, the same etchant can produce either anisotropic or isotropic grooves. V-grooved solar cells were manufactured on InP, and the improved optical absorption was demonstrated. Preferred parameters for various applications are listed and discussed.

  20. Wetting kinetics in surface capillary grooves

    SciTech Connect

    Rye, R.R.; Yost, F.G.; Mann, J.A. Jr.

    1996-10-02

    For V-shaped surface grooves in copper, we have obtained the capillary driven flow kinetics for two liquids: unreactive 1-heptanol and eutectic Sn/Pb solder, which is known to react with copper. We show experimentally that the flow of both liquids in these grooves follows the classical Washburn kinetics, i.e., a Poiseuille flow process, modified to include a dynamic contact angle. Because no subsidiary processes are necessary to fit our data, we propose that in this geometry capillary driven solder flow is too rapid for reaction to provide an appreciable effect. Thus, to observe the effects of Sn/Cu reaction kinetics, the flow rate must be decreased, which the present experiments allow through redesign of the groove geometry and size. 16 refs., 4 figs.

  1. Character and origin of Phobos’ grooves

    NASA Astrophysics Data System (ADS)

    Murray, J. B.; Heggie, D. C.

    2014-11-01

    Phobos’ parallel grooves, which are such a striking feature of its surface, have attracted interest since their discovery on Viking images in 1976 (Veverka and Duxbury, 1977. J. Geophys. Res. 82, 4213-4223.), but their origin is still in dispute today. The great increase in knowledge of Phobos’ surface features effected by images from the High Resolution Stereo Camera (HRSC) onboard the E.S.A. Mars Express spacecraft has clearly demonstrated that only one hypothesis can seriously be upheld: that the grooves are chains of secondary impacts resulting from primary impact events on Mars (Murray and Iliffe, 2011. Martian Geomorphology. Geological Society, London, Special Publications, 356, 21-41. DOI: 10.1144/SP356.3). But even this hypothesis has recently been questioned from a ballistic standpoint (Ramsley and Head, 2014. Planet. Space Sci. 75, 69-95.) mainly using estimated data for the grooves themselves. In the present paper we present summaries of extensive new measurements of groove sizes, pit separations, groove family parameters and geographical distribution. We also re-examine their unique characteristics, and present a review of past ideas. But we concentrate on extending and refining the work of Ramsley & Head using the new measurements, and the much-improved geodetic data from Mars Express (Willner et al., 2014. Planet. Space Sci. (2014)). We find that the total mass of Mars ejecta required to form all the observed grooves on Phobos is between 2.0×109 and 2.7×1010 kg, and that the total mass of impact ejecta from all Mars craters between 19 and 384 km diameter likely to hit Phobos (in its present orbit) at sufficient velocity to form all the grooves is one or two orders of magnitude greater than this. The larger available ejecta mass from Mars is due to several factors, including the fact that Phobos is known to have orbited Mars at a greater distance at the time when the grooves were formed. A new rigorous celestial mechanical analysis of the

  2. Dissecting the active site of a photoreceptor protein

    NASA Astrophysics Data System (ADS)

    Hoff, Wouter; Hara, Miwa; Ren, Jie; Moghadam, Farzaneh; Xie, Aihua; Kumauchi, Masato

    While enzymes are quite large molecules, functionally important chemical events are often limited to a small region of the protein: the active site. The physical and chemical properties of residues at such active sites are often strongly altered compared to the same groups dissolved in water. Understanding such effects is important for unraveling the mechanisms underlying protein function and for protein engineering, but has proven challenging. Here we report on our ongoing efforts on using photoactive yellow protein (PYP), a bacterial photoreceptor, as a model system for such effects. We will report on the following questions: How many residues affect active site properties? Are these residues in direct physical contact with the active site? Can functionally important residues be recognized in the crystal structure of a protein? What structural resolution is needed to understand active sites? What spectroscopic techniques are most informative? Which weak interactions dominate active site properties?

  3. Aerodynamics of a golf ball with grooves

    NASA Astrophysics Data System (ADS)

    Kim, Jooha; Son, Kwangmin; Choi, Haecheon

    2009-11-01

    It is well known that the drag on a dimpled ball is much lower than that on smooth ball. Choi et al. (Phys. Fluids, 2006) showed that turbulence is generated through the instability of shear layer separating from the edge of dimples and delays flow separation. Based on this mechanism, we devise a new golf ball with grooves on the surface but without any dimples. To investigate the aerodynamic performance of this new golf ball, an experiment is conducted in a wind tunnel at the Reynolds numbers of 0.5 x10^5 - 2.7 x10^5 and the spin ratios (ratio of surface velocity to the free-stream velocity) of α=0 - 0.5, which are within the ranges of real golf-ball velocity and spin rate. We measure the drag and lift forces on the grooved ball and compare them with those of smooth ball. At zero spin, the drag coefficient on the grooved ball shows a rapid fall-off at a critical Reynolds number and maintains a minimum value which is lower by 50% than that on smooth ball. At non-zero α, the drag coefficient on the grooved ball increases with increasing α, but is still lower by 40% than that on smooth ball. The lift coefficient on the grooved ball increases with increasing α, and is 100% larger than that on smooth ball. The aerodynamic characteristics of grooved ball is in general quite similar to that of dimpled ball. Some more details will be discussed in the presentation.

  4. The origin of the grooves on Phobos

    NASA Technical Reports Server (NTRS)

    Thomas, P. C.; Veverka, J.; Duxbury, T.

    1977-01-01

    Various theories for the long, linear depressions on the surface of Phobos are reviewed. Imagery from Viking Orbiters is used to map the surface distribution of the grooves, study their morphology, and date them by means of the density of superimposed impact craters. Data is presented which tends to support the hypothesis that the deep-seated fracturing was caused by a large, nearly catastrophic cratering event. It is suggested that the grooves were produced during the creation of the Stickney crater, rather than as the result of tidal stresses induced by Mars or by drag forces during the hypothetical capture of the satellite by Mars.

  5. Optimization of non-ATP competitive CDK/cyclin groove Inhibitors through REPLACE mediated Fragment Assembly

    PubMed Central

    Liu, Shu; Premnath, Padmavathy Nandha; Bolger, Joshua K.; Perkins, Tracy; Kirkland, Lindsay O.; Kontopidis, George; McInnes, Campbell

    2013-01-01

    A major challenge in drug discovery is to develop and improve methods for targeting protein-protein interactions. Further exemplification of the REPLACE strategy for generating inhibitors of protein-protein interactions demonstrated that it can be used to optimize fragment alternatives of key determinants, to combine these in an effective way and was achieved for compounds targeting the CDK2 substrate recruitment site on the cyclin regulatory subunit. Phenylheterocyclic isosteres replacing a critical charge-charge interaction provided new structural insights for binding to the cyclin groove. In particular, these results shed light onto the key contributions of a H-bond observed in crystal structures of N-terminally capped peptides. Furthermore the structure-activity relationship of a bisarylether C-terminal capping group mimicking dipeptide interactions, was probed through ring substitutions, allowing increased complementarity with the primary hydrophobic pocket. This study further validates REPLACE as an effective strategy for converting peptidic compounds to more pharmaceutically relevant compounds. PMID:23323521

  6. Mars Surveyor Project Landing Site Activities

    NASA Technical Reports Server (NTRS)

    Gulick, Virginia C.; Briggs, Geoffrey; Saunders, R. Stephen; Gilmore, Martha; Soderblom, Larry

    1999-01-01

    The Mars Surveyor Program --now a cooperative program led by NASA and CNES along with other international partners -- is underway. It has the primary science objective of furthering our understanding of the biological potential and possible biological history of Mars and has the complementary objective of improving our understanding of martian climate evolution and planetary history The missions will develop technology and acquire data necessary for eventual human Exploration. Launches of orbiters, landers and rovers will take place in 2001 and in 2003; in 2005 a complete system will be launched capable of returning samples to Earth by 2008. A key aspect of the program is the selection of landing sites. This abstract 1) reports on the status of the landing site selection process that begins with the 2001 lander mission and 2) outlines be opportunities for the Mars community to provide input into the landing site selection process.

  7. Mars Surveyor Project Landing Site Activities

    NASA Technical Reports Server (NTRS)

    Gulick, V. C.; Briggs, Geoffrey; Saunders, R. Stephen; Gilmore, Martha; Soderblom, Larry

    1999-01-01

    The Mars Surveyor Program -- now a cooperative program led by NASA and CNES along with other international partners -- is underway. It has the primary science objective of furthering our understanding of the biological potential and possible biological history of Mars and has the complementary objective of improving our understanding of martian climate evolution and planetary history. The missions will develop technology and acquire data necessary for eventual human exploration. Launches of orbiters, landers and rovers will take place in 2001 and in 2003; in 2005 a complete system will be launched capable of returning samples to Earth by 2008. A key aspect of the program is the selection of landing sites. This abstract 1) reports on the status of the landing site selection process that begins with the 2001 lander mission and 2) outlines the opportunities for the Mars community to provide input into the landing site selection process.

  8. The bifunctional active site of s-adenosylmethionine synthetase. Roles of the active site aspartates.

    PubMed

    Taylor, J C; Markham, G D

    1999-11-12

    S-Adenosylmethionine (AdoMet) synthetase catalyzes the biosynthesis of AdoMet in a unique enzymatic reaction. Initially the sulfur of methionine displaces the intact tripolyphosphate chain (PPP(i)) from ATP, and subsequently PPP(i) is hydrolyzed to PP(i) and P(i) before product release. The crystal structure of Escherichia coli AdoMet synthetase shows that the active site contains four aspartate residues. Aspartate residues Asp-16* and Asp-271 individually provide the sole protein ligand to one of the two required Mg(2+) ions (* denotes a residue from a second subunit); aspartates Asp-118 and Asp-238* are proposed to interact with methionine. Each aspartate has been changed to an uncharged asparagine, and the metal binding residues were also changed to alanine, to assess the roles of charge and ligation ability on catalytic efficiency. The resultant enzyme variants all structurally resemble the wild type enzyme as indicated by circular dichroism spectra and are tetramers. However, all have k(cat) reductions of approximately 10(3)-fold in AdoMet synthesis, whereas the MgATP and methionine K(m) values change by less than 3- and 8-fold, respectively. In the partial reaction of PPP(i) hydrolysis, mutants of the Mg(2+) binding residues have >700-fold reduced catalytic efficiency (k(cat)/K(m)), whereas the D118N and D238*N mutants are impaired less than 35-fold. The catalytic efficiency for PPP(i) hydrolysis by Mg(2+) site mutants is improved by AdoMet, like the wild type enzyme. In contrast AdoMet reduces the catalytic efficiency for PPP(i) hydrolysis by the D118N and D238*N mutants, indicating that the events involved in AdoMet activation are hindered in these methionyl binding site mutants. Ca(2+) uniquely activates the D271A mutant enzyme to 15% of the level of Mg(2+), in contrast to the approximately 1% Ca(2+) activation of the wild type enzyme. This indicates that the Asp-271 side chain size is a discriminator between the activating ability of Ca(2+) and the

  9. Spiral groove seal. [for hydraulic rotating shaft

    NASA Technical Reports Server (NTRS)

    Ludwig, L. P. (Inventor)

    1973-01-01

    Mating flat surfaces inhibit leakage of a fluid around a stationary shaft. A spiral groove pattern produces a pumping action toward the fluid when the shaft rotates which prevents leakage while a generated hydraulic lifting force separates the mating surfaces to minimize wear.

  10. The active site of ribulose-bisphosphate carboxylase/oxygenase

    SciTech Connect

    Hartman, F.C.

    1991-01-01

    The active site of ribulose-bisphosphate carboxylase/oxygenase requires interacting domains of adjacent, identical subunits. Most active-site residues are located within the loop regions of an eight-stranded {beta}/{alpha}-barrel which constitutes the larger C-terminal domain; additional key residues are located within a segment of the smaller N-terminal domain which partially covers the mouth of the barrel. Site-directed mutagenesis of the gene encoding the enzyme from Rhodospirillum rubrum has been used to delineate functions of active-site residues. 6 refs., 2 figs.

  11. A novel p38 MAPK docking groove-targeted compound is a potent inhibitor of inflammatory hyperalgesia

    PubMed Central

    Willemen, Hanneke L.D.M.; Campos, Pedro M.; Lucas, Elisa; Morreale, Antonio; Gil-Redondo, Rubén; Agut, Juan; González, Florenci V.; Ramos, Paula; Heijnen, Cobi; Mayor, Federico; Kavelaars, Annemieke; Murga, Cristina

    2014-01-01

    Synopsis The mitogen activated protein kinase (MAPK) p38 is an important mediator of inflammation and of inflammatory and neuropathic pain. We recently described that docking-groove dependent interactions are important for p38 MAPK-mediated signal transduction. Thus, virtual screening was performed to identify putative docking groove-targeted p38 MAPK inhibitors. Several compounds of the benzooxadiazol family were identified with low micromolar inhibitory activity both in a p38 MAPK activity assay, and in THP-1 human monocytes acting as inhibitors of LPS-induced TNFα secretion. Positions 2 and 5 in the phenyl ring are essential for the described inhibitory activity with a chloride in position 5 and a methyl-group in position 2 yielding the best results with an IC50 of 1.8 μM (FGA-19 compound). Notably, FGA-19 exerted a potent and long-lasting analgesic effect in vivo when tested in a mouse model of inflammatory hyperalgesia. A single intrathecal injection of FGA-19 completely resolved hyperalgesia, being ten times as potent and displaying longer lasting effects than the established p38 MAPK inhibitor SB239063. FGA-19 also reversed persistent pain in a model of post-inflammatory hyperalgesia (in LysM-GRK2+/− mice). These potent in vivo effects put forward p38 MAPK docking-site targeted inhibitors as a potential novel strategy for the treatment of inflammatory pain. PMID:24517375

  12. A study on the flexibility of enzyme active sites

    PubMed Central

    2011-01-01

    Background A common assumption about enzyme active sites is that their structures are highly conserved to specifically distinguish between closely similar compounds. However, with the discovery of distinct enzymes with similar reaction chemistries, more and more studies discussing the structural flexibility of the active site have been conducted. Results Most of the existing works on the flexibility of active sites focuses on a set of pre-selected active sites that were already known to be flexible. This study, on the other hand, proposes an analysis framework composed of a new data collecting strategy, a local structure alignment tool and several physicochemical measures derived from the alignments. The method proposed to identify flexible active sites is highly automated and robust so that more extensive studies will be feasible in the future. The experimental results show the proposed method is (a) consistent with previous works based on manually identified flexible active sites and (b) capable of identifying potentially new flexible active sites. Conclusions This proposed analysis framework and the former analyses on flexibility have their own advantages and disadvantage, depending on the cause of the flexibility. In this regard, this study proposes an alternative that complements previous studies and helps to construct a more comprehensive view of the flexibility of enzyme active sites. PMID:21342563

  13. Safety Oversight of Decommissioning Activities at DOE Nuclear Sites

    SciTech Connect

    Zull, Lawrence M.; Yeniscavich, William

    2008-01-15

    The Defense Nuclear Facilities Safety Board (Board) is an independent federal agency established by Congress in 1988 to provide nuclear safety oversight of activities at U.S. Department of Energy (DOE) defense nuclear facilities. The activities under the Board's jurisdiction include the design, construction, startup, operation, and decommissioning of defense nuclear facilities at DOE sites. This paper reviews the Board's safety oversight of decommissioning activities at DOE sites, identifies the safety problems observed, and discusses Board initiatives to improve the safety of decommissioning activities at DOE sites. The decommissioning of former defense nuclear facilities has reduced the risk of radioactive material contamination and exposure to the public and site workers. In general, efforts to perform decommissioning work at DOE defense nuclear sites have been successful, and contractors performing decommissioning work have a good safety record. Decommissioning activities have recently been completed at sites identified for closure, including the Rocky Flats Environmental Technology Site, the Fernald Closure Project, and the Miamisburg Closure Project (the Mound site). The Rocky Flats and Fernald sites, which produced plutonium parts and uranium materials for defense needs (respectively), have been turned into wildlife refuges. The Mound site, which performed R and D activities on nuclear materials, has been converted into an industrial and technology park called the Mound Advanced Technology Center. The DOE Office of Legacy Management is responsible for the long term stewardship of these former EM sites. The Board has reviewed many decommissioning activities, and noted that there are valuable lessons learned that can benefit both DOE and the contractor. As part of its ongoing safety oversight responsibilities, the Board and its staff will continue to review the safety of DOE and contractor decommissioning activities at DOE defense nuclear sites.

  14. DOE site performance assessment activities. Radioactive Waste Technical Support Program

    SciTech Connect

    Not Available

    1990-07-01

    Information on performance assessment capabilities and activities was collected from eight DOE sites. All eight sites either currently dispose of low-level radioactive waste (LLW) or plan to dispose of LLW in the near future. A survey questionnaire was developed and sent to key individuals involved in DOE Order 5820.2A performance assessment activities at each site. The sites surveyed included: Hanford Site (Hanford), Idaho National Engineering Laboratory (INEL), Los Alamos National Laboratory (LANL), Nevada Test Site (NTS), Oak Ridge National Laboratory (ORNL), Paducah Gaseous Diffusion Plant (Paducah), Portsmouth Gaseous Diffusion Plant (Portsmouth), and Savannah River Site (SRS). The questionnaire addressed all aspects of the performance assessment process; from waste source term to dose conversion factors. This report presents the information developed from the site questionnaire and provides a comparison of site-specific performance assessment approaches, data needs, and ongoing and planned activities. All sites are engaged in completing the radioactive waste disposal facility performance assessment required by DOE Order 5820.2A. Each site has achieved various degrees of progress and have identified a set of critical needs. Within several areas, however, the sites identified common needs and questions.

  15. Savannah River Site prioritization of transition activities

    SciTech Connect

    Finley, R.H.

    1993-11-01

    Effective management of SRS conversion from primarily a production facility to other missions (or Decontamination and Decommissioning (D&D)) requires a systematic and consistent method of prioritizing the transition activities. This report discusses the design of a prioritizing method developed to achieve systematic and consistent methods of prioritizing these activities.

  16. Ionizable Side Chains at Catalytic Active Sites of Enzymes

    PubMed Central

    Jimenez-Morales, David; Liang, Jie

    2012-01-01

    Catalytic active sites of enzymes of known structure can be well defined by a modern program of computational geometry. The CASTp program was used to define and measure the volume of the catalytic active sites of 573 enzymes in the Catalytic Site Atlas database. The active sites are identified as catalytic because the amino acids they contain are known to participate in the chemical reaction catalyzed by the enzyme. Acid and base side chains are reliable markers of catalytic active sites. The catalytic active sites have 4 acid and 5 base side chains, in an average volume of 1072 Å3. The number density of acid side chains is 8.3 M (in chemical units); the number density of basic side chains is 10.6 M. The catalytic active site of these enzymes is an unusual electrostatic and steric environment in which side chains and reactants are crowded together in a mixture more like an ionic liquid than an ideal infinitely dilute solution. The electrostatics and crowding of reactants and side chains seems likely to be important for catalytic function. In three types of analogous ion channels, simulation of crowded charges accounts for the main properties of selectivity measured in a wide range of solutions and concentrations. It seems wise to use mathematics designed to study interacting complex fluids when making models of the catalytic active sites of enzymes. PMID:22484856

  17. Coupling interaction of electromagnetic wave in a groove doublet configuration.

    PubMed

    Ding, Lan; Liu, Jinsong; Wang, Dong; Wang, Kejia

    2010-09-27

    Based on the waveguide mode (WGM) method, coupling interaction of electromagnetic wave in a groove doublet configuration is studied. The formulation obtained by WGM method for a single groove [Prog. Electromagn. Res. 18, 1-17 (1998)] is extended to two grooves. By exploring the total scattered field of the configuration, coupling interaction ratios are defined to describe the interaction between grooves quantitatively. Since each groove in this groove doublet configuration is regarded as the basic unit, the effects of coupling interaction on the scattered fields of each groove can be investigated respectively. Numerical results show that an oscillatory behavior of coupling interaction is damped with increasing groove spacing. The incident and scattering angle dependence of coupling interaction is symmetrical when the two grooves are the same. For the case of two subwavelength grooves, the coupling interaction is not sensitive to the incident angle and scattering angle. Although the case of two grooves is discussed for simplicity, the formulation developed in this article can be generalized to arbitrary number of grooves. Moreover, our study offers a simple alternative to investigate and design metallic gratings, compact directional antennas, couplers, and other devices especially in low frequency regime such as THz and microwave domain. PMID:20941004

  18. Design of a G[center dot]C-specific DNA minor groove-binding peptide

    SciTech Connect

    Geierstanger, B.H.; Wemmer, D.E. ); Mrksich, M.; Dervan, P.B. )

    1994-10-28

    A four-ring tripeptide containing alternating imidazole and pyrrole carboxamides specifically binds six-base pair 5[prime]-(A,T)GCGC(A,T)-3[prime] sites in the minor groove of DNA. The designed peptide has a specificity completely reversed from that of the tripyrrole distamycin, which binds A,T sequences. Structural studies with nuclear magnetic resonance revealed that two peptides bound side-by-side and in an antiparallel orientation in the minor groove. Each of the four imidazoles in the 2:1 ligand-DNA complex recognized a specific guanine amino group in the GCGC core through a hydrogen bond. Targeting a designated four-base pair G[center dot]C tract by this synthetic ligand supports the generality of the 2:1 peptide-DNA motif for sequence-specific minor groove recognition of DNA. 24 refs., 4 figs., 1 tab.

  19. Active Sites Environmental Monitoring Program FY 1996 annual report

    SciTech Connect

    Morrissey, C.M.; Marshall, D.S.; Cunningham, G.R.

    1997-11-01

    This report summarizes the activities of the Active Sites Environmental Monitoring Program (ASEMP) from October 1995 through September 1996. The Radioactive Solid Waste Operations Group (RSWOG) of the Waste Management and Remedial Action Division (WMRAD) and the Environmental Sciences Division (ESD) at Oak Ridge National Laboratory (ORNL) established ASEMP in 1989. The purpose of the program is to provide early detection and performance monitoring at active low-level waste (LLW) disposal sites in Solid Waste Storage Area (SWSA) 6 and transuranic (TRU) waste storage sites in SWSA 5 North as required by Chapters 2 and 3 of US Department of Energy Order 5820.2A.

  20. Active sites environmental monitoring Program - Program Plan: Revision 2

    SciTech Connect

    Morrissey, C.M.; Hicks, D.S.; Ashwood, T.L.; Cunningham, G.R.

    1994-05-01

    The Active Sites Environmental Monitoring Program (ASEMP), initiated in 1989, provides early detection and performance monitoring of active low-level-waste (LLW) and transuranic (TRU) waste facilities at Oak Ridge National Laboratory (ORNL). Several changes have recently occurred in regard to the sites that are currently used for waste storage and disposal. These changes require a second set of revisions to the ASEMP program plan. This document incorporates those revisions. This program plan presents the organization and procedures for monitoring the active sites. The program plan also provides internal reporting levels to guide the evaluation of monitoring results.

  1. U-groove aluminum weld strength improvement

    NASA Technical Reports Server (NTRS)

    Verderaime, V.; Vaughan, R.

    1995-01-01

    Though butt-welds are among the most preferred joining methods in aerostructures, their strength dependence on inelastic mechanics is generally the least understood. This study investigated experimental strain distributions across a thick aluminum U-grooved weld and identified two weld process considerations for improving the multipass weld strength. The extreme thermal expansion and contraction gradient of the fusion heat input across the groove tab thickness produces severe peaking which induces bending under uniaxial loading. The filler strain-hardening deceased with increasing filler pass sequence, producing the weakest welds on the last pass side. Current welding schedules unknowingly compound these effects which reduce the weld strength. A de-peaking index model was developed to select filler pass thicknesses, pass numbers, and sequences to improve de-peaking in the welding process. Intent is to combine the strongest weld pass side with the peaking induced bending tension to provide a more uniform stress and stronger weld under axial tensile loading.

  2. U-Groove aluminum weld strength improvement

    NASA Technical Reports Server (NTRS)

    Verderaime, V.; Vaughan, R.

    1996-01-01

    Though butt-welds are among the most preferred joining methods in aerostructures, their strength dependence on inelastic mechanics is generally the least understood. This study investigated experimental strain distributions across a thick aluminum U-grooved weld and identified two weld process considerations for improving the multipass weld strength. The extreme thermal expansion and contraction gradient of the fusion heat input across the groove tab thickness produces severe peaking, which induces bending under uniaxial loading. The filler strain-hardening decreased with increasing filler pass sequence, producing the weakest welds on the last pass side. Current welding schedules unknowingly compound these effects which reduce the weld strength. A depeaking index model was developed to select filler pass thicknesses, pass numbers, and sequences to improve depeaking in the welding process. The intent is to combine the strongest weld pass side with the peaking induced bending tension to provide a more uniform stress and stronger weld under axial tensile loading.

  3. Diamond grooving of rapidly solidified optical aluminium

    NASA Astrophysics Data System (ADS)

    Abou-El-Hossein, Khaled; Hsu, Wei-Yao; Ghobashy, Sameh; Cheng, Yuan-Chieh; Mkoko, Zwelinzima

    2015-10-01

    Traditional optical aluminium grades such as Al 6061 are intensively used for making optical components for applications ranging from mould insert fabrication to laser machine making. However, because of their irregular microstructure and relative inhomogeneity of material properties at micro scale, traditional optical aluminium may exhibit some difficulties when ultra-high precision diamond turned. Inhomogeneity and micro-variation in the material properties combined with uneven and coarse microstructure may cause unacceptable surface finish and accelerated tool wear, especially in grooving operation when the diamond tool edge is fully immersed in the material surface. Recently, new grades of optical aluminium that are featured by their ultra-fine microstructure and improved material properties have been developed to overcome the problem of high tool wear rates. The new aluminium grades have been developed using rapid solidification process which results in extremely small grain sizes combined with improved mechanical properties. The current study is concerned with investigating the performance of single-point diamond turning when grooving two grades of rapidly solidified aluminium (RSA) grades: RSA905 which is a high-alloyed aluminium grade and RSA443 which has a high silicon content. In this study, two series of experiments employed to create radial microgrooves on the two RSA grades. The surface roughness obtained on the groove surface is measured when different combinations of cutting parameters are used. Cutting speed is varied while feed rate and depth of cut were kept constant. The results show that groove surface roughness produced on RSA443 is higher than that obtained on RSA905. Also, the paper reports on the effect of cutting speed on surface roughness for each RSA grade.

  4. Grooved Terrain on Ganymede: First Results from Galileo High-Resolution Imaging

    USGS Publications Warehouse

    Pappalardo, R.T.; Head, J.W.; Collins, G.C.; Kirk, R.L.; Neukum, G.; Oberst, J.; Giese, B.; Greeley, R.; Chapman, C.R.; Helfenstein, P.; Moore, Johnnie N.; McEwen, A.; Tufts, B.R.; Senske, D.A.; Herbert, Breneman H.; Klaasen, K.

    1998-01-01

    High-resolution Galileo imaging has provided important insight into the origin and evolution of grooved terrain on Ganymede. The Uruk Sulcus target site was the first imaged at high resolution, and considerations of resolution, viewing geometry, low image compression, and complementary stereo imaging make this region extremely informative. Contrast variations in these low-incidence angle images are extreme and give the visual impression of topographic shading. However, photometric analysis shows that the scene must owe its character to albedo variations. A close correlation of albedo variations to topography is demonstrated by limited stereo coverage, allowing extrapolation of the observed brightness and topographic relationships to the rest of the imaged area. Distinct geological units are apparent across the region, and ridges and grooves are ubiquitous within these units. The stratigraphically lowest and most heavily cratered units ("lineated grooved terrain") generally show morphologies indicative of horst-and-graben-style normal faulting. The stratigraphically highest groove lanes ("parallel ridged terrain") exhibit ridges of roughly triangular cross section, suggesting that tilt-block-style normal faulting has shaped them. These extensional-tectonic models are supported by crosscutting relationships at the margins of groove lanes. Thus, a change in tectonic style with time is suggested in the Uruk Sulcus region, varying from horst and graben faulting for the oldest grooved terrain units to tilt block normal faulting for the latest units. The morphologies and geometries of some stratigraphically high units indicate that a strike-slip component of deformation has played an important role in shaping this region of grooved terrain. The most recent tectonic episode is interpreted as right-lateral transtension, with its tectonic pattern of two contemporaneous structural orientations superimposed on older units of grooved terrain. There is little direct evidence for

  5. Directional Movement of Droplets in Grooves: Suspended or Immersed?

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Lan, Zhong; Peng, Benli; Wen, Rongfu; Chen, Yansong; Ma, Xuehu

    2016-01-01

    The behavior of droplets trapped in geometric structures is essential to droplet manipulation applications such as for droplet transport. Here we show that directional droplet movement can be realized by a V-shaped groove with the movement direction controlled by adjusting the surface wettability of the groove inner wall and the cross sectional angle of the groove. Experiments and analyses show that a droplet in a superhydrophobic groove translates from the immersed state to the suspended state as the cross sectional angle of the groove decreases and the suspended droplet departs from the groove bottom as the droplet volume increases. We also demonstrate that this simple grooved structure can be used to separate a water-oil mixture and generate droplets with the desired sizes. The structural effect actuated droplet movements provide a controllable droplet transport method which can be used in a wide range of droplet manipulation applications.

  6. Directional Movement of Droplets in Grooves: Suspended or Immersed?

    PubMed Central

    Xu, Wei; Lan, Zhong; Peng, Benli; Wen, Rongfu; Chen, Yansong; Ma, Xuehu

    2016-01-01

    The behavior of droplets trapped in geometric structures is essential to droplet manipulation applications such as for droplet transport. Here we show that directional droplet movement can be realized by a V-shaped groove with the movement direction controlled by adjusting the surface wettability of the groove inner wall and the cross sectional angle of the groove. Experiments and analyses show that a droplet in a superhydrophobic groove translates from the immersed state to the suspended state as the cross sectional angle of the groove decreases and the suspended droplet departs from the groove bottom as the droplet volume increases. We also demonstrate that this simple grooved structure can be used to separate a water-oil mixture and generate droplets with the desired sizes. The structural effect actuated droplet movements provide a controllable droplet transport method which can be used in a wide range of droplet manipulation applications. PMID:26743167

  7. Flow of liquids in surface grooves

    SciTech Connect

    Rye, R.R.; Yost, F.G.; Mann, J.A. Jr.

    1996-01-24

    We have obtained detailed capillary kinetic data for flow of a series of alcohols with various surface tension to viscosity ratios, {gamma}/{mu}, spreading in open V-shaped grooves cut in Cu with three different groove angles. Two theoretical models which assume Poiseuille flow and static advancing contact angles were tested against the experimental data. One is a detailed hydrodynamic model with the basic driving force resulting from the pressure drop across a curved interface. The second depends on the total interfacial energy change, independent of the shape of the liquid interface. Both agree with the experimental data. Both predict numerical values in general agreement with experiment and with each other. In the threshold region where the transition occurs between filled and empty regions of the groove, the liquid height decreases linearly with distance, within experimental limitations, and forms an angle which roughly scales as the contact angle for a significant fraction of the threshold region. On the basis of the present detailed experimental data for both kinetics and threshold profile, the differences between experiment and theory and between the theoretical models are insufficient to allow a clear choice between the models. 20 refs., 11 figs., 3 tabs.

  8. The active site behaviour of electrochemically synthesised gold nanomaterials.

    PubMed

    Plowman, Blake J; O'Mullane, Anthony P; Bhargava, Suresh K

    2011-01-01

    Even though gold is the noblest of metals, a weak chemisorber and is regarded as being quite inert, it demonstrates significant electrocatalytic activity in its nanostructured form. It is demonstrated here that nanostructured and even evaporated thin films of gold are covered with active sites which are responsible for such activity. The identification of these sites is demonstrated with conventional electrochemical techniques such as cyclic voltammetry as well as a large amplitude Fourier transformed alternating current (FT-ac) method under acidic and alkaline conditions. The latter technique is beneficial in determining if an electrode process is either Faradaic or capacitive in nature. The observed behaviour is analogous to that observed for activated gold electrodes whose surfaces have been severely disrupted by cathodic polarisation in the hydrogen evolution region. It is shown that significant electrochemical oxidation responses occur at discrete potential values well below that for the formation of the compact monolayer oxide of bulk gold and are attributed to the facile oxidation of surface active sites. Several electrocatalytic reactions are explored in which the onset potential is determined by the presence of such sites on the surface. Significantly, the facile oxidation of active sites is used to drive the electroless deposition of metals such as platinum, palladium and silver from their aqueous salts on the surface of gold nanostructures. The resultant surface decoration of gold with secondary metal nanoparticles not only indicates regions on the surface which are rich in active sites but also provides a method to form interesting bimetallic surfaces. PMID:22455038

  9. Nicotinamide Cofactors Suppress Active-Site Labeling of Aldehyde Dehydrogenases.

    PubMed

    Stiti, Naim; Chandrasekar, Balakumaran; Strubl, Laura; Mohammed, Shabaz; Bartels, Dorothea; van der Hoorn, Renier A L

    2016-06-17

    Active site labeling by (re)activity-based probes is a powerful chemical proteomic tool to globally map active sites in native proteomes without using substrates. Active site labeling is usually taken as a readout for the active state of the enzyme because labeling reflects the availability and reactivity of active sites, which are hallmarks for enzyme activities. Here, we show that this relationship holds tightly, but we also reveal an important exception to this rule. Labeling of Arabidopsis ALDH3H1 with a chloroacetamide probe occurs at the catalytic Cys, and labeling is suppressed upon nitrosylation and oxidation, and upon treatment with other Cys modifiers. These experiments display a consistent and strong correlation between active site labeling and enzymatic activity. Surprisingly, however, labeling is suppressed by the cofactor NAD(+), and this property is shared with other members of the ALDH superfamily and also detected for unrelated GAPDH enzymes with an unrelated hydantoin-based probe in crude extracts of plant cell cultures. Suppression requires cofactor binding to its binding pocket. Labeling is also suppressed by ALDH modulators that bind at the substrate entrance tunnel, confirming that labeling occurs through the substrate-binding cavity. Our data indicate that cofactor binding adjusts the catalytic Cys into a conformation that reduces the reactivity toward chloroacetamide probes. PMID:26990764

  10. Active site - a site of binding of affinity inhibitors in baker's yeast inorganic pyrophosphatase

    SciTech Connect

    Svyato, I.E.; Sklyankina, V.A.; Avaeva, S.M.

    1986-03-20

    The interaction of the enzyme-substrate complex with methyl phosphate, O-phosphoethanolamine, O-phosphopropanolamine, N-acetylphosphoserine, and phosphoglyolic acid, as well as pyrophosphatase, modified by monoesters of phosphoric acid, with pyrophosphate and tripolyphosphate, was investigated. It was shown that the enzyme containing the substrate in the active site does not react with monophosphates, but modified pyrophosphatase entirely retains the ability to bind polyanions to the regulatory site. It is concluded that the inactivation of baker's yeast inorganic pyrophosphatase by monoesters of phosphoric acid, which are affinity inhibitors of it, is the result of modification of the active site of the enzyme.

  11. A small ribozyme with dual-site kinase activity

    PubMed Central

    Biondi, Elisa; Maxwell, Adam W.R.; Burke, Donald H.

    2012-01-01

    Phosphoryl transfer onto backbone hydroxyls is a recognized catalytic activity of nucleic acids. We find that kinase ribozyme K28 possesses an unusually complex active site that promotes (thio)phosphorylation of two residues widely separated in primary sequence. After allowing the ribozyme to radiolabel itself by phosphoryl transfer from [γ-32P]GTP, DNAzyme-mediated cleavage yielded two radiolabeled cleavage fragments, indicating phosphorylation sites within each of the two cleavage fragments. These sites were mapped by alkaline digestion and primer extension pausing. Enzymatic digestion and mutational analysis identified nucleotides important for activity and established the active structure as being a constrained pseudoknot with unusual connectivity that may juxtapose the two reactive sites. Nuclease sensitivities for nucleotides near the pseudoknot core were altered in the presence of GTPγS, indicating donor-induced folding. The 5′ target site was more strongly favored in full-length ribozyme K28 (128 nt) than in truncated RNAs (58 nt). Electrophoretic mobilities of self-thiophosphorylated products on organomercurial gels are distinct from the 5′ mono-thiophosphorylated product produced by reaction with polynucleotide kinase, potentially indicating simultaneous labeling of both sites within individual RNA strands. Our evidence supports a single, compact structure with local dynamics, rather than global rearrangement, as being responsible for dual-site phosphorylation. PMID:22618879

  12. Modulation of cell attachment and collagen production of anterior cruciate ligament cells via submicron grooves/ridges structures with different cell affinity.

    PubMed

    Wang, Peng-Yuan; Wu, Tsung-Han; Chao, Pen-Hsiu Grace; Kuo, Wei-Hsuan; Wang, Meng-Jiy; Hsu, Cheng-Che; Tsai, Wei-Bor

    2013-01-01

    This study aimed to investigate the effects of submicron-grooved topography and surface cell affinity on the attachment, proliferation and collagen synthesis of anterior cruciate ligament (ACL) cells. Two grooved polystyrene (PS) surfaces (equal groove/ridge width of 800 nm) with a groove depth of 100 or 700 nm were fabricated and modified by oxygen plasma treatment, dopamine deposition and conjugation of RGD-containing peptides to enhance cell affinity. The elongation and alignment of ACL cells was enhanced by grooved structures with increasing groove depths regardless of surface chemistry. On the other hand, cell spreading and proliferation mainly depended on surface chemistry, in accordance with surface cell affinity: O(2) plasma < dopamine deposition < RGD conjugation. The synthesis of type I collagen was the highest by the ACL cells cultured on the 700 nm grooved surface conjugated with RGD peptides, indicating that both surface grooved topography and chemistry play a role in modulating collagen production of ACL cells. Furthermore, the type I collagen deposited on the 700 nm PS surface was aligned with grooves/ridges. Our results indicated that both ligand presentation and cell alignment are important in the physiological activities of ACL fibroblasts. Such information is critical for design of biomaterials for ACL tissue engineering. PMID:22833331

  13. Predictive binding geometry of ligands to DNA minor groove: isohelicity and hydrogen-bonding pattern.

    PubMed

    Stockert, Juan C

    2014-01-01

    The interaction of drugs and dyes with nucleic acids, particularly when binding to DNA minor groove occurs, has increasing importance in biomedical sciences. This is due to the resulting biological activity and to the possibility of recognizing AT and GC base pairs. In such cases, DNA binding can be predicted if appropriate helical and hydrogen-bonding parameters are deduced from DNA models, and a simplified geometrical rule in the form of a stencil is then applied on computer-drawn molecules of interest. Relevant structure parameter values for minor groove binders are the length (4.6 < L < 5.4 Å) and angle (152 < σ < 156.5°) between three consecutive units, measured at the level of hydrogen donor or acceptor groups. Application of the stencil shows that predictive methods can aid in the design of new compounds, by checking the possible binding of isohelical sequence-specific ligands along the DNA minor groove. PMID:24162975

  14. Dashboard applications to monitor experiment activities at sites

    NASA Astrophysics Data System (ADS)

    Andreeva, Julia; Belforte, Stefano; Boehm, Max; Casajus, Adrian; Flix, Josep; Gaidioz, Benjamin; Grigoras, Costin; Kokoszkiewicz, Lukasz; Lanciotti, Elisa; Rocha, Ricardo; Saiz, Pablo; Santinelli, Roberto; Sidorova, Irina; Sciabà, Andrea; Tsaregorodtsev, Andrei

    2010-04-01

    In the framework of a distributed computing environment, such as WLCG, monitoring has a key role in order to keep under control activities going on in sites located in different countries and involving people based in many different sites. To be able to cope with such a large scale heterogeneous infrastructure, it is necessary to have monitoring tools providing a complete and reliable view of the overall performance of the sites. Moreover, the structure of a monitoring system critically depends on the object to monitor and on the users it is addressed to. In this article we will describe two different monitoring systems both aimed to monitor activities and services provided in the WLCG framework, but designed in order to meet the requirements of different users: Site Status Board has an overall view of the services available in all the sites supporting an experiment, whereas Siteview provides a complete view of all the activities going on at a site, for all the experiments supported by the site.

  15. Architecture and active site of particulate methane monooxygenase

    PubMed Central

    Culpepper, Megen A.; Rosenzweig, Amy C.

    2012-01-01

    Particulate methane monooxygenase (pMMO) is an integral membrane metalloenzyme that oxidizes methane to methanol in methanotrophic bacteria, organisms that live on methane gas as their sole carbon source. Understanding pMMO function has important implications for bioremediation applications and for the development of new, environmentally friendly catalysts for the direct conversion of methane to methanol. Crystal structures of pMMOs from three different methanotrophs reveal a trimeric architecture, consisting of three copies each of the pmoB, pmoA, and pmoC subunits. There are three distinct metal centers in each protomer of the trimer, mononuclear and dinuclear copper sites in the periplasmic regions of pmoB and a mononuclear site within the membrane that can be occupied by copper or zinc. Various models for the pMMO active site have been proposed within these structural constraints, including dicopper, tricopper, and diiron centers. Biochemical and spectroscopic data on pMMO and recombinant soluble fragments, denoted spmoB proteins, indicate that the active site involves copper and is located at the site of the dicopper center in the pmoB subunit. Initial spectroscopic evidence for O2 binding at this site has been obtained. Despite these findings, questions remain about the active site identity and nuclearity and will be the focus of future studies. PMID:22725967

  16. Methanopyrus kandleri topoisomerase V contains three distinct AP lyase active sites in addition to the topoisomerase active site.

    PubMed

    Rajan, Rakhi; Osterman, Amy; Mondragón, Alfonso

    2016-04-20

    Topoisomerase V (Topo-V) is the only topoisomerase with both topoisomerase and DNA repair activities. The topoisomerase activity is conferred by a small alpha-helical domain, whereas the AP lyase activity is found in a region formed by 12 tandem helix-hairpin-helix ((HhH)2) domains. Although it was known that Topo-V has multiple repair sites, only one had been mapped. Here, we show that Topo-V has three AP lyase sites. The atomic structure and Small Angle X-ray Scattering studies of a 97 kDa fragment spanning the topoisomerase and 10 (HhH)2domains reveal that the (HhH)2domains extend away from the topoisomerase domain. A combination of biochemical and structural observations allow the mapping of the second repair site to the junction of the 9th and 10th (HhH)2domains. The second site is structurally similar to the first one and to the sites found in other AP lyases. The 3rd AP lyase site is located in the 12th (HhH)2domain. The results show that Topo-V is an unusual protein: it is the only known protein with more than one (HhH)2domain, the only known topoisomerase with dual activities and is also unique by having three AP lyase repair sites in the same polypeptide. PMID:26908655

  17. Methanopyrus kandleri topoisomerase V contains three distinct AP lyase active sites in addition to the topoisomerase active site

    PubMed Central

    Rajan, Rakhi; Osterman, Amy; Mondragón, Alfonso

    2016-01-01

    Topoisomerase V (Topo-V) is the only topoisomerase with both topoisomerase and DNA repair activities. The topoisomerase activity is conferred by a small alpha-helical domain, whereas the AP lyase activity is found in a region formed by 12 tandem helix-hairpin-helix ((HhH)2) domains. Although it was known that Topo-V has multiple repair sites, only one had been mapped. Here, we show that Topo-V has three AP lyase sites. The atomic structure and Small Angle X-ray Scattering studies of a 97 kDa fragment spanning the topoisomerase and 10 (HhH)2 domains reveal that the (HhH)2 domains extend away from the topoisomerase domain. A combination of biochemical and structural observations allow the mapping of the second repair site to the junction of the 9th and 10th (HhH)2 domains. The second site is structurally similar to the first one and to the sites found in other AP lyases. The 3rd AP lyase site is located in the 12th (HhH)2 domain. The results show that Topo-V is an unusual protein: it is the only known protein with more than one (HhH)2 domain, the only known topoisomerase with dual activities and is also unique by having three AP lyase repair sites in the same polypeptide. PMID:26908655

  18. Grooved Terrain in Nippur Sulcus on Ganymede

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Complex sets of ridges and grooves are visible in this image of the Nippur Sulcus region on Jupiter's largest moon Ganymede. NASA's Galileo spacecraft imaged this region as it passed Ganymede during its second orbit through the Jovian system. The Nippur Sulcus region is an example of Bright Terrain on Ganymede which is typified by multiple sets of ridges and grooves. The intersections of these sets reveal complex age relationships. North is to the top of the picture and the sun illuminates the surface from the southeast (lower right). In this image a younger sinuous northwest-southeast trending groove set cuts through and apparently destroys the older east-west trending features on the right of the image, allowing scientists to determine the sequence of events that led to the region's formation. The area contains many impact craters. The large crater in the bottom of the image is about 12 kilometers (8 miles) in diameter.

    The image, centered at 51 degrees latitude and 204 degrees longitude, covers an area approximately 79 kilometers (50 miles) by 57 kilometers (36 miles) across. The resolution is 93 meters (330 feet) per picture element. The images were taken on September 6, 1996 at a range of 9,971 kilometers (6,232 miles) by the solid state imaging (CCD) system on NASA's Galileo spacecraft.

    The Jet Propulsion Laboratory, Pasadena, CA manages the Galileo mission for NASA's Office of Space Science, Washington, DC. JPL is an operating division of California Institute of Technology (Caltech).

    This image and other images and data received from Galileo are posted on the World Wide Web, on the Galileo mission home page at URL http://galileo.jpl.nasa.gov.

  19. Optics of a single ultrasharp groove in metal.

    PubMed

    Søndergaard, Thomas; Bozhevolnyi, Sergey I

    2016-07-01

    Optical properties of a single ultrasharp groove of subwavelength width cut in an otherwise flat metal surface are examined theoretically. We calculate optical extinction, scattering, and absorption cross-section spectra for a wide range of groove profiles, establishing several fundamental trends. As grooves are made sharper, amplitudes of oscillations in cross-section spectra and their period decrease, while the absorption level increases, leading eventually to efficient broadband (nonresonant) absorption. Oscillations in scattering spectra are generally more pronounced than those in corresponding absorption spectra. For ultrasharp grooves, oscillations in all spectra can be suppressed by increasing the groove depth. Finally, the level of absorption relative to that of scattering increases as the top groove width decreases, a trend that is analogous to that found when decreasing the size of metal nanoparticles. PMID:27367061

  20. Grooved impactor and inertial trap for sampling inhalable particulate matter

    DOEpatents

    Loo, Billy W.

    1984-01-01

    An inertial trap and grooved impactor for providing a sharp cutoff for particles over 15 microns from entering an inhalable particulate sampler. The impactor head has a tapered surface and is provided with V-shaped grooves. The tapered surface functions for reducing particle blow-off or reentrainment while the grooves prevent particle bounce. Water droplets and any resuspended material over the 15 micron size are collected by the inertial trap and deposited in a reservoir associated with the impactor.

  1. Application of high strength grooved wire in fiber protection

    NASA Astrophysics Data System (ADS)

    Kamata, Y.; Niijima, M.; Kawazoe, H.; Ogai, M.; Ninomiya, T.

    1986-11-01

    V Grooves were successfully machined on the high strength steel wire of around 3 mm diameter. Eight of thin coated fibers were protected in these grooves against pulling force of greater than 150kg (allowing 0.2% strain) and lateral pressure of greater 400kg/5cm. Many applications of this high strength grooved wire can be expected in design of optical fiber cable.

  2. Reducing Water/Hull Drag By Injecting Air Into Grooves

    NASA Technical Reports Server (NTRS)

    Reed, Jason C.; Bushnell, Dennis M.; Weinstein, Leonard M.

    1991-01-01

    Proposed technique for reduction of friction drag on hydrodynamic body involves use of grooves and combinations of surfactants to control motion of layer on surface of such body. Surface contains many rows of side-by-side, evenly spaced, longitudinal grooves. Dimensions of grooves and sharpnesses of tips in specific case depends on conditions of flow about vessel. Requires much less air than does microbubble-injection method.

  3. Molecular Imprint of Enzyme Active Site by Camel Nanobodies

    PubMed Central

    Li, Jiang-Wei; Xia, Lijie; Su, Youhong; Liu, Hongchun; Xia, Xueqing; Lu, Qinxia; Yang, Chunjin; Reheman, Kalbinur

    2012-01-01

    Screening of inhibitory Ab1 antibodies is a critical step for producing catalytic antibodies in the anti-idiotypic approach. However, the incompatible surface of the active site of the enzyme and the antigen-binding site of heterotetrameric conventional antibodies become the limiting step. Because camelid-derived nanobodies possess the potential to preferentially bind to the active site of enzymes due to their small size and long CDR3, we have developed a novel approach to produce antibodies with alliinase activities by exploiting the molecular mimicry of camel nanobodies. By screening the camelid-derived variable region of the heavy chain cDNA phage display library with alliinase, we obtained an inhibitory nanobody VHHA4 that recognizes the active site. Further screening with VHHA4 from the same variable domain of the heavy chain of a heavy-chain antibody library led to a higher incidence of anti-idiotypic Ab2 abzymes with alliinase activities. One of the abzymes, VHHC10, showed the highest activity that can be inhibited by Ab1 VHHA4 and alliinase competitive inhibitor penicillamine and significantly suppressed the B16 tumor cell growth in the presence of alliin in vitro. The results highlight the feasibility of producing abzymes via anti-idiotypic nanobody approach. PMID:22374998

  4. Active Sites Environmental Monitoring Program: Mid-FY 1991 report

    SciTech Connect

    Ashwood, T.L.; Wickliff, D.S.; Morrissey, C.M.

    1991-10-01

    This report summarizes the activities of the Active Sites Environmental Monitoring Program (ASEMP) from October 1990 through March 1991. The ASEMP was established in 1989 by Solid Waste Operations and the Environmental Sciences Division to provide early detection and performance monitoring at active low-level radioactive waste (LLW) disposal sites in Solid Waste Storage Area (SWSA) 6 and transuranic (TRU) waste storage sites in SWSA 5 as required by chapters II and III of US Department of Energy Order 5820.2A. Monitoring results continue to demonstrate the no LLW is being leached from the storage vaults on the tumulus pads. Loading of vaults on Tumulus II began during this reporting period and 115 vaults had been loaded by the end of March 1991.

  5. An active-site peptide from pepsin C

    PubMed Central

    Kay, J.; Ryle, A. P.

    1971-01-01

    Porcine pepsin C is inactivated rapidly and irreversibly by diazoacetyl-dl-norleucine methyl ester in the presence of cupric ions at pH values above 4.5. The inactivation is specific in that complete inactivation accompanies the incorporation of 1mol of inhibitor residue/mol of enzyme and evidence has been obtained to suggest that the reaction occurs with an active site residue. The site of reaction is the β-carboxyl group of an aspartic acid residue in the sequence Ile-Val-Asp-Thr. This sequence is identical with the active-site sequence in pepsin and the significance of this in terms of the different activities of the two enzymes is discussed. PMID:4942834

  6. Fluid dynamic effects of grooves on circular cylinder surface

    NASA Astrophysics Data System (ADS)

    Kimura, Takeyoshi; Tsutahara, Michihisa

    1991-12-01

    It is shown that a groove on the surface of a circular cylinder affects movement of the separation point backward and reduces drag even at Reynolds numbers of about a few thousand. Several types of circular-arc cross-section grooves are studied using flow visualizations and numerical simulations. Whether these grooves are effective depends strongly on their positions, and the most effective positions are about 80 deg, measured from the foremost point. When they are effective, cavity flows are developed inside the grooves. This effect corresponds to that of dimples on golf balls and will explain unique characteristics of the drag curve.

  7. Sensorimotor coupling in music and the psychology of the groove.

    PubMed

    Janata, Petr; Tomic, Stefan T; Haberman, Jason M

    2012-02-01

    The urge to move in response to music, combined with the positive affect associated with the coupling of sensory and motor processes while engaging with music (referred to as sensorimotor coupling) in a seemingly effortless way, is commonly described as the feeling of being in the groove. Here, we systematically explore this compelling phenomenon in a population of young adults. We utilize multiple levels of analysis, comprising phenomenological, behavioral, and computational techniques. Specifically, we show (a) that the concept of the groove is widely appreciated and understood in terms of a pleasurable drive toward action, (b) that a broad range of musical excerpts can be appraised reliably for the degree of perceived groove, (c) that the degree of experienced groove is inversely related to experienced difficulty of bimanual sensorimotor coupling under tapping regimes with varying levels of expressive constraint, (d) that high-groove stimuli elicit spontaneous rhythmic movements, and (e) that quantifiable measures of the quality of sensorimotor coupling predict the degree of experienced groove. Our results complement traditional discourse regarding the groove, which has tended to take the psychological phenomenon for granted and has focused instead on the musical and especially the rhythmic qualities of particular genres of music that lead to the perception of groove. We conclude that groove can be treated as a psychological construct and model system that allows for experimental exploration of the relationship between sensorimotor coupling with music and emotion. PMID:21767048

  8. Grooves on Phobos - Their distribution, morphology and possible origin

    NASA Technical Reports Server (NTRS)

    Thomas, P.; Veverka, J.; Bloom, A.; Duxbury, T.

    1979-01-01

    The global distribution, morphology, age, possible origin and significance of the long, linear depressions termed grooves on the surface of Phobos are discussed, based on Viking Orbiter data. The grooves, which consist of linear strings of coalesced and separate depressions in a loose regolith up to 100-200 m in depth, are observed to define the intersection of several sets of parallel planes with the surface of Phobos, with the widest and deepest grooves occurring just outside the rim of the 10-km crater, Stickney. The superposition of the grooves on older craters, crater density within the grooves and the intersections of groove sets suggest that the grooves are all of the same age, with their formation closely following that of Stickney. The evidence of groove morphology and distribution is used to attribute their formation to the enlargement of preexisting fractures or the formation of new fractures by the Stickney impact, causing the mobilization of the regolith along the fractures. The lack of observable grooves on Deimos is explained by the absence of a crater large enough to have severly fractured its surface.

  9. Active chemisorption sites in functionalized ionic liquids for carbon capture.

    PubMed

    Cui, Guokai; Wang, Jianji; Zhang, Suojiang

    2016-07-25

    Development of novel technologies for the efficient and reversible capture of CO2 is highly desired. In the last decade, CO2 capture using ionic liquids has attracted intensive attention from both academia and industry, and has been recognized as a very promising technology. Recently, a new approach has been developed for highly efficient capture of CO2 by site-containing ionic liquids through chemical interaction. This perspective review focuses on the recent advances in the chemical absorption of CO2 using site-containing ionic liquids, such as amino-based ionic liquids, azolate ionic liquids, phenolate ionic liquids, dual-functionalized ionic liquids, pyridine-containing ionic liquids and so on. Other site-containing liquid absorbents such as amine-based solutions, switchable solvents, and functionalized ionic liquid-amine blends are also investigated. Strategies have been discussed for how to activate the existent reactive sites and develop novel reactive sites by physical and chemical methods to enhance CO2 absorption capacity and reduce absorption enthalpy. The carbon capture mechanisms of these site-containing liquid absorbents are also presented. Particular attention has been paid to the latest progress in CO2 capture in multiple-site interactions by amino-free anion-functionalized ionic liquids. In the last section, future directions and prospects for carbon capture by site-containing ionic liquids are outlined. PMID:27243042

  10. Identification of the active site of human mitochondrial malonyl-coenzyme a decarboxylase: A combined computational study.

    PubMed

    Ling, Baoping; Liu, Yuxia; Li, Xiaoping; Wang, Zhiguo; Bi, Siwei

    2016-06-01

    Malonyl-CoA decarboxylase (MCD) can control the level of malonyl-CoA in cell through the decarboxylation of malonyl-CoA to acetyl-CoA, and plays an essential role in regulating fatty acid metabolism, thus it is a potential target for drug discovery. However, the interactions of MCD with CoA derivatives are not well understood owing to unavailable crystal structure with a complete occupancy in the active site. To identify the active site of MCD, molecular docking and molecular dynamics simulations were performed to explore the interactions of human mitochondrial MCD (HmMCD) and CoA derivatives. The findings reveal that the active site of HmMCD indeed resides in the prominent groove which resembles that of CurA. However, the binding modes are slightly different from the one observed in CurA due to the occupancy of the side chain of Lys183 from the N-terminal helical domain instead of the adenine ring of CoA. The residues 300 - 305 play an essential role in maintaining the stability of complex mainly through hydrogen bond interactions with the pyrophosphate moiety of acetyl-CoA. Principle component analysis elucidates the conformational distribution and dominant concerted motions of HmMCD. MM_PBSA calculations present the crucial residues and the major driving force responsible for the binding of acetyl-CoA. These results provide useful information for understanding the interactions of HmMCD with CoA derivatives. Proteins 2016; 84:792-802. © 2016 Wiley Periodicals, Inc. PMID:26948533

  11. Crystal Structure of a Bacterial Type IB DNA Topoisomerase Reveals a Preassembled Active Site in the Absence of DNA

    SciTech Connect

    Patel, Asmita; Shuman, Stewart; Mondragon, Alfonso

    2010-03-08

    Type IB DNA topoisomerases are found in all eukarya, two families of eukaryotic viruses (poxviruses and mimivirus), and many genera of bacteria. They alter DNA topology by cleaving and resealing one strand of duplex DNA via a covalent DNA-(3-phosphotyrosyl)-enzyme intermediate. Bacterial type IB enzymes were discovered recently and are described as poxvirus-like with respect to their small size, primary structures, and bipartite domain organization. Here we report the 1.75-{angstrom} crystal structure of Deinococcus radiodurans topoisomerase IB (DraTopIB), a prototype of the bacterial clade. DraTopIB consists of an amino-terminal (N) {beta}-sheet domain (amino acids 1-90) and a predominantly {alpha}-helical carboxyl-terminal (C) domain (amino acids 91-346) that closely resemble the corresponding domains of vaccinia virus topoisomerase IB. The five amino acids of DraTopIB that comprise the catalytic pentad (Arg-137, Lys-174, Arg-239, Asn-280, and Tyr-289) are preassembled into the active site in the absence of DNA in a manner nearly identical to the pentad configuration in human topoisomerase I bound to DNA. This contrasts with the apoenzyme of vaccinia topoisomerase, in which three of the active site constituents are either displaced or disordered. The N and C domains of DraTopIB are splayed apart in an 'open' conformation, in which the surface of the catalytic domain containing the active site is exposed for DNA binding. A comparison with the human topoisomerase I-DNA cocrystal structure suggests how viral and bacterial topoisomerase IB enzymes might bind DNA circumferentially via movement of the N domain into the major groove and clamping of a disordered loop of the C domain around the helix.

  12. U-Groove Aluminum Weld Strength Improvement

    NASA Technical Reports Server (NTRS)

    Verderaime, V.; Vaughan, R.

    1997-01-01

    Though butt-welds are among the most preferred joining methods in aerostructures, their strength dependence on inelastic mechanics is generally the least understood. This study investigated experimental strain distributions across a thick aluminum U-grooved weld and identified two weld process considerations for improving the multipass weld strength. One is the source of peaking in which the extreme thermal expansion and contraction gradient of the fusion heat input across the groove tab thickness produces severe angular distortion that induces bending under uniaxial loading. The other is the filler strain hardening decreasing with increasing filler pass sequences, producing the weakest welds on the last weld pass side. Both phenomena are governed by weld pass sequences. Many industrial welding schedules unknowingly compound these effects, which reduce the weld strength. A depeaking index model was developed to select filler pass thickness, pass numbers, and sequences to improve depeaking in the welding process. The result was to select the number and sequence of weld passes to reverse the peaking angle such as to combine the strongest weld pass side with the peaking induced bending tension component side to provide a more uniform stress and stronger weld under axial tensile loading.

  13. Cratering and Grooved Terrain on Ganymede

    NASA Technical Reports Server (NTRS)

    1979-01-01

    This color picture as acquired by Voyager 1 during its approach to Ganymede on Monday afternoon (the 5th of March). At ranges between about 230 to 250 thousand km. The image shows detail on the surface with a resolution of four and a half km. This picture is just south of PIA001515 (P21161) and shows more craters. It also shows the two distinctive types of terrain found by Voyager, the darker ungrooved regions and the lighter areas which show the grooves or fractures in abundance. The most striking features are the bright ray craters which havE a distinctly 'bluer' color appearing white against the redder background. Ganymede's surface is known to contain large amounts of surface ice and it appears that these relatively young craters have spread bright fresh ice materials over the surface. Likewise, the lighter color and reflectivity of the grooved areas suggests that here too, there is cleaner ice. We see ray craters with all sizes of ray patterns, ranging from extensive systems of the crater in the northern part of this picture, which has rays at least 300-500 kilometers long, down to craters which have only faint remnants of bright ejecta patterns. This variation suggests that, as on the Moon, there are processes which act to darken ray material, probably 'gardening' by micrometeoroid impact. JPL manages and controls the Voyager project for NASA's Office of Space Science.

  14. The order of condensation in capillary grooves.

    PubMed

    Rascón, Carlos; Parry, Andrew O; Nürnberg, Robert; Pozzato, Alessandro; Tormen, Massimo; Bruschi, Lorenzo; Mistura, Giampaolo

    2013-05-15

    We consider capillary condensation in a deep groove of width L. The transition occurs at a pressure p(co)(L) described, for large widths, by the Kelvin equation p(sat) - p(co)(L) = 2σ cosθ/L, where θ is the contact angle at the side walls and σ is the surface tension. The order of the transition is determined by the contact angle of the capped end θcap; it is continuous if the liquid completely wets the cap, and first-order otherwise. When the transition is first-order, corner menisci at the bottom of the capillary lead to a pronounced metastability, determined by a complementary Kelvin equation Δp(L) = 2σ sinθcap/L. On approaching the wetting temperature of the capillary cap, the corner menisci merge and a single meniscus unbinds from the bottom of the groove. Finite-size scaling shifts, crossover behaviour and critical singularities are determined at mean-field level and beyond. Numerical and experimental results showing the continuous nature of condensation for θcap = 0 and the influence of corner menisci on adsorption isotherms are presented. PMID:23611878

  15. Large Grooves in the South Polar Layered Deposits: Insights from Spacecraft Data and Terrestrial Analogs

    NASA Technical Reports Server (NTRS)

    Bridges, N. T.; Herkenhoff, K. E.

    2000-01-01

    The Martian polar layered deposits (PLD) are probably the best source of information about the recent climate history of Mars, but their origin and the mechanisms of accumulation are still a mystery. The polar layers are sedimentary deposits that most planetary scientists believe are composed of water ice and varying amounts of wind-blown dust, although their composition is poorly constrained. Interpretation of the observed polar stratigraphy in terms of global climate changes is complicated by the significant difference in surface ages between the north and south PLD inferred from crater statistics. The study reported here was undertaken as part of the landing site selection effort for the Mars Polar Lander (MPL) and Deep Space 2 (DS2) missions that made use of all available data. We used Mariner 9, Viking, and Mars Global Surveyor images of the south PLD in the area accessible to MPL and DS2 to evaluate the topography and morphology of grooves, terraced layers, and other features. Here we report on results from grooves that appear to have been carved by strong winds. Because these features are found throughout the interior of the PLD, where MPL and DS2 were targeted to land, their topographic characteristics were judged as important input for landing site safety assessment. The characteristics of the grooves also provide constraints and insights into aeolian processes in the polar regions and the effects these have on PLD ablation. Our results indicate that these grooves do not represent landing hazards at the scale of the images (approx. 80 m/pixel). Their topography and shape do not seem correlated with south PLD layering. No Earth analog of suitable scale exists, although the grooves bear some resemblance to smaller terrestrial deflation hollows found in soft sediment and ice. Additional information is contained in original extended abstract.

  16. Rat intestinal trehalase. Studies of the active site.

    PubMed

    Chen, C C; Guo, W J; Isselbacher, K J

    1987-11-01

    Rat intestinal trehalase was solubilized, purified and reconstituted into proteoliposomes. With octyl glucoside as the solubilizing detergent, the purified protein appeared as a single band on SDS/polyacrylamide-gel electrophoresis with an apparent molecular mass of 67 kDa. Kinetic studies indicated that the active site of this enzyme can be functionally divided into two adjacent regions, namely a binding site (with pKa 4.8) and a catalytic site (with pKa 7.2). Other findings suggested that the catalytic site contains a functional thiol group, which is sensitive to inhibition by N-ethylmaleimide, Hg2+ and iodoacetate. Substrate protection and iodoacetate labelling of the thiol group demonstrated that only a protein of 67 kDa was labelled. Furthermore, sucrose and phlorizin protected the thiol group, but Tris-like inhibitors did not. Structure-inhibition analysis of Tris-like inhibitors, the pH effect of Tris inhibition and Tris protection of 1-(3-dimethylaminopropyl)-3-ethylcarbodi-imide inactivation permitted characterization and location of a separate site containing a carboxy group for Tris binding, which may also be the binding region. On the basis of these findings, a possible structure for the active site of trehalase is proposed. PMID:3426558

  17. Active Site and Remote Contributions to Catalysis in Methylthioadenosine Nucleosidases

    PubMed Central

    Thomas, Keisha; Cameron, Scott A.; Almo, Steven C.; Burgos, Emmanuel S.; Gulab, Shivali A.; Schramm, Vern L.

    2015-01-01

    5′-Methylthioadenosine/S-adenosyl-L-homocysteine nucleosidases (MTANs) catalyze the hydrolysis of 5′-methylthioadenosine to adenine and 5-methylthioribose. The amino acid sequences of the MTANs from Vibrio cholerae (VcMTAN) and Escherichia coli (EcMTAN) are 60% identical and 75% similar. Protein structure folds and kinetic properties are similar. However, binding of transition-state analogues is dominated by favorable entropy in VcMTAN and by enthalpy in EcMTAN. Catalytic sites of VcMTAN and EcMTAN in contact with reactants differ by two residues; Ala113 and Val153 in VcMTAN are Pro113 and Ile152, respectively, in EcMTAN. We mutated the VcMTAN catalytic site residues to match those of EcMTAN in anticipation of altering its properties toward EcMTAN. Inhibition of VcMTAN by transition-state analogues required filling both active sites of the homodimer. However, in the Val153Ile mutant or double mutants, transition-state analogue binding at one site caused complete inhibition. Therefore, a single amino acid, Val153, alters the catalytic site cooperativity in VcMTAN. The transition-state analogue affinity and thermodynamics in mutant VcMTAN became even more unlike those of EcMTAN, the opposite of expectations from catalytic site similarity; thus, catalytic site contacts in VcMTAN are unable to recapitulate the properties of EcMTAN. X-ray crystal structures of EcMTAN, VcMTAN, and a multiple-site mutant of VcMTAN most closely resembling EcMTAN in catalytic site contacts show no major protein conformational differences. The overall protein architectures of these closely related proteins are implicated in contributing to the catalytic site differences. PMID:25806409

  18. Resonant active sites in catalytic ammonia synthesis: A structural model

    NASA Astrophysics Data System (ADS)

    Cholach, Alexander R.; Bryliakova, Anna A.; Matveev, Andrey V.; Bulgakov, Nikolai N.

    2016-03-01

    Adsorption sites Mn consisted of n adjacent atoms M, each bound to the adsorbed species, are considered within a realistic model. The sum of bonds Σ lost by atoms in a site in comparison with the bulk atoms was used for evaluation of the local surface imperfection, while the reaction enthalpy at that site was used as a measure of activity. The comparative study of Mn sites (n = 1-5) at basal planes of Pt, Rh, Ir, Fe, Re and Ru with respect to heat of N2 dissociative adsorption QN and heat of Nad + Had → NHad reaction QNH was performed using semi-empirical calculations. Linear QN(Σ) increase and QNH(Σ) decrease allowed to specify the resonant Σ for each surface in catalytic ammonia synthesis at equilibrium Nad coverage. Optimal Σ are realizable for Ru2, Re2 and Ir4 only, whereas other centers meet steric inhibition or unreal crystal structure. Relative activity of the most active sites in proportion 5.0 × 10- 5: 4.5 × 10- 3: 1: 2.5: 3.0: 1080: 2270 for a sequence of Pt4, Rh4, Fe4(fcc), Ir4, Fe2-5(bcc), Ru2, Re2, respectively, is in agreement with relevant experimental data. Similar approach can be applied to other adsorption or catalytic processes exhibiting structure sensitivity.

  19. Effect of type and location of oil groove on the performance of journal bearings

    NASA Technical Reports Server (NTRS)

    Vijayaraghavan, D.; Keith, T. G., Jr.

    1992-01-01

    A numerical study is performed of oil groove type (circumferential and axial), groove number (single and double) and groove location on journal bearing performance. The analysis involves the use of a cavitation algorithm. The interaction between cavitation phenomena and grooving is determined. Quantitative information is provided which will aid designers to better locate oil feed grooves.

  20. Water in the Active Site of Ketosteroid Isomerase

    PubMed Central

    Hanoian, Philip; Hammes-Schiffer, Sharon

    2011-01-01

    Classical molecular dynamics simulations were utilized to investigate the structural and dynamical properties of water in the active site of ketosteroid isomerase (KSI) to provide insight into the role of these water molecules in the enzyme-catalyzed reaction. This reaction is thought to proceed via a dienolate intermediate that is stabilized by hydrogen bonding with residues Tyr16 and Asp103. A comparative study was performed for the wild-type (WT) KSI and the Y16F, Y16S, and Y16F/Y32F/Y57F (FFF) mutants. These systems were studied with three different bound ligands: equilenin, which is an intermediate analog, and the intermediate states of two steroid substrates. Several distinct water occupation sites were identified in the active site of KSI for the WT and mutant systems. Three additional sites were identified in the Y16S mutant that were not occupied in WT KSI or the other mutants studied. The number of water molecules directly hydrogen bonded to the ligand oxygen was approximately two waters in the Y16S mutant, one water in the Y16F and FFF mutants, and intermittent hydrogen bonding of one water molecule in WT KSI. The molecular dynamics trajectories of the Y16F and FFF mutants reproduced the small conformational changes of residue 16 observed in the crystal structures of these two mutants. Quantum mechanical/molecular mechanical calculations of 1H NMR chemical shifts of the protons in the active site hydrogen-bonding network suggest that the presence of water in the active site does not prevent the formation of short hydrogen bonds with far-downfield chemical shifts. The molecular dynamics simulations indicate that the active site water molecules exchange much more frequently for WT KSI and the FFF mutant than for the Y16F and Y16S mutants. This difference is most likely due to the hydrogen-bonding interaction between Tyr57 and an active site water molecule that is persistent in the Y16F and Y16S mutants but absent in the FFF mutant and significantly less

  1. Energy transfer at the active sites of heme proteins

    SciTech Connect

    Dlott, D.D.; Hill, J.R.

    1995-12-31

    Experiments using a picosecond pump-probe apparatus at the Picosecond Free-electron Laser Center at Stanford University, were performed to investigate the relaxation of carbon monoxide bound to the active sites of heme proteins. The significance of these experiments is two-fold: (1) they provide detailed information about molecular dynamics occurring at the active sites of proteins; and (2) they provide insight into the nature of vibrational relaxation processes in condensed matter. Molecular engineering is used to construct various molecular systems which are studied with the FEL. We have studied native proteins, mainly myoglobin obtained from different species, mutant proteins produced by genetic engineering using recombinant DNA techniques, and a variety of model systems which mimic the structures of the active sites of native proteins, which are produced using molecular synthesis. Use of these different systems permits us to investigate how specific molecular structural changes affect dynamical processes occurring at the active sites. This research provides insight into the problems of how different species needs are fulfilled by heme proteins which have greatly different functionality, which is induced by rather small structural changes.

  2. Chemical Modification of Papain and Subtilisin: An Active Site Comparison

    ERIC Educational Resources Information Center

    St-Vincent, Mireille; Dickman, Michael

    2004-01-01

    An experiment using methyle methanethiosulfonate (MMTS) and phenylmethylsulfonyl flouride (PMSF) to specifically modify the cysteine and serine residues in the active sites of papain and subtilism respectively is demonstrated. The covalent modification of these enzymes and subsequent rescue of papain shows the beginning biochemist that proteins…

  3. Changes in active site histidine hydrogen bonding trigger cryptochrome activation.

    PubMed

    Ganguly, Abir; Manahan, Craig C; Top, Deniz; Yee, Estella F; Lin, Changfan; Young, Michael W; Thiel, Walter; Crane, Brian R

    2016-09-01

    Cryptochrome (CRY) is the principal light sensor of the insect circadian clock. Photoreduction of the Drosophila CRY (dCRY) flavin cofactor to the anionic semiquinone (ASQ) restructures a C-terminal tail helix (CTT) that otherwise inhibits interactions with targets that include the clock protein Timeless (TIM). All-atom molecular dynamics (MD) simulations indicate that flavin reduction destabilizes the CTT, which undergoes large-scale conformational changes (the CTT release) on short (25 ns) timescales. The CTT release correlates with the conformation and protonation state of conserved His378, which resides between the CTT and the flavin cofactor. Poisson-Boltzmann calculations indicate that flavin reduction substantially increases the His378 pKa Consistent with coupling between ASQ formation and His378 protonation, dCRY displays reduced photoreduction rates with increasing pH; however, His378Asn/Arg variants show no such pH dependence. Replica-exchange MD simulations also support CTT release mediated by changes in His378 hydrogen bonding and verify other responsive regions of the protein previously identified by proteolytic sensitivity assays. His378 dCRY variants show varying abilities to light-activate TIM and undergo self-degradation in cellular assays. Surprisingly, His378Arg/Lys variants do not degrade in light despite maintaining reactivity toward TIM, thereby implicating different conformational responses in these two functions. Thus, the dCRY photosensory mechanism involves flavin photoreduction coupled to protonation of His378, whose perturbed hydrogen-bonding pattern alters the CTT and surrounding regions. PMID:27551082

  4. Fabricating Radial Groove Gratings Using Projection Photolithography

    NASA Technical Reports Server (NTRS)

    Iazikov, Dmitri; Mossberg, Thomas W.

    2009-01-01

    Projection photolithography has been used as a fabrication method for radial grove gratings. Use of photolithographic method for diffraction grating fabrication represents the most significant breakthrough in grating technology in the last 60 years, since the introduction of holographic written gratings. Unlike traditional methods utilized for grating fabrication, this method has the advantage of producing complex diffractive groove contours that can be designed at pixel-by-pixel level, with pixel size currently at the level of 45 45 nm. Typical placement accuracy of the grating pixels is 10 nm over 30 nm. It is far superior to holographic, mechanically ruled or direct e-beam written gratings and results in high spatial coherence and low spectral cross-talk. Due to the smooth surface produced by reactive ion etch, such gratings have a low level of randomly scattered light. Also, due to high fidelity and good surface roughness, this method is ideally suited for fabrication of radial groove gratings. The projection mask is created using a laser writer. A single crystal silicon wafer is coated with photoresist, and then the projection mask, with its layer of photoresist, is exposed for patterning in a stepper or scanner. To develop the photoresist, the fabricator either removes the exposed areas (positive resist) of the unexposed areas (negative resist). Next, the patterned and developed photoresist silicon substrate is subjected to reactive ion etching. After this step, the substrate is cleaned. The projection mask is fabricated according to electronic design files that may be generated in GDS file format using any suitable CAD (computer-aided design) or other software program. Radial groove gratings in off-axis grazing angle of incidence mount are of special interest for x-ray spectroscopy, as they allow achieving higher spectral resolution for the same grating area and have lower alignment tolerances than traditional in-plane grating scheme. This is especially

  5. Molecular dynamics simulations and binding free energy analysis of DNA minor groove complexes of curcumin.

    PubMed

    Koonammackal, Mathew Varghese; Nellipparambil, Unnikrishnan Viswambharan Nair; Sudarsanakumar, Chellappanpillai

    2011-11-01

    Curcumin is a natural phytochemical that exhibits a wide range of pharmacological properties, including antitumor and anticancer activities. The similarity in the shape of curcumin to DNA minor groove binding drugs is the motivation for exploring its binding affinity in the minor grooves of DNA sequences. Interactions of curcumin with DNA have not been extensively examined, while its pharmacological activities have been studied and documented in depth. Curcumin was docked with two DNA duplexes, d(GTATATAC)(2) and d(CGCGATATCGCG)(2), and molecular dynamics simulations of the complexes were performed in explicit solvent to determine the stability of the binding. In all systems, the curcumin is positioned in the minor groove in the A·T region, and was stably bound throughout the simulation, causing only minor modifications to the structural parameters of DNA. Water molecules were found to contribute to the stability of the binding of the ligand. Free energy analyses of the complexes were performed with MM-PBSA, and the binding affinities that were calculated are comparable to the values reported for other similar nucleic acid-ligand systems, indicating that curcumin is a suitable natural molecule for the development of minor groove binding drugs. PMID:21287216

  6. Active sites environmental monitoring program. Annual report FY 1992

    SciTech Connect

    Morrissey, C.M.; Ashwood, T.L.; Hicks, D.S.

    1994-04-01

    This report summarizes the activities of the Active Sites Environmental Monitoring Program (ASEMP) at ORNL from October 1991 through September 1992. Solid Waste Operations and the Environmental Sciences Division established ASEMP in 1989 to provide early detection and performance monitoring at active low-level waste (LLW) disposal sites in Solid Waste Storage Area (SWSA) 6 and transuranic (TRU) waste storage sites in SWSA 5 as required by Chapter 2 and 3 of US Department of Energy Order 5820.2A. The Interim Waste Management Facility (IWMF) began operation in December 1991. Monitoring results from the tumulus and IWMF disposal pads continue to indicate that no LLW is leaching from the storage vaults. Storm water falling on the IWMF active pad was collected and transported to the Process Waste Treatment Plant while operators awaited approval of the National Pollutant Discharge Elimination System (NPDES) permit. Several of the recent samples collected from the active IWMF pad had pH levels above the NPDES limit of 9.0 because of alkali leached from the concrete. The increase in gross beta activity has been slight; only 1 of the 21 samples collected contained activity above the 5.0 Bq/L action level. Automated sample-collection and flow-measurement equipment has been installed at IWMF and is being tested. The flume designed to electronically measure flow from the IWMF pads and underpads is too large to be of practical value for measuring most flows at this site. Modification of this system will be necessary. A CO{sub 2} bubbler system designed to reduce the pH of water from the pads is being tested at IWMF.

  7. From the Bandstand to the Classroom: Thinking and Playing Grooves

    ERIC Educational Resources Information Center

    Baxter, Marsha; Santantasio, Christopher

    2012-01-01

    In this article, narratives of a salsa concert and a lesson with a Native American flute performer provide openings for exploring grooves and their application in the music classroom. The term "groove" is examined, along with some non-Western ideas about time as represented in the music of the West African Kpelle people. A sixth-grade composition…

  8. Effects of ultrasonic vibrations in micro-groove turning.

    PubMed

    Zhang, Chen; Guo, Ping; Ehmann, Kornel F; Li, Yingguang

    2016-04-01

    Ultrasonic vibration cutting is an efficient cutting process for mechanical micro-machining. This process can generate intricate surface textures with different geometric characteristics. Micro-grooves/micro-channels are among the most frequently encountered micro-structures and, as such, are the focus of this paper. The effectiveness of both the linear and ultrasonic elliptical vibration-assisted machining technique in micro-groove turning is analyzed and discussed in the paper. The paper first investigates the mechanisms of micro-groove generation induced by the linear and elliptical vibration modes. A simplified cutting force analysis method is given to compare the effectiveness of the two modes in micro-groove turning. The surface roughness of the generated micro-grooves is analyzed next and theoretical expressions are given for the two cases. Finally, micro-groove turning experiments are conducted to compare the influences of the two vibration modes on the cutting forces and the surface roughness. The experimental results show that linear vibration-assisted micro-groove turning leads to better surface roughness as compared to the elliptical vibration-assisted case, while elliptical vibration-assisted micro-groove turning shows advantages in terms of decreasing the cutting forces. PMID:26773790

  9. Fabrication of advanced design (grooved) cermet anodes

    NASA Astrophysics Data System (ADS)

    Windisch, C. F., Jr.; Huettig, F. R.

    1993-05-01

    Attempts were made to fabricate full-size anodes with advanced, or grooved, design using isostatic pressing, slip casting injection molding. Of the three approaches, isostatic pressing produced an anode with dimensions nearest to the target specifications, without serious macroscopic flaws. This approach is considered the most promising for making advanced anodes for aluminum smelting. However, significant work still remains to optimize the physical properties and microstructure of the anode, both of which were significantly different from that of previous anodes. Injection molding and slip casting yielded anode materials with serious deficiencies, including cracks and holes. Injection molding gave cermet material with the best intrinsic microstructure, i.e., the microstructure of the material between macroscopic flaws was very similar to that of anodes previously made at PNL. The reason for the similarity may have to do with amount of residual binder in the material prior to sintering.

  10. Olfactory groove meningiomas: approaches and complications.

    PubMed

    Aguiar, Paulo Henrique Pires de; Tahara, Adriana; Almeida, Antonio Nogueira; Simm, Renata; Silva, Arnaldo Neves da; Maldaun, Marcos Vinicius Calfatt; Panagopoulos, Alexandros Theodoros; Zicarelli, Carlos Alexandre; Silva, Pedro Gabriel

    2009-09-01

    Olfactory groove meningiomas (OGM) account for 4.5% of all intracranial meningiomas. We report 21 patients with OGMs. Tumors were operated on using three surgical approaches: bifrontal (7 patients), fronto-pterional (11 patients) and fronto-orbital (3 patients). Total tumor removal (Simpson Grade 1) was achieved in 13 patients and Simpson II in 8 patients. Perioperative mortality was 4.76%. The average size of the OGM was 4.3+/-1.1cm. The overall recurrence rate was 19%. We preferred to use the pterional approach, which provides quick access to the tumor with less brain exposure. It also allows complete drainage of cisternal cerebrospinal fluid, providing a good level of brain relaxation during surgery. However, for long, thin tumors, hemostasis can be difficult using this approach. PMID:19577476

  11. Fabrication of advanced design (grooved) cermet anodes

    SciTech Connect

    Windisch, C.F. Jr.; Huettig, F.R.

    1993-05-01

    Attempts were made to fabricate full-size anodes with advanced, or grooved, design using isostatic pressing, slip casting injection molding. Of the three approaches, isostatic pressing produced an anode with dimensions nearest to the target specifications, without serious macroscopic flaws. This approach is considered the most promising for making advanced anodes for aluminum smelting. However, significant work still remains to optimize the physical properties and microstructure of the anode, both of which were significantly different from that of previous anodes. Injection molding and slip casting yielded anode materials with serious deficiencies, including cracks and holes. Injection molding gave cermet material with the best intrinsic microstructure, i.e., the microstructure of the material between macroscopic flaws was very similar to that of anodes previously made at PNL. Reason for the similarity may have to do with amount of residual binder in the material prior to sintering.

  12. Probing the promiscuous active site of myo-inositol dehydrogenase using synthetic substrates, homology modeling, and active site modification.

    PubMed

    Daniellou, Richard; Zheng, Hongyan; Langill, David M; Sanders, David A R; Palmer, David R J

    2007-06-26

    The active site of myo-inositol dehydrogenase (IDH, EC 1.1.1.18) from Bacillus subtilis recognizes a variety of mono- and disaccharides, as well as 1l-4-O-substituted inositol derivatives. It catalyzes the NAD+-dependent oxidation of the axial alcohol of these substrates with comparable kinetic constants. We have found that 4-O-p-toluenesulfonyl-myo-inositol does not act as a substrate for IDH, in contrast to structurally similar compounds such as those bearing substituted benzyl substituents in the same position. X-ray crystallographic analysis of 4-O-p-toluenesulfonyl-myo-inositol and 4-O-(2-naphthyl)methyl-myo-inositol, which is a substrate for IDH, shows a distinct difference in the preferred conformation of the aryl substituent. Conformational analysis of known substrates of IDH suggests that this conformational difference may account for the difference in reactivity of 4-O-p-toluenesulfonyl-myo-inositol in the presence of IDH. A sequence alignment of IDH with the homologous glucose-fructose oxidoreductase allowed the construction of an homology model of inositol dehydrogenase, to which NADH and 4-O-benzyl-scyllo-inosose were docked and the active site energy minimized. The active site model is consistent with all experimental results and suggests that a conserved tyrosine-glycine-tyrosine motif forms the hydrophobic pocket adjoining the site of inositol recognition. Y233F and Y235F retain activity, while Y233R and Y235R do not. A histidine-aspartate pair, H176 and D172, are proposed to act as a dyad in which H176 is the active site acid/base. The enzyme is inactivated by diethyl pyrocarbonate, and the mutants H176A and D172N show a marked loss of activity. Kinetic isotope effect experiments with D172N indicate that chemistry is rate-determining for this mutant. PMID:17539607

  13. Groove dimensioning using remote field eddy current inspection

    NASA Astrophysics Data System (ADS)

    Davoust, M.-E.; Fleury, G.

    2000-09-01

    The remote field eddy current technique is used for dimensioning the grooves that may occur in the ferromagnetic pipes. We propose a method to estimate the depth and the length of corrosion grooves from measurement of a pick-up coil signal phase at different positions close to the defect. Groove dimensioning requires the knowledge of the physical relation between measurements and defect dimensions; therefore finite-element calculations are performed to design parametric algebraic functions for modeling the physical phenomena. Different models are possible; the choice of this algebraic function is discussed from identification criteria. By means of new measurement formalism and two previously defined measurement relations, estimates of groove sizes may be given. In the first approach, algebraic function parameters and groove dimensions are linked through a polynomial function; this approach is proved to be better than a second one which tries to take advantage of more physical considerations.

  14. Syncopation creates the sensation of groove in synthesized music examples.

    PubMed

    Sioros, George; Miron, Marius; Davies, Matthew; Gouyon, Fabien; Madison, Guy

    2014-01-01

    In order to better understand the musical properties which elicit an increased sensation of wanting to move when listening to music-groove-we investigate the effect of adding syncopation to simple piano melodies, under the hypothesis that syncopation is correlated to groove. Across two experiments we examine listeners' experience of groove to synthesized musical stimuli covering a range of syncopation levels and densities of musical events, according to formal rules implemented by a computer algorithm that shifts musical events from strong to weak metrical positions. Results indicate that moderate levels of syncopation lead to significantly higher groove ratings than melodies without any syncopation or with maximum possible syncopation. A comparison between the various transformations and the way they were rated shows that there is no simple relation between syncopation magnitude and groove. PMID:25278923

  15. Active-Site-Accessible, Porphyrinic Metal;#8722;Organic Framework Materials

    SciTech Connect

    Farha, Omar K.; Shultz, Abraham M.; Sarjeant, Amy A.; Nguyen, SonBinh T.; Hupp, Joseph T.

    2012-02-06

    On account of their structural similarity to cofactors found in many metallo-enzymes, metalloporphyrins are obvious potential building blocks for catalytically active, metal-organic framework (MOF) materials. While numerous porphyrin-based MOFs have already been described, versions featuring highly accessible active sites and permanent microporosity are remarkably scarce. Indeed, of the more than 70 previously reported porphyrinic MOFs, only one has been shown to be both permanently microporous and contain internally accessible active sites for chemical catalysis. Attempts to generalize the design approach used in this single successful case have failed. Reported here, however, is the synthesis of an extended family of MOFs that directly incorporate a variety of metalloporphyrins (specifically Al{sup 3+}, Zn{sup 2+}, Pd{sup 2+}, Mn{sup 3+}, and Fe{sup 3+} complexes). These robust porphyrinic materials (RPMs) feature large channels and readily accessible active sites. As an illustrative example, one of the manganese-containing RPMs is shown to be catalytically competent for the oxidation of alkenes and alkanes.

  16. Nest predation increases with parental activity: Separating nest site and parental activity effects

    USGS Publications Warehouse

    Martin, T.E.; Scott, J.; Menge, C.

    2000-01-01

    Alexander Skutch hypothesized that increased parental activity can increase the risk of nest predation. We tested this hypothesis using ten open-nesting bird species in Arizona, USA. Parental activity was greater during the nestling than incubation stage because parents visited the nest frequently to feed their young during the nestling stage. However, nest predation did not generally increase with parental activity between nesting stages across the ten study species. Previous investigators have found similar results. We tested whether nest site effects might yield higher predation during incubation because the most obvious sites are depredated most rapidly. We conducted experiments using nest sites from the previous year to remove parental activity. Our results showed that nest sites have highly repeatable effects on nest predation risk; poor nest sites incurred rapid predation and caused predation rates to be greater during the incubation than nestling stage. This pattern also was exhibited in a bird species with similar (i.e. controlled) parental activity between nesting stages. Once nest site effects are taken into account, nest predation shows a strong proximate increase with parental activity during the nestling stage within and across species. Parental activity and nest sites exert antagonistic influences on current estimates of nest predation between nesting stages and both must be considered in order to understand current patterns of nest predation, which is an important source of natural selection.

  17. Nest predation increases with parental activity: separating nest site and parental activity effects.

    PubMed Central

    Martin, T E; Scott, J; Menge, C

    2000-01-01

    Alexander Skutch hypothesized that increased parental activity can increase the risk of nest predation. We tested this hypothesis using ten open-nesting bird species in Arizona, USA. Parental activity was greater during the nestling than incubation stage because parents visited the nest frequently to feed their young during the nestling stage. However, nest predation did not generally increase with parental activity between nesting stages across the ten study species. Previous investigators have found similar results. We tested whether nest site effects might yield higher predation during incubation because the most obvious sites are depredated most rapidly. We conducted experiments using nest sites from the previous year to remove parental activity. Our results showed that nest sites have highly repeatable effects on nest predation risk; poor nest sites incurred rapid predation and caused predation rates to be greater during the incubation than nestling stage. This pattern also was exhibited in a bird species with similar (i.e. controlled) parental activity between nesting stages. Once nest site effects are taken into account, nest predation shows a strong proximate increase with parental activity during the nestling stage within and across species. Parental activity and nest sites exert antagonistic influences on current estimates of nest predation between nesting stages and both must be considered in order to understand current patterns of nest predation, which is an important source of natural selection. PMID:11413645

  18. Osteogenic lineage restriction by osteoprogenitors cultured on nanometric grooved surfaces: the role of focal adhesion maturation.

    PubMed

    Cassidy, John W; Roberts, Jemma N; Smith, Carol-Anne; Robertson, Mary; White, Kate; Biggs, Manus J; Oreffo, Richard O C; Dalby, Matthew J

    2014-02-01

    The differentiation of progenitor cells is dependent on more than biochemical signalling. Topographical cues in natural bone extracellular matrix guide cellular differentiation through the formation of focal adhesions, contact guidance, cytoskeletal rearrangement and ultimately gene expression. Osteoarthritis and a number of bone disorders present as growing challenges for our society. Hence, there is a need for next generation implantable devices to substitute for, or guide, bone repair in vivo. Cellular responses to nanometric topographical cues need to be better understood in vitro in order to ensure the effective and efficient integration and performance of these orthopedic devices. In this study, the FDA-approved plastic polycaprolactone was embossed with nanometric grooves and the response of primary and immortalized osteoprogenitor cells observed. Nanometric groove dimensions were 240 nm or 540 nm deep and 12.5 μm wide. Cells cultured on test surfaces followed contact guidance along the length of groove edges, elongated along their major axis and showed nuclear distortion; they formed more focal complexes and lower proportions of mature adhesions relative to planar controls. Down-regulation of the osteoblast marker genes RUNX2 and BMPR2 in primary and immortalized cells was observed on grooved substrates. Down-regulation appeared to directly correlate with focal adhesion maturation, indicating the involvement of ERK 1/2 negative feedback pathways following integrin-mediated FAK activation. PMID:24252447

  19. Identification of Ice Nucleation Active Sites on Silicate Dust Particles

    NASA Astrophysics Data System (ADS)

    Zolles, Tobias; Burkart, Julia; Häusler, Thomas; Pummer, Bernhard; Hitzenberger, Regina; Grothe, Hinrich

    2015-04-01

    Mineral dusts originating from Earth's crust are known to be important atmospheric ice nuclei. In agreement with earlier studies, feldspar was found as the most active of the tested natural mineral dusts [1-3]. Nevertheless, among those structures K-feldspar showed by far the highest ice nucleation activity. In this study, the reasons for its activity and the difference in the activity of the different feldspars were investigated in closer details. Conclusions are drawn from scanning electron microscopy, X-ray powder diffraction, infrared spectroscopy, and oil-immersion freezing experiments. We give a potential explanation of the increased ice nucleation activity of K-feldspar. The ice nucleating sites are very much dependent on the alkali ion present by altering the water structure and the feldspar surface. The higher activity of K-feldspar can be attributed to the presence of potassium ions on the surface and surface bilayer. The alkali-ions have different hydration shells and thus an influence on the ice nucleation activity of feldspar. Chaotropic behavior of Calcium and Sodium ions are lowering the ice nucleation potential of the other feldspars, while kosmotropic Potassium has a neutral or even positive effect. Furthermore we investigated the influence of milling onto the ice nucleation of quartz particles. The ice nucleation activity can be increased by mechanical milling, by introducing more molecular, nucleation active defects to the particle surface. This effect is larger than expected by plane surface increase. [1] Atkinson et al. The Importance of Feldspar for Ice Nucleation by Mineral Dust in Mixed-Phase Clouds. Nature 2013, 498, 355-358. [2] Yakobi-Hancock et al.. Feldspar Minerals as Efficient Deposition Ice Nuclei. Atmos. Chem. Phys. 2013, 13, 11175-11185. [3] Zolles et al. Identification of Ice Nucleation Active Sites on Feldspar Dust Particles. J. Phys. Chem. A 2015 accepted.

  20. Theory of anchoring on a two-dimensionally grooved surface

    NASA Astrophysics Data System (ADS)

    Fukuda, Jun-Ichi; Gwag, Jin Seog; Yoneya, Makoto; Yokoyama, Hiroshi

    2008-01-01

    We investigate analytically the anchoring of a nematic liquid crystal on a two-dimensionally grooved surface of arbitrary shape, induced by the elastic distortions of a liquid crystal adjacent to the surface. Our theoretical framework applied to a surface with square grooves reveals that such a surface can exhibit bistable anchoring, while a direct extension of a well-known theory of Berreman [Phys. Rev. Lett. 28, 1683 (1972)] results in no azimuthal anchoring in the so-called one-constant case ( K1=K2=K3 , with K1 , K2 , and K3 being the splay, twist, and bend elastic constants, respectively). We show under the assumption of K1=K2=K that the direction of the bistable easy axes and the anchoring strength crucially depend on the ratios K3/K and K24/K , where K24 is the saddle-splay surface elastic constant. To demonstrate the applicability of our theory to general cases and to elucidate the effect of surface shape and the elastic constants on the properties of surface anchoring, we also consider several specific cases of interest; one-dimensional grooves of arbitrary shape, rhombic grooves, and surfaces possessing 2N -fold symmetry, including hexagonal grooves, and show the following: (i) The rescaled anchoring energy f(ϕ)/f(π/2) of one-dimensional grooves, with ϕ being the angle between the director n and the groove direction, is independent of the groove shape. (ii) Whether two diagonal axes of rhombic grooves can become easy axes depends sensitively on K3/K , K24/K and the angle α between the grooves. The angle α yielding the maximum anchoring strength for given groove pitch and amplitude depends again on K3/K and K24/K ; in some cases α=0 (one-dimensional grooves), and in other cases α≠0 , gives the maximum anchoring strength. Square grooves (α=π/2) do not necessarily exhibit the largest anchoring strength. (iii) A surface possessing 2N -fold symmetry can yield N -stable azimuthal anchoring. However, when K1=K2=K3 and N≥3 , azimuthal anchoring is

  1. Active Sites Environmental Monitoring Program. FY 1993: Annual report

    SciTech Connect

    Morrissey, C.M.; Ashwood, T.L.; Hicks, D.S.; Marsh, J.D.

    1994-08-01

    This report continues a series of annual and semiannual reports that present the results of the Active Sites Environmental Monitoring Program (ASEMP) monitoring activities. The report details monitoring data for fiscal year (FY) 1993 and is divided into three major areas: SWSA 6 [including tumulus pads, Interim Waste Management Facility (IWMF), and other sites], the low-level Liquid-Waste Solidification Project (LWSP), and TRU-waste storage facilities in SWSA 5 N. The detailed monitoring methodology is described in the second revision of the ASEMP program plan. This report also presents a summary of the methodology used to gather data for each major area along with the results obtained during FY 1993.

  2. Active sites in char gasification: Final technical report

    SciTech Connect

    Wojtowicz, M.; Lilly, W.D.; Perkins, M.T.; Hradil, G.; Calo, J.M.; Suuberg, E.M.

    1987-09-01

    Among the key variables in the design of gasifiers and combustors is the reactivity of the chars which must be gasified or combusted. Significant loss of unburned char is unacceptable in virtually any process; the provision of sufficient residence time for complete conversion is essential. A very wide range of reactivities are observed, depending upon the nature of the char in a process. The current work focuses on furthering the understanding of gasification reactivities of chars. It has been well established that the reactivity of char to gasification generally depends upon three principal factors: (1) the concentration of ''active sites'' in the char; (2) mass transfer within the char; and (3) the type and concentration of catalytic impurities in the char. The present study primarily addresses the first factor. The subject of this research is the origin, nature, and fate of active sites in chars derived from parent hydrocarbons with coal-like structure. The nature and number of the active sites and their reactivity towards oxygen are examined in ''model'' chars derived from phenol-formaldehyde type resins. How the active sites are lost by the process of thermal annealing during heat treatment of chars are studied, and actual rate for the annealing process is derived. Since intrinsic char reactivities are of primary interest in the present study, a fair amount of attention was given to the model char synthesis and handling so that the effect of catalytic impurities and oxygen-containing functional groups in the chemical structure of the material were minimized, if not completely eliminated. The project would not be considered complete without comparing characteristic features of synthetic chars with kinetic behavior exhibited by natural chars, including coal chars.

  3. Crystal Structures of Human Choline Kinase Isoforms in Complex with Hemicholinium-3 Single Amino Acid near the Active Site Influences Inhibitor Sensitivity

    SciTech Connect

    Hong, Bum Soo; Allali-Hassani, Abdellah; Tempel, Wolfram; Finerty, Jr., Patrick J.; MacKenzie, Farrell; Dimov, Svetoslav; Vedadi, Masoud; Park, Hee-Won

    2010-07-06

    Human choline kinase (ChoK) catalyzes the first reaction in phosphatidylcholine biosynthesis and exists as ChoK{alpha} ({alpha}1 and {alpha}2) and ChoK{beta} isoforms. Recent studies suggest that ChoK is implicated in tumorigenesis and emerging as an attractive target for anticancer chemotherapy. To extend our understanding of the molecular mechanism of ChoK inhibition, we have determined the high resolution x-ray structures of the ChoK{alpha}1 and ChoK{beta} isoforms in complex with hemicholinium-3 (HC-3), a known inhibitor of ChoK. In both structures, HC-3 bound at the conserved hydrophobic groove on the C-terminal lobe. One of the HC-3 oxazinium rings complexed with ChoK{alpha}1 occupied the choline-binding pocket, providing a structural explanation for its inhibitory action. Interestingly, the HC-3 molecule co-crystallized with ChoK{beta} was phosphorylated in the choline binding site. This phosphorylation, albeit occurring at a very slow rate, was confirmed experimentally by mass spectroscopy and radioactive assays. Detailed kinetic studies revealed that HC-3 is a much more potent inhibitor for ChoK{alpha} isoforms ({alpha}1 and {alpha}2) compared with ChoK{beta}. Mutational studies based on the structures of both inhibitor-bound ChoK complexes demonstrated that Leu-401 of ChoK{alpha}2 (equivalent to Leu-419 of ChoK{alpha}1), or the corresponding residue Phe-352 of ChoK{beta}, which is one of the hydrophobic residues neighboring the active site, influences the plasticity of the HC-3-binding groove, thereby playing a key role in HC-3 sensitivity and phosphorylation.

  4. Potential sites of CFTR activation by tyrosine kinases.

    PubMed

    Billet, Arnaud; Jia, Yanlin; Jensen, Timothy J; Hou, Yue-Xian; Chang, Xiu-Bao; Riordan, John R; Hanrahan, John W

    2016-05-01

    The CFTR chloride channel is tightly regulated by phosphorylation at multiple serine residues. Recently it has been proposed that its activity is also regulated by tyrosine kinases, however the tyrosine phosphorylation sites remain to be identified. In this study we examined 2 candidate tyrosine residues near the boundary between the first nucleotide binding domain and the R domain, a region which is important for channel function but devoid of PKA consensus sequences. Mutating tyrosines at positions 625 and 627 dramatically reduced responses to Src or Pyk2 without altering the activation by PKA, suggesting they may contribute to CFTR regulation. PMID:26645934

  5. Brownian aggregation rate of colloid particles with several active sites

    SciTech Connect

    Nekrasov, Vyacheslav M.; Yurkin, Maxim A.; Chernyshev, Andrei V.; Polshchitsin, Alexey A.; Yakovleva, Galina E.; Maltsev, Valeri P.

    2014-08-14

    We theoretically analyze the aggregation kinetics of colloid particles with several active sites. Such particles (so-called “patchy particles”) are well known as chemically anisotropic reactants, but the corresponding rate constant of their aggregation has not yet been established in a convenient analytical form. Using kinematic approximation for the diffusion problem, we derived an analytical formula for the diffusion-controlled reaction rate constant between two colloid particles (or clusters) with several small active sites under the following assumptions: the relative translational motion is Brownian diffusion, and the isotropic stochastic reorientation of each particle is Markovian and arbitrarily correlated. This formula was shown to produce accurate results in comparison with more sophisticated approaches. Also, to account for the case of a low number of active sites per particle we used Monte Carlo stochastic algorithm based on Gillespie method. Simulations showed that such discrete model is required when this number is less than 10. Finally, we applied the developed approach to the simulation of immunoagglutination, assuming that the formed clusters have fractal structure.

  6. 3D bicipital groove shape analysis and relationship to tendopathy.

    PubMed

    Ward, Aaron D; Hamarneh, Ghassan; Schweitzer, Mark E

    2008-06-01

    The bicipital groove of the proximal humerus is formed by the medial and lateral tuberosities and serves to retain the long biceps tendon in its proper place as the arm moves. Bicipital root and proximal tendon disorders are an important symptom generator in the shoulder. The accuracy of the diagnosis of many shoulder disorders visually without quantitative shape analysis is limited, motivating a clinical need for some ancillary method to assess the proximal biceps. In previous studies, measurements of bicipital groove shape were 2-dimensional (2D), taken from a single axial slice. Because of significant variations in groove shape from one axial slice to another in a single patient, such approaches risk overlooking shape features important to long biceps tendon pathology. In this paper, we present a study of the relationship between bicipital groove shape and long biceps tendon pathology using a novel 3-dimensional (3D) shape descriptor for the bicipital groove. In addition to providing quantitative measures of the shape of the groove and its relation to tendopathy, the new descriptor allows for intuitive, descriptive visualization of the shape of the groove. PMID:17342555

  7. Morphological Transitions of Droplets Wetting a Series of Triangular Grooves.

    PubMed

    Dokowicz, Marcin; Nowicki, Waldemar

    2016-07-19

    Morphology and thermodynamics of a microdroplet deposited on a grooved inhomogeneous surface with triangular cross section of the grooves were studied by computer simulations with the use of Surface Evolver program. With increasing volume of the droplet, it initially spreads along the series of grooves assuming the filament-like morphology. After reaching a certain volume, the surface wetted by the droplet is reduced and the droplet assumes the bulge morphology or spreads over the surface bordering on the groove initially occupied (it can be either a neighboring groove or a flat surface). The character of the process is determined by the geometry of the edge of the inhomogeneity studied. The effect described also depends on the number of grooves G and the Young contact angle θY. The change in the shape of the droplet becomes more pronounced with decreasing θY and G. Above a certain number of grooves, in the range of contact angles studied (e.g., G > 6 if θY = 70° and G > 4 if θY = 75°), no morphological transition of the droplet was observed. PMID:27347695

  8. Electrospinning of Grooved Polystyrene Fibers: Effect of Solvent Systems

    NASA Astrophysics Data System (ADS)

    Liu, Wanjun; Huang, Chen; Jin, Xiangyu

    2015-05-01

    Secondary surface texture is of great significance to morphological variety and further expands the application areas of electrospun nanofibers. This paper presents the possibility of directly electrospinning grooved polystyrene (PS) fibers using both single and binary solvent systems. Solvents were classified as low boiling point solvent (LBPS): dichloromethane (DCM), acetone (ACE), and tetrahydrofuran (THF); high boiling point solvent (HBPS): N, N-dimethylformamide (DMF) and cyclohexanone (CYCo); and non-solvent (NS): 1-butanol (BuOH). By the systematic selection and combination of these solvents at given parameters, we found that single solvent systems produced non-grooved fibers. LBPS/DMF solvent systems resulted in fibers with different grooved textures, while LBPS/CYCo led to fibers with double grooved texture. Grooved fibers can also be fabricated from LBPS/LBPS, NS/LBPS, and NS/HBPS systems under specific conditions. The results indicated that the difference of evaporation rate (DER) between the two solvents played a key role in the formation of grooved texture. The formation of this unique texture should be attributed to three separate mechanisms, namely void-based elongation, wrinkle-based elongation, and collapsed jet-based elongation. Our findings can serve as guidelines for the preparation of ultrafine fibers with grooved secondary texture.

  9. Electrospinning of Grooved Polystyrene Fibers: Effect of Solvent Systems.

    PubMed

    Liu, Wanjun; Huang, Chen; Jin, Xiangyu

    2015-12-01

    Secondary surface texture is of great significance to morphological variety and further expands the application areas of electrospun nanofibers. This paper presents the possibility of directly electrospinning grooved polystyrene (PS) fibers using both single and binary solvent systems. Solvents were classified as low boiling point solvent (LBPS): dichloromethane (DCM), acetone (ACE), and tetrahydrofuran (THF); high boiling point solvent (HBPS): N,N-dimethylformamide (DMF) and cyclohexanone (CYCo); and non-solvent (NS): 1-butanol (BuOH). By the systematic selection and combination of these solvents at given parameters, we found that single solvent systems produced non-grooved fibers. LBPS/DMF solvent systems resulted in fibers with different grooved textures, while LBPS/CYCo led to fibers with double grooved texture. Grooved fibers can also be fabricated from LBPS/LBPS, NS/LBPS, and NS/HBPS systems under specific conditions. The results indicated that the difference of evaporation rate (DER) between the two solvents played a key role in the formation of grooved texture. The formation of this unique texture should be attributed to three separate mechanisms, namely void-based elongation, wrinkle-based elongation, and collapsed jet-based elongation. Our findings can serve as guidelines for the preparation of ultrafine fibers with grooved secondary texture. PMID:26055481

  10. A study of heat flux induced dryout in capillary grooves

    NASA Astrophysics Data System (ADS)

    Murphy, Timothy J.

    1992-12-01

    This is an experimental study of ethanol flowing in the narrow grooves of a copper plate which is subjected to heat fluxes sufficient to evaporate more liquid than can be replaced by capillary pumping. Three groove geometries are used: square, rectangle, and trapezoid. The objective is to simulate aspects of liquid flow in heat pipes with axial grooves. In order to validate analytical models of capillary flow in grooves, the capillary limit, dryout front location, and dryout front movement in response to power draw downs are documented. The results show the rewet performance of the groove is dependent on geometry. Grooves of higher heat transfer capacity can be poor for recovering from dryout, like the trapezoidal groove. Comparisons of the theoretical maximum heat transfer with the data are good for the square and rectangle, but overestimate the value for the trapezoid. No theory sufficiently predicted the location of the dryout front for the three geometries. For both a quiescent dryout front and a boiling dryout front, the theory does not utilize an accurate description of the geometry of the liquid front which is critical for determining the capillary pressure difference.

  11. Grooved Terrain on Ganymede: A Galileo-based Synthesis

    NASA Technical Reports Server (NTRS)

    Pappalardo, Robert T.; Collins, Geoffrey C.; Head, James W.; Moore, Jeffrey M.; Schenk, Paul M.

    2003-01-01

    Swaths of bright "grooved terrain" (sulci) on Ganymede are 10s to 100s of kilometers wide and cross-cut the older dark terrain, forming an intricate patchwork across 2/3 of Ganymede's surface. The view of grooved terrain developed from Voyager images is that bright cells are broad graben infilled by extrusion of relatively clean (silicate-poor) liquid water, warm ice, or icy slush, and then extended and faulted. Galileo imaging has greatly improved understanding of the emplacement history and geological implications of grooved terrain, supporting a rift-like model for its formation.

  12. Analysis and tests of NASA coverted groove heat pipe

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A low-cost thermal control heat pipe having nearly covered grooves extruded in aluminum was developed at NASA. Analytical predictions of transport capability are in excellent agreement with experimental results using ammonia. Axial heat transport predictions as a function of fluid charge are presented also for methane, ethane, propane, and butane. Experimental tests show performance considerably better than that of open groove extruded pipes and comparing favorably with that of more complicated arterial/wick configurations. For ammonia at 20 C, the covert groove pipe obtained a static wicking height of 2.5 cm and an axial heat transport capability of 143 W-m.

  13. GaAs solar cells with V-grooved emitters

    NASA Technical Reports Server (NTRS)

    Bailey, S. G.; Fatemi, N.; Wilt, D. M.; Landis, G. A.; Thomas, R. D.

    1989-01-01

    A GaAs solar cell with a V-grooved front surface is described. It shows improved optical coupling and higher short-circuit current compared to planar cells. The GaAs homojunction cells, manufactured by OrganoMetallic Chemical Vapor Deposition (OMCVD), are described. The V-grooves were formed by anisotropic etching. Reflectivity measurements show significantly lower reflectance for the microgrooved cell compared to the planar structure. The short circuit current of the V-grooved solar cell is consistently higher than that of the planar controls.

  14. Laser window with annular grooves for thermal isolation

    DOEpatents

    Warner, B.E.; Horton, J.A.; Alger, T.W.

    1983-07-13

    A laser window or other optical element which is thermally loaded, heats up and causes optical distortions because of temperature gradients between the center and the edge. A number of annular grooves, one to three or more, are formed in the element between a central portion and edge portion, producing a web portion which concentrates the thermal gradient and thermally isolates the central portion from the edge portion, producing a uniform temperature profile across the central portion and therefore reduce the optical distortions. The grooves are narrow and closely spaced with respect to the thickness of the element, and successive grooves are formed from alternate sides of the element.

  15. Groove Density Measurements for the VLS grating by Diffraction Method

    SciTech Connect

    Hu, Z.W.; Yu, X.J.; Liu, Z.P.; Wang, Q.P.; Chen, Q.

    2004-05-12

    A grating groove density measurement system is developed to measure the groove variation of VLS grating in NSRL. It has certain advantages over methods like Atomic force microscopy(AFM), Moire fringe method and long trace profiler(LTP). It is applicable to gratings of arbitrary surface shape and with arbitrary groove density distribution. The errors affecting the measurement accuracy are analyzed. The mechanical setup sketch is given. The mechanical accuracy is calibrated in order to control the uncertainty. The first result of a VLS plane grating is tested. The system accuracy ({delta}N/N) is about 2x10-4.

  16. Grooved Fuel Rings for Nuclear Thermal Rocket Engines

    NASA Technical Reports Server (NTRS)

    Emrich, William

    2009-01-01

    An alternative design concept for nuclear thermal rocket engines for interplanetary spacecraft calls for the use of grooved-ring fuel elements. Beyond spacecraft rocket engines, this concept also has potential for the design of terrestrial and spacecraft nuclear electric-power plants. The grooved ring fuel design attempts to retain the best features of the particle bed fuel element while eliminating most of its design deficiencies. In the grooved ring design, the hydrogen propellant enters the fuel element in a manner similar to that of the Particle Bed Reactor (PBR) fuel element.

  17. Studies of interaction between a new synthesized minor-groove targeting artificial nuclease and DNA

    NASA Astrophysics Data System (ADS)

    Yin, Qiang; Zhang, Zhen; Zhao, Yu-Fen

    2007-04-01

    Nuclease plays an important role in molecular biology, such as DNA sequencing. Synthetic polyamide conjugates can be considered as new tool in the selective inhibition of gene expression and as potential drugs in anticancer or antiviral chemotherapy. In this paper, a new synthesized minor-groove targeting artificial nuclease, oligopyrrol-containing peptide, was reported. It was found that this new compound can bind DNA in AT-riched minor groove with high affinity and site specificity. DNA binding behavior was determined by UV-vis and circular dichroism (CD) methods. It was indicated that compound 6 can enhance the Tm of oligomer DNA from 51.8 to 63.5 °C and possesses large binding constant ( Kb = 8.83 × 10 4 L/mol).

  18. Pancreatico-duodenectomy for complicated groove pancreatitis

    PubMed Central

    Verbeke, Caroline S.; Gomez, Dhanwant; McMahon, Michael J.; Menon, Krishna V.

    2007-01-01

    Objectives. Groove pancreatitis (GP) describes a form of segmental pancreatitis, which affects the pancreatic head at the interface with the duodenum, and is frequently associated with ectopic pancreatic tissue in the duodenal wall. We present a series of symptomatic patients with complicated GP who underwent pancreaticoduodenectomy, and review the diagnostic challenges, imaging modalities, pathological features and clinical outcome of this rare condition. Patients and methods. This was a prospective case base study of clinical, radiological and pathological data collected between the years 2000 and 2005 on patients diagnosed with severe GP – confirmed by histopathological examination following pancreaticoduodenectomy. Results. In total 11 patients were included, presenting with chronic abdominal pain (n=11), gastric outlet obstruction (n=5) and jaundice (n=1). Exocrine dysfunction with associated weight loss (median > 9 kg) was present in 10 patients, and type 2 diabetes in 2 patients. Radiological imaging (CT/MRCP/EUS) provided complementary investigations and correlated well with classic histopathological findings (duodenal wall thickening, mucosal irregularity and Brunner's gland hyperplasia, duodenal wall cysts and pancreatic heterotropia). Following pancreaticoduodenectomy (median follow-up period 52 weeks) all patients experienced significant pain alleviation and weight gain (average 3 kg at 2 months). Conclusion. Pancreaticoduodenectomy is associated with significant improvements in weight gain and alleviates the chronic pain associated with severe GP. PMID:18333228

  19. Current activities handbook: formerly utilized sites remedial action program

    SciTech Connect

    1981-02-27

    This volume is one of a series produced under contract with the DOE, by Politech Corporation to develop a legislative and regulatory data base to assist the FUSRAP management in addressing the institutional and socioeconomic issues involved in carrying out the Formerly Utilized Sites Remedial Action Program. This Information Handbook series contains information about all relevant government agencies at the Federal and state levels, the pertinent programs they administer, each affected state legislature, and current Federal and state legislative and regulatory initiatives. This volume is a compilation of information about the activities each of the thirteen state legislatures potentially affected by the Formerly Utilized Sites Remedial Action Program. It contains a description of the state legislative procedural rules and a schedule of each legislative session; a summary of pending relevant legislation; the name and telephone number of legislative and state agency contacts; and the full text of all bills identified.

  20. 4. DETAIL VIEW OF TRIPLE TONGUE AND GROOVE CRIBBING USED ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. DETAIL VIEW OF TRIPLE TONGUE AND GROOVE CRIBBING USED IN DAM CONSTRUCTION, NORTH EAST OF EAST DAM, LOOKING NORTH - Three Bears Lake & Dams, East Dam, North of Marias Pass, East Glacier Park, Glacier County, MT

  1. Surface profilometer for examining grain-boundary grooves

    NASA Technical Reports Server (NTRS)

    Jech, R. E.; Ready, D. W.

    1969-01-01

    Surface profilometer, consisting primarily of commercially available components, measures surface topographical features accurately and precisely. It shows improvement over the interferometric technique in measurement of grain-boundary grooves formed during annealing on nickel-oxide bicrystals.

  2. 13. GROOVED FOOTING (CONSTRUCTION KEY) EXTENDING ABOVE CEMENT FLOOR IN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. GROOVED FOOTING (CONSTRUCTION KEY) EXTENDING ABOVE CEMENT FLOOR IN FIRST UNLINED SECTION BEYOND SOUTH PORTAL. - Salinas River Project, Cuesta Tunnel, Southeast of U.S. 101, San Luis Obispo, San Luis Obispo County, CA

  3. Measurement and analysis of grain boundary grooving by volume diffusion

    NASA Technical Reports Server (NTRS)

    Hardy, S. C.; Mcfadden, G. B.; Coriell, S. R.; Voorhees, P. W.; Sekerka, R. F.

    1991-01-01

    Experimental measurements of isothermal grain boundary grooving by volume diffusion are carried out for Sn bicrystals in the Sn-Pb system near the eutectic temperature. The dimensions of the groove increase with a temporal exponent of 1/3, and measurement of the associated rate constant allows the determination of the product of the liquid diffusion coefficient D and the capillarity length Gamma associated with the interfacial free energy of the crystal-melt interface. The small-slope theory of Mullins is generalized to the entire range of dihedral angles by using a boundary integral formulation of the associated free boundary problem, and excellent agreement with experimental groove shapes is obtained. By using the diffusivity measured by Jordon and Hunt, the present measured values of Gamma are found to agree to within 5 percent with the values obtained from experiments by Gunduz and Hunt on grain boundary grooving in a temperature gradient.

  4. The Effectiveness of the "Golfer's Groove" in Improving Golfers' Scores

    ERIC Educational Resources Information Center

    Yost, Michael; And Others

    1976-01-01

    Use of the "golfer's groove," a device for controlling the angle and plane of a practicing golfer's swing, significantly influences the accuracy with which male and female college students can be taught to drive golfballs. (MB)

  5. Simulation of multipactor on the rectangular grooved dielectric surface

    NASA Astrophysics Data System (ADS)

    Cai, Libing; Wang, Jianguo; Cheng, Guoxin; Zhu, Xiangqin; Xia, Hongfu

    2015-11-01

    Multipactor discharge on the rectangular grooved dielectric surface is simulated self-consistently by using a two-and-a-half dimensional (2.5 D) electrostatic particle-in-cell (PIC) code. Compared with the electromagnetic PIC code, the former can give much more accurate solution for the space charge field caused by the multipactor electrons and the deposited surface charge. According to the rectangular groove width and height, the multipactor can be divided into four models, the spatial distributions of the multipactor electrons and the space charge fields are presented for these models. It shows that the rectangular groove in different models gives very different suppression effect on the multipactor, effective and efficient suppression on the multipactor can only be reached with a proper groove size.

  6. Static and dynamic characteristics of parallel-grooved seals

    NASA Technical Reports Server (NTRS)

    Iwatsubo, Takuzo; Yang, Bo-Suk; Ibaraki, Ryuji

    1987-01-01

    Presented is an analytical method to determine static and dynamic characteristics of annular parallel-grooved seals. The governing equations were derived by using the turbulent lubrication theory based on the law of fluid friction. Linear zero- and first-order perturbation equations of the governing equations were developed, and these equations were analytically investigated to obtain the reaction force of the seals. An analysis is presented that calculates the leakage flow rate, the torque loss, and the rotordynamic coefficients for parallel-grooved seals. To demonstrate this analysis, we show the effect of changing number of stages, land and groove width, and inlet swirl on stability of the boiler feed water pump seals. Generally, as the number of stages increased or the grooves became wider, the leakage flow rate and rotor-dynamic coefficients decreased and the torque loss increased.

  7. E-Cloud Build-up in Grooved Chambers

    SciTech Connect

    Venturini, Marco

    2007-05-01

    We simulate electron cloud build-up in a grooved vacuumchamber including the effect of space charge from the electrons. Weidentify conditions for e-cloud suppression and make contact withprevious estimates of an effective secondary electron yield for groovedsurfaces.

  8. Determination of groove spacings for concave diffraction gratings

    SciTech Connect

    Hu Zhongwen; Liu Zuping; Wang Qiuping

    2004-11-01

    A long trace profiler (LTP) based method has been reported to measure the groove density of a concave grating with a curvature radius 14346.8 mm. It is appropriate for gratings with a sufficiently large curvature radius. Measurements of the groove density of a concave or convex grating with a small curvature radius could be problematic. A system based on a diffraction method and developed to check the groove variation of variable line spacing (VLS) gratings was used to measure a concave grating at NSRL recently and is the subject of this paper. For a grating with a small radius of curvature, the off-axis errors become dominant factors determining the system uncertainty. The errors are evaluated, and a correction algorithm is developed. A commercially available concave grating with a curvature radius of 750 mm was measured. The maximum relative groove density error ({delta}N/N) was 3x10{sup -5}.

  9. Simulation of multipactor on the rectangular grooved dielectric surface

    SciTech Connect

    Cai, Libing; Wang, Jianguo; Cheng, Guoxin; Zhu, Xiangqin; Xia, Hongfu

    2015-11-15

    Multipactor discharge on the rectangular grooved dielectric surface is simulated self-consistently by using a two-and-a-half dimensional (2.5 D) electrostatic particle-in-cell (PIC) code. Compared with the electromagnetic PIC code, the former can give much more accurate solution for the space charge field caused by the multipactor electrons and the deposited surface charge. According to the rectangular groove width and height, the multipactor can be divided into four models, the spatial distributions of the multipactor electrons and the space charge fields are presented for these models. It shows that the rectangular groove in different models gives very different suppression effect on the multipactor, effective and efficient suppression on the multipactor can only be reached with a proper groove size.

  10. Syncopation creates the sensation of groove in synthesized music examples

    PubMed Central

    Sioros, George; Miron, Marius; Davies, Matthew; Gouyon, Fabien; Madison, Guy

    2014-01-01

    In order to better understand the musical properties which elicit an increased sensation of wanting to move when listening to music—groove—we investigate the effect of adding syncopation to simple piano melodies, under the hypothesis that syncopation is correlated to groove. Across two experiments we examine listeners' experience of groove to synthesized musical stimuli covering a range of syncopation levels and densities of musical events, according to formal rules implemented by a computer algorithm that shifts musical events from strong to weak metrical positions. Results indicate that moderate levels of syncopation lead to significantly higher groove ratings than melodies without any syncopation or with maximum possible syncopation. A comparison between the various transformations and the way they were rated shows that there is no simple relation between syncopation magnitude and groove. PMID:25278923

  11. Characterisation of a grooved heat pipe with an anodised surface

    NASA Astrophysics Data System (ADS)

    Solomon, A. Brusly; Ram Kumar, A. M.; Ramachandran, K.; Pillai, B. C.; Senthil Kumar, C.; Sharifpur, Mohsen; Meyer, Josua P.

    2016-06-01

    A grooved heat pipe (GHP) is an important device for managing heat in space applications such as satellites and space stations, as it works efficiently in the absence of gravity. Apart from the above application, axial GHPs are used in many applications, such as electronic cooling units for temperature control and permafrost cooling. Improving the performance of GHPs is essential for better cooling and thermal management. In the present study, the effect of anodization on the heat transfer characteristics of a GHP is studied with R600a as a working fluid. In addition, the effects of fill ratio, inclination angle and heat inputs on the heat transfer performance of a GHP are studied. Furthermore, the effect of heat flux on dimensional numbers, such as the Webber, Bond, Kutateladze and condensation numbers, are studied. The inclination angle, heat input and fill ratio of GHPs are varied in the range of 0°-90°, 25-250 W and 10-70 % respectively. It is found that the above parameters have a significant effect on the performance of a GHP. Due to the anodisation, the maximum enhancement in heat transfer coefficient at the evaporator is 39 % for a 90° inclination at a heat flux of 11 kW/m2. The reported performance enhancement of a GHP may be due to the large numbers of nucleation sites created by the anodisation process and enhancement in the capillary force due to the coating.

  12. Sequence-specific minor groove binding ligands as potential regulators of gene expression in Xenopus laevis oocytes.

    PubMed

    Belikov, S V; Grokhovsky, S L; Isaguliants, M G; Surovaya, A N; Gursky, G V

    2005-10-01

    The mouse mammary tumor virus (MMTV) promoter is induced by glucocorticoid hormone. A robust hormone- and receptor-dependent gene activation could be reproduced in Xenopus laevis oocytes. The homogeneous response in this system allowed a detailed analysis of the DNA-protein interactions following hormone activation. The strategy of artificial regulating of gene activity by sequence-specific minor groove binding ligands is very attractive. We have synthesized and studied the interaction with DNA of bis-linked netropsin derivatives in which two monomers are attached via short linkers in head-to-head and tail-to-tail manners. We have found that cis-diammine-platinum bridged bis-netropsin added to Xenopus oocytes media penetrates cellular and nuclear membrane and binds selectively to the MMTV promoter at the DNA segment that partly overlaps with the site recognized by glucocorticoid receptor. DNase I footprinting studies demonstrate that there are more stronger binding sites for cis-diammine-platinum bridged bis-netropsin on the naked MMTV DNA which are found to be inaccessible for its binding in oocytes. PMID:16060693

  13. Development of optimized, graded-permeability axial groove heat pipes

    NASA Technical Reports Server (NTRS)

    Kapolnek, Michael R.; Holmes, H. Rolland

    1988-01-01

    Heat pipe performance can usually be improved by uniformly varying or grading wick permeability from end to end. A unique and cost effective method for grading the permeability of an axial groove heat pipe is described - selective chemical etching of the pipe casing. This method was developed and demonstrated on a proof-of-concept test article. The process improved the test article's performance by 50 percent. Further improvement is possible through the use of optimally etched grooves.

  14. Polymer scaffolds with preferential parallel grooves enhance nerve regeneration.

    PubMed

    Mobasseri, Atefeh; Faroni, Alessandro; Minogue, Ben M; Downes, Sandra; Terenghi, Giorgio; Reid, Adam J

    2015-03-01

    We have modified the surface topography of poly ɛ-caprolactone (PCL) and polylactic acid (PLA) blended films to improve cell proliferation and to guide the regeneration of peripheral nerves. Films with differing shaped grooves were made using patterned silicon templates, sloped walls (SL), V-shaped (V), and square-shaped (SQ), and compared with nongrooved surfaces with micropits. The solvent cast films were tested in vitro using adult adipose-derived stem cells differentiated to Schwann cell-like cells. Cell attachment, proliferation, and cell orientation were all improved on the grooved surfaces, with SL grooves giving the best results. We present in vivo data on Sprague-Dawley rat sciatic nerve injury with a 10-mm gap, evaluating nerve regeneration at 3 weeks across a polymer nerve conduit modified with intraluminal grooves (SL, V, and SQ) and differing wall thicknesses (70, 100, 120, and 210 μm). The SL-grooved nerve conduit showed a significant improvement over the other topographical-shaped grooves, while increasing the conduit wall thickness saw no positive effect on the biological response of the regenerating nerve. Furthermore, the preferred SL-grooved conduit (C) with 70 μm wall thickness was compared with the current clinical gold standard of autologous nerve graft (Ag) in the rat 10-mm sciatic nerve gap model. At 3 weeks postsurgery, all nerve gaps across both groups were bridged with regenerated nerve fibers. At 16 weeks, features of regenerated axons were comparable between the autograft (Ag) and conduit (C) groups. End organ assessments of muscle weight, electromyography, and skin reinnervation were also similar between the groups. The comparable experimental outcome between conduit and autograft, suggests that the PCL/PLA conduit with inner lumen microstructured grooves could be used as a potential alternative treatment for peripheral nerve repair. PMID:25435096

  15. [Developmental radicular groove as a cause of endodontic failure].

    PubMed

    Fabra Campos, H; Millet Part, J

    1989-01-01

    A clinical case of apical injury on an upper lateral incisor with endodontical and surgical failures in its treatment is presented. Extraction of the incisor and its study at the stereoscopic microscope showed the existence of a developmental groove running from the cingulum to the end of the root, establishing a communication between the crevice and the apical part of the tooth. Bacterial infection through the groove could provide an explanation for treatment failure. PMID:2640035

  16. Oriental transitions in nematic liquid crystals on grooved substrates

    SciTech Connect

    Krekhov, A.P.; Khasimullin, M.V.; Lebedev, Y.A.

    1995-12-31

    An expression for the surface energy of a nematic liquid crystal (NLC) on a fine-grooved substrate is obtained with the phenomenological approach. Temperature-induced orientational transitions in nematic liquid crystals are analyzed as functions of the surface-profile parameters. A planar{yields}tilted{yields}homeotropic alignment transition was observed near the clearing point of an MBBA layer sandwiched between two grooved glass substrates, with a microrelief obtained by oblique evaporation of silicon monoxide. 15 refs., 1 fig.

  17. Polymer Scaffolds with Preferential Parallel Grooves Enhance Nerve Regeneration

    PubMed Central

    Mobasseri, Atefeh; Faroni, Alessandro; Minogue, Ben M.; Downes, Sandra; Reid, Adam J.

    2015-01-01

    We have modified the surface topography of poly ɛ-caprolactone (PCL) and polylactic acid (PLA) blended films to improve cell proliferation and to guide the regeneration of peripheral nerves. Films with differing shaped grooves were made using patterned silicon templates, sloped walls (SL), V-shaped (V), and square-shaped (SQ), and compared with nongrooved surfaces with micropits. The solvent cast films were tested in vitro using adult adipose-derived stem cells differentiated to Schwann cell-like cells. Cell attachment, proliferation, and cell orientation were all improved on the grooved surfaces, with SL grooves giving the best results. We present in vivo data on Sprague-Dawley rat sciatic nerve injury with a 10-mm gap, evaluating nerve regeneration at 3 weeks across a polymer nerve conduit modified with intraluminal grooves (SL, V, and SQ) and differing wall thicknesses (70, 100, 120, and 210 μm). The SL-grooved nerve conduit showed a significant improvement over the other topographical-shaped grooves, while increasing the conduit wall thickness saw no positive effect on the biological response of the regenerating nerve. Furthermore, the preferred SL-grooved conduit (C) with 70 μm wall thickness was compared with the current clinical gold standard of autologous nerve graft (Ag) in the rat 10-mm sciatic nerve gap model. At 3 weeks postsurgery, all nerve gaps across both groups were bridged with regenerated nerve fibers. At 16 weeks, features of regenerated axons were comparable between the autograft (Ag) and conduit (C) groups. End organ assessments of muscle weight, electromyography, and skin reinnervation were also similar between the groups. The comparable experimental outcome between conduit and autograft, suggests that the PCL/PLA conduit with inner lumen microstructured grooves could be used as a potential alternative treatment for peripheral nerve repair. PMID:25435096

  18. Gap and channeled plasmons in tapered grooves: a review.

    PubMed

    Smith, C L C; Stenger, N; Kristensen, A; Mortensen, N A; Bozhevolnyi, S I

    2015-06-01

    Tapered metallic grooves have been shown to support plasmons - electromagnetically coupled oscillations of free electrons at metal-dielectric interfaces - across a variety of configurations and V-like profiles. Such plasmons may be divided into two categories: gap-surface plasmons (GSPs) that are confined laterally between the tapered groove sidewalls and propagate either along the groove axis or normal to the planar surface, and channeled plasmon polaritons (CPPs) that occupy the tapered groove profile and propagate exclusively along the groove axis. Both GSPs and CPPs exhibit an assortment of unique properties that are highly suited to a broad range of cutting-edge nanoplasmonic technologies, including ultracompact photonic circuits, quantum-optics components, enhanced lab-on-a-chip devices, efficient light-absorbing surfaces and advanced optical filters, while additionally affording a niche platform to explore the fundamental science of plasmon excitations and their interactions. In this Review, we provide a research status update of plasmons in tapered grooves, starting with a presentation of the theory and important features of GSPs and CPPs, and follow with an overview of the broad range of applications they enable or improve. We cover the techniques that can fabricate tapered groove structures, in particular highlighting wafer-scale production methods, and outline the various photon- and electron-based approaches that can be used to launch and study GSPs and CPPs. We conclude with a discussion of the challenges that remain for further developing plasmonic tapered-groove devices, and consider the future directions offered by this select yet potentially far-reaching topic area. PMID:25965100

  19. Evaporative cooling on a grooved surface. M.S. Thesis

    NASA Technical Reports Server (NTRS)

    Yoder, D.

    1979-01-01

    The transition point where water begins to accumulate on the surface during spray evaporative cooling was investigated experimentally to determine the temperatures and corresponding heat flux at which this transition occurs. Several pressure ranges were considered including one below the triple point of water. Additionally, the results using a grooved surface were compared to those using a smooth surface. It was determined that a grooved surface has no effect on the heat transfer.

  20. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  1. Phobos grooves and impact craters: A stereographic analysis

    NASA Astrophysics Data System (ADS)

    Simioni, Emanuele; Pajola, Maurizio; Massironi, Matteo; Cremonese, Gabriele

    2015-08-01

    Phobos parallel grooves were first observed on Viking images 38 years ago and since then they have been greatly debated leading to several formation hypotheses. Nevertheless, none of them have been favoured and widely accepted. In this work, we provide a different approach, assuming that Phobos grooves can be the expression of fracture planes, and deriving their spatial distribution and orientation on 3D reconstructions, we point out that any origin related only to craters at Phobos surface should be ruled out, since the majority of the grooves is unrelated to any craters now present at its surface. This raises the intriguing possibility that such grooves, if expression of fracture planes, are remnant features of an ancient parent body from which Phobos could have originated. Such scenario has never been considered for Phobos, though this origin was already proposed for the formation of 433 Eros grooves (Buczkowski, D.L., Barnouin-Jha, O.S., Prockter, L.M. [2008]. Icarus 193, 39). If this idea holds true, the observed groove distribution could be explained as the result of possible major impacts on the larger parent body, which were inherited by the "Phobos shard".

  2. Experimental Studies on Grooved Surfaces to Suppress Secondary Electron Emission

    SciTech Connect

    Suetsugu, Y.; Fukuma, H.; Shibata, K.; Pivi, M.; Wang, L.; /SLAC

    2010-06-15

    Grooved surfaces are effective to suppress the secondary electron emission, and can be a promising technique to mitigate the electron cloud effect in positron/proton storage rings. Aiming for the application in a dipole-type magnetic field, various shapes of triangular grooved surfaces have been studied at KEK. The grooves tested here have vertex angles of 20-30{sup o}, depths of 2.5-5.0 mm, and vertex roundness of 0.05-0.2 mm. In a laboratory, the secondary electron yields (SEY) of small test pieces were measured using an electron beam in a magnetic-free condition. The grooved surfaces clearly had low SEY compared to flat surfaces of the same materials. The grooves with sharper vertexes had smaller SEY. A test chamber installed in a wiggler magnet of the KEKB positron ring was used to investigate the efficacy of the grooved surface in a strong magnetic field. In the chamber, a remarkable reduction in the electron density around the beam orbit was observed compared to the case of a flat surface with TiN coating.

  3. Droplet impact on regular micro-grooved surfaces

    NASA Astrophysics Data System (ADS)

    Hu, Hai-Bao; Huang, Su-He; Chen, Li-Bin

    2013-08-01

    We have investigated experimentally the process of a droplet impact on a regular micro-grooved surface. The target surfaces are patterned such that micro-scale spokes radiate from the center, concentric circles, and parallel lines on the polishing copper plate, using Quasi-LIGA molding technology. The dynamic behavior of water droplets impacting on these structured surfaces is examined using a high-speed camera, including the drop impact processes, the maximum spreading diameters, and the lengths and numbers of fingers at different values of Weber number. Experimental results validate that the spreading processes are arrested on all target surfaces at low velocity. Also, the experimental results at higher impact velocity demonstrate that the spreading process is conducted on the surface parallel to the micro-grooves, but is arrested in the direction perpendicular to the micro-grooves. Besides, the lengths of fingers increase observably, even when they are ejected out as tiny droplets along the groove direction, at the same time the drop recoil velocity is reduced by micro-grooves which are parallel to the spreading direction, but not by micro-grooves which are vertical to the spreading direction.

  4. Polarizability of the active site of cytochrome c reduces the activation barrier for electron transfer.

    PubMed

    Dinpajooh, Mohammadhasan; Martin, Daniel R; Matyushov, Dmitry V

    2016-01-01

    Enzymes in biology's energy chains operate with low energy input distributed through multiple electron transfer steps between protein active sites. The general challenge of biological design is how to lower the activation barrier without sacrificing a large negative reaction free energy. We show that this goal is achieved through a large polarizability of the active site. It is polarized by allowing a large number of excited states, which are populated quantum mechanically by electrostatic fluctuations of the protein and hydration water shells. This perspective is achieved by extensive mixed quantum mechanical/molecular dynamics simulations of the half reaction of reduction of cytochrome c. The barrier for electron transfer is consistently lowered by increasing the number of excited states included in the Hamiltonian of the active site diagonalized along the classical trajectory. We suggest that molecular polarizability, in addition to much studied electrostatics of permanent charges, is a key parameter to consider in order to understand how enzymes work. PMID:27306204

  5. Polarizability of the active site of cytochrome c reduces the activation barrier for electron transfer

    NASA Astrophysics Data System (ADS)

    Dinpajooh, Mohammadhasan; Martin, Daniel R.; Matyushov, Dmitry V.

    2016-06-01

    Enzymes in biology’s energy chains operate with low energy input distributed through multiple electron transfer steps between protein active sites. The general challenge of biological design is how to lower the activation barrier without sacrificing a large negative reaction free energy. We show that this goal is achieved through a large polarizability of the active site. It is polarized by allowing a large number of excited states, which are populated quantum mechanically by electrostatic fluctuations of the protein and hydration water shells. This perspective is achieved by extensive mixed quantum mechanical/molecular dynamics simulations of the half reaction of reduction of cytochrome c. The barrier for electron transfer is consistently lowered by increasing the number of excited states included in the Hamiltonian of the active site diagonalized along the classical trajectory. We suggest that molecular polarizability, in addition to much studied electrostatics of permanent charges, is a key parameter to consider in order to understand how enzymes work.

  6. Polarizability of the active site of cytochrome c reduces the activation barrier for electron transfer

    PubMed Central

    Dinpajooh, Mohammadhasan; Martin, Daniel R.; Matyushov, Dmitry V.

    2016-01-01

    Enzymes in biology’s energy chains operate with low energy input distributed through multiple electron transfer steps between protein active sites. The general challenge of biological design is how to lower the activation barrier without sacrificing a large negative reaction free energy. We show that this goal is achieved through a large polarizability of the active site. It is polarized by allowing a large number of excited states, which are populated quantum mechanically by electrostatic fluctuations of the protein and hydration water shells. This perspective is achieved by extensive mixed quantum mechanical/molecular dynamics simulations of the half reaction of reduction of cytochrome c. The barrier for electron transfer is consistently lowered by increasing the number of excited states included in the Hamiltonian of the active site diagonalized along the classical trajectory. We suggest that molecular polarizability, in addition to much studied electrostatics of permanent charges, is a key parameter to consider in order to understand how enzymes work. PMID:27306204

  7. Crystal structure of the dithiol oxidase DsbA enzyme from proteus mirabilis bound non-covalently to an active site peptide ligand.

    PubMed

    Kurth, Fabian; Duprez, Wilko; Premkumar, Lakshmanane; Schembri, Mark A; Fairlie, David P; Martin, Jennifer L

    2014-07-11

    The disulfide bond forming DsbA enzymes and their DsbB interaction partners are attractive targets for development of antivirulence drugs because both are essential for virulence factor assembly in Gram-negative pathogens. Here we characterize PmDsbA from Proteus mirabilis, a bacterial pathogen increasingly associated with multidrug resistance. PmDsbA exhibits the characteristic properties of a DsbA, including an oxidizing potential, destabilizing disulfide, acidic active site cysteine, and dithiol oxidase catalytic activity. We evaluated a peptide, PWATCDS, derived from the partner protein DsbB and showed by thermal shift and isothermal titration calorimetry that it binds to PmDsbA. The crystal structures of PmDsbA, and the active site variant PmDsbAC30S were determined to high resolution. Analysis of these structures allows categorization of PmDsbA into the DsbA class exemplified by the archetypal Escherichia coli DsbA enzyme. We also present a crystal structure of PmDsbAC30S in complex with the peptide PWATCDS. The structure shows that the peptide binds non-covalently to the active site CXXC motif, the cis-Pro loop, and the hydrophobic groove adjacent to the active site of the enzyme. This high-resolution structural data provides a critical advance for future structure-based design of non-covalent peptidomimetic inhibitors. Such inhibitors would represent an entirely new antibacterial class that work by switching off the DSB virulence assembly machinery. PMID:24831013

  8. Crystal Structure of the Dithiol Oxidase DsbA Enzyme from Proteus Mirabilis Bound Non-covalently to an Active Site Peptide Ligand

    PubMed Central

    Kurth, Fabian; Duprez, Wilko; Premkumar, Lakshmanane; Schembri, Mark A.; Fairlie, David P.; Martin, Jennifer L.

    2014-01-01

    The disulfide bond forming DsbA enzymes and their DsbB interaction partners are attractive targets for development of antivirulence drugs because both are essential for virulence factor assembly in Gram-negative pathogens. Here we characterize PmDsbA from Proteus mirabilis, a bacterial pathogen increasingly associated with multidrug resistance. PmDsbA exhibits the characteristic properties of a DsbA, including an oxidizing potential, destabilizing disulfide, acidic active site cysteine, and dithiol oxidase catalytic activity. We evaluated a peptide, PWATCDS, derived from the partner protein DsbB and showed by thermal shift and isothermal titration calorimetry that it binds to PmDsbA. The crystal structures of PmDsbA, and the active site variant PmDsbAC30S were determined to high resolution. Analysis of these structures allows categorization of PmDsbA into the DsbA class exemplified by the archetypal Escherichia coli DsbA enzyme. We also present a crystal structure of PmDsbAC30S in complex with the peptide PWATCDS. The structure shows that the peptide binds non-covalently to the active site CXXC motif, the cis-Pro loop, and the hydrophobic groove adjacent to the active site of the enzyme. This high-resolution structural data provides a critical advance for future structure-based design of non-covalent peptidomimetic inhibitors. Such inhibitors would represent an entirely new antibacterial class that work by switching off the DSB virulence assembly machinery. PMID:24831013

  9. The copper active site of CBM33 polysaccharide oxygenases.

    PubMed

    Hemsworth, Glyn R; Taylor, Edward J; Kim, Robbert Q; Gregory, Rebecca C; Lewis, Sally J; Turkenburg, Johan P; Parkin, Alison; Davies, Gideon J; Walton, Paul H

    2013-04-24

    The capacity of metal-dependent fungal and bacterial polysaccharide oxygenases, termed GH61 and CBM33, respectively, to potentiate the enzymatic degradation of cellulose opens new possibilities for the conversion of recalcitrant biomass to biofuels. GH61s have already been shown to be unique metalloenzymes containing an active site with a mononuclear copper ion coordinated by two histidines, one of which is an unusual τ-N-methylated N-terminal histidine. We now report the structural and spectroscopic characterization of the corresponding copper CBM33 enzymes. CBM33 binds copper with high affinity at a mononuclear site, significantly stabilizing the enzyme. X-band EPR spectroscopy of Cu(II)-CBM33 shows a mononuclear type 2 copper site with the copper ion in a distorted axial coordination sphere, into which azide will coordinate as evidenced by the concomitant formation of a new absorption band in the UV/vis spectrum at 390 nm. The enzyme's three-dimensional structure contains copper, which has been photoreduced to Cu(I) by the incident X-rays, confirmed by X-ray absorption/fluorescence studies of both aqueous solution and intact crystals of Cu-CBM33. The single copper(I) ion is ligated in a T-shaped configuration by three nitrogen atoms from two histidine side chains and the amino terminus, similar to the endogenous copper coordination geometry found in fungal GH61. PMID:23540833

  10. The Copper Active Site of CBM33 Polysaccharide Oxygenases

    PubMed Central

    2013-01-01

    The capacity of metal-dependent fungal and bacterial polysaccharide oxygenases, termed GH61 and CBM33, respectively, to potentiate the enzymatic degradation of cellulose opens new possibilities for the conversion of recalcitrant biomass to biofuels. GH61s have already been shown to be unique metalloenzymes containing an active site with a mononuclear copper ion coordinated by two histidines, one of which is an unusual τ-N-methylated N-terminal histidine. We now report the structural and spectroscopic characterization of the corresponding copper CBM33 enzymes. CBM33 binds copper with high affinity at a mononuclear site, significantly stabilizing the enzyme. X-band EPR spectroscopy of Cu(II)-CBM33 shows a mononuclear type 2 copper site with the copper ion in a distorted axial coordination sphere, into which azide will coordinate as evidenced by the concomitant formation of a new absorption band in the UV/vis spectrum at 390 nm. The enzyme’s three-dimensional structure contains copper, which has been photoreduced to Cu(I) by the incident X-rays, confirmed by X-ray absorption/fluorescence studies of both aqueous solution and intact crystals of Cu-CBM33. The single copper(I) ion is ligated in a T-shaped configuration by three nitrogen atoms from two histidine side chains and the amino terminus, similar to the endogenous copper coordination geometry found in fungal GH61. PMID:23540833

  11. An Active Site Water Network in the Plasminogen Activator Pla from Yersinia pestis

    SciTech Connect

    Eren, Elif; Murphy, Megan; Goguen, Jon; van den Berg, Bert

    2010-08-13

    The plasminogen activator Pla from Yersinia pestis is an outer membrane protease (omptin) that is important for the virulence of plague. Here, we present the high-resolution crystal structure of wild-type, enzymatically active Pla at 1.9 {angstrom}. The structure shows a water molecule located between active site residues D84 and H208, which likely corresponds to the nucleophilic water. A number of other water molecules are present in the active site, linking residues important for enzymatic activity. The R211 sidechain in loop L4 is close to the nucleophilic water and possibly involved in the stabilization of the oxyanion intermediate. Subtle conformational changes of H208 result from the binding of lipopolysaccharide to the outside of the barrel, explaining the unusual dependence of omptins on lipopolysaccharide for activity. The Pla structure suggests a model for the interaction with plasminogen substrate and provides a more detailed understanding of the catalytic mechanism of omptin proteases.

  12. Target-classification approach applied to active UXO sites

    NASA Astrophysics Data System (ADS)

    Shubitidze, F.; Fernández, J. P.; Shamatava, Irma; Barrowes, B. E.; O'Neill, K.

    2013-06-01

    This study is designed to illustrate the discrimination performance at two UXO active sites (Oklahoma's Fort Sill and the Massachusetts Military Reservation) of a set of advanced electromagnetic induction (EMI) inversion/discrimination models which include the orthonormalized volume magnetic source (ONVMS), joint diagonalization (JD), and differential evolution (DE) approaches and whose power and flexibility greatly exceed those of the simple dipole model. The Fort Sill site is highly contaminated by a mix of the following types of munitions: 37-mm target practice tracers, 60-mm illumination mortars, 75-mm and 4.5'' projectiles, 3.5'', 2.36'', and LAAW rockets, antitank mine fuzes with and without hex nuts, practice MK2 and M67 grenades, 2.5'' ballistic windshields, M2A1-mines with/without bases, M19-14 time fuzes, and 40-mm practice grenades with/without cartridges. The site at the MMR site contains targets of yet different sizes. In this work we apply our models to EMI data collected using the MetalMapper (MM) and 2 × 2 TEMTADS sensors. The data for each anomaly are inverted to extract estimates of the extrinsic and intrinsic parameters associated with each buried target. (The latter include the total volume magnetic source or NVMS, which relates to size, shape, and material properties; the former includes location, depth, and orientation). The estimated intrinsic parameters are then used for classification performed via library matching and the use of statistical classification algorithms; this process yielded prioritized dig-lists that were submitted to the Institute for Defense Analyses (IDA) for independent scoring. The models' classification performance is illustrated and assessed based on these independent evaluations.

  13. Differential Active Site Loop Conformations Mediate Promiscuous Activities in the Lactonase SsoPox

    PubMed Central

    Elias, Mikael; Chabriere, Eric

    2013-01-01

    Enzymes are proficient catalysts that enable fast rates of Michaelis-complex formation, the chemical step and products release. These different steps may require different conformational states of the active site that have distinct binding properties. Moreover, the conformational flexibility of the active site mediates alternative, promiscuous functions. Here we focused on the lactonase SsoPox from Sulfolobus solfataricus. SsoPox is a native lactonase endowed with promiscuous phosphotriesterase activity. We identified a position in the active site loop (W263) that governs its flexibility, and thereby affects the substrate specificity of the enzyme. We isolated two different sets of substitutions at position 263 that induce two distinct conformational sampling of the active loop and characterized the structural and kinetic effects of these substitutions. These sets of mutations selectively and distinctly mediate the improvement of the promiscuous phosphotriesterase and oxo-lactonase activities of SsoPox by increasing active-site loop flexibility. These observations corroborate the idea that conformational diversity governs enzymatic promiscuity and is a key feature of protein evolvability. PMID:24086491

  14. Structural and Dynamic Characterization of Polymerase κ’s Minor Groove Lesion Processing Reveals How Adduct Topology Impacts Fidelity

    PubMed Central

    2015-01-01

    DNA lesion bypass polymerases process different lesions with varying fidelities, but the structural, dynamic, and mechanistic origins of this phenomenon remain poorly understood. Human DNA polymerase κ (Polκ), a member of the Y family of lesion bypass polymerases, is specialized to bypass bulky DNA minor groove lesions in a predominantly error-free manner, by housing them in its unique gap. We have investigated the role of the unique Polκ gap and N-clasp structural features in the fidelity of minor groove lesion processing with extensive molecular modeling and molecular dynamics simulations to pinpoint their functioning in lesion bypass. Here we consider the N2-dG covalent adduct derived from the carcinogenic aromatic amine, 2-acetylaminofluorene (dG-N2-AAF), that is produced via the combustion of kerosene and diesel fuel. Our simulations reveal how the spacious gap directionally accommodates the lesion aromatic ring system as it transits through the stages of incorporation of the predominant correct partner dCTP opposite the damaged guanine, with preservation of local active site organization for nucleotidyl transfer. Furthermore, flexibility in Polκ’s N-clasp facilitates the significant misincorporation of dTTP opposite dG-N2-AAF via wobble pairing. Notably, we show that N-clasp flexibility depends on lesion topology, being markedly reduced in the case of the benzo[a]pyrene-derived major adduct to N2-dG, whose bypass by Polκ is nearly error-free. Thus, our studies reveal how Polκ’s unique structural and dynamic properties can regulate its bypass fidelity of polycyclic aromatic lesions and how the fidelity is impacted by lesion structures. PMID:25148552

  15. Spectroscopic Definition of the Ferroxidase Site in M Ferritin: Comparison of Binuclear Substrate vs. Cofactor Active Sites

    PubMed Central

    Schwartz, Jennifer K.; Liu, Xiaofeng S.; Tosha, Takehiko; Theil, Elizabeth C.; Solomon, Edward I.

    2008-01-01

    Maxi ferritins, 24 subunit protein nanocages, are essential in humans, plants, bacteria, and other animals for the concentration and storage of iron as hydrated ferric oxide, while minimizing free radical generation or use by pathogens. Formation of the precursors to these ferric oxides is catalyzed at a non-heme biferrous substrate site, which has some parallels with the cofactor sites in other biferrous enzymes. A combination of circular dichroism (CD), magnetic circular dichroism (MCD), and variable-temperature, variable-field MCD (VTVH MCD) has been used to probe Fe(II) binding to the substrate active site in frog M ferritin. These data determined that the active site within each subunit consists of two inequivalent five-coordinate (5C) ferrous centers that are weakly anti-ferromagnetically coupled, consistent with a μ-1,3 carboxylate bridge. The active site ligand set is unusual and likely includes a terminal water bound to each Fe(II) center. The Fe(II) ions bind to the active sites in a concerted manner, and cooperativity among the sites in each subunit is observed, potentially providing a mechanism for the control of ferritin iron loading. Differences in geometric and electronic structure – including a weak ligand field, availability of two water ligands at the biferrous substrate site, and the single carboxylate bridge in ferritin – coincide with the divergent reaction pathways observed between this substrate site and the previously studied cofactor active sites. PMID:18576633

  16. Metal active site elasticity linked to activation of homocysteine in methionine synthases

    SciTech Connect

    Koutmos, Markos; Pejchal, Robert; Bomer, Theresa M.; Matthews, Rowena G.; Smith, Janet L.; Ludwig, Martha L.

    2008-04-02

    Enzymes possessing catalytic zinc centers perform a variety of fundamental processes in nature, including methyl transfer to thiols. Cobalamin-independent (MetE) and cobalamin-dependent (MetH) methionine synthases are two such enzyme families. Although they perform the same net reaction, transfer of a methyl group from methyltetrahydrofolate to homocysteine (Hcy) to form methionine, they display markedly different catalytic strategies, modular organization, and active site zinc centers. Here we report crystal structures of zinc-replete MetE and MetH, both in the presence and absence of Hcy. Structural investigation of the catalytic zinc sites of these two methyltransferases reveals an unexpected inversion of zinc geometry upon binding of Hcy and displacement of an endogenous ligand in both enzymes. In both cases a significant movement of the zinc relative to the protein scaffold accompanies inversion. These structures provide new information on the activation of thiols by zinc-containing enzymes and have led us to propose a paradigm for the mechanism of action of the catalytic zinc sites in these and related methyltransferases. Specifically, zinc is mobile in the active sites of MetE and MetH, and its dynamic nature helps facilitate the active site conformational changes necessary for thiol activation and methyl transfer.

  17. Evidence for segmental mobility in the active site of pepsin

    SciTech Connect

    Pohl, J.; Strop, P.; Senn, H.; Foundling, S.; Kostka, V.

    1986-05-01

    The low hydrolytic activity (k/sub cat/ < 0.001 s/sup -1/) of chicken pepsin (CP) towards tri- and tetrapeptides is enhanced at least 100 times by modification of its single sulfhydryl group of Cys-115, with little effect on K/sub m/-values. Modification thus simulates the effect of secondary substrate binding on pepsin catalysis. The rate of Cys-115 modification is substantially decreased in the presence of some competitive inhibitors, suggesting its active site location. Experiments with CP alkylated at Cys-115 with Acrylodan as a fluorescent probe or with N-iodoacetyl-(4-fluoro)-aniline as a /sup 19/F-nmr probe suggest conformation change around Cys-115 to occur on substrate or substrate analog binding. The difference /sup 1/H-nmr spectra (500 MHz) of unmodified free and inhibitor-complexed CP reveal chemical shifts almost exclusively in the aromatic region. The effects of Cu/sup + +/ on /sup 19/F- and /sup 1/H-nmr spectra have been studied. Examination of a computer graphics model of CP based on E. parasitica pepsin-inhibitor complex X-ray coordinates suggests that Cys-115 is located near the S/sub 3//S/sub 5/ binding site. The results are interpreted in favor of segmental mobility of this region important for pepsin substrate binding and catalysis.

  18. Perchlorate Reductase Is Distinguished by Active Site Aromatic Gate Residues.

    PubMed

    Youngblut, Matthew D; Tsai, Chi-Lin; Clark, Iain C; Carlson, Hans K; Maglaqui, Adrian P; Gau-Pan, Phonchien S; Redford, Steven A; Wong, Alan; Tainer, John A; Coates, John D

    2016-04-22

    Perchlorate is an important ion on both Earth and Mars. Perchlorate reductase (PcrAB), a specialized member of the dimethylsulfoxide reductase superfamily, catalyzes the first step of microbial perchlorate respiration, but little is known about the biochemistry, specificity, structure, and mechanism of PcrAB. Here we characterize the biophysics and phylogeny of this enzyme and report the 1.86-Å resolution PcrAB complex crystal structure. Biochemical analysis revealed a relatively high perchlorate affinity (Km = 6 μm) and a characteristic substrate inhibition compared with the highly similar respiratory nitrate reductase NarGHI, which has a relatively much lower affinity for perchlorate (Km = 1.1 mm) and no substrate inhibition. Structural analysis of oxidized and reduced PcrAB with and without the substrate analog SeO3 (2-) bound to the active site identified key residues in the positively charged and funnel-shaped substrate access tunnel that gated substrate entrance and product release while trapping transiently produced chlorate. The structures suggest gating was associated with shifts of a Phe residue between open and closed conformations plus an Asp residue carboxylate shift between monodentate and bidentate coordination to the active site molybdenum atom. Taken together, structural and mutational analyses of gate residues suggest key roles of these gate residues for substrate entrance and product release. Our combined results provide the first detailed structural insight into the mechanism of biological perchlorate reduction, a critical component of the chlorine redox cycle on Earth. PMID:26940877

  19. Eel calcitonin binding site distribution and antinociceptive activity in rats

    SciTech Connect

    Guidobono, F.; Netti, C.; Sibilia, V.; Villa, I.; Zamboni, A.; Pecile, A.

    1986-03-01

    The distribution of binding site for (/sup 125/I)-eel-calcitonin (ECT) to rat central nervous system, studied by an autoradiographic technique, showed concentrations of binding in the diencephalon, the brain stem and the spinal cord. Large accumulations of grains were seen in the hypothalamus, the amygdala, in the fasciculus medialis prosencephali, in the fasciculus longitudinalis medialis, in the ventrolateral part of the periventricular gray matter, in the lemniscus medialis and in the raphe nuclei. The density of grains in the reticular formation and in the nucleus tractus spinalis nervi trigemini was more moderate. In the spinal cord, grains were scattered throughout the dorsal horns. Binding of the ligand was displaced equally by cold ECT and by salmon CT(sCT), indicating that both peptides bind to the same receptors. Human CT was much weaker than sCT in displacing (/sup 125/I)-ECT binding. The administration of ECT into the brain ventricles of rats dose-dependently induced a significant and long-lasting enhancement of hot-plate latencies comparable with that obtained with sCT. The antinociceptive activity induced by ECT is compatible with the topographical distribution of binding sites for the peptide and is a further indication that fish CTs are active in the mammalian brain.

  20. Large, sequence-dependent effects on DNA conformation by minor groove binding compounds

    PubMed Central

    Tevis, Denise S.; Kumar, Arvind; Stephens, Chad E.; Boykin, David W.; Wilson, W. David

    2009-01-01

    To determine what topological changes antiparasitic heterocyclic dications can have on kinetoplast DNA, we have constructed ligation ladders, with phased A5 and ATATA sequences in the same flanking sequence context, as models. Bending by the A5 tract is observed, as expected, while the ATATA sequence bends DNA very little. Complexes of these DNAs with three diamidines containing either furan, thiophene or selenophene groups flanked by phenylamidines were investigated along with netropsin. With the bent A5 ladder the compounds caused either a slight increase or decrease in the bending angle. Surprisingly, however, with ATATA all of the compounds caused significant bending, to values close to or even greater than the A5 bend angle. Results with a mixed cis sequence, which has one A5 and one ATATA, show that the compounds bend ATATA in the same direction as a reference A5 tract, that is, into the minor groove. These results are interpreted in terms of a groove structure for A5 which is largely pre-organized for a fit to the heterocyclic amidines. With ATATA the groove is intrinsically wider and must close to bind the compounds tightly. The conformational change at the binding site then leads to significant bending of the alternating DNA sequence. PMID:19578063

  1. Active Sites Environmental Monitoring Program: Program plan. Revision 1

    SciTech Connect

    Ashwood, T.L.; Wickliff, D.S.; Morrissey, C.M.

    1992-02-01

    The Active Sites Environmental Monitoring Program (ASEMP), initiated in 1989, provides early detection and performance monitoring of transuranic (TRU) waste and active low-level waste (LLW) facilities at Oak Ridge National Laboratory (ORNL) in accordance with US Department of Energy (DOE) Order 5820.2A. Active LLW facilities in Solid Waste Storage Area (SWSA) 6 include Tumulus I and Tumulus II, the Interim Waste Management Facility (IWMF), LLW silos, high-range wells, asbestos silos, and fissile wells. The tumulus pads and IWMF are aboveground, high-strength concrete pads on which concrete vaults containing metal boxes of LLW are placed; the void space between the boxes and vaults is filled with grout. Eventually, these pads and vaults will be covered by an engineered multilayered cap. All other LLW facilities in SWSA 6 are below ground. In addition, this plan includes monitoring of the Hillcut Disposal Test Facility (HDTF) in SWSA 6, even though this facility was completed prior to the data of the DOE order. In SWSA 5 North, the TRU facilities include below-grade engineered caves, high-range wells, and unlined trenches. All samples from SWSA 6 are screened for alpha and beta activity, counted for gamma-emitting isotopes, and analyzed for tritium. In addition to these analytes, samples from SWSA 5 North are analyzed for specific transuranic elements.

  2. Active Site and Laminarin Binding in Glycoside Hydrolase Family 55*

    PubMed Central

    Bianchetti, Christopher M.; Takasuka, Taichi E.; Deutsch, Sam; Udell, Hannah S.; Yik, Eric J.; Bergeman, Lai F.; Fox, Brian G.

    2015-01-01

    The Carbohydrate Active Enzyme (CAZy) database indicates that glycoside hydrolase family 55 (GH55) contains both endo- and exo-β-1,3-glucanases. The founding structure in the GH55 is PcLam55A from the white rot fungus Phanerochaete chrysosporium (Ishida, T., Fushinobu, S., Kawai, R., Kitaoka, M., Igarashi, K., and Samejima, M. (2009) Crystal structure of glycoside hydrolase family 55 β-1,3-glucanase from the basidiomycete Phanerochaete chrysosporium. J. Biol. Chem. 284, 10100–10109). Here, we present high resolution crystal structures of bacterial SacteLam55A from the highly cellulolytic Streptomyces sp. SirexAA-E with bound substrates and product. These structures, along with mutagenesis and kinetic studies, implicate Glu-502 as the catalytic acid (as proposed earlier for Glu-663 in PcLam55A) and a proton relay network of four residues in activating water as the nucleophile. Further, a set of conserved aromatic residues that define the active site apparently enforce an exo-glucanase reactivity as demonstrated by exhaustive hydrolysis reactions with purified laminarioligosaccharides. Two additional aromatic residues that line the substrate-binding channel show substrate-dependent conformational flexibility that may promote processive reactivity of the bound oligosaccharide in the bacterial enzymes. Gene synthesis carried out on ∼30% of the GH55 family gave 34 active enzymes (19% functional coverage of the nonredundant members of GH55). These active enzymes reacted with only laminarin from a panel of 10 different soluble and insoluble polysaccharides and displayed a broad range of specific activities and optima for pH and temperature. Application of this experimental method provides a new, systematic way to annotate glycoside hydrolase phylogenetic space for functional properties. PMID:25752603

  3. Active site and laminarin binding in glycoside hydrolase family 55.

    PubMed

    Bianchetti, Christopher M; Takasuka, Taichi E; Deutsch, Sam; Udell, Hannah S; Yik, Eric J; Bergeman, Lai F; Fox, Brian G

    2015-05-01

    The Carbohydrate Active Enzyme (CAZy) database indicates that glycoside hydrolase family 55 (GH55) contains both endo- and exo-β-1,3-glucanases. The founding structure in the GH55 is PcLam55A from the white rot fungus Phanerochaete chrysosporium (Ishida, T., Fushinobu, S., Kawai, R., Kitaoka, M., Igarashi, K., and Samejima, M. (2009) Crystal structure of glycoside hydrolase family 55 β-1,3-glucanase from the basidiomycete Phanerochaete chrysosporium. J. Biol. Chem. 284, 10100-10109). Here, we present high resolution crystal structures of bacterial SacteLam55A from the highly cellulolytic Streptomyces sp. SirexAA-E with bound substrates and product. These structures, along with mutagenesis and kinetic studies, implicate Glu-502 as the catalytic acid (as proposed earlier for Glu-663 in PcLam55A) and a proton relay network of four residues in activating water as the nucleophile. Further, a set of conserved aromatic residues that define the active site apparently enforce an exo-glucanase reactivity as demonstrated by exhaustive hydrolysis reactions with purified laminarioligosaccharides. Two additional aromatic residues that line the substrate-binding channel show substrate-dependent conformational flexibility that may promote processive reactivity of the bound oligosaccharide in the bacterial enzymes. Gene synthesis carried out on ∼30% of the GH55 family gave 34 active enzymes (19% functional coverage of the nonredundant members of GH55). These active enzymes reacted with only laminarin from a panel of 10 different soluble and insoluble polysaccharides and displayed a broad range of specific activities and optima for pH and temperature. Application of this experimental method provides a new, systematic way to annotate glycoside hydrolase phylogenetic space for functional properties. PMID:25752603

  4. Active Site Loop Conformation Regulates Promiscuous Activity in a Lactonase from Geobacillus kaustophilus HTA426

    PubMed Central

    Zhang, Yu; An, Jiao; Yang, Guang-Yu; Bai, Aixi; Zheng, Baisong; Lou, Zhiyong; Wu, Geng; Ye, Wei; Chen, Hai-Feng; Feng, Yan; Manco, Giuseppe

    2015-01-01

    Enzyme promiscuity is a prerequisite for fast divergent evolution of biocatalysts. A phosphotriesterase-like lactonase (PLL) from Geobacillus kaustophilus HTA426 (GkaP) exhibits main lactonase and promiscuous phosphotriesterase activities. To understand its catalytic and evolutionary mechanisms, we investigated a “hot spot” in the active site by saturation mutagenesis as well as X-ray crystallographic analyses. We found that position 99 in the active site was involved in substrate discrimination. One mutant, Y99L, exhibited 11-fold improvement over wild-type in reactivity (kcat/Km) toward the phosphotriesterase substrate ethyl-paraoxon, but showed 15-fold decrease toward the lactonase substrate δ-decanolactone, resulting in a 157-fold inversion of the substrate specificity. Structural analysis of Y99L revealed that the mutation causes a ∼6.6 Å outward shift of adjacent loop 7, which may cause increased flexibility of the active site and facilitate accommodation and/or catalysis of organophosphate substrate. This study provides for the PLL family an example of how the evolutionary route from promiscuity to specificity can derive from very few mutations, which promotes alteration in the conformational adjustment of the active site loops, in turn draws the capacity of substrate binding and activity. PMID:25706379

  5. To trigger apoptosis, Bak exposes its BH3 domain and homodimerizes via BH3:groove interactions.

    PubMed

    Dewson, Grant; Kratina, Tobias; Sim, Huiyan W; Puthalakath, Hamsa; Adams, Jerry M; Colman, Peter M; Kluck, Ruth M

    2008-05-01

    The Bcl-2 relative Bak is thought to drive apoptosis by forming homo-oligomers that permeabilize mitochondria, but how it is activated and oligomerizes is unclear. To clarify these pivotal steps toward apoptosis, we have characterized multiple random loss-of-function Bak mutants and explored the mechanism of Bak conformation change during apoptosis. Single missense mutations located to the alpha helix 2-5 region of Bak, with most altering the BH3 domain or hydrophobic groove (BH1 domain). Loss of function invariably corresponded to impaired ability to oligomerize. An essential early step in Bak activation was shown to be exposure of the BH3 domain, which became reburied in dimers. We demonstrate that oligomerization involves insertion of the BH3 domain of one Bak molecule into the groove of another and may produce symmetric Bak dimers. We conclude that this BH3:groove interaction is essential to nucleate Bak oligomerization, which in turn is required for its proapoptotic function. PMID:18471982

  6. Molecular Probing of the HPV-16 E6 Protein Alpha Helix Binding Groove with Small Molecule Inhibitors

    PubMed Central

    Rietz, Anne; Petrov, Dino P.; Bartolowits, Matthew; DeSmet, Marsha; Davisson, V. Jo; Androphy, Elliot J.

    2016-01-01

    The human papillomavirus (HPV) HPV E6 protein has emerged as a central oncoprotein in HPV-associated cancers in which sustained expression is required for tumor progression. A majority of the E6 protein interactions within the human proteome use an alpha-helix groove interface for binding. The UBE3A/E6AP HECT domain ubiquitin ligase binds E6 at this helix-groove interface. This enables formation of a trimeric complex with p53, resulting in destruction of this tumor suppressor. While recent x-ray crystal structures are useful, examples of small molecule probes that can modulate protein interactions at this interface are limited. To develop insights useful for potential structure-based design of ligands for HPV E6, a series of 2,6-disubstituted benzopyranones were prepared and tested as competitive antagonists of E6-E6AP helix-groove interactions. These small molecule probes were used in both binding and functional assays to evaluate recognition features of the E6 protein. Evidence for an ionic functional group interaction within the helix groove was implicated by the structure-activity among the highest affinity ligands. The molecular topographies of these protein-ligand interactions were evaluated by comparing the binding and activities of single amino acid E6 mutants with the results of molecular dynamic simulations. A group of arginine residues that form a rim-cap over the E6 helix groove offer compensatory roles in binding and recognition of the small molecule probes. The flexibility and impact on the overall helix-groove shape dictated by these residues offer new insights for structure-based targeting of HPV E6. PMID:26915086

  7. Molecular Probing of the HPV-16 E6 Protein Alpha Helix Binding Groove with Small Molecule Inhibitors.

    PubMed

    Rietz, Anne; Petrov, Dino P; Bartolowits, Matthew; DeSmet, Marsha; Davisson, V Jo; Androphy, Elliot J

    2016-01-01

    The human papillomavirus (HPV) HPV E6 protein has emerged as a central oncoprotein in HPV-associated cancers in which sustained expression is required for tumor progression. A majority of the E6 protein interactions within the human proteome use an alpha-helix groove interface for binding. The UBE3A/E6AP HECT domain ubiquitin ligase binds E6 at this helix-groove interface. This enables formation of a trimeric complex with p53, resulting in destruction of this tumor suppressor. While recent x-ray crystal structures are useful, examples of small molecule probes that can modulate protein interactions at this interface are limited. To develop insights useful for potential structure-based design of ligands for HPV E6, a series of 2,6-disubstituted benzopyranones were prepared and tested as competitive antagonists of E6-E6AP helix-groove interactions. These small molecule probes were used in both binding and functional assays to evaluate recognition features of the E6 protein. Evidence for an ionic functional group interaction within the helix groove was implicated by the structure-activity among the highest affinity ligands. The molecular topographies of these protein-ligand interactions were evaluated by comparing the binding and activities of single amino acid E6 mutants with the results of molecular dynamic simulations. A group of arginine residues that form a rim-cap over the E6 helix groove offer compensatory roles in binding and recognition of the small molecule probes. The flexibility and impact on the overall helix-groove shape dictated by these residues offer new insights for structure-based targeting of HPV E6. PMID:26915086

  8. Extensive site-directed mutagenesis reveals interconnected functional units in the alkaline phosphatase active site.

    PubMed

    Sunden, Fanny; Peck, Ariana; Salzman, Julia; Ressl, Susanne; Herschlag, Daniel

    2015-01-01

    Enzymes enable life by accelerating reaction rates to biological timescales. Conventional studies have focused on identifying the residues that have a direct involvement in an enzymatic reaction, but these so-called 'catalytic residues' are embedded in extensive interaction networks. Although fundamental to our understanding of enzyme function, evolution, and engineering, the properties of these networks have yet to be quantitatively and systematically explored. We dissected an interaction network of five residues in the active site of Escherichia coli alkaline phosphatase. Analysis of the complex catalytic interdependence of specific residues identified three energetically independent but structurally interconnected functional units with distinct modes of cooperativity. From an evolutionary perspective, this network is orders of magnitude more probable to arise than a fully cooperative network. From a functional perspective, new catalytic insights emerge. Further, such comprehensive energetic characterization will be necessary to benchmark the algorithms required to rationally engineer highly efficient enzymes. PMID:25902402

  9. Metavanadate at the active site of the phosphatase VHZ.

    PubMed

    Kuznetsov, Vyacheslav I; Alexandrova, Anastassia N; Hengge, Alvan C

    2012-09-01

    Vanadate is a potent modulator of a number of biological processes and has been shown by crystal structures and NMR spectroscopy to interact with numerous enzymes. Although these effects often occur under conditions where oligomeric forms dominate, the crystal structures and NMR data suggest that the inhibitory form is usually monomeric orthovanadate, a particularly good inhibitor of phosphatases because of its ability to form stable trigonal-bipyramidal complexes. We performed a computational analysis of a 1.14 Å structure of the phosphatase VHZ in complex with an unusual metavanadate species and compared it with two classical trigonal-bipyramidal vanadate-phosphatase complexes. The results support extensive delocalized bonding to the apical ligands in the classical structures. In contrast, in the VHZ metavanadate complex, the central, planar VO(3)(-) moiety has only one apical ligand, the nucleophilic Cys95, and a gap in electron density between V and S. A computational analysis showed that the V-S interaction is primarily ionic. A mechanism is proposed to explain the formation of metavanadate in the active site from a dimeric vanadate species that previous crystallographic evidence has shown to be able to bind to the active sites of phosphatases related to VHZ. Together, the results show that the interaction of vanadate with biological systems is not solely reliant upon the prior formation of a particular inhibitory form in solution. The catalytic properties of an enzyme may act upon the oligomeric forms primarily present in solution to generate species such as the metavanadate ion observed in the VHZ structure. PMID:22876963

  10. DNA sequence preferences of several AT-selective minor groove binding ligands.

    PubMed Central

    Abu-Daya, A; Brown, P M; Fox, K R

    1995-01-01

    We have examined the interaction of distamycin, netropsin, Hoechst 33258 and berenil, which are AT-selective minor groove-binding ligands, with synthetic DNA fragments containing different arrangements of AT base pairs by DNase I footprinting. For fragments which contain multiple blocks of (A/T)4 quantitative DNase I footprinting reveals that AATT and AAAA are much better binding sites than TTAA and TATA. Hoechst 33258 shows that greatest discrimination between these sites with a 50-fold difference in affinity between AATT and TATA. Alone amongst these ligands, Hoechst 33258 binds to AATT better than AAAA. These differences in binding to the various AT-tracts are interpreted in terms of variations in DNA minor groove width and suggest that TpA steps within an AT-tract decrease the affinity of these ligands. The behaviour of each site also depends on the flanking sequences; adjacent pyrimidine-purine steps cause a decrease in affinity. The precise ranking order for the various binding sites is not the same for each ligand. Images PMID:7567447

  11. Design of pellet surface grooves for fission gas plenum

    SciTech Connect

    Carter, T.J.; Jones, L.R.; Macici, N.; Miller, G.C.

    1986-01-01

    In the Canada deuterium uranium pressurized heavy water reactor, short (50-cm) Zircaloy-4 clad bundles are fueled on-power. Although internal void volume within the fuel rods is adequate for the present once-through natural uranium cycle, the authors have investigated methods for increasing the internal gas storage volume needed in high-power, high-burnup, experimental ceramic fuels. This present work sought to prove the methodology for design of gas storage volume within the fuel pellets - specifically the use of grooves pressed or machined into the relatively cool pellet/cladding interface. Preanalysis and design of pellet groove shape and volume was accomplished using the TRUMP heat transfer code. Postirradiation examination (PIE) was used to check the initial design and heat transfer assumptions. Fission gas release was found to be higher for the grooved pellet rods than for the comparison rods with hollow or unmodified pellets. This had been expected from the initial TRUMP thermal analyses. The ELESIM fuel modeling code was used to check in-reactor performance, but some modifications were necessary to accommodate the loss of heat transfer surface to the grooves. It was concluded that for plenum design purposes, circumferential pellet grooves could be adequately modeled by the codes TRUMP and ELESIM.

  12. Osteochondritis Dissecans Involving the Trochlear Groove Treated With Retrograde Drilling

    PubMed Central

    Kaji, Yoshio; Nakamura, Osamu; Yamaguchi, Konosuke; Yamamoto, Tetsuji

    2015-01-01

    Abstract Osteochondritis dissecans (OCD) occurs frequently in the humeral capitellum of the upper extremity, whereas OCD involving the trochlear groove (trochlear groove OCD) is rarely reported. A standard treatment for trochlear groove OCD has therefore not been determined, although several methods have been tried. The case of a 14-year-old male gymnast with bilateral trochlear groove OCD is presented. Retrograde drilling from the lateral condyle of the humerus was applied for the OCD lesion of the left elbow, since it was larger in size than that in the right elbow and was symptomatic. Conversely, since the right lesion was small and asymptomatic, it was managed conservatively. After treatment, consolidation of the OCD lesions was observed in both elbows. However, the time to healing was shorter in the left elbow treated surgically than in the right elbow managed conservatively. In conclusion, retrograde drilling is a very simple and minimally invasive treatment. This case suggests that retrograde drilling for trochlear groove OCD may be a useful procedure that may accelerate the healing process for OCD lesions. PMID:26356703

  13. Mimicking enzymatic active sites on surfaces for energy conversion chemistry.

    PubMed

    Gutzler, Rico; Stepanow, Sebastian; Grumelli, Doris; Lingenfelder, Magalí; Kern, Klaus

    2015-07-21

    Metal-organic supramolecular chemistry on surfaces has matured to a point where its underlying growth mechanisms are well understood and structures of defined coordination environments of metal atoms can be synthesized in a controlled and reproducible procedure. With surface-confined molecular self-assembly, scientists have a tool box at hand which can be used to prepare structures with desired properties, as for example a defined oxidation number and spin state of the transition metal atoms within the organic matrix. From a structural point of view, these coordination sites in the supramolecular structure resemble the catalytically active sites of metallo-enzymes, both characterized by metal centers coordinated to organic ligands. Several chemical reactions take place at these embedded metal ions in enzymes and the question arises whether these reactions also take place using metal-organic networks as catalysts. Mimicking the active site of metal atoms and organic ligands of enzymes in artificial systems is the key to understanding the selectivity and efficiency of enzymatic reactions. Their catalytic activity depends on various parameters including the charge and spin configuration in the metal ion, but also on the organic environment, which can stabilize intermediate reaction products, inhibits catalytic deactivation, and serves mostly as a transport channel for the reactants and products and therefore ensures the selectivity of the enzyme. Charge and spin on the transition metal in enzymes depend on the one hand on the specific metal element, and on the other hand on its organic coordination environment. These two parameters can carefully be adjusted in surface confined metal-organic networks, which can be synthesized by virtue of combinatorial mixing of building synthons. Different organic ligands with varying functional groups can be combined with several transition metals and spontaneously assemble into ordered networks. The catalytically active metal

  14. Hybrid [FeFe]-hydrogenases with modified active sites show remarkable residual enzymatic activity.

    PubMed

    Siebel, Judith F; Adamska-Venkatesh, Agnieszka; Weber, Katharina; Rumpel, Sigrun; Reijerse, Edward; Lubitz, Wolfgang

    2015-02-24

    [FeFe]-hydrogenases are to date the only enzymes for which it has been demonstrated that the native inorganic binuclear cofactor of the active site Fe2(adt)(CO)3(CN)2 (adt = azadithiolate = [S-CH2-NH-CH2-S](2-)) can be synthesized on the laboratory bench and subsequently inserted into the unmaturated enzyme to yield fully functional holo-enzyme (Berggren, G. et al. (2013) Nature 499, 66-70; Esselborn, J. et al. (2013) Nat. Chem. Biol. 9, 607-610). In the current study, we exploit this procedure to introduce non-native cofactors into the enzyme. Mimics of the binuclear subcluster with a modified bridging dithiolate ligand (thiodithiolate, N-methylazadithiolate, dimethyl-azadithiolate) and three variants containing only one CN(-) ligand were inserted into the active site of the enzyme. We investigated the activity of these variants for hydrogen oxidation as well as proton reduction and their structural accommodation within the active site was analyzed using Fourier transform infrared spectroscopy. Interestingly, the monocyanide variant with the azadithiolate bridge showed ∼50% of the native enzyme activity. This would suggest that the CN(-) ligands are not essential for catalytic activity, but rather serve to anchor the binuclear subsite inside the protein pocket through hydrogen bonding. The inserted artificial cofactors with a propanedithiolate and an N-methylazadithiolate bridge as well as their monocyanide variants also showed residual activity. However, these activities were less than 1% of the native enzyme. Our findings indicate that even small changes in the dithiolate bridge of the binuclear subsite lead to a rather strong decrease of the catalytic activity. We conclude that both the Brønsted base function and the conformational flexibility of the native azadithiolate amine moiety are essential for the high catalytic activity of the native enzyme. PMID:25633077

  15. Site-specific PEGylation of lidamycin and its antitumor activity.

    PubMed

    Li, Liang; Shang, Boyang; Hu, Lei; Shao, Rongguang; Zhen, Yongsu

    2015-05-01

    In this study, N-terminal site-specific mono-PEGylation of the recombinant lidamycin apoprotein (rLDP) of lidamycin (LDM) was prepared using a polyethyleneglycol (PEG) derivative (M w 20 kDa) through a reactive terminal aldehyde group under weak acidic conditions (pH 5.5). The biochemical properties of mPEG-rLDP-AE, an enediyne-integrated conjugate, were analyzed by SDS-PAGE, RP-HPLC, SEC-HPLC and MALDI-TOF. Meanwhile, in vitro and in vivo antitumor activity of mPEG-rLDP-AE was evaluated by MTT assays and in xenograft model. The results indicated that mPEG-rLDP-AE showed significant antitumor activity both in vitro and in vivo. After PEGylation, mPEG-rLDP still retained the binding capability to the enediyne AE and presented the physicochemical characteristics similar to that of native LDP. It is of interest that the PEGylation did not diminish the antitumor efficacy of LDM, implying the possibility that this derivative may function as a payload to deliver novel tumor-targeted drugs. PMID:26579455

  16. Effect of DNA Groove Binder Distamycin A upon Chromatin Structure

    PubMed Central

    Majumder, Parijat; Dasgupta, Dipak

    2011-01-01

    Background Distamycin A is a prototype minor groove binder, which binds to B-form DNA, preferentially at A/T rich sites. Extensive work in the past few decades has characterized the binding at the level of double stranded DNA. However, effect of the same on physiological DNA, i.e. DNA complexed in chromatin, has not been well studied. Here we elucidate from a structural perspective, the interaction of distamycin with soluble chromatin, isolated from Sprague-Dawley rat. Methodology/Principal Findings Chromatin is a hierarchical assemblage of DNA and protein. Therefore, in order to characterize the interaction of the same with distamycin, we have classified the system into various levels, according to the requirements of the method adopted, and the information to be obtained. Isothermal titration calorimetry has been employed to characterize the binding at the levels of chromatin, chromatosome and chromosomal DNA. Thermodynamic parameters obtained thereof, identify enthalpy as the driving force for the association, with comparable binding affinity and free energy for chromatin and chromosomal DNA. Reaction enthalpies at different temperatures were utilized to evaluate the change in specific heat capacity (ΔCp), which, in turn, indicated a possible binding associated structural change. Ligand induced structural alterations have been monitored by two complementary methods - dynamic light scattering, and transmission electron microscopy. They indicate compaction of chromatin. Using transmission electron microscopy, we have visualized the effect of distamycin upon chromatin architecture at di- and trinucleosome levels. Our results elucidate the simultaneous involvement of linker bending and internucleosomal angle contraction in compaction process induced by distamycin. Conclusions/Significance We summarize here, for the first time, the thermodynamic parameters for the interaction of distamycin with soluble chromatin, and elucidate its effect on chromatin architecture

  17. Protein and drug interactions in the minor groove of DNA

    PubMed Central

    Morávek, Zdenek; Neidle, Stephen; Schneider, Bohdan

    2002-01-01

    Interactions between proteins, drugs, water and B-DNA minor groove have been analyzed in crystal structures of 60 protein–DNA and 14 drug–DNA complexes. It was found that only purine N3, pyrimidine O2, guanine N2 and deoxyribose O4′ are involved in the interactions, and that contacts to N3 and O2 are most frequent and more polar than contacts to O4′. Many protein contacts are mediated by water, possibly to increase the DNA effective surface. Fewer water-mediated contacts are observed in drug complexes. The distributions of ligands around N3 are significantly more compact than around O2, and distributions of water molecules are the most compact. Distributions around O4′ are more diffuse than for the base atoms but most distributions still have just one binding site. Ligands bind to N3 and O2 atoms in analogous positions, and simultaneous binding to N3 and N2 in guanines is extremely rare. Contacts with two consecutive nucleotides are much more frequent than base–sugar contacts within one nucleotide. The probable reason for this is the large energy of deformation of hydrogen bonds for the one nucleotide motif. Contacts of Arg, the most frequent amino acid ligand, are stereochemically indistinguishable from the binding of the remaining amino acids except asparagine (Asn) and phenylalanine (Phe). Asn and Phe bind in distinct ways, mostly to a deformed DNA, as in the complexes of TATA-box binding proteins. DNA deformation concentrates on dinucleotide regions with a distinct deformation of the δ and ɛ backbone torsion angles for the Asn and δ, ɛ, ζ and χ for the Phe-contacted regions. PMID:11861910

  18. Combined Endodontic-Periodontal Treatment of a Palatogingival Groove.

    PubMed

    Castelo-Baz, Pablo; Ramos-Barbosa, Isabel; Martín-Biedma, Benjamín; Dablanca-Blanco, Ana Belén; Varela-Patiño, Purificación; Blanco-Carrión, Juan

    2015-11-01

    A palatogingival groove is a developmental anomaly that predisposes the involved tooth to develop a severe periodontal lesion. These grooves often present a clinical challenge because diagnosis and treatment planning require an interdisciplinary approach. This case report describes the successful management of a right maxillary lateral incisor with a deep palatogingival groove in combination with an extensive periodontal pocket and pulp necrosis of the involved tooth. Collaborative management used a combination of endodontic treatment, periodontal therapy, odontoplasty, and a periodontal regenerative procedure using protein complex derived from enamel matrix (Emdogain; Straumann, Basel, Switzerland). Despite a predicted poor prognosis, the tooth lesion healed. This report also discusses the rationale behind the treatment modalities. PMID:26395912

  19. A V-grooved GaAs solar cell

    NASA Technical Reports Server (NTRS)

    Bailey, S. G.; Fatemi, N. S.; Landis, G. A.; Wilt, D. M.; Thomas, R. D.; Arrison, A.

    1988-01-01

    V-grooved GaAs solar cells promise the benefits of improved optical coupling, higher short-circuit current, and increased tolerance to particle radiation compared to planar cells. A GaAs homojunction cell was fabricated by etching a V-groove pattern into an n epilayer (2.1 x 10 to the 17th power per cu cm) grown by metalorganic chemical vapor deposition (MOCVD) on an n+ substrate (2.8 x 10 to the 18th power per cu cm) and then depositing and MOCVD p epilayer (4.2 x 10 to the 18th power per cu cm). Reflectivity measurements on cells with and without an antireflective coating confirm the expected decrease in reluctance of the microgrooved cell compared to the planar structure. The short circuit current of the V-grooved solar cell was 13 percent higher than that of the planar control.

  20. Method of forming grooves in the [011] crystalline direction

    NASA Technical Reports Server (NTRS)

    Marinelli, Donald Paul (Inventor)

    1977-01-01

    An A-B etchant is applied to a (100) surface of a body of semiconductor material, a portion of which along the (100) surface of the body is either gallium arsenide or gallium aluminum arsenide. The etchant is applied for at least 15 seconds at a temperature of approximately 80.degree. C. The A-B etchant is a solution by weight percent of 47.5%, water, 0.2% silver nitrate, 23.8% chromium trioxide and 28.5% of a 48% aqueous solution of hydrofluoric acid. As a result of the application of the A-B etchant a pattern of elongated etch pits form having their longitudinal axes along the [011] crystalline direction. Grooves are formed in the body at a surface opposite the (100) surface on which was applied the etchant. The grooves are formed along the [011] crystalline direction by aligning the longitudinal axes of the grooves with the longitudinal axes of the etch pits.

  1. Mechanisms for photon sorting based on slit-groove arrays

    NASA Astrophysics Data System (ADS)

    Villate-Guío, F.; Martín-Moreno, L.; de León-Pérez, F.

    2015-01-01

    Mechanisms for one-dimensional photon sorting are theoretically studied in the framework of a coupled-mode method. The considered system is a nanopatterned structure composed of two different pixels drilled on the surface of a thin gold layer. Each pixel consists of a slit-groove array designed to squeeze a large fraction of the incident light into the central slit. The Double-Pixel is optimized to resolve two different frequencies in the near infrared. This system shows high transmission efficiencies and a small crosstalk. It is found that the response of the system strongly depends on the effective area shared by overlapping pixels. According to such degree of overlap, photon sorting can be achieved within three different regimes, which are discussed in detail. Optimal photon-sorting efficiencies are obtained for a moderate number of grooves that overlap with grooves of the neighbor pixel. These results could be applied to both optical and infrared detectors.

  2. Allosteric site-mediated active site inhibition of PBP2a using Quercetin 3-O-rutinoside and its combination.

    PubMed

    Rani, Nidhi; Vijayakumar, Saravanan; P T V, Lakshmi; Arunachalam, Annamalai

    2016-08-01

    Recent crystallographic study revealed the involvement of allosteric site in active site inhibition of penicillin binding protein (PBP2a), where one molecule of Ceftaroline (Cef) binds to the allosteric site of PBP2a and paved way for the other molecule (Cef) to bind at the active site. Though Cef has the potency to inhibit the PBP2a, its adverse side effects are of major concern. Previous studies have reported the antibacterial property of Quercetin derivatives, a group of natural compounds. Hence, the present study aims to evaluate the effect of Quercetin 3-o-rutinoside (Rut) in allosteric site-mediated active site inhibition of PBP2a. The molecular docking studies between allosteric site and ligands (Rut, Que, and Cef) revealed a better binding efficiency (G-score) of Rut (-7.790318) and Cef (-6.194946) with respect to Que (-5.079284). Molecular dynamic (MD) simulation studies showed significant changes at the active site in the presence of ligands (Rut and Cef) at allosteric site. Four different combinations of Rut and Cef were docked and their G-scores ranged between -6.320 and -8.623. MD studies revealed the stability of the key residue (Ser403) with Rut being at both sites, compared to other complexes. Morphological analysis through electron microscopy confirmed that combination of Rut and Cefixime was able to disturb the bacterial cell membrane in a similar fashion to that of Rut and Cefixime alone. The results of this study indicate that the affinity of Rut at both sites were equally good, with further validations Rut could be considered as an alternative for inhibiting MRSA growth. PMID:26360629

  3. Active site hydrophobicity is critical to the bioluminescence activity of Vibrio harveyi luciferase.

    PubMed

    Li, Chi-Hui; Tu, Shiao-Chun

    2005-10-01

    Vibrio harveyi luciferase is an alphabeta heterodimer containing a single active site, proposed earlier to be at a cleft in the alpha subunit. In this work, six conserved phenylalanine residues at this proposed active site were subjected to site-directed mutations to investigate their possible functional roles and to delineate the makeup of luciferase active site. After initial screening of Phe --> Ala mutants, alphaF46, alphaF49, alphaF114, and alphaF117 were chosen for additional mutations to Asp, Ser, and Tyr. Comparisons of the general kinetic properties of wild-type and mutated luciferases indicated that the hydrophobic nature of alphaF46, alphaF49, alphaF114, and alphaF117 was important to luciferase V(max) and V(max)/K(m), which were reduced by 3-5 orders of magnitude for the Phe --> Asp mutants. Both alphaF46 and alphaF117 also appeared to be involved in the binding of reduced flavin substrate. Additional studies on the stability and yield of the 4a-hydroperoxyflavin intermediate II and measurements of decanal substrate oxidation by alphaF46D, alphaF49D, alphaF114D, and alphaF117D revealed that their marked reductions in the overall quantum yield (phi( degrees )) were a consequence of diminished yields of luciferase intermediates and, with the exception of alphaF114D, emission quantum yield of the excited emitter due to the replacement of the hydrophobic Phe by the anionic Asp. The locations of these four critical Phe residues in relation to other essential and/or hydrophobic residues are depicted in a refined map of the active site. Functional implications of these residues are discussed. PMID:16185065

  4. A proposed definition of the 'activity' of surface sites on lactose carriers for dry powder inhalation.

    PubMed

    Grasmeijer, Floris; Frijlink, Henderik W; de Boer, Anne H

    2014-06-01

    A new definition of the activity of surface sites on lactose carriers for dry powder inhalation is proposed which relates to drug detachment during dispersion. The new definition is expected to improve the understanding of 'carrier surface site activity', which stimulates the unambiguous communication about this subject and may aid in the rational design and interpretation of future formulation studies. In contrast to the currently prevailing view on carrier surface site activity, it follows from the newly proposed definition that carrier surface site activity depends on more variables than just the physicochemical properties of the carrier surface. Because the term 'active sites' is ambiguous, it is recommended to use the term 'highly active sites' instead to denote carrier surface sites with a relatively high activity. PMID:24613490

  5. Disturbance opens recruitment sites for bacterial colonization in activated sludge.

    PubMed

    Vuono, David C; Munakata-Marr, Junko; Spear, John R; Drewes, Jörg E

    2016-01-01

    Little is known about the role of immigration in shaping bacterial communities or the factors that may dictate success or failure of colonization by bacteria from regional species pools. To address these knowledge gaps, the influence of bacterial colonization into an ecosystem (activated sludge bioreactor) was measured through a disturbance gradient (successive decreases in the parameter solids retention time) relative to stable operational conditions. Through a DNA sequencing approach, we show that the most abundant bacteria within the immigrant community have a greater probability of colonizing the receiving ecosystem, but mostly as low abundance community members. Only during the disturbance do some of these bacterial populations significantly increase in abundance beyond background levels and in few cases become dominant community members post-disturbance. Two mechanisms facilitate the enhanced enrichment of immigrant populations during disturbance: (i) the availability of resources left unconsumed by established species and (ii) the increased availability of niche space for colonizers to establish and displace resident populations. Thus, as a disturbance decreases local diversity, recruitment sites become available to promote colonization. This work advances our understanding of microbial resource management and diversity maintenance in complex ecosystems. PMID:25727891

  6. Construction of DNA recognition sites active in Haemophilus transformation.

    PubMed Central

    Danner, D B; Smith, H O; Narang, S A

    1982-01-01

    Competent Haemophilus cells recognize and preferentially take up Haemophilus DNA during genetic transformation. This preferential uptake is correlated with the presence on incoming DNA of an 11-base-pair (bp) sequence, 5'-A-A-G-T-G-C-G-G-T-C-A-3'. To prove that this sequence is the recognition site that identifies Haemophilus DNA to the competent cell, we have now constructed a series of plasmids, each of which contains the 11-bp sequence. Using two different assay systems we have tested the ability of fragments from these plasmids to compete with cloned Haemophilus DNA fragments that naturally contain the 11-bp sequence. We find that the addition of the 11-bp sequence to a DNA fragment is necessary and sufficient for preferential uptake of that fragment. However, plasmid DNAs containing this sequence may vary as much as 48-fold in uptake activity, and this variation correlates with the A+T-richness of the DNA flanking the 11-mer. Images PMID:6285382

  7. Characterization of active site residues of nitroalkane oxidase.

    PubMed

    Valley, Michael P; Fenny, Nana S; Ali, Shah R; Fitzpatrick, Paul F

    2010-06-01

    The flavoenzyme nitroalkane oxidase catalyzes the oxidation of primary and secondary nitroalkanes to the corresponding aldehydes and ketones plus nitrite. The structure of the enzyme shows that Ser171 forms a hydrogen bond to the flavin N5, suggesting that it plays a role in catalysis. Cys397 and Tyr398 were previously identified by chemical modification as potential active site residues. To more directly probe the roles of these residues, the S171A, S171V, S171T, C397S, and Y398F enzymes have been characterized with nitroethane as substrate. The C397S and Y398 enzymes were less stable than the wild-type enzyme, and the C397S enzyme routinely contained a substoichiometric amount of FAD. Analysis of the steady-state kinetic parameters for the mutant enzymes, including deuterium isotope effects, establishes that all of the mutations result in decreases in the rate constants for removal of the substrate proton by approximately 5-fold and decreases in the rate constant for product release of approximately 2-fold. Only the S171V and S171T mutations alter the rate constant for flavin oxidation. These results establish that these residues are not involved in catalysis, but rather are required for maintaining the protein structure. PMID:20056514

  8. Detection limit for activation measurements in ultralow background sites

    NASA Astrophysics Data System (ADS)

    Trache, Livius; Chesneanu, D.; Margineanu, R.; Pantelica, A.; Ghita, D. G.; Burducea, I.; Straticiuc, M.; Tang, X. D.

    2014-09-01

    We used 12C +13C fusion at the beam energies E = 6, 7 and 8 MeV to determine the sensitivity and the limits of activation method measurements in ultralow background sites. A 13C beam of 0.5 μA from the 3 MV Tandem accelerator of the Horia Hulubei National Institute of Physics and Nuclear Engineering - IFIN HH impinged on thick graphite targets. After about 24 hrs of irradiation targets were measured in two different laboratories: one with a heavy shielded Ge detector in the institute (at the surface) and one located underground in the microBequerel laboratory, in the salt mine of Slanic-Prahova, Romania. The 1369- and 2754 keV peaks from 24Na deactivation were clearly observed in the γ-ray spectra obtained for acquisitions lasting a few hours, or a few days. Determination of the detection limit in evaluating the cross sections for the target irradiated at Ec . m = 3 MeV indicates the fact that it is possible to measure gamma spectrum in underground laboratory down to Ec . m = 2 . 6 MeV. Cleaning the spectra with beta-gamma coincidences and increasing beam intensity 20 times will take as further down. The measurements are motivated by the study of the 12 C +12 C reaction at astrophysical energies.

  9. N6-Methyldeoxyadenosine Marks Active Transcription Start Sites in Chlamydomonas

    PubMed Central

    Chen, Kai; Deng, Xin; Yu, Miao; Han, Dali; Hao, Ziyang; Liu, Jianzhao; Lu, Xingyu; Dore, Louis C; Weng, Xiaocheng; Ji, Quanjiang; Mets, Laurens; He, Chuan

    2015-01-01

    SUMMARY N6-methyldeoxyadenosine (6mA or m6A) is a DNA modification preserved in prokaryotes to eukaryotes. It is widespread in bacteria, and functions in DNA mismatch repair, chromosome segregation, and virulence regulation. In contrast, the distribution and function of 6mA in eukaryotes have been unclear. Here we present a comprehensive analysis of the 6mA landscape in the genome of Chlamydomonas using new sequencing approaches. We identified the 6mA modification in 84% of genes in Chlamydomonas. We found that 6mA mainly locates at ApT dinucleotides around transcription start sites (TSS) with a bimodal distribution, and appears to mark active genes. A periodic pattern of 6mA deposition was also observed at base resolution, which is associated with nucleosome distribution near the TSS, suggesting a possible role in nucleosome positioning. The new genome-wide mapping of 6mA and its unique distribution in the Chlamydomonas genome suggest potential regulatory roles of 6mA in gene expression in eukaryotic organisms. PMID:25936837

  10. 10 CFR 63.16 - Review of site characterization activities. 2

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses Preapplication Review § 63.16 Review of... conduct of site characterization activities at the Yucca Mountain site, DOE shall report the nature and... activities at the Yucca Mountain site, NRC staff shall be permitted to visit and inspect the locations...

  11. 10 CFR 63.16 - Review of site characterization activities. 2

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses Preapplication Review § 63.16 Review of... conduct of site characterization activities at the Yucca Mountain site, DOE shall report the nature and... activities at the Yucca Mountain site, NRC staff shall be permitted to visit and inspect the locations...

  12. 10 CFR 63.16 - Review of site characterization activities. 2

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses Preapplication Review § 63.16 Review of... conduct of site characterization activities at the Yucca Mountain site, DOE shall report the nature and... activities at the Yucca Mountain site, NRC staff shall be permitted to visit and inspect the locations...

  13. 10 CFR 63.16 - Review of site characterization activities. 2

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses Preapplication Review § 63.16 Review of... conduct of site characterization activities at the Yucca Mountain site, DOE shall report the nature and... activities at the Yucca Mountain site, NRC staff shall be permitted to visit and inspect the locations...

  14. 10 CFR 63.16 - Review of site characterization activities. 2

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses Preapplication Review § 63.16 Review of... conduct of site characterization activities at the Yucca Mountain site, DOE shall report the nature and... activities at the Yucca Mountain site, NRC staff shall be permitted to visit and inspect the locations...

  15. Optical properties of grooved silicon microstructures: Theory and experiment

    SciTech Connect

    Dyakov, S. A.; Astrova, E. V.; Perova, T. S.; Tikhodeev, S. G.; Gippius, N. A.; Timoshenko, V. Yu.

    2011-07-15

    The reflection spectra of grooved silicon structures consisting of alternating silicon walls and grooves (air channels) with a period of a = 4-6 {mu}m are studied experimentally and theoretically in the mid-IR spectral range (2-25 {mu}m) upon irradiation of samples by normally incident light polarized along and perpendicular to silicon layers. The calculation is performed by the scattering matrix method taking into account Rayleigh scattering losses in a grooved layer by adding imaginary parts to the refractive indices of silicon and air in grooved regions. The experimental and calculated reflection spectra are in good agreement in the entire spectral range studied. The analysis of experimental and calculated spectra gave close values of the effective refractive indices and birefringence of the studied structures in the long-wavelength spectral region. The values calculated in the effective medium model in the long-wavelength approximation ({lambda} Much-Greater-Than a) gave considerably understated values. The obtained results confirm the efficiency of the scattering matrix method for describing the optical properties of silicon microstructures.

  16. Groove pancreatitis and pancreatic heterotopia in the minor duodenal papilla.

    PubMed

    Chatelain, Denis; Vibert, Eric; Yzet, Thierry; Geslin, Guillaume; Bartoli, Eric; Manaouil, David; Delcenserie, Richard; Brevet, Marie; Dupas, Jean-Louis; Regimbeau, Jean-Marc

    2005-05-01

    Groove pancreatitis is a rare form of segmental chronic pancreatitis that involves the anatomic space between the head of the pancreas, the duodenum, and the common bile duct. We report 2 cases of groove pancreatitis with pancreatic heterotopia in the minor papilla. Patients were a 44-year-old woman and a 47-year-old man. Both had a past history of alcohol consumption and presented with abdominal pain, vomiting, and weight loss caused by duodenal stenosis. Abdominal computed tomography revealed thickening of the duodenal wall and enlargement of the pancreatic head in both patients. In 1 patient, ultrasound endoscopy showed a dilated duct in the head of the pancreas. Pancreaticoduodenectomy was performed to rule out pancreatic adenocarcinoma and because of the severity of the symptoms. In both cases, gross and microscopic examinations showed fibrous scar of the groove area. The Santorini duct was dilated and contained protein plugs in both patients, with abscesses in 1 of them. In both cases, there were microscopic foci of heterotopic pancreas with mild fibrosis in the wall of the minor papilla. Groove pancreatitis is often diagnosed in middle-aged alcoholic men presenting with clinical symptoms caused by duodenal stenosis. The pathogenesis of this rare entity could be because of disturbance of the pancreatic secretion through the minor papilla. Pancreatitis in heterotopic pancreas located in the minor papilla and chronic consumption of alcohol seem to be important pathogenic factors. PMID:15841034

  17. 9. DETAIL VIEW OF 2' TONGUE AND GROOVE PLANKING IN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. DETAIL VIEW OF 2' TONGUE AND GROOVE PLANKING IN WATER CONTROL BOX. THIS SAME PLANKING IS USED AS CRIBBING FOR BOTH EAST DAM AND WEST DAM - Three Bears Lake & Dams, Water Control Box, North of Marias Pass, East Glacier Park, Glacier County, MT

  18. Syncopation, Body-Movement and Pleasure in Groove Music

    PubMed Central

    Witek, Maria A. G.; Clarke, Eric F.; Wallentin, Mikkel; Kringelbach, Morten L.; Vuust, Peter

    2014-01-01

    Moving to music is an essential human pleasure particularly related to musical groove. Structurally, music associated with groove is often characterised by rhythmic complexity in the form of syncopation, frequently observed in musical styles such as funk, hip-hop and electronic dance music. Structural complexity has been related to positive affect in music more broadly, but the function of syncopation in eliciting pleasure and body-movement in groove is unknown. Here we report results from a web-based survey which investigated the relationship between syncopation and ratings of wanting to move and experienced pleasure. Participants heard funk drum-breaks with varying degrees of syncopation and audio entropy, and rated the extent to which the drum-breaks made them want to move and how much pleasure they experienced. While entropy was found to be a poor predictor of wanting to move and pleasure, the results showed that medium degrees of syncopation elicited the most desire to move and the most pleasure, particularly for participants who enjoy dancing to music. Hence, there is an inverted U-shaped relationship between syncopation, body-movement and pleasure, and syncopation seems to be an important structural factor in embodied and affective responses to groove. PMID:24740381

  19. Partial-Thickness Grooves In A VBL Memory Device

    NASA Technical Reports Server (NTRS)

    Katti, Romney R.; Wu, Jiin-Chuan; Stadler, Henry L.

    1994-01-01

    Bias magnetic fields tailored to match those needed elsewhere in device. Grooves through part of thickness of magnetic garnet storage layer of vertical-Bloch-line (VBL) memory device used to confine magnetic bubble and stripe domains in desired storage areas. VBL-memory concept described in "Vertical-Bloch-Line Memory" (NPO-18467).

  20. Syncopation, body-movement and pleasure in groove music.

    PubMed

    Witek, Maria A G; Clarke, Eric F; Wallentin, Mikkel; Kringelbach, Morten L; Vuust, Peter

    2014-01-01

    Moving to music is an essential human pleasure particularly related to musical groove. Structurally, music associated with groove is often characterised by rhythmic complexity in the form of syncopation, frequently observed in musical styles such as funk, hip-hop and electronic dance music. Structural complexity has been related to positive affect in music more broadly, but the function of syncopation in eliciting pleasure and body-movement in groove is unknown. Here we report results from a web-based survey which investigated the relationship between syncopation and ratings of wanting to move and experienced pleasure. Participants heard funk drum-breaks with varying degrees of syncopation and audio entropy, and rated the extent to which the drum-breaks made them want to move and how much pleasure they experienced. While entropy was found to be a poor predictor of wanting to move and pleasure, the results showed that medium degrees of syncopation elicited the most desire to move and the most pleasure, particularly for participants who enjoy dancing to music. Hence, there is an inverted U-shaped relationship between syncopation, body-movement and pleasure, and syncopation seems to be an important structural factor in embodied and affective responses to groove. PMID:24740381

  1. A re-entrant groove hydrogen heat pipe

    NASA Technical Reports Server (NTRS)

    Alario, J.; Kosson, R.; Mccreight, C.

    1978-01-01

    This paper extends the development of reentrant groove technology to hydrogen heat pipes. Parametric analyses are presented which optimize the theoretical design while considering the limitations of state-of-the-art extrusion technology. Acceptable production-type runs of extruded lengths (over 300 m) could only be achieved at the expense of a wider nominal groove opening than specified (0.33 mm vs. 0.20 mm). However, dimensional variations of other critical dimensions were within 0.05 mm, which exceeded expectations. The 6063-T6 aluminum extrusion is 14.6 mm OD with a wall thickness of 1.66 mm and contains 20 axial grooves which surround a central 9.3-mm-diam vapor core. Each axial groove is 0.775-mm-diam with a 0.33 mm opening. An excess vapor reservoir is provided at the evaporator to minimize the pressure containment hazard during ambient storage. Details of the instrumentation and helium-cooled test installation are also presented.

  2. V-Grooved GaAs Solar Cell

    NASA Technical Reports Server (NTRS)

    Bailey, S. G.; Landis, G. R.; Wilt, D. M.; Thomas, R. D.; Arrison, A.; Fatemi, N. S.

    1991-01-01

    V-grooved GaAs solar photovoltaic cells increase optical coupling and greater conversion of light into electricity. Increases both trapping of incident light and lengths of optical paths in cell material. Net effect increases in total absorptivity, tolerance to damage by energetic particles, and short-circuit current. These improvements expected to follow from similar improvements obtained in silicon solar cells.

  3. HALL WITH FOYER IN BACKGROUND. NOTE THE TONGUE AND GROOVE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    HALL WITH FOYER IN BACKGROUND. NOTE THE TONGUE AND GROOVE WALL BOARDS, CANEC PANEL CEILING AND LINEN CLOSET WITH BUILT-IN SHELVES. VIEW FACING SOUTHWEST - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, M-Shaped Four-Bedroom Duplex Type 5, Birch Circle, Cedar Drive, Pearl City, Honolulu County, HI

  4. Active-site mutagenesis of tetanus neurotoxin implicates TYR-375 and GLU-271 in metalloproteolytic activity.

    PubMed

    Rossetto, O; Caccin, P; Rigoni, M; Tonello, F; Bortoletto, N; Stevens, R C; Montecucco, C

    2001-08-01

    Tetanus neurotoxin (TeNT) blocks neurotransmitter release by cleaving VAMP/synaptobrevin, a membrane associated protein involved in synaptic vesicle fusion. Such activity is exerted by the N-terminal 50kDa domain of TeNT which is a zinc-dependent endopeptidase (TeNT-L-chain). Based on the three-dimensional structure of botulinum neurotoxin serotype A (BoNT/A) and serotype B (BoNT/B), two proteins closely related to TeNT, and on X-ray scattering studies of TeNT, we have designed mutations at two active site residues to probe their involvement in activity. The active site of metalloproteases is composed of a primary sphere of residues co-ordinating the zinc atom, and a secondary sphere of residues that determines proteolytic specificity and activity. Glu-261 and Glu-267 directly co-ordinates the zinc atom in BoNT/A and BoNT/B respectively and the corresponding residue of TeNT was replaced by Asp or by the non conservative residue Ala. Tyr-365 is 4.3A away from zinc in BoNT/A, and the corresponding residue of TeNT was replaced by Phe or by Ala. The purified mutants had CD, fluorescence and UV spectra closely similar to those of the wild-type molecule. The proteolytic activity of TeNT-Asp-271 (E271D) is similar to that of the native molecule, whereas that of TeNT-Phe-375 (Y375F) is lower than the control. Interestingly, the two Ala mutants are completely devoid of enzymatic activity. These results demonstrate that both Glu-271 and Tyr-375 are essential for the proteolytic activity of TeNT. PMID:11306125

  5. GAS HYDRATES AT TWO SITES OF AN ACTIVE CONTINENTAL MARGIN.

    USGS Publications Warehouse

    Kvenvolden, K.A.

    1985-01-01

    Sediment containing gas hydrates from two distant Deep Sea Drilling Project sites (565 and 568), located about 670 km apart on the landward flank of the Middle America Trench, was studied to determine the geochemical conditions that characterize the occurrence of gas hydrates. Site 565 was located in the Pacific Ocean offshore the Nicoya Peninsula of Costa Rica in 3,111 m of water. The depth of the hole at this site was 328 m, and gas hydrates were recovered from 285 and 319 m. Site 568 was located about 670 km to the northwest offshore Guatemala in 2,031 m of water. At this site the hole penetrated to 418 m, and gas hydrates were encountered at 404 m.

  6. Dynamically Achieved Active Site Precision in Enzyme Catalysis

    PubMed Central

    2015-01-01

    Conspectus The grand challenge in enzymology is to define and understand all of the parameters that contribute to enzymes’ enormous rate accelerations. The property of hydrogen tunneling in enzyme reactions has moved the focus of research away from an exclusive focus on transition state stabilization toward the importance of the motions of the heavy atoms of the protein, a role for reduced barrier width in catalysis, and the sampling of a protein conformational landscape to achieve a family of protein substates that optimize enzyme–substrate interactions and beyond. This Account focuses on a thermophilic alcohol dehydrogenase for which the chemical step of hydride transfer is rate determining across a wide range of experimental conditions. The properties of the chemical coordinate have been probed using kinetic isotope effects, indicating a transition in behavior below 30 °C that distinguishes nonoptimal from optimal C–H activation. Further, the introduction of single site mutants has the impact of either enhancing or eliminating the temperature dependent transition in catalysis. Biophysical probes, which include time dependent hydrogen/deuterium exchange and fluorescent lifetimes and Stokes shifts, have also been pursued. These studies allow the correlation of spatially resolved transitions in protein motions with catalysis. It is now possible to define a long-range network of protein motions in ht-ADH that extends from a dimer interface to the substrate binding domain across to the cofactor binding domain, over a distance of ca. 30 Å. The ongoing challenge to obtaining spatial and temporal resolution of catalysis-linked protein motions is discussed. PMID:25539048

  7. Robotics and Automation Activities at the Savannah River Site: A Site Report for SUBWOG 39F

    SciTech Connect

    Teese, G.D.

    1995-09-28

    The Savannah River Site has successfully used robots, teleoperators, and remote video to reduce exposure to ionizing radiation, improve worker safety, and improve the quality of operations. Previous reports have described the use of mobile teleoperators in coping with a high level liquid waste spill, the removal of highly contaminated equipment, and the inspection of nuclear reactor vessels. This report will cover recent applications at the Savannah River, as well as systems which SRS has delivered to other DOE site customers.

  8. Improving upon Nature: Active site remodeling produces highly efficient aldolase activity towards hydrophobic electrophilic substrates

    PubMed Central

    Cheriyan, Manoj; Toone, Eric J.; Fierke, Carol A.

    2012-01-01

    Substrate specificity of enzymes is frequently narrow and constrained by multiple interactions, limiting the use of natural enzymes in biocatalytic applications. Aldolases have important synthetic applications, but the usefulness of these enzymes is hampered by their narrow reactivity profile with unnatural substrates. To explore the determinants of substrate selectivity and alter the specificity of E. coli 2-keto-3-deoxy-6-phosphogluconate (KDPG) aldolase, we employed structure-based mutagenesis coupled with library screening of mutant enzymes localized to the bacterial periplasm. We identified two active site mutations (T161S/S184L) that work additively to enhance the substrate specificity of this aldolase to include catalysis of retro-aldol cleavage of (4S)-2-keto-4-hydroxy-4-(2′-pyridyl)butyrate (S-KHPB). These mutations improve the value of kcat/KMS-KHPB by >450-fold, resulting in a catalytic efficiency that is comparable to that of the wild-type enzyme with the natural substrate while retaining high stereoselectivity. Moreover, the value of kcatS-KHPB for this mutant enzyme, a parameter critical for biocatalytic applications, is 3-fold higher than the maximum value achieved by the natural aldolase with any substrate. This mutant also possesses high catalytic efficiency for the retro-aldol cleavage of the natural substrate, KDPG, and a >50-fold improved activity for cleavage of 2-keto-4-hydroxy-octonoate (KHO), a non-functionalized hydrophobic analog. These data suggest a substrate binding mode that illuminates the origin of facial selectivity in aldol addition reactions catalyzed by KDPG and 2-keto-3-deoxy-6-phosphogalactonate (KDPGal) aldolases. Furthermore, targeting mutations to the active site provides marked improvement in substrate selectivity, demonstrating that structure-guided active site mutagenesis combined with selection techniques can efficiently identify proteins with characteristics that compare favorably to naturally occurring enzymes. PMID

  9. Modeling of E-Cloud Build-Up in Grooved Vacuum Chambers using POSINST

    SciTech Connect

    Furman, Miguel A.; Vay, Jean-Luc; Venturini, M.; Pivi, M.T.F.; /SLAC

    2008-01-23

    Use of grooved vacuum chambers have been suggested as a way to limit electron cloud accumulation in the ILCDR. We report on simulations carried out using an augmented version of POSINST, accounting for e-cloud dynamics in the presence of grooves, and make contact with previous estimates of an effective secondary electron yield for grooved surfaces.

  10. Atomically-thin two-dimensional sheets for understanding active sites in catalysis.

    PubMed

    Sun, Yongfu; Gao, Shan; Lei, Fengcai; Xie, Yi

    2015-02-01

    Catalysis can speed up chemical reactions and it usually occurs on the low coordinated steps, edges, terraces, kinks and corner atoms that are often called "active sites". However, the atomic level interplay between active sites and catalytic activity is still an open question, owing to the large difference between idealized models and real catalysts. This stimulates us to pursue a suitable material model for studying the active sites-catalytic activity relationship, in which the atomically-thin two-dimensional sheets could serve as an ideal model, owing to their relatively simple type of active site and the ultrahigh fraction of active sites that are comparable to the overall atoms. In this tutorial review, we focus on the recent progress in disclosing the factors that affect the activity of reactive sites, including characterization of atomic coordination number, structural defects and disorder in ultrathin two-dimensional sheets by X-ray absorption fine structure spectroscopy, positron annihilation spectroscopy, electron spin resonance and high resolution transmission electron microscopy. Also, we overview their applications in CO catalytic oxidation, photocatalytic water splitting, electrocatalytic oxygen and hydrogen evolution reactions, and hence highlight the atomic level interplay among coordination number, structural defects/disorder, active sites and catalytic activity in the two-dimensional sheets with atomic thickness. Finally, we also present the major challenges and opportunities regarding the role of active sites in catalysis. We believe that this review provides critical insights for understanding the catalysis and hence helps to develop new catalysts with high catalytic activity. PMID:25382246

  11. The active sites of supported silver particle catalysts in formaldehyde oxidation.

    PubMed

    Chen, Yaxin; Huang, Zhiwei; Zhou, Meijuan; Hu, Pingping; Du, Chengtian; Kong, Lingdong; Chen, Jianmin; Tang, Xingfu

    2016-08-01

    Surface silver atoms with upshifted d-orbitals are identified as the catalytically active sites in formaldehyde oxidation by correlating their activity with the number of surface silver atoms, and the degree of the d-orbital upshift governs the catalytic performance of the active sites. PMID:27406403

  12. Design and analysis of a cryogenic variable conductance axial grooved heat pipe

    NASA Technical Reports Server (NTRS)

    1976-01-01

    An investigation to adapt axial grooved designs to the gammit of heat pipe thermal control techniques, with particular emphasis on those suited for cryogenic applications was conducted. In addition to considering both active and passive gas control, diode designs utilizing liquid or gas blockage, or a liquid trap, are evaluated. The use of the liquid trap as a secondary heat pipe for forward mode operation during diode shutdown is also studied. This latter function is basically that of a thermal switch. Finally, a system capable of hybrid functions consisting of gas-controlled variable conductance and liquid trap diode shutdown or thermal switching is defined.

  13. Application of axial grooves to cryogenic variable conductance heat pipe technology. [cryogenic thermal diodes

    NASA Technical Reports Server (NTRS)

    Brennan, P. J.; Groll, M.

    1976-01-01

    Tests results obtained with an ATS axial groove aluminum extrusion adapted for use as a cryogenic thermal diode and/or a variable conductance heat pipe are presented. Ethane at a nominal operating temperature of 185 C was used as working fluid. In addition to both active and passive gas control, diode designs utilizing gas blockage or liquid trap were investigated. Specific requirements and performance parameters such as transient behavior, reservoir sizes, shutdown energy, etc., were evaluated. Results are also presented for tests where the liquid trap was used as a secondary heat pipe to demonstrate thermal switching with simultaneous heat pipe operation and diode shutdown.

  14. Identification of promiscuous ene-reductase activity by mining structural databases using active site constellations

    PubMed Central

    Steinkellner, Georg; Gruber, Christian C.; Pavkov-Keller, Tea; Binter, Alexandra; Steiner, Kerstin; Winkler, Christoph; Łyskowski, Andrzej; Schwamberger, Orsolya; Oberer, Monika; Schwab, Helmut; Faber, Kurt; Macheroux, Peter; Gruber, Karl

    2014-01-01

    The exploitation of catalytic promiscuity and the application of de novo design have recently opened the access to novel, non-natural enzymatic activities. Here we describe a structural bioinformatic method for predicting catalytic activities of enzymes based on three-dimensional constellations of functional groups in active sites (‘catalophores’). As a proof-of-concept we identify two enzymes with predicted promiscuous ene-reductase activity (reduction of activated C–C double bonds) and compare them with known ene-reductases, that is, members of the Old Yellow Enzyme family. Despite completely different amino acid sequences, overall structures and protein folds, high-resolution crystal structures reveal equivalent binding modes of typical Old Yellow Enzyme substrates and ligands. Biochemical and biocatalytic data show that the two enzymes indeed possess ene-reductase activity and reveal an inverted stereopreference compared with Old Yellow Enzymes for some substrates. This method could thus be a tool for the identification of viable starting points for the development and engineering of novel biocatalysts. PMID:24954722

  15. Structural mechanism of RuBisCO activation by carbamylation of the active site lysine

    PubMed Central

    Stec, Boguslaw

    2012-01-01

    Ribulose 1,5-bisphosphate carboxylase/oxygenase (RuBisCO) is a crucial enzyme in carbon fixation and the most abundant protein on earth. It has been studied extensively by biochemical and structural methods; however, the most essential activation step has not yet been described. Here, we describe the mechanistic details of Lys carbamylation that leads to RuBisCO activation by atmospheric CO2. We report two crystal structures of nitrosylated RuBisCO from the red algae Galdieria sulphuraria with O2 and CO2 bound at the active site. G. sulphuraria RuBisCO is inhibited by cysteine nitrosylation that results in trapping of these gaseous ligands. The structure with CO2 defines an elusive, preactivation complex that contains a metal cation Mg2+ surrounded by three H2O/OH molecules. Both structures suggest the mechanism for discriminating gaseous ligands by their quadrupole electric moments. We describe conformational changes that allow for intermittent binding of the metal ion required for activation. On the basis of these structures we propose the individual steps of the activation mechanism. Knowledge of all these elements is indispensable for engineering RuBisCO into a more efficient enzyme for crop enhancement or as a remedy to global warming. PMID:23112176

  16. 78 FR 33908 - Commercial Wind Lease Issuance and Site Assessment Activities on the Atlantic Outer Continental...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-05

    ... identified Wind Energy Area (WEA) on the OCS offshore Rhode Island (RI) and Massachusetts (MA). The revised... from leasing, site characterization, and site assessment in and around the Call Area (76 FR 51391). The... Bureau of Ocean Energy Management Commercial Wind Lease Issuance and Site Assessment Activities on...

  17. 77 FR 39508 - Commercial Wind Lease Issuance and Site Assessment Activities on the Atlantic Outer Continental...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-03

    ... specific project proposals on those leases) in an identified Wind Energy Area (WEA) on the OCS offshore..., site characterization, and site assessment in and around the Call Area (76 FR 51391). The Call Area is... Bureau of Ocean Energy Management Commercial Wind Lease Issuance and Site Assessment Activities on...

  18. Active Layer and Moisture Measurements for Intensive Site 0 and 1, Barrow, Alaska

    DOE Data Explorer

    John Peterson

    2015-04-17

    These are measurements of Active Layer Thickness collected along several lines beginning in September, 2011 to the present. The data were collected at several time periods along the Site0 L2 Line, the Site1 AB Line, and an ERT Monitoring Line near Area A in Site1.

  19. Nuclear Site Security in the Event of Terrorist Activity

    SciTech Connect

    Thomson, M.L.; Sims, J.

    2008-07-01

    This paper, presented as a poster, identifies why ballistic protection should now be considered at nuclear sites to counter terrorist threats. A proven and flexible form of multi purpose protection is described in detail with identification of trial results that show its suitability for this role. (authors)

  20. Preliminary siting activities for new waste handling facilities at the Idaho National Engineering Laboratory

    SciTech Connect

    Taylor, D.D.; Hoskinson, R.L.; Kingsford, C.O.; Ball, L.W.

    1994-09-01

    The Idaho Waste Processing Facility, the Mixed and Low-Level Waste Treatment Facility, and the Mixed and Low-Level Waste Disposal Facility are new waste treatment, storage, and disposal facilities that have been proposed at the Idaho National Engineering Laboratory (INEL). A prime consideration in planning for such facilities is the selection of a site. Since spring of 1992, waste management personnel at the INEL have been involved in activities directed to this end. These activities have resulted in the (a) identification of generic siting criteria, considered applicable to either treatment or disposal facilities for the purpose of preliminary site evaluations and comparisons, (b) selection of six candidate locations for siting,and (c) site-specific characterization of candidate sites relative to selected siting criteria. This report describes the information gathered in the above three categories for the six candidate sites. However, a single, preferred site has not yet been identified. Such a determination requires an overall, composite ranking of the candidate sites, which accounts for the fact that the sites under consideration have different advantages and disadvantages, that no single site is superior to all the others in all the siting criteria, and that the criteria should be assigned different weighing factors depending on whether a site is to host a treatment or a disposal facility. Stakeholder input should now be solicited to help guide the final selection. This input will include (a) siting issues not already identified in the siting, work to date, and (b) relative importances of the individual siting criteria. Final site selection will not be completed until stakeholder input (from the State of Idaho, regulatory agencies, the public, etc.) in the above areas has been obtained and a strategy has been developed to make a composite ranking of all candidate sites that accounts for all the siting criteria.

  1. Perineal Groove: A Rare Congenital Midline Defect of Perineum

    PubMed Central

    Harsono, Mimily; Pourcyrous, Massroor

    2015-01-01

    Perineal groove is a rare congenital malformation that is characterized by an exposed wet sulcus with nonkeratinized mucous membrane that extends from the posterior vaginal fourchette to the anterior ridge of the anal orifice. This condition is one of the uncommon anomalies of urogenital/anogenital region that is unknown to many clinicians. Although, this condition may be self-resolved before the age of 2 years, this nonepithelized mucous membrane can pose the risk of local irritation and infection, urinary tract infection, and the possibility of nonself-resolved condition that eventually needs surgical correction. Only a few reported cases (n = 23) were found in current medical literatures. This lesion could be misdiagnosed as contact dermatitis, trauma, or even sexual abuse. Therefore, recognition of the congenital perineal groove at birth is important for the health care providers to deliver an appropriate parental counseling and appropriate follow-up. PMID:26929866

  2. Hydrodynamic simulations of microjetting from shock-loaded grooves

    NASA Astrophysics Data System (ADS)

    Roland, Caroline; de Resseguier, Thibaut; Sollier, Arnaud; Lescoute, Emilien; Soulard, Laurent; Loison, Didier

    2015-06-01

    The interaction of a shock wave with a free surface presenting geometrical defects, such as cavities or grooves, may lead to the ejection of micrometric debris at velocities of km/s order. This process can be involved in many applications, like pyrotechnics or industrial safety. Laser shock experiments reported in this conference (T. de Resseguier, C. Roland et al., abstract ref.000066) provide insight into jet formation and peak velocities for various groove angles and shock pressures. Here, we present hydrodynamic simulations of these experiments, in both 2D and 3D geometries, using both finite element method and smoothed particles hydrodynamics. Numerical results are compared to several theoretical predictions including the Richtmyer-Meshkov instabilities. The role of the elastic-plastic behavior on jet formation is investigated. Finally, the possibility to simulate the late stages of jet expansion and fragmentation is explored, to evaluate the mass distribution of the ejecta and their ballistic properties, still essentially unknown in the experiments.

  3. Investigation of performance limits in axial groove heat pipes

    NASA Technical Reports Server (NTRS)

    Feldman, K. T.

    1976-01-01

    The entrainment-shear performance limit which occurs in axial groove heat pipes was investigated and explained. In the existing heat pipe literature the entrainment heat flux limit is defined as the condition where the Weber number is greater than or equal to one. In this analysis, the critical value for the entrainment Weber number is found to be 2 pi less than or equal to 3 pi. Perhaps more important to the heat pipe designer than the entrainment performance limit is the prediction of the performance degradation due to vapor-liquid shearing stress which is also described. Preliminary qualitative experiments were conducted to observe the shear. stress wave formation phenomena. The equations presented may be used to predict and minimize the vapor-liquid shear stress performance effects that occur in axial groove and puddle flow artery heat pipes.

  4. Scattering by a groove in an impedance plane

    NASA Technical Reports Server (NTRS)

    Bindiganavale, Sunil; Volakis, John L.

    1993-01-01

    An analysis of two-dimensional scattering from a narrow groove in an impedance plane is presented. The groove is represented by a impedance surface and the problem reduces to that of scattering from an impedance strip in an otherwise uniform impedance plane. On the basis of this model, appropriate integral equations are constructed using a form of the impedance plane Green's functions involving rapidly convergent integrals. The integral equations are solved by introducing a single basis representation of the equivalent current on the narrow impedance insert. Both transverse electric (TE) and transverse magnetic (TM) polarizations are treated. The resulting solution is validated by comparison with results from the standard boundary integral method (BIM) and a high frequency solution. It is found that the presented solution for narrow impedance inserts can be used in conjunction with the high frequency solution for the characterization of impedance inserts of any given width.

  5. Dance, Music, Meter and Groove: A Forgotten Partnership.

    PubMed

    Fitch, W Tecumseh

    2016-01-01

    I argue that core aspects of musical rhythm, especially "groove" and syncopation, can only be fully understood in the context of their origins in the participatory social experience of dance. Musical meter is first considered in the context of bodily movement. I then offer an interpretation of the pervasive but somewhat puzzling phenomenon of syncopation in terms of acoustic emphasis on certain offbeat components of the accompanying dance style. The reasons for the historical tendency of many musical styles to divorce themselves from their dance-based roots are also briefly considered. To the extent that musical rhythms only make sense in the context of bodily movement, researchers interested in ecologically valid approaches to music cognition should make a more concerted effort to extend their analyses to dance, particularly if we hope to understand the cognitive constraints underlying rhythmic aspects of music like meter and groove. PMID:26973489

  6. Solder wetting kinetics in narrow V-grooves

    SciTech Connect

    Yost, F.G.; Rye, R.R.; Mann, J.A. Jr.

    1997-12-01

    Experiments are performed to observe capillary flow in grooves cut into copper surfaces. Flow kinetics of two liquids, 1-heptanol and eutectic Sn-Pb solder, are modeled with modified Washburn kinetics and compared to flow data. It is shown that both liquids flow parabolically in narrow V-grooves, and the data scale as predicted by the modified Washburn model. The early portions of the flow kinetics are characterized by curvature in the length vs time relationship which is not accounted for in the modified Washburn model. This effect is interpreted in terms of a dynamic contact angle. It is concluded that under conditions of rapid flow, solder spreading can be understood as a simple fluid flow process. Slower kinetics, e.g. solder droplet spreading on flat surfaces, may be affected by subsidiary chemical processes such as reaction.

  7. Narrow groove welding gas diffuser assembly and welding torch

    SciTech Connect

    Rooney, Stephen J.

    2000-02-04

    A diffuser assembly is provided for narrow groove welding using an automatic gas tungsten arc welding torch. The diffuser assembly includes manifold adapted for adjustable mounting on the welding torch which is received in a central opening in the manifold. Laterally extending manifold sections communicate with a shield gas inlet such that shield gas supplied to the inlet passes to gas passages of the manifold sections. First and second tapered diffusers are respectively connected to the manifold sections in fluid communication with the gas passages thereof. The diffusers extend downwardly along the torch electrode on opposite sides thereof so as to release shield gas along the length of the electrode and at the distal tip of the electrode. The diffusers are of a transverse width which is on the order of the thickness of the electrode so that the diffusers can, in use, be inserted into a narrow welding groove before and after the electrode in the direction of the weld operation.

  8. Narrow groove welding gas diffuser assembly and welding torch

    DOEpatents

    Rooney, Stephen J.

    2001-01-01

    A diffuser assembly is provided for narrow groove welding using an automatic gas tungsten arc welding torch. The diffuser assembly includes a manifold adapted for adjustable mounting on the welding torch which is received in a central opening in the manifold. Laterally extending manifold sections communicate with a shield gas inlet such that shield gas supplied to the inlet passes to gas passages of the manifold sections. First and second tapered diffusers are respectively connected to the manifold sections in fluid communication with the gas passages thereof. The diffusers extend downwardly along the torch electrode on opposite sides thereof so as to release shield gas along the length of the electrode and at the distal tip of the electrode. The diffusers are of a transverse width which is on the order of the thickness of the electrode so that the diffusers can, in use, be inserted into a narrow welding groove before and after the electrode in the direction of the weld operation.

  9. A camera for a narrow and deep welding groove

    NASA Astrophysics Data System (ADS)

    Vehmanen, Miika S.; Korhonen, Mika; Mäkynen, Anssi J.

    2008-06-01

    In this paper welding seam imaging in a very narrow and deep groove is presented. Standard camera optics can not be used as it does not reach the bottom of the groove. Therefore, selecting suitable imaging optics and components was the main challenge of the study. The implementation is based on image transmission via a borescope. The borescope has a long and narrow tube with graded index relay optics inside. To avoid excessive heating, the borescope tube is enclosed in a cooling pipe. The performance of the imaging system was tested by measuring its modulation transfer function (MTF) and visually evaluated its distortion. The results show that a borescope providing VGA resolution is adequate for the application. The spectrum of the welding processes was studied to determine optimum window to observe the welding seam and electrode. Optimal bandwidth was found in region of 700nm-1000nm.

  10. Fabrication and characterization of V-groove liquid core waveguide

    NASA Astrophysics Data System (ADS)

    Nazari, T.; Khazaeinezhad, R.; Kassani, S. H.; Joo, B.; Suwal, O. K.; Hwang, J. H.; Paulson, B.; Park, J.; Oh, K.

    2015-07-01

    We report development of a new kind of micro-optical waveguide based on liquid core in a V-groove glass and air cladding and a similar finite element method was constructed to investigate the guiding properties such as mode distribution and modal birefringence. Through the detailed modeling, we investigate the role of each parameter such as, refractive index of core and diameter of core of V-groove structure. This work demonstrates numerically and experimentally high birefringence in this optical waveguide and different aspects of the fiber properties related to the fundamental mode and fiber birefringence are revealed. As a result, wave-guide with large birefringence is identified for opening angle of 40 degree and refractive index of 1.472.

  11. Empirical rheological model for rough or grooved bonded interfaces.

    PubMed

    Belloncle, Valentina Vlasie; Rousseau, Martine

    2007-12-01

    In the industrial sector, it is common to use metal/adhesive/metal structural bonds. The cohesion of such structures can be improved by preliminary chemical treatments (degreasing with solvents, alkaline, or acid pickling), electrochemical treatments (anodising), or mechanical treatments (abrasion, sandblasting, grooving) of the metallic plates. All these pretreatments create some asperities, ranging from roughnesses to grooves. On the other hand, in damage solid mechanics and in non-destructive testing, rheological models are used to measure the strength of bonded interfaces. However, these models do not take into account the interlocking of the adhesive in the porosities. Here, an empirical rheological model taking into account the interlocking effects is developed. This model depends on a characteristic parameter representing the average porosity along the interface, which considerably simplifies the corresponding stress and displacement jump conditions. The paper deals with the influence of this interface model on the ultrasonic guided modes of the structure. PMID:17659313

  12. Perineal Groove: A Rare Congenital Midline Defect of Perineum.

    PubMed

    Harsono, Mimily; Pourcyrous, Massroor

    2016-03-01

    Perineal groove is a rare congenital malformation that is characterized by an exposed wet sulcus with nonkeratinized mucous membrane that extends from the posterior vaginal fourchette to the anterior ridge of the anal orifice. This condition is one of the uncommon anomalies of urogenital/anogenital region that is unknown to many clinicians. Although, this condition may be self-resolved before the age of 2 years, this nonepithelized mucous membrane can pose the risk of local irritation and infection, urinary tract infection, and the possibility of nonself-resolved condition that eventually needs surgical correction. Only a few reported cases (n = 23) were found in current medical literatures. This lesion could be misdiagnosed as contact dermatitis, trauma, or even sexual abuse. Therefore, recognition of the congenital perineal groove at birth is important for the health care providers to deliver an appropriate parental counseling and appropriate follow-up. PMID:26929866

  13. Blogs and Social Network Sites as Activity Systems: Exploring Adult Informal Learning Process through Activity Theory Framework

    ERIC Educational Resources Information Center

    Heo, Gyeong Mi; Lee, Romee

    2013-01-01

    This paper uses an Activity Theory framework to explore adult user activities and informal learning processes as reflected in their blogs and social network sites (SNS). Using the assumption that a web-based space is an activity system in which learning occurs, typical features of the components were investigated and each activity system then…

  14. Groove Pancreatitis: A Rare form of Chronic Pancreatitis

    PubMed Central

    Jani, Bharivi; Rzouq, Fadi; Saligram, Shreyas; Nawabi, Atta; Nicola, Marian; Dennis, Katie; Ernst, Carly; Abbaszadeh, Ali; Bonino, John; Olyaee, Mojtaba

    2015-01-01

    Context: Groove pancreatitis is a rare form of chronic pancreatitis affecting the “groove” of the pancreas among the pancreatic head, duodenum, and common bile duct. The exact cause is unknown, although there are associations with long-term alcohol abuse, smoking, peptic ulcer disease, heterotopic pancreas, gastric resection, biliary disease, and anatomical or functional obstruction of the minor papilla. The diagnosis can be challenging. Endoscopic ultrasound (EUS) and magnetic resonance cholangiopancreatography are the preferred imaging modalities. The treatment of choice is conservative although surgical intervention can sometimes be required. Case Report: A 57-year-old male with a history of human immunodeficiency virus and hepatitis B presented with 4 days of epigastric pain. Abdominal exam revealed absent bowel sounds and epigastric tenderness. He had a creatinine of 1.72 mg/dL, potassium of 2.9 mmol/L, and a normal lipase level of 86 U/L. Liver enzymes and total bilirubin were normal. Computed tomography abdomen showed high-grade obstruction of the second portion of the duodenum without any obvious mass. An esophagogastroduodenoscopy showed a mass at the duodenal bulb causing luminal narrowing, with biopsies negative for malignancy. Magnetic resonance imaging revealed a mass in the region of the pancreatic head and descending duodenum. EUS revealed a 3 cm mass in the region of pancreatic head with irregular borders and no vascular invasion. Fine needle aspiration (FNA) was nondiagnostic. The patient then underwent a Whipple's procedure. Pathology of these specimens was negative for malignancy but was consistent with para-duodenal or groove pancreatitis. Conclusion: The low incidence of groove pancreatitis is partly due to lack of familiarity with the disease. Groove pancreatitis should be considered in the differential for patients presenting with pancreatic head lesions and no cholestatic jaundice, especially when a duodenal obstruction is present, and

  15. DETAILED VIEW OF THE CARPORT WITH TWO TONGUE AND GROOVE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DETAILED VIEW OF THE CARPORT WITH TWO TONGUE AND GROOVE DOORS TO THE STORAGE CLOSET. REPLACEMENT VINYL VENTED SOFFIT MATERIAL IS VISIBLE IN THIS SHOT - Camp H.M. Smith and Navy Public Works Center Manana Title VII (Capehart) Housing, U-Shaped Two-Bedroom Single-Family Type 6, Birch Circle, Elm Drive, Elm Circle, and Date Drive, Pearl City, Honolulu County, HI

  16. Presentation and Patterns of Late Recurrence of Olfactory Groove Meningiomas

    PubMed Central

    Snyder, William E.; Shah, Mitesh V.; Weisberger, Edward C.; Campbell, Robert L.

    2000-01-01

    The objective of this article is to present the recurrence pattern of olfactory groove meningiomas after surgical resection. Four patients, one female and three males, with surgically resected olfactory groove meningiomas presented with tumor recurrence. All patients underwent resection of an olfactory groove meningioma and later presented with recurrent tumors. The mean age at initial diagnosis was 47 years. All presented initially with vision changes, anosmia, memory dysfunction, and personality changes. Three patients had a preoperative MRI scan. All patients had a craniotomy, with gross total resection achieved in three, and 90% tumor removal achieved in the fourth. Involved dura was coagulated, but not resected, in all cases. Three patients were followed with routine head CT scans postoperatively, and none was followed with MRI scan. The mean time to recurrence was 6 years. Three patients presented with recurrent visual deterioration, and one presented with symptoms of nasal obstruction. Postoperative CT scans failed to document early tumor recurrence, whereas MRI documented tumor recurrence in all patients. Tumor resection and optic nerve decompression improved vision in two patients and stabilized vision in two. Complete resection was not possible because of extensive bony involvement around the anterior clinoid and inferior to the anterior cranial fossa in all cases. Evaluation of four patients with recurrent growth of olfactory groove meningiomas showed the epicenter of recurrence to be inferior to the anterior cranial fossa, with posterior extension involving the optic canals, leading to visual deterioration. This location led to a delay in diagnosis in patients who were followed only with routine CT scans. Initial surgical procedures should include removal of involved dura and bone, and follow-up evaluation should include formal ophthalmologic evaluations and routine head MRI scans. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6Figure 7 PMID

  17. Morphological study of proximal root grooves and their influence on periodontal attachment loss

    PubMed Central

    Kaur, Saravpreet; Gupta, Rajan; Dahiya, Parveen; Kumar, Mukesh

    2016-01-01

    Background: The etiology of periodontal diseases is multifactorial including both systemic and local causes. Local factors such as grooves on root surfaces contribute a great deal to the causation of periodontal diseases. Materials and Methods: Proximal radicular grooves were studied in 150 extracted maxillary and mandibular anterior teeth. Periodontal attachment loss was measured after staining the root surfaces with 0.1% toluidine blue stain. The relationship of the presence and absence of grooves with periodontal attachment loss was also studied. Results: The prevalence of proximal root grooves was found to be 86.67%. The prevalence of grooves on maxillary teeth was 43.42% and on mandibular teeth was 56.67%. A greater loss of attachment was present on grooved surfaces than on nongrooved surfaces. Conclusion: The proximal radicular grooves present as one of the major etiological factors in periodontal diseases. PMID:27563206

  18. Modulation of alignment and differentiation of skeletal myoblasts by submicron ridges/grooves surface structure.

    PubMed

    Wang, Peng-Yuan; Yu, Hung-Te; Tsai, Wei-Bor

    2010-06-01

    Alignment and fusion of myoblasts into parallel arrays of multinucleated myotubes are critical in skeletal muscle tissue engineering. It is well known that contact guidance by grooves/ridges structures induces myoblasts to align and to migrate along the anisotropic direction. In this study, two series of grooved substrata with different widths (450 and 900 nm) and different depths (100, 350, and 550 nm) were studied on their effects on myoblast adhesion, proliferation, and differentiation into myotubes. We found that C2C12 cells were aligned and elongated along the direction of grooves. Groove depth was more influential on cellular morphology, proliferation, and differentiation than groove width. While cell proliferation was retarded on the grooved surfaces especially on the substrate with 900/550 nm (width/depth), differentiation was also enhanced on the patterned surfaces compared to the flat control. Our results demonstrated the potential of grooved substrata with submicron scale in skeletal muscle tissue engineering. PMID:20148416

  19. Optimization of self-acting herringbone-grooved journal bearings for maximum stability

    NASA Technical Reports Server (NTRS)

    Fleming, D. P.; Hamrock, B. J.

    1974-01-01

    Groove parameters were determined to maximize the stability of herringbone-grooved journal bearings. Parameters optimized were groove depth, width, length, and angle. Optimization was performed by using a small-eccentricity, infinite-groove analysis in conjunction with a previously developed Newton-Raphson procedure for bearings with the smooth member rotating or with the grooved member rotating at low compressibility numbers, and a newly developed vector technique for bearings with the grooved member rotating at high compressibility numbers. The design curves in this report enable one to choose the optimum bearing for a wide range of operating conditions. Compared with bearings optimized to maximize load capacity, bearings optimized for stability allow a thousandfold increase in bearing-supported mass in some cases before onset of instability, and lose no more than 77 percent of their load capacity in any case studied. Stability is much greater when the grooved member rotates.

  20. Active-Site Hydration and Water Diffusion in Cytochrome P450cam: A Highly Dynamic Process

    SciTech Connect

    Miao, Yinglong; Baudry, Jerome Y

    2011-01-01

    Long-timescale molecular dynamics simulations (300 ns) are performed on both the apo- (i.e., camphor-free) and camphor-bound cytochrome P450cam (CYP101). Water diffusion into and out of the protein active site is observed without biased sampling methods. During the course of the molecular dynamics simulation, an average of 6.4 water molecules is observed in the camphor-binding site of the apo form, compared to zero water molecules in the binding site of the substrate-bound form, in agreement with the number of water molecules observed in crystal structures of the same species. However, as many as 12 water molecules can be present at a given time in the camphor-binding region of the active site in the case of apo-P450cam, revealing a highly dynamic process for hydration of the protein active site, with water molecules exchanging rapidly with the bulk solvent. Water molecules are also found to exchange locations frequently inside the active site, preferentially clustering in regions surrounding the water molecules observed in the crystal structure. Potential-of-mean-force calculations identify thermodynamically favored trans-protein pathways for the diffusion of water molecules between the protein active site and the bulk solvent. Binding of camphor in the active site modifies the free-energy landscape of P450cam channels toward favoring the diffusion of water molecules out of the protein active site.

  1. The flow past a cactus-inspired grooved cylinder

    NASA Astrophysics Data System (ADS)

    El-Makdah, Adnan M.; Oweis, Ghanem F.

    2013-02-01

    The star-shaped cross section of giant cylindrical cactus plants is thought to be aerodynamically favorable for protection against toppling by strong winds. Particle image velocimetry is used to investigate the flow details within the surface grooves and in the immediate wake of a cactus-inspired model cylinder with eight longitudinal grooves, at biologically relevant Reynolds numbers between 50 × 103 and 170 × 103. The wake flow is analyzed and compared to a similarly sized circular cylinder. At the lowest Re tested, the wakes from the two geometries are similar. At higher Re, the cactus wake exhibits superior behavior as seen from the mean and turbulent velocities, suggesting that the flow mechanisms are Re dependent. The flow within the surface grooves reveals counter rotating rollers, while the geometrical ridges act as vortex generators known to help with the surface flow attachment. Lastly, a simplistic analysis is described to recover, qualitatively, certain time-dependent flow features from the randomly acquired PIV realizations.

  2. Minimum energy paths of wetting transitions on grooved surfaces.

    PubMed

    Pashos, George; Kokkoris, George; Boudouvis, Andreas G

    2015-03-17

    A method that computes minimum energy paths (MEPs) of wetting transitions is developed. The method couples the Cahn-Hilliard formulation of a modified phase-field method with the simplified string method. Its main computational kernel is the fast Fourier transform that is efficiently performed on graphics processing units. The effectiveness of the proposed method is demonstrated on two types of transitions of droplets on grooved surfaces. The first is the transition from the Cassie-Baxter wetting state to the Wenzel state, where it is shown that it progresses in a sequential manner with the droplet wetting each groove successively. The second transition type is a lateral displacement of the droplet against the grooves, where the droplet successively detaches/attaches from/to the rear/front protrusion of the surface (a transition in the reverse order is also possible). The energy barriers of both the transitions are extracted from the MEP; they are useful for the evaluation of the robustness of superhydrophobic surfaces (resistance to the Cassie-Baxter to Wenzel transition) and the droplet mobility on those surfaces (high mobility/small resistance to lateral displacements). The relation of the MEP with the potential transition paths coming from the solution space mapping is discussed. PMID:25715270

  3. Plant nuclei can contain extensive grooves and invaginations.

    PubMed

    Collings, D A; Carter, C N; Rink, J C; Scott, A C; Wyatt, S E; Allen, N S

    2000-12-01

    Plant cells can exhibit highly complex nuclear organization. Through dye-labeling experiments in untransformed onion epidermal and tobacco culture cells and through the expression of green fluorescent protein targeted to either the nucleus or the lumen of the endoplasmic reticulum/nuclear envelope in these cells, we have visualized deep grooves and invaginations into the large nuclei of these cells. In onion, these structures, which are similar to invaginations seen in some animal cells, form tubular or planelike infoldings of the nuclear envelope. Both grooves and invaginations are stable structures, and both have cytoplasmic cores containing actin bundles that can support cytoplasmic streaming. In dividing tobacco cells, invaginations seem to form during cell division, possibly from strands of the endoplasmic reticulum trapped in the reforming nucleus. The substantial increase in nuclear surface area resulting from these grooves and invaginations, their apparent preference for association with nucleoli, and the presence in them of actin bundles that support vesicle motility suggest that the structures might function both in mRNA export from the nucleus and in protein import from the cytoplasm to the nucleus. PMID:11148288

  4. Plant nuclei can contain extensive grooves and invaginations

    NASA Technical Reports Server (NTRS)

    Collings, D. A.; Carter, C. N.; Rink, J. C.; Scott, A. C.; Wyatt, S. E.; Allen, N. S.; Brown, C. S. (Principal Investigator)

    2000-01-01

    Plant cells can exhibit highly complex nuclear organization. Through dye-labeling experiments in untransformed onion epidermal and tobacco culture cells and through the expression of green fluorescent protein targeted to either the nucleus or the lumen of the endoplasmic reticulum/nuclear envelope in these cells, we have visualized deep grooves and invaginations into the large nuclei of these cells. In onion, these structures, which are similar to invaginations seen in some animal cells, form tubular or planelike infoldings of the nuclear envelope. Both grooves and invaginations are stable structures, and both have cytoplasmic cores containing actin bundles that can support cytoplasmic streaming. In dividing tobacco cells, invaginations seem to form during cell division, possibly from strands of the endoplasmic reticulum trapped in the reforming nucleus. The substantial increase in nuclear surface area resulting from these grooves and invaginations, their apparent preference for association with nucleoli, and the presence in them of actin bundles that support vesicle motility suggest that the structures might function both in mRNA export from the nucleus and in protein import from the cytoplasm to the nucleus.

  5. Features and applications of the Groove Analysis Program (GAP)

    NASA Technical Reports Server (NTRS)

    Ku, Jentung; Nguyen, Tu M.; Brennan, Patrick J.

    1995-01-01

    An IBM Personal Computer (PC) version of the Groove Analysis program (GAP) was developed to predict the steady state heat transport capability of an axially grooved heat pipe for a specified groove geometry and working fluid. In the model, the capillary limit is determined by the numerical solution of the differential equation for momentum conservation with the appropriate boundary conditions. This governing equation accounts for the hydrodynamic losses due to friction in liquid and vapor flows and due to liquid/vapor shear interaction. Back-pumping in both 0-g and 1-g is accounted for in the boundary condition at the condenser end. Slug formation in 0-g and puddle flow in 1-g are also considered in the model. At the user's discretion, the code will perform the analysis for various fluid inventories (undercharge, nominal charge, overcharge, or a fixed fluid charge) and heat pipe elevations. GAP will also calculate the minimum required heat pipe wall thickness for pressure containment at design temperatures that are greater than or lower than the critical temperature of the working fluid. This paper discusses the theory behind the development of the GAP model. It also presents the many useful and powerful capabilities of the model. Furthermore, a correlation of flight test performance data and the predictions using GAP are presented and discussed.

  6. Active site densities, oxygen activation and adsorbed reactive oxygen in alcohol activation on npAu catalysts.

    PubMed

    Wang, Lu-Cun; Friend, C M; Fushimi, Rebecca; Madix, Robert J

    2016-07-01

    The activation of molecular O2 as well as the reactivity of adsorbed oxygen species is of central importance in aerobic selective oxidation chemistry on Au-based catalysts. Herein, we address the issue of O2 activation on unsupported nanoporous gold (npAu) catalysts by applying a transient pressure technique, a temporal analysis of products (TAP) reactor, to measure the saturation coverage of atomic oxygen, its collisional dissociation probability, the activation barrier for O2 dissociation, and the facility with which adsorbed O species activate methanol, the initial step in the catalytic cycle of esterification. The results from these experiments indicate that molecular O2 dissociation is associated with surface silver, that the density of reactive sites is quite low, that adsorbed oxygen atoms do not spill over from the sites of activation onto the surrounding surface, and that methanol reacts quite facilely with the adsorbed oxygen atoms. In addition, the O species from O2 dissociation exhibits reactivity for the selective oxidation of methanol but not for CO. The TAP experiments also revealed that the surface of the npAu catalyst is saturated with adsorbed O under steady state reaction conditions, at least for the pulse reaction. PMID:27376884

  7. Active Site Structure and Peroxidase Activity of Oxidatively Modified Cytochrome c Species in Complexes with Cardiolipin.

    PubMed

    Capdevila, Daiana A; Oviedo Rouco, Santiago; Tomasina, Florencia; Tortora, Verónica; Demicheli, Verónica; Radi, Rafael; Murgida, Daniel H

    2015-12-29

    We report a resonance Raman and UV-vis characterization of the active site structure of oxidatively modified forms of cytochrome c (Cyt-c) free in solution and in complexes with cardiolipin (CL). The studied post-translational modifications of Cyt-c include methionine sulfoxidation and tyrosine nitration, which lead to altered heme axial ligation and increased peroxidase activity with respect to those of the wild-type protein. In spite of the structural and activity differences between the protein variants free in solution, binding to CL liposomes induces in all cases the formation of a spectroscopically identical bis-His axial coordination conformer that more efficiently promotes lipid peroxidation. The spectroscopic results indicate that the bis-His form is in equilibrium with small amounts of high-spin species, thus suggesting a labile distal His ligand as the basis for the CL-induced increase in enzymatic activity observed for all protein variants. For Cyt-c nitrated at Tyr74 and sulfoxidized at Met80, the measured apparent binding affinities for CL are ∼4 times larger than for wild-type Cyt-c. On the basis of these results, we propose that these post-translational modifications may amplify the pro-apoptotic signal of Cyt-c under oxidative stress conditions at CL concentrations lower than for the unmodified protein. PMID:26620444

  8. Cross slit-grooves grid structure for surface plasmon resonant sensor

    NASA Astrophysics Data System (ADS)

    Lee, Jooho; Nakarmi, Bikash; Kim, Bongho; Jang, Wonjae; Bang, Yousung; Lee, Muyoung; Won, Y. H.

    2016-03-01

    Surface plasmon resonant (SPR) phenomenon is widely researched for various purposes, among which biomedical sensing is getting more attentions as they are suitable for surface functionalization acting as a bio recognition element to detect different biological infections. The common method of surface resonant is propagating SPR such as reflection method. Another method which is widely used for SPR is localized SPR which use nanostructures in thin metal. Various structures such as slit only, slit- groove and slit-multiple groove are used for generation of SPR and obtaining the optimum optical transmittance through the structure. The number and position of slits and grooves affect transmittance through the structure. In this paper we propose a new structure of cross slit-grooves structure, which includes slit-groove structure in grid form. The slit-grooves structures are arranged in such a way that it forms symmetrical structure in two dimension with slit and groove and hence the transmittance with cross slit-grooves structure increases significantly. The cross slit-grooves structure takes the advantage of symmetrical slit and groove by using both dimensional structures for generating SPR which increases the transmittance through the structure. A comparison of proposed slit-grooves grid structure with straight slit-grooves structure is carried out to show the increase in transmittance through the cross slit-grooves grid structure. Plane wavelength of 400 nm to 900 nm is used for the analysis of transmittance through the Ag slit-grooves grid structures with glass substrate. We also measure the change in transmittance with change in refractive index, which can be helpful for measuring different chemical analytes, and hence can be used for different chemical and biosensors applications.

  9. Identification of Ice Nucleation Active Sites on Feldspar Dust Particles

    PubMed Central

    2015-01-01

    Mineral dusts originating from Earth’s crust are known to be important atmospheric ice nuclei. In agreement with earlier studies, feldspar was found as the most active of the tested natural mineral dusts. Here we investigated in closer detail the reasons for its activity and the difference in the activity of the different feldspars. Conclusions are drawn from scanning electron microscopy, X-ray powder diffraction, infrared spectroscopy, and oil-immersion freezing experiments. K-feldspar showed by far the highest ice nucleation activity. Finally, we give a potential explanation of this effect, finding alkali-metal ions having different hydration shells and thus an influence on the ice nucleation activity of feldspar surfaces. PMID:25584435

  10. Early Site Permit Demonstration Program: Recommendations for communication activities and public participation in the Early Site Permit Demonstration Program

    SciTech Connect

    Not Available

    1993-01-27

    On October 24, 1992, President Bush signed into law the National Energy Policy Act of 1992. The bill is a sweeping, comprehensive overhaul of the Nation`s energy laws, the first in more than a decade. Among other provisions, the National Energy Policy Act reforms the licensing process for new nuclear power plants by adopting a new approach developed by the US Nuclear Regulatory Commission (NRC) in 1989, and upheld in court in 1992. The NRC 10 CFR Part 52 rule is a three-step process that guarantees public participation at each step. The steps are: early site permit approval; standard design certifications; and, combined construction/operating licenses for nuclear power reactors. Licensing reform increases an organization`s ability to respond to future baseload electricity generation needs with less financial risk for ratepayers and the organization. Costly delays can be avoided because design, safety and siting issues will be resolved before a company starts to build a plant. Specifically, early site permit approval allows for site suitability and acceptability issues to be addressed prior to an organization`s commitment to build a plant. Responsibility for site-specific activities, including communications and public participation, rests with those organizations selected to try out early site approval. This plan has been prepared to assist those companies (referred to as sponsoring organizations) in planning their communications and public involvement programs. It provides research findings, information and recommendations to be used by organizations as a resource and starting point in developing their own plans.

  11. Ultrafast ligand binding dynamics in the active site of native bacterial nitric oxide reductase.

    PubMed

    Kapetanaki, Sofia M; Field, Sarah J; Hughes, Ross J L; Watmough, Nicholas J; Liebl, Ursula; Vos, Marten H

    2008-01-01

    The active site of nitric oxide reductase from Paracoccus denitrificans contains heme and non-heme iron and is evolutionarily related to heme-copper oxidases. The CO and NO dynamics in the active site were investigated using ultrafast transient absorption spectroscopy. We find that, upon photodissociation from the active site heme, 20% of the CO rebinds in 170 ps, suggesting that not all the CO transiently binds to the non-heme iron. The remaining 80% does not rebind within 4 ns and likely migrates out of the active site without transient binding to the non-heme iron. Rebinding of NO to ferrous heme takes place in approximately 13 ps. Our results reveal that heme-ligand recombination in this enzyme is considerably faster than in heme-copper oxidases and are consistent with a more confined configuration of the active site. PMID:18420024

  12. Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination

    PubMed Central

    Rowley, Paul A.; Kachroo, Aashiq H.; Ma, Chien-Hui; Maciaszek, Anna D.; Guga, Piotr; Jayaram, Makkuni

    2015-01-01

    Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modification. The chemical chirality of MeP, in conjunction with mutant recombinases, reveals the stereochemical contributions of Arg-I and Arg-II. The SP preference of the native reaction is specified primarily by Arg-I. MeP reaction supported by Arg-II is nearly bias-free or RP-biased, depending on the Arg-I substituent. Positional conservation of the arginines does not translate into strict functional conservation. Charge reversal by glutamic acid substitution at Arg-I or Arg-II has opposite effects on Cre and Flp in MeP reactions. In Flp, the base immediately 5′ to the scissile MeP strongly influences the choice between the catalytic tyrosine and water as the nucleophile for strand scission, thus between productive recombination and futile hydrolysis. The recombinase active site embodies the evolutionary optimization of interactions that not only favor the normal reaction but also proscribe antithetical side reactions. PMID:25999343

  13. Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination.

    PubMed

    Rowley, Paul A; Kachroo, Aashiq H; Ma, Chien-Hui; Maciaszek, Anna D; Guga, Piotr; Jayaram, Makkuni

    2015-07-13

    Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modification. The chemical chirality of MeP, in conjunction with mutant recombinases, reveals the stereochemical contributions of Arg-I and Arg-II. The SP preference of the native reaction is specified primarily by Arg-I. MeP reaction supported by Arg-II is nearly bias-free or RP-biased, depending on the Arg-I substituent. Positional conservation of the arginines does not translate into strict functional conservation. Charge reversal by glutamic acid substitution at Arg-I or Arg-II has opposite effects on Cre and Flp in MeP reactions. In Flp, the base immediately 5' to the scissile MeP strongly influences the choice between the catalytic tyrosine and water as the nucleophile for strand scission, thus between productive recombination and futile hydrolysis. The recombinase active site embodies the evolutionary optimization of interactions that not only favor the normal reaction but also proscribe antithetical side reactions. PMID:25999343

  14. Shaping Diffraction-Grating Grooves to Optimize Efficiency

    NASA Technical Reports Server (NTRS)

    Backlund, John; Wilson, Daniel; Mouroulis, Pantazis; Maker, Paul; Muller, Richard

    2008-01-01

    A method of shaping diffraction-grating grooves to optimize the spectral efficiency, spectral range, and image quality of a spectral imaging instrument is under development. The method is based on the use of an advanced design algorithm to determine the possibly complex shape of grooves needed to obtain a desired efficiency-versus-wavelength response (see figure). Then electron- beam fabrication techniques are used to realize the required groove shape. The method could be used, for example, to make the spectral efficiency of the grating in a given wavelength range proportional to the inverse of the spectral efficiency of a photodetector array so that the overall spectral efficiency of the combination of the grating and the photodetector array would be flat. The method has thus far been applied to one-dimensional gratings only, but in principle, it is also applicable to two-dimensional gratings. The algorithm involves calculations in the spatial-frequency domain. The spatial-frequency spectrum of a grating is represented as a diffraction-order spectral-peak-width function multiplied by an efficiency function for a single grating groove. This representation affords computational efficiency and accuracy by making it possible to consider only the response from one grating groove (one period of the grating), instead of from the whole grating area, in determining the response from the entire grating. This combination of efficiency and accuracy is crucial for future extensions of the algorithm to two-dimensional designs and to designs in which polarization must also be taken into account. The algorithm begins with the definition of target values of relative efficiency that represent the desired spectral response of the grating in certain spectral frequencies calculated from the diffraction order and wavelength. The grating period is divided into a number of cells - typically, 100. The phase contribution from each cell is determined from the phase of the incident

  15. Rock resistance and the development of horizontal grooves on Danxia slopes

    NASA Astrophysics Data System (ADS)

    Zhu, Cheng; Peng, Hua; Ouyang, Jie; Hu, Zhinong; Li, Lan

    2010-11-01

    Experimental analyses of uniaxial mechanical (compressive) strength, resistance against sulfuric acid, and freezing and thawing properties were performed on 137 sandstone cores collected from the Danxiashan Mountain (Guangdong Province), Langshan Mountain (Hunan Province), Taining (Fujian Province), and Longhushan Mountain (Jiangxi Province). In addition, 42 rock slices were collected for analysis under a polarizing microscope. The results show that the sandstone samples from the Longhu Mountain are the weakest in terms of the uniaxial mechanical strength and in the resistance against sulfuric acid, freezing, and thawing followed by Danxiashan, Langshan, and Taining. As the conglomerates, they are the weakest in Taining in the uniaxial mechanical strength and in the resistance against sulfuric acid, freezing, and thawing followed by Danxiashan, Longhushan and Langshan. As proved by the experiment, in the same area of the Danxia landscape, the uniaxial mechanical strength of the conglomerates over the flat grooves is universally higher than the sandstones in the flat grooves. In addition, the uniaxial mechanical strength without saturated water of both the sandstone and conglomerate are generally higher than those stones with saturated water, implying that in rainy and water-saturated season, Danxia rocks tend to crack and collapse more easily. Also discovered in this research, the developments of flat grooves in the strata of sandstones have certain reasons. The uniaxial mechanical strength, and the resistance against sulfuric acid, freezing, and thawing of the sandstones in the four sites of the Danxia landscape are universally lower than that of the conglomerates over the grooves. In terms of the physical composition and structure of the rocks, sandstone universally has a higher content of calcium fragments, more tensile cracks, and can be more easily penetrated into calcite veins; and the crystal fragments can be easily carbonated and are mostly cemented in the

  16. Quantifying the density and utilization of active sites in non-precious metal oxygen electroreduction catalysts.

    PubMed

    Sahraie, Nastaran Ranjbar; Kramm, Ulrike I; Steinberg, Julian; Zhang, Yuanjian; Thomas, Arne; Reier, Tobias; Paraknowitsch, Jens-Peter; Strasser, Peter

    2015-01-01

    Carbon materials doped with transition metal and nitrogen are highly active, non-precious metal catalysts for the electrochemical conversion of molecular oxygen in fuel cells, metal air batteries, and electrolytic processes. However, accurate measurement of their intrinsic turn-over frequency and active-site density based on metal centres in bulk and surface has remained difficult to date, which has hampered a more rational catalyst design. Here we report a successful quantification of bulk and surface-based active-site density and associated turn-over frequency values of mono- and bimetallic Fe/N-doped carbons using a combination of chemisorption, desorption and (57)Fe Mössbauer spectroscopy techniques. Our general approach yields an experimental descriptor for the intrinsic activity and the active-site utilization, aiding in the catalyst development process and enabling a previously unachieved level of understanding of reactivity trends owing to a deconvolution of site density and intrinsic activity. PMID:26486465

  17. Quantifying the density and utilization of active sites in non-precious metal oxygen electroreduction catalysts

    NASA Astrophysics Data System (ADS)

    Sahraie, Nastaran Ranjbar; Kramm, Ulrike I.; Steinberg, Julian; Zhang, Yuanjian; Thomas, Arne; Reier, Tobias; Paraknowitsch, Jens-Peter; Strasser, Peter

    2015-10-01

    Carbon materials doped with transition metal and nitrogen are highly active, non-precious metal catalysts for the electrochemical conversion of molecular oxygen in fuel cells, metal air batteries, and electrolytic processes. However, accurate measurement of their intrinsic turn-over frequency and active-site density based on metal centres in bulk and surface has remained difficult to date, which has hampered a more rational catalyst design. Here we report a successful quantification of bulk and surface-based active-site density and associated turn-over frequency values of mono- and bimetallic Fe/N-doped carbons using a combination of chemisorption, desorption and 57Fe Mössbauer spectroscopy techniques. Our general approach yields an experimental descriptor for the intrinsic activity and the active-site utilization, aiding in the catalyst development process and enabling a previously unachieved level of understanding of reactivity trends owing to a deconvolution of site density and intrinsic activity.

  18. Quantifying the density and utilization of active sites in non-precious metal oxygen electroreduction catalysts

    PubMed Central

    Sahraie, Nastaran Ranjbar; Kramm, Ulrike I.; Steinberg, Julian; Zhang, Yuanjian; Thomas, Arne; Reier, Tobias; Paraknowitsch, Jens-Peter; Strasser, Peter

    2015-01-01

    Carbon materials doped with transition metal and nitrogen are highly active, non-precious metal catalysts for the electrochemical conversion of molecular oxygen in fuel cells, metal air batteries, and electrolytic processes. However, accurate measurement of their intrinsic turn-over frequency and active-site density based on metal centres in bulk and surface has remained difficult to date, which has hampered a more rational catalyst design. Here we report a successful quantification of bulk and surface-based active-site density and associated turn-over frequency values of mono- and bimetallic Fe/N-doped carbons using a combination of chemisorption, desorption and 57Fe Mössbauer spectroscopy techniques. Our general approach yields an experimental descriptor for the intrinsic activity and the active-site utilization, aiding in the catalyst development process and enabling a previously unachieved level of understanding of reactivity trends owing to a deconvolution of site density and intrinsic activity. PMID:26486465

  19. Active Site Metal Occupancy and Cyclic Di-GMP Phosphodiesterase Activity of Thermotoga maritima HD-GYP.

    PubMed

    Miner, Kyle D; Kurtz, Donald M

    2016-02-16

    HD-GYPs make up a subclass of the metal-dependent HD phosphohydrolase superfamily and catalyze conversion of cyclic di(3',5')-guanosine monophosphate (c-di-GMP) to 5'-phosphoguanylyl-(3'→5')-guanosine (pGpG) and GMP. Until now, the only reported crystal structure of an HD-GYP that also exhibits c-di-GMP phosphodiesterase activity contains a His/carboxylate ligated triiron active site. However, other structural and phylogenetic correlations indicate that some HD-GYPs contain dimetal active sites. Here we provide evidence that an HD-GYP c-di-GMP phosphodiesterase, TM0186, from Thermotoga maritima can accommodate both di- and trimetal active sites. We show that an as-isolated iron-containing TM0186 has an oxo/carboxylato-bridged diferric site, and that the reduced (diferrous) form is necessary and sufficient to catalyze conversion of c-di-GMP to pGpG, but that conversion of pGpG to GMP requires more than two metals per active site. Similar c-di-GMP phosphodiesterase activities were obtained with divalent iron or manganese. On the basis of activity correlations with several putative metal ligand residue variants and molecular dynamics simulations, we propose that TM0186 can accommodate both di- and trimetal active sites. Our results also suggest that a Glu residue conserved in a subset of HD-GYPs is required for formation of the trimetal site and can also serve as a labile ligand to the dimetal site. Given the anaerobic growth requirement of T. maritima, we suggest that this HD-GYP can function in vivo with either divalent iron or manganese occupying di- and trimetal sites. PMID:26786892

  20. Molecular Basis for Enzymatic Sulfite Oxidation -- HOW THREE CONSERVED ACTIVE SITE RESIDUES SHAPE ENZYME ACTIVITY

    SciTech Connect

    Bailey, Susan; Rapson, Trevor; Johnson-Winters, Kayunta; Astashkin, Andrei; Enemark, John; Kappler, Ulrike

    2008-11-10

    Sulfite dehydrogenases (SDHs) catalyze the oxidation and detoxification of sulfite to sulfate, a reaction critical to all forms of life. Sulfite-oxidizing enzymes contain three conserved active site amino acids (Arg-55, His-57, and Tyr-236) that are crucial for catalytic competency. Here we have studied the kinetic and structural effects of two novel and one previously reported substitution (R55M, H57A, Y236F) in these residues on SDH catalysis. Both Arg-55 and His-57 were found to have key roles in substrate binding. An R55M substitution increased Km(sulfite)(app) by 2-3 orders of magnitude, whereas His-57 was required for maintaining a high substrate affinity at low pH when the imidazole ring is fully protonated. This effect may be mediated by interactions of His-57 with Arg-55 that stabilize the position of the Arg-55 side chain or, alternatively, may reflect changes in the protonation state of sulfite. Unlike what is seen for SDHWT and SDHY236F, the catalytic turnover rates of SDHR55M and SDHH57A are relatively insensitive to pH (~;;60 and 200 s-1, respectively). On the structural level, striking kinetic effects appeared to correlate with disorder (in SDHH57A and SDHY236F) or absence of Arg-55 (SDHR55M), suggesting that Arg-55 and the hydrogen bonding interactions it engages in are crucial for substrate binding and catalysis. The structure of SDHR55M has sulfate bound at the active site, a fact that coincides with a significant increase in the inhibitory effect of sulfate in SDHR55M. Thus, Arg-55 also appears to be involved in enabling discrimination between the substrate and product in SDH.

  1. Assessment of activation products in the Savannah River Site environment

    SciTech Connect

    Carlton, W.H.; Denham, M.

    1996-07-01

    This document assesses the impact of radioactive activation products released from SRS facilities since the first reactor became operational late in 1953. The isotopes reported here are those whose release resulted in the highest dose to people living near SRS: {sup 32}P, {sup 51}Cr, {sup 60}C, and {sup 65}Zn. Release pathways, emission control features, and annual releases to the aqueous and atmospheric environments are discussed. No single incident has resulted in a major acute release of activation products to the environment. The releases were the result of normal operations of the reactors and separations facilities. Releases declined over the years as better controls were established and production was reduced. The overall radiological impact of SRS activation product atmospheric releases from 1954 through 1994 on the offsite maximally exposed individual can be characterized by a total dose of 0.76 mrem. During the same period, such an individual received a total dose of 14,400 mrem from non-SRS sources of ionizing radiation present in the environment. SRS activation product aqueous releases between 1954 and 1994 resulted in a total dose of 54 mrem to the offsite maximally exposed individual. The impact of SRS activation product releases on offsite populations also has been evaluated.

  2. Tailoring the grooved texture of electrospun polystyrene nanofibers by controlling the solvent system and relative humidity.

    PubMed

    Liu, Wanjun; Huang, Chen; Jin, Xiangyu

    2014-01-01

    In this study, we have successfully fabricated electrospun polystyrene (PS) nanofibers having a diameter of 326 ± 50 nm with a parallel grooved texture using a mixed solvent of tetrahydrofuran (THF) and N,N-dimethylformamide (DMF). We discovered that solvent system, solution concentration, and relative humidity were the three key factors to the formation of grooved texture and the diameter of nanofibers. We demonstrated that grooved nanofibers with desired properties (e.g., different numbers of grooves, widths between two adjacent grooves, and depths of grooves) could be electrospun under certain conditions. When THF/DMF ratio was higher than 2:1, the formation mechanism of single grooved texture should be attributed to the formation of voids on the jet surface at the early stage of electrospinning and subsequent elongation and solidification of the voids into a line surface structure. When THF/DMF ratio was 1:1, the formation mechanism of grooved texture should be ascribed to the formation of wrinkled surface on the jet surface at the early stage of electrospinning and subsequent elongation into a grooved texture. Such findings can serve as guidelines for the preparation of grooved nanofibers with desired secondary morphology. PMID:25114643

  3. Tailoring the grooved texture of electrospun polystyrene nanofibers by controlling the solvent system and relative humidity

    PubMed Central

    2014-01-01

    In this study, we have successfully fabricated electrospun polystyrene (PS) nanofibers having a diameter of 326 ± 50 nm with a parallel grooved texture using a mixed solvent of tetrahydrofuran (THF) and N,N-dimethylformamide (DMF). We discovered that solvent system, solution concentration, and relative humidity were the three key factors to the formation of grooved texture and the diameter of nanofibers. We demonstrated that grooved nanofibers with desired properties (e.g., different numbers of grooves, widths between two adjacent grooves, and depths of grooves) could be electrospun under certain conditions. When THF/DMF ratio was higher than 2:1, the formation mechanism of single grooved texture should be attributed to the formation of voids on the jet surface at the early stage of electrospinning and subsequent elongation and solidification of the voids into a line surface structure. When THF/DMF ratio was 1:1, the formation mechanism of grooved texture should be ascribed to the formation of wrinkled surface on the jet surface at the early stage of electrospinning and subsequent elongation into a grooved texture. Such findings can serve as guidelines for the preparation of grooved nanofibers with desired secondary morphology. PMID:25114643

  4. Cyanide does more to inhibit heme enzymes, than merely serving as an active-site ligand.

    PubMed

    Parashar, Abhinav; Venkatachalam, Avanthika; Gideon, Daniel Andrew; Manoj, Kelath Murali

    2014-12-12

    The toxicity of cyanide is hitherto attributed to its ability to bind to heme proteins' active site and thereby inhibit their activity. It is shown herein that the long-held interpretation is inadequate to explain several observations in heme-enzyme reaction systems. Generation of cyanide-based diffusible radicals in heme-enzyme reaction milieu could shunt electron transfers (by non-active site processes), and thus be detrimental to the efficiency of oxidative outcomes. PMID:25449264

  5. Active site proton delivery and the lyase activity of human CYP17A1

    SciTech Connect

    Khatri, Yogan; Gregory, Michael C.; Grinkova, Yelena V.; Denisov, Ilia G.; Sligar, Stephen G.

    2014-01-03

    equivalents and protons are funneled into non-productive pathways. This is similar to previous work with other P450 catalyzed hydroxylation. However, catalysis of carbon–carbon bond scission by the T306A mutant was largely unimpeded by disruption of the CYP17A1 acid-alcohol pair. The unique response of CYP17A1 lyase activity to mutation of Thr306 is consistent with a reactive intermediate formed independently of proton delivery in the active site, and supports involvement of a nucleophilic peroxo-anion rather than the traditional Compound I in catalysis.

  6. Characterization of an Active Thermal Erosion Site, Caribou Creek, Alaska

    NASA Astrophysics Data System (ADS)

    Busey, R.; Bolton, W. R.; Cherry, J. E.; Hinzman, L. D.

    2013-12-01

    The goal of this project is to estimate volume loss of soil over time from this site, provide parameterizations on erodibility of ice rich permafrost and serve as a baseline for future landscape evolution simulations. Located in the zone of discontinuous permafrost, the interior region of Alaska (USA) is home to a large quantity of warm, unstable permafrost that is both high in ice content and has soil temperatures near the freezing point. Much of this permafrost maintains a frozen state despite the general warming air temperature trend in the region due to the presence of a thick insulating organic mat and a dense root network in the upper sub-surface of the soil column. At a rapidly evolving thermo-erosion site, located within the Caribou-Poker Creeks Research Watershed (part of the Bonanza Creek LTER) near Chatanika, Alaska (N65.140, W147.570), the protective organic layer and associated plants were disturbed by an adjacent traditional use trail and the shifting of a groundwater spring. These triggers have led to rapid geomorphological change on the landscape as the soil thaws and sediment is transported into the creek at the valley bottom. Since 2006 (approximately the time of initiation), the thermal erosion has grown to 170 meters length, 3 meters max depth, and 15 meters maximum width. This research combines several data sets: DGPS survey, imagery from an extremely low altitude pole-based remote sensing (3 to 5 meters above ground level), and imagery from an Unmanned Aerial System (UAS) at about 60m altitude.

  7. Marine Biology Field Trip Sites. Ocean Related Curriculum Activities.

    ERIC Educational Resources Information Center

    Pauls, John

    The ocean affects all of our lives. Therefore, awareness of and information about the interconnections between humans and oceans are prerequisites to making sound decisions for the future. Project ORCA (Ocean Related Curriculum Activities) has developed interdisciplinary curriculum materials designed to meet the needs of students and teachers…

  8. Reduction of urease activity by interaction with the flap covering the active site.

    PubMed

    Macomber, Lee; Minkara, Mona S; Hausinger, Robert P; Merz, Kenneth M

    2015-02-23

    With the increasing appreciation for the human microbiome coupled with the global rise of antibiotic resistant organisms, it is imperative that new methods be developed to specifically target pathogens. To that end, a novel computational approach was devised to identify compounds that reduce the activity of urease, a medically important enzyme of Helicobacter pylori, Proteus mirabilis, and many other microorganisms. Urease contains a flexible loop that covers its active site; Glide was used to identify small molecules predicted to lock this loop in an open conformation. These compounds were screened against the model urease from Klebsiella aerogenes, and the natural products epigallocatechin and quercetin were shown to inhibit at low and high micromolar concentrations, respectively. These molecules exhibit a strong time-dependent inactivation of urease that was not due to their oxygen sensitivity. Rather, these compounds appear to inactivate urease by reacting with a specific Cys residue located on the flexible loop. Substitution of this cysteine by alanine in the C319A variant increased the urease resistance to both epigallocatechin and quercetin, as predicted by the computational studies. Protein dynamics are integral to the function of many enzymes; thus, identification of compounds that lock an enzyme into a single conformation presents a useful approach to define potential inhibitors. PMID:25594724

  9. Reduction of Urease Activity by Interaction with the Flap Covering the Active Site

    PubMed Central

    Macomber, Lee; Minkara, Mona S.; Hausinger, Robert P.; Merz, Kenneth M.

    2015-01-01

    With the increasing appreciation for the human microbiome coupled with the global rise of antibiotic resistant organisms, it is imperative that new methods be developed to specifically target pathogens. To that end, a novel computational approach was devised to identify compounds that reduce the activity of urease, a medically important enzyme of Helicobacter pylori, Proteus mirabilis, and many other microorganisms. Urease contains a flexible loop that covers its active site; Glide was used to identify small molecules predicted to lock this loop in an open conformation. These compounds were screened against the model urease from Klebsiella aerogenes and the natural products epigallocatechin and quercetin were shown to inhibit at low and high micromolar concentrations, respectively. These molecules exhibit a strong time-dependent inactivation of urease that was not due to their oxygen sensitivity. Rather, these compounds appear to inactivate urease by reacting with a specific Cys residue located on the flexible loop. Substitution of this cysteine by alanine in the C319A variant increased the urease resistance to both epigallocatechin and quercetin, as predicted by the computational studies. Protein dynamics are integral to the function of many enzymes; thus, identification of compounds that lock an enzyme into a single conformation presents a useful approach to define potential inhibitors. PMID:25594724

  10. Encroachment of Human Activity on Sea Turtle Nesting Sites

    NASA Astrophysics Data System (ADS)

    Ziskin, D.; Aubrecht, C.; Elvidge, C.; Tuttle, B.; Baugh, K.; Ghosh, T.

    2008-12-01

    The encroachment of anthropogenic lighting on sea turtle nesting sites poses a serious threat to the survival of these animals [Nicholas, 2001]. This danger is quantified by combining two established data sets. The first is the Nighttime Lights data produced by the NOAA National Geophysical Data Center [Elvidge et al., 1997]. The second is the Marine Turtle Database produced by the World Conservation Monitoring Centre (WCMC). The technique used to quantify the threat of encroachment is an adaptation of the method described in Aubrecht et al. [2008], which analyzes the stress on coral reef systems by proximity to nighttime lights near the shore. Nighttime lights near beaches have both a direct impact on turtle reproductive success since they disorient hatchlings when they mistake land-based lights for the sky-lit surf [Lorne and Salmon, 2007] and the lights are also a proxy for other anthropogenic threats. The identification of turtle nesting sites with high rates of encroachment will hopefully steer conservation efforts to mitigate their effects [Witherington, 1999]. Aubrecht, C, CD Elvidge, T Longcore, C Rich, J Safran, A Strong, M Eakin, KE Baugh, BT Tuttle, AT Howard, EH Erwin, 2008, A global inventory of coral reef stressors based on satellite observed nighttime lights, Geocarto International, London, England: Taylor and Francis. In press. Elvidge, CD, KE Baugh, EA Kihn, HW Kroehl, ER Davis, 1997, Mapping City Lights with Nighttime Data from the DMSP Operational Linescan System, Photogrammatic Engineering and Remote Sensing, 63:6, pp. 727-734. Lorne, JK, M Salmon, 2007, Effects of exposure to artificial lighting on orientation of hatchling sea turtles on the beach and in the ocean, Endangered Species Research, Vol. 3: 23-30. Nicholas, M, 2001, Light Pollution and Marine Turtle Hatchlings: The Straw that Breaks the Camel's Back?, George Wright Forum, 18:4, p77-82. Witherington, BE, 1999, Reducing Threats To Nesting Habitat, Research and Management Techniques for

  11. Small Molecule Active Site Directed Tools for Studying Human Caspases.

    PubMed

    Poreba, Marcin; Szalek, Aleksandra; Kasperkiewicz, Paulina; Rut, Wioletta; Salvesen, Guy S; Drag, Marcin

    2015-11-25

    Caspases are proteases of clan CD and were described for the first time more than two decades ago. They play critical roles in the control of regulated cell death pathways including apoptosis and inflammation. Due to their involvement in the development of various diseases like cancer, neurodegenerative diseases, or autoimmune disorders, caspases have been intensively investigated as potential drug targets, both in academic and industrial laboratories. This review presents a thorough, deep, and systematic assessment of all technologies developed over the years for the investigation of caspase activity and specificity using substrates and inhibitors, as well as activity based probes, which in recent years have attracted considerable interest due to their usefulness in the investigation of biological functions of this family of enzymes. PMID:26551511

  12. Activation of brown adipose tissue mitochondrial GDP binding sites

    SciTech Connect

    Swick, A.G.

    1987-01-01

    The primary function of brown adipose tissue (BAT) is heat production. This ability is attributed to the existence of a unique inner mitochondrial membrane protein termed the uncoupling protein or thermogenin. This protein is permeable to H+ and thus allows respiration (and therefore thermogenesis) to proceed at a rapid rate, independent of ADP phosphorylation. Proton conductance can be inhibited by the binding of purine nucleotides to the uncoupling protein. The binding of (/sup 3/H)-GDP to BAT mitochondria is frequently used as a measure of BAT thermogenic activity. Rats fed a diet that was low but adequate in protein exhibited a decrease in feed efficiency. In addition, BAT thermogenesis was activated as indicated by an elevation in the level of GDP binding to BAT mitochondria. This phenomena occurred in older rats and persisted over time.

  13. Milling Of Shaped Grooves - Profile Of Form Tools

    NASA Astrophysics Data System (ADS)

    Pilc, Jozef; Sajgalik, Michal; Stancekova, Dana; Janota, Miroslav; Pitela, David

    2015-12-01

    This paper deals with design of milling tool for milling of shaped groove. Actual industry production requires the large amount of tools and notably the special tools used for example when shaped milling. The requirements on the quality of tools are increasingly demanding. The quality of tools is given by construction, production process, selected material and also heat treatment. Shaped milling requires special tools made for given shape. Main request on the construction of tool is making of shape of cutting edge, which can produce the required shape of workpiece.

  14. Groove Sizing Using a Robust Neural Network Approach

    NASA Astrophysics Data System (ADS)

    Le Brusquet, L.; Davoust, M.-E.; Fleury, G.

    2003-03-01

    The remote field eddy current technique is used to inspect conductive pipes from the inside. The problem is to calculate an estimation of groove dimensions from observed data. A first approach was previously developed using a two-step parametric inversion. Results from this first approach are produced using a new model. A second approach using a neural network is presented. This technique is known for the lack of robustness which may occur when precautions are not sufficient. This paper presents these precautions and the results of both approaches.

  15. The SSME seal test program: Leakage tests for helically-grooved seals

    NASA Technical Reports Server (NTRS)

    Childs, D. W.

    1983-01-01

    Helically grooved annular seal configurations were tested in highly turbulent flow to determine if reduced leakage and enhanced stability would result from the pumping action of the seal. It was found that: (1) leakage of a helically grooved seals decreases with running speed; (2) leakage reduction due to increased running speed is greater at lower values of R sub a; (3) an asymptote for leakage reduction is indicated with increasing running speed; (4) leakage is reduced by reducing the ridge (minimum) and average clearances; (5) leakage increases with increasing pitch angles and with increasing groove depth. Plain seals with smooth rotors and stators will leak more than a helically grooved seal. It was also found that plain seals with a rough rotor and a rough stator leak less than a properly designed helically grooved seal. A properly designed helically grooved seal consumes at least twice as much power as a conventional annular seal.

  16. Rotordynamic coefficients and leakage flow of parallel grooved seals and smooth seals

    NASA Technical Reports Server (NTRS)

    Nordmann, R.; Dietzen, F. J.; Janson, W.; Frei, A.; Florjancic, S.

    1987-01-01

    Based on Childs finite length solution for annular plain seals an extension of the bulk flow theory is derived to calculate the rotordynamic coefficients and the leakage flow of seals with parallel grooves in the stator. Hirs turbulent lubricant equations are modified to account for the different friction factors in circumferential and axial direction. Furthermore an average groove depth is introduced to consider the additional circumferential flow in the grooves. Theoretical and experimental results are compared for the smooth constant clearance seal and the corresponding seal with parallel grooves. Compared to the smooth seal the direct and cross-coupled stiffness coefficients as well as the direct damping coefficients are lower in the grooved seal configuration. Leakage is reduced by the grooving pattern.

  17. Experimental investigation of turbulent flow in smooth and longitudinal grooved tubes

    NASA Technical Reports Server (NTRS)

    Nitschke, P.

    1984-01-01

    Turbulent flow in tubes with and without longitudinal grooves is examined. The discovery of fine grooves forming a sort of streamline pattern on the body of sharks led to the expectation that the grooves on a surface reduce the momentum change, and thus the drag. To test this thesis, drag law, velocity profile and the profile of the velocity fluctuation were determined. Results show that for moderate Reynolds numbers the drag coefficient for grooved tubes is about 3 percent smaller than that of the smooth tubes. At higher Reynolds numbers, however, the drag coefficient for grooved tubes becomes larger than that for smooth tubes. No significant differences in the velocity profiles between grooved tubes and smooth tubes are found.

  18. School Pharmacist/School Environmental Hygienic Activities at School Site.

    PubMed

    Muramatsu, Akiyoshi

    2016-01-01

    The "School Health and Safety Act" was enforced in April 2009 in Japan, and "school environmental health standards" were established by the Minister of Education, Culture, Sports, Science and Technology. In Article 24 of the Enforcement Regulations, the duties of the school pharmacist have been clarified; school pharmacists have charged with promoting health activities in schools and carrying out complete and regular checks based on the "school environmental health standards" in order to protect the health of students and staff. In supported of this, the school pharmacist group of Japan Pharmaceutical Association has created and distributed digital video discs (DVDs) on "check methods of school environmental health standards" as support material. We use the DVD to ensure the basic issues that school pharmacists deal with, such as objectives, criteria, and methods for each item to be checked, advice, and post-measures. We conduct various workshops and classes, and set up Q&A committees so that inquiries from members are answered with the help of such activities. In addition, school pharmacists try to improve the knowledge of the school staff on environmental hygiene during their in-service training. They also conduct "drug abuse prevention classes" at school and seek to improve knowledge and recognition of drugs, including "dangerous drugs". PMID:27252053

  19. An Accessory Agonist Binding Site Promotes Activation of α4β2* Nicotinic Acetylcholine Receptors*

    PubMed Central

    Wang, Jingyi; Kuryatov, Alexander; Sriram, Aarati; Jin, Zhuang; Kamenecka, Theodore M.; Kenny, Paul J.; Lindstrom, Jon

    2015-01-01

    Neuronal nicotinic acetylcholine receptors containing α4, β2, and sometimes other subunits (α4β2* nAChRs) regulate addictive and other behavioral effects of nicotine. These nAChRs exist in several stoichiometries, typically with two high affinity acetylcholine (ACh) binding sites at the interface of α4 and β2 subunits and a fifth accessory subunit. A third low affinity ACh binding site is formed when this accessory subunit is α4 but not if it is β2. Agonists selective for the accessory ACh site, such as 3-[3-(3-pyridyl)-1,2,4-oxadiazol-5-yl]benzonitrile (NS9283), cannot alone activate a nAChR but can facilitate more efficient activation in combination with agonists at the canonical α4β2 sites. We therefore suggest categorizing agonists according to their site selectivity. NS9283 binds to the accessory ACh binding site; thus it is termed an accessory site-selective agonist. We expressed (α4β2)2 concatamers in Xenopus oocytes with free accessory subunits to obtain defined nAChR stoichiometries and α4/accessory subunit interfaces. We show that α2, α3, α4, and α6 accessory subunits can form binding sites for ACh and NS9283 at interfaces with α4 subunits, but β2 and β4 accessory subunits cannot. To permit selective blockage of the accessory site, α4 threonine 126 located on the minus side of α4 that contributes to the accessory site, but not the α4β2 sites, was mutated to cysteine. Alkylation of this cysteine with a thioreactive reagent blocked activity of ACh and NS9283 at the accessory site. Accessory agonist binding sites are promising drug targets. PMID:25869137

  20. Isolated metal active site concentration and stability control catalytic CO2 reduction selectivity.

    PubMed

    Matsubu, John C; Yang, Vanessa N; Christopher, Phillip

    2015-03-01

    CO2 reduction by H2 on heterogeneous catalysts is an important class of reactions that has been studied for decades. However, atomic scale details of structure-function relationships are still poorly understood. Particularly, it has been suggested that metal particle size plays a unique role in controlling the stability of CO2 hydrogenation catalysts and the distribution of active sites, which dictates reactivity and selectivity. These studies often have not considered the possible role of isolated metal active sites in the observed dependences. Here, we utilize probe molecule diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) with known site-specific extinction coefficients to quantify the fraction of Rh sites residing as atomically dispersed isolated sites (Rhiso), as well as Rh sites on the surface of Rh nanoparticles (RhNP) for a series of TiO2 supported Rh catalysts. Strong correlations were observed between the catalytic reverse water gas shift turn over frequency (TOF) and the fraction of Rhiso sites and between catalytic methanation TOF and the fraction of RhNP sites. Furthermore, it was observed that reaction condition-induced disintegration of Rh nanoparticles, forming Rhiso active sites, controls the changing reactivity with time on stream. This work demonstrates that isolated atoms and nanoparticles of the same metal on the same support can exhibit uniquely different catalytic selectivity in competing parallel reaction pathways and that disintegration of nanoparticles under reaction conditions can play a significant role in controlling stability. PMID:25671686

  1. The balance of flexibility and rigidity in the active site residues of hen egg white lysozyme

    NASA Astrophysics Data System (ADS)

    Qi, Jian-Xun; Jiang, Fan

    2011-05-01

    The crystallographic temperature factors (B factor) of individual atoms contain important information about the thermal motion of the atoms in a macromolecule. Previously the theory of flexibility of active site has been established based on the observation that the enzyme activity is sensitive to low concentration denaturing agents. It has been found that the loss of enzyme activity occurs well before the disruption of the three-dimensional structural scaffold of the enzyme. To test the theory of conformational flexibility of enzyme active site, crystal structures were perturbed by soaking in low concentration guanidine hydrochloride solutions. It was found that many lysozyme crystals tested could still diffract until the concentration of guanidine hydrochloride reached 3 M. It was also found that the B factors averaged over individually collected data sets were more accurate. Thus it suggested that accurate measurement of crystal temperature factors could be achieved for medium-high or even medium resolution crystals by averaging over multiple data sets. Furthermore, we found that the correctly predicted active sites included not only the more flexible residues, but also some more rigid residues. Both the flexible and the rigid residues in the active site played an important role in forming the active site residue network, covering the majority of the substrate binding residues. Therefore, this experimental prediction method may be useful for characterizing the binding site and the function of a protein, such as drug targeting.

  2. Plasmonic black metals by broadband light absorption in ultra-sharp convex grooves

    NASA Astrophysics Data System (ADS)

    Beermann, Jonas; Eriksen, René L.; Søndergaard, Thomas; Holmgaard, Tobias; Pedersen, Kjeld; Bozhevolnyi, Sergey I.

    2013-07-01

    We have recently reported broadband (450-850 nm) and efficient (96% on average) light absorption on gold surfaces with arrays of ultra-sharp convex grooves via excitation and subsequent adiabatic nanofocusing and absorption of gap surface plasmon modes (Søndergaard et al 2012 Nature Commun. 3 969). Here, we significantly extend our spectroscopy investigations of one- and two-dimensional (1D and 2D) groove arrays in gold covering the wavelength range of 500-1700 nm and report first results on broadband light absorption by 1D groove arrays in nickel. For 1D groove arrays (periods 250 and 350 nm, groove depth 450 nm) in gold, the experimental characterization as well as numerical simulations based on the surface integral equation method reveal gradually increasing reflectivity for wavelengths above ˜650 nm reaching finally ˜60% at 1700 nm, but with a remarkable dip around 1150-1250 nm featuring only ˜10% reflectivity. Results indicate that the dip position can be adjusted with the precise groove geometry, a feature that could prove particularly useful for selective thermal emitters in thermophotovoltaics. Furthermore, investigations of field enhancement at the groove bottoms of 1D groove arrays in gold, mapped via diffraction-limited two-photon photoluminescence (TPL) scanning microscopy, reveal very selective polarization properties of excitation and TPL emission from the groove bottoms. 1D groove arrays in nickel were fabricated by making parallel 300 nm periodic adiabatic grooves of depths 100, 200, 300, 400 or 500 nm in a 600 nm thick nickel film. Their experimental characterization verifies that the structures are indeed very dark, exhibiting only 5-8% reflectivity over an entire wavelength range 400-1700 nm for the deepest grooves, which is in good correspondence with simulations.

  3. The calculation of surface orbital energies for specific types of active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.; Cole, F.

    1992-11-01

    An angular overlap calculation has been used to determine the s, p, and d orbital energy levels of the different types of surface sites present on dispersed metal catalysts. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  4. The calculation of surface orbital energies for specific types of active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.; Cole, F.

    1992-01-01

    An angular overlap calculation has been used to determine the s, p, and d orbital energy levels of the different types of surface sites present on dispersed metal catalysts. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  5. Extending the Diffuse Layer Model of Surface Acidity Behavior: III. Estimating Bound Site Activity Coefficients

    EPA Science Inventory

    Although detailed thermodynamic analyses of the 2-pK diffuse layer surface complexation model generally specify bound site activity coefficients for the purpose of accounting for those non-ideal excess free energies contributing to bound site electrochemical potentials, in applic...

  6. 1993 annual report of hazardous waste activities for the Oak Ridge K-25 site

    SciTech Connect

    Not Available

    1994-02-01

    This report is a detailed listing of all of the Hazardous Waste activities occurring at Martin Marietta`s K-25 site. Contained herein are hazardous waste notification forms, waste stream reports, generator fee forms and various TSDR reports.

  7. Chemical modification studies on arginine kinase: essential cysteine and arginine residues at the active site.

    PubMed

    Zhu, Wen-Jing; Li, Miao; Wang, Xiao-Yun

    2007-12-01

    Chemical modification was used to elucidate the essential amino acids in the catalytic activity of arginine kinase (AK) from Migratoria manilensis. Among six cysteine (Cys) residues only one Cys residue was determined to be essential in the active site by Tsou's method. Furthermore, the AK modified by DTNB can be fully reactivated by dithiothreitol (DTT) in a monophasic kinetic course. At the same time, this reactivation can be slowed down in the presence of ATP, suggesting that the essential Cys is located near the ATP binding site. The ionizing groups at the AK active site were studied and the standard dissociation enthalpy (DeltaH degrees ) was 12.38kcal/mol, showing that the dissociation group may be the guanidino of arginine (Arg). Using the specific chemical modifier phenylglyoxal (PG) demonstrated that only one Arg, located near the ATP binding site, is essential for the activity of AK. PMID:17765964

  8. 78 FR 8190 - Commercial Wind Leasing and Site Assessment Activities on the Atlantic Outer Continental Shelf...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-05

    ...BOEM is reopening the comment period announced in the Notice of Intent to Prepare an Environmental Assessment (EA) for Commercial Wind Leasing and Site Assessment Activities on the OCS Offshore North...

  9. Electromagnetic enhancement by a single nano-groove in metallic substrate.

    PubMed

    Zhang, Siwen; Liu, Haitao; Mu, Guoguang

    2010-07-01

    We propose systematic investigations of the electromagnetic enhancement by a single nano-groove in gold substrate. The impacts of the groove parameters and of the illumination conditions on the enhanced intensity are explored using a fully vectorial numerical method. The obtained data can be well predicted and explained by a simple Fabry-Perot model. By virtue of the semi-analytical model, we identify two main factors that enable giant electric-field enhancement in very narrow grooves: the Fabry-Perot resonance and the large wave impedance of the fundamental mode in the groove. PMID:20596141

  10. Control of mid-spatial frequency errors considering the pad groove feature in smoothing polishing process.

    PubMed

    Nie, Xuqing; Li, Shengyi; Hu, Hao; Li, Qi

    2014-10-01

    Mid-spatial frequency error (MSFR) should be strictly controlled in modern optical systems. As an effective approach to suppress MSFR, the smoothing polishing (SP) process is not easy to handle because it can be affected by many factors. This paper mainly focuses on the influence of the pad groove, which has not been researched yet. The SP process is introduced, and the important role of the pad groove is explained in detail. The relationship between the contact pressure distribution and the groove feature including groove section type, groove width, and groove depth is established, and the optimized result is achieved with the finite element method. The different kinds of groove patterns are compared utilizing the numerical superposition method established scrupulously. The optimal groove is applied in the verification experiment conducted on a self-developed SP machine. The root mean square value of the MSFR after the SP process is diminished from 2.38 to 0.68 nm, which reveals that the selected pad can smooth out the MSFR to a great extent with proper SP parameters, while the newly generated MSFR due to the groove can be suppressed to a very low magnitude. PMID:25322215

  11. Anisotropic Covalency Contributions to Superexchange Pathways in Type One Copper Active Sites

    PubMed Central

    2015-01-01

    Type one (T1) Cu sites deliver electrons to catalytic Cu active sites: the mononuclear type two (T2) Cu site in nitrite reductases (NiRs) and the trinuclear Cu cluster in the multicopper oxidases (MCOs). The T1 Cu and the remote catalytic sites are connected via a Cys-His intramolecular electron-transfer (ET) bridge, which contains two potential ET pathways: P1 through the protein backbone and P2 through the H-bond between the Cys and the His. The high covalency of the T1 Cu–S(Cys) bond is shown here to activate the T1 Cu site for hole superexchange via occupied valence orbitals of the bridge. This covalency-activated electronic coupling (HDA) facilitates long-range ET through both pathways. These pathways can be selectively activated depending on the geometric and electronic structure of the T1 Cu site and thus the anisotropic covalency of the T1 Cu–S(Cys) bond. In NiRs, blue (π-type) T1 sites utilize P1 and green (σ-type) T1 sites utilize P2, with P2 being more efficient. Comparing the MCOs to NiRs, the second-sphere environment changes the conformation of the Cys-His pathway, which selectively activates HDA for superexchange by blue π sites for efficient turnover in catalysis. These studies show that a given protein bridge, here Cys-His, provides different superexchange pathways and electronic couplings depending on the anisotropic covalencies of the donor and acceptor metal sites. PMID:25310460

  12. Glutathione Binding to the Bcl-2 Homology-3 Domain Groove

    PubMed Central

    Zimmermann, Angela K.; Loucks, F. Alexandra; Schroeder, Emily K.; Bouchard, Ron J.; Tyler, Kenneth L.; Linseman, Daniel A.

    2008-01-01

    Bcl-2 protects cells against mitochondrial oxidative stress and subsequent apoptosis. However, the mechanism underlying the antioxidant function of Bcl-2 is currently unknown. Recently, Bax and several Bcl-2 homology-3 domain (BH3)-only proteins (Bid, Puma, and Noxa) have been shown to induce a pro-oxidant state at mitochondria (1-4). Given the opposing effects of Bcl-2 and Bax/BH3-only proteins on the redox state of mitochondria, we hypothesized that the antioxidant function of Bcl-2 is antagonized by its interaction with the BH3 domains of pro-apoptotic family members. Here, we show that BH3 mimetics that bind to a hydrophobic surface (the BH3 groove) of Bcl-2 induce GSH-sensitive mitochondrial dysfunction and apoptosis in cerebellar granule neurons. BH3 mimetics displace a discrete mitochondrial GSH pool in neurons and suppress GSH transport into isolated rat brain mitochondria. Moreover, BH3 mimetics and the BH3-only protein, Bim, inhibit a novel interaction between Bcl-2 and GSH in vitro. These results suggest that Bcl-2 regulates an essential pool of mitochondrial GSH and that this regulation may depend upon Bcl-2 directly interacting with GSH via the BH3 groove. We conclude that this novel GSH binding property of Bcl-2 likely plays a central role in its antioxidant function at mitochondria. PMID:17690097

  13. Hydrodynamically Lubricated and Grooved Biomimetic Self-Adapting Surfaces

    PubMed Central

    Jackson, Robert L.; Lei, Jiang

    2014-01-01

    In many machines and mechanical components, there is a need for new bearing technologies to reduce friction and wear, and provide precision control of motion when the load is varied. This can be provided by electronically controlled actuators and sensors on the surfaces, but then the system reliability can be an issue. In contrast, biomimetic surfaces can be created that adapt mechanically to variations in load. This work uses numerical methods to research the use of self-adapting surfaces for bearings that are based on the deformable nature of biological materials such as articular cartilage. These surfaces are designed to change their profiles to achieve a desired behavior, without any external control. The surfaces change their profile to control the film height and tilt of the bearing to a near constant value for different loads. If the surfaces are tilted, the grooved self-adapting surfaces will also react with a larger restoring moment than a conventional grooved surface. These surfaces could be beneficial to applications where electrical systems and controls are not feasible. PMID:24956441

  14. Stationary Vortices in Karman Grooves. I.Vortex Growth Rate

    NASA Astrophysics Data System (ADS)

    Balle, Gregory J.; Kier, Thiemo M.; Breidenthal, Robert E.

    1999-11-01

    The effect of a stationary vortex on wall fluxes in turbulent flow is predicted by the vortex persistence theory of turbulence. As a first step to test the theory, the feasibility of holding a vortex sufficiently stationary whilst embedded in a turbulent boundary layer is investi gated. Exploiting the stationarity of von Karman vortices in a wake, the dividing stream line is replaced by a wavy wall. Vortex generators are accurately positioned in the valleys (the "Karman grooves") so that the resulting streamwise vortices correspond to those in the vortex street. Complex potential theory predicts stationary points for such vortices, while there are no such points near a flat wall. Flow visualization experiments explore the basic properties of these vortices. In comparison to vortices near a flat plate, the growth rate of the stationary vortex in a Karman groove is reduced dramatically, i.e. by about an order of magnitude. This is consistent with the idea that the stationarity, persistence and growth rate of a turbulent vortex are intimately linked. Passive control of near-wall stream wise vortices is demonstrated, a foundation for the next step, measurement of a wall flux.

  15. Flight trajectory of a rotating golf ball with grooves

    NASA Astrophysics Data System (ADS)

    Baek, Moonheum; Kim, Jooha; Choi, Haecheon

    2014-11-01

    Dimples are known to reduce drag on a sphere by the amount of 50% as compared to a smooth surface. Despite the advantage of reducing drag, dimples deteriorate the putting accuracy owing to their sharp edges. To minimize this putting error but maintain the same flight distance, we have devised a grooved golf ball (called G ball hereafter) for several years. In this study, we modify the shape and pattern of grooves, and investigate the flow characteristics of the G ball by performing wind-tunnel experiments at the Reynolds numbers of 0 . 5 ×105 - 2 . 5 ×105 and the spin ratios (ratio of surface velocity to the free-stream velocity) of 0 - 0.6 that include the real golf-ball velocity and rotational speed. We measure the drag and lift forces on the rotating G ball and compare them with those of a smooth ball and two well-known dimpled balls. The lift-to-drag ratio of the G ball is much higher than that of a smooth ball and is in between those of the two dimpled balls. The trajectories of flying golf balls are computed. The flight distance of G ball is almost the same as that of one dimpled ball but slightly shorter than that of the other dimpled ball. The fluid-dynamic aspects of these differences will be discussed at the talk. Supported by 2011-0028032, 2014M3C1B1033980.

  16. Safety Modification of Cam-and-Groove Hose Coupling

    NASA Technical Reports Server (NTRS)

    Schwindt, Paul; Littlefield, Alan

    2008-01-01

    A modification has been made in the mating halves of a cam-and-groove hose coupling to prevent rapid separation of the halves in the event that the cam levers are released while the fluid in the hose is pressurized. The need for this modification arises because commercial off-the-shelf cam-and-groove hose-coupling halves do not incorporate safety features to prevent separation in the pressurized state. Especially when the pressurized fluid is compressible (e.g., steam or compressed air), the separated halves can be propelled with considerable energy, causing personal injury and/or property damage. Therefore, one purpose served by the modification is to provide for venting to release compressive energy in a contained and safe manner while preventing personal injury and/or property damage. Another purpose served by the modification, during the process of connecting the coupling halves, is to ensure that the coupling halves are properly aligned before the cam levers can be locked into position.

  17. The Three Mycobacterium tuberculosis Antigen 85 Isoforms Have Unique Substrates and Activities Determined by Non-active Site Regions*

    PubMed Central

    Backus, Keriann M.; Dolan, Michael A.; Barry, Conor S.; Joe, Maju; McPhie, Peter; Boshoff, Helena I. M.; Lowary, Todd L.; Davis, Benjamin G.; Barry, Clifton E.

    2014-01-01

    The three isoforms of antigen 85 (A, B, and C) are the most abundant secreted mycobacterial proteins and catalyze transesterification reactions that synthesize mycolated arabinogalactan, trehalose monomycolate (TMM), and trehalose dimycolate (TDM), important constituents of the outermost layer of the cellular envelope of Mycobacterium tuberculosis. These three enzymes are nearly identical at the active site and have therefore been postulated to exist to evade host immunity. Distal to the active site is a second putative carbohydrate-binding site of lower homology. Mutagenesis of the three isoforms at this second site affected both substrate selectivity and overall catalytic activity in vitro. Using synthetic and natural substrates, we show that these three enzymes exhibit unique selectivity; antigen 85A more efficiently mycolates TMM to form TDM, whereas C (and to a lesser extent B) has a higher rate of activity using free trehalose to form TMM. This difference in substrate selectivity extends to the hexasaccharide fragment of cell wall arabinan. Mutation of secondary site residues from the most active isoform (C) into those present in A or B partially interconverts this substrate selectivity. These experiments in combination with molecular dynamics simulations reveal that differences in the N-terminal helix α9, the adjacent Pro216–Phe228 loop, and helix α5 are the likely cause of changes in activity and substrate selectivity. These differences explain the existence of three isoforms and will allow for future work in developing inhibitors. PMID:25028517

  18. Troxerutin, a natural flavonoid binds to DNA minor groove and enhances cancer cell killing in response to radiation.

    PubMed

    Panat, Niranjan A; Singh, Beena G; Maurya, Dharmendra K; Sandur, Santosh K; Ghaskadbi, Saroj S

    2016-05-01

    Troxerutin, a flavonoid best known for its radioprotective and antioxidant properties is of considerable interest of study due to its broad pharmacological activities. The present study on troxerutin highlights its abilities to bind DNA and enhance cancer cell killing in response to radiation. Troxerutin showed strong binding with calf thymus DNA in vitro. Troxerutin-DNA interaction was confirmed by CD spectropolarimetry. The mode of binding of troxerutin to DNA was assessed by competing troxerutin with EtBr or DAPI, known DNA intercalator and a minor groove binder, respectively. DAPI fluorescence was drastically reduced with linear increase in troxerutin concentration suggesting possible binding of troxerutin to DNA minor groove. Further, computational studies of docking of troxerutin molecule on mammalian DNA also indicated possible troxerutin-DNA interaction at minor groove of DNA. Troxerutin was found to mainly localize in the nucleus of prostate cancer cells. It induced cytotoxicity in radioresistant (DU145) and sensitive (PC3) prostate cancer cells. When troxerutin pre-treated DU145 and PC3 cells were exposed to γ-radiation, cytotoxicity as estimated by MTT assay, was found to be further enhanced. In addition, the % subG1 population detected by propidium iodide staining also showed similar response when combined with radiation. A similar trend was observed in terms of ROS generation and DNA damage in DU145 cells when troxerutin and radiation were combined. DNA binding at minor groove by troxerutin may have contributed to strand breaks leading to increased radiation induced cell death. PMID:27016192

  19. Conformational coupling, bridge helix dynamics and active site dehydration in catalysis by RNA polymerase

    PubMed Central

    Seibold, Steve A.; Singh, Badri Nath; Zhang, Chunfen; Kireeva, Maria; Domecq, Céline; Bouchard, Annie; Nazione, Anthony M.; Feig, Michael; Cukier, Robert I.; Coulombe, Benoit; Kashlev, Mikhail; Hampsey, Michael; Burton, Zachary F.

    2010-01-01

    Molecular dynamics simulation of Thermus thermophilus (Tt) RNA polymerase (RNAP) in a catalytic conformation demonstrates that the active site dNMP-NTP base pair must be substantially dehydrated to support full active site closing and optimum conditions for phosphodiester bond synthesis. In silico mutant β R428A RNAP, which was designed based on substitutions at the homologous position (Rpb2 R512) of Saccharomyces cerevisiae (Sc) RNAP II, was used as a reference structure to compare to Tt RNAP in simulations. Long range conformational coupling linking a dynamic segment of the bridge α-helix, the extended fork loop, the active site, and the trigger loop-trigger helix is apparent and adversely affected in β R428A RNAP. Furthermore, bridge helix bending is detected in the catalytic structure, indicating that bridge helix dynamics may regulate phosphodiester bond synthesis as well as translocation. An active site “latch” assembly that includes a key trigger helix residue Tt β’ H1242 and highly conserved active site residues β E445 and R557 appears to help regulate active site hydration/dehydration. The potential relevance of these observations in understanding RNAP and DNAP induced fit and fidelity is discussed. PMID:20478425

  20. 'Unconventional' coordination chemistry by metal chelating fragments in a metalloprotein active site.

    PubMed

    Martin, David P; Blachly, Patrick G; Marts, Amy R; Woodruff, Tessa M; de Oliveira, César A F; McCammon, J Andrew; Tierney, David L; Cohen, Seth M

    2014-04-01

    The binding of three closely related chelators: 5-hydroxy-2-methyl-4H-pyran-4-thione (allothiomaltol, ATM), 3-hydroxy-2-methyl-4H-pyran-4-thione (thiomaltol, TM), and 3-hydroxy-4H-pyran-4-thione (thiopyromeconic acid, TPMA) to the active site of human carbonic anhydrase II (hCAII) has been investigated. Two of these ligands display a monodentate mode of coordination to the active site Zn(2+) ion in hCAII that is not recapitulated in model complexes of the enzyme active site. This unprecedented binding mode in the hCAII-thiomaltol complex has been characterized by both X-ray crystallography and X-ray spectroscopy. In addition, the steric restrictions of the active site force the ligands into a 'flattened' mode of coordination compared with inorganic model complexes. This change in geometry has been shown by density functional computations to significantly decrease the strength of the metal-ligand binding. Collectively, these data demonstrate that the mode of binding by small metal-binding groups can be significantly influenced by the protein active site. Diminishing the strength of the metal-ligand bond results in unconventional modes of metal coordination not found in typical coordination compounds or even carefully engineered active site models, and understanding these effects is critical to the rational design of inhibitors that target clinically relevant metalloproteins. PMID:24635441

  1. Atrioventricular and interventricular groove and septal extension of right sinus of valsalva aneurysm: a rare cause of complete heart block.

    PubMed

    Khan, Javaid Arif; Hussain, Mushtaq; Rizvi, Nadeem H; Fehmi, Nadeem; Hussain, Akhtar; Sial, Jawaid A

    2013-10-01

    A 26 years old male presented with vertigo and history of fall. The electrocardiogram revealed 2:1 second-degree heart block and later progression to complete heart block. Transthoracic echocardiography revealed aneurysm at the site of ascending aorta and computed tomographic scan showed an aneurysm of right sinsus of Valsalva extending into right atrioventricular and interventricular groove and causing complete heart block by compression on the conduction system. He also suffered from lymph node tuberculosis. This case report is unique because of rare presentation as complete heart block. PMID:24112264

  2. Active sites for NO reduction over Fe-ZSM-5 catalysts.

    PubMed

    Schwidder, M; Santhosh Kumar, M; Brückner, A; Grünert, W

    2005-02-14

    A study of Fe-ZSM-5 catalysts with variable amounts of isolated, oligomeric and heavily aggregated Fe3+ oxo sites (as evidenced by UV-Vis and EPR spectroscopic data) and their catalytic properties in the selective catalytic reduction of NO by isobutane or by NH3 is presented, which allows development of a unified concept of the active Fe sites in these reactions, according to which isolated Fe sites catalyse both SCR reactions while oligomeric sites, though also involved in the selective reduction path, limit the catalyst performance by causing the total oxidation of the reductant. PMID:15685345

  3. Site-directed mutagenesis and high-resolution NMR spectroscopy of the active site of porphobilinogen deaminase

    SciTech Connect

    Scott, A.I.; Roessner, C.A.; Stolowich, N.J.; Karuso, P.; Williams, H.J.; Grant, S.K.; Gonzalez, M.D.; Hoshino, T. )

    1988-10-18

    The active site of porphobilinogen (PBG){sup 1} deaminase from Escherichia coli has been found to contain an unusual dipyrromethane derived from four molecules of 5-aminolevulinic acid (ALA) covalently linked to Cys-242, one of the two cysteine residues conserved in E. coli and human deaminase. By use of a hemA{sup {minus}} strain of E. coli the enzyme was enriched from (5-{sup 13}C)ALA and examined by {sup 1}H-detected multiple quantum coherence spectroscopy, which revealed all of the salient features of a dipyrromethane composed of two PBG units linked heat to tail and terminating in a CH{sub 2}-S bond to a cysteine residue. Site-specific mutagenesis of Cys-99 and Cys-242, respectively, has shown that substitution of Ser for Cys-99 does not affect the enzymatic activity, whereas substitution of Ser for Cys-242 removes essentially all of the catalytic activity as measured by the conversion of the substrate PBG to uro'gen I. The NMR spectrum of the covalent complex of deaminase with the suicide inhibitor 2-bromo-(2,11-{sup 13}C{sub 2})PBG reveals that the aminomethyl terminus of the inhibitor reacts with the enzyme's cofactor at the {alpha}-free pyrrole. NMR spectroscopy of the ES{sub 2} complex confirmed a PBG-derived head-to-tail dipyrromethane attached to the {alpha}-free pyrrole position of the enzyme. A mechanistic rationale for deaminase is presented.

  4. The 1.3 Å resolution structure of the RNA tridecamer r(GCGUUUGAAACGC): Metal ion binding correlates with base unstacking and groove contraction

    PubMed Central

    Timsit, Youri; Bombard, Sophie

    2007-01-01

    Metal ions play a key role in RNA folding and activity. Elucidating the rules that govern the binding of metal ions is therefore an essential step for better understanding the RNA functions. High-resolution data are a prerequisite for a detailed structural analysis of ion binding on RNA and, in particular, the observation of monovalent cations. Here, the high-resolution crystal structures of the tridecamer duplex r(GCGUUUGAAACGC) crystallized under different conditions provides new structural insights on ion binding on GAAA/UUU sequences that exhibit both unusual structural and functional properties in RNA. The present study extends the repertory of RNA ion binding sites in showing that the two first bases of UUU triplets constitute a specific site for sodium ions. A striking asymmetric pattern of metal ion binding in the two equivalent halves of the palindromic sequence demonstrates that sequence and its environment act together to bind metal ions. A highly ionophilic half that binds six metal ions allows, for the first time, the observation of a disodium cluster in RNA. The comparison of the equivalent halves of the duplex provides experimental evidences that ion binding correlates with structural alterations and groove contraction. PMID:17940138

  5. Identification of active-site residues in protease 3C of hepatitis A virus by site-directed mutagenesis.

    PubMed Central

    Gosert, R; Dollenmaier, G; Weitz, M

    1997-01-01

    Picornavirus 3C proteases (3Cpro) are cysteine proteases related by amino acid sequence to trypsin-like serine proteases. Comparisons of 3Cpro of hepatitis A virus (HAV) to those of other picornaviruses have resulted in prediction of active-site residues: histidine at position 44 (H44), aspartic acid (D98), and cysteine (C172). To test whether these residues are key members of a putative catalytic triad, oligonucleotide-directed mutagenesis was targeted to 3Cpro in the context of natural polypeptide precursor P3. Autocatalytic processing of the polyprotein containing wild-type or variant 3Cpro was tested by in vivo expression of vaccinia virus-HAV chimeras in an animal cell-T7 hybrid system and by in vitro translation of corresponding RNAs. Comparison with proteins present in HAV-infected cells showed that both expression systems mimicked authentic polyprotein processing. Individual substitutions of H44 by tyrosine and of C172 by glycine or serine resulted in complete loss of the virus-specific proteolytic cascade. In contrast, a P3 polyprotein in which D98 was substituted by asparagine underwent only slightly delayed processing, while an additional substitution of valine (V47) by glycine within putative protein 3A caused a more pronounced loss of processing. Therefore, apparently H44 and C172 are active-site constituents whereas D98 is not. The results, furthermore, suggest that substitution of amino acid residues distant from polyprotein cleavage sites may reduce proteolytic activity, presumably by altering substrate conformation. PMID:9060667

  6. Correlated structural kinetics and retarded solvent dynamics at the metalloprotease active site

    PubMed Central

    Grossman, Moran; Born, Benjamin; Heyden, Matthias; Tworowski, Dmitry; Fields, Gregg B; Sagi, Irit; Havenith, Martina

    2012-01-01

    Solvent dynamics can play a major role in enzyme activity, but obtaining an accurate, quantitative picture of solvent activity during catalysis is quite challenging. Here, we combine terahertz spectroscopy and X-ray absorption analyses to measure changes in the coupled water-protein motions during peptide hydrolysis by a zinc-dependent human metalloprotease. These changes were tightly correlated with rearrangements at the active site during the formation of productive enzyme-substrate intermediates and were different from those in an enzyme–inhibitor complex. Molecular dynamics simulations showed a steep gradient of fast-to-slow coupled protein-water motions around the protein, active site and substrate. Our results show that water retardation occurs before formation of the functional Michaelis complex. We propose that the observed gradient of coupled protein-water motions may assist enzyme-substrate interactions through water-polarizing mechanisms that are remotely mediated by the catalytic metal ion and the enzyme active site. PMID:21926991

  7. Correlated structural kinetics and retarded solvent dynamics at the metalloprotease active site

    SciTech Connect

    Grossman, Moran; Born, Benjamin; Heyden, Matthias; Tworowski, Dmitry; Fields, Gregg B.; Sagi, Irit; Havenith, Martina

    2011-09-18

    Solvent dynamics can play a major role in enzyme activity, but obtaining an accurate, quantitative picture of solvent activity during catalysis is quite challenging. Here, we combine terahertz spectroscopy and X-ray absorption analyses to measure changes in the coupled water-protein motions during peptide hydrolysis by a zinc-dependent human metalloprotease. These changes were tightly correlated with rearrangements at the active site during the formation of productive enzyme-substrate intermediates and were different from those in an enzyme–inhibitor complex. Molecular dynamics simulations showed a steep gradient of fast-to-slow coupled protein-water motions around the protein, active site and substrate. Our results show that water retardation occurs before formation of the functional Michaelis complex. We propose that the observed gradient of coupled protein-water motions may assist enzyme-substrate interactions through water-polarizing mechanisms that are remotely mediated by the catalytic metal ion and the enzyme active site.

  8. HIV integration site distributions in resting and activated CD4+ T cells infected in culture

    PubMed Central

    Brady, Troy; Agosto, Luis M.; Malani, Nirav; Berry, Charles C.; O'Doherty, Una; Bushman, Frederic

    2010-01-01

    Objective The goal of this study was to investigate whether the location of HIV integration differs in resting versus activated T cells, a feature that could contribute to the formation of latent viral reservoirs via effects on integration targeting. Design Primary resting or activated CD4+ T cells were infected with purified X4-tropic HIV in the presence and absence of nucleoside triphosphates and genomic locations of integrated provirus determined. Methods We sequenced and analyzed a total of 2661 HIV integration sites using linker-mediated PCR and 454 sequencing. Integration site data sets were then compared to each other and to computationally generated random distributions. Results HIV integration was favored in active transcription units in both cell types, but integration sites from activated cells were found more often in genomic regions that were dense in genes, dense in CpG islands, and enriched in G/C bases. Integration sites from activated cells were also more strongly correlated with histone methylation patterns associated with active genes. Conclusion These data indicate that integration site distributions show modest but significant differences between resting and activated CD4+ T cells, and that integration in resting cells occurs more often in regions that may be suboptimal for proviral gene expression. PMID:19550285

  9. Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

    SciTech Connect

    Carra,J.; McHugh, C.; Mulligan, S.; Machiesky, L.; Soares, A.; Millard, C.

    2007-01-01

    We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding to a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.

  10. Assessment of the site of ventricular activation by Fourier analysis of gated blood-pool studies

    SciTech Connect

    Links, J.M.; Raichlen, J.S.; Wagner, H.N. Jr.; Reid, P.R.

    1985-01-01

    The authors studied the use of first-harmonic Fourier analysis of gated blood-pool images to assess the site of ventricular activation in a group of 12 patients undergoing electrophysiologic pacing studies. They acquired gated blood-pool studies during pacing at up to four sites at each of two different rates. A total of 50 studies were made. At a pacing rate of 100 beats/min, when the pacing electrode was the right-ventricular outflow tract, 7/8; at the anterolateral left-ventricular wall, 4/4. When the Fourier activation site was at the right-ventricular apex, 9/9 times the pacing electrode was there; at the right-ventricular outflow tract, 7/10; in the left ventricle, 4/4. Fourier analysis of gated blood-pool studies can help identify the site of ventricular activation but is not sufficiently accurate to fully replace endocardial mapping.

  11. Structural and Kinetic Analyses of Macrophage Migration Inhibitory Factor Active Site Interactions

    SciTech Connect

    Crichlow, G.; Lubetsky, J; Leng, L; Bucala, R; Lolis, E

    2009-01-01

    Macrophage migration inhibitory factor (MIF) is a secreted protein expressed in numerous cell types that counters the antiinflammatory effects of glucocorticoids and has been implicated in sepsis, cancer, and certain autoimmune diseases. Interestingly, the structure of MIF contains a catalytic site resembling the tautomerase/isomerase sites of microbial enzymes. While bona fide physiological substrates remain unknown, model substrates have been identified. Selected compounds that bind in the tautomerase active site also inhibit biological functions of MIF. It had previously been shown that the acetaminophen metabolite, N-acetyl-p-benzoquinone imine (NAPQI), covalently binds to the active site of MIF. In this study, kinetic data indicate that NAPQI inhibits MIF both covalently and noncovalently. The structure of MIF cocrystallized with NAPQI reveals that the NAPQI has undergone a chemical alteration forming an acetaminophen dimer (bi-APAP) and binds noncovalently to MIF at the mouth of the active site. We also find that the commonly used protease inhibitor, phenylmethylsulfonyl fluoride (PMSF), forms a covalent complex with MIF and inhibits the tautomerase activity. Crystallographic analysis reveals the formation of a stable, novel covalent bond for PMSF between the catalytic nitrogen of the N-terminal proline and the sulfur of PMSF with complete, well-defined electron density in all three active sites of the MIF homotrimer. Conclusions are drawn from the structures of these two MIF-inhibitor complexes regarding the design of novel compounds that may provide more potent reversible and irreversible inhibition of MIF.

  12. Active Site Inhibitors Protect Protein Kinase C from Dephosphorylation and Stabilize Its Mature Form*

    PubMed Central

    Gould, Christine M.; Antal, Corina E.; Reyes, Gloria; Kunkel, Maya T.; Adams, Ryan A.; Ziyar, Ahdad; Riveros, Tania; Newton, Alexandra C.

    2011-01-01

    Conformational changes acutely control protein kinase C (PKC). We have previously shown that the autoinhibitory pseudosubstrate must be removed from the active site in order for 1) PKC to be phosphorylated by its upstream kinase phosphoinositide-dependent kinase 1 (PDK-1), 2) the mature enzyme to bind and phosphorylate substrates, and 3) the mature enzyme to be dephosphorylated by phosphatases. Here we show an additional level of conformational control; binding of active site inhibitors locks PKC in a conformation in which the priming phosphorylation sites are resistant to dephosphorylation. Using homogeneously pure PKC, we show that the active site inhibitor Gö 6983 prevents the dephosphorylation by pure protein phosphatase 1 (PP1) or the hydrophobic motif phosphatase, pleckstrin homology domain leucine-rich repeat protein phosphatase (PHLPP). Consistent with results using pure proteins, treatment of cells with the competitive inhibitors Gö 6983 or bisindolylmaleimide I, but not the uncompetitive inhibitor bisindolylmaleimide IV, prevents the dephosphorylation and down-regulation of PKC induced by phorbol esters. Pulse-chase analyses reveal that active site inhibitors do not affect the net rate of priming phosphorylations of PKC; rather, they inhibit the dephosphorylation triggered by phorbol esters. These data provide a molecular explanation for the recent studies showing that active site inhibitors stabilize the phosphorylation state of protein kinases B/Akt and C. PMID:21715334

  13. Molecular modeling benzo[a]pyrene N2-dG adducts in the two overlapping active sites of the Y-family DNA polymerase Dpo4.

    PubMed

    Chandani, Sushil; Loechler, Edward L

    2007-01-01

    The potent, ubiquitous environmental mutagen/carcinogen benzo[a]pyrene (B[a]P) induces a single major adduct [+ta]-B[a]P-N2-dG, whose bypass in most cases results in either no mutation (dCTP insertion) or a G-->T mutation (dATP insertion). Translesion synthesis (TLS) of [+ta]-B[a]P-N2-dG generally requires DNA polymerases (DNAPs) in the Y-family, which exist in cells to bypass DNA damage caused by chemicals and radiation. A molecular dynamics (MD) study is described with dCTP opposite [+ta]-B[a]P-N2-dG in Dpo4, which is the best studied Y-family DNAP from a structural point of view. Two orientations of B[a]P-N2-dG (BPmi5 and BPmi3) are considered, along with two orientations of the dCTP (AS1 and AS2), as outlined next. Based on NMR studies, the pyrene moiety of B[a]P-N2-dG is in the minor groove, when paired with dC, and can point toward either the base on the 5'-side (BPmi5) or the 3'-side (BPmi3). Based on published X-ray structures, Dpo4 appears to have two partially overlapping active sites. The architecture of active site 1 (AS1) is similar to all other families of DNAPs (e.g., the shape of the dNTP). Active site 2 (AS2), however, is non-canonical (e.g., the beta- and gamma-phosphates in AS2 are approximately where the alpha- and beta-phosphates are in AS1). In the Dpo4 models generated herein, using the BPmi3 orientation the pyrene moiety of [+ta]-B[a]P-N2-dG points toward the duplex region of the DNA, and is accommodated without distortions in AS1, but with distortions in AS2. Considering the BPmi5 orientation, the pyrene moiety points toward the ss-region of DNA in Dpo4, and sits in a hole defined by the fingers and little fingers domain ("chimney"); BPmi5 is accommodated in AS2 without significant distortions, but poorly in AS1. In summary, when dCTP is paired with [+ta]-B[a]P-N2-dG in the two overlapping active sites in Dpo4, the pyrene in the BPmi3 orientation is accommodated better in active site 1 (AS1), while the pyrene in the BPmi5 orientation is

  14. Characterization of the Functional Roles of Amino Acid Residues in Acceptor-binding Subsite +1 in the Active Site of the Glucansucrase GTF180 from Lactobacillus reuteri 180.

    PubMed

    Meng, Xiangfeng; Pijning, Tjaard; Dobruchowska, Justyna M; Gerwig, Gerrit J; Dijkhuizen, Lubbert

    2015-12-11

    α-Glucans produced by glucansucrase enzymes hold strong potential for industrial applications. The exact determinants of the linkage specificity of glucansucrase enzymes have remained largely unknown, even with the recent elucidation of glucansucrase crystal structures. Guided by the crystal structure of glucansucrase GTF180-ΔN from Lactobacillus reuteri 180 in complex with the acceptor substrate maltose, we identified several residues (Asp-1028 and Asn-1029 from domain A, as well as Leu-938, Ala-978, and Leu-981 from domain B) near subsite +1 that may be critical for linkage specificity determination, and we investigated these by random site-directed mutagenesis. First, mutants of Ala-978 (to Leu, Pro, Phe, or Tyr) and Asp-1028 (to Tyr or Trp) with larger side chains showed reduced degrees of branching, likely due to the steric hindrance by these bulky residues. Second, Leu-938 mutants (except L938F) and Asp-1028 mutants showed altered linkage specificity, mostly with increased (α1 → 6) linkage synthesis. Third, mutation of Leu-981 and Asn-1029 significantly affected the transglycosylation reaction, indicating their essential roles in acceptor substrate binding. In conclusion, glucansucrase product specificity is determined by an interplay of domain A and B residues surrounding the acceptor substrate binding groove. Residues surrounding the +1 subsite thus are critical for activity and specificity of the GTF180 enzyme and play different roles in the enzyme functions. This study provides novel insights into the structure-function relationships of glucansucrase enzymes and clearly shows the potential of enzyme engineering to produce tailor-made α-glucans. PMID:26507662

  15. Active-site motions and polarity enhance catalytic turnover of hydrated subtilisin dissolved in organic solvents.

    PubMed

    Hudson, Elton P; Eppler, Ross K; Beaudoin, Julianne M; Dordick, Jonathan S; Reimer, Jeffrey A; Clark, Douglas S

    2009-04-01

    The enzyme subtilisin Carlsberg was surfactant-solubilized into two organic solvents, isooctane and tetrahydrofuran, and hydrated through stepwise changes in the thermodynamic water activity, a(w). The apparent turnover number k(cat)(app) in these systems ranged from 0.2 to 80 s(-1) and increased 11-fold in isooctane and up to 50-fold in tetrahydrofuran with increasing a(w). (19)F NMR relaxation experiments employing an active-site inhibitor were used to assess the dependence of active-site motions on a(w). The rates of NMR-derived fast (k > 10(7) s(-1)) and slow (k < 10(4) s(-1)) active-site motions increased in both solvents upon hydration, but only the slow motions correlated with k(cat). The (19)F chemical shift was a sensitive probe of the local electronic environment and provided an empirical measure of the active-site dielectric constant epsilon(as), which increased with hydration to epsilon(as) approximately 13 in each solvent. In both solvents, the transition state free energy data and epsilon(as) followed Kirkwood's model for the continuum solvation of a dipole, indicating that water also enhanced catalysis by altering the active-site's electronic environment and increasing its polarity to better stabilize the transition state. These results reveal that favorable dynamic and electrostatic effects both contribute to accelerated catalysis by solubilized subtilisin Carlsberg upon hydration in organic solvents. PMID:19317505

  16. Enhanced Enzyme Kinetic Stability by Increasing Rigidity within the Active Site*

    PubMed Central

    Xie, Yuan; An, Jiao; Yang, Guangyu; Wu, Geng; Zhang, Yong; Cui, Li; Feng, Yan

    2014-01-01

    Enzyme stability is an important issue for protein engineers. Understanding how rigidity in the active site affects protein kinetic stability will provide new insight into enzyme stabilization. In this study, we demonstrated enhanced kinetic stability of Candida antarctica lipase B (CalB) by mutating the structurally flexible residues within the active site. Six residues within 10 Å of the catalytic Ser105 residue with a high B factor were selected for iterative saturation mutagenesis. After screening 2200 colonies, we obtained the D223G/L278M mutant, which exhibited a 13-fold increase in half-life at 48 °C and a 12 °C higher T5015, the temperature at which enzyme activity is reduced to 50% after a 15-min heat treatment. Further characterization showed that global unfolding resistance against both thermal and chemical denaturation also improved. Analysis of the crystal structures of wild-type CalB and the D223G/L278M mutant revealed that the latter formed an extra main chain hydrogen bond network with seven structurally coupled residues within the flexible α10 helix that are primarily involved in forming the active site. Further investigation of the relative B factor profile and molecular dynamics simulation confirmed that the enhanced rigidity decreased fluctuation of the active site residues at high temperature. These results indicate that enhancing the rigidity of the flexible segment within the active site may provide an efficient method for improving enzyme kinetic stability. PMID:24448805

  17. Morphometric Study on Bicipital Groove among South Indian Population

    PubMed Central

    Rajan, Yamini Soundara

    2016-01-01

    Introduction The Bicipital Groove (BG) is an indentation between the lesser and greater tubercles of the proximal part of the humerus. It conveys biceps tendon, its synovial sheath and ascending branch of anterior circumflex humeral artery. The knowledge of the morphometry is important for the understanding of the functional aspect of the shoulder region. Aim To study the morphometry of bicipital groove of humerus in south Indian population. Materials and Methods In the present study, 100 adult humeri (50 right and 50 left) were examined. The length of the medial wall, lateral wall, width and depth were measured by using vernier calliper. The humeri were examined for the presence of supratubercular ridge. All the parameters were accurately measured and the data were analysed. Results The mean length of BG on right side was 84.79±5.84 mm and 87.33±6.40mm on the left side. The mean width of BG on right side was 6.84±1.01mm and 7.74±1.96mm on the left side. The mean depth of BG on right side was 4.21±0.58 mm and 5.01±1.05mm on the left side. The mean length of the medial and lateral walls on the right side was 24.22±1.02mm and 32.05±2.21mm respectively and that on the left side was 23.31±2.21mm and 31.12±0.24mm respectively. 17% of humeri on the right side and 14% on the left side showed the presence of supratubercular ridge of Meyer in the present study. Conclusion Bicipital groove is present in the shoulder region where wide range of movements occurs. Osseous spurs and supratubercular ridge may predispose dislocation of tendon of biceps brachii. Hence morphometric knowledge is obligatory and is significant functionally and clinically for better understanding of this region.

  18. Effects of resource activities upon repository siting and waste containment with reference to bedded salt

    SciTech Connect

    Ashby, J.; Rowe, J.

    1980-02-01

    The primary consideration for the suitability of a nuclear waste repository site is the overall ability of the repository to safely contain radioactive waste. This report is a discussion of the past, present, and future effects of resource activities on waste containment. Past and present resource activities which provide release pathways (i.e., leaky boreholes, adjacent mines) will receive initial evaluation during the early stages of any repository site study. However, other resource activities which may have subtle effects on containment (e.g., long-term pumping causing increased groundwater gradients, invasion of saline water causing lower retardation) and all potential future resource activities must also be considered during the site evaluation process. Resource activities will affect both the siting and the designing of repositories. Ideally, sites should be located in areas of low resource activity and low potential for future activity, and repository design should seek to eliminate or minimize the adverse effects of any resource activity. Buffer zones should be created to provide areas in which resource activities that might adversely affect containment can be restricted or curtailed. This could mean removing large areas of land from resource development. The impact of these frozen assets should be assessed in terms of their economic value and of their effect upon resource reserves. This step could require a major effort in data acquisition and analysis followed by extensive numerical modeling of regional fluid flow and mass transport. Numerical models should be used to assess the effects of resource activity upon containment and should include the cumulative effects of different resource activities. Analysis by other methods is probably not possible except for relatively simple cases.

  19. A caspase active site probe reveals high fractional inhibition needed to block DNA fragmentation.

    PubMed

    Méthot, Nathalie; Vaillancourt, John P; Huang, JingQi; Colucci, John; Han, Yongxin; Ménard, Stéphane; Zamboni, Robert; Toulmond, Sylvie; Nicholson, Donald W; Roy, Sophie

    2004-07-01

    Apoptotic markers consist of either caspase substrate cleavage products or phenotypic changes that manifest themselves as a consequence of caspase-mediated substrate cleavage. We have shown recently that pharmacological inhibitors of caspase activity prevent the appearance of two such apoptotic manifestations, alphaII-spectrin cleavage and DNA fragmentation, but that blockade of the latter required a significantly higher concentration of inhibitor. We investigated this phenomenon through the use of a novel radiolabeled caspase inhibitor, [(125)I]M808, which acts as a caspase active site probe. [(125)I]M808 bound to active caspases irreversibly and with high sensitivity in apoptotic cell extracts, in tissue extracts from several commonly used animal models of cellular injury, and in living cells. Moreover, [(125)I]M808 detected active caspases in septic mice when injected intravenously. Using this caspase probe, an active site occupancy assay was developed and used to measure the fractional inhibition required to block apoptosis-induced DNA fragmentation. In thymocytes, occupancy of up to 40% of caspase active sites had no effect on DNA fragmentation, whereas inhibition of half of the DNA cleaving activity required between 65 and 75% of active site occupancy. These results suggest that a high and persistent fractional inhibition will be required for successful caspase inhibition-based therapies. PMID:15067000

  20. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  1. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  2. Computational approaches to the determination of active site structures and reaction mechanisms in heterogeneous catalysts.

    PubMed

    Catlow, C R A; French, S A; Sokol, A A; Thomas, J M

    2005-04-15

    We apply quantum chemical methods to the study of active site structures and reaction mechanisms in mesoporous silica and metal oxide catalysts. Our approach is based on the use of both molecular cluster and embedded cluster (QM/MM) techniques, where the active site and molecular complex are described using density functional theory (DFT) and the embedding matrix simulated by shell model potentials. We consider three case studies: alkene epoxidation over the microporous TS-1 catalyst; methanol synthesis on ZnO and Cu/ZnO and C-H bond activation over Li-doped MgO. PMID:15901543

  3. Denaturation studies of active-site labeled papain using electron paramagnetic resonance and fluorescence spectroscopy.

    PubMed Central

    Ping, Z A; Butterfiel, D A

    1991-01-01

    A spin-labeled p-chloromercuribenzoate (SL-PMB) and a fluorescence probe, 6-acryloyl-2-dimethylaminonaphthalene (Acrylodan), both of which bind to the single SH group located in the active site of papain, were used to investigate the interaction of papain (EC 3.4.22.2) with two protein denaturants. It was found that the active site of papain was highly stable in urea solution, but underwent a large conformational change in guanidine hydrochloride solution. Electron paramagnetic resonance and fluorescence results were in agreement and both paralleled enzymatic activity of papain with respect to both the variation in pH and denaturation. These results strongly suggest that SL-PMB and Acrylodan labels can be used to characterize the physical state of the active site of the enzyme. PMID:1657229

  4. Failure of origin activation in response to fork stalling leads to chromosomal instability at fragile sites.

    PubMed

    Ozeri-Galai, Efrat; Lebofsky, Ronald; Rahat, Ayelet; Bester, Assaf C; Bensimon, Aaron; Kerem, Batsheva

    2011-07-01

    Perturbed DNA replication in early stages of cancer development induces chromosomal instability preferentially at fragile sites. However, the molecular basis for this instability is unknown. Here, we show that even under normal growth conditions, replication fork progression along the fragile site, FRA16C, is slow and forks frequently stall at AT-rich sequences, leading to activation of additional origins to enable replication completion. Under mild replication stress, the frequency of stalling at AT-rich sequences is further increased. Strikingly, unlike in the entire genome, in the FRA16C region additional origins are not activated, suggesting that all potential origins are already activated under normal conditions. Thus, the basis for FRA16C fragility is replication fork stalling at AT-rich sequences and inability to activate additional origins under replication stress. Our results provide a mechanism explaining the replication stress sensitivity of fragile sites and thus, the basis for genomic instability during early stages of cancer development. PMID:21726815

  5. Active-site mobility revealed by the crystal structure of arylmalonate decarboxylase from Bordetella bronchiseptica.

    PubMed

    Kuettner, E Bartholomeus; Keim, Antje; Kircher, Markus; Rosmus, Susann; Sträter, Norbert

    2008-03-21

    Arylmalonate decarboxylase (AMDase) from Bordetella bronchiseptica catalyzes the enantioselective decarboxylation of arylmethylmalonates without the need for an organic cofactor or metal ion. The decarboxylation reaction is of interest for the synthesis of fine chemicals. As basis for an analysis of the catalytic mechanism of AMDase and for a rational enzyme design, we determined the X-ray structure of the enzyme up to 1.9 A resolution. Like the distantly related aspartate or glutamate racemases, AMDase has an aspartate transcarbamoylase fold consisting of two alpha/beta domains related by a pseudo dyad. However, the domain orientation of AMDase differs by about 30 degrees from that of the glutamate racemases, and also significant differences in active-site structures are observed. In the crystals, four independent subunits showing different conformations of active-site loops are present. This finding is likely to reflect the active-site mobility necessary for catalytic activity. PMID:18258259

  6. Cyanide does more to inhibit heme enzymes, than merely serving as an active-site ligand

    SciTech Connect

    Parashar, Abhinav; Venkatachalam, Avanthika; Gideon, Daniel Andrew; Manoj, Kelath Murali

    2014-12-12

    Highlights: • Cyanide (CN) is a well-studied toxic principle, known to inhibit heme-enzymes. • Inhibition is supposed to result from CN binding at the active site as a ligand. • Diverse heme enzymes’ CN inhibition profiles challenge prevailing mechanism. • Poor binding efficiency of CN at low enzyme concentrations and ligand pressures. • CN-based diffusible radicals cause ‘non-productive electron transfers’ (inhibition). - Abstract: The toxicity of cyanide is hitherto attributed to its ability to bind to heme proteins’ active site and thereby inhibit their activity. It is shown herein that the long-held interpretation is inadequate to explain several observations in heme-enzyme reaction systems. Generation of cyanide-based diffusible radicals in heme-enzyme reaction milieu could shunt electron transfers (by non-active site processes), and thus be detrimental to the efficiency of oxidative outcomes.

  7. Multiple active site residues are important for photochemical efficiency in the light-activated enzyme protochlorophyllide oxidoreductase (POR).

    PubMed

    Menon, Binuraj R K; Hardman, Samantha J O; Scrutton, Nigel S; Heyes, Derren J

    2016-08-01

    Protochlorophyllide oxidoreductase (POR) catalyzes the light-driven reduction of protochlorophyllide (Pchlide), an essential, regulatory step in chlorophyll biosynthesis. The unique requirement of the enzyme for light has provided the opportunity to investigate how light energy can be harnessed to power biological catalysis and enzyme dynamics. Excited state interactions between the Pchlide molecule and the protein are known to drive the subsequent reaction chemistry. However, the structural features of POR and active site residues that are important for photochemistry and catalysis are currently unknown, because there is no crystal structure for POR. Here, we have used static and time-resolved spectroscopic measurements of a number of active site variants to study the role of a number of residues, which are located in the proposed NADPH/Pchlide binding site based on previous homology models, in the reaction mechanism of POR. Our findings, which are interpreted in the context of a new improved structural model, have identified several residues that are predicted to interact with the coenzyme or substrate. Several of the POR variants have a profound effect on the photochemistry, suggesting that multiple residues are important in stabilizing the excited state required for catalysis. Our work offers insight into how the POR active site geometry is finely tuned by multiple active site residues to support enzyme-mediated photochemistry and reduction of Pchlide, both of which are crucial to the existence of life on Earth. PMID:27285815

  8. Catalysis-dependent selenium incorporation and migration in the nitrogenase active site iron-molybdenum cofactor

    PubMed Central

    Spatzal, Thomas; Perez, Kathryn A; Howard, James B; Rees, Douglas C

    2015-01-01

    Dinitrogen reduction in the biological nitrogen cycle is catalyzed by nitrogenase, a two-component metalloenzyme. Understanding of the transformation of the inert resting state of the active site FeMo-cofactor into an activated state capable of reducing dinitrogen remains elusive. Here we report the catalysis dependent, site-selective incorporation of selenium into the FeMo-cofactor from selenocyanate as a newly identified substrate and inhibitor. The 1.60 Å resolution structure reveals selenium occupying the S2B site of FeMo-cofactor in the Azotobacter vinelandii MoFe-protein, a position that was recently identified as the CO-binding site. The Se2B-labeled enzyme retains substrate reduction activity and marks the starting point for a crystallographic pulse-chase experiment of the active site during turnover. Through a series of crystal structures obtained at resolutions of 1.32–1.66 Å, including the CO-inhibited form of Av1-Se2B, the exchangeability of all three belt-sulfur sites is demonstrated, providing direct insights into unforeseen rearrangements of the metal center during catalysis. DOI: http://dx.doi.org/10.7554/eLife.11620.001 PMID:26673079

  9. Gradient ROtating Outer Volume Excitation (GROOVE): A Novel Method for Single-Shot 2-D OVS

    PubMed Central

    Powell, Nathaniel J.; Jang, Albert; Park, Jang-Yeon; Valette, Julien; Garwood, Michael; Marjańska, Małgorzata

    2014-01-01

    Purpose A new outer volume suppression (OVS) technique is introduced that uses a single pulse and rotating gradients to accomplish frequency-swept excitation. This new technique, which is called Gradient ROtating Outer Volume Excitation (GROOVE), produces a circular or elliptical suppression band rather than suppressing the entire outer volume. Methods Theoretical and k-space descriptions of GROOVE are provided. The properties of GROOVE were investigated with simulations, phantom, and human experiments performed using a 4 T horizontal bore magnet equipped with a TEM coil. Results Similar suppression performance was obtained in phantom and human brain using GROOVE with circular and elliptical shapes. Simulations indicate that GROOVE requires less SAR and time than traditional OVS schemes, but traditional schemes provide a sharper transition zone and less residual signal. Conclusion GROOVE represents a new way of performing OVS in which spins are excited temporally in space on a trajectory which can be tailored to fit the shape of the suppression region. In addition, GROOVE is capable of suppressing tailored regions of space with more flexibility and in a shorter period of time than conventional methods. GROOVE provides a fast, low SAR alternative to conventional OVS methods in some applications (e.g., scalp suppression). PMID:24478130

  10. Light guide plate with curved V-groove patterns in edge-lit backlight

    NASA Astrophysics Data System (ADS)

    Park, Sohee; Shin, Yongjin

    2016-01-01

    We propose curved V-groove-based patterns for light guide plates (LGPs) and demonstrate their performance by calculating their uniformity and luminance. Instead of the linear V-groove patterns used in previous research, curved patterns with asymmetric V-groove cuts were applied to the LGPs. The feasibility of obtaining enhanced uniformity and luminance from LGPs with the proposed patterns was evaluated by varying the degree of asymmetry of the V-grooves themselves and the distance between the V-groove patterns. The suggested patterns provided more stable uniformity with a small number of patterns and a large distance between patterns. The number of V-grooves is directly related to the processing time, and the degree of asymmetry in the V-groove cuts corresponds to the processing error during fabrication. Therefore, the proposed patterns could be fabricated with a low tolerance and shorter processing time. Their use would contribute to the cost-effective fabrication of LGPs. Because LGPs using the proposed patterns exhibited uniform illumination, a small number of curved patterns composed of asymmetric V-grooves can improve the characteristics of edge-type backlighting.

  11. Treatment of combined endodontic: periodontic lesion by sealing of palato-radicular groove using biodentine

    PubMed Central

    Naik, Mayuri; de Ataide, Ida de Noronha; Fernandes, Marina; Lambor, Rajan

    2014-01-01

    Introduction: Palatoradicular groove is a developmental anomaly which is predominantly found in maxillary lateral incisors. It provides a susceptible alcove for the progression of localised periodontal inflammation which can further cause pulpal involvement. This case report describes the successful treatment of a large periodontic – endodontic lesion usingnon surgical endodontic therapy and biodentine for the sealing of the palatoradicular groove. PMID:25506153

  12. Modelling of e-cloud build-up in grooved vacuum chambers usingPOSINST

    SciTech Connect

    Venturini, Marco; Celata, C.; Furman, Miguel; Vay, Jean-Luc; Pivi, Mauro

    2007-06-29

    Use of grooved vacuum chambers have been suggested as a wayto limitelectron cloud accumulation in the ILC-DR. We report onsimulations carried out using an augmented version of POSINST, accountingfor e-cloud dynamics in the presence of grooves, and make contact withprevious estimates of an effective secondary electron yield for groovedsurfaces.

  13. Bax dimerizes via a symmetric BH3:groove interface during apoptosis

    PubMed Central

    Dewson, G; Ma, S; Frederick, P; Hockings, C; Tan, I; Kratina, T; Kluck, R M

    2012-01-01

    During apoptotic cell death, Bax and Bak change conformation and homo-oligomerize to permeabilize mitochondria. We recently reported that Bak homodimerizes via an interaction between the BH3 domain and hydrophobic surface groove, that this BH3:groove interaction is symmetric, and that symmetric dimers can be linked via the α6-helices to form the high order oligomers thought responsible for pore formation. We now show that Bax also dimerizes via a BH3:groove interaction after apoptotic signaling in cells and in mitochondrial fractions. BH3:groove dimers of Bax were symmetric as dimers but not higher order oligomers could be linked by cysteine residues placed in both the BH3 and groove. The BH3:groove interaction was evident in the majority of mitochondrial Bax after apoptotic signaling, and correlated strongly with cytochrome c release, supporting its central role in Bax function. A second interface between the Bax α6-helices was implicated by cysteine linkage studies, and could link dimers to higher order oligomers. We also found that a population of Bax:Bak heterodimers generated during apoptosis formed via a BH3:groove interaction, further demonstrating that Bax and Bak oligomerize via similar mechanisms. These findings highlight the importance of BH3:groove interactions in apoptosis regulation by the Bcl-2 protein family. PMID:22015607

  14. Current Teaching of Proximal Retention Grooves for Class II Amalgam Preparations.

    ERIC Educational Resources Information Center

    Moore, David L.

    1992-01-01

    A survey gathered information on methods of class II amalgam preparation taught in 59 dental schools. Focus was on the teaching and testing of proximal retention groove use, stated rationale for placing retention grooves, and the relationship of the instruction to board criteria for cavity preparation. (MSE)

  15. Insight into the mechanism of phosphoenolpyruvate mutase catalysis derived from site-directed mutagenesis studies of active site residues.

    PubMed

    Jia, Y; Lu, Z; Huang, K; Herzberg, O; Dunaway-Mariano, D

    1999-10-26

    PEP mutase catalyzes the conversion of phosphoenolpyruvate (PEP) to phosphonopyruvate in biosynthetic pathways leading to phosphonate secondary metabolites. A recent X-ray structure [Huang, K., Li, Z., Jia, Y., Dunaway-Mariano, D., and Herzberg, O. (1999) Structure (in press)] of the Mytilus edulis enzyme complexed with the Mg(II) cofactor and oxalate inhibitor reveals an alpha/beta-barrel backbone-fold housing an active site in which Mg(II) is bound by the two carboxylate groups of the oxalate ligand and the side chain of D85 and, via bridging water molecules, by the side chains of D58, D85, D87, and E114. The oxalate ligand, in turn, interacts with the side chains of R159, W44, and S46 and the backbone amide NHs of G47 and L48. Modeling studies identified two feasible PEP binding modes: model A in which PEP replaces oxalate with its carboxylate group interacting with R159 and its phosphoryl group positioned close to D58 and Mg(II) shifting slightly from its original position in the crystal structure, and model B in which PEP replaces oxalate with its phosphoryl group interacting with R159 and Mg(II) retaining its original position. Site-directed mutagenesis studies of the key mutase active site residues (R159, D58, D85, D87, and E114) were carried out in order to evaluate the catalytic roles predicted by the two models. The observed retention of low catalytic activity in the mutants R159A, D85A, D87A, and E114A, coupled with the absence of detectable catalytic activity in D58A, was interpreted as evidence for model A in which D58 functions in nucleophilic catalysis (phosphoryl transfer), R159 functions in PEP carboxylate group binding, and the carboxylates of D85, D87 and E114 function in Mg(II) binding. These results also provide evidence against model B in which R159 serves to mediate the phosphoryl transfer. A catalytic motif, which could serve both the phosphoryl transfer and the C-C cleavage enzymes of the PEP mutase superfamily, is proposed. PMID:10571990

  16. Localization of the binding site of tissue-type plasminogen activator to fibrin.

    PubMed Central

    Ichinose, A; Takio, K; Fujikawa, K

    1986-01-01

    Functionally active A and B chains were separated from a two-chain form of recombinant tissue-type plasminogen activator after mild reduction and alkylation. The A chain was found to be responsible for the binding to lysine-Sepharose or fibrin and the B chain contained the catalytic activity of tissue-type plasminogen activator. An extensive reduction of two-chain tissue-type plasminogen activator, however, destroyed both the binding and catalytic activities. A thermolytic fragment, Fr. 1, of tissue-type plasminogen activator that contained a growth factor and two kringle segments retained its lysine binding activity. Additional thermolytic cleavages in the kringle-2 segment of Fr. 1 caused a total loss of the binding activity. These results indicated that the binding site of tissue-type plasminogen activator to fibrin was located in the kringle-2 segment. Images PMID:3088041

  17. Dance, Music, Meter and Groove: A Forgotten Partnership

    PubMed Central

    Fitch, W. Tecumseh

    2016-01-01

    I argue that core aspects of musical rhythm, especially “groove” and syncopation, can only be fully understood in the context of their origins in the participatory social experience of dance. Musical meter is first considered in the context of bodily movement. I then offer an interpretation of the pervasive but somewhat puzzling phenomenon of syncopation in terms of acoustic emphasis on certain offbeat components of the accompanying dance style. The reasons for the historical tendency of many musical styles to divorce themselves from their dance-based roots are also briefly considered. To the extent that musical rhythms only make sense in the context of bodily movement, researchers interested in ecologically valid approaches to music cognition should make a more concerted effort to extend their analyses to dance, particularly if we hope to understand the cognitive constraints underlying rhythmic aspects of music like meter and groove. PMID:26973489

  18. Crystal structure of an avian influenza polymerase PA[subscript N] reveals an endonuclease active site

    SciTech Connect

    Yuan, Puwei; Bartlam, Mark; Lou, Zhiyong; Chen, Shoudeng; Zhou, Jie; He, Xiaojing; Lv, Zongyang; Ge, Ruowen; Li, Xuemei; Deng, Tao; Fodor, Ervin; Rao, Zihe; Liu, Yingfang

    2009-11-10

    The heterotrimeric influenza virus polymerase, containing the PA, PB1 and PB2 proteins, catalyses viral RNA replication and transcription in the nucleus of infected cells. PB1 holds the polymerase active site and reportedly harbours endonuclease activity, whereas PB2 is responsible for cap binding. The PA amino terminus is understood to be the major functional part of the PA protein and has been implicated in several roles, including endonuclease and protease activities as well as viral RNA/complementary RNA promoter binding. Here we report the 2.2 angstrom (A) crystal structure of the N-terminal 197 residues of PA, termed PA(N), from an avian influenza H5N1 virus. The PA(N) structure has an alpha/beta architecture and reveals a bound magnesium ion coordinated by a motif similar to the (P)DX(N)(D/E)XK motif characteristic of many endonucleases. Structural comparisons and mutagenesis analysis of the motif identified in PA(N) provide further evidence that PA(N) holds an endonuclease active site. Furthermore, functional analysis with in vivo ribonucleoprotein reconstitution and direct in vitro endonuclease assays strongly suggest that PA(N) holds the endonuclease active site and has critical roles in endonuclease activity of the influenza virus polymerase, rather than PB1. The high conservation of this endonuclease active site among influenza strains indicates that PA(N) is an important target for the design of new anti-influenza therapeutics.

  19. In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

    PubMed

    Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

    2012-05-01

    Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds. PMID:21877154

  20. Sites of Regulated Phosphorylation that Control K-Cl Cotransporter Activity

    PubMed Central

    Rinehart, Jesse; Maksimova, Yelena D.; Tanis, Jessica E.; Stone, Kathryn L.; Hodson, Caleb A.; Zhang, Junhui; Risinger, Mary; Pan, Weijun; Wu, Dianqing; Colangelo, Christopher M.; Forbush, Biff; Joiner, Clinton H.; Gulcicek, Erol E.; Gallagher, Patrick G.; Lifton, Richard P.

    2010-01-01

    Summary Modulation of intracellular chloride concentration ([Cl−]i) plays a fundamental role in cell volume regulation and neuronal response to GABA. Cl− exit via K-Cl cotransporters (KCCs) is a major determinant of [Cl−]I; however, mechanisms governing KCC activities are poorly understood. We identified two sites in KCC3 that are rapidly dephosphorylated in hypotonic conditions in cultured cells and human red blood cells in parallel with increased transport activity. Alanine substitutions at these sites result in constitutively active cotransport. These sites are highly phosphorylated in plasma membrane KCC3 in isotonic conditions, suggesting that dephosphorylation increases KCC3's intrinsic transport activity. Reduction of WNK1 expression via RNA interference reduces phosphorylation at these sites. Homologous sites are phosphorylated in all human KCCs. KCC2 is partially phosphorylated in neonatal mouse brain and dephosphorylated in parallel with KCC2 activation. These findings provide insight into regulation of [Cl−]i and have implications for control of cell volume and neuronal function. PMID:19665974

  1. Dimeric calixarenes: a new family of major-groove binders.

    PubMed

    Hu, Wenbin; Blecking, Caroline; Kralj, Marijeta; Šuman, Lidija; Piantanida, Ivo; Schrader, Thomas

    2012-03-19

    A new class of potent DNA binding agents is presented. Dimeric calix[4]arenes with cationic groups at their upper rims and flexible alkyl bridges can be synthesized from triply acyl-protected calix[4]arene tetramines in relatively short synthetic sequences (3-5 steps). The compounds attach themselves to double-stranded nucleic acids in a noncovalent fashion, with micro- to nanomolar affinities. Guanidinium headgroups with their extended hydrogen-bonding "fingers" are more powerful than ammonium groups, and the benzylamine series is superior to the anilinium series (see below). The new ligands easily distinguish between RNA and various DNA types, and produce characteristic changes in UV/Vis, fluorescence, CD, as well as NMR spectra. Especially extended oligonucleotides of more than 100 base pairs are bound with affinities increasing from RNA (10 μM K(d))groove. Most UV/Vis melting curves display an inverted shape, and start from drastically enhanced absorption intensities for the DNA complexes. DAPI displacement studies prove that up to one equivalent of calixarene dimer can be accommodated in the dye-loaded DNA. RNA complexation by calixarene dimers is accompanied by a drastic CD spectral transition from the typical A-form to a perfect B-signature, providing further experimental evidence for major-groove binding. The orientation of the ligands can be deduced from NMR titrations and is reproduced in Monte-Carlo simulations on 1:1 complexes in water. PMID:22336964

  2. Active sites of ligand-protected Au25 nanoparticle catalysts for CO2 electroreduction to CO

    NASA Astrophysics Data System (ADS)

    Alfonso, Dominic R.; Kauffman, Douglas; Matranga, Christopher

    2016-05-01

    Recent experimental studies have reported the electrochemical reduction of carbon dioxide (CO2) into CO at atomically precise negatively charged Au25- nanoclusters. The studies showed CO2 conversion at remarkably low overpotentials, but the exact mechanisms and nature of the active sites remain unclear. We used first-principles density functional theory and continuum solvation models to examine the role of the cluster during electrochemical CO2 reduction and analyze the free energies of proposed intermediate species. Contrary to previous assumptions, our results show that the fully ligand protected cluster is not an active CO2 reduction catalyst because formation of the crucial carboxyl intermediate required very high electrochemical potentials. Instead, our calculations suggest that the reduction process likely occurs on a dethiolated gold site, and adsorbed carboxyl intermediate formation was significantly stabilized at dethiolated gold sites. These findings point to the crucial role of exposed metal sites during electrochemical CO2 reduction at gold nanocluster catalysts.

  3. Active sites of ligand-protected Au25 nanoparticle catalysts for CO2 electroreduction to CO.

    PubMed

    Alfonso, Dominic R; Kauffman, Douglas; Matranga, Christopher

    2016-05-14

    Recent experimental studies have reported the electrochemical reduction of carbon dioxide (CO2) into CO at atomically precise negatively charged Au25 (-) nanoclusters. The studies showed CO2 conversion at remarkably low overpotentials, but the exact mechanisms and nature of the active sites remain unclear. We used first-principles density functional theory and continuum solvation models to examine the role of the cluster during electrochemical CO2 reduction and analyze the free energies of proposed intermediate species. Contrary to previous assumptions, our results show that the fully ligand protected cluster is not an active CO2 reduction catalyst because formation of the crucial carboxyl intermediate required very high electrochemical potentials. Instead, our calculations suggest that the reduction process likely occurs on a dethiolated gold site, and adsorbed carboxyl intermediate formation was significantly stabilized at dethiolated gold sites. These findings point to the crucial role of exposed metal sites during electrochemical CO2 reduction at gold nanocluster catalysts. PMID:27179498

  4. Analysis of pneumatic hammer in rectangular aerostatic thrust bearing with groove

    NASA Astrophysics Data System (ADS)

    Ma, Wei; Tan, Jiubin; Cui, Jiwen; Liu, Yongmeng

    2015-02-01

    The pneumatic hammer in rectangular aerostatic thrust bearings with groove is analyzed using perturbation theory. Routh stability criterion was used to evaluate the critical condition of pneumatic hammer in rectangular aerostatic thrust bearings with groove, and the influence of supply pressure, throttle area, groove area, and thickness of film on aerostatic thrust bearings. It was found through analysis that the change rate of stiffness and the volume ratio of aerostatic bearing could be used to analyze the pneumatic hammer in rectangular aerostatic thrust bearings with groove. At a certain film thickness, the stability of aerostatic bearings could be improved by reducing supply pressure, increasing throttle area and decreasing groove area to facilitate the design of a general aerostatic thrust bearing.

  5. Influence of edge conditions on material ejection from periodic grooves in laser shock-loaded tin

    NASA Astrophysics Data System (ADS)

    de Rességuier, T.; Roland, C.; Prudhomme, G.; Lescoute, E.; Loison, D.; Mercier, P.

    2016-05-01

    In a material subjected to high dynamic compression, the breakout of a shock wave at a rough free surface can lead to the ejection of high velocity debris. Anticipating the ballistic properties of such debris is a key safety issue in many applications involving shock loading, including pyrotechnics and inertial confinement fusion experiments. In this paper, we use laser driven shocks to investigate particle ejection from calibrated grooves of micrometric dimensions and approximately sinusoidal profile in tin samples, with various boundary conditions at the groove edges, including single groove and periodic patterns. Fast transverse shadowgraphy provides ejection velocities after shock breakout. They are found to depend not only on the groove depth and wavelength, as predicted theoretically and already observed in the past, but also, unexpectedly, on the edge conditions, with a jet tip velocity significantly lower in the case of a single groove than behind a periodic pattern.

  6. Flow visualization study of grooved surface/surfactant/air sheet interaction

    NASA Astrophysics Data System (ADS)

    Reed, Jason C.; Weinstein, Leonard M.

    1989-03-01

    The effects of groove geometry, surfactants, and airflow rate have been ascertained by a flow-visualization study of grooved-surface models which addresses the possible conditions for skin friction-reduction in marine vehicles. It is found that the grooved surface geometry holds the injected bubble stream near the wall and, in some cases, results in a 'tube' of air which remains attached to the wall. It is noted that groove dimension and the use of surfactants can substantially affect the stability of this air tube; deeper grooves, surfactants with high contact angles, and angled air injection, are all found to increase the stability of the attached air tube, while convected disturbances and high shear increase interfacial instability.

  7. Some effects of grooved runway configurations on aircraft tire braking traction under flooded runway conditions

    NASA Technical Reports Server (NTRS)

    Byrdsong, T. A.

    1973-01-01

    An experimental investigation was conducted to study the effect of grooved runway configurations on aircraft tire braking traction on flooded runway surfaces. The investigation was performed, utilizing size 49 x 17, type VII, aircraft tires with an inflation pressure of 170 lb per square inch at ground speeds up to approximately 120 knots. The results of this investigation indicate that when the runway is flooded, grooved surfaces provide better braking traction than an ungrooved surface and, in general, the level of braking traction was found to improve as the tire bearing pressure was increased because of an increase in the groove area of either the surface or the tire tread. Rounding the groove edges tended to degrade the tire braking capability from that developed on the same groove configuration with sharp edges. Results also indicate that braking friction coefficients for the test tires and runway surfaces decreased as ground speed was increased because of the hydroplaning effects.

  8. Gas Seal Pad With Herringbone-Grooved Rotor-Stiffness and Load Capacity

    NASA Technical Reports Server (NTRS)

    Flemming, David P.

    2006-01-01

    The principle of herringbone-grooved journal bearings has been applied to the case of a seal disc running under a finger seal pad. The inward pumping action of herringbone grooves on the disc generates load capacity and stiffness to maintain a fluid film and prevent contact of the pad and disc. This mechanism does not depend on a converging film under the pad, such as analyzed in previous works. Analysis shows that significant stiffness and load capacity can be supplied by herringbone grooves. In order for the grooves to be effective, the seal pressure drop must be taken outside of the grooved portion of the rotor, but this may be acceptable in order to gain freedom from maintaining a precise film convergence.

  9. Flow visualization study of grooved surface/surfactant/air sheet interaction

    NASA Technical Reports Server (NTRS)

    Reed, Jason C.; Weinstein, Leonard M.

    1989-01-01

    The effects of groove geometry, surfactants, and airflow rate have been ascertained by a flow-visualization study of grooved-surface models which addresses the possible conditions for skin friction-reduction in marine vehicles. It is found that the grooved surface geometry holds the injected bubble stream near the wall and, in some cases, results in a 'tube' of air which remains attached to the wall. It is noted that groove dimension and the use of surfactants can substantially affect the stability of this air tube; deeper grooves, surfactants with high contact angles, and angled air injection, are all found to increase the stability of the attached air tube, while convected disturbances and high shear increase interfacial instability.

  10. Dispersion characteristics of planar grating with arbitrary grooves for terahertz Smith-Purcell radiation

    SciTech Connect

    Cao, Miaomiao Li, Ke; Liu, Wenxin Wang, Yong

    2015-03-15

    In this paper, a novel method of getting the dispersion relations in planar grating with arbitrary grooves for terahertz Smith-Purcell radiation is investigated analytically. The continuous profile of the groove is approximately replaced by a series of rectangular steps. By making use of field matches method and the continuity of transverse admittance, the universal dispersion equation for grating with arbitrarily shaped grooves is derived. By solving the dispersion equation in presence of electron beam, the growth rate is obtained directly and the dependence on beam parameters is analyzed. Comparisons of the dispersion characteristics among some special groove shapes have been made by numerical calculation. The results show that the rectangular-step approximation method provides a novel approach to obtain the universal dispersion relation for grating with arbitrary grooves for Smith-Purcell radiation.

  11. Bi-site activation occurs with the native and nucleotide-depleted mitochondrial F1-ATPase.

    PubMed Central

    Milgrom, Y M; Murataliev, M B; Boyer, P D

    1998-01-01

    Experiments are reported on the uni-site catalysis and the transition from uni-site to multi-site catalysis with bovine heart mitochondrial F1-ATPase. The very slow uni-site ATP hydrolysis is shown to occur without tightly bound nucleotides present and with or without Pi in the buffer. Measurements of the transition to higher rates and the amount of bound ATP committed to hydrolysis as the ATP concentration is increased at different fixed enzyme concentrations give evidence that the filling of a second site can initiate near maximal turnover rates. They provide rate constant information, and show that an apparent Km for a second site of about 2 microM and Vmax of 10 s-1, as suggested by others, is not operative. Careful initial velocity measurements also eliminate other suggested Km values and are consistent with bi-site activation to near maximal hydrolysis rates, with a Km of about 130 microM and Vmax of about 700 s-1. However, the results do not eliminate the possibility of additional 'hidden' Km values with similar Vmax:Km ratios. Recent data on competition between TNP-ATP and ATP revealed a third catalytic site for ATP in the millimolar concentration range. This result, and those reported in the present paper, allow the conclusion that the mitochondrial F1-ATPase can attain near maximal activity in bi-site catalysis. Our data also add to the evidence that a recent claim, that the mitochondrial F1-ATPase does not show catalytic site cooperativity, is invalid. PMID:9480927

  12. Individual differences in beat perception affect gait responses to low- and high-groove music.

    PubMed

    Leow, Li-Ann; Parrott, Taylor; Grahn, Jessica A

    2014-01-01

    Slowed gait in patients with Parkinson's disease (PD) can be improved when patients synchronize footsteps to isochronous metronome cues, but limited retention of such improvements suggest that permanent cueing regimes are needed for long-term improvements. If so, music might make permanent cueing regimes more pleasant, improving adherence; however, music cueing requires patients to synchronize movements to the "beat," which might be difficult for patients with PD who tend to show weak beat perception. One solution may be to use high-groove music, which has high beat salience that may facilitate synchronization, and affective properties, which may improve motivation to move. As a first step to understanding how beat perception affects gait in complex neurological disorders, we examined how beat perception ability affected gait in neurotypical adults. Synchronization performance and gait parameters were assessed as healthy young adults with strong or weak beat perception synchronized to low-groove music, high-groove music, and metronome cues. High-groove music was predicted to elicit better synchronization than low-groove music, due to its higher beat salience. Two musical tempi, or rates, were used: (1) preferred tempo: beat rate matched to preferred step rate and (2) faster tempo: beat rate adjusted to 22.5% faster than preferred step rate. For both strong and weak beat-perceivers, synchronization performance was best with metronome cues, followed by high-groove music, and worst with low-groove music. In addition, high-groove music elicited longer and faster steps than low-groove music, both at preferred tempo and at faster tempo. Low-groove music was particularly detrimental to gait in weak beat-perceivers, who showed slower and shorter steps compared to uncued walking. The findings show that individual differences in beat perception affect gait when synchronizing footsteps to music, and have implications for using music in gait rehabilitation. PMID:25374521

  13. Individual Differences in Beat Perception Affect Gait Responses to Low- and High-Groove Music

    PubMed Central

    Leow, Li-Ann; Parrott, Taylor; Grahn, Jessica A.

    2014-01-01

    Slowed gait in patients with Parkinson’s disease (PD) can be improved when patients synchronize footsteps to isochronous metronome cues, but limited retention of such improvements suggest that permanent cueing regimes are needed for long-term improvements. If so, music might make permanent cueing regimes more pleasant, improving adherence; however, music cueing requires patients to synchronize movements to the “beat,” which might be difficult for patients with PD who tend to show weak beat perception. One solution may be to use high-groove music, which has high beat salience that may facilitate synchronization, and affective properties, which may improve motivation to move. As a first step to understanding how beat perception affects gait in complex neurological disorders, we examined how beat perception ability affected gait in neurotypical adults. Synchronization performance and gait parameters were assessed as healthy young adults with strong or weak beat perception synchronized to low-groove music, high-groove music, and metronome cues. High-groove music was predicted to elicit better synchronization than low-groove music, due to its higher beat salience. Two musical tempi, or rates, were used: (1) preferred tempo: beat rate matched to preferred step rate and (2) faster tempo: beat rate adjusted to 22.5% faster than preferred step rate. For both strong and weak beat-perceivers, synchronization performance was best with metronome cues, followed by high-groove music, and worst with low-groove music. In addition, high-groove music elicited longer and faster steps than low-groove music, both at preferred tempo and at faster tempo. Low-groove music was particularly detrimental to gait in weak beat-perceivers, who showed slower and shorter steps compared to uncued walking. The findings show that individual differences in beat perception affect gait when synchronizing footsteps to music, and have implications for using music in gait rehabilitation. PMID:25374521

  14. Counting Active Sites on Titanium Oxide-Silica Catalysts for Hydrogen Peroxide Activation through In Situ Poisoning with Phenylphosphonic Acid

    SciTech Connect

    Eaton, Todd R.; Boston, Andrew M.; Thompson, Anthony B.; Gray, Kimberly A.; Notestein, Justin M.

    2015-06-04

    Quantifying specific active sites in supported catalysts improves our understanding and assists in rational design. Supported oxides can undergo significant structural changes as surface densities increase from site-isolated cations to monolayers and crystallites, which changes the number of kinetically relevant sites. Herein, TiOx domains are titrated on TiOx–SiO2 selectively with phenylphosphonic acid (PPA). An ex situ method quantifies all fluid-accessible TiOx, whereas an in situ titration during cis-cyclooctene epoxidation provides previously unavailable values for the number of tetrahedral Ti sites on which H2O2 activation occurs. We use this method to determine the active site densities of 22 different catalysts with different synthesis methods, loadings, and characteristic spectra and find a single intrinsic turnover frequency for cis-cyclooctene epoxidation of (40±7) h-1. This simple method gives molecular-level insight into catalyst structure that is otherwise hidden when bulk techniques are used.

  15. Modified Active Site Coordination in a Clinical Mutant of Sulfite Oxidase

    SciTech Connect

    Doonan, C.J.; Wilson, H.L.; Rajagopalan, K.V.; Garrett, R.M.; Bennett, B.; Prince, R.C.; George, G.N.

    2009-06-02

    The molybdenum site of the Arginine 160 {yields} Glutamine clinical mutant of the physiologically vital enzyme sulfite oxidase has been investigated by a combination of X-ray absorption spectroscopy and density functional theory calculations. We conclude that the mutant enzyme has a six-coordinate pseudo-octahedral active site with coordination of Glutamine O{sup {epsilon}} to molybdenum. This contrasts with the wild-type enzyme which is five-coordinate with approximately square-based pyramidal geometry. This difference in the structure of the molybdenum site explains many of the properties of the mutant enzyme which have previously been reported.

  16. Mutations Closer to the Active Site Improve the Promiscuous Aldolase Activity of 4-Oxalocrotonate Tautomerase More Effectively than Distant Mutations.

    PubMed

    Rahimi, Mehran; van der Meer, Jan-Ytzen; Geertsema, Edzard M; Poddar, Harshwardhan; Baas, Bert-Jan; Poelarends, Gerrit J

    2016-07-01

    The enzyme 4-oxalocrotonate tautomerase (4-OT), which catalyzes enol-keto tautomerization as part of a degradative pathway for aromatic hydrocarbons, promiscuously catalyzes various carbon-carbon bond-forming reactions. These include the aldol condensation of acetaldehyde with benzaldehyde to yield cinnamaldehyde. Here, we demonstrate that 4-OT can be engineered into a more efficient aldolase for this condensation reaction, with a >5000-fold improvement in catalytic efficiency (kcat /Km ) and a >10(7) -fold change in reaction specificity, by exploring small libraries in which only "hotspots" are varied. The hotspots were identified by systematic mutagenesis (covering each residue), followed by a screen for single mutations that give a strong improvement in the desired aldolase activity. All beneficial mutations were near the active site of 4-OT, thus underpinning the notion that new catalytic activities of a promiscuous enzyme are more effectively enhanced by mutations close to the active site. PMID:27238293

  17. Systematic mutagenesis of the active site omega loop of TEM-1 beta-lactamase.

    PubMed Central

    Petrosino, J F; Palzkill, T

    1996-01-01

    Beta-Lactamase is a bacterial protein that provides resistance against beta-lactam antibiotics. TEM-1 beta-lactamase is the most prevalent plasmid-mediated beta-lactamase in gram-negative bacteria. Normally, this enzyme has high levels of hydrolytic activity for penicillins, but mutant beta-lactamases have evolved with activity toward a variety of beta-lactam antibiotics. It has been shown that active site substitutions are responsible for changes in the substrate specificity. Since mutant beta-lactamases pose a serious threat to antimicrobial therapy, the mechanisms by which mutations can alter the substrate specificity of TEM-1 beta-lactamase are of interest. Previously, screens of random libraries encompassing 31 of 55 active site amino acid positions enabled the identification of the residues responsible for maintaining the substrate specificity of TEM-1 beta-lactamase. In addition to substitutions found in clinical isolates, many other specificity-altering mutations were also identified. Interestingly, many nonspecific substitutions in the N-terminal half of the active site omega loop were found to increase ceftazidime hydrolytic activity and decrease ampicillin hydrolytic activity. To complete the active sight study, eight additional random libraries were constructed and screened for specificity-altering mutations. All additional substitutions found to alter the substrate specificity were located in the C-terminal half of the active site loop. These mutants, much like the N-terminal omega loop mutants, appear to be less stable than the wild-type enzyme. Further analysis of a 165-YYG-167 triple mutant, selected for high levels of ceftazidime hydrolytic activity, provides an example of the correlation which exists between enzyme instability and increased ceftazidime hydrolytic activity in the ceftazidime-selected omega loop mutants. PMID:8606154

  18. Active-site motions and polarity enhance catalytic turnover of hydrated subtilisin dissolved in organic solvents

    PubMed Central

    Hudson, Elton P; Eppler, Ross K; Beaudoin, Julianne M; Dordick, Jonathan S; Reimer, Jeffrey A; Clark, Douglas S

    2009-01-01

    The enzyme subtilisin Carlsberg was surfactant-solubilized into two organic solvents, isooctane and tetrahydrofuran, and hydrated through stepwise changes in the thermodynamic water activity, aw. The apparent turnover number kcatapp in these systems ranged from 0.2 to 80 s−1 and increased 11-fold in isooctane and up to 50-fold in tetrahydrofuran with increasing aw. 19F-NMR relaxation experiments employing an active-site inhibitor were used to assess the dependence of active-site motions on aw. The rates of NMR-derived fast (k > 107 s−1) and slow (k < 104 s−1) active-site motions increased in both solvents upon hydration, but only the slow motions correlated with kcat. The 19F chemical shift was a sensitive probe of the local electronic environment and provided an empirical measure of the active-site dielectric constant εas, which increased with hydration to εas ≈ 13 in each solvent. In both solvents the transition state free energy data and εas followed Kirkwood’s model for the continuum solvation of a dipole, indicating that water also enhanced catalysis by altering the active-site’s electronic environment and increasing its polarity to better stabilize the transition state. These results reveal that favorable dynamic and electrostatic effects both contribute to accelerated catalysis by solubilized subtilisin Carlsberg upon hydration in organic solvents. PMID:19317505

  19. Acylpeptide hydrolase: inhibitors and some active site residues of the human enzyme.

    PubMed

    Scaloni, A; Jones, W M; Barra, D; Pospischil, M; Sassa, S; Popowicz, A; Manning, L R; Schneewind, O; Manning, J M

    1992-02-25

    Acylpeptide hydrolase may be involved in N-terminal deacetylation of nascent polypeptide chains and of bioactive peptides. The activity of this enzyme from human erythrocytes is sensitive to anions such as chloride, nitrate, and fluoride. Furthermore, blocked amino acids act as competitive inhibitors of the enzyme. Acetyl leucine chloromethyl ketone has been employed to identify one active site residue as His-707. Diisopropylfluorophosphate has been used to identify a second active site residue as Ser-587. Chemical modification studies with a water-soluble carbodiimide implicate a carboxyl group in catalytic activity. These results and the sequence around these active site residues, especially near Ser-587, suggest that acylpeptide hydrolase contains a catalytic triad. The presence of a cysteine residue in the vicinity of the active site is suggested by the inactivation of the enzyme by sulfhydryl-modifying agents and also by a low amount of modification by the peptide chloromethyl ketone inhibitor. Ebelactone A, an inhibitor of the formyl aminopeptidase, the bacterial counterpart of eukaryotic acylpeptide hydrolase, was found to be an effective inhibitor of this enzyme. These findings suggest that acylpeptidase hydrolase is a member of a family of enzymes with extremely diverse functions. PMID:1740429

  20. Improving the neutral phytase activity from Bacillus amyloliquefaciens DSM 1061 by site-directed mutagenesis.

    PubMed

    Xu, Wei; Shao, Rong; Wang, Zupeng; Yan, Xiuhua

    2015-03-01

    Neutral phytase is used as a feed additive for degradation of anti-nutritional phytate in aquatic feed industry. Site-directed mutagenesis of Bacillus amyloliquefaciens DSM 1061 phytase was performed with an aim to increase its activity. Mutation residues were chosen based on multiple sequence alignments and structure analysis of neutral phytsaes from different microorganisms. The mutation sites on surface (D148E, S197E and N156E) and around the active site (D52E) of phytase were selected. Analysis of the phytase variants showed that the specific activities of mutants D148E and S197E remarkably increased by about 35 and 13% over a temperature range of 40-75 °C at pH 7.0, respectively. The k cat of mutants D148E and S197E were 1.50 and 1.25 times than that of the wild-type phytase, respectively. Both D148E and S197E showed much higher thermostability than that of the wild-type phytase. However, mutants N156E and D52E led to significant loss of specific activity of the enzyme. Structural analysis revealed that these mutations may affect conformation of the active site of phytase. The present mutant phytases D148E and S197E with increased activities and thermostabilities have application potential as additives in aquaculture feed. PMID:25613522

  1. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase

    SciTech Connect

    Fenwick, Michael K.; Mehta, Angad P.; Zhang, Yang; Abdelwahed, Sameh H.; Begley, Tadhg P.; Ealick, Steven E.

    2015-03-27

    Radical S-adenosylmethionine (SAM) enzymes use a [4Fe-4S] cluster to generate a 5'-deoxyadenosyl radical. Canonical radical SAM enzymes are characterized by a β-barrel-like fold and SAM anchors to the differentiated iron of the cluster, which is located near the amino terminus and within the β-barrel, through its amino and carboxylate groups. Here we show that ThiC, the thiamin pyrimidine synthase in plants and bacteria, contains a tethered cluster-binding domain at its carboxy terminus that moves in and out of the active site during catalysis. In contrast to canonical radical SAM enzymes, we predict that SAM anchors to an additional active site metal through its amino and carboxylate groups. Superimposition of the catalytic domains of ThiC and glutamate mutase shows that these two enzymes share similar active site architectures, thus providing strong evidence for an evolutionary link between the radical SAM and adenosylcobalamin-dependent enzyme superfamilies.

  2. Quantum delocalization of protons in the hydrogen-bond network of an enzyme active site

    PubMed Central

    Wang, Lu; Fried, Stephen D.; Boxer, Steven G.; Markland, Thomas E.

    2014-01-01

    Enzymes use protein architectures to create highly specialized structural motifs that can greatly enhance the rates of complex chemical transformations. Here, we use experiments, combined with ab initio simulations that exactly include nuclear quantum effects, to show that a triad of strongly hydrogen-bonded tyrosine residues within the active site of the enzyme ketosteroid isomerase (KSI) facilitates quantum proton delocalization. This delocalization dramatically stabilizes the deprotonation of an active-site tyrosine residue, resulting in a very large isotope effect on its acidity. When an intermediate analog is docked, it is incorporated into the hydrogen-bond network, giving rise to extended quantum proton delocalization in the active site. These results shed light on the role of nuclear quantum effects in the hydrogen-bond network that stabilizes the reactive intermediate of KSI, and the behavior of protons in biological systems containing strong hydrogen bonds. PMID:25503367

  3. Evidence from molecular dynamics simulations of conformational preorganization in the ribonuclease H active site

    PubMed Central

    Stafford, Kate A.; Palmer III, Arthur G.

    2014-01-01

    Ribonuclease H1 (RNase H) enzymes are well-conserved endonucleases that are present in all domains of life and are particularly important in the life cycle of retroviruses as domains within reverse transcriptase. Despite extensive study, especially of the E. coli homolog, the interaction of the highly negatively charged active site with catalytically required magnesium ions remains poorly understood. In this work, we describe molecular dynamics simulations of the E. coli homolog in complex with magnesium ions, as well as simulations of other homologs in their apo states. Collectively, these results suggest that the active site is highly rigid in the apo state of all homologs studied and is conformationally preorganized to favor the binding of a magnesium ion. Notably, representatives of bacterial, eukaryotic, and retroviral RNases H all exhibit similar active-site rigidity, suggesting that this dynamic feature is only subtly modulated by amino acid sequence and is primarily imposed by the distinctive RNase H protein fold. PMID:25075292

  4. Conformational Change in the Active Site of Streptococcal Unsaturated Glucuronyl Hydrolase Through Site-Directed Mutagenesis at Asp-115.

    PubMed

    Nakamichi, Yusuke; Oiki, Sayoko; Mikami, Bunzo; Murata, Kousaku; Hashimoto, Wataru

    2016-08-01

    Bacterial unsaturated glucuronyl hydrolase (UGL) degrades unsaturated disaccharides generated from mammalian extracellular matrices, glycosaminoglycans, by polysaccharide lyases. Two Asp residues, Asp-115 and Asp-175 of Streptococcus agalactiae UGL (SagUGL), are completely conserved in other bacterial UGLs, one of which (Asp-175 of SagUGL) acts as a general acid and base catalyst. The other Asp (Asp-115 of SagUGL) also affects the enzyme activity, although its role in the enzyme reaction has not been well understood. Here, we show substitution of Asp-115 in SagUGL with Asn caused a conformational change in the active site. Tertiary structures of SagUGL mutants D115N and D115N/K370S with negligible enzyme activity were determined at 2.00 and 1.79 Å resolution, respectively, by X-ray crystallography. The side chain of Asn-115 is drastically shifted in both mutants owing to the interaction with several residues, including Asp-175, by formation of hydrogen bonds. This interaction between Asn-115 and Asp-175 probably prevents the mutants from triggering the enzyme reaction using Asp-175 as an acid catalyst. PMID:27402448

  5. Conserved phosphorylation sites in the activation loop of the Arabidopsis phytosulfokine receptor PSKR1 differentially affect kinase and receptor activity

    PubMed Central

    Hartmann, Jens; Linke, Dennis; Bönniger, Christine; Tholey, Andreas; Sauter, Margret

    2015-01-01

    PSK (phytosulfokine) is a plant peptide hormone perceived by a leucine-rich repeat receptor kinase. Phosphosite mapping of epitope-tagged PSKR1 (phytosulfokine receptor 1) from Arabidopsis thaliana plants identified Ser696 and Ser698 in the JM (juxtamembrane) region and probably Ser886 and/or Ser893 in the AL (activation loop) as in planta phosphorylation sites. In vitro-expressed kinase was autophosphorylated at Ser717 in the JM, and at Ser733, Thr752, Ser783, Ser864, Ser911, Ser958 and Thr998 in the kinase domain. The LC–ESI–MS/MS spectra provided support that up to three sites (Thr890, Ser893 and Thr894) in the AL were likely to be phosphorylated in vitro. These sites are evolutionarily highly conserved in PSK receptors, indicative of a conserved function. Site-directed mutagenesis of the four conserved residues in the activation segment, Thr890, Ser893, Thr894 and Thr899, differentially altered kinase activity in vitro and growth-promoting activity in planta. The T899A and the quadruple-mutated TSTT-A (T890A/S893A/T894A/T899A) mutants were both kinase-inactive, but PSKR1(T899A) retained growth-promoting activity. The T890A and S893A/T894A substitutions diminished kinase activity and growth promotion. We hypothesize that phosphorylation within the AL activates kinase activity and receptor function in a gradual and distinctive manner that may be a means to modulate the PSK response. PMID:26472115

  6. Conserved phosphorylation sites in the activation loop of the Arabidopsis phytosulfokine receptor PSKR1 differentially affect kinase and receptor activity.

    PubMed

    Hartmann, Jens; Linke, Dennis; Bönniger, Christine; Tholey, Andreas; Sauter, Margret

    2015-12-15

    PSK (phytosulfokine) is a plant peptide hormone perceived by a leucine-rich repeat receptor kinase. Phosphosite mapping of epitope-tagged PSKR1 (phytosulfokine receptor 1) from Arabidopsis thaliana plants identified Ser(696) and Ser(698) in the JM (juxtamembrane) region and probably Ser(886) and/or Ser(893) in the AL (activation loop) as in planta phosphorylation sites. In vitro-expressed kinase was autophosphorylated at Ser(717) in the JM, and at Ser(733), Thr(752), Ser(783), Ser(864), Ser(911), Ser(958) and Thr(998) in the kinase domain. The LC-ESI-MS/MS spectra provided support that up to three sites (Thr(890), Ser(893) and Thr(894)) in the AL were likely to be phosphorylated in vitro. These sites are evolutionarily highly conserved in PSK receptors, indicative of a conserved function. Site-directed mutagenesis of the four conserved residues in the activation segment, Thr(890), Ser(893), Thr(894) and Thr(899), differentially altered kinase activity in vitro and growth-promoting activity in planta. The T899A and the quadruple-mutated TSTT-A (T890A/S893A/T894A/T899A) mutants were both kinase-inactive, but PSKR1(T899A) retained growth-promoting activity. The T890A and S893A/T894A substitutions diminished kinase activity and growth promotion. We hypothesize that phosphorylation within the AL activates kinase activity and receptor function in a gradual and distinctive manner that may be a means to modulate the PSK response. PMID:26472115

  7. Testing the applicability of rapid on-site enzymatic activity detection for surface water monitoring

    NASA Astrophysics Data System (ADS)

    Stadler, Philipp; Vogl, Wolfgang; Juri, Koschelnik; Markus, Epp; Maximilian, Lackner; Markus, Oismüller; Monika, Kumpan; Peter, Strauss; Regina, Sommer; Gabriela, Ryzinska-Paier; Farnleitner Andreas, H.; Matthias, Zessner

    2015-04-01

    On-site detection of enzymatic activities has been suggested as a rapid surrogate for microbiological pollution monitoring of water resources (e.g. using glucuronidases, galactosidases, esterases). Due to the possible short measuring intervals enzymatic methods have high potential as near-real time water quality monitoring tools. This presentation describes results from a long termed field test. For twelve months, two ColiMinder devices (Vienna Water Monitoring, Austria) for on-site determination of enzymatic activity were tested for stream water monitoring at the experimental catchment HOAL (Hydrological Open Air Laboratory, Center for Water Resource Systems, Vienna University of Technology). The devices were overall able to follow and reflect the diverse hydrological and microbiological conditions of the monitored stream during the test period. Continuous data in high temporal resolution captured the course of enzymatic activity in stream water during diverse rainfall events. The method also proofed sensitive enough to determine diurnal fluctuations of enzymatic activity in stream water during dry periods. The method was able to capture a seasonal trend of enzymatic activity in stream water that matches the results gained from Colilert18 analysis for E. coli and coliform bacteria of monthly grab samples. Furthermore the comparison of ColiMinder data with measurements gained at the same test site with devices using the same method but having different construction design (BACTcontrol, microLAN) showed consistent measuring results. Comparative analysis showed significant differences between measured enzymatic activity (modified fishman units and pmol/min/100ml) and cultivation based analyses (most probable number, colony forming unit). Methods of enzymatic activity measures are capable to detect ideally the enzymatic activity caused by all active target bacteria members, including VBNC (viable but nonculturable) while cultivation based methods cannot detect VBNC

  8. Preliminary examination of the impacts of repository site characterization activities and facility construction and operation activities on Hanford air quality

    SciTech Connect

    Glantz, C.S.; Ramsdell, J.V.

    1986-04-01

    Air quality impacts that would result from site characterization activities and from the construction and operation of a high-level nuclear wste repository at Hanford are estimated using two simple atmospheric dispersion models, HANCHI and CHISHORT. Model results indicate that pollutant concentrations would not exceed ambient air quality standards at any point outside the Hanford fenceline or at any publicly accessible location within the Hanford Site. The increase in pollutant concentrations in nearby communities due to site activities would be minimal. HANCHI and CHISHORT are documented in the appendices of this document. Further study of the repository's impact on air quality will be conducted when more detailed project plans and work schedules are available.

  9. Activity-dependent labeling of oxygenase enzymes in a trichloroethene-contaminated groundwater site.

    PubMed

    Lee, M Hope; Clingenpeel, Scott C; Leiser, Owen P; Wymore, Ryan A; Sorenson, Kent S; Watwood, Mary E

    2008-05-01

    A variety of naturally occurring bacteria produce enzymes that cometabolically degrade trichloroethene (TCE), including organisms with aerobic oxygenases. Groundwater contaminated with TCE was collected from the aerobic region of the Test Area North site of the Idaho National Laboratory. Samples were evaluated with enzyme activity probes, and resulted in measurable detection of toluene oxygenase activity (6-79% of the total microbial cells). Wells from both inside and outside contaminated plume showed activity. Toluene oxygenase-specific PCR primers determined that toluene-degrading genes were present in all groundwater samples evaluated. In addition, bacterial isolates were obtained and possessed toluene oxygenase enzymes, demonstrated activity, and were dominated by the phylotype Pseudomonas. This study demonstrated, through the use of enzymatic probes and oxygenase gene identification, that indigenous microorganisms at a contaminated site were cometabolically active. Documentation such as this can be used to substantiate observations of natural attenuation of TCE-contaminated groundwater plumes. PMID:17904715

  10. DNA damage processing by human 8-oxoguanine-DNA glycosylase mutants with the occluded active site.

    PubMed

    Lukina, Maria V; Popov, Alexander V; Koval, Vladimir V; Vorobjev, Yuri N; Fedorova, Olga S; Zharkov, Dmitry O

    2013-10-01

    8-Oxoguanine-DNA glycosylase (OGG1) removes premutagenic lesion 8-oxoguanine (8-oxo-G) from DNA and then nicks the nascent abasic (apurinic/apyrimidinic) site by β-elimination. Although the structure of OGG1 bound to damaged DNA is known, the dynamic aspects of 8-oxo-G recognition are not well understood. To comprehend the mechanisms of substrate recognition and processing, we have constructed OGG1 mutants with the active site occluded by replacement of Cys-253, which forms a wall of the base-binding pocket, with bulky leucine or isoleucine. The conformational dynamics of OGG1 mutants were characterized by single-turnover kinetics and stopped-flow kinetics with fluorescent detection. Additionally, the conformational mobility of wild type and the mutant OGG1 substrate complex was assessed using molecular dynamics simulations. Although pocket occlusion distorted the active site and greatly decreased the catalytic activity of OGG1, it did not fully prevent processing of 8-oxo-G and apurinic/apyrimidinic sites. Both mutants were notably stimulated in the presence of free 8-bromoguanine, indicating that this base can bind to the distorted OGG1 and facilitate β-elimination. The results agree with the concept of enzyme plasticity, suggesting that the active site of OGG1 is flexible enough to compensate partially for distortions caused by mutation. PMID:23955443

  11. Threatened and endangered wildlife species of the Hanford Site related to CERCLA characterization activities

    SciTech Connect

    Fitzner, R.E.; Weiss, S.G.; Stegen, J.A.

    1994-06-01

    The US Department of Energy`s (DOE) Hanford Site has been placed on the National Priorities List, which requires that it be remediated under the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) or Superfund. Potentially contaminated areas of the Hanford Site were grouped into operable units, and detailed characterization and investigation plans were formulated. The DOE Richland Operations Office requested Westinghouse Hanford Company (WHC) to conduct a biological assessment of the potential impact of these characterization activities on the threatened, endangered, and sensitive wildlife species of the Hanford Site. Additional direction for WHC compliances with wildlife protection can be found in the Environmental Compliance Manual. This document is intended to meet these requirements, in part, for the CERCLA characterization activities, as well as for other work comparable in scope. This report documents the biological assessment and describes the pertinent components of the Hanford Site as well as the planned characterization activities. Also provided are accounts of endangered, threatened, and federal candidate wildlife species on the Hanford Site and information as to how human disturbances can affect these species. Potential effects of the characterization activities are described with recommendations for mitigation measures.

  12. A Tale of Two Isomerases: Compact versus Extended Active Sites in Ketosteroid Isomerase and Phosphoglucose Isomerase

    SciTech Connect

    Somarowthu, Srinivas; Brodkin, Heather R.; D’Aquino, J. Alejandro; Ringe, Dagmar; Ondrechen, Mary Jo; Beuning, Penny J.

    2012-07-11

    Understanding the catalytic efficiency and specificity of enzymes is a fundamental question of major practical and conceptual importance in biochemistry. Although progress in biochemical and structural studies has enriched our knowledge of enzymes, the role in enzyme catalysis of residues that are not nearest neighbors of the reacting substrate molecule is largely unexplored experimentally. Here computational active site predictors, THEMATICS and POOL, were employed to identify functionally important residues that are not in direct contact with the reacting substrate molecule. These predictions then guided experiments to explore the active sites of two isomerases, Pseudomonas putida ketosteroid isomerase (KSI) and human phosphoglucose isomerase (PGI), as prototypes for very different types of predicted active sites. Both KSI and PGI are members of EC 5.3 and catalyze similar reactions, but they represent significantly different degrees of remote residue participation, as predicted by THEMATICS and POOL. For KSI, a compact active site of mostly first-shell residues is predicted, but for PGI, an extended active site in which residues in the first, second, and third layers around the reacting substrate are predicted. Predicted residues that have not been previously tested experimentally were investigated by site-directed mutagenesis and kinetic analysis. In human PGI, single-point mutations of the predicted second- and third-shell residues K362, H100, E495, D511, H396, and Q388 show significant decreases in catalytic activity relative to that of the wild type. The results of these experiments demonstrate that, as predicted, remote residues are very important in PGI catalysis but make only small contributions to catalysis in KSI.

  13. The active site of low-temperature methane hydroxylation in iron-containing zeolites.

    PubMed

    Snyder, Benjamin E R; Vanelderen, Pieter; Bols, Max L; Hallaert, Simon D; Böttger, Lars H; Ungur, Liviu; Pierloot, Kristine; Schoonheydt, Robert A; Sels, Bert F; Solomon, Edward I

    2016-08-18

    An efficient catalytic process for converting methane into methanol could have far-reaching economic implications. Iron-containing zeolites (microporous aluminosilicate minerals) are noteworthy in this regard, having an outstanding ability to hydroxylate methane rapidly at room temperature to form methanol. Reactivity occurs at an extra-lattice active site called α-Fe(ii), which is activated by nitrous oxide to form the reactive intermediate α-O; however, despite nearly three decades of research, the nature of the active site and the factors determining its exceptional reactivity are unclear. The main difficulty is that the reactive species-α-Fe(ii) and α-O-are challenging to probe spectroscopically: data from bulk techniques such as X-ray absorption spectroscopy and magnetic susceptibility are complicated by contributions from inactive 'spectator' iron. Here we show that a site-selective spectroscopic method regularly used in bioinorganic chemistry can overcome this problem. Magnetic circular dichroism reveals α-Fe(ii) to be a mononuclear, high-spin, square planar Fe(ii) site, while the reactive intermediate, α-O, is a mononuclear, high-spin Fe(iv)=O species, whose exceptional reactivity derives from a constrained coordination geometry enforced by the zeolite lattice. These findings illustrate the value of our approach to exploring active sites in heterogeneous systems. The results also suggest that using matrix constraints to activate metal sites for function-producing what is known in the context of metalloenzymes as an 'entatic' state-might be a useful way to tune the activity of heterogeneous catalysts. PMID:27535535

  14. Dynamics of the Active Sites of Dimeric Seryl tRNA Synthetase from Methanopyrus kandleri.

    PubMed

    Dutta, Saheb; Nandi, Nilashis

    2015-08-27

    Aminoacyl tRNA synthetases (aaRSs) carry out the first step of protein biosynthesis. Several aaRSs are multimeric, and coordination between the dynamics of active sites present in each monomer is a prerequisite for the fast and accurate aminoacylation. However, important lacunae of understanding exist concerning the conformational dynamics of multimeric aaRSs. Questions remained unanswered pertaining to the dynamics of the active site. Little is known concerning the conformational dynamics of the active sites in response to the substrate binding, reorganization of the catalytic residues around reactants, time-dependent changes at the reaction center, which are essential for facilitating the nucleophilic attack, and interactions at the interface of neighboring monomers. In the present work, we carried out all-atom molecular dynamics simulation of dimeric (mk)SerRS from Methanopyrus kandleri bound with tRNA using an explicit solvent system. Two dimeric states of seryl tRNA synthetase (open, substrate bound, and adenylate bound) and two monomeric states (open and substrate bound) are simulated with bound tRNA. The aim is to understand the conformational dynamics of (mk)SerRS during its reaction cycle. While the present results provide a clear dynamical perspective of the active sites of (mk)SerRS, they corroborate with the results from the time-averaged experimental data such as crystallographic and mutation analysis of methanogenic SerRS from M. kandleri and M. barkeri. It is observed from the present simulation that the motif 2 loop gates the active site and its Glu351 and Arg360 stabilizes ATP in a bent state favorable for nucleophilic attack. The flexibility of the walls of the active site gradually reduces near reaction center, which is a more organized region compared to the lid region. The motif 2 loop anchors Ser and ATP using Arg349 in a hydrogen bonded geometry crucial for nucleophilic attack and favorably influences the electrostatic potential at the

  15. Grain boundary grooving of Al-bicrystals in the presence of a liquid Al-In alloy

    NASA Astrophysics Data System (ADS)

    Ratke, L.; Vogel, H. J.

    1987-02-01

    Grain boundary grooving of the Al bicrystal by diffusion of Al through an In-rich liquid was investigated at different temperatures below the monotectic. An instability of the groove profile is observed leading to a completely different groove profile than theoretically predicted by the theory of Mullins. The occurrence of this instability is explained by the existence of a second process disturbing the groove kinetics: grain boundary diffusion of In atoms into the bicrystal boundary.

  16. Monitoring of geological activity on astronomical sites of the Canary Islands, Hawaii, and Chile

    NASA Astrophysics Data System (ADS)

    Eff-Darwich, Antonio; Garcia-Lorenzo, Begoña; Rodriguez-Losada, Jose A.; Hernández-Gutiérrez, Luis E.; de la Nuez, Julio; Romero-Ruiz, Maria C.

    2009-09-01

    Future large and extremely large ground-based telescopes will demand stable geological settings.Remote sensing could be an unvaluable tool to analyse the impact of geological activity at selected astronomical sites, namely the observatories of El Teide (Tenerife, Canary Islands), Roque de los Muchachos (La Palma, Canary Islands), Mauna Kea (Hawaii) and Paranal (Chile; the candidate site of Cerro Ventarrones, Chile). In this sense, the extent of lava flows, eruptive clouds or ground deformation associated to seismic and/or volcanic activity could be analysed and characterised through remote sensing.

  17. Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

    PubMed Central

    Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

    2015-01-01

    The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

  18. Active-Site Monovalent Cations Revealed in a 1.55 Å Resolution Hammerhead Ribozyme Structure

    PubMed Central

    Anderson, Michael; Schultz, Eric P.; Martick, Monika; Scott, William G.

    2013-01-01

    We have obtained a 1.55 Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni in conditions that permit detailed observations of Na+ ion binding in the ribozyme's active site. At least two such Na+ ions are observed. The first Na+ ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical to that previously observed for divalent cations. A second Na+ ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na+, but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na+ directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest resolution ribozyme structure in the protein data bank. PMID:23711504

  19. Tuned by metals: the TET peptidase activity is controlled by 3 metal binding sites

    PubMed Central

    Colombo, Matteo; Girard, Eric; Franzetti, Bruno

    2016-01-01

    TET aminopeptidases are dodecameric particles shared in the three life domains involved in various biological processes, from carbon source provider in archaea to eye-pressure regulation in humans. Each subunit contains a dinuclear metal site (M1 and M2) responsible for the enzyme catalytic activity. However, the role of each metal ion is still uncharacterized. Noteworthy, while mesophilic TETs are activated by Mn2+, hyperthermophilic TETs prefers Co2+. Here, by means of anomalous x-ray crystallography and enzyme kinetics measurements of the TET3 aminopeptidase from the hyperthermophilic organism Pyrococcus furiosus (PfTET3), we show that M2 hosts the catalytic activity of the enzyme, while M1 stabilizes the TET3 quaternary structure and controls the active site flexibility in a temperature dependent manner. A new third metal site (M3) was found in the substrate binding pocket, modulating the PfTET3 substrate preferences. These data show that TET activity is tuned by the molecular interplay among three metal sites. PMID:26853450

  20. Human Activities in Natura 2000 Sites: A Highly Diversified Conservation Network

    NASA Astrophysics Data System (ADS)

    Tsiafouli, Maria A.; Apostolopoulou, Evangelia; Mazaris, Antonios D.; Kallimanis, Athanasios S.; Drakou, Evangelia G.; Pantis, John D.

    2013-05-01

    The Natura 2000 network was established across the European Union's (EU) Member States with the aim to conserve biodiversity, while ensuring the sustainability of human activities. However, to what kind and to what extent Natura 2000 sites are subject to human activities and how this varies across Member States remains unspecified. Here, we analyzed 111,269 human activity records from 14,727 protected sites in 20 Member States. The frequency of occurrence of activities differs among countries, with more than 86 % of all sites being subjected to agriculture or forestry. Activities like hunting, fishing, urbanization, transportation, and tourism are more frequently recorded in south European sites than in northern or eastern ones. The observed variations indicate that Natura 2000 networks are highly heterogeneous among EU Member States. Our analysis highlights the importance of agriculture in European landscapes and indicates possible targets for policy interventions at national, European, or "sub-European" level. The strong human presence in the Natura 2000 network throughout Member States, shows that conservation initiatives could succeed only by combining social and ecological sustainability and by ensuring the integration of policies affecting biodiversity.

  1. Small activating RNA binds to the genomic target site in a seed-region-dependent manner

    PubMed Central

    Meng, Xing; Jiang, Qian; Chang, Nannan; Wang, Xiaoxia; Liu, Chujun; Xiong, Jingwei; Cao, Huiqing; Liang, Zicai

    2016-01-01

    RNA activation (RNAa) is the upregulation of gene expression by small activating RNAs (saRNAs). In order to investigate the mechanism by which saRNAs act in RNAa, we used the progesterone receptor (PR) gene as a model, established a panel of effective saRNAs and assessed the involvement of the sense and antisense strands of saRNA in RNAa. All active saRNAs had their antisense strand effectively incorporated into Ago2, whereas such consistency did not occur for the sense strand. Using a distal hotspot for saRNA targeting at 1.6-kb upstream from the PR transcription start site, we further established that gene activation mediated by saRNA depended on the complementarity of the 5′ region of the antisense strand, and that such activity was largely abolished by mutations in this region of the saRNA. We found markedly reduced RNAa effects when we created mutations in the genomic target site of saRNA PR-1611, thus providing evidence that RNAa depends on the integrity of the DNA target. We further demonstrated that this saRNA bound the target site on promoter DNA. These results demonstrated that saRNAs work via an on-site mechanism by binding to target genomic DNA in a seed-region-dependent manner, reminiscent of miRNA-like target recognition. PMID:26873922

  2. A Ty1 Reverse Transcriptase Active-Site Aspartate Mutation Blocks Transposition but Not Polymerization†

    PubMed Central

    Uzun, Ozcan; Gabriel, Abram

    2001-01-01

    Reverse transcriptases (RTs) are found in a wide variety of mobile genetic elements including viruses, retrotransposons, and infectious organellar introns. An invariant triad of aspartates is thought to be required for the catalytic function of RTs. We generated RT mutants in the yeast retrotransposon Ty1, changing each of these active-site aspartates to asparagine or glutamate. All but one of the mutants lacked detectable polymerase activity. The novel exception, D211N, retained near wild-type in vitro polymerase activity within virus-like particles but failed to carry out in vivo transposition. For this mutant, minus-strand synthesis is impaired and formation of the plus-strand strong-stop intermediate is eliminated. Intragenic second-site suppressor mutations of the transposition defect map to the RNase H domain of the enzyme. Our results demonstrate that one of the three active-site aspartates in a retrotransposon RT is not catalytically critical. This implies a basic difference in the polymerase active-site geometry of Ty1 and human immunodeficiency virus RT and shows that subtle mutations in one domain can cause dramatic functional effects on a distant domain of the same enzyme. PMID:11413300

  3. DNA binding induces active site conformational change in the human TREX2 3'-exonuclease.

    PubMed

    de Silva, Udesh; Perrino, Fred W; Hollis, Thomas

    2009-04-01

    The TREX enzymes process DNA as the major 3'-->5' exonuclease activity in mammalian cells. TREX2 and TREX1 are members of the DnaQ family of exonucleases and utilize a two metal ion catalytic mechanism of hydrolysis. The structure of the dimeric TREX2 enzyme in complex with single-stranded DNA has revealed binding properties that are distinct from the TREX1 protein. The TREX2 protein undergoes a conformational change in the active site upon DNA binding including ordering of active site residues and a shift of an active site helix. Surprisingly, even when a single monomer binds DNA, both monomers in the dimer undergo the structural rearrangement. From this we have proposed a model for DNA binding and 3' hydrolysis for the TREX2 dimer. The structure also shows how TREX proteins potentially interact with double-stranded DNA and suggest features that might be involved in strand denaturation to provide a single-stranded substrate for the active site. PMID:19321497

  4. A facile reflux procedure to increase active surface sites form highly active and durable supported palladium@platinum bimetallic nanodendrites

    NASA Astrophysics Data System (ADS)

    Wang, Qin; Li, Yingjun; Liu, Baocang; Xu, Guangran; Zhang, Geng; Zhao, Qi; Zhang, Jun

    2015-11-01

    A series of well-dispersed bimetallic Pd@Pt nanodendrites uniformly supported on XC-72 carbon black are fabricated by using different capping agents. These capping agents are essential for the branched morphology control. However, the surfactant adsorbed on the nanodendrites surface blocks the access of reactant molecules to the active surface sites, and the catalytic activities of these bimetallic nanodendrites are significantly restricted. Herein, a facile reflux procedure to effectively remove the capping agent molecules without significantly affecting their sizes is reported for activating supported nanocatalysts. More significantly, the structure and morphology of the nanodendrites can also be retained, enhancing the numbers of active surface sites, catalytic activity and stability toward methanol and ethanol electro-oxidation reactions. The as-obtained hot water reflux-treated Pd@Pt/C catalyst manifests superior catalytic activity and stability both in terms of surface and mass specific activities, as compared to the untreated catalysts and the commercial Pt/C and Pd/C catalysts. We anticipate that this effective and facile removal method has more general applicability to highly active nanocatalysts prepared with various surfactants, and should lead to improvements in environmental protection and energy production.

  5. Role of methionine in the active site of alpha-galactosidase from Trichoderma reesei.

    PubMed Central

    Kachurin, A M; Golubev, A M; Geisow, M M; Veselkina, O S; Isaeva-Ivanova, L S; Neustroev, K N

    1995-01-01

    alpha-Galactosidase from Trichoderma reesei when treated with H2O2 shows a 12-fold increase in activity towards p-nitrophenyl alpha-D-galactopyranoside. A similar effect is produced by the treatment of alpha-galactosidase with other non-specific oxidants: NaIO4, KMnO4 and K4S4O8. In addition to the increase in activity, the Michaelis constant rises from 0.2 to 1.4 mM, the temperature coefficient decreases by a factor of 1.5 and the pH-activity curve falls off sharply with increasing pH. Galactose (a competitive inhibitor of alpha-galactosidase; Ki 0.09 mM for the native enzyme at pH 4.4) effectively inhibits oxidative activation of the enzyme, because the observed activity changes are related to oxidation of the catalytically important methionine in the active site. NMR measurements and amino acid analysis show that oxidation to methionine sulphoxide of one of five methionines is sufficient to activate alpha-galactosidase. Binding of galactose prevents this. Oxidative activation does not lead to conversion of other H2O2-sensitive amino acid residues, such as histidine, tyrosine, tryptophan and cysteine. The catalytically important cysteine thiol group is quantitatively titrated after protein oxidative activation. Further oxidation of methionines (up to four of five residues) can be achieved by increasing the oxidation time and/or by prior denaturation of the protein. Obviously, a methionine located in the active site of alpha-galactosidase is more accessible. The oxidative-activation phenomenon can be explained by a conformational change in the active site as a result of conversion of non-polar methionine into polar methionine sulphoxide. Images Figure 10 PMID:8948456

  6. Structure of inorganic pyrophosphatase from Staphylococcus aureus reveals conformational flexibility of the active site.

    PubMed

    Gajadeera, Chathurada S; Zhang, Xinyi; Wei, Yinan; Tsodikov, Oleg V

    2015-02-01

    Cytoplasmic inorganic pyrophosphatase (PPiase) is an enzyme essential for survival of organisms, from bacteria to human. PPiases are divided into two structurally distinct families: family I PPiases are Mg(2+)-dependent and present in most archaea, eukaryotes and prokaryotes, whereas the relatively less understood family II PPiases are Mn(2+)-dependent and present only in some archaea, bacteria and primitive eukaryotes. Staphylococcus aureus (SA), a dangerous pathogen and a frequent cause of hospital infections, contains a family II PPiase (PpaC), which is an attractive potential target for development of novel antibacterial agents. We determined a crystal structure of SA PpaC in complex with catalytic Mn(2+) at 2.1Å resolution. The active site contains two catalytic Mn(2+) binding sites, each half-occupied, reconciling the previously observed 1:1 Mn(2+):enzyme stoichiometry with the presence of two divalent metal ion sites in the apo-enzyme. Unexpectedly, despite the absence of the substrate or products in the active site, the two domains of SA PpaC form a closed active site, a conformation observed in structures of other family II PPiases only in complex with substrate or product mimics. A region spanning residues 295-298, which contains a conserved substrate binding RKK motif, is flipped out of the active site, an unprecedented conformation for a PPiase. Because the mutant of Arg295 to an alanine is devoid of activity, this loop likely undergoes an induced-fit conformational change upon substrate binding and product dissociation. This closed conformation of SA PPiase may serve as an attractive target for rational design of inhibitors of this enzyme. PMID:25576794

  7. NMR structure of the active conformation of the Varkud satellite ribozyme cleavage site

    PubMed Central

    Hoffmann, Bernd; Mitchell, G. Thomas; Gendron, Patrick; Major, François; Andersen, Angela A.; Collins, Richard A.; Legault, Pascale

    2003-01-01

    Substrate cleavage by the Neurospora Varkud satellite (VS) ribozyme involves a structural change in the stem-loop I substrate from an inactive to an active conformation. We have determined the NMR solution structure of a mutant stem-loop I that mimics the active conformation of the cleavage site internal loop. This structure shares many similarities, but also significant differences, with the previously determined structures of the inactive internal loop. The active internal loop displays different base-pairing interactions and forms a novel RNA fold composed exclusively of sheared G-A base pairs. From chemical-shift mapping we identified two Mg2+ binding sites in the active internal loop. One of the Mg2+ binding sites forms in the active but not the inactive conformation of the internal loop and is likely important for catalysis. Using the structure comparison program mc-search, we identified the active internal loop fold in other RNA structures. In Thermus thermophilus 16S rRNA, this RNA fold is directly involved in a long-range tertiary interaction. An analogous tertiary interaction may form between the active internal loop of the substrate and the catalytic domain of the VS ribozyme. The combination of NMR and bioinformatic approaches presented here has identified a novel RNA fold and provides insights into the structural basis of catalytic function in the Neurospora VS ribozyme. PMID:12782785

  8. Immobilized low-activity waste site borehole 299-E17-21

    SciTech Connect

    Reidel, S.P.; Reynolds, K.D.; Horton, D.G.

    1998-08-01

    The Tank Waste Remediation System (TWRS) is the group at the Hanford Site responsible for the safe underground storage of liquid waste from previous Hanford Site operations, the storage and disposal of immobilized tank waste, and closure of underground tanks. The current plan is to dispose of immobilized low-activity tank waste (ILAW) in new facilities in the southcentral part of 200-East Area and in four existing vaults along the east side of 200-East Area. Boreholes 299-E17-21, B8501, and B8502 were drilled at the southwest corner of the ILAW site in support of the Performance Assessment activities for the disposal options. This report summarizes the initial geologic findings, field tests conducted on those boreholes, and ongoing studies. One deep (480 feet) borehole and two shallow (50 feet) boreholes were drilled at the southwest corner of the ILAW site. The primary factor dictating the location of the boreholes was their characterization function with respect to developing the geohydrologic model for the site and satisfying associated Data Quality Objectives. The deep borehole was drilled to characterize subsurface conditions beneath the ILAW site, and two shallow boreholes were drilled to support an ongoing environmental tracer study. The tracer study will supply information to the Performance Assessment. All the boreholes provide data on the vadose zone and saturated zone in a previously uncharacterized area.

  9. Active site diversification of P450cam with indole generates catalysts for benzylic oxidation reactions

    PubMed Central

    Herter, Susanne; Kranz, David C; Turner, Nicholas J

    2015-01-01

    Summary Cytochrome P450 monooxygenases are useful biocatalysts for C–H activation, and there is a need to expand the range of these enzymes beyond what is naturally available. A panel of 93 variants of active self-sufficient P450cam[Tyr96Phe]-RhFRed fusion enzymes with a broad diversity in active site amino acids was developed by screening a large mutant library of 16,500 clones using a simple, highly sensitive colony-based colorimetric screen against indole. These mutants showed distinct fingerprints of activity not only when screened in oxidations of substituted indoles but also for unrelated oxidations such as benzylic hydroxylations. PMID:26664590

  10. Molecular dioxygen enters the active site of 12/15-lipoxygenase via dynamic oxygen access channels.

    PubMed

    Saam, Jan; Ivanov, Igor; Walther, Matthias; Holzhütter, Hermann-Georg; Kuhn, Hartmut

    2007-08-14

    Cells contain numerous enzymes that use molecular oxygen for their reactions. Often, their active sites are buried deeply inside the protein, which raises the question whether there are specific access channels guiding oxygen to the site of catalysis. Choosing 12/15-lipoxygenase as a typical example for such oxygen-dependent enzymes, we determined the oxygen distribution within the protein and defined potential routes for oxygen access. For this purpose, we have applied an integrated strategy of structural modeling, molecular dynamics simulations, site-directed mutagenesis, and kinetic measurements. First, we computed the 3D free-energy distribution for oxygen, which led to identification of four oxygen channels in the protein. All channels connect the protein surface with a region of high oxygen affinity at the active site. This region is localized opposite to the nonheme iron providing a structural explanation for the reaction specificity of this lipoxygenase isoform. The catalytically most relevant path can be obstructed by L367F exchange, which leads to a strongly increased Michaelis constant for oxygen. The blocking mechanism is explained in detail by reordering the hydrogen-bonding network of water molecules. Our results provide strong evidence that the main route for oxygen access to the active site of the enzyme follows a channel formed by transiently interconnected cavities whereby the opening and closure are governed by side chain dynamics. PMID:17675410

  11. CO Oxidation on Au/TiO2: Condition-Dependent Active Sites and Mechanistic Pathways.

    PubMed

    Wang, Yang-Gang; Cantu, David C; Lee, Mal-Soon; Li, Jun; Glezakou, Vassiliki-Alexandra; Rousseau, Roger

    2016-08-24

    We present results of ab initio electronic structure and molecular dynamics simulations (AIMD), as well as a microkinetic model of CO oxidation catalyzed by TiO2 supported Au nanocatalysts. A coverage-dependent microkinetic analysis, based on energetics obtained with density functional methods, shows that the dominant kinetic pathway, activated oxygen species, and catalytic active sites are all strongly depended on both temperature and oxygen partial pressure. Under oxidizing conditions and T < 400 K, the prevalent pathway involves a dynamic single atom catalytic mechanism. This reaction is catalyzed by a transient Au-CO species that migrates from the Au-cluster onto a surface oxygen adatom. It subsequently reacts with the TiO2 support via a Mars van Krevelen mechanism to form CO2 and finally the Au atom reintegrates back into the gold cluster to complete the catalytic cycle. At 300 ≤ T ≤ 600 K, oxygen-bound single Oad-Au(+)-CO sites and the perimeter Au-sites of the nanoparticle work in tandem to optimally catalyze the reaction. Above 600 K, a variety of alternate pathways associated with both single-atom and the perimeter sites of the Au nanoparticle are found to be active. Under low oxygen pressures, Oad-Au(+)-CO species can be a source of catalyst deactivation and the dominant pathway involves only Au-perimeter sites. A detailed comparison of the current model and the existing literature resolves many apparent inconsistencies in the mechanistic interpretations. PMID:27480512

  12. Investigation of the active site and the conformational stability of nucleoside diphosphate kinase by site-directed mutagenesis.

    PubMed

    Tepper, A D; Dammann, H; Bominaar, A A; Véron, M

    1994-12-23

    Nucleoside-diphosphate kinase (EC 2.7.4.6) catalyzes phosphate exchange between nucleoside triphosphates and nucleoside diphosphates. Its 17 kDa subunits are highly conserved throughout evolution in both sequence and tertiary structure. Using site-directed mutagenesis we investigated the function of 8 amino acids (Lys16, Tyr56, Arg92, Thr98, Arg109, Asn119, Ser124, and Glu133) that are totally conserved among all nucleoside diphosphate kinases known to date. The mutant proteins all show decreased specific activity and support roles for these residues in catalysis, substrate binding, or both, as was previously proposed on the basis of the x-ray structure (Moréra, S., Lascu, I., Dumas, C., LeBras, G., Briozzo, P., Véron, M., and Janin, J. (1994) Biochemistry 33, 459-467). Furthermore, residues Lys16, Arg109, and Asn 119 were identified to play important roles in conformational stability or subunit interactions. We show that Lys16 and Asn119 form a rigid structure that is important for enzymatic function and that Arg109, known to interact with the phosphate moiety of the substrate, also plays an important role in subunit association. The dual roles of Lys16, Arg109, and Asn119 in both substrate binding and subunit assembly provide further evidence for a functional coupling between catalytic activity and quaternary structure in nucleoside diphosphate kinase. PMID:7798215

  13. Review of Bicipital Groove Morphology and Its Analysis in North Indian Population

    PubMed Central

    Rajani, Singh; Man, Singh

    2013-01-01

    The variant morphometry of bicipital groove is reported to be associated with pathologies of biceps tendon and is useful in surgical procedures in this region. The pathologies of biceps tendon are frequent causes of shoulder pain. Therefore, under the condition of paucity of data pertaining to north Indians, not only morphometric analysis of bicipital groove and a new definition of narrow/shallow groove to provide logical explanation for dependence of pathologies of biceps tendon on groove morphology is done but also a review of the literature has been carried out. Various dimensions such as lengths of medial and lateral walls, width, depth, medial wall, and opening angles including incidence of supratubercular ridge of bicipital groove from 101 humerii are 23 ± 5, 32 ± 5, 8 ± 2, 6 ± 1, 48.91 ± 10.31, 82.20 ± 22.62, and 37%, respectively. The average height along with average width of biceps tendon and average width along with average depth of bicipital groove from two cadavers are 1.8, 10.5, 11.3, and 5.5 mm, respectively. The knowledge of bicipital groove will be of paramount importance to anatomists for new data, for orthopaedic surgeons in carrying out surgical procedures in this region, and for physicians in the management of anterior shoulder pain in north Indian population. PMID:25938095

  14. An experimental study of flow separation over a flat plate with 2D transverse grooves

    NASA Astrophysics Data System (ADS)

    Jones, Emily Michelle

    Nature has long been an inspiration for research in engineering. In particular, the biological surfaces of aquatic swimmers have been studied for their potential as drag reducing surfaces. The hydrodynamic benefit of riblets, or grooves embedded parallel to the flow, which appear on many aquatic biological surfaces, have been well documented and implemented in practical engineering applications. However the skin of dolphins is embedded with grooves that run perpendicular to the flow of water over their bodies. It is theorized that the transverse grooves present on dolphin skin trap vortices between them, creating a partial slip condition over the surface and inducing turbulence augmentation in the boundary layer, thus controlling boundary layer separation over the dolphin's skin. Similarly, sharks are covered with scales that are flexible at the base and capable of bristling, forming grooves running transverse to the flow. It is theorized that the scales bristle when encountering a reversing flow, thereby trapping vortices between the scales and, similarly, delaying boundary layer separation. In an attempt to test this hypothesis and study these affects, a spinning cylinder was used in a water tunnel to induce separation over a flat plate with 2 mm, rectangular transverse grooves and sinusoidal grooves of similar scaling. The results were compared to tripped, turbulent boundary layer separation occurring over a flat plate without grooves using time-resolved particle image velocimetry. The strength of the adverse pressure gradient was varied, and the observed delay in flow separation and other affects upon the boundary layer are discussed.

  15. Linear stability of pressure-driven flow over longitudinal superhydrophobic grooves

    NASA Astrophysics Data System (ADS)

    Yu, K. H.; Teo, C. J.; Khoo, B. C.

    2016-02-01

    The modal analysis of pressure-driven flows in channels patterned with superhydrophobic surfaces containing periodic grooves and ribs aligned longitudinally to the flow direction has been performed. The effects of shear-free fraction (" separators=" δ ) and groove-rib spatial period normalized by full-channel height (" separators=" L ) on the linear flow stability of such flows have been explored. By performing a BiGlobal linear stability analysis via the pseudo-spectral method, such surfaces have been found to potentially exert a stabilizing or destabilizing effect on the base flow, depending predominantly on the normalized groove-rib spacing. For small values of L (i.e., L = 0.01 and 0.02), a stabilizing effect is predicted for flows over longitudinal superhydrophobic grooves, in agreement with the results obtained using a local stability analysis which employs a homogeneous slip condition along the walls. For a moderate value of normalized groove-rib spacing where the groove-rib periodic spacing is one-tenth of the channel height, the presence of longitudinal superhydrophobic grooves leads to flow instabilities at a lower critical Reynolds number. The redistribution of the base flow resulting from the vanishing shear rates along the liquid-gas interface could give rise to an inflectional instability that promotes temporal instability. The effects of patterning the superhydrophobic surfaces on one or both channel walls are also examined.

  16. Directing reaction pathways by catalyst active-site selection using self-assembled monolayers.

    PubMed

    Pang, Simon H; Schoenbaum, Carolyn A; Schwartz, Daniel K; Medlin, J Will

    2013-01-01

    One key route for controlling reaction selectivity in heterogeneous catalysis is to prepare catalysts that exhibit only specific types of sites required for desired product formation. Here we show that alkanethiolate self-assembled monolayers with varying surface densities can be used to tune selectivity to desired hydrogenation and hydrodeoxygenation products during the reaction of furfural on supported palladium catalysts. Vibrational spectroscopic studies demonstrate that the selectivity improvement is achieved by controlling the availability of specific sites for the hydrogenation of furfural on supported palladium catalysts through the selection of an appropriate alkanethiolate. Increasing self-assembled monolayer density by controlling the steric bulk of the organic tail ligand restricts adsorption on terrace sites and dramatically increases selectivity to desired products furfuryl alcohol and methylfuran. This technique of active-site selection simultaneously serves both to enhance selectivity and provide insight into the reaction mechanism. PMID:24025780

  17. Lessons learned from DOE site culture change activities: Implications for waste management organizations

    SciTech Connect

    Kurstedt, H.A. Jr.; Howard, E.M.; Doss, A.R.; Mallak, L.A.

    1991-01-01

    Management Systems Laboratories (MSL) has worked with the US Department of Energy (DOE) and several of its contractors as they understand and assess the DOE culture change and change the contractor culture to serve DOE's needs. Primarily, these contractors have been those whose responsibilities include starting up and operating weapons materials facilities. The number and scope of these activities have escalated and expanded to contractors at DOE sites such as Westinghouse at the Savannah River Site (SRS) in Aiken, South Carolina, EG G at the Rocky Flats Plant (RFP) in Golden, Colorado, and Westinghouse at the Feed Materials Processing Center (FMPC) in Fernald, Ohio. The point of this paper is not to compare or contrast the relative merit of one site over another. It is to show the lessons, good and bad, and use and communicate those lessons, especially those lessons transferable to other sites in similar situations. 8 refs., 1 fig.

  18. A three-dimensional model of mammalian tyrosinase active site accounting for loss of function mutations.

    PubMed

    Schweikardt, Thorsten; Olivares, Concepción; Solano, Francisco; Jaenicke, Elmar; García-Borrón, José Carlos; Decker, Heinz

    2007-10-01

    Tyrosinases are the first and rate-limiting enzymes in the synthesis of melanin pigments responsible for colouring hair, skin and eyes. Mutation of tyrosinases often decreases melanin production resulting in albinism, but the effects are not always understood at the molecular level. Homology modelling of mouse tyrosinase based on recently published crystal structures of non-mammalian tyrosinases provides an active site model accounting for loss-of-function mutations. According to the model, the copper-binding histidines are located in a helix bundle comprising four densely packed helices. A loop containing residues M374, S375 and V377 connects the CuA and CuB centres, with the peptide oxygens of M374 and V377 serving as hydrogen acceptors for the NH-groups of the imidazole rings of the copper-binding His367 and His180. Therefore, this loop is essential for the stability of the active site architecture. A double substitution (374)MS(375) --> (374)GG(375) or a single M374G mutation lead to a local perturbation of the protein matrix at the active site affecting the orientation of the H367 side chain, that may be unable to bind CuB reliably, resulting in loss of activity. The model also accounts for loss of function in two naturally occurring albino mutations, S380P and V393F. The hydroxyl group in S380 contributes to the correct orientation of M374, and the substitution of V393 for a bulkier phenylalanine sterically impedes correct side chain packing at the active site. Therefore, our model explains the mechanistic necessity for conservation of not only active site histidines but also adjacent amino acids in tyrosinase. PMID:17850513

  19. Recent Experience Using Active Love Wave Techniques to Characterize Seismographic Station Sites

    NASA Astrophysics Data System (ADS)

    Martin, A. J.; Yong, A.; Salomone, L.

    2014-12-01

    Active-source Love waves recorded by the multi-channel analysis of surface wave (MASLW) technique were recently analyzed in two site characterization projects. Between 2010 and 2011, the 2009 American Recovery and Reinvestment Act (ARRA) funded GEOVision to conduct geophysical investigations at 189 seismographic stations—185 in California and 4 in the Central Eastern U.S. (CEUS). The original project plan was to utilize active and passive Rayleigh wave-based techniques to obtain shear-wave velocity (VS) profiles to a minimum depth of 30 m and the time-averaged VS of the upper 30 meters (VS30). Early in the investigation it became evident that Rayleigh wave techniques, such as multi-channel analysis of surface waves (MASRW), were not effective at characterizing all sites. Shear-wave seismic refraction and MASLW techniques were therefore applied. The MASLW technique was deployed at a total of 38 sites, in addition to other methods, and used as the primary technique to characterize 22 sites, 5 of which were also characterized using Rayleigh wave techniques. In 2012, the Electric Power Research Institute funded characterization of 33 CEUS station sites. Based on experience from the ARRA investigation, both MASRW and MASLW data were acquired by GEOVision at 24 CEUS sites—the remaining 9 sites and 2 overlapping sites were characterized by University of Texas, Austin. Of the 24 sites characterized by GEOVision, 16 were characterized using MASLW data, 4 using both MASLW and MASRW data and 4 using MASRW data. Love wave techniques were often found to perform better, or at least yield phase velocity data that could be more readily modeled using the fundamental mode assumption, at shallow rock sites, sites with steep velocity gradients, and, sites with a thin, low velocity, surficial soil layer overlying stiffer sediments. These types of velocity structure often excite dominant higher modes in Rayleigh wave data, but not in Love wave data. At such sites, it may be possible

  20. Thiolactomycin inhibits D-aspartate oxidase: a novel approach to probing the active site environment.

    PubMed

    Katane, Masumi; Saitoh, Yasuaki; Hanai, Toshihiko; Sekine, Masae; Furuchi, Takemitsu; Koyama, Nobuhiro; Nakagome, Izumi; Tomoda, Hiroshi; Hirono, Shuichi; Homma, Hiroshi

    2010-10-01

    D-Aspartate oxidase (DDO) and D-amino acid oxidase (DAO) are flavin adenine dinucleotide (FAD)-containing flavoproteins that catalyze the oxidative deamination of D-amino acids. While several functionally and structurally important amino acid residues have been identified in the DAO protein, little is known about the structure-function relationships of DDO. In the search for a potent DDO inhibitor as a novel tool for investigating its structure-function relationships, a large number of biologically active compounds of microbial origin were screened for their ability to inhibit the enzymatic activity of mouse DDO. We discovered several compounds that inhibited the activity of mouse DDO, and one of the compounds identified, thiolactomycin (TLM), was then characterized and evaluated as a novel DDO inhibitor. TLM reversibly inhibited the activity of mouse DDO with a mixed type of inhibition more efficiently than meso-tartrate and malonate, known competitive inhibitors of mammalian DDOs. The selectivity of TLM was investigated using various DDOs and DAOs, and it was found that TLM inhibits not only DDO, but also DAO. Further experiments with apoenzymes of DDO and DAO revealed that TLM is most likely to inhibit the activities of DDO and DAO by competition with both the substrate and the coenzyme, FAD. Structural models of mouse DDO/TLM complexes supported this finding. The binding mode of TLM to DDO was validated further by site-directed mutagenesis of an active site residue, Arg-237. Collectively, our findings show that TLM is a novel, active site-directed DDO inhibitor that will be useful for elucidating the molecular details of the active site environment of DDO. PMID:20603179

  1. Evidence for a hydroxide ion bridging two magnesium ions at the active site of the hammerhead ribozyme.

    PubMed Central

    Hermann, T; Auffinger, P; Scott, W G; Westhof, E

    1997-01-01

    In the presence of magnesium ions, cleavage by the hammerhead ribozyme RNA at a specific residue leads to 2'3'-cyclic phosphate and 5'-OH extremities. In the cleavage reaction an activated ribose 2'-hydroxyl group attacks its attached 3'-phosphate. Molecular dynamics simulations of the crystal structure of the hammerhead ribozyme, obtained after flash-freezing of crystals under conditions where the ribozyme is active, provide evidence that a mu-bridging OH-ion is located between two Mg2+ions close to the cleavable phosphate. Constrained simulations show further that a flip from the C3'- endo to the C2'- endo conformation of the ribose at the cleavable phosphate brings the 2'-hydroxyl in proximity to both the attacked phosphorous atom and the mu-bridging OH-ion. Thus, the simulations lead to a detailed new insight into the mechanism of hammerhead ribozyme cleavage where a mu-hydroxo bridged magnesium cluster, located on the deep groove side, provides an OH-ion that is able to activate the 2'-hydroxyl nucleophile after a minor and localized conformational change in the RNA. PMID:9254698

  2. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes

  3. A Novel Blasted and Grooved Low Profile Pedicle Screw Able to Resist High Compression Bending Loads

    PubMed Central

    Kim, Young-Sung; Choi, Hong-June; Kim, Kyung-Hyun; Park, Jeong-Yoon; Jeong, Hyun-Yong; Chin, Dong-Kyu; Kim, Keun-Su; Yoon, Young-Sul; Lee, Yoon-Chul; Cho, Yong-Eun

    2012-01-01

    Objective Polyaxial pedicle screws are a safe, useful adjunct to transpedicular fixation. However, the large screw head size can cause soft tissue irritation, high rod positioning, and facet joint injury. However, the mechanical resistance provided by small and low profile pedicle screws is very limited. We therefore developed a novel, low profile pedicle screw using grooving and blasting treatment that is able to resist a high compression bending load. Methods We evaluated the compression bending force to displacement and yield loads for seven different screw head types that differed with regard to their groove intervals and whether or not they had been blasted. Results The rank order of screw types that had the greatest compression bending force to displacement was as follows: (1) universal polyaxial, (2) low polyaxial with 0.1mm grooves and blasting, (3) low polyaxial with blasting, (4) low polyaxial with 0.15mm grooves and blasting, (5) low polyaxial with 0.05mm grooves and blasting, (6) low polyaxial with 0.05mm grooves, (7) and low polyaxial. Low polyaxial screws with 0.1mm grooves and blasting had the maximum yield load and highest compression bending force to displacement of all seven polyaxial screw head systems evaluated. Conclusion Blasting and grooving treatment of pedicle screw heads resulted in screw heads with a high yield load and compression bending force relative to displacement because of increased friction. Low polyaxial pedicle screws with 0.1 mm grooves treated by blasting have mechanical characteristics similar to those of universal polyaxial pedicle screws. PMID:25983790

  4. Archaeological Activity Report: Post-Review Discoveries Within 45BN431 at Solid Waste Site 128-F-2

    SciTech Connect

    T. E. Marceau; J. J. Sharpe

    2006-12-21

    During monitoring of remedial activities at Solid Waste Site 128-F-2 on August 19, 2005, a concentration of mussel shell was discovered in the west wall of a trench in the northen section of the waste site.

  5. A Unique Chitinase with Dual Active Sites and Triple Substrate Binding Sites from the Hyperthermophilic Archaeon Pyrococcus kodakaraensis KOD1

    PubMed Central

    Tanaka, Takeshi; Fujiwara, Shinsuke; Nishikori, Shingo; Fukui, Toshiaki; Takagi, Masahiro; Imanaka, Tadayuki

    1999-01-01

    We have found that the hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1 produces an extracellular chitinase. The gene encoding the chitinase (chiA) was cloned and sequenced. The chiA gene was found to be composed of 3,645 nucleotides, encoding a protein (1,215 amino acids) with a molecular mass of 134,259 Da, which is the largest among known chitinases. Sequence analysis indicates that ChiA is divided into two distinct regions with respective active sites. The N-terminal and C-terminal regions show sequence similarity with chitinase A1 from Bacillus circulans WL-12 and chitinase from Streptomyces erythraeus (ATCC 11635), respectively. Furthermore, ChiA possesses unique chitin binding domains (CBDs) (CBD1, CBD2, and CBD3) which show sequence similarity with cellulose binding domains of various cellulases. CBD1 was classified into the group of family V type cellulose binding domains. In contrast, CBD2 and CBD3 were classified into that of the family II type. chiA was expressed in Escherichia coli cells, and the recombinant protein was purified to homogeneity. The optimal temperature and pH for chitinase activity were found to be 85°C and 5.0, respectively. Results of thin-layer chromatography analysis and activity measurements with fluorescent substrates suggest that the enzyme is an endo-type enzyme which produces a chitobiose as a major end product. Various deletion mutants were constructed, and analyses of their enzyme characteristics revealed that both the N-terminal and C-terminal halves are independently functional as chitinases and that CBDs play an important role in insoluble chitin binding and hydrolysis. Deletion mutants which contain the C-terminal half showed higher thermostability than did N-terminal-half mutants and wild-type ChiA. PMID:10583986

  6. Active sites residues of beef liver carnitine octanoyltransferase (COT) and carnitine palmitoyltransferase (CPT-II).

    PubMed Central

    Nic a'Bháird, N; Yankovskaya, V; Ramsay, R R

    1998-01-01

    The carnitine acyltransferases which catalyse the reversible transfer of fatty acyl groups between carnitine and coenzyme A have been proposed to contain a catalytic histidine. Here, the chemical reactivity of active site groups has been used to demonstrate differences between the active sites of beef liver carnitine octanoyltransferase (COT) and carnitine palmitoyltransferase-II (CPT-II). Treatment of CPT-II with the histidine-selective reagent, diethyl pyrocarbonate (DEPC), resulted in simple linear pseudo-first-order kinetics. The reversal of the inhibition by hydroxylamine and the pKa (7.1) of the modified residue indicated that the residue was a histidine. The order of the inactivation kinetics showed that 1mol of histidine was modified per mol of CPT-II.When COT was treated with DEPC the kinetics of inhibition were biphasic with an initial rapid loss of activity followed by a slower loss of activity. The residue reacting in the faster phase of inhibition was not a histidine but possibly a serine. The modification of this residue did not lead to complete loss of activity suggesting that a direct role in catalysis is unlikely. It was deduced that the residue modified by DEPC in the slower phase was a lysine and indeed fluorodinitrobenzene (FDNB) inactivated COT with linear pseudo-first-order kinetics. The COT peptide containing the FDNB-labelled lysine was isolated and sequenced. Alignment of this sequence placed it 10 amino acids downstream of the putative active-site histidine. PMID:9480926

  7. Identification of active sites in gold-catalyzed hydrogenation of acrolein.

    PubMed

    Mohr, Christian; Hofmeister, Herbert; Radnik, Jörg; Claus, Peter

    2003-02-19

    The active sites of supported gold catalysts, favoring the adsorption of C=O groups of acrolein and subsequent reaction to allyl alcohol, have been identified as edges of gold nanoparticles. After our recent finding that this reaction preferentially occurs on single crystalline particles rather than multiply twinned ones, this paper reports on a new approach to distinguish different features of the gold particle morphology. Elucidation of the active site issue cannot be simply done by varying the size of gold particles, since the effects of faceting and multiply twinned particles may interfere. Therefore, modification of the gold particle surface by indium has been used to vary the active site characteristics of a suitable catalyst, and a selective decoration of gold particle faces has been observed, leaving edges free. This is in contradiction to theoretical predictions, suggesting a preferred occupation of the low-coordinated edges of the gold particles. On the bimetallic catalyst, the desired allyl alcohol is the main product (selectivity 63%; temperature 593 K, total pressure p(total) = 2 MPa). From the experimentally proven correlation between surface structure and catalytic behavior, the edges of single crystalline gold particles have been identified as active sites for the preferred C=O hydrogenation. PMID:12580618

  8. Strategies and Activities for Using Local Communities as Environmental Education Sites.

    ERIC Educational Resources Information Center

    Roth, Charles E.; Lockwood, Linda G.

    Presented are over 100 environmental education activities which use the local community for a learning site and resource. These lessons are grouped under seven topical headings: (1) biological neighbors, (2) physical environs, (3) built environs, (4) social environs, (5) understanding ourselves, (6) influencing change, and (7) improvement and…

  9. 77 FR 5830 - Commercial Wind Leasing and Site Assessment Activities on the Atlantic Outer Continental Shelf...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-06

    ... FR 30,616) of the EA for Issuance of Leases for Wind Resource Data Collection on the Outer... (NOA) in the Federal Register (72 FR 62,672) of the Programmatic EIS for Alternative Energy Development... Bureau of Ocean Energy Management Commercial Wind Leasing and Site Assessment Activities on the...

  10. 40 CFR 35.6260 - Combining Cooperative Agreement sites and activities.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Combining Cooperative Agreement sites and activities. 35.6260 Section 35.6260 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Contracts for Superfund Response Actions Combining Cooperative Agreements § 35.6260 Combining...

  11. Organized Agents: Canadian Teacher Unions as Alternative Sites for Social Justice Activism

    ERIC Educational Resources Information Center

    Rottmann, Cindy

    2008-01-01

    Historically teachers' federations have been some of the major organizational sites for social justice leadership in K-12 public education. Despite this history of activism, social justice teacher unionism remains a relatively underdeveloped concept. This article merges four philosophical conceptions of social justice in education: liberal…

  12. Active site electrostatics protect genome integrity by blocking abortive hydrolysis during DNA recombination

    PubMed Central

    Ma, Chien-Hui; Rowley, Paul A; Macieszak, Anna; Guga, Piotr; Jayaram, Makkuni

    2009-01-01

    Water, acting as a rogue nucleophile, can disrupt transesterification steps of important phosphoryl transfer reactions in DNA and RNA. We have unveiled this risk, and identified safeguards instituted against it, during strand cleavage and joining by the tyrosine site-specific recombinase Flp. Strand joining is threatened by a latent Flp endonuclease activity (type I) towards the 3′-phosphotyrosyl intermediate resulting from strand cleavage. This risk is not alleviated by phosphate electrostatics; neutralizing the negative charge on the scissile phosphate through methylphosphonate (MeP) substitution does not stimulate type I endonuclease. Rather, protection derives from the architecture of the recombination synapse and conformational dynamics within it. Strand cleavage is protected against water by active site electrostatics. Replacement of the catalytic Arg-308 of Flp by alanine, along with MeP substitution, elicits a second Flp endonuclease activity (type II) that directly targets the scissile phosphodiester bond in DNA. MeP substitution, combined with appropriate active site mutations, will be useful in revealing anti-hydrolytic mechanisms engendered by systems that mediate DNA relaxation, DNA transposition, site-specific recombination, telomere resolution, RNA splicing and retrohoming of mobile introns. PMID:19440204

  13. 40 CFR 35.6260 - Combining Cooperative Agreement sites and activities.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 1 2014-07-01 2014-07-01 false Combining Cooperative Agreement sites and activities. 35.6260 Section 35.6260 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Cooperative Agreements and Superfund State Contracts for Superfund Response...

  14. 40 CFR 35.6260 - Combining Cooperative Agreement sites and activities.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Combining Cooperative Agreement sites and activities. 35.6260 Section 35.6260 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Cooperative Agreements and Superfund State Contracts for Superfund Response...

  15. 40 CFR 35.6260 - Combining Cooperative Agreement sites and activities.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 1 2013-07-01 2013-07-01 false Combining Cooperative Agreement sites and activities. 35.6260 Section 35.6260 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Cooperative Agreements and Superfund State Contracts for Superfund Response...

  16. 40 CFR 35.6260 - Combining Cooperative Agreement sites and activities.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 1 2012-07-01 2012-07-01 false Combining Cooperative Agreement sites and activities. 35.6260 Section 35.6260 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Cooperative Agreements and Superfund State Contracts for Superfund Response...

  17. The Thumbs Up Ecology Curriculum: A Fun Group of School Site Activities for Sixth Graders.

    ERIC Educational Resources Information Center

    Smith, John; And Others

    This guide is a collection of "fun" school site activities for sixth graders. Some of the topics covered are: animals, trees, energy and lifestyle, land use and you, energy conservation, and car-pooling. Each section offers both introductory information about the topic as well as questions to ponder such as what, so what, now what, and another way…

  18. IN VIVO ACTIVITY OF RHOPALOSIPHUM PADI VIRUS INTERNAL RIBOSOME ENTRY SITES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The RNA genome of Rhopalosiphum padi virus (RhPV), like other members of the Dicistroviridae, contains two open reading frames that are preceded by internal ribosome entry sites (IRESs). To compare the activities of the two RhPV IRESs in insect cells, a system was established for the in vivo transc...

  19. Cyclic silicate active site and stereochemical match for apatite nucleation on pseudowollastonite bioceramic-bone interfaces.

    PubMed

    Sahai, Nita; Anseau, Michel

    2005-10-01

    Hydroxyapatite (Ca5(PO4)3(OH)) forms on pseudowollastonite (psW) (alpha-CaSiO3) in vitro in simulated body fluid, human parotid saliva and cell-culture medium, and in vivo in implanted rat tibias. We used crystallographic constraints with ab initio molecular orbital calculations to identify the active site and reaction mechanism for heterogeneous nucleation of the earliest calcium phosphate oligomer/phase. The active site is the planar, cyclic, silicate trimer (Si3O9) on the (001) face of psW. The trimer has three silanol groups (>SiOH) arranged at 60 degrees from each other, providing a stereochemical match for O atoms bonded to Ca2+ on the (001) face of hydroxyapatite. Calcium phosphate nucleation is modeled in steps as hydrolysis of surface Ca-O bonds with leaching of Ca2+ into solution, protonation of the surface Si-O groups to form silanols, calcium sorption as an inner-sphere surface complex and, attachment of HPO4(2-). Our model explains the experimental solution and high resolution transmission electron microscopy data for epitaxial hydroxyapatite growth on psW in vitro and in vivo. We propose that the cyclic silicate trimer is the universal active site for heterogeneous, stereochemically promoted nucleation on silicate-based bioactive ceramics. A critical active site-density and a point of zero charge of the bioceramic less than physiological pH are required for bioactivity. PMID:15949543

  20. Bithionol Potently Inhibits Human Soluble Adenylyl Cyclase through Binding to the Allosteric Activator Site.

    PubMed

    Kleinboelting, Silke; Ramos-Espiritu, Lavoisier; Buck, Hannes; Colis, Laureen; van den Heuvel, Joop; Glickman, J Fraser; Levin, Lonny R; Buck, Jochen; Steegborn, Clemens

    2016-04-29

    The signaling molecule cAMP regulates functions ranging from bacterial transcription to mammalian memory. In mammals, cAMP is synthesized by nine transmembrane adenylyl cyclases (ACs) and one soluble AC (sAC). Despite similarities in their catalytic domains, these ACs differ in regulation. Transmembrane ACs respond to G proteins, whereas sAC is uniquely activated by bicarbonate. Via bicarbonate regulation, sAC acts as a physiological sensor for pH/bicarbonate/CO2, and it has been implicated as a therapeutic target, e.g. for diabetes, glaucoma, and a male contraceptive. Here we identify the bisphenols bithionol and hexachlorophene as potent, sAC-specific inhibitors. Inhibition appears mostly non-competitive with the substrate ATP, indicating that they act via an allosteric site. To analyze the interaction details, we solved a crystal structure of an sAC·bithionol complex. The structure reveals that the compounds are selective for sAC because they bind to the sAC-specific, allosteric binding site for the physiological activator bicarbonate. Structural comparison of the bithionol complex with apo-sAC and other sAC·ligand complexes along with mutagenesis experiments reveals an allosteric mechanism of inhibition; the compound induces rearrangements of substrate binding residues and of Arg(176), a trigger between the active site and allosteric site. Our results thus provide 1) novel insights into the communication between allosteric regulatory and active sites, 2) a novel mechanism for sAC inhibition, and 3) pharmacological compounds targeting this allosteric site and utilizing this mode of inhibition. These studies provide support for the future development of sAC-modulating drugs. PMID:26961873

  1. Numerical Modeling of Extensional Necking Instabilities: Application to Ganymede's Grooved Terrain

    NASA Technical Reports Server (NTRS)

    Bland, M. T.; Showman, A. P.

    2005-01-01

    Ganymede s pervasive 5-10 km-wavelength grooves have been suggested to result from a necking instability during an epoch of lithospheric extension, but to date few quantitative studies of groove formation have been performed. We present two-dimensional numerical models of necking instabilities under conditions that are appropriate to Ganymede at the time of groove formation. Preliminary simulations indicate that extensional necking instabilities can occur under a range of conditions, many of which may be relevant to Ganymede. The form of the surface topography produced by these instabilities varies as a function of the strain rate, amount of extension, initial topographic perturbation, and rheological parameters.

  2. Longitudinal afterbody grooves and shoulder radiusing for low-speed bluff body drag reduction

    NASA Technical Reports Server (NTRS)

    Howard, F. G.; Quass, B. F.; Weinstein, L. M.; Bushnell, D. M.

    1981-01-01

    A new low-speed drag reduction approach is proposed which employs longitudinal surface V-shaped grooves cutting through the afterbody shoulder region. The test Reynolds number range was from 20,000 to 200,000 based on undisturbed free-stream flow and a body diameter of 6.08 cm. The V-grooves are shown to be most effective in reducing drag when the afterbody shoulder radius is zero. Reductions in drag of up to 33% have been measured for this condition. For large shoulder radius, the grooves are only effective at the lower Reynolds numbers of the test.

  3. Elastohydrodynamic film thickness measurements of artificially produced surface dents and grooves. [using optical interferometry

    NASA Technical Reports Server (NTRS)

    Wedeven, L. D.; Cusano, C.

    1978-01-01

    Elastohydrodynamic (EHD) film thickness measurements using optical interferometry were made of artificially produced dents and grooves under rolling and sliding conditions. These measurements are compared to stylus traces of the dent and groove profiles to determine the local deformation associated with micro-EHD pressure generation. The surface geometry associated with the dents and grooves became intimately involved in the lubrication process itself, creating local pressure variations that substantially deformed the local surface geometry, particularly under sliding conditions. The rolling results implied surface initiated fatigue, and the sliding results showed clearly the EHD surface interactions that must occur prior to scuffing failure.

  4. Elastohydrodynamic film thickness measurements of artificially produced surface dents and grooves. [on fatigue failure of bearings

    NASA Technical Reports Server (NTRS)

    Wedeven, L. D.; Cusano, C.

    1978-01-01

    Elastohydrodynamic (EHD) film thickness measurements using optical interferometry have been made of artificially produced dents and grooves under rolling and sliding conditions. These measurements are compared to stylus traces of the dent and groove profiles to determine the local deformation associated with micro-EHD pressure generation. The surface geometry associated with the dents and grooves is seen to become intimately involved in the lubrication process itself, creating local pressure variations that substantially deform the local surface geometry, particularly under sliding conditions. The rolling results have implications concerning surface initiated fatigue and the sliding results show clearly the EHD surface interactions that must occur prior to scuffing failure.

  5. Expansion of access tunnels and active-site cavities influence activity of haloalkane dehalogenases in organic cosolvents.

    PubMed

    Stepankova, Veronika; Khabiri, Morteza; Brezovsky, Jan; Pavelka, Antonin; Sykora, Jan; Amaro, Mariana; Minofar, Babak; Prokop, Zbynek; Hof, Martin; Ettrich, Rudiger; Chaloupkova, Radka; Damborsky, Jiri

    2013-05-10

    The use of enzymes for biocatalysis can be significantly enhanced by using organic cosolvents in the reaction mixtures. Selection of the cosolvent type and concentration range for an enzymatic reaction is challenging and requires extensive empirical testing. An understanding of protein-solvent interaction could provide a theoretical framework for rationalising the selection process. Here, the behaviour of three model enzymes (haloalkane dehalogenases) was investigated in the presence of three representative organic cosolvents (acetone, formamide, and isopropanol). Steady-state kinetics assays, molecular dynamics simulations, and time-resolved fluorescence spectroscopy were used to elucidate the molecular mechanisms of enzyme-solvent interactions. Cosolvent molecules entered the enzymes' access tunnels and active sites, enlarged their volumes with no change in overall protein structure, but surprisingly did not act as competitive inhibitors. At low concentrations, the cosolvents either enhanced catalysis by lowering K(0.5) and increasing k(cat), or caused enzyme inactivation by promoting substrate inhibition and decreasing k(cat). The induced activation and inhibition of the enzymes correlated with expansion of the active-site pockets and their occupancy by cosolvent molecules. The study demonstrates that quantitative analysis of the proportions of the access tunnels and active-sites occupied by organic solvent molecules provides the valuable information for rational selection of appropriate protein-solvent pair and effective cosolvent concentration. PMID:23564727

  6. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  7. Threshold occupancy and specific cation binding modes in the hammerhead ribozyme active site are required for active conformation

    PubMed Central

    Lee, Tai-Sung; Giambaşu, George M.; Sosa, Carlos P.; Martick, Monika; Scott, William G.; York, Darrin M.

    2009-01-01

    The relationship between formation of active in-line attack conformations and monovalent (Na+) and divalent (Mg2+) metal ion binding in the hammerhead ribozyme has been explored with molecular dynamics simulations. To stabilize repulsions between negatively charged groups, different requirements of threshold occupancy of metal ions were observed in the reactant and activated precursor states both in the presence or absence of a Mg2+ in the active site. Specific bridging coordination patterns of the ions are correlated with the formation of active in-line attack conformations and can be accommodated in both cases. Furthermore, simulation results suggest that the hammerhead ribozyme folds to form an electronegative recruiting pocket that attracts high local concentrations of positive charge. The present simulations help to reconcile experiments that probe the metal ion sensitivity of hammerhead ribozyme catalysis and support the supposition that Mg2+, in addition to stabilizing active conformations, plays a specific chemical role in catalysis. PMID:19265710

  8. Functional copper at the acetyl-CoA synthase active site

    PubMed Central

    Seravalli, Javier; Gu, Weiwei; Tam, Annie; Strauss, Erick; Begley, Tadhg P.; Cramer, Stephen P.; Ragsdale, Stephen W.

    2003-01-01

    The bifunctional CO dehydrogenase/acetyl-CoA synthase (CODH/ACS) plays a central role in the Wood–Ljungdahl pathway of autotrophic CO2 fixation. A recent structure of the Moorella thermoacetica enzyme revealed that the ACS active site contains a [4Fe-4S] cluster bridged to a binuclear Cu-Ni site. Here, biochemical and x-ray absorption spectroscopic (XAS) evidence is presented that the copper ion at the M. thermoacetica ACS active site is essential. Depletion of copper correlates with reduction in ACS activity and in intensity of the “NiFeC” EPR signal without affecting either the activity or the EPR spectroscopic properties associated with CODH. In contrast, Zn content is negatively correlated with ACS activity without any apparent relationship to CODH activity. Cu is also found in the methanogenic CODH/ACS from Methanosarcina thermophila. XAS studies are consistent with a distorted Cu(I)–S3 site in the fully active enzyme in solution. Cu extended x-ray absorption fine structure analysis indicates an average Cu–S bond length of 2.25 Å and a metal neighbor at 2.65 Å, consistent with the Cu–Ni distance observed in the crystal structure. XAS experiments in the presence of seleno-CoA reveal a Cu–S3Se environment with a 2.4-Å Se–Cu bond, strongly implicating a Cu–SCoA intermediate in the mechanism of acetyl-CoA synthesis. These results indicate an essential and functional role for copper in the CODH/ACS from acetogenic and methanogenic organisms. PMID:12589021

  9. Probing the Role of Active Site Water in the Sesquiterpene Cyclization Reaction Catalyzed by Aristolochene Synthase.

    PubMed

    Chen, Mengbin; Chou, Wayne K W; Al-Lami, Naeemah; Faraldos, Juan A; Allemann, Rudolf K; Cane, David E; Christianson, David W

    2016-05-24

    Aristolochene synthase (ATAS) is a high-fidelity terpenoid cyclase that converts farnesyl diphosphate exclusively into the bicyclic hydrocarbon aristolochene. Previously determined crystal structures of ATAS complexes revealed trapped active site water molecules that could potentially interact with catalytic intermediates: water "w" hydrogen bonds with S303 and N299, water molecules "w1" and "w2" hydrogen bond with Q151, and a fourth water molecule coordinates to the Mg(2+)C ion. There is no obvious role for water in the ATAS mechanism because the enzyme exclusively generates a hydrocarbon product. Thus, these water molecules are tightly controlled so that they cannot react with carbocation intermediates. Steady-state kinetics and product distribution analyses of eight ATAS mutants designed to perturb interactions with active site water molecules (S303A, S303H, S303D, N299A, N299L, N299A/S303A, Q151H, and Q151E) indicate relatively modest effects on catalysis but significant effects on sesquiterpene product distributions. X-ray crystal structures of S303A, N299A, N299A/S303A, and Q151H mutants reveal minimal perturbation of active site solvent structure. Seven of the eight mutants generate farnesol and nerolidol, possibly resulting from addition of the Mg(2+)C-bound water molecule to the initially formed farnesyl cation, but no products are generated that would suggest enhanced reactivity of other active site water molecules. However, intermediate germacrene A tends to accumulate in these mutants. Thus, apart from the possible reactivity of Mg(2+)C-bound water, active site water molecules in ATAS are not directly involved in the chemistry of catalysis but instead contribute to the template that governs the conformation of the flexible substrate and carbocation intermediates. PMID:27172425

  10. Spectroscopic Studies of Single and Double Variants of M Ferritin: Lack of Conversion of a Biferrous Substrate Site into a Cofactor Site for O2 Activation

    PubMed Central

    2015-01-01

    Ferritin has a binuclear non-heme iron active site that functions to oxidize iron as a substrate for formation of an iron mineral core. Other enzymes of this class have tightly bound diiron cofactor sites that activate O2 to react with substrate. Ferritin has an active site ligand set with 1-His/4-carboxylate/1-Gln rather than the 2-His/4-carboxylate set of the cofactor site. This ligand variation has been thought to make a major contribution to this biferrous substrate rather than cofactor site reactivity. However, the Q137E/D140H double variant of M ferritin, has a ligand set that is equivalent to most of the diiron cofactor sites, yet did not rapidly react with O2 or generate the peroxy intermediate observed in the cofactor sites. Therefore, in this study, a combined spectroscopic methodology of circular dichroism (CD)/magnetic CD (MCD)/variable temperature, variable field (VTVH) MCD has been applied to evaluate the factors required for the rapid O2 activation observed in cofactor sites. This methodology defines the coordination environment of each iron and the bridging ligation of the biferrous active sites in the double and corresponding single variants of frog M ferritin. Based on spectral changes, the D140H single variant has the new His ligand binding, and the Q137E variant has the new carboxylate forming a μ-1,3 bridge. The spectra for the Q137E/D140H double variant, which has the cofactor ligand set, however, reflects a site that is more coordinately saturated than the cofactor sites in other enzymes including ribonucleotide reductase, indicating the presence of additional water ligation. Correlation of this double variant and the cofactor sites to their O2 reactivities indicates that electrostatic and steric changes in the active site and, in particular, the hydrophobic nature of a cofactor site associated with its second sphere protein environment, make important contributions to the activation of O2 by the binuclear non-heme iron enzymes. PMID

  11. Conformational dynamics of the active site loop of S-adenosylmethionine synthetase illuminated by site-directed spin labeling.

    PubMed

    Taylor, John C; Markham, George D

    2003-07-15

    S-adenosylmethionine synthetase (ATP: L-methionine S-adenosyltransferase, methionine adenosyltransferase, a.k.a. MAT) is one of numerous enzymes that have a flexible polypeptide loop that moves to gate access to the active site in a motion that is closely coupled to catalysis. Crystallographic studies of this tetrameric enzyme have shown that the loop is closed in the absence of bound substrates. However, the loop must open to allow substrate binding and a variety of data indicate that the loop is closed during the catalytic steps. Previous kinetic studies indicate that during turnover loop motion occurs on a time scale of 10(-2)s, ca. 10-fold faster than chemical transformations and turnover. Site-directed spin labeling has been used to introduce nitroxide groups at two positions in the loop to illuminate how the motion of the loop is affected by substrate binding. The two loop mutants constructed, G105C and D107C, retain wild type levels of MAT activity; attachment of a methanethiosulfonate spin label to convert the cysteine to the "R1" residue reduced the k(cat) only for the labeled D107R1 form (7-fold). The K(m) value for methionine increased 2- to 4-fold for the cysteine mutants and 2- to 7-fold for the labeled proteins, whereas the K(m) for ATP was changed by at most 2-fold. EPR spectra for both labeled proteins are nearly identical and show the presence of two major spin label environments with rotational diffusion rates differing by approximately 10-fold; the slower rate is ca. 4-fold faster than the estimated protein rotational rate. The spectra are not altered by addition of substrates or products. At both positions the less mobile conformation constitutes ca. 65% of the total species, indicating an equilibrium that only slightly favors one form, that in which the label is more immobilized. The equilibrium constant that relates the two forms is comparable to the equilibrium constant of 1.5 for a conformational change that was previously deduced from the

  12. Observation of nanometer-sized crystalline grooves in as-grown β-Ga2O3 single crystals

    NASA Astrophysics Data System (ADS)

    Hanada, Kenji; Moribayashi, Tomoya; Uematsu, Takumi; Masuya, Satoshi; Koshi, Kimiyoshi; Sasaki, Kohei; Kuramata, Akito; Ueda, Osamu; Kasu, Makoto

    2016-03-01

    On the surface of as-grown β-Ga2O3 single crystals that are cut and polished, we found nanometer-sized grooves elongated in the [001] direction. We confirmed that these grooves terminate within the crystals in the [010] direction. This proves that the grooves are different from micropipes penetrating crystals. Their typical length and width are 50-1200 nm in the [001] direction and ˜40 nm in the [100] direction, respectively. The grooves tend to form an array in the [001] direction. The type of nanometer-sized grooves should be essentially different from etch pits.

  13. Roles of s3 site residues of nattokinase on its activity and substrate specificity.

    PubMed

    Wu, Shuming; Feng, Chi; Zhong, Jin; Huan, Liandong

    2007-09-01

    Nattokinase (Subtilisin NAT, NK) is a bacterial serine protease with high fibrinolytic activity. To probe their roles on protease activity and substrate specificity, three residues of S3 site (Gly(100), Ser(101) and Leu(126)) were mutated by site-directed mutagenesis. Kinetics parameters of 20 mutants were measured using tetrapeptides as substrates, and their fibrinolytic activities were determined by fibrin plate method. Results of mutation analysis showed that Gly(100) and Ser(101) had reverse steric and electrostatic effects. Residues with bulky or positively charged side chains at position 100 decreased the substrate binding and catalytic activity drastically, while residues with the same characters at position 101 could obviously enhance protease and fibrinolytic activity of NK. Mutation of Leu(126) might impair the structure of the active cleft and drastically decreased the activity of NK. Kinetics studies of the mutants showed that S3 residues were crucial to keep protease activity while they moderately affected substrate specificity of NK. The present study provided some original insight into the P3-S3 interaction in NK and other subtilisins, as well as showed successful protein engineering cases to improve NK as a potential therapeutic agent. PMID:17673485

  14. Locomotor activity influences muscle architecture and bone growth but not muscle attachment site morphology

    PubMed Central

    Rabey, Karyne N.; Green, David J.; Taylor, Andrea B.; Begun, David R.; Richmond, Brian G.; McFarlin, Shannon C.

    2014-01-01

    The ability to make behavioural inferences from skeletal remains is critical to understanding the lifestyles and activities of past human populations and extinct animals. Muscle attachment site (enthesis) morphology has long been assumed to reflect muscle strength and activity during life, but little experimental evidence exists to directly link activity patterns with muscle development and the morphology of their attachments to the skeleton. We used a mouse model to experimentally test how the level and type of activity influences forelimb muscle architecture of spinodeltoideus, acromiodeltoideus, and superficial pectoralis, bone growth rate and gross morphology of their insertion sites. Over an 11-week period, we collected data on activity levels in one control group and two experimental activity groups (running, climbing) of female wild-type mice. Our results show that both activity type and level increased bone growth rates influenced muscle architecture, including differences in potential muscular excursion (fibre length) and potential force production (physiological cross-sectional area). However, despite significant influences on muscle architecture and bone development, activity had no observable effect on enthesis morphology. These results suggest that the gross morphology of entheses is less reliable than internal bone structure for making inferences about an individual’s past behaviour. PMID:25467113

  15. Minor Groove Binder Distamycin Remodels Chromatin but Inhibits Transcription

    PubMed Central

    Majumder, Parijat; Banerjee, Amrita; Shandilya, Jayasha; Senapati, Parijat; Chatterjee, Snehajyoti; Kundu, Tapas K.; Dasgupta, Dipak

    2013-01-01

    The condensed structure of chromatin limits access of cellular machinery towards template DNA. This in turn represses essential processes like transcription, replication, repair and recombination. The repression is alleviated by a variety of energy dependent processes, collectively known as “chromatin remodeling”. In a eukaryotic cell, a fine balance between condensed and de-condensed states of chromatin helps to maintain an optimum level of gene expression. DNA binding small molecules have the potential to perturb such equilibrium. We present herein the study of an oligopeptide antibiotic distamycin, which binds to the minor groove of B-DNA. Chromatin mobility assays and circular dichroism spectroscopy have been employed to study the effect of distamycin on chromatosomes, isolated from the liver of Sprague-Dawley rats. Our results show that distamycin is capable of remodeling both chromatosomes and reconstituted nucleosomes, and the remodeling takes place in an ATP-independent manner. Binding of distamycin to the linker and nucleosomal DNA culminates in eviction of the linker histone and the formation of a population of off-centered nucleosomes. This hints at a possible corkscrew type motion of the DNA with respect to the histone octamer. Our results indicate that distamycin in spite of remodeling chromatin, inhibits transcription from both DNA and chromatin templates. Therefore, the DNA that is made accessible due to remodeling is either structurally incompetent for transcription, or bound distamycin poses a roadblock for the transcription machinery to advance. PMID:23460895

  16. Lunar and Planetary Science XXXV: Icy Worlds: Moving and Grooving

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Reports from the conference session entitled Icy Worlds: Moving and Grooving, include:Mass Anomalies on Ganymede; Europan Chaos and Lenticulae: A Synthesis of Size, Spacing, and Areal Density Analyses; Thermal and Topographic Tests of Europa Chaos Formation Models; Flexure of Europa s Lithosphere Due to Ridge-Loading; Ridges on Europa: Origin by Incremental Ice-Wedging ; Convergent Boundaries on Europa: a Numerical Approach to Euler Pole Analysis and Its' Implications for Plate Reconstruction; Numerical Simulations of Subsolidus Convection in the Ice Shell of Europa: Implications for the Thermal Evolution and Present State; Effects of Plasticity on Convection in an Ice Shell: Implications for Europa; Non-Newtonian Convection and Compositional Buoyancy: Advances in Modeling Convection and Dome Formation on Europa; Convective Instability in Ice I: Application to Callisto and Ganymede; Crater Size Distributions on Callisto: A Galileo SSI Summary; Neutron Diffraction Studies of Planetary Ices; and H2O2 Synthesis Induced by Irradiation of H2O with Energetic H+ and Ar+ Ions at Various Temperatures.

  17. Sequences flanking the core-binding site modulate glucocorticoid receptor structure and activity.

    PubMed

    Schöne, Stefanie; Jurk, Marcel; Helabad, Mahdi Bagherpoor; Dror, Iris; Lebars, Isabelle; Kieffer, Bruno; Imhof, Petra; Rohs, Remo; Vingron, Martin; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H

    2016-01-01

    The glucocorticoid receptor (GR) binds as a homodimer to genomic response elements, which have particular sequence and shape characteristics. Here we show that the nucleotides directly flanking the core-binding site, differ depending on the strength of GR-dependent activation of nearby genes. Our study indicates that these flanking nucleotides change the three-dimensional structure of the DNA-binding site, the DNA-binding domain of GR and the quaternary structure of the dimeric complex. Functional studies in a defined genomic context show that sequence-induced changes in GR activity cannot be explained by differences in GR occupancy. Rather, mutating the dimerization interface mitigates DNA-induced changes in both activity and structure, arguing for a role of DNA-induced structural changes in modulating GR activity. Together, our study shows that DNA sequence identity of genomic binding sites modulates GR activity downstream of binding, which may play a role in achieving regulatory specificity towards individual target genes. PMID:27581526

  18. Active site of the replication protein of the rolling circle plasmid pC194.

    PubMed Central

    Noirot-Gros, M F; Bidnenko, V; Ehrlich, S D

    1994-01-01

    Mutation analysis of the rolling circle (RC) replication initiator protein RepA of plasmid pC194 was targeted to tyrosine and acidic amino acids (glutamate and aspartate) which are well conserved among numerous related plasmids. The effect of mutations was examined by an in vivo activity test. Mutations of one tyrosine and two glutamate residues were found to greatly impair or abolish activity, without affecting affinity for the origin, as deduced from in vitro gel mobility assays. We conclude that all three amino acids have a catalytic role. Tyrosine residues were found previously in active sites of different RC plasmid Rep proteins and topoisomerases, but not in association with acidic residues, which are a hallmark of the active sites of DNA hydrolyzing enzymes, such as the exo- and endonucleases. We propose that the active site of RepA contains two different catalytic centers, corresponding to a tyrosine and a glutamate. The former may be involved in the formation of the covalent DNA-protein intermediate at the initiation step of RC replication, and the latter may catalyze the release of the protein from the intermediate at the termination step. Images PMID:7925284

  19. Alkyl isocyanates as active site-directed inactivators of guinea pig liver transglutaminase.

    PubMed

    Gross, M; Whetzel, N K; Folk, J E

    1975-10-10

    Alkyl isocyanates are effective inactivators of guinea pig liver transglutaminase. Based on the specificity of the reaction the protection against inactivation by glutamine substrate, and the essential nature of calcium for the inactivation reaction, it is concluded that these reagents act as amide substrate analogs and, thus function in an active site-specific manner. Support for the contention that inactivation results from alkyl thiocarbamate ester formation through the single active site sulfhydryl group of the enzyme is (a) the loss of one free--SH group and the incorporation of 1 mol of reagent/mol of enzyme in the reaction, (b) similarity in chemical properties of the inactive enzyme derivative formed to those previously reported for another alkyl thiocarbamoylenzyme and an alkyl thiocarbamoylcysteine derivative, and (c) the finding that labeled peptides from digests of [methyl-14C]thiocarbamoyltransglutaminase and those from digests of iodoacetamide-inactivated enzyme occupy similar positions on peptide maps. Transglutaminase was found to be inactivated neither by urethan anlogs of its active ester substrates nor by urea analogs of its amide substrates. It is concluded on the basis of these findings that inactive carbamoylenzyme derivatives are formed only by direct addition of the transglutaminase active--SH group to the isocyanate C--N double bond, and not, like several serine active site enzymes, by nucleophilic displacement with urethan analogs of substrate, or by nucleophilic displacement with urea analogs of substrate. PMID:240837

  20. Imino proton NMR guides the reprogramming of A•T specific minor groove binders for mixed base pair recognition.

    PubMed

    Harika, Narinder K; Paul, Ananya; Stroeva, Ekaterina; Chai, Yun; Boykin, David W; Germann, Markus W; Wilson, W David

    2016-06-01

    Sequence-specific binding to DNA is crucial for targeting transcription factor-DNA complexes to modulate gene expression. The heterocyclic diamidine, DB2277, specifically recognizes a single G•C base pair in the minor groove of mixed base pair sequences of the type AAAGTTT. NMR spectroscopy reveals the presence of major and minor species of the bound compound. To understand the principles that determine the binding affinity and orientation in mixed sequences of DNA, over thirty DNA hairpin substrates were examined by NMR and thermal melting. The NMR exchange dynamics between major and minor species shows that the exchange is much faster than compound dissociation determined from biosensor-surface plasmon resonance. Extensive modifications of DNA sequences resulted in a unique DNA sequence with binding site AAGATA that binds DB2277 in a single orientation. A molecular docking result agrees with the model representing rapid flipping of DB2277 between major and minor species. Imino spectral analysis of a (15)N-labeled central G clearly shows the crucial role of the exocyclic amino group of G in sequence-specific recognition. Our results suggest that this approach can be expanded to additional modules for recognition of more sequence-specific DNA complexes. This approach provides substantial information about the sequence-specific, highly efficient, dynamic nature of minor groove binding agents. PMID:27131382