Ubiquitin C-terminal electrophiles are activity-based probes for identification and mechanistic study of ubiquitin conjugating machinery.

PubMed

Love, Kerry Routenberg; Pandya, Renuka K; Spooner, Eric; Ploegh, Hidde L

2009-04-17

Protein modification by ubiquitin (Ub) and ubiquitin-like modifiers (Ubl) requires the action of activating (E1), conjugating (E2), and ligating (E3) enzymes and is a key step in the specific destruction of proteins. Deubiquitinating enzymes (DUBs) deconjugate substrates modified with Ub/Ubl's and recycle Ub inside the cell. Genome mining based on sequence homology to proteins with known function has assigned many enzymes to this pathway without confirmation of either conjugating or DUB activity. Function-dependent methodologies are still the most useful for rapid identification or assessment of biological activity of expressed proteins from cells. Activity-based protein profiling uses chemical probes that are active-site-directed for the classification of protein activities in complex mixtures. Here we show that the design and use of an expanded set of Ub-based electrophilic probes allowed us to recover and identify members of each enzyme class in the ubiquitin-proteasome system, including E3 ligases and DUBs with previously unverified activity. We show that epitope-tagged Ub-electrophilic probes can be used as activity-based probes for E3 ligase identification by in vitro labeling and activity studies of purified enzymes identified from complex mixtures in cell lysate. Furthermore, the reactivity of our probe with the HECT domain of the E3 Ub ligase ARF-BP1 suggests that multiple cysteines may be in the vicinity of the E2-binding site and are capable of the transfer of Ub to self or to a substrate protein.

49 CFR 599.201 - Identification of salvage auctions and disposal facilities.

Code of Federal Regulations, 2014 CFR

2014-10-01

... on the Web site at http://www.cars.gov/disposal; or (3) A facility that disposes of vehicles in...) of this section, be currently listed on the Web site at http://www.cars.gov/disposal, as of the date.... (1) A disposal facility that qualifies as such by active membership in ELVS and that fails to...

49 CFR 599.201 - Identification of salvage auctions and disposal facilities.

Code of Federal Regulations, 2012 CFR

2012-10-01

... on the Web site at http://www.cars.gov/disposal; or (3) A facility that disposes of vehicles in...) of this section, be currently listed on the Web site at http://www.cars.gov/disposal, as of the date.... (1) A disposal facility that qualifies as such by active membership in ELVS and that fails to...

49 CFR 599.201 - Identification of salvage auctions and disposal facilities.

Code of Federal Regulations, 2013 CFR

2013-10-01

... on the Web site at http://www.cars.gov/disposal; or (3) A facility that disposes of vehicles in...) of this section, be currently listed on the Web site at http://www.cars.gov/disposal, as of the date.... (1) A disposal facility that qualifies as such by active membership in ELVS and that fails to...

49 CFR 599.201 - Identification of salvage auctions and disposal facilities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... on the Web site at http://www.cars.gov/disposal; or (3) A facility that disposes of vehicles in...) of this section, be currently listed on the Web site at http://www.cars.gov/disposal, as of the date.... (1) A disposal facility that qualifies as such by active membership in ELVS and that fails to...

Analogs of methyllycaconitine as novel noncompetitive inhibitors of nicotinic receptors: pharmacological characterization, computational modeling, and pharmacophore development.

PubMed

McKay, Dennis B; Chang, Cheng; González-Cestari, Tatiana F; McKay, Susan B; El-Hajj, Raed A; Bryant, Darrell L; Zhu, Michael X; Swaan, Peter W; Arason, Kristjan M; Pulipaka, Aravinda B; Orac, Crina M; Bergmeier, Stephen C

2007-05-01

As a novel approach to drug discovery involving neuronal nicotinic acetylcholine receptors (nAChRs), our laboratory targeted nonagonist binding sites (i.e., noncompetitive binding sites, negative allosteric binding sites) located on nAChRs. Cultured bovine adrenal cells were used as neuronal models to investigate interactions of 67 analogs of methyllycaconitine (MLA) on native alpha3beta4* nAChRs. The availability of large numbers of structurally related molecules presents a unique opportunity for the development of pharmacophore models for noncompetitive binding sites. Our MLA analogs inhibited nicotine-mediated functional activation of both native and recombinant alpha3beta4* nAChRs with a wide range of IC(50) values (0.9-115 microM). These analogs had little or no inhibitory effects on agonist binding to native or recombinant nAChRs, supporting noncompetitive inhibitory activity. Based on these data, two highly predictive 3D quantitative structure-activity relationship (comparative molecular field analysis and comparative molecular similarity index analysis) models were generated. These computational models were successfully validated and provided insights into the molecular interactions of MLA analogs with nAChRs. In addition, a pharmacophore model was constructed to analyze and visualize the binding requirements to the analog binding site. The pharmacophore model was subsequently applied to search structurally diverse molecular databases to prospectively identify novel inhibitors. The rapid identification of eight molecules from database mining and our successful demonstration of in vitro inhibitory activity support the utility of these computational models as novel tools for the efficient retrieval of inhibitors. These results demonstrate the effectiveness of computational modeling and pharmacophore development, which may lead to the identification of new therapeutic drugs that target novel sites on nAChRs.

Sequencing of the amylopullulanase (apu) gene of Thermoanaerobacter ethanolicus 39E, and identification of the active site by site-directed mutagenesis.

PubMed

Mathupala, S P; Lowe, S E; Podkovyrov, S M; Zeikus, J G

1993-08-05

The complete nucleotide sequence of the gene encoding the dual active amylopullulanase of Thermoanaerobacter ethanolicus 39E (formerly Clostridium thermohydrosulfuricum) was determined. The structural gene (apu) contained a single open reading frame 4443 base pairs in length, corresponding to 1481 amino acids, with an estimated molecular weight of 162,780. Analysis of the deduced sequence of apu with sequences of alpha-amylases and alpha-1,6 debranching enzymes enabled the identification of four conserved regions putatively involved in substrate binding and in catalysis. The conserved regions were localized within a 2.9-kilobase pair gene fragment, which encoded a M(r) 100,000 protein that maintained the dual activities and thermostability of the native enzyme. The catalytic residues of amylopullulanase were tentatively identified by using hydrophobic cluster analysis for comparison of amino acid sequences of amylopullulanase and other amylolytic enzymes. Asp597, Glu626, and Asp703 were individually modified to their respective amide form, or the alternate acid form, and in all cases both alpha-amylase and pullulanase activities were lost, suggesting the possible involvement of 3 residues in a catalytic triad, and the presence of a putative single catalytic site within the enzyme. These findings substantiate amylopullulanase as a new type of amylosaccharidase.

A Novel Proteomics Approach to Identify SUMOylated Proteins and Their Modification Sites in Human Cells*

PubMed Central

Galisson, Frederic; Mahrouche, Louiza; Courcelles, Mathieu; Bonneil, Eric; Meloche, Sylvain; Chelbi-Alix, Mounira K.; Thibault, Pierre

2011-01-01

The small ubiquitin-related modifier (SUMO) is a small group of proteins that are reversibly attached to protein substrates to modify their functions. The large scale identification of protein SUMOylation and their modification sites in mammalian cells represents a significant challenge because of the relatively small number of in vivo substrates and the dynamic nature of this modification. We report here a novel proteomics approach to selectively enrich and identify SUMO conjugates from human cells. We stably expressed different SUMO paralogs in HEK293 cells, each containing a His6 tag and a strategically located tryptic cleavage site at the C terminus to facilitate the recovery and identification of SUMOylated peptides by affinity enrichment and mass spectrometry. Tryptic peptides with short SUMO remnants offer significant advantages in large scale SUMOylome experiments including the generation of paralog-specific fragment ions following CID and ETD activation, and the identification of modified peptides using conventional database search engines such as Mascot. We identified 205 unique protein substrates together with 17 precise SUMOylation sites present in 12 SUMO protein conjugates including three new sites (Lys-380, Lys-400, and Lys-497) on the protein promyelocytic leukemia. Label-free quantitative proteomics analyses on purified nuclear extracts from untreated and arsenic trioxide-treated cells revealed that all identified SUMOylated sites of promyelocytic leukemia were differentially SUMOylated upon stimulation. PMID:21098080

Identification of an hexapeptide that binds to a surface pocket in cyclin A and inhibits the catalytic activity of the complex cyclin-dependent kinase 2-cyclin A.

PubMed

Canela, Núria; Orzáez, Mar; Fucho, Raquel; Mateo, Francesca; Gutierrez, Ricardo; Pineda-Lucena, Antonio; Bachs, Oriol; Pérez-Payá, Enrique

2006-11-24

The protein-protein complexes formed between different cyclins and cyclin-dependent kinases (CDKs) are central to cell cycle regulation. These complexes represent interesting points of chemical intervention for the development of antineoplastic molecules. Here we describe the identification of an all d-amino acid hexapeptide, termed NBI1, that inhibits the kinase activity of the cyclin-dependent kinase 2 (cdk2)-cyclin A complex through selective binding to cyclin A. The mechanism of inhibition is non-competitive for ATP and non-competitive for protein substrates. In contrast to the existing CDKs peptide inhibitors, the hexapeptide NBI1 interferes with the formation of the cdk2-cyclin A complex. Furthermore, a cell-permeable derivative of NBI1 induces apoptosis and inhibits proliferation of tumor cell lines. Thus, the NBI1-binding site on cyclin A may represent a new target site for the selective inhibition of activity cdk2-cyclin A complex.

Solid frustrated-Lewis-pair catalysts constructed by regulations on surface defects of porous nanorods of CeO2

PubMed Central

Zhang, Sai; Huang, Zheng-Qing; Ma, Yuanyuan; Gao, Wei; Li, Jing; Cao, Fangxian; Li, Lin; Chang, Chun-Ran; Qu, Yongquan

2017-01-01

Identification on catalytic sites of heterogeneous catalysts at atomic level is important to understand catalytic mechanism. Surface engineering on defects of metal oxides can construct new active sites and regulate catalytic activity and selectivity. Here we outline the strategy by controlling surface defects of nanoceria to create the solid frustrated Lewis pair (FLP) metal oxide for efficient hydrogenation of alkenes and alkynes. Porous nanorods of ceria (PN-CeO2) with a high concentration of surface defects construct new Lewis acidic sites by two adjacent surface Ce3+. The neighbouring surface lattice oxygen as Lewis base and constructed Lewis acid create solid FLP site due to the rigid lattice of ceria, which can easily dissociate H–H bond with low activation energy of 0.17 eV. PMID:28516952

Proteomic Identification and Quantification of S-glutathionylation in Mouse Macrophages Using Resin-Assisted Enrichment and Isobaric Labeling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Dian; Gaffrey, Matthew J.; Guo, Jia

2014-02-11

Protein S-glutathionylation (SSG) is an important regulatory posttranslational modification of protein cysteine (Cys) thiol redox switches, yet the role of specific cysteine residues as targets of modification is poorly understood. We report a novel quantitative mass spectrometry (MS)-based proteomic method for site-specific identification and quantification of S-glutathionylation across different conditions. Briefly, this approach consists of initial blocking of free thiols by alkylation, selective reduction of glutathionylated thiols and enrichment using thiol affinity resins, followed by on-resin tryptic digestion and isobaric labeling with iTRAQ (isobaric tags for relative and absolute quantitation) for MS-based identification and quantification. The overall approach was validatedmore » by application to RAW 264.7 mouse macrophages treated with different doses of diamide to induce glutathionylation. A total of 1071 Cys-sites from 690 proteins were identified in response to diamide treatment, with ~90% of the sites displaying >2-fold increases in SSG-modification compared to controls.. This approach was extended to identify potential SSG modified Cys-sites in response to H2O2, an endogenous oxidant produced by activated macrophages and many pathophysiological stimuli. The results revealed 364 Cys-sites from 265 proteins that were sensitive to S-glutathionylation in response to H2O2 treatment. These proteins covered a range of molecular types and molecular functions with free radical scavenging, and cell death and survival included as the most significantly enriched functional categories. Overall the results demonstrate that our approach is effective for site-specific identification and quantification of S-glutathionylated proteins. The analytical strategy also provides a unique approach to determining the major pathways and cell processes most susceptible to glutathionylation at a proteome-wide scale.« less

75 FR 8407 - Agency Information Collection Activities: Proposed Collection; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-24

... Request, NA Form 6006, which will be used by NARA employees, on-site contractors, volunteers, Foundation...: Identification Card Request. OMB number: 3095-0057. Agency form number: NA Form 6006. Type of review: Regular...

Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq)

PubMed Central

Langley, Alexander R.; Gräf, Stefan; Smith, James C.; Krude, Torsten

2016-01-01

Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. PMID:27587586

Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

PubMed

Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

2016-12-01

Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Human germline and pan-cancer variomes and their distinct functional profiles

PubMed Central

Pan, Yang; Karagiannis, Konstantinos; Zhang, Haichen; Dingerdissen, Hayley; Shamsaddini, Amirhossein; Wan, Quan; Simonyan, Vahan; Mazumder, Raja

2014-01-01

Identification of non-synonymous single nucleotide variations (nsSNVs) has exponentially increased due to advances in Next-Generation Sequencing technologies. The functional impacts of these variations have been difficult to ascertain because the corresponding knowledge about sequence functional sites is quite fragmented. It is clear that mapping of variations to sequence functional features can help us better understand the pathophysiological role of variations. In this study, we investigated the effect of nsSNVs on more than 17 common types of post-translational modification (PTM) sites, active sites and binding sites. Out of 1 705 285 distinct nsSNVs on 259 216 functional sites we identified 38 549 variations that significantly affect 10 major functional sites. Furthermore, we found distinct patterns of site disruptions due to germline and somatic nsSNVs. Pan-cancer analysis across 12 different cancer types led to the identification of 51 genes with 106 nsSNV affected functional sites found in 3 or more cancer types. 13 of the 51 genes overlap with previously identified Significantly Mutated Genes (Nature. 2013 Oct 17;502(7471)). 62 mutations in these 13 genes affecting functional sites such as DNA, ATP binding and various PTM sites occur across several cancers and can be prioritized for additional validation and investigations. PMID:25232094

Calcium-stimulated autophosphorylation site of plant chimeric calcium/calmodulin-dependent protein kinase

NASA Technical Reports Server (NTRS)

Sathyanarayanan, P. V.; Siems, W. F.; Jones, J. P.; Poovaiah, B. W.

2001-01-01

The existence of two molecular switches regulating plant chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK), namely the C-terminal visinin-like domain acting as Ca(2+)-sensitive molecular switch and calmodulin binding domain acting as Ca(2+)-stimulated autophosphorylation-sensitive molecular switch, has been described (Sathyanarayanan, P. V., Cremo, C. R., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 30417-30422). Here we report the identification of Ca(2+)-stimulated autophosphorylation site of CCaMK by matrix-assisted laser desorption ionization time of flight-mass spectrometry. Thr(267) was confirmed as the Ca(2+)-stimulated autophosphorylation site by post-source decay experiments and by site-directed mutagenesis. The purified T267A mutant form of CCaMK did not show Ca(2+)-stimulated autophosphorylation, autophosphorylation-dependent variable calmodulin affinity, or Ca(2+)/calmodulin stimulation of kinase activity. Sequence comparison of CCaMK from monocotyledonous plant (lily) and dicotyledonous plant (tobacco) suggests that the autophosphorylation site is conserved. This is the first identification of a phosphorylation site specifically responding to activation by second messenger system (Ca(2+) messenger system) in plants. Homology modeling of the kinase and calmodulin binding domain of CCaMK with the crystal structure of calcium/calmodulin-dependent protein kinase 1 suggests that the Ca(2+)-stimulated autophosphorylation site is located on the surface of the kinase and far from the catalytic site. Analysis of Ca(2+)-stimulated autophosphorylation with increasing concentration of CCaMK indicates the possibility that the Ca(2+)-stimulated phosphorylation occurs by an intermolecular mechanism.

Martian Magmatic-Driven Hydrothermal Sites: Potential Sources of Energy, Water, and Life

NASA Technical Reports Server (NTRS)

Anderson, R. C.; Dohm, J. M.; Baker, V. R.; Ferris, J. C.; Hare, T. M.; Tanaka, K. L.; Klemaszewski, J. E.; Skinner, J. A.; Scott, D. H.

2000-01-01

Magmatic-driven processes and impact events dominate the geologic record of Mars. Such recorded geologic activity coupled with significant evidence of past and present-day water/ice, above and below the martian surface, indicate that hydrothermal environments certainly existed in the past and may exist today. The identification of such environments, especially long-lived magmatic-driven hydrothermal environments, provides NASA with significant target sites for future sample return missions, since they (1) could favor the development and sustenance of life, (2) may comprise a large variety of exotic mineral assemblages, and (3) could potentially contain water/ice reservoirs for future Mars-related human activities. If life developed on Mars, the fossil record would presumably be at its greatest concentration and diversity in environments where long-term energy sources and water coexisted such as at sites where long-lived, magmatic-driven hydrothermal activity occurred. These assertions are supported by terrestrial analogs. Small, single-celled creatures (prokaryotes) are vitally important in the evolution of the Earth; these prokaryotes are environmentally tough and tolerant of environmental extremes of pH, temperature, salinity, and anoxic conditions found around hydrothermal vents. In addition, there is a great ability for bacteria to survive long periods of geologic time in extreme conditions, including high temperature hydrogen sulfide and sulfur erupted from Mount St. Helens volcano. Our team of investigators is conducting a geological investigation using multiple mission-derived datasets (e.g., existing geologic map data, MOC imagery, MOLA, TES image data, geophysical data, etc.) to identify prime target sites of hydrothermal activity for future hydrological, mineralogical, and biological investigations. The identification of these sites will enhance the probability of success for future missions to Mars.

An approach to functionally relevant clustering of the protein universe: Active site profile-based clustering of protein structures and sequences.

PubMed

Knutson, Stacy T; Westwood, Brian M; Leuthaeuser, Janelle B; Turner, Brandon E; Nguyendac, Don; Shea, Gabrielle; Kumar, Kiran; Hayden, Julia D; Harper, Angela F; Brown, Shoshana D; Morris, John H; Ferrin, Thomas E; Babbitt, Patricia C; Fetrow, Jacquelyn S

2017-04-01

Protein function identification remains a significant problem. Solving this problem at the molecular functional level would allow mechanistic determinant identification-amino acids that distinguish details between functional families within a superfamily. Active site profiling was developed to identify mechanistic determinants. DASP and DASP2 were developed as tools to search sequence databases using active site profiling. Here, TuLIP (Two-Level Iterative clustering Process) is introduced as an iterative, divisive clustering process that utilizes active site profiling to separate structurally characterized superfamily members into functionally relevant clusters. Underlying TuLIP is the observation that functionally relevant families (curated by Structure-Function Linkage Database, SFLD) self-identify in DASP2 searches; clusters containing multiple functional families do not. Each TuLIP iteration produces candidate clusters, each evaluated to determine if it self-identifies using DASP2. If so, it is deemed a functionally relevant group. Divisive clustering continues until each structure is either a functionally relevant group member or a singlet. TuLIP is validated on enolase and glutathione transferase structures, superfamilies well-curated by SFLD. Correlation is strong; small numbers of structures prevent statistically significant analysis. TuLIP-identified enolase clusters are used in DASP2 GenBank searches to identify sequences sharing functional site features. Analysis shows a true positive rate of 96%, false negative rate of 4%, and maximum false positive rate of 4%. F-measure and performance analysis on the enolase search results and comparison to GEMMA and SCI-PHY demonstrate that TuLIP avoids the over-division problem of these methods. Mechanistic determinants for enolase families are evaluated and shown to correlate well with literature results. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

Premature extravasation. A bleeding site identified during the dynamic phase of Tc-99m red blood cell bleeding scintigraphy.

PubMed

el-Shirbiny, A; Fernandez, R; Zuckier, L S

1995-08-01

Tc-99m RBC scintigraphy is favored by many investigators because it provides the ability to image the abdomen over a prolonged period of time, thereby allowing identification of delayed bleeding sites that are frequently encountered due to the intermittent nature of gastrointestinal bleeding. The authors describe a case of bleeding scintigraphy with labeled red blood cells in which the bleeding site was identifiable only on the dynamic blood-flow and first static images. On later images, the labeled blood cells had spread throughout the colon, rendering localization of the actual bleeding site impossible. Two previous red blood cell scintigraphies and a subsequent contrast angiogram did not reveal sites of active bleeding. As illustrated by this unusual case, factors governing timing and visualization of abnormal bleeding sites are discussed, as is a differential diagnosis of abnormal foci of activity seen on the dynamic phase of bleeding scintigraphy.

10 CFR 960.3-1-4-1 - Site identification as potentially acceptable.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Site identification as potentially acceptable. 960.3-1-4-1 Section 960.3-1-4-1 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR THE PRELIMINARY SCREENING OF POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Implementation Guidelines § 960.3-1-4-1 Site identification...

Experimental Identification of the Active Site in the Heteronuclear Redox Couples [AlVOx ]+. /CO/N2 O (x=3, 4) by Gas-Phase IR Spectroscopy.

PubMed

Debnath, Sreekanta; Knorke, Harald; Schöllkopf, Wieland; Zhou, Shaodong; Asmis, Knut R; Schwarz, Helmut

2018-06-18

Cryogenic ion vibrational spectroscopy was used in combination with electronic structure calculations to identify the active site in the oxygen atom transfer reaction [AlVO 4 ] +. +CO→[AlVO 3 ] +. +CO 2 . Infrared photodissociation spectra of messenger-tagged heteronuclear clusters demonstrate that in contrast to [AlVO 4 ] +. , [AlVO 3 ] +. is devoid of a terminal Al-O t unit while the terminal V=O t group remains intact. Thus it is the Al-O t moiety that forms the active site in the [AlVO x ] +. /CO/N 2 O (x=3, 4) redox couples, which is in line with theoretical predictions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Installation-restoration program. Preliminary assessment: 106th Civil Engineering Flight, Roslyn Air National Guard Station, New York Air National Guard, Roslyn, New York

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1991-02-01

The preliminary assessment included the following activities: (1) An on-site visit, including interviews and field surveys; (2) Acquisition and analysis of information on past hazardous materials use, waste generation, and waste disposal at the Station; (3) Acquisition and analysis of available geological surveys, hydrological data, meteorological data, and environmental data; and (4) The identification and assessment of sites where contamination of soils, ground water and/or surface water may have occurred. Operations that have involved the use of hazardous materials and the disposal of hazardous wastes include vehicle maintenance and aerospace ground equipment (AGE) maintenance. The hazardous wastes disposed fo throughmore » these operations include varying quantities of petroleum-oil-lubricant (POL) products, acids, paints, thinners, strippers, and solvents. The field surveys and interviews resulted in the identification of three sites that exhibit the potential for migration of contaminants.« less

Environmental restoration and waste management: Robotics technology development program: Robotics 5-year program plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

In FY 1990 Robotics Technology Development Program (RTDP) planning teams visited five DOE sites. These sites were selected by the Office of Technology Development to provide a needs basis for developing a 5-Year Plan. Visits to five DOE sites provided identification of needs for robotics technology development to support Environmental Restoration and Waste Management (ER WM) projects at those sites. Additional site visits will be conducted in the future to expand the planning basis. This volume summarizes both the results of the site visits and the needs and requirements of the priority ER WM activities at the sites, including potentialmore » needs for robotics and remote systems technology. It also discusses hazards associated with the site activities and any problems or technical uncertainties associated with dealing with the hazards in the performance of the ER WM work. Robotic or remote systems currently under development for remediation projects or waste operations are also discussed. The information in this document is organized principally by site, activity, and priority. Section 2.0, Site Needs, is based on information from the site visit reports and provides a summary which focuses on the site needs and requirements for each priority activity. Section 2.0 also records evaluations and discussions by the RTDP team following the site visit. Section 3.0, Commonality Assessment, documents similar site needs where common, or cross-cutting, robotics technology might be applied to several activities. Section 4.0 contains a summary of the site needs and requirements in tabular form. 1 tab.« less

Discovery of d-amino acid oxidase inhibitors based on virtual screening against the lid-open enzyme conformation.

PubMed

Szilágyi, Bence; Skok, Žiga; Rácz, Anita; Frlan, Rok; Ferenczy, György G; Ilaš, Janez; Keserű, György M

2018-06-01

d-Amino acid oxidase (DAAO) inhibitors are typically small polar compounds with often suboptimal pharmacokinetic properties. Features of the native binding site limit the operational freedom of further medicinal chemistry efforts. We therefore initiated a structure based virtual screening campaign based on the X-ray structures of DAAO complexes where larger ligands shifted the loop (lid opening) covering the native binding site. The virtual screening of our in-house collection followed by the in vitro test of the best ranked compounds led to the identification of a new scaffold with micromolar IC 50 . Subsequent SAR explorations enabled us to identify submicromolar inhibitors. Docking studies supported by in vitro activity measurements suggest that compounds bind to the active site with a salt-bridge characteristic to DAAO inhibitor binding. In addition, displacement of and interaction with the loop covering the active site contributes significantly to the activity of the most potent compounds. Copyright © 2018 Elsevier Ltd. All rights reserved.

Real-space identification of intermolecular bonding with atomic force microscopy.

PubMed

Zhang, Jun; Chen, Pengcheng; Yuan, Bingkai; Ji, Wei; Cheng, Zhihai; Qiu, Xiaohui

2013-11-01

We report a real-space visualization of the formation of hydrogen bonding in 8-hydroxyquinoline (8-hq) molecular assemblies on a Cu(111) substrate, using noncontact atomic force microscopy (NC-AFM). The atomically resolved molecular structures enable a precise determination of the characteristics of hydrogen bonding networks, including the bonding sites, orientations, and lengths. The observation of bond contrast was interpreted by ab initio density functional calculations, which indicated the electron density contribution from the hybridized electronic state of the hydrogen bond. Intermolecular coordination between the dehydrogenated 8-hq and Cu adatoms was also revealed by the submolecular resolution AFM characterization. The direct identification of local bonding configurations by NC-AFM would facilitate detailed investigations of intermolecular interactions in complex molecules with multiple active sites.

Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

2004-08-06

The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

Phase 1 archaeological investigation, cultural resources survey, Hawaii Geothermal Project, Makawao and Hana districts, south shore of Maui, Hawaii

DOE Office of Scientific and Technical Information (OSTI.GOV)

Erkelens, C.

1995-04-01

This report details the archaeological investigation of a 200 foot wide sample corridor extending approximately 9 miles along the southern portion of Maui within the present districts of Hana and Makawao. The survey team documented a total of 51 archaeological sites encompassing 233 surface features. Archaeological sites are abundant throughout the region and only become scarce where vegetation has been bulldozed for ranching activities. At the sea-land transition points for the underwater transmission cable, both Ahihi Bay and Huakini Bay are subjected to seasonal erosion and redeposition of their boulder shorelines. The corridor at the Ahihi Bay transition point runsmore » through the Maonakala Village Complex which is an archaeological site on the State Register of Historic Places within a State Natural Area Reserve. Numerous other potentially significant archaeological sites lie within the project corridor. It is likely that rerouting of the corridor in an attempt to avoid known sites would result in other undocumented sites located outside the sample corridor being impacted. Given the distribution of archaeological sites, there is no alternative route that can be suggested that is likely to avoid encountering sites. Twelve charcoal samples were obtained for potential taxon identification and radiocarbon analysis. Four of these samples were subsequently submitted for dating and species identification. Bird bones from various locations within a lava tube were collected for identification. Sediment samples for subsequent pollen analysis were obtained from within two lava tubes. With these three sources of information it is hoped that paleoenvironmental data can be recovered that will enable a better understanding of the setting for Hawaiian habitation of the area.« less

77 FR 57094 - Draft Guidance for Industry on Self-Identification of Generic Drug Facilities, Sites, and...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-17

... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2012-D-0881] Draft Guidance for Industry on Self-Identification of Generic Drug Facilities, Sites, and Organizations... ``Self-Identification of Generic Drug Facilities, Sites, and Organizations.'' The document was published...

10 CFR 960.3-2 - Siting process.

Code of Federal Regulations, 2010 CFR

2010-01-01

... REPOSITORY Implementation Guidelines § 960.3-2 Siting process. The siting process begins with site screening... first repository before the enactment of the Act, and the identification of such sites was made after... identification of potentially acceptable sites for the second and subsequent repositories shall be conducted in...

10 CFR 851.21 - Hazard identification and assessment.

Code of Federal Regulations, 2013 CFR

2013-01-01

.... Procedures must include methods to: (1) Assess worker exposure to chemical, physical, biological, or safety workplace hazards through appropriate workplace monitoring; (2) Document assessment for chemical, physical... hazards; (6) Perform routine job activity-level hazard analyses; (7) Review site safety and health...

10 CFR 851.21 - Hazard identification and assessment.

Code of Federal Regulations, 2014 CFR

2014-01-01

.... Procedures must include methods to: (1) Assess worker exposure to chemical, physical, biological, or safety workplace hazards through appropriate workplace monitoring; (2) Document assessment for chemical, physical... hazards; (6) Perform routine job activity-level hazard analyses; (7) Review site safety and health...

Use of satellite remote sensing as a monitoring tool for land and water resources development activities in an Indian tropical site.

PubMed

Behera, M D; Gupta, A K; Barik, S K; Das, P; Panda, R M

2018-06-15

With the availability of satellite data from free data domain, remote sensing has increasingly become a fast-hand tool for monitoring of land and water resources development activities with minimal cost and time. Here, we verified construction of check dams and implementation of plantation activities in two districts of Tripura state using Landsat and Sentinel-2 images for the years 2008 and 2016-2017, respectively. We applied spectral reflectance curves and index-based proxies to quantify these activities for two time periods. A subset of the total check dams and plantation sites was chosen on the basis of site condition, nature of check dams, and planted species for identification on satellite images, and another subset was randomly chosen to validate identification procedure. The normalized difference water index (NDWI) derived from Landsat and Senitnel-2 were used to quantify water area evolved, qualify the water quality, and influence of associated tree shadows. Three types of check dams were observed, i.e., full, partial, and fully soil exposed on the basis of the presence of grass or scrub on the check dams. Based on the nature of check dam and site characteristics, we classified the water bodies under 11-categories using six interpretation keys (size, shape, water depth, quality, shadow of associated trees, catchment area). The check dams constructed on existing narrow gullies totally covered by branches or associated plants were not identified without field verification. Further, use of EVI enabled us to approve the plantation activities and adjudge the corresponding increase in vegetation vigor. The plantation activities were established based on the presence and absence of existing vegetation. Clearing on the plantation sites for plantation shows differential increase in EVI values during the initial years. The 403 plantation sites were categorized into 12 major groups on the basis of presence of dominant species and site conditions. The dominant species were Areca catechu, Musa paradisiaca, Ananas comosus, Bambusa sp., and mix plantation of A. catechu and M. paradisiaca. However, the highest maximum increase in average EVI was observed for the pine apple plantation sites (0.11), followed by Bambussa sp. (0.10). These sites were fully covered with plantation without any exposed soil. The present study successfully demonstrates a satellite-based survey supplemented with ground information evaluating the changes in vegetation profile due to plantation activities, locations of check dams, extent of water bodies, downstream irrigation, and catchment area of water bodies.

A description of the index of active Florida water data collection stations and a user's guide for station or site information retrieval using computer program Findex H578

USGS Publications Warehouse

Merritt, M.L.

1977-01-01

A computerized index of water-data collection activities and retrieval software to generate publication list of this information was developed for Florida. This system serves a vital need in the administration of the many and diverse water-data collection activities. Previously, needed data was very difficult to assemble for use in program planning or project implementation. Largely descriptive, the report tells how a file of computer card images has been established which contains entries for all sites in Florida at which there is currently a water-data-collection activity. Entries include information such as identification number, station name, location, type of site, county, information about data collection, funding, and other pertinent details. The computer program FINDEX selectively retrieves entries and lists them in a format suitable for publication. Updating the index is done routinely. (Woodard-USGS)

Unraveling the Nature of Active Sites in Ethanol Electro-oxidation by Site-Specific Marking of a Pt Catalyst with Isotope-Labeled 13CO.

PubMed

Farias, Manuel J S; Cheuquepán, William; Tanaka, Auro A; Feliu, Juan M

2018-03-15

This works deals with the identification of preferential site-specific activation at a model Pt surface during a multiproduct reaction. The (110)-type steps of a Pt(332) surface were selectively marked by attaching isotope-labeled 13 CO molecules to them, and ethanol oxidation was probed by in situ Foureir transfrom infrared spectroscopy in order to precisely determine the specific sites at which CO 2 , acetic acid, and acetaldehyde were preferentially formed. The (110) steps were active for splitting the C-C bond, but unexpectedly, we provide evidence that the pathway of CO 2 formation was preferentially activated at (111) terraces, rather than at (110) steps. Acetaldehyde was formed at (111) terraces at potentials comparable to those for CO 2 formation also at (111) terraces, while the acetic acid formation pathway became active only when the (110) steps were released by the oxidation of adsorbed 13 CO, at potentials higher than for the formation of CO 2 at (111) terraces of the stepped surface.

The hppA gene of Helicobacter pylori encodes the class C acid phosphatase precursor.

PubMed

Godlewska, Renata; Bujnicki, Janusz M; Ostrowski, Jerzy; Jagusztyn-Krynicka, Elzbieta K

2002-08-14

Screening of the Helicobacter pylori genomic library with sera from infected humans and from immunized rabbits resulted in identification of the 25 kDa protein cell envelope (HppA) which exhibits acid phosphatase activity. Enzyme activity was demonstrated by specific enzymatic assays with whole-cell protein preparations of H. pylori strain N6 and from Escherichia coli carrying the hppA gene (pUWM192). HppA showed optimum activity at pH 5.6 and was resistant to inhibition by EDTA. Bioinformatics analysis and site-directed mutagenesis of two putative active site residues (D73 and D192) provide further insight into the sequence-structure-function relationships of HppA as a member of the DDDD phosphohydrolase superfamily.

Identification and conservation of apple genetic diversity

USDA-ARS?s Scientific Manuscript database

The USDA-ARS National Plant Germplasm System (NPGS) maintains a vast collection of plant genetic resources that includes over 570,000 accessions representing nearly 15,000 species. This collection is dispersed amongst 17 active sites throughout the United States. The NPGS base collection at the Nati...

Developing a programmatic approach to investigating and remediating many unrelated comprehensive environmental response, compensation, and liability act sites at Kelly Air Force Base

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamp, G.; Regan, P.; Ninesteel, R.

1988-01-01

Kelly Air Force Base (AFB), which was founded in 1917, is involved in logistics and maintenance activities supporting the Air Logistics Command. In addition, Kelly AFB hosts over 50 tenant organizations representing the Air Force, Department of Defense, and other government agencies. Over the years waste disposal from this complex was conducted in a manner that led to the identification of over 30 sites to be included in the Installation Restoration Program (IRP) after the Phase 1 investigation. A methodology was needed to prioritize the Remedial Investigations and Feasibility Study (RI/FS) activities for the sites. A Strategy Plan was developedmore » that involved reviewing and interpreting existing data, identifying data voids relative to site specific RI/FS activities, and developing methodology to prioritize activities. Sites were prioritized, and a comprehensive IRP planning document was developed. One data deficiency was revealed -- the lack of understanding of the Basewide hydrogeologic conditions necessary to establish an effective restoration program. A Hydrogeologic Investigation was initiated to provide this data. This data will allow better interpretation of the interaction of the sites, particularly those in close proximity, and improved planning of remediation activities.« less

Source identification of uranium-containing materials at mine legacy sites in Portugal.

PubMed

Keatley, A C; Martin, P G; Hallam, K R; Payton, O D; Awbery, R; Carvalho, F P; Oliveira, J M; Silva, L; Malta, M; Scott, T B

2018-03-01

Whilst prior nuclear forensic studies have focused on identifying signatures to distinguish between different uranium deposit types, this paper focuses on providing a scientific basis for source identification of materials from different uranium mine sites within a single region, which can then be potentially used within nuclear forensics. A number of different tools, including gamma spectrometry, alpha spectrometry, mineralogy and major and minor elemental analysis, have been utilised to determine the provenance of uranium mineral samples collected at eight mine sites, located within three different uranium provinces, in Portugal. A radiation survey was initially conducted by foot and/or unmanned aerial vehicle at each site to assist sample collection. The results from each mine site were then compared to determine if individual mine sites could be distinguished based on characteristic elemental and isotopic signatures. Gamma and alpha spectrometry were used to differentiate between samples from different sites and also give an indication of past milling and mining activities. Ore samples from the different mine sites were found to be very similar in terms of gangue and uranium mineralogy. However, rarer minerals or specific impurity elements, such as calcium and copper, did permit some separation of the sites examined. In addition, classification rates using linear discriminant analysis were comparable to those in the literature. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.

Simultaneous screening of four epidermal growth factor receptor antagonists from Curcuma longa via cell membrane chromatography online coupled with HPLC-MS.

PubMed

Sun, Meng; Ma, Wei-na; Guo, Ying; Hu, Zhi-gang; He, Lang-chong

2013-07-01

The epidermal growth factor receptors (EGFRs) are significant targets for screening active compounds. In this work, an analytical method was established for rapid screening, separation, and identification of EGFRs antagonists from Curcuma longa. Human embryonic kidney 293 cells with a steadily high expression of EGFRs were used to prepare the cell membrane stationary phase in a cell membrane chromatography model for screening active compounds. Separation and identification of the retention chromatographic peaks was achieved by HPLC-MS. The active sites, docking extents and inhibitory effects of the active compounds were also demonstrated. The screening result found that ar-turmerone, curcumin, demethoxycurcumin, and bisdemethoxycurcumin from Curcuma longa could be active components in a similar manner to gefitinib. Biological trials showed that all of four compounds can inhibit EGFRs protein secretion and cell growth in a dose-dependent manner, and downregulate the phosphorylation of EGFRs. This analytical method demonstrated fast and effective characteristics for screening, separation and identification of the active compounds from a complex system and should be useful for drug discovery with natural medicinal herbs. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

PubMed

Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

1999-09-24

We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

Identification of the Allosteric Site for Phenylalanine in Rat Phenylalanine Hydroxylase*

PubMed Central

Zhang, Shengnan; Fitzpatrick, Paul F.

2016-01-01

Liver phenylalanine hydroxylase (PheH) is an allosteric enzyme that requires activation by phenylalanine for full activity. The location of the allosteric site for phenylalanine has not been established. NMR spectroscopy of the isolated regulatory domain (RDPheH(25–117) is the regulatory domain of PheH lacking residues 1–24) of the rat enzyme in the presence of phenylalanine is consistent with formation of a side-by-side ACT dimer. Six residues in RDPheH(25–117) were identified as being in the phenylalanine-binding site on the basis of intermolecular NOEs between unlabeled phenylalanine and isotopically labeled protein. The location of these residues is consistent with two allosteric sites per dimer, with each site containing residues from both monomers. Site-specific variants of five of the residues (E44Q, A47G, L48V, L62V, and H64N) decreased the affinity of RDPheH(25–117) for phenylalanine based on the ability to stabilize the dimer. Incorporation of the A47G, L48V, and H64N mutations into the intact protein increased the concentration of phenylalanine required for activation. The results identify the location of the allosteric site as the interface of the regulatory domain dimer formed in activated PheH. PMID:26823465

National Register of Historic Places multiple property documentation form -- Historic, archaeological, and traditional cultural properties of the Hanford Site, Washington

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nickens, P.R.

The US Department of Energy`s Hanford Site encompasses an area of 560 square miles on the Columbia River in southeastern Washington. Since 1943, the Hanford Site has existed as a protected area for activities primarily related to the production of radioactive materials for national defense uses. For cultural resources on the Hanford Site, establishment of the nuclear reservation as a high security area, with public access restricted, has resulted in a well-protected status, although no deliberate resource protection measures were in effect to mitigate effects of facilities construction and associated activities. Thus, the Hanford Site contains an extensive record ofmore » aboriginal archaeological sites and Native American cultural properties, along with pre-Hanford Euro-American sites (primarily archaeological in nature with the removal of most pre-1943 structures), and a considerable number of Manhattan Project/Cold War era buildings and structures. The recent mission change from production to clean up and disposal of DOE lands created a critical need for development and implementation of new and different cultural resource management strategies. DOE-RL has undertaken a preservation planning effort for the Hanford Site. The intent of this Plan is to enable DOE-RL to organize data and develop goals, objectives, and priorities for the identification, evaluation, registration, protection, preservation, and enhancement of the Site`s historical and cultural properties. Decisions made about the identification, evaluation, registration and treatment of historic properties are most aptly made when relationships between individual properties and other similar properties are considered. The historic context and the multiple property documentation (NTD) process provides DOE-RL the organizational framework for these decisions. Once significant patterns are identified, contexts developed, and expected properties are defined, the NTD process provides the foundation for future decisions concerning the management of significant cultural resources on the Hanford Site.« less

Identification and characterization of Hoxa9 binding sites in hematopoietic cells

PubMed Central

Huang, Yongsheng; Sitwala, Kajal; Bronstein, Joel; Sanders, Daniel; Dandekar, Monisha; Collins, Cailin; Robertson, Gordon; MacDonald, James; Cezard, Timothee; Bilenky, Misha; Thiessen, Nina; Zhao, Yongjun; Zeng, Thomas; Hirst, Martin; Hero, Alfred; Jones, Steven

2012-01-01

The clustered homeobox proteins play crucial roles in development, hematopoiesis, and leukemia, yet the targets they regulate and their mechanisms of action are poorly understood. Here, we identified the binding sites for Hoxa9 and the Hox cofactor Meis1 on a genome-wide level and profiled their associated epigenetic modifications and transcriptional targets. Hoxa9 and the Hox cofactor Meis1 cobind at hundreds of highly evolutionarily conserved sites, most of which are distant from transcription start sites. These sites show high levels of histone H3K4 monomethylation and CBP/P300 binding characteristic of enhancers. Furthermore, a subset of these sites shows enhancer activity in transient transfection assays. Many Hoxa9 and Meis1 binding sites are also bound by PU.1 and other lineage-restricted transcription factors previously implicated in establishment of myeloid enhancers. Conditional Hoxa9 activation is associated with CBP/P300 recruitment, histone acetylation, and transcriptional activation of a network of proto-oncogenes, including Erg, Flt3, Lmo2, Myb, and Sox4. Collectively, this work suggests that Hoxa9 regulates transcription by interacting with enhancers of genes important for hematopoiesis and leukemia. PMID:22072553

Screening and identification of potential PTP1B allosteric inhibitors using in silico and in vitro approaches.

PubMed

Shinde, Ranajit Nivrutti; Kumar, G Siva; Eqbal, Shahbaz; Sobhia, M Elizabeth

2018-01-01

Protein tyrosine phosphatase 1B (PTP1B) is a validated therapeutic target for Type 2 diabetes due to its specific role as a negative regulator of insulin signaling pathways. Discovery of active site directed PTP1B inhibitors is very challenging due to highly conserved nature of the active site and multiple charge requirements of the ligands, which makes them non-selective and non-permeable. Identification of the PTP1B allosteric site has opened up new avenues for discovering potent and selective ligands for therapeutic intervention. Interactions made by potent allosteric inhibitor in the presence of PTP1B were studied using Molecular Dynamics (MD). Computationally optimized models were used to build separate pharmacophore models of PTP1B and TCPTP, respectively. Based on the nature of interactions the target residues offered, a receptor based pharmacophore was developed. The pharmacophore considering conformational flexibility of the residues was used for the development of pharmacophore hypothesis to identify potentially active inhibitors by screening large compound databases. Two pharmacophore were successively used in the virtual screening protocol to identify potential selective and permeable inhibitors of PTP1B. Allosteric inhibition mechanism of these molecules was established using molecular docking and MD methods. The geometrical criteria values confirmed their ability to stabilize PTP1B in an open conformation. 23 molecules that were identified as potential inhibitors were screened for PTP1B inhibitory activity. After screening, 10 molecules which have good permeability values were identified as potential inhibitors of PTP1B. This study confirms that selective and permeable inhibitors can be identified by targeting allosteric site of PTP1B.

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

Early Market Site Identification Data

DOE Data Explorer

Levi Kilcher

2016-04-01

This data was compiled for the 'Early Market Opportunity Hot Spot Identification' project. The data and scripts included were used in the 'MHK Energy Site Identification and Ranking Methodology' Reports (Part I: Wave, NREL Report #66038; Part II: Tidal, NREL Report #66079). The Python scripts will generate a set of results--based on the Excel data files--some of which were described in the reports. The scripts depend on the 'score_site' package, and the score site package depends on a number of standard Python libraries (see the score_site install instructions).

Targeting of Repeated Sequences Unique to a Gene Results in Significant Increases in Antisense Oligonucleotide Potency

PubMed Central

Vickers, Timothy A.; Freier, Susan M.; Bui, Huynh-Hoa; Watt, Andrew; Crooke, Stanley T.

2014-01-01

A new strategy for identifying potent RNase H-dependent antisense oligonucleotides (ASOs) is presented. Our analysis of the human transcriptome revealed that a significant proportion of genes contain unique repeated sequences of 16 or more nucleotides in length. Activities of ASOs targeting these repeated sites in several representative genes were compared to those of ASOs targeting unique single sites in the same transcript. Antisense activity at repeated sites was also evaluated in a highly controlled minigene system. Targeting both native and minigene repeat sites resulted in significant increases in potency as compared to targeting of non-repeated sites. The increased potency at these sites is a result of increased frequency of ASO/RNA interactions which, in turn, increases the probability of a productive interaction between the ASO/RNA heteroduplex and human RNase H1 in the cell. These results suggest a new, highly efficient strategy for rapid identification of highly potent ASOs. PMID:25334092

Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method.

PubMed

Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

2014-08-01

Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method

NASA Astrophysics Data System (ADS)

Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

2014-08-01

Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

Installation Restoration Program. Preliminary Assessment: 183rd Tactical Fighter Group, Illinois Air National Guard, Capital Airport, Springfield, Illinois

DTIC Science & Technology

1990-05-01

11140 Rockville Pike Rockville, Maryland 20852 Contract No. DLA 900-82-C-4426 Completed by Science & Technology, Inc. 704 South Illinois Avenue Suite C... Environments . .......... 111-19 IV. SITE EVALUATION...................v-i *A. Activity Review ................. v-i B. Disposal/Spill Site Identification...approximately 120 feet north of a small pond and creek located on the south side of the airport on airport property. The Base conducted operations at

Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

2004-08-06

Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.

PubMed

Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart

2014-01-15

High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter

Identification of inhibitors using a cell-based assay for monitoring Golgi-resident protease activity.

PubMed

Coppola, Julia M; Hamilton, Christin A; Bhojani, Mahaveer S; Larsen, Martha J; Ross, Brian D; Rehemtulla, Alnawaz

2007-05-01

Noninvasive real-time quantification of cellular protease activity allows monitoring of enzymatic activity and identification of activity modulators within the protease's natural milieu. We developed a protease activity assay based on differential localization of a recombinant reporter consisting of a Golgi retention signal and a protease cleavage sequence fused to alkaline phosphatase (AP). When expressed in mammalian cells, this protein localizes to Golgi bodies and, on protease-mediated cleavage, AP translocates to the extracellular medium where its activity is measured. We used this system to monitor the Golgi-associated protease furin, a pluripotent enzyme with a key role in tumorigenesis, viral propagation of avian influenza, ebola, and HIV as well as in activation of anthrax, pseudomonas, and diphtheria toxins. This technology was adapted for high-throughput screening of 39,000-compound small molecule libraries, leading to identification of furin inhibitors. Furthermore, this strategy was used to identify inhibitors of another Golgi protease, the beta-site amyloid precursor protein (APP)-cleaving enzyme (BACE). BACE cleavage of the APP leads to formation of the Abeta peptide, a key event that leads to Alzheimer's disease. In conclusion, we describe a customizable noninvasive technology for real-time assessment of Golgi protease activity used to identify inhibitors of furin and BACE.

Identification of inhibitors using a cell based assay for monitoring golgi-resident protease activity

PubMed Central

Coppola, Julia M.; Hamilton, Christin A.; Bhojani, Mahaveer S.; Larsen, Martha J.; Ross, Brian D.; Rehemtulla, Alnawaz

2007-01-01

Non-invasive real time quantification of cellular protease activity allows monitoring of enzymatic activity and identification of activity modulators within the protease’s natural milieu. We developed a protease-activity assay based on differential localization of a recombinant reporter consisting of a Golgi retention signal and a protease cleavage sequence fused to alkaline phosphatase (AP). When expressed in mammalian cells, this protein localizes to Golgi bodies and, upon protease mediated cleavage, AP translocates to the extracellular medium where its activity is measured. We used this system to monitor the Golgi-associated protease furin, a pluripotent enzyme with a key role in tumorigenesis, viral propagation of avian influenza, ebola, and HIV, and in activation of anthrax, pseudomonas, and diphtheria toxins. This technology was adapted for high throughput screening of 30,000 compound small molecule libraries, leading to identification of furin inhibitors. Further, this strategy was utilized to identify inhibitors of another Golgi protease, the β-site APP-cleaving enzyme (BACE). BACE cleavage of the amyloid precursor protein leads to formation of the Aβ peptide, a key event that leads to Alzheimer’s disease. In conclusion, we describe a customizable, non-invasive technology for real time assessment of Golgi protease activity used to identify inhibitors of furin and BACE. PMID:17316541

Enzyme/non-enzyme discrimination and prediction of enzyme active site location using charge-based methods.

PubMed

Bate, Paul; Warwicker, Jim

2004-07-02

Calculations of charge interactions complement analysis of a characterised active site, rationalising pH-dependence of activity and transition state stabilisation. Prediction of active site location through large DeltapK(a)s or electrostatic strain is relevant for structural genomics. We report a study of ionisable groups in a set of 20 enzymes, finding that false positives obscure predictive potential. In a larger set of 156 enzymes, peaks in solvent-space electrostatic properties are calculated. Both electric field and potential match well to active site location. The best correlation is found with electrostatic potential calculated from uniform charge density over enzyme volume, rather than from assignment of a standard atom-specific charge set. Studying a shell around each molecule, for 77% of enzymes the potential peak is within that 5% of the shell closest to the active site centre, and 86% within 10%. Active site identification by largest cleft, also with projection onto a shell, gives 58% of enzymes for which the centre of the largest cleft lies within 5% of the active site, and 70% within 10%. Dielectric boundary conditions emphasise clefts in the uniform charge density method, which is suited to recognition of binding pockets embedded within larger clefts. The variation of peak potential with distance from active site, and comparison between enzyme and non-enzyme sets, gives an optimal threshold distinguishing enzyme from non-enzyme. We find that 87% of the enzyme set exceeds the threshold as compared to 29% of the non-enzyme set. Enzyme/non-enzyme homologues, "structural genomics" annotated proteins and catalytic/non-catalytic RNAs are studied in this context.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Zhiyi; Chen, Guangxu; Li, Yanbin

Identification of active sites for catalytic processes has both fundamental and technological implications for rational design of future catalysts. Herein, we study the active surfaces of layered lithium cobalt oxide (LCO) for the oxygen evolution reaction (OER) using the enhancement effect of electrochemical delithiation (De-LCO). Our theoretical results indicate that the most stable (0001) surface has a very large overpotential for OER independent of lithium content. In contrast, edge sites such as the nonpolar (1120) and polar (0112) surfaces are predicted to be highly active and dependent on (de)lithiation. The effect of lithium extraction from LCO on the surfaces andmore » their OER activities can be understood by the increase of Co 4+ sites relative to Co 3+ and by the shift of active oxygen 2p states. Experimentally, it is demonstrated that LCO nanosheets, which dominantly expose the (0001) surface show negligible OER enhancement upon delithiation. However, a noticeable increase in OER activity (~0.1 V in overpotential shift at 10 mA cm –2) is observed for the LCO nanoparticles, where the basal plane is greatly diminished to expose the edge sites, consistent with the theoretical simulations. In addition, we find that the OER activity of De-LCO nanosheets can be improved if we adopt an acid etching method on LCO to create more active edge sites, which in turn provides a strong evidence for the theoretical indication.« less

Identification and Characterization of Sites Where Persistent Atrial Fibrillation Is Terminated by Localized Ablation.

PubMed

Zaman, Junaid A B; Sauer, William H; Alhusseini, Mahmood I; Baykaner, Tina; Borne, Ryan T; Kowalewski, Christopher A B; Busch, Sonia; Zei, Paul C; Park, Shirley; Viswanathan, Mohan N; Wang, Paul J; Brachmann, Johannes; Krummen, David E; Miller, John M; Rappel, Wouter Jan; Narayan, Sanjiv M; Peters, Nicholas S

2018-01-01

The mechanisms by which persistent atrial fibrillation (AF) terminates via localized ablation are not well understood. To address the hypothesis that sites where localized ablation terminates persistent AF have characteristics identifiable with activation mapping during AF, we systematically examined activation patterns acquired only in cases of unequivocal termination by ablation. We recruited 57 patients with persistent AF undergoing ablation, in whom localized ablation terminated AF to sinus rhythm or organized tachycardia. For each site, we performed an offline analysis of unprocessed unipolar electrograms collected during AF from multipolar basket catheters using the maximum -dV/dt assignment to construct isochronal activation maps for multiple cycles. Additional computational modeling and phase analysis were used to study mechanisms of map variability. At all sites of AF termination, localized repetitive activation patterns were observed. Partial rotational circuits were observed in 26 of 57 (46%) cases, focal patterns in 19 of 57 (33%), and complete rotational activity in 12 of 57 (21%) cases. In computer simulations, incomplete segments of partial rotations coincided with areas of slow conduction characterized by complex, multicomponent electrograms, and variations in assigning activation times at such sites substantially altered mapped mechanisms. Local activation mapping at sites of termination of persistent AF showed repetitive patterns of rotational or focal activity. In computer simulations, complete rotational activation sequence was observed but was sensitive to assignment of activation timing particularly in segments of slow conduction. The observed phenomena of repetitive localized activation and the mechanism by which local ablation terminates putative AF drivers require further investigation. © 2018 American Heart Association, Inc.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

Identification of new allosteric sites and modulators of AChE through computational and experimental tools.

PubMed

Roca, Carlos; Requena, Carlos; Sebastián-Pérez, Víctor; Malhotra, Sony; Radoux, Chris; Pérez, Concepción; Martinez, Ana; Antonio Páez, Juan; Blundell, Tom L; Campillo, Nuria E

2018-12-01

Allosteric sites on proteins are targeted for designing more selective inhibitors of enzyme activity and to discover new functions. Acetylcholinesterase (AChE), which is most widely known for the hydrolysis of the neurotransmitter acetylcholine, has a peripheral allosteric subsite responsible for amyloidosis in Alzheimer's disease through interaction with amyloid β-peptide. However, AChE plays other non-hydrolytic functions. Here, we identify and characterise using computational tools two new allosteric sites in AChE, which have allowed us to identify allosteric inhibitors by virtual screening guided by structure-based and fragment hotspot strategies. The identified compounds were also screened for in vitro inhibition of AChE and three were observed to be active. Further experimental (kinetic) and computational (molecular dynamics) studies have been performed to verify the allosteric activity. These new compounds may be valuable pharmacological tools in the study of non-cholinergic functions of AChE.

Installation-restoration program. Preliminary assessment: 201st Red Horse, Civil Engineering Flight, Fort Indiantown Gap Air National Guard Station, Pennsylvania Air National Guard, Annville, Pennsylvania

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1991-02-01

The preliminary assessment included the following activities: (1) An on-site visit, including interviews and field surveys; (2) Acquisition and analysis of information on past hazardous materials use, waste generation, and waste disposal at the Station; (3) Acquisition and analysis of available geological surveys, hydrological data, meteorological data, and environmental data; and (4) The identification and assessment of sites where contamination of soils, ground water and/or surface water may have occurred. Operations that have involved the use of hazardous materials and the disposal of hazardous wastes include vehicle maintenance and aerospace ground equipment (AGE) maintenance. The hazardous wastes disposed of throughmore » these operations include varying quantities of petroleum-oil-lubricant (POL) products, acids, paints, thinners, strippers, and solvents. The field surveys and interviews resulted in the identification of three sites that exhibit the potential for migration of contaminants due to leakage or seepage from landfills and storage tanks.« less

System-wide identification of wild-type SUMO-2 conjugation sites

PubMed Central

Hendriks, Ivo A.; D'Souza, Rochelle C.; Chang, Jer-Gung; Mann, Matthias; Vertegaal, Alfred C. O.

2015-01-01

SUMOylation is a reversible post-translational modification (PTM) regulating all nuclear processes. Identification of SUMOylation sites by mass spectrometry (MS) has been hampered by bulky tryptic fragments, which thus far necessitated the use of mutated SUMO. Here we present a SUMO-specific protease-based methodology which circumvents this problem, dubbed Protease-Reliant Identification of SUMO Modification (PRISM). PRISM allows for detection of SUMOylated proteins as well as identification of specific sites of SUMOylation while using wild-type SUMO. The method is generic and could be widely applied to study lysine PTMs. We employ PRISM in combination with high-resolution MS to identify SUMOylation sites from HeLa cells under standard growth conditions and in response to heat shock. We identified 751 wild-type SUMOylation sites on endogenous proteins, including 200 dynamic SUMO sites in response to heat shock. Thus, we have developed a method capable of quantitatively studying wild-type mammalian SUMO at the site-specific and system-wide level. PMID:26073453

Revised description of index of Florida water data collection active stations and a user's guide for station or site information retrieval computer program FINDEX H578

USGS Publications Warehouse

Geiger, Linda H.

1983-01-01

The report is an update of U.S. Geological Survey Open-File Report 77-703, which described a retrieval program for administrative index of active data-collection sites in Florida. Extensive changes to the Findex system have been made since 1977 , making the previous report obsolete. A description of the data base and computer programs that are available in the Findex system are documented in this report. This system serves a vital need in the administration of the many and diverse water-data collection activities. District offices with extensive data-collection activities will benefit from the documentation of the system. Largely descriptive, the report tells how a file of computer card images has been established which contains entries for all sites in Florida at which there is currently a water-data collection activity. Entries include information such as identification number, station name, location, type of site, county, frequency of data collection, funding, and other pertinent details. The computer program FINDEX selectively retrieves entries and lists them in a format suitable for publication. The index is updated routinely. (USGS)

Physical-Habitat and Geomorphic Data for Selected River Reaches in Central Arizona Basins, 1995-98

DTIC Science & Technology

2000-01-01

identification purposes only and does not constitute endorsement by the U.S. Geological Survey. Information regarding research and data-collection programs of...of measurement sites for Central Arizona Basins study area [<, less than] Site number (see fig. 1) Site name Station- identification number Latitude...measurements of instream characteristics, solar contribution to the system, and identification of riparian vegetation. The methods used to measure

Self-identification and empathy modulate error-related brain activity during the observation of penalty shots between friend and foe

PubMed Central

Ganesh, Shanti; van Schie, Hein T.; De Bruijn, Ellen R. A.; Bekkering, Harold

2009-01-01

The ability to detect and process errors made by others plays an important role is many social contexts. The capacity to process errors is typically found to rely on sites in the medial frontal cortex. However, it remains to be determined whether responses at these sites are driven primarily by action errors themselves or by the affective consequences normally associated with their commission. Using an experimental paradigm that disentangles action errors and the valence of their affective consequences, we demonstrate that sites in the medial frontal cortex (MFC), including the ventral anterior cingulate cortex (vACC) and pre-supplementary motor area (pre-SMA), respond to action errors independent of the valence of their consequences. The strength of this response was negatively correlated with the empathic concern subscale of the Interpersonal Reactivity Index. We also demonstrate a main effect of self-identification by showing that errors committed by friends and foes elicited significantly different BOLD responses in a separate region of the middle anterior cingulate cortex (mACC). These results suggest that the way we look at others plays a critical role in determining patterns of brain activation during error observation. These findings may have important implications for general theories of error processing. PMID:19015079

Identifying the Active Surfaces of Electrochemically Tuned LiCoO 2 for Oxygen Evolution Reaction

DOE PAGES

Lu, Zhiyi; Chen, Guangxu; Li, Yanbin; ...

2017-04-18

Identification of active sites for catalytic processes has both fundamental and technological implications for rational design of future catalysts. Herein, we study the active surfaces of layered lithium cobalt oxide (LCO) for the oxygen evolution reaction (OER) using the enhancement effect of electrochemical delithiation (De-LCO). Our theoretical results indicate that the most stable (0001) surface has a very large overpotential for OER independent of lithium content. In contrast, edge sites such as the nonpolar (1120) and polar (0112) surfaces are predicted to be highly active and dependent on (de)lithiation. The effect of lithium extraction from LCO on the surfaces andmore » their OER activities can be understood by the increase of Co 4+ sites relative to Co 3+ and by the shift of active oxygen 2p states. Experimentally, it is demonstrated that LCO nanosheets, which dominantly expose the (0001) surface show negligible OER enhancement upon delithiation. However, a noticeable increase in OER activity (~0.1 V in overpotential shift at 10 mA cm –2) is observed for the LCO nanoparticles, where the basal plane is greatly diminished to expose the edge sites, consistent with the theoretical simulations. In addition, we find that the OER activity of De-LCO nanosheets can be improved if we adopt an acid etching method on LCO to create more active edge sites, which in turn provides a strong evidence for the theoretical indication.« less

Identification of the In Vivo Phosphorylation Sites of the Ras Suppressor Rsu-1

DTIC Science & Technology

2000-12-11

to phosphatidic acid (PA). Ras activation of the Raf serine/threonine kinases and activation of the MAPKs remains an important component of Ras...of either phospholipase C isofonns to yield DAG, or phospholipase D to yield phosphatidic acid and then DAG. Diacylglycerol is the key "on" switch...Rsu-I is phosphorylated in vivo in response to growth factor and TPA , a known activator of PKC. Phosphoamino acid analysis of Rsu- I suggests that

Comparative Bioinformatic Analysis of Active Site Structures in Evolutionarily Remote Homologues of α,β-Hydrolase Superfamily Enzymes.

PubMed

Suplatov, D A; Arzhanik, V K; Svedas, V K

2011-01-01

Comparative bioinformatic analysis is the cornerstone of the study of enzymes' structure-function relationship. However, numerous enzymes that derive from a common ancestor and have undergone substantial functional alterations during natural selection appear not to have a sequence similarity acceptable for a statistically reliable comparative analysis. At the same time, their active site structures, in general, can be conserved, while other parts may largely differ. Therefore, it sounds both plausible and appealing to implement a comparative analysis of the most functionally important structural elements - the active site structures; that is, the amino acid residues involved in substrate binding and the catalytic mechanism. A computer algorithm has been developed to create a library of enzyme active site structures based on the use of the PDB database, together with programs of structural analysis and identification of functionally important amino acid residues and cavities in the enzyme structure. The proposed methodology has been used to compare some α,β-hydrolase superfamily enzymes. The insight has revealed a high structural similarity of catalytic site areas, including the conservative organization of a catalytic triad and oxyanion hole residues, despite the wide functional diversity among the remote homologues compared. The methodology can be used to compare the structural organization of the catalytic and substrate binding sites of various classes of enzymes, as well as study enzymes' evolution and to create of a databank of enzyme active site structures.

Identification of specific sites in the third intracellular loop and carboxyl terminus of the Bombyx mori PBAN receptor crucial for ligand-induced internalization

USDA-ARS?s Scientific Manuscript database

Sex pheromone production in most moths is mediated by the pheromone biosynthesis activating neuropeptide receptor (PBANR). Similar to other rhodopsin-like G protein-coupled receptors, the silkmoth Bombyx mori PBANR (BmPBANR) undergoes agonist-induced internalization. Despite interest in developing...

Chelation and effectiveness of salicylate related compounds on pyresis, sedimentation rate and hematocrit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schubert, J.; Rosenthal, M.W.; Fried, J.F.

1984-01-01

The mechanism of action and identification of sites of salicylates and related compounds in antipyresis were studied. Structure-activity investigations of antipyresis were made using Sprague-Dawley rats. Results showed copper was chelated by the salicylate, passes through the cell membrane, and repairs the lesion. 13 references, 2 figures. (ACR)

On-line LC-MS approach combining collision-induced dissociation (CID), electron-transfer dissociation (ETD), and CID of an isolated charge-reduced species for the trace-level characterization of proteins with post-translational modifications.

PubMed

Wu, Shiaw-Lin; Hühmer, Andreas F R; Hao, Zhiqi; Karger, Barry L

2007-11-01

We have expanded our recent on-line LC-MS platform for large peptide analysis to combine collision-induced dissociation (CID), electron-transfer dissociation (ETD), and CID of an isolated charge-reduced (CRCID) species derived from ETD to determine sites of phosphorylation and glycosylation modifications, as well as the sequence of large peptide fragments (i.e., 2000-10,000 Da) from complex proteins, such as beta-casein, epidermal growth factor receptor (EGFR), and tissue plasminogen activator (t-PA) at the low femtomol level. The incorporation of an additional CID activation step for a charge-reduced species, isolated from ETD fragment ions, improved ETD fragmentation when precursor ions with high m/z (approximately >1000) were automatically selected for fragmentation. Specifically, the identification of the exact phosphorylation sites was strengthened by the extensive coverage of the peptide sequence with a near-continuous product ion series. The identification of N-linked glycosylation sites in EGFR and an O-linked glycosylation site in t-PA were also improved through the enhanced identification of the peptide backbone sequence of the glycosylated precursors. The new strategy is a good starting survey scan to characterize enzymatic peptide mixtures over a broad range of masses using LC-MS with data-dependent acquisition, as the three activation steps can provide complementary information to each other. In general, large peptides can be extensively characterized by the ETD and CRCID steps, including sites of modification from the generated, near-continuous product ion series, supplemented by the CID-MS2 step. At the same time, small peptides (e.g.,

Stressor Identification (Si) at Contaminated Sites: Upper Arkansas River, Colorado (Final)

EPA Science Inventory

EPA announced the availability of the final report, Stressor Identification (SI) at Contaminated Sites: Upper Arkansas River, Colorado. This report describes a causal assessment for impairments of plant growth and plant species richness at a terrestrial contaminated site ...

Identification of New Drug Targets in Multi-Drug Resistant Bacterial Infections

DTIC Science & Technology

2013-10-01

observation allowed us to improve the substrate specificity assay and identify that threonine serves as an optimal substrate in the pyrophosphate exchange...activity was obtained, and the activity now seems to be optimal with the small hydroxyl containing amino acids threonine and serine. These... diabetic ulcers are favored sites of infection (6, 7). A. baumannii has also been shown to cause infections outside the health care setting, namely, severe

[Identification of meeting places of sexual partners in 2 cities of the Southern Mexican borders, using the PLACE method].

PubMed

Negroni-Belén, Mirka; Vargas-Guadarrama, Galileo; Rueda-Neria, Celina Magally; Bassett-Hileman, Sarah; Weir, Sharon; Bronfman, Mario

2003-01-01

To identify the meeting sites of new sexual partners in two Southern border cities in Mexico. A descriptive epidemiologic study was carried out in May 2001, by surveying key informants in two border cities. Each reported site was visited to interview a resident subject. Subjects socializing in a subsample of sites were also interviewed. The key informants of the community reported 134 meeting sites in Chetumal and 111 in Ciudad Hidalgo. Both sites had scarce HIV/AIDS prevention activities. Characteristics were obtained for 89 sites in Chetumal and 42 in Ciudad Hidalgo. Almost 21% of interviewees reportedly met a new sexual partner in these sites in the past four weeks. Preventive actions are needed in meeting sites of new sexual partners. This method may provide information to plan for future interventions. The English version of this paper is available too at:http://www.insp.mx/salud/index.html.

Identification of Anaerobic Aniline-Degrading Bacteria at a Contaminated Industrial Site.

PubMed

Sun, Weimin; Li, Yun; McGuinness, Lora R; Luo, Shuai; Huang, Weilin; Kerkhof, Lee J; Mack, E Erin; Häggblom, Max M; Fennell, Donna E

2015-09-15

Anaerobic aniline biodegradation was investigated under different electron-accepting conditions using contaminated canal and groundwater aquifer sediments from an industrial site. Aniline loss was observed in nitrate- and sulfate-amended microcosms and in microcosms established to promote methanogenic conditions. Lag times of 37 days (sulfate amended) to more than 100 days (methanogenic) were observed prior to activity. Time-series DNA-stable isotope probing (SIP) was used to identify bacteria that incorporated (13)C-labeled aniline in the microcosms established to promote methanogenic conditions. In microcosms from heavily contaminated aquifer sediments, a phylotype with 92.7% sequence similarity to Ignavibacterium album was identified as a dominant aniline degrader as indicated by incorporation of (13)C-aniline into its DNA. In microcosms from contaminated canal sediments, a bacterial phylotype within the family Anaerolineaceae, but without a match to any known genus, demonstrated the assimilation of (13)C-aniline. Acidovorax spp. were also identified as putative aniline degraders in both of these two treatments, indicating that these species were present and active in both the canal and aquifer sediments. There were multiple bacterial phylotypes associated with anaerobic degradation of aniline at this complex industrial site, which suggests that anaerobic transformation of aniline is an important process at the site. Furthermore, the aniline degrading phylotypes identified in the current study are not related to any known aniline-degrading bacteria. The identification of novel putative aniline degraders expands current knowledge regarding the potential fate of aniline under anaerobic conditions.

Identification of a Pyridoxine-Derived Small-Molecule Inhibitor Targeting Dengue Virus RNA-Dependent RNA Polymerase.

PubMed

Xu, Hong-Tao; Colby-Germinario, Susan P; Hassounah, Said; Quashie, Peter K; Han, Yingshan; Oliveira, Maureen; Stranix, Brent R; Wainberg, Mark A

2016-01-01

The viral RNA-dependent RNA polymerase (RdRp) activity of the dengue virus (DENV) NS5 protein is an attractive target for drug design. Here, we report the identification of a novel class of inhibitor (i.e., an active-site metal ion chelator) that acts against DENV RdRp activity. DENV RdRp utilizes a two-metal-ion mechanism of catalysis; therefore, we constructed a small library of compounds, through mechanism-based drug design, aimed at chelating divalent metal ions in the catalytic site of DENV RdRp. We now describe a pyridoxine-derived small-molecule inhibitor that targets DENV RdRp and show that 5-benzenesulfonylmethyl-3-hydroxy-4-hydroxymethyl-pyridine-2-carboxylic acid hydroxyamide (termed DMB220) inhibited the RdRp activity of DENV serotypes 1 to 4 at low micromolar 50% inhibitory concentrations (IC50s of 5 to 6.7 μM) in an enzymatic assay. The antiviral activity of DMB220 against DENV infection was also verified in a cell-based assay and showed a 50% effective concentration (EC50) of <3 μM. Enzyme assays proved that DMB220 was competitive with nucleotide incorporation. DMB220 did not inhibit the enzymatic activity of recombinant HIV-1 reverse transcriptase and showed only weak inhibition of HIV-1 integrase strand transfer activity, indicating high specificity for DENV RdRp. S600T substitution in the DENV RdRp, which was previously shown to confer resistance to nucleoside analogue inhibitors (NI), conferred 3-fold hypersusceptibility to DMB220, and enzymatic analyses showed that this hypersusceptibility may arise from the decreased binding/incorporation efficiency of the natural NTP substrate without significantly impacting inhibitor binding. Thus, metal ion chelation at the active site of DENV RdRp represents a viable anti-DENV strategy, and DMB220 is the first of a new class of DENV inhibitor. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Murine and human CFTR exhibit different sensitivities to CFTR potentiators

PubMed Central

Cui, Guiying

2015-01-01

Development of therapeutic molecules with clinical efficacy as modulators of defective CFTR includes efforts to identify potentiators that can overcome or repair the gating defect in mutant CFTR channels. This has taken a great leap forward with the identification of the potentiator VX-770, now available to patients as “Kalydeco.” Other small molecules with different chemical structure also are capable of potentiating the activity of either wild-type or mutant CFTR, suggesting that there are features of the protein that may be targeted to achieve stimulation of channel activity by structurally diverse compounds. However, neither the mechanisms by which these compounds potentiate mutant CFTR nor the site(s) where these compounds bind have been identified. This knowledge gap partly reflects the lack of appropriate experimental models to provide clues toward the identification of binding sites. Here, we have compared the channel behavior and response to novel and known potentiators of human CFTR (hCFTR) and murine (mCFTR) expressed in Xenopus oocytes. Both hCFTR and mCFTR were blocked by GlyH-101 from the extracellular side, but mCFTR activity was increased with GlyH-101 applied directly to the cytoplasmic side. Similarly, glibenclamide only exhibited a blocking effect on hCFTR but both blocked and potentiated mCFTR in excised membrane patches and in intact oocytes. The clinically used CFTR potentiator VX-770 transiently increased hCFTR by ∼13% but potentiated mCFTR significantly more strongly. Our results suggest that mCFTR pharmacological sensitivities differ from hCFTR, which will provide a useful tool for identifying the binding sites and mechanism for these potentiators. PMID:26209275

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

PubMed Central

Pierce, M L; Ruffner, D E

1998-01-01

Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

Identification of novel antilipogenic agents targeting fatty acid biosynthesis through structure-based virtual screening.

PubMed

Soulère, Laurent; Alix, Pascaline M; Croze, Marine L; Soulage, Christophe O

2018-04-10

An Asinex Gold Platinium chemical library subset of 12 055 compounds was screened employing docking simulations in the active site of the human FAS KS domain. Among them, 13 compounds were further evaluated for their ability to inhibit fatty acid biosynthesis. Four compounds were found to be active in particular ASN05064661 and ASN05374526 with IC50 values of 6.6 and 10.5 μm, respectively. A binding mode study was further conducted with these two compounds structurally related to benzene sulfonamide and aromatic polyamide. This study showed that they fit tightly with the active site with several interactions, notably with the key residues Cys161, His293, and His331. © 2018 John Wiley & Sons A/S.

Direct atomic-level insight into the active sites of a high-performance PGM-free ORR catalyst

NASA Astrophysics Data System (ADS)

Chung, Hoon T.; Cullen, David A.; Higgins, Drew; Sneed, Brian T.; Holby, Edward F.; More, Karren L.; Zelenay, Piotr

2017-08-01

Platinum group metal-free (PGM-free) metal-nitrogen-carbon catalysts have emerged as a promising alternative to their costly platinum (Pt)-based counterparts in polymer electrolyte fuel cells (PEFCs) but still face some major challenges, including (i) the identification of the most relevant catalytic site for the oxygen reduction reaction (ORR) and (ii) demonstration of competitive PEFC performance under automotive-application conditions in the hydrogen (H2)-air fuel cell. Herein, we demonstrate H2-air performance gains achieved with an iron-nitrogen-carbon catalyst synthesized with two nitrogen precursors that developed hierarchical porosity. Current densities recorded in the kinetic region of cathode operation, at fuel cell voltages greater than ~0.75 V, were the same as those obtained with a Pt cathode at a loading of 0.1 milligram of Pt per centimeter squared. The proposed catalytic active site, carbon-embedded nitrogen-coordinated iron (FeN4), was directly visualized with aberration-corrected scanning transmission electron microscopy, and the contributions of these active sites associated with specific lattice-level carbon structures were explored computationally.

Direct atomic-level insight into the active sites of a high-performance PGM-free ORR catalyst

DOE PAGES

Chung, Hoon T.; Cullen, David A.; Higgins, Drew; ...

2017-08-04

Platinum group metal–free (PGM-free) metal-nitrogen-carbon catalysts have emerged as a promising alternative to their costly platinum (Pt)–based counterparts in polymer electrolyte fuel cells (PEFCs) but still face some major challenges, including (i) the identification of the most relevant catalytic site for the oxygen reduction reaction (ORR) and (ii) demonstration of competitive PEFC performance under automotive-application conditions in the hydrogen (H 2)–air fuel cell. We demonstrate H 2-air performance gains achieved with an iron-nitrogen-carbon catalyst synthesized with two nitrogen precursors that developed hierarchical porosity. In current densities recorded in the kinetic region of cathode operation, at fuel cell voltages greater thanmore » ~0.75 V, were the same as those obtained with a Pt cathode at a loading of 0.1 milligram of Pt per centimeter squared. The catalytic active site we proposed, carbon-embedded nitrogen-coordinated iron (FeN 4), was directly visualized with aberration-corrected scanning transmission electron microscopy, and the contributions of these active sites associated with specific lattice-level carbon structures were explored computationally.« less

Identification of Bacteria Synthesizing Ribosomal RNA in Response to Uranium Addition During Biostimulation at the Rifle, CO Integrated Field Research Site

PubMed Central

McGuinness, Lora R.; Wilkins, Michael J.; Williams, Kenneth H.; Long, Philip E.; Kerkhof, Lee J.

2015-01-01

Understanding which organisms are capable of reducing uranium at historically contaminated sites provides crucial information needed to evaluate treatment options and outcomes. One approach is determination of the bacteria which directly respond to uranium addition. In this study, uranium amendments were made to groundwater samples from a site of ongoing biostimulation with acetate. The active microbes in the planktonic phase were deduced by monitoring ribosomes production via RT-PCR. The results indicated several microorganisms were synthesizing ribosomes in proportion with uranium amendment up to 2 μM. Concentrations of U (VI) >2 μM were generally found to inhibit ribosome synthesis. Two active bacteria responding to uranium addition in the field were close relatives of Desulfobacter postgateii and Geobacter bemidjiensis. Since RNA content often increases with growth rate, our findings suggest it is possible to rapidly elucidate active bacteria responding to the addition of uranium in field samples and provides a more targeted approach to stimulate specific populations to enhance radionuclide reduction in contaminated sites. PMID:26382047

Taqman real-time quantitative PCR for identification of western flower thrip (Frankliniella occidentalis) for plant quarantine

PubMed Central

Huang, K. S.; Lee, S. E.; Yeh, Y.; Shen, G. S.; Mei, E.; Chang, C. M.

2010-01-01

Western flower thrip (Frankliniella occidentalis) is a major global pest of agricultural products. It directly damages crops through feeding, oviposition activity or transmission of several plant viruses. We describe a Taqman real-time quantitative PCR detection system, which can rapidly identify F. occidentalis from thrips larvae to complement the traditional morphological identification. The data showed that our detection system targeted on the ribosomal RNA gene regions of F. occidentalis has high sensitivity and specificity. The rapid method can be used for on-site testing of samples at ports-of-entry in the future. PMID:20129946

Taqman real-time quantitative PCR for identification of western flower thrip (Frankliniella occidentalis) for plant quarantine.

PubMed

Huang, K S; Lee, S E; Yeh, Y; Shen, G S; Mei, E; Chang, C M

2010-08-23

Western flower thrip (Frankliniella occidentalis) is a major global pest of agricultural products. It directly damages crops through feeding, oviposition activity or transmission of several plant viruses. We describe a Taqman real-time quantitative PCR detection system, which can rapidly identify F. occidentalis from thrips larvae to complement the traditional morphological identification. The data showed that our detection system targeted on the ribosomal RNA gene regions of F. occidentalis has high sensitivity and specificity. The rapid method can be used for on-site testing of samples at ports-of-entry in the future.

Identification and characterization of the sodium-binding site of activated protein C.

PubMed

He, X; Rezaie, A R

1999-02-19

Activated protein C (APC) requires both Ca2+ and Na+ for its optimal catalytic function. In contrast to the Ca2+-binding sites, the Na+-binding site(s) of APC has not been identified. Based on a recent study with thrombin, the 221-225 loop is predicted to be a potential Na+-binding site in APC. The sequence of this loop is not conserved in trypsin. We engineered a Gla domainless form of protein C (GDPC) in which the 221-225 loop was replaced with the corresponding loop of trypsin. We found that activated GDPC (aGDPC) required Na+ (or other alkali cations) for its amidolytic activity with dissociation constant (Kd(app)) = 44.1 +/- 8.6 mM. In the presence of Ca2+, however, the requirement for Na+ by aGDPC was eliminated, and Na+ stimulated the cleavage rate 5-6-fold with Kd(app) = 2.3 +/- 0.3 mM. Both cations were required for efficient factor Va inactivation by aGDPC. In the presence of Ca2+, the catalytic function of the mutant was independent of Na+. Unlike aGDPC, the mutant did not discriminate among monovalent cations. We conclude that the 221-225 loop is a Na+-binding site in APC and that an allosteric link between the Na+ and Ca2+ binding loops modulates the structure and function of this anticoagulant enzyme.

U.S. Geological Survey research in radioactive waste disposal - Fiscal years 1983, 1984, and 1985

USGS Publications Warehouse

Dinwiddie, G.A.; Trask, N.J.

1986-01-01

The report summarizes progress on geologic and hydrologic research related to the disposal of radioactive wastes. The research is described according to whether it is related most directly to: (1) high-level and transuranic wastes, (2) low-level wastes, or (3) uranium mill tailings. Included is research applicable to the identification and geohydrologic characterization of waste-disposal sites, to investigations of specific sites where wastes have been stored, and to studies of regions or environments where waste-disposal sites might be located. A significant part of the activity is concerned with techniques and methods for characterizing disposal sites and studies of geologic and hydrologic processes related to the transport and (or) retention of waste radionuclides.

Expanding the Nucleotide and Sugar 1-Phosphate Promiscuity of Nucleotidyltransferase RmlA via Directed Evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moretti, Rocco; Chang, Aram; Peltier-Pain, Pauline

2012-03-15

Directed evolution is a valuable technique to improve enzyme activity in the absence of a priori structural knowledge, which can be typically enhanced via structure-guided strategies. In this study, a combination of both whole-gene error-prone polymerase chain reaction and site-saturation mutagenesis enabled the rapid identification of mutations that improved RmlA activity toward non-native substrates. These mutations have been shown to improve activities over 10-fold for several targeted substrates, including non-native pyrimidine- and purine-based NTPs as well as non-native d- and l-sugars (both a- and b-isomers). This study highlights the first broadly applicable high throughput sugar-1-phosphate nucleotidyltransferase screen and the firstmore » proof of concept for the directed evolution of this enzyme class toward the identification of uniquely permissive RmlA variants.« less

SITEHOUND-web: a server for ligand binding site identification in protein structures.

PubMed

Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

2009-07-01

SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

Identification of in vivo phosphorylation sites on human deoxycytidine kinase. Role of Ser-74 in the control of enzyme activity.

PubMed

Smal, Caroline; Vertommen, Didier; Bertrand, Luc; Ntamashimikiro, Sandrine; Rider, Mark H; Van Den Neste, Eric; Bontemps, Françoise

2006-02-24

Deoxycytidine kinase (dCK) catalyzes the rate-limiting step of the deoxyribonucleoside salvage pathway in mammalian cells and plays a key role in the activation of numerous nucleoside analogues used in anti-cancer and antiviral chemotherapy. Although compelling evidence indicated that dCK activity might be regulated by phosphorylation/dephosphorylation, direct demonstration was lacking. Here we showed that dCK overexpressed in HEK 293T cells was labeled after incubating the cells with [32P]orthophosphate. Sorbitol, which was reported to decrease dCK activity, also decreased the labeling of dCK. These results indicated that dCK may exist as a phosphoprotein in vivo and that its activity can be correlated with its phosphorylation level. After purification of 32P-labeled dCK, digestion by trypsin, and analysis of the radioactive peptides by tandem mass spectrometry, the following four in vivo phosphorylation sites were identified: Thr-3, Ser-11, Ser-15, and Ser-74, the latter being the major phosphorylation site. Site-directed mutagenesis and use of an anti-phospho-Ser-74 antibody demonstrated that Ser-74 phosphorylation was crucial for dCK activity in HEK 293T cells, whereas phosphorylation of other identified sites did not seem essential. Phosphorylation of Ser-74 was also detected on endogenous dCK in leukemic cells, in which the Ser-74 phosphorylation state was increased by agents that enhanced dCK activity. Our study provided direct evidence that dCK activity can be controlled by phosphorylation in intact cells and highlights the importance of Ser-74 for dCK activity.

Molecular identification and in vitro antifungal susceptibility of Scedosporium complex isolates from high-human-activity sites in Mexico.

PubMed

Elizondo-Zertuche, Mariana; de J Treviño-Rangel, Rogelio; Robledo-Leal, Efrén; Luna-Rodríguez, Carolina E; Martínez-Fierro, Margarita L; Rodríguez-Sánchez, Iram P; González, Gloria M

2017-01-01

The genus Scedosporium is a complex of ubiquitous moulds associated with a wide spectrum of clinical entities, with high mortality principally in immunocompromised hosts. Ecology of these microorganisms has been studied performing isolations from environmental sources, showing a preference for human-impacted environments. This study aimed to evaluate the presence and antifungal susceptibility of Scedosporium complex species in soil samples collected in high-human-activity sites of Mexico. A total of 97 soil samples from 25 Mexican states were collected. Identifications were performed by microscopic morphology and confirmed by sequencing of the rDNA (internal transcribed spacer [ITS], D1/D2) and β-tubulin partial loci. Antifungal susceptibility testing was performed according to the Clinical and Laboratory Standards Institute (CLSI) protocols. Soil samples of urban gardens and industrial parks constituted the best sources for isolation of Scedosporium complex species. S. apiospermum sensu stricto was the most prevalent species (69%), followed by S. boydii (16%). Voriconazole (minimal inhibitory concentration [MIC] geometric mean ≤2.08 µg/mL), followed by posaconazole (MIC geometric mean ≤2.64 µg/mL), exhibited excellent in vitro activity for most species. Amphotericin B and fluconazole demonstrated limited antifungal activity, and all of the strains were resistant to echinocandins. This is the first report in Mexico of environmental distribution and antifungal in vitro susceptibility of these emergent pathogens.

Chemical mixtures and environmental effects: a pilot study to assess ecological exposure and effects in streams

USGS Publications Warehouse

Buxton, Herbert T.; Reilly, Timothy J.; Kuivila, Kathryn; Kolpin, Dana W.; Bradley, Paul M.; Villeneuve, Daniel L.; Mills, Marc A.

2015-01-01

Assessment and management of the risks of exposure to complex chemical mixtures in streams are priorities for human and environmental health organizations around the world. The current lack of information on the composition and variability of environmental mixtures and a limited understanding of their combined effects are fundamental obstacles to timely identification and prevention of adverse human and ecological effects of exposure. This report describes the design of a field-based study of the composition and biological activity of chemical mixtures in U.S. stream waters affected by a wide range of human activities and contaminant sources. The study is a collaborative effort by the U.S. Geological Survey and the U.S. Environmental Protection Agency. Scientists sampled 38 streams spanning 24 States and Puerto Rico. Thirty-four of the sites were located in watersheds impacted by multiple contaminant sources, including industrial and municipal wastewater discharges, crop and animal agricultural runoff, urban runoff, and other point and nonpoint contaminant sources. The remaining four sites were minimally development reference watersheds. All samples underwent comprehensive chemical and biological characterization, including sensitive and specific direct analysis for over 700 dissolved organic and inorganic chemicals and field parameters, identification of unknown contaminants (environmental diagnostics), and a variety of bioassays to evaluate biological activity and toxicity.

TSPA 1991: An initial total-system performance assessment for Yucca Mountain; Yucca Mountain Site Characterization Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnard, R.W.; Wilson, M.L.; Dockery, H.A.

1992-07-01

This report describes an assessment of the long-term performance of a repository system that contains deeply buried highly radioactive waste; the system is assumed to be located at the potential site at Yucca Mountain, Nevada. The study includes an identification of features, events, and processes that might affect the potential repository, a construction of scenarios based on this identification, a selection of models describing these scenarios (including abstraction of appropriate models from detailed models), a selection of probability distributions for the parameters in the models, a stochastic calculation of radionuclide releases for the scenarios, and a derivation of complementary cumulativemore » distribution functions (CCDFs) for the releases. Releases and CCDFs are calculated for four categories of scenarios: aqueous flow (modeling primarily the existing conditions at the site, with allowances for climate change), gaseous flow, basaltic igneous activity, and human intrusion. The study shows that models of complex processes can be abstracted into more simplified representations that preserve the understanding of the processes and produce results consistent with those of more complex models.« less

Hierarchy within the mammary STAT5-driven Wap super-enhancer

PubMed Central

Zeng, Xianke; Wang, Chaochen; Metser, Gil; Hennighausen, Lothar

2016-01-01

Super-enhancers comprise of dense transcription factor platforms highly enriched for active chromatin marks. A paucity of functional data led us to investigate their role in the mammary gland, an organ characterized by exceptional gene regulatory dynamics during pregnancy. ChIP-Seq for the master regulator STAT5, the glucocorticoid receptor, H3K27ac and MED1, identified 440 mammary-specific super-enhancers, half of which were associated with genes activated during pregnancy. We interrogated the Wap super-enhancer, generating mice carrying mutations in STAT5 binding sites within its three constituent enhancers. Individually, only the most distal site displayed significant enhancer activity. However, combinatorial mutations showed that the 1,000-fold gene induction relied on all enhancers. Disabling the binding sites of STAT5, NFIB and ELF5 in the proximal enhancer incapacitated the entire super-enhancer, suggesting an enhancer hierarchy. The identification of mammary-specific super-enhancers and the mechanistic exploration of the Wap locus provide insight into the complexity of cell-specific and hormone-regulated genes. PMID:27376239

Active Site Flexibility of Mycobacterium tuberculosis Isocitrate Lyase in Dimer Form.

PubMed

Lee, Yie-Vern; Choi, Sy Bing; Wahab, Habibah A; Choong, Yee Siew

2017-09-25

Tuberculosis (TB) still remains a global threat due to the emergence of a drug-resistant strain. Instead of focusing on the drug target of active stage TB, we are highlighting the isocitrate lyase (ICL) at the dormant stage TB. ICL is one of the persistent factors for Mycobacterium tuberculosis (MTB) to survive during the dormant phase. In addition, the absence of ICL in human has made ICL a potential drug target for TB therapy. However, the dynamic details of ICL which could give insights to the ICL-ligand interaction have yet to be solved. Therefore, a series of ICL dimer dynamics studies through molecular dynamics simulation were performed in this work. The ICL active site entrance gate closure is contributed to by hydrogen bonding and electrostatic interactions with the C-terminal. Analysis suggested that the open-closed behavior of the ICL active site entrance depends on the type of ligand present in the active site. We also observed four residues (Ser91, Asp108, Asp153, and Cys191) which could possibly be the nucleophiles for nucleophilic attack on the cleavage of isocitrate at the C 2 -C 3 bond. We hope that the elucidation of ICL dynamics can benefit future works such as lead identification or antibody design against ICL for TB therapeutics.

Identification of essential histidine residues in the active site of Escherichia coli xylose (glucose) isomerase.

PubMed Central

Batt, C A; Jamieson, A C; Vandeyar, M A

1990-01-01

Two conserved histidine residues (His-101 and His-271) appear to be essential components in the active site of the enzyme xylose (glucose) isomerase (EC 5.3.1.5). These amino acid residues were targeted for mutagenesis on the basis of sequence homology among xylose isomerases isolated from Escherichia coli, Bacillus subtilis, Ampullariella sp. strain 3876, and Streptomyces violaceus-niger. Each residue was selectively replaced by site-directed mutagenesis and shown to be essential for activity. No measurable activity was observed for any mutations replacing either His-101 or His-271. Circular dichroism measurements revealed no significant change in the overall conformation of the mutant enzymes, and all formed dimers similar to the wild-type enzyme. Mutations at His-271 could be distinguished from those at His-101, since the former resulted in a thermolabile protein whereas no significant change in heat stability was observed for the latter. Based upon these results and structural data recently reported, we speculate that His-101 is the catalytic base mediating the reaction. Replacement of His-271 may render the enzyme thermolabile, since this residue appears to be a ligand for one of the metal ions in the active site of the enzyme. Images PMID:2405386

Identification of a salivary vasodilator in the primary North American vector of bluetongue viruses, Culicoides variipennis.

PubMed

Perez de Leon, A A; Ribeiro, J M; Tabachnick, W J; Valenzuela, J G

1997-09-01

Several species of Culicoides biting midges are important pests and vectors of pathogens affecting humans and other animals. Bluetongue is the most economically important arthropod-borne animal disease in the United States. Culicoides variipennis is the primary North American vector of the bluetongue viruses. A reddish halo surrounding a petechial hemorrhage was noticed at the site of C. variipennis blood feeding in previously unexposed sheep and rabbits. Salivary gland extracts of nonblood-fed C. variipennis injected intradermally into sheep and rabbits induced cutaneous vasodilation in the form of erythema. A local, dose-dependent erythema, without edema or pruritus, was noted 30 min after injection. Erythema was inapparent with salivary gland extracts obtained after blood feeding. This observation suggested that the vasodilatory activity was inoculated into the host skin at the feeding site. The vasodilatory activity was insoluble in ethanol and destroyed by trypsin or chymotrypsin, which indicated that vasodilation was due to a protein. The association of cutaneous vasodilation with a salivary protein was corroborated by reversed-phase, high-performance liquid chromatography (HPLC). Fractionation of salivary gland extracts by molecular sieving HPLC resulted in maximal vasodilatory activity that coeluted with a protein having a relative molecular weight (MWr) of 22.45 kD. The C. variipennis vasodilator appears to be biologically active at the nanogram level. This vasodilator likely assists C. variipennis during feeding by increasing blood flow from host superficial blood vessels surrounding the bite site. The identification of a salivary vasodilator in C. variipennis may have implications for the transmission of Culicoides-borne pathogens and in the development of dermatitis resulting from the sensitization of humans and animals to Culicoides salivary antigens.

Active site specificity profiling datasets of matrix metalloproteinases (MMPs) 1, 2, 3, 7, 8, 9, 12, 13 and 14.

PubMed

Eckhard, Ulrich; Huesgen, Pitter F; Schilling, Oliver; Bellac, Caroline L; Butler, Georgina S; Cox, Jennifer H; Dufour, Antoine; Goebeler, Verena; Kappelhoff, Reinhild; Auf dem Keller, Ulrich; Klein, Theo; Lange, Philipp F; Marino, Giada; Morrison, Charlotte J; Prudova, Anna; Rodriguez, David; Starr, Amanda E; Wang, Yili; Overall, Christopher M

2016-06-01

The data described provide a comprehensive resource for the family-wide active site specificity portrayal of the human matrix metalloproteinase family. We used the high-throughput proteomic technique PICS (Proteomic Identification of protease Cleavage Sites) to comprehensively assay 9 different MMPs. We identified more than 4300 peptide cleavage sites, spanning both the prime and non-prime sides of the scissile peptide bond allowing detailed subsite cooperativity analysis. The proteomic cleavage data were expanded by kinetic analysis using a set of 6 quenched-fluorescent peptide substrates designed using these results. These datasets represent one of the largest specificity profiling efforts with subsequent structural follow up for any protease family and put the spotlight on the specificity similarities and differences of the MMP family. A detailed analysis of this data may be found in Eckhard et al. (2015) [1]. The raw mass spectrometry data and the corresponding metadata have been deposited in PRIDE/ProteomeXchange with the accession number PXD002265.

Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase

PubMed Central

Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel

2012-01-01

The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308

Forest Species Identification with High Spectral Resolution Data

NASA Technical Reports Server (NTRS)

Olson, C. E., Jr.; Zhu, Z.

1985-01-01

Data collected over the Sleeping Bear Sand Dunes Test Site and the Saginaw Forest Test Site (Michigan) with the JPL Airborne Imaging Spectrometer and the Collins' Airborne Spectroradiometer are being used for forest species identification. The linear discriminant function has provided higher identification accuracies than have principal components analyses. Highest identification accuracies are obtained in the 450 to 520 nm spectral region. Spectral bands near 1,300, 1,685 and 2,220 nm appear to be important, also.

7 CFR 12.31 - On-site wetland identification criteria.

Code of Federal Regulations, 2011 CFR

2011-01-01

... CONSERVATION Wetland Conservation § 12.31 On-site wetland identification criteria. (a) Hydric soils. (1) NRCS shall identify hydric soils through the use of published soil maps which reflect soil surveys completed by NRCS or through the use of on-site reviews. If a published soil map is unavailable for a given...

7 CFR 12.31 - On-site wetland identification criteria.

Code of Federal Regulations, 2014 CFR

2014-01-01

... CONSERVATION Wetland Conservation § 12.31 On-site wetland identification criteria. (a) Hydric soils. (1) NRCS shall identify hydric soils through the use of published soil maps which reflect soil surveys completed by NRCS or through the use of on-site reviews. If a published soil map is unavailable for a given...

7 CFR 12.31 - On-site wetland identification criteria.

Code of Federal Regulations, 2010 CFR

2010-01-01

... CONSERVATION Wetland Conservation § 12.31 On-site wetland identification criteria. (a) Hydric soils. (1) NRCS shall identify hydric soils through the use of published soil maps which reflect soil surveys completed by NRCS or through the use of on-site reviews. If a published soil map is unavailable for a given...

7 CFR 12.31 - On-site wetland identification criteria.

Code of Federal Regulations, 2013 CFR

2013-01-01

... CONSERVATION Wetland Conservation § 12.31 On-site wetland identification criteria. (a) Hydric soils. (1) NRCS shall identify hydric soils through the use of published soil maps which reflect soil surveys completed by NRCS or through the use of on-site reviews. If a published soil map is unavailable for a given...

7 CFR 12.31 - On-site wetland identification criteria.

Code of Federal Regulations, 2012 CFR

2012-01-01

... CONSERVATION Wetland Conservation § 12.31 On-site wetland identification criteria. (a) Hydric soils. (1) NRCS shall identify hydric soils through the use of published soil maps which reflect soil surveys completed by NRCS or through the use of on-site reviews. If a published soil map is unavailable for a given...

Studies on the regulation of the human E1 subunit of the 2-oxoglutarate dehydrogenase complex, including the identification of a novel calcium-binding site.

PubMed

Armstrong, Craig T; Anderson, J L Ross; Denton, Richard M

2014-04-15

The regulation of the 2-oxoglutarate dehydrogenase complex is central to intramitochondrial energy metabolism. In the present study, the active full-length E1 subunit of the human complex has been expressed and shown to be regulated by Ca2+, adenine nucleotides and NADH, with NADH exerting a major influence on the K0.5 value for Ca2+. We investigated two potential Ca2+-binding sites on E1, which we term site 1 (D114ADLD) and site 2 (E139SDLD). Comparison of sequences from vertebrates with those from Ca2+-insensitive non-vertebrate complexes suggest that site 1 may be the more important. Consistent with this view, a mutated form of E1, D114A, shows a 6-fold decrease in sensitivity for Ca2+, whereas variant ∆site1 (in which the sequence of site 1 is replaced by A114AALA) exhibits an almost complete loss of Ca2+ activation. Variant ∆site2 (in which the sequence is replaced with A139SALA) shows no measurable change in Ca2+ sensitivity. We conclude that site 1, but not site 2, forms part of a regulatory Ca2+-binding site, which is distinct from other previously described Ca2+-binding sites.

A Combined Probe-Molecule, Mössbauer, Nuclear Resonance Vibrational Spectroscopy, and Density Functional Theory Approach for Evaluation of Potential Iron Active Sites in an Oxygen Reduction Reaction Catalyst

DOE PAGES

Kneebone, Jared L.; Daifuku, Stephanie L.; Kehl, Jeffrey A.; ...

2017-07-06

While non-precious metal M-N-C (M = Fe or Co) catalysts have been developed that are effective for the oxygen reduction reaction in polymer electrolyte fuel cells, no consensus has yet been reached regarding the nature of the M sites in these heterogeneous catalysts that are responsible for reaction with dioxygen (O 2). While multiple studies have developed correlations between Fe distributions in as-prepared catalysts and ORR activity, the direct identification of sites reactive towards O 2 or O 2-analog molecules remains a significant challenge. In the present study, we demonstrate a new approach to identifying and characterizing potential Fe activemore » sites in complex ORR catalysts that combines an effective probe molecule (NO (g)) Mössbauer spectroscopy and nuclear resonance vibrational spectroscopy (NRVS) with density functional theory (DFT) calculations. Mössbauer spectroscopic studies demonstrate that NO (g) treatment of electrochemically reduced PANI-57Fe-C leads to selective reaction with only a sub-set of the Fe species present. Nuclear resonance vibrational spectroscopic studies identified new Fe-ligand vibrations associated with the site reactive towards NO (g). DFT calculations of vibrational properties of a small selection of previously proposed active site structures suggest that graphene zig-zag edge hosted Fe-N structures may be responsible for the observed vibrational behavior with NO (g) probe molecules. Moreover, such sites are likely also reactive to O 2, possibly serving as the ORR active sites in the synthesized materials.« less

A Combined Probe-Molecule, Mössbauer, Nuclear Resonance Vibrational Spectroscopy, and Density Functional Theory Approach for Evaluation of Potential Iron Active Sites in an Oxygen Reduction Reaction Catalyst

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kneebone, Jared L.; Daifuku, Stephanie L.; Kehl, Jeffrey A.

While non-precious metal M-N-C (M = Fe or Co) catalysts have been developed that are effective for the oxygen reduction reaction in polymer electrolyte fuel cells, no consensus has yet been reached regarding the nature of the M sites in these heterogeneous catalysts that are responsible for reaction with dioxygen (O 2). While multiple studies have developed correlations between Fe distributions in as-prepared catalysts and ORR activity, the direct identification of sites reactive towards O 2 or O 2-analog molecules remains a significant challenge. In the present study, we demonstrate a new approach to identifying and characterizing potential Fe activemore » sites in complex ORR catalysts that combines an effective probe molecule (NO (g)) Mössbauer spectroscopy and nuclear resonance vibrational spectroscopy (NRVS) with density functional theory (DFT) calculations. Mössbauer spectroscopic studies demonstrate that NO (g) treatment of electrochemically reduced PANI-57Fe-C leads to selective reaction with only a sub-set of the Fe species present. Nuclear resonance vibrational spectroscopic studies identified new Fe-ligand vibrations associated with the site reactive towards NO (g). DFT calculations of vibrational properties of a small selection of previously proposed active site structures suggest that graphene zig-zag edge hosted Fe-N structures may be responsible for the observed vibrational behavior with NO (g) probe molecules. Moreover, such sites are likely also reactive to O 2, possibly serving as the ORR active sites in the synthesized materials.« less

De Novo Enzyme Design Using Rosetta3

PubMed Central

Richter, Florian; Leaver-Fay, Andrew; Khare, Sagar D.; Bjelic, Sinisa; Baker, David

2011-01-01

The Rosetta de novo enzyme design protocol has been used to design enzyme catalysts for a variety of chemical reactions, and in principle can be applied to any arbitrary chemical reaction of interest, The process has four stages: 1) choice of a catalytic mechanism and corresponding minimal model active site, 2) identification of sites in a set of scaffold proteins where this minimal active site can be realized, 3) optimization of the identities of the surrounding residues for stabilizing interactions with the transition state and primary catalytic residues, and 4) evaluation and ranking the resulting designed sequences. Stages two through four of this process can be carried out with the Rosetta package, while stage one needs to be done externally. Here, we demonstrate how to carry out the Rosetta enzyme design protocol from start to end in detail using for illustration the triosephosphate isomerase reaction. PMID:21603656

Identification of potential leads against 4-hydroxytetrahydrodipicolinate synthase from Mycobacterium tuberculosis

PubMed Central

Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.

2016-01-01

4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards identification of more potent phyto-inhibitors. Molecular interaction studies were accomplished using three different tools to understand and establish the participation of active site residues as the key players in stabilizing the binding mode of ligands and target protein. The best phyto-compound deduced on the basis of binding affinity was further used as a template to make similarity scan across the PubChem Compound database (score > = 80 %) to get more divesred leads. In this search 5098 hits were obtained that further reduced to 262 after drug-likeness filtration. These phytochemicallike compounds were docked at the active site of DHDPS.Then, those hits selected from docking analysis that showing stronger binding and forming maximum H-bonds with the active site residues (Thr54, Thr55, Tyr143, Arg148 and Lys171). Finally, we predicted one phytochemical compound (SN00003544), two PubChem-compounds (CID41032023, CID54025334) akin to phytochemical molecule showing better interactions in comaprison of known inhibitors of target protein.These findings might be further useful to gain the structural insight into the designing of novel leads against DapA family. PMID:28293071

The active site structure of tetanus neurotoxin resolved by multiple scattering analysis in X-Ray absorption spectroscopy.

PubMed Central

Meneghini, C; Morante, S

1998-01-01

A detailed study of the x-ray absorption spectrum of tetanus neurotoxin in the K-edge EXAFS region of the zinc absorber is presented that allows the complete identification of the amino acid residues coordinated to the zinc active site. A very satisfactory interpretation of the experimental data can be given if multiple scattering contributions are included in the analysis. Comparing the absorption spectrum of tetanus neurotoxin to that of two other structurally similar zinc-endopeptidases, thermolysin and astacin, in which the zinc coordination mode is known from crystallographic data, we conclude that in tetanus neurotoxin, besides a water molecule, zinc is coordinated to two histidines and a tyrosine. PMID:9746536

Identification of one of the apurinic/apyrimidinic lyase active sites of topoisomerase V by structural and functional studies

PubMed Central

Rajan, Rakhi; Prasad, Rajendra; Taneja, Bhupesh; Wilson, Samuel H.; Mondragón, Alfonso

2013-01-01

Topoisomerase V (Topo-V) is the only member of a novel topoisomerase subtype. Topo-V is unique because it is a bifunctional enzyme carrying both topoisomerase and DNA repair lyase activities within the same protein. Previous studies had shown that the topoisomerase domain spans the N-terminus of the protein and is followed by 12 tandem helix–hairpin–helix [(HhH)2] domains. There are at least two DNA repair lyase active sites for apurinic/apyrimidinic (AP) site processing, one within the N-terminal region and the second within the C-terminal domain of Topo-V, but their exact locations and characteristics are unknown. In the present study, the N-terminal 78-kDa fragment of Topo-V (Topo-78), containing the topoisomerase domain and one of the lyase DNA repair domains, was characterized by structural and biochemical studies. The results show that an N-terminal 69-kDa fragment is the minimal fragment with both topoisomerase and AP lyase activities. The lyase active site of Topo-78 is at the junction of the fifth and sixth (HhH)2 domains. From the biochemical and structural data, it appears that Lys571 is the most probable nucleophile responsible for the lyase activity. Our experiments also suggest that Topo-V most likely acts as a Class I AP endonuclease in vivo. PMID:23125368

The phosphoproteome of bloodstream form Trypanosoma brucei, causative agent of African sleeping sickness.

PubMed

Nett, Isabelle R E; Martin, David M A; Miranda-Saavedra, Diego; Lamont, Douglas; Barber, Jonathan D; Mehlert, Angela; Ferguson, Michael A J

2009-07-01

The protozoan parasite Trypanosoma brucei is the causative agent of human African sleeping sickness and related animal diseases, and it has over 170 predicted protein kinases. Protein phosphorylation is a key regulatory mechanism for cellular function that, thus far, has been studied in T.brucei principally through putative kinase mRNA knockdown and observation of the resulting phenotype. However, despite the relatively large kinome of this organism and the demonstrated essentiality of several T. brucei kinases, very few specific phosphorylation sites have been determined in this organism. Using a gel-free, phosphopeptide enrichment-based proteomics approach we performed the first large scale phosphorylation site analyses for T.brucei. Serine, threonine, and tyrosine phosphorylation sites were determined for a cytosolic protein fraction of the bloodstream form of the parasite, resulting in the identification of 491 phosphoproteins based on the identification of 852 unique phosphopeptides and 1204 phosphorylation sites. The phosphoproteins detected in this study are predicted from their genome annotations to participate in a wide variety of biological processes, including signal transduction, processing of DNA and RNA, protein synthesis, and degradation and to a minor extent in metabolic pathways. The analysis of phosphopeptides and phosphorylation sites was facilitated by in-house developed software, and this automated approach was validated by manual annotation of spectra of the kinase subset of proteins. Analysis of the cytosolic bloodstream form T. brucei kinome revealed the presence of 44 phosphorylated protein kinases in our data set that could be classified into the major eukaryotic protein kinase groups by applying a multilevel hidden Markov model library of the kinase catalytic domain. Identification of the kinase phosphorylation sites showed conserved phosphorylation sequence motifs in several kinase activation segments, supporting the view that phosphorylation-based signaling is a general and fundamental regulatory process that extends to this highly divergent lower eukaryote.

Remote identification of research and educational activities using spectral properties of nighttime light

NASA Astrophysics Data System (ADS)

Rybnikova, Nataliya A.; Portnov, Boris A.

2017-06-01

Research and educational activities (R&EAs) are major forces behind modern economic growth. However, data on geographic location of such activities are often poorly reported. According to our research hypothesis, intensities and spectral properties of artificial light-at-night (ALAN) can be used for remote identification of R&EAs, due to their unique ALAN signatures. In order to develop activity identification models, we carried out a series of in situ measurements of ALAN intensities and spectral properties in a major metropolitan area in Israel. For this task, we used an illuminance CL-500A spectrophotometer that measures the total intensity and spectral irradiance of ALAN, incremented by a 1-nm pitch, from 360 to 780 nm. As our analysis shows, logistic regressions, incorporating ALAN intensities at the peak or near-peak wavelengths, and geographical attributes of the measurement sites as controls, succeeded to predict correctly up to 98.6% of the actual locations of R&EAs. A digital camera satellite image, obtained from the Astronaut Photography Database, was used for the model's validation. According to the validation results, the actual locations of R&EAs coincided well with the estimated high probability areas, as confirmed by the values of Cohen's Kappa index of up to 64%, which indicate a reasonable level of agreement.

2-Aryl-5-carboxytetrazole as a New Photoaffinity Label for Drug Target Identification.

PubMed

Herner, András; Marjanovic, Jasmina; Lewandowski, Tracey M; Marin, Violeta; Patterson, Melanie; Miesbauer, Laura; Ready, Damien; Williams, Jon; Vasudevan, Anil; Lin, Qing

2016-11-09

Photoaffinity labels are powerful tools for dissecting ligand-protein interactions, and they have a broad utility in medicinal chemistry and drug discovery. Traditional photoaffinity labels work through nonspecific C-H/X-H bond insertion reactions with the protein of interest by the highly reactive photogenerated intermediate. Herein, we report a new photoaffinity label, 2-aryl-5-carboxytetrazole (ACT), that interacts with the target protein via a unique mechanism in which the photogenerated carboxynitrile imine reacts with a proximal nucleophile near the target active site. In two distinct case studies, we demonstrate that the attachment of ACT to a ligand does not significantly alter the binding affinity and specificity of the parent drug. Compared with diazirine and benzophenone, two commonly used photoaffinity labels, in two case studies ACT showed higher photo-cross-linking yields toward their protein targets in vitro based on mass spectrometry analysis. In the in situ target identification studies, ACT successfully captured the desired targets with an efficiency comparable to the diazirine. We expect that further development of this class of photoaffinity labels will lead to a broad range of applications across target identification, and validation and elucidation of the binding site in drug discovery.

2-Aryl-5-carboxytetrazole as a New Photoaffinity Label for Drug Target Identification

PubMed Central

2016-01-01

Photoaffinity labels are powerful tools for dissecting ligand–protein interactions, and they have a broad utility in medicinal chemistry and drug discovery. Traditional photoaffinity labels work through nonspecific C–H/X–H bond insertion reactions with the protein of interest by the highly reactive photogenerated intermediate. Herein, we report a new photoaffinity label, 2-aryl-5-carboxytetrazole (ACT), that interacts with the target protein via a unique mechanism in which the photogenerated carboxynitrile imine reacts with a proximal nucleophile near the target active site. In two distinct case studies, we demonstrate that the attachment of ACT to a ligand does not significantly alter the binding affinity and specificity of the parent drug. Compared with diazirine and benzophenone, two commonly used photoaffinity labels, in two case studies ACT showed higher photo-cross-linking yields toward their protein targets in vitro based on mass spectrometry analysis. In the in situ target identification studies, ACT successfully captured the desired targets with an efficiency comparable to the diazirine. We expect that further development of this class of photoaffinity labels will lead to a broad range of applications across target identification, and validation and elucidation of the binding site in drug discovery. PMID:27740749

Space shuttle EVA/IVA support equipment requirements study. Volume 1: Final summary report

NASA Technical Reports Server (NTRS)

1973-01-01

A study was conducted to determine the support equipment requirements for space shuttle intravehicular and extravehicular activities. The subjects investigated are; (1) EVA/IVA task identification and analysis,. (2) primary life support system, (3) emergency life support system, (4) pressure suit assembly, (5) restraints, (6) work site provision, (7) emergency internal vehicular emergencies, and (8) vehicular interfaces.

A Comparative Analysis of the Department of Defense (DoD) Passive Radio Frequency Identification (RFID) Policy and Perspective in Terms of Site Implementations

DTIC Science & Technology

2006-06-01

as a field programmable or reprogrammable tag) can be written over between 10,000 and 100,000 times or more, either by the reader or by the active...agriculture, tracking airfreight and automobile manufacturing. Because of the technological limitations and high cost, RFID could not be used for

A targeted mass spectrometry-based approach for the identification and characterization of proteins containing α-aminoadipic and γ-glutamic semialdehyde residues

PubMed Central

Chavez, Juan D.; Bisson, William H.

2011-01-01

The site-specific identification of α-aminoadipic semialdehyde (AAS) and γ-glutamic semialdehyde (GGS) residues in proteins is reported. Semialdehydic protein modifications result from the metal-catalyzed oxidation of Lys or Arg and Pro residues, respectively. Most of the analytical methods for the analysis of protein carbonylation measure change to the global level of carbonylation and fail to provide details regarding protein identity, site, and chemical nature of the carbonylation. In this work, we used a targeted approach, which combines chemical labeling, enrichment, and tandem mass spectrometric analysis, for the site-specific identification of AAS and GGS sites in proteins. The approach is applied to in vitro oxidized glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and an untreated biological sample, namely cardiac mitochondrial proteins. The analysis of GAPDH resulted in the site-specific identification of two AAA and four GGS residues. Computational evaluation of the identified AAS and GGS sites in GAPDH indicated that these sites are located in flexible regions, show high solvent accessibility values, and are in proximity with possible metal ion binding sites. The targeted proteomic analysis of semialdehydic modifications in cardiac mitochondria yielded nine AAS modification sites which were unambiguously assigned to distinct lysine residues in the following proteins: ATP/ATP translocase isoforms 1 and 2, ubiquinol cytochrome-c reductase core protein 2, and ATP synthase α-subunit. PMID:20957471

Targeted Identification of SUMOylation Sites in Human Proteins Using Affinity Enrichment and Paralog-specific Reporter Ions*

PubMed Central

Lamoliatte, Frederic; Bonneil, Eric; Durette, Chantal; Caron-Lizotte, Olivier; Wildemann, Dirk; Zerweck, Johannes; Wenshuk, Holger; Thibault, Pierre

2013-01-01

Protein modification by small ubiquitin-like modifier (SUMO) modulates the activities of numerous proteins involved in different cellular functions such as gene transcription, cell cycle, and DNA repair. Comprehensive identification of SUMOylated sites is a prerequisite to determine how SUMOylation regulates protein function. However, mapping SUMOylated Lys residues by mass spectrometry (MS) is challenging because of the dynamic nature of this modification, the existence of three functionally distinct human SUMO paralogs, and the large SUMO chain remnant that remains attached to tryptic peptides. To overcome these problems, we created HEK293 cell lines that stably express functional SUMO paralogs with an N-terminal His6-tag and an Arg residue near the C terminus that leave a short five amino acid SUMO remnant upon tryptic digestion. We determined the fragmentation patterns of our short SUMO remnant peptides by collisional activation and electron transfer dissociation using synthetic peptide libraries. Activation using higher energy collisional dissociation on the LTQ-Orbitrap Elite identified SUMO paralog-specific fragment ions and neutral losses of the SUMO remnant with high mass accuracy (< 5 ppm). We exploited these features to detect SUMO modified tryptic peptides in complex cell extracts by correlating mass measurements of precursor and fragment ions using a data independent acquisition method. We also generated bioinformatics tools to retrieve MS/MS spectra containing characteristic fragment ions to the identification of SUMOylated peptide by conventional Mascot database searches. In HEK293 cell extracts, this MS approach uncovered low abundance SUMOylated peptides and 37 SUMO3-modified Lys residues in target proteins, most of which were previously unknown. Interestingly, we identified mixed SUMO-ubiquitin chains with ubiquitylated SUMO proteins (K20 and K32) and SUMOylated ubiquitin (K63), suggesting a complex crosstalk between these two modifications. PMID:23750026

Quantifying animal movement for caching foragers: the path identification index (PII) and cougars, Puma concolor.

PubMed

Ironside, Kirsten E; Mattson, David J; Theimer, Tad; Jansen, Brian; Holton, Brandon; Arundel, Terence; Peters, Michael; Sexton, Joseph O; Edwards, Thomas C

2017-01-01

Many studies of animal movement have focused on directed versus area-restricted movement, which rely on correlations between step-length and turn-angles and on stationarity through time to define behavioral states. Although these approaches might apply well to grazing in patchy landscapes, species that either feed for short periods on large, concentrated food sources or cache food exhibit movements that are difficult to model using the traditional metrics of turn-angle and step-length alone. We used GPS telemetry collected from a prey-caching predator, the cougar ( Puma concolor, Linnaeus ), to test whether combining metrics of site recursion, spatiotemporal clustering, speed, and turning into an index of movement using partial sums, improves the ability to identify caching behavior. The index was used to identify changes in movement characteristics over time and segment paths into behavioral classes. The identification of behaviors from the Path Identification Index (PII) was evaluated using field investigations of cougar activities at GPS locations. We tested for statistical stationarity across behaviors for use of topographic view-sheds. Changes in the frequency and duration of PII were useful for identifying seasonal activities such as migration, gestation, and denning. The comparison of field investigations of cougar activities to behavioral PII classes resulted in an overall classification accuracy of 81%. Changes in behaviors were reflected in cougars' use of topographic view-sheds, resulting in statistical nonstationarity over time, and revealed important aspects of hunting behavior. Incorporating metrics of site recursion and spatiotemporal clustering revealed the temporal structure in movements of a caching forager. The movement index PII, shows promise for identifying behaviors in species that frequently return to specific locations such as food caches, watering holes, or dens, and highlights the potential role memory and cognitive abilities play in determining animal movements.

Isopentenyldiphosphate:dimethylallyldiphosphate isomerase: Construction of a high-level heterologous expression system for the gene from Saccharomyces cerevisiae and identification of an active-site nucleophile

DOE Office of Scientific and Technical Information (OSTI.GOV)

Street, I.P.; Poulter, C.D.

1990-08-14

Isopentenyldiphosphate:dimethylallyldiphosphate isomerase (IPP isomerase) is an enzyme in isoprene metabolism which catalyzes the interconversion of the fundamental five-carbon homoallylic and allylic diphosphate building blocks for the pathway. The gene encoding IPP isomerase has recently been isolated from Saccharomyces cerevisiae. A heterologous expression system was constructed for the gene and used to overexpress IPP isomerase in Escherichia coli. In transformants carrying the expression vector, IPP isomerase activity was increased by over 100,000-fold relative to that of the untransformed host strain. The overexpressed enzyme constitutes 30-35% of the total soluble cell protein and can be purified to homogeneity in two steps. Recombinantmore » IPP isomerase was indistinguishable from that purified from yeast. 3-(Fluoromethyl)-3-butenyl diphosphate (FIPP) is a specific active-site-directed inhibitor of IPP isomerase from Claviceps purpurea. Inactivation of yeast IPP isomerase by FIPP was active-site-directed, and inhibition resulted in formation of a stoichiometric enzyme-inhibitor complex. The site of covalent attachment in the enzyme-inhibitor complex was determined by inactivating IPP isomerase with (4-{sup 3}H)FIPP, followed by digestion of the labeled enzyme with trypsin and purification of the resulting radioactive peptides by reversed-phase high-performance liquid chromatography. The primary site of attachment was Cys-139.« less

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

PubMed Central

Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

PubMed

Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

2015-01-01

Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

Site Formation Processes and Hunter-Gatherers Use of Space in a Tropical Environment: A Geo-Ethnoarchaeological Approach from South India

PubMed Central

Friesem, David E.; Lavi, Noa; Madella, Marco; Ajithprasad, P.; French, Charles

2016-01-01

Hunter-gatherer societies have distinct social perceptions and practices which are expressed in unique use of space and material deposition patterns. However, the identification of archaeological evidence associated with hunter-gatherer activity is often challenging, especially in tropical environments such as rainforests. We present an integrated study combining ethnoarchaeology and geoarchaeology in order to study archaeological site formation processes related to hunter-gatherers’ ways of living in tropical forests. Ethnographic data was collected from an habitation site of contemporary hunter-gatherers in the forests of South India, aimed at studying how everyday activities and way of living dictate patterns of material deposition. Ethnoarchaeological excavations of abandoned open-air sites and a rock-shelter of the same group located deep in the forests, involved field observations and sampling of sediments from the abandoned sites and the contemporary site. Laboratory analyses included geochemical analysis (i.e., FTIR, ICP-AES), phytolith concentration analysis and soil micromorphology. The results present a dynamic spatial deposition pattern of macroscopic, microscopic and chemical materials, which stem from the distinctive ways of living and use of space by hunter-gatherers. This study shows that post-depositional processes in tropical forests result in poor preservation of archaeological materials due to acidic conditions and intensive biological activity within the sediments. Yet, the multiple laboratory-based analyses were able to trace evidence for activity surfaces and their maintenance practices as well as localized concentrations of activity remains such as the use of plants, metals, hearths and construction materials. PMID:27783683

Comparative analysis of amino acid composition in the active site of nirk gene encoding copper-containing nitrite reductase (CuNiR) in bacterial spp.

PubMed

Adhikari, Utpal Kumar; Rahman, M Mizanur

2017-04-01

The nirk gene encoding the copper-containing nitrite reductase (CuNiR), a key catalytic enzyme in the environmental denitrification process that helps to produce nitric oxide from nitrite. The molecular mechanism of denitrification process is definitely complex and in this case a theoretical investigation has been conducted to know the sequence information and amino acid composition of the active site of CuNiR enzyme using various Bioinformatics tools. 10 Fasta formatted sequences were retrieved from the NCBI database and the domain and disordered regions identification and phylogenetic analyses were done on these sequences. The comparative modeling of protein was performed through Modeller 9v14 program and visualized by PyMOL tools. Validated protein models were deposited in the Protein Model Database (PMDB) (PMDB id: PM0080150 to PM0080159). Active sites of nirk encoding CuNiR enzyme were identified by Castp server. The PROCHECK showed significant scores for four protein models in the most favored regions of the Ramachandran plot. Active sites and cavities prediction exhibited that the amino acid, namely Glycine, Alanine, Histidine, Aspartic acid, Glutamic acid, Threonine, and Glutamine were common in four predicted protein models. The present in silico study anticipates that active site analyses result will pave the way for further research on the complex denitrification mechanism of the selected species in the experimental laboratory. Copyright © 2016. Published by Elsevier Ltd.

Identification of suitable sites for mountain ginseng cultivation using GIS and geo-temperature.

PubMed

Kang, Hag Mo; Choi, Soo Im; Kim, Hyun

2016-01-01

This study was conducted to explore an accurate site identification technique using a geographic information system (GIS) and geo-temperature (gT) for locating suitable sites for growing cultivated mountain ginseng (CMG; Panax ginseng), which is highly sensitive to the environmental conditions in which it grows. The study site was Jinan-gun, South Korea. The spatial resolution for geographic data was set at 10 m × 10 m, and the temperatures for various climatic factors influencing CMG growth were calculated by averaging the 3-year temperatures obtained from the automatic weather stations of the Korea Meteorological Administration. Identification of suitable sites for CMG cultivation was undertaken using both a conventional method and a new method, in which the gT was added as one of the most important factors for crop cultivation. The results yielded by the 2 methods were then compared. When the gT was added as an additional factor (new method), the proportion of suitable sites identified decreased by 0.4 % compared with the conventional method. However, the proportion matching real CMG cultivation sites increased by 3.5 %. Moreover, only 68.2 % corresponded with suitable sites identified using the conventional factors; i.e., 31.8 % were newly detected suitable sites. The accuracy of GIS-based identification of suitable CMG cultivation sites improved by applying the temperature factor (i.e., gT) in addition to the conventionally used factors.

Identification of continuous interaction sites in PLA(2)-based protein complexes by peptide arrays.

PubMed

Fortes-Dias, Consuelo Latorre; Santos, Roberta Márcia Marques dos; Magro, Angelo José; Fontes, Marcos Roberto de Mattos; Chávez-Olórtegui, Carlos; Granier, Claude

2009-01-01

Crotoxin (CA.CB) is a beta-neurotoxin from Crotalus durissus terrificus snake venom that is responsible for main envenomation effects upon biting by this snake. It is a heterodimer of an acidic protein (CA) devoid of any biological activity per se and a basic, enzymatically active, PLA(2) counterpart (CB). Both lethal and enzymatic activities of crotoxin have been shown to be inhibited by CNF, a protein from the blood of C. d. terrificus snakes. CNF replaces CA in the CA.CB complex, forming a stable, non-toxic complex CNF.CB. The molecular sites involved in the tight interfacial protein-protein interactions in these PLA(2)-based complexes have not been clearly determined. To help address this question, we used the peptide arrays approach to map possible interfacial interaction sites in CA.CB and CNF.CB. Amino acid stretches putatively involved in these interactions were firstly identified in the primary structure of CB. Further analysis of the interfacial availability of these stretches in the presumed biologically active structure of CB, suggested two interaction main sites, located at the amino-terminus and beta-wing regions. Peptide segments at the carboxyl-terminus of CB were also suggested to play a secondary role in the binding of both CA and CNF.

Phase I Archaeological Investigation Cultural Resources Survey, Hawaii Geothermal Project, Makawao and Hana Districts, South Shore of Maui, Hawaii (DRAFT )

DOE Office of Scientific and Technical Information (OSTI.GOV)

Erkelens, Conrad

1994-03-01

This report details the archaeological investigation of a 200 foot wide sample corridor extending approximately 9 miles along the southern portion of Maui within the present districts of Hana and Makawao. A total of 51 archaeological sites encompassing 233 surface features were documented. A GPS receiver was used to accurately and precisely plot locations for each of the documented sites. Analysis of the locational information suggests that archaeological sites are abundant throughout the region and only become scarce where vegetation has been bulldozed for ranching activities. At the sea-land transition points for the underwater transmission cable, both Ahihi Bay andmore » Huakini Bay are subjected to seasonal erosion and redeposition of their boulder shorelines. The corridor at the Ahihi Bay transition point runs through the Moanakala Village Complex which is an archaeological site on the State Register of Historic Places within a State Natural Area Reserve. Numerous other potentially significant archaeological sites lie within the project corridor. It is likely that rerouting of the corridor in an attempt to avoid known sites would result in other undocumented sites located outside the sample corridor being impacted. Given the distribution of archaeological sites, there is no alternative route that can be suggested that is likely to avoid encountering sites. A total of twelve charcoal samples were obtained for potential taxon identification and radiocarbon analysis. Four of these samples were subsequently submitted for dating and species identification. Bird bone from various locations within a lava tube were collected for identification. Sediment samples for subsequent pollen analysis were obtained from within two lava tubes. With these three sources of information it is hoped that paleoenvironmental data can be recovered that will enable a better understanding of the setting for Hawaiian habitation of the area. A small test unit was excavated at one habitation site. Charcoal, molluscan and fish remains, basalt tools, and other artifacts were recovered. This material, while providing an extremely small sample, will greatly enhance our understanding of the use of the area. Recommendations regarding the need for further investigation and the preservation of sites within the project corridor are suggested. All sites within the project corridor must be considered potentially significant at this juncture. Further archaeological investigation consisting of a full inventory survey will be required prior to a final assessment of significance for each site and the development of a mitigation plan for sites likely to be impacted by the Hawaii Geothermal Project.« less

Hyodeoxycholic acid derivatives as liver X receptor α and G-protein-coupled bile acid receptor agonists

NASA Astrophysics Data System (ADS)

de Marino, Simona; Carino, Adriana; Masullo, Dario; Finamore, Claudia; Marchianò, Silvia; Cipriani, Sabrina; di Leva, Francesco Saverio; Catalanotti, Bruno; Novellino, Ettore; Limongelli, Vittorio; Fiorucci, Stefano; Zampella, Angela

2017-02-01

Bile acids are extensively investigated for their potential in the treatment of human disorders. The liver X receptors (LXRs), activated by oxysterols and by a secondary bile acid named hyodeoxycholic acid (HDCA), have been found essential in the regulation of lipid homeostasis in mammals. Unfortunately, LXRα activates lipogenic enzymes causing accumulation of lipid in the liver. In addition to LXRs, HDCA has been also shown to function as ligand for GPBAR1, a G protein coupled receptor for secondary bile acids whose activation represents a promising approach to liver steatosis. In the present study, we report a library of HDCA derivatives endowed with modulatory activity on the two receptors. The lead optimization of HDCA moiety was rationally driven by the structural information on the binding site of the two targets and results from pharmacological characterization allowed the identification of hyodeoxycholane derivatives with selective agonistic activity toward LXRα and GPBAR1 and notably to the identification of the first example of potent dual LXRα/GPBAR1 agonists. The new chemical entities might hold utility in the treatment of dyslipidemic disorders.

Identification of carbon-encapsulated iron nanoparticles as active species in non-precious metal oxygen reduction catalysts

PubMed Central

Varnell, Jason A.; Tse, Edmund C. M.; Schulz, Charles E.; Fister, Tim T.; Haasch, Richard T.; Timoshenko, Janis; Frenkel, Anatoly I.; Gewirth, Andrew A.

2016-01-01

The widespread use of fuel cells is currently limited by the lack of efficient and cost-effective catalysts for the oxygen reduction reaction. Iron-based non-precious metal catalysts exhibit promising activity and stability, as an alternative to state-of-the-art platinum catalysts. However, the identity of the active species in non-precious metal catalysts remains elusive, impeding the development of new catalysts. Here we demonstrate the reversible deactivation and reactivation of an iron-based non-precious metal oxygen reduction catalyst achieved using high-temperature gas-phase chlorine and hydrogen treatments. In addition, we observe a decrease in catalyst heterogeneity following treatment with chlorine and hydrogen, using Mössbauer and X-ray absorption spectroscopy. Our study reveals that protected sites adjacent to iron nanoparticles are responsible for the observed activity and stability of the catalyst. These findings may allow for the design and synthesis of enhanced non-precious metal oxygen reduction catalysts with a higher density of active sites. PMID:27538720

[Groundwater organic pollution source identification technology system research and application].

PubMed

Wang, Xiao-Hong; Wei, Jia-Hua; Cheng, Zhi-Neng; Liu, Pei-Bin; Ji, Yi-Qun; Zhang, Gan

2013-02-01

Groundwater organic pollutions are found in large amount of locations, and the pollutions are widely spread once onset; which is hard to identify and control. The key process to control and govern groundwater pollution is how to control the sources of pollution and reduce the danger to groundwater. This paper introduced typical contaminated sites as an example; then carried out the source identification studies and established groundwater organic pollution source identification system, finally applied the system to the identification of typical contaminated sites. First, grasp the basis of the contaminated sites of geological and hydrogeological conditions; determine the contaminated sites characteristics of pollutants as carbon tetrachloride, from the large numbers of groundwater analysis and test data; then find the solute transport model of contaminated sites and compound-specific isotope techniques. At last, through groundwater solute transport model and compound-specific isotope technology, determine the distribution of the typical site of organic sources of pollution and pollution status; invest identified potential sources of pollution and sample the soil to analysis. It turns out that the results of two identified historical pollution sources and pollutant concentration distribution are reliable. The results provided the basis for treatment of groundwater pollution.

Identification of Ice Nucleation Active Sites on Feldspar Dust Particles

PubMed Central

2015-01-01

Mineral dusts originating from Earth’s crust are known to be important atmospheric ice nuclei. In agreement with earlier studies, feldspar was found as the most active of the tested natural mineral dusts. Here we investigated in closer detail the reasons for its activity and the difference in the activity of the different feldspars. Conclusions are drawn from scanning electron microscopy, X-ray powder diffraction, infrared spectroscopy, and oil-immersion freezing experiments. K-feldspar showed by far the highest ice nucleation activity. Finally, we give a potential explanation of this effect, finding alkali-metal ions having different hydration shells and thus an influence on the ice nucleation activity of feldspar surfaces. PMID:25584435

Proteomic identification of an embryo-specific 1Cys-Prx promoter and analysis of its activity in transgenic rice.

PubMed

Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh

2011-04-29

Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.

Differential Mechanisms of Activation of the Ang Peptide Receptors AT1, AT2, and MAS: Using In Silico Techniques to Differentiate the Three Receptors

PubMed Central

Prokop, Jeremy W.; Santos, Robson A. S.; Milsted, Amy

2013-01-01

The renin-angiotensin system is involved in multiple conditions ranging from cardiovascular disorders to cancer. Components of the pathway, including ACE, renin and angiotensin receptors are targets for disease treatment. This study addresses three receptors of the pathway: AT1, AT2, and MAS and how the receptors are similar and differ in activation by angiotensin peptides. Combining biochemical and amino acid variation data with multiple species sequence alignments, structural models, and docking site predictions allows for visualization of how angiotensin peptides may bind and activate the receptors; allowing identification of conserved and variant mechanisms in the receptors. MAS differs from AT1 favoring Ang-(1–7) and not Ang II binding, while AT2 recently has been suggested to preferentially bind Ang III. A new model of Ang peptide binding to AT1 and AT2 is proposed that correlates data from site directed mutagenesis and photolabled experiments that were previously considered conflicting. Ang II binds AT1 and AT2 through a conserved initial binding mode involving amino acids 111 (consensus 325) of AT1 (Asn) interacting with Tyr (4) of Ang II and 199 and 256 (consensus 512 and 621, a Lys and His respectively) interacting with Phe (8) of Ang II. In MAS these sites are not conserved, leading to differential binding and activation by Ang-(1–7). In both AT1 and AT2, the Ang II peptide may internalize through Phe (8) of Ang II propagating through the receptors’ conserved aromatic amino acids to the final photolabled positioning relative to either AT1 (amino acid 294, Asn, consensus 725) or AT2 (138, Leu, consensus 336). Understanding receptor activation provides valuable information for drug design and identification of other receptors that can potentially bind Ang peptides. PMID:23755216

Identification of B. anthracis N(5)-carboxyaminoimidazole ribonucleotide mutase (PurE) active site binding compounds via fragment library screening.

PubMed

Lei, Hao; Jones, Christopher; Zhu, Tian; Patel, Kavankumar; Wolf, Nina M; Fung, Leslie W-M; Lee, Hyun; Johnson, Michael E

2016-02-15

The de novo purine biosynthesis pathway is an attractive target for antibacterial drug design, and PurE from this pathway has been identified to be crucial for Bacillus anthracis survival in serum. In this study we adopted a fragment-based hit discovery approach, using three screening methods-saturation transfer difference nucleus magnetic resonance (STD-NMR), water-ligand observed via gradient spectroscopy (WaterLOGSY) NMR, and surface plasmon resonance (SPR), against B. anthracis PurE (BaPurE) to identify active site binding fragments by initially testing 352 compounds in a Zenobia fragment library. Competition STD NMR with the BaPurE product effectively eliminated non-active site binding hits from the primary hits, selecting active site binders only. Binding affinities (dissociation constant, KD) of these compounds varied between 234 and 301μM. Based on test results from the Zenobia compounds, we subsequently developed and applied a streamlined fragment screening strategy to screen a much larger library consisting of 3000 computationally pre-selected fragments. Thirteen final fragment hits were confirmed to exhibit binding affinities varying from 14μM to 700μM, which were categorized into five different basic scaffolds. All thirteen fragment hits have ligand efficiencies higher than 0.30. We demonstrated that at least two fragments from two different scaffolds exhibit inhibitory activity against the BaPurE enzyme. Published by Elsevier Ltd.

Uncertainty quantification and experimental design based on unsupervised machine learning identification of contaminant sources and groundwater types using hydrogeochemical data

NASA Astrophysics Data System (ADS)

Vesselinov, V. V.

2017-12-01

Identification of the original groundwater types present in geochemical mixtures observed in an aquifer is a challenging but very important task. Frequently, some of the groundwater types are related to different infiltration and/or contamination sources associated with various geochemical signatures and origins. The characterization of groundwater mixing processes typically requires solving complex inverse models representing groundwater flow and geochemical transport in the aquifer, where the inverse analysis accounts for available site data. Usually, the model is calibrated against the available data characterizing the spatial and temporal distribution of the observed geochemical species. Numerous geochemical constituents and processes may need to be simulated in these models which further complicates the analyses. As a result, these types of model analyses are typically extremely challenging. Here, we demonstrate a new contaminant source identification approach that performs decomposition of the observation mixtures based on Nonnegative Matrix Factorization (NMF) method for Blind Source Separation (BSS), coupled with a custom semi-supervised clustering algorithm. Our methodology, called NMFk, is capable of identifying (a) the number of groundwater types and (b) the original geochemical concentration of the contaminant sources from measured geochemical mixtures with unknown mixing ratios without any additional site information. We also demonstrate how NMFk can be extended to perform uncertainty quantification and experimental design related to real-world site characterization. The NMFk algorithm works with geochemical data represented in the form of concentrations, ratios (of two constituents; for example, isotope ratios), and delta notations (standard normalized stable isotope ratios). The NMFk algorithm has been extensively tested on synthetic datasets; NMFk analyses have been actively performed on real-world data collected at the Los Alamos National Laboratory (LANL) groundwater sites related to Chromium and RDX contamination.

DOE Office of Scientific and Technical Information (OSTI.GOV)

McLing, Travis; Carpenter, Michael; Brandon, William

The Environmental Protection Agency (EPA) has teamed with Battelle Energy Alliance, LLC (BEA) at Idaho National Laboratory (INL) to facilitate further testing of geologic-fracture-identification methodology at a field site near the Monsanto Superfund Site located in Soda Springs, Idaho. INL has the necessary testing and technological expertise to perform this work. Battelle Memorial Institute (BMI) has engaged INL to perform this work through a Work for Others (WFO) Agreement. This study continues a multi-year collaborative effort between INL and EPA to test the efficacy of using field deployed Cr-39 radon in soil portals. This research enables identification of active fracturesmore » capable of transporting contaminants at sites where fractures are suspected pathways into the subsurface. Current state of the art methods for mapping fracture networks are exceedingly expensive and notoriously inaccurate. The proposed WFO will evaluate the applicability of using cheap, readily available, passive radon detectors to identify conductive geologic structures (i.e. fractures, and fracture networks) in the subsurface that control the transport of contaminants at fracture-dominated sites. The proposed WFO utilizes proven off-the-shelf technology in the form of CR-39 radon detectors, which have been widely deployed to detect radon levels in homes and businesses. In an existing collaborative EPA/INL study outside of this workscope,. CR-39 detectors are being utilized to determine the location of active transport fractures in a fractured granitic upland adjacent to a landfill site at the Fort Devens, MA that EPA-designated as National Priorities List (NPL) site. The innovative concept of using an easily deployed port that allows the CR-39 to measure the Rn-222 in the soil or alluvium above the fractured rock, while restricting atmospheric Rn-222 and soil sourced Ra from contaminating the detector is unique to INL and EPA approach previously developed. By deploying a series of these inexpensive detector-casing combinations statistical samples of the Rn-222 flux can be measured, elucidating the most communicative fractures (i.e. fractures that are actively transporting water and gasses). The Rn-222 measurements can then be used as an input to create a more accurate conceptual model to be used for transport modeling and related cleanup activities. If the team’s approach is demonstrated to be applicable to a wide variety of rock types and soil conditions it might potentially offer significant cost saving without a reduction in data quality at Monsanto Superfund and other sites underlain by fracture-dominated bedrock.« less

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

Comparison of alternative MS/MS and bioinformatics approaches for confident phosphorylation site localization.

PubMed

Wiese, Heike; Kuhlmann, Katja; Wiese, Sebastian; Stoepel, Nadine S; Pawlas, Magdalena; Meyer, Helmut E; Stephan, Christian; Eisenacher, Martin; Drepper, Friedel; Warscheid, Bettina

2014-02-07

Over the past years, phosphoproteomics has advanced to a prime tool in signaling research. Since then, an enormous amount of information about in vivo protein phosphorylation events has been collected providing a treasure trove for gaining a better understanding of the molecular processes involved in cell signaling. Yet, we still face the problem of how to achieve correct modification site localization. Here we use alternative fragmentation and different bioinformatics approaches for the identification and confident localization of phosphorylation sites. Phosphopeptide-enriched fractions were analyzed by multistage activation, collision-induced dissociation and electron transfer dissociation (ETD), yielding complementary phosphopeptide identifications. We further found that MASCOT, OMSSA and Andromeda each identified a distinct set of phosphopeptides allowing the number of site assignments to be increased. The postsearch engine SLoMo provided confident phosphorylation site localization, whereas different versions of PTM-Score integrated in MaxQuant differed in performance. Based on high-resolution ETD and higher collisional dissociation (HCD) data sets from a large synthetic peptide and phosphopeptide reference library reported by Marx et al. [Nat. Biotechnol. 2013, 31 (6), 557-564], we show that an Andromeda/PTM-Score probability of 1 is required to provide an false localization rate (FLR) of 1% for HCD data, while 0.55 is sufficient for high-resolution ETD spectra. Additional analyses of HCD data demonstrated that for phosphotyrosine peptides and phosphopeptides containing two potential phosphorylation sites, PTM-Score probability cutoff values of <1 can be applied to ensure an FLR of 1%. Proper adjustment of localization probability cutoffs allowed us to significantly increase the number of confident sites with an FLR of <1%.Our findings underscore the need for the systematic assessment of FLRs for different score values to report confident modification site localization.

A systematic identification of species-specific protein succinylation sites using joint element features information.

PubMed

Hasan, Md Mehedi; Khatun, Mst Shamima; Mollah, Md Nurul Haque; Yong, Cao; Guo, Dianjing

2017-01-01

Lysine succinylation, an important type of protein posttranslational modification, plays significant roles in many cellular processes. Accurate identification of succinylation sites can facilitate our understanding about the molecular mechanism and potential roles of lysine succinylation. However, even in well-studied systems, a majority of the succinylation sites remain undetected because the traditional experimental approaches to succinylation site identification are often costly, time-consuming, and laborious. In silico approach, on the other hand, is potentially an alternative strategy to predict succinylation substrates. In this paper, a novel computational predictor SuccinSite2.0 was developed for predicting generic and species-specific protein succinylation sites. This predictor takes the composition of profile-based amino acid and orthogonal binary features, which were used to train a random forest classifier. We demonstrated that the proposed SuccinSite2.0 predictor outperformed other currently existing implementations on a complementarily independent dataset. Furthermore, the important features that make visible contributions to species-specific and cross-species-specific prediction of protein succinylation site were analyzed. The proposed predictor is anticipated to be a useful computational resource for lysine succinylation site prediction. The integrated species-specific online tool of SuccinSite2.0 is publicly accessible.

Spatial characterization, risk assessment, and statistical source identification of the dissolved trace elements in the Ganjiang River-feeding tributary of the Poyang Lake, China.

PubMed

Zhang, Hua; Jiang, Yinghui; Wang, Min; Wang, Peng; Shi, Guangxun; Ding, Mingjun

2017-01-01

Surface water samples were collected from 20 sampling sites throughout the Ganjiang River during pre-monsoon, monsoon, and post-monsoon seasons, and the concentrations of dissolved trace elements were determined by inductively coupled plasma-mass spectrometry (ICP-MS) for the spatial and seasonal variations, risk assessment, source identification, and categorization for risk area. The result demonstrated that concentrations of the elements exhibited significant seasonality. The high total element concentrations were detected at sites close to the intensive mining and urban activities. The concentrations of the elements were under the permissible limits as prescribed by related standards with a few exceptions. The most of heavy metal pollution index (HPI) values were lower than the critical index limit, indicating the basically clean water used as habitat for aquatic life. As was identified as the priority pollutant of non-carcinogenic and carcinogenic concerns, and the inhabitants ingesting the surface water at particular site might be subjected to the integrated health risks for exposure to the mixed trace elements. Multivariate statistical analyses confirmed that Zn, As, Cd, and Tl were derived from mining and urban activities; V, Cd, and Pb exhibited mixed origin; and Co, Ni, and Cu mainly resulted from natural processes. Three categorized risk areas corresponded to high, moderate, and low risks, respectively. As a whole, the upstream of the Ganjiang River was identified as the high-risk area relatively.

Distribution and Features of the Six Classes of Peroxiredoxins

PubMed Central

Poole, Leslie B.; Nelson, Kimberly J.

2016-01-01

Peroxiredoxins are cysteine-dependent peroxide reductases that group into 6 different, structurally discernable classes. In 2011, our research team reported the application of a bioinformatic approach called active site profiling to extract active site-proximal sequence segments from the 29 distinct, structurally-characterized peroxiredoxins available at the time. These extracted sequences were then used to create unique profiles for the six groups which were subsequently used to search GenBank(nr), allowing identification of ∼3500 peroxiredoxin sequences and their respective subgroups. Summarized in this minireview are the features and phylogenetic distributions of each of these peroxiredoxin subgroups; an example is also provided illustrating the use of the web accessible, searchable database known as PREX to identify subfamily-specific peroxiredoxin sequences for the organism Vitis vinifera (grape). PMID:26810075

Final Scientific Report - Wind Powering America State Outreach Project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sinclair, Mark; Margolis, Anne

2012-02-01

The goal of the Wind Powering America State Outreach Project was to facilitate the adoption of effective state legislation, policy, finance programs, and siting best practices to accelerate public acceptance and development of wind energy. This was accomplished by Clean Energy States Alliance (CESA) through provision of informational tools including reports and webinars as well as the provision of technical assistance to state leaders on wind siting, policy, and finance best practices, identification of strategic federal-state partnership activities for both onshore and offshore wind, and participation in regional wind development collaboratives. The Final Scientific Report - Wind Powering America Statemore » Outreach Project provides a summary of the objectives, activities, and outcomes of this project as accomplished by CESA over the period 12/1/2009 - 11/30/2011.« less

In their own words: why teenagers don't use social networking sites.

PubMed

Baker, Rosland K; White, Katherine M

2011-06-01

We explored common reasons for non-use of the rapidly growing popularity of social networking sites among a sample of Australian adolescents (N = 69). Transcripts were coded by grouping responses along similar themes for non-use that had been commonly stated by participants. The primary reasons offered by adolescents were: lack of motivation, poor use of time, preference for other forms of communication, preference for engaging in other activities, cybersafety concerns, and a dislike of self-presentation online. The identification of these themes allows for a greater understanding of teenagers' decisions not to engage in the popular medium of communication and points to possible strategies that could be utilised by Web site developers in efforts to appeal to a wider teenage audience.

Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

2003-06-01

OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less

Hierarchy within the mammary STAT5-driven Wap super-enhancer.

PubMed

Shin, Ha Youn; Willi, Michaela; HyunYoo, Kyung; Zeng, Xianke; Wang, Chaochen; Metser, Gil; Hennighausen, Lothar

2016-08-01

Super-enhancers comprise dense transcription factor platforms highly enriched for active chromatin marks. A paucity of functional data led us to investigate the role of super-enhancers in the mammary gland, an organ characterized by exceptional gene regulatory dynamics during pregnancy. ChIP-seq analysis for the master regulator STAT5A, the glucocorticoid receptor, H3K27ac and MED1 identified 440 mammary-specific super-enhancers, half of which were associated with genes activated during pregnancy. We interrogated the Wap super-enhancer, generating mice carrying mutations in STAT5-binding sites within its constituent enhancers. Individually, the most distal site displayed the greatest enhancer activity. However, combinatorial mutation analysis showed that the 1,000-fold induction in gene expression during pregnancy relied on all enhancers. Disabling the binding sites of STAT5, NFIB and ELF5 in the proximal enhancer incapacitated the entire super-enhancer. Altogether, these data suggest a temporal and functional enhancer hierarchy. The identification of mammary-specific super-enhancers and the mechanistic exploration of the Wap locus provide insights into the regulation of cell-type-specific expression of hormone-sensing genes.

Identification of a novel selD homolog from Eukaryotes, Bacteria, and Archaea: Is there an autoregulatory mechanism in selenocysteine metabolism?

PubMed Central

Guimarães, M. Jorge; Peterson, David; Vicari, Alain; Cocks, Benjamin G.; Copeland, Neal G.; Gilbert, Debra J.; Jenkins, Nancy A.; Ferrick, David A.; Kastelein, Robert A.; Bazan, J. Fernando; Zlotnik, Albert

1996-01-01

Escherichia coli selenophosphate synthetase (SPS, the selD gene product) catalyzes the production of monoselenophosphate, the selenium donor compound required for synthesis of selenocysteine (Sec) and seleno-tRNAs. We report the molecular cloning of human and mouse homologs of the selD gene, designated Sps2, which contains an in-frame TGA codon at a site corresponding to the enzyme’s putative active site. These sequences allow the identification of selD gene homologs in the genomes of the bacterium Haemophilus influenzae and the archaeon Methanococcus jannaschii, which had been previously misinterpreted due to their in-frame TGA codon. Sps2 mRNA levels are elevated in organs previously implicated in the synthesis of selenoproteins and in active sites of blood cell development. In addition, we show that Sps2 mRNA is up-regulated upon activation of T lymphocytes and have mapped the Sps2 gene to mouse chromosome 7. Using the mouse gene isolated from the hematopoietic cell line FDCPmixA4, we devised a construct for protein expression that results in the insertion of a FLAG tag sequence at the N terminus of the SPS2 protein. This strategy allowed us to document the readthrough of the in-frame TGA codon and the incorporation of 75Se into SPS2. These results suggest the existence of an autoregulatory mechanism involving the incorporation of Sec into SPS2 that might be relevant to blood cell biology. This mechanism is likely to have been present in ancient life forms and conserved in a variety of living organisms from all domains of life. PMID:8986768

Evolutionarily Conserved Linkage between Enzyme Fold, Flexibility, and Catalysis

PubMed Central

Ramanathan, Arvind; Agarwal, Pratul K.

2011-01-01

Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 Å away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme–substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme–substrate interactions, thereby impacting the mechanism of catalyzed chemistry. These results have implications for understanding the mechanism of allostery, and for protein engineering and drug design. PMID:22087074

Evolutionarily conserved linkage between enzyme fold, flexibility, and catalysis.

PubMed

Ramanathan, Arvind; Agarwal, Pratul K

2011-11-01

Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 Å away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme-substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme-substrate interactions, thereby impacting the mechanism of catalyzed chemistry. These results have implications for understanding the mechanism of allostery, and for protein engineering and drug design.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramanathan, Arvind; Agarwal, Pratul K

Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function.more » Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme substrate interactions, thereby impacting the mechanism of catalyzed chemistry. These results have implications for understanding the mechanism of allostery, and for protein engineering and drug design.« less

Identification of a DNA sequence motif required for expression of iron-regulated genes in pseudomonads.

PubMed

Rombel, I T; McMorran, B J; Lamont, I L

1995-02-20

Many bacteria respond to a lack of iron in the environment by synthesizing siderophores, which act as iron-scavenging compounds. Fluorescent pseudomonads synthesize strain-specific but chemically related siderophores called pyoverdines or pseudobactins. We have investigated the mechanisms by which iron controls expression of genes involved in pyoverdine metabolism in Pseudomonas aeruginosa. Transcription of these genes is repressed by the presence of iron in the growth medium. Three promoters from these genes were cloned and the activities of the promoters were dependent on the amounts of iron in the growth media. Two of the promoters were sequenced and the transcriptional start site were identified by S1 nuclease analysis. Sequences similar to the consensus binding site for the Fur repressor protein, which controls expression of iron-repressible genes in several gram-negative species, were not present in the promoters, suggesting that they are unlikely to have a high affinity for Fur. However, comparison of the promoter sequences with those of iron-regulated genes from other Pseudomonas species and also the iron-regulated exotoxin gene of P. aeruginosa allowed identification of a shared sequence element, with the consensus sequence (G/C)CTAAAT-CCC, which is likely to act as a binding site for a transcriptional activator protein. Mutations in this sequence greatly reduced the activities of the promoters characterized here as well as those of other iron-regulated promoters. The requirement for this motif in the promoters of iron-regulated genes of different Pseudomonas species indicates that similar mechanisms are likely to be involved in controlling expression of a range of iron-regulated genes in pseudomonads.

Identification of residues of CXCR4 critical for human immunodeficiency virus coreceptor and chemokine receptor activities.

PubMed

Brelot, A; Heveker, N; Montes, M; Alizon, M

2000-08-04

CXCR4 is a G-coupled receptor for the stromal cell-derived factor (SDF-1) chemokine, and a CD4-associated human immunodeficiency virus type 1 (HIV-1) coreceptor. These functions were studied in a panel of CXCR4 mutants bearing deletions in the NH(2)-terminal extracellular domain (NT) or substitutions in the NT, the extracellular loops (ECL), or the transmembrane domains (TMs). The coreceptor activity of CXCR4 was markedly impaired by mutations of two Tyr residues in NT (Y7A/Y12A) or at a single Asp residue in ECL2 (D193A), ECL3 (D262A), or TMII (D97N). These acidic residues could engage electrostatical interactions with basic residues of the HIV-1 envelope protein gp120, known to contribute to the selectivity for CXCR4. The ability of CXCR4 mutants to bind SDF-1 and mediate cell signal was consistent with the two-site model of chemokine-receptor interaction. Site I involved in SDF-1 binding but not signaling was located in NT with particular importance of Glu(14) and/or Glu(15) and Tyr(21). Residues required for both SDF-1 binding and signaling, and thus probably part of site II, were identified in ECL2 (Asp(187)), TMII (Asp(97)), and TMVII (Glu(288)). The first residues () of NT also seem required for SDF-1 binding and signaling. A deletion in the third intracellular loop abolished signaling, probably by disrupting the coupling with G proteins. The identification of CXCR4 residues involved in the interaction with both SDF-1 and HIV-1 may account for the signaling activity of gp120 and has implications for the development of antiviral compounds.

Mass spectrometry for identification of proteins that specifically bind to a distal enhancer of the Oct4 gene

NASA Astrophysics Data System (ADS)

Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.

2017-11-01

Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.

Mapping of contact sites in complex formation between transducin and light-activated rhodopsin by covalent crosslinking: Use of a photoactivatable reagent

PubMed Central

Cai, Kewen; Itoh, Yoshiki; Khorana, H. Gobind

2001-01-01

Interaction of light-activated rhodopsin with transducin (T) is the first event in visual signal transduction. We use covalent crosslinking approaches to map the contact sites in interaction between the two proteins. Here we use a photoactivatable reagent, N-[(2-pyridyldithio)-ethyl], 4-azido salicylamide. The reagent is attached to the SH group of cytoplasmic monocysteine rhodopsin mutants by a disulfide-exchange reaction with the pyridylthio group, and the derivatized rhodopsin then is complexed with T by illumination at λ >495 nm. Subsequent irradiation of the complex at λ310 nm generates covalent crosslinks between the two proteins. Crosslinking was demonstrated between T and a number of single cysteine rhodopsin mutants. However, sites of crosslinks were investigated in detail only between T and the rhodopsin mutant S240C (cytoplasmic loop V-VI). Crosslinking occurred predominantly with Tα. For identification of the sites of crosslinks in Tα, the strategy used involved: (i) derivatization of all of the free cysteines in the crosslinked proteins with N-ethylmaleimide; (ii) reduction of the disulfide bond linking the two proteins and isolation of all of the Tα species carrying the crosslinked moiety with a free SH group; (iii) adduct formation of the latter with the N-maleimide moiety of the reagent, maleimido-butyryl-biocytin, containing a biotinyl group; (iv) trypsin degradation of the resulting Tα derivatives and isolation of Tα peptides carrying maleimido-butyryl-biocytin by avidin-agarose chromatography; and (v) identification of the isolated peptides by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. We found that crosslinking occurred mainly to two C-terminal peptides in Tα containing the amino acid sequences 310–313 and 342–345. PMID:11320237

Virtual Lead Identification of Farnesyltransferase Inhibitors Based on Ligand and Structure-Based Pharmacophore Techniques

PubMed Central

Al-Balas, Qosay A.; Amawi, Haneen A.; Hassan, Mohammad A.; Qandil, Amjad M.; Almaaytah, Ammar M.; Mhaidat, Nizar M.

2013-01-01

Farnesyltransferase enzyme (FTase) is considered an essential enzyme in the Ras signaling pathway associated with cancer. Thus, designing inhibitors for this enzyme might lead to the discovery of compounds with effective anticancer activity. In an attempt to obtain effective FTase inhibitors, pharmacophore hypotheses were generated using structure-based and ligand-based approaches built in Discovery Studio v3.1. Knowing the presence of the zinc feature is essential for inhibitor’s binding to the active site of FTase enzyme; further customization was applied to include this feature in the generated pharmacophore hypotheses. These pharmacophore hypotheses were thoroughly validated using various procedures such as ROC analysis and ligand pharmacophore mapping. The validated pharmacophore hypotheses were used to screen 3D databases to identify possible hits. Those which were both high ranked and showed sufficient ability to bind the zinc feature in active site, were further refined by applying drug-like criteria such as Lipiniski’s “rule of five” and ADMET filters. Finally, the two candidate compounds (ZINC39323901 and ZINC01034774) were allowed to dock using CDOCKER and GOLD in the active site of FTase enzyme to optimize hit selection. PMID:24276257

Virtual lead identification of farnesyltransferase inhibitors based on ligand and structure-based pharmacophore techniques.

PubMed

Al-Balas, Qosay A; Amawi, Haneen A; Hassan, Mohammad A; Qandil, Amjad M; Almaaytah, Ammar M; Mhaidat, Nizar M

2013-05-27

Farnesyltransferase enzyme (FTase) is considered an essential enzyme in the Ras signaling pathway associated with cancer. Thus, designing inhibitors for this enzyme might lead to the discovery of compounds with effective anticancer activity. In an attempt to obtain effective FTase inhibitors, pharmacophore hypotheses were generated using structure-based and ligand-based approaches built in Discovery Studio v3.1. Knowing the presence of the zinc feature is essential for inhibitor's binding to the active site of FTase enzyme; further customization was applied to include this feature in the generated pharmacophore hypotheses. These pharmacophore hypotheses were thoroughly validated using various procedures such as ROC analysis and ligand pharmacophore mapping. The validated pharmacophore hypotheses were used to screen 3D databases to identify possible hits. Those which were both high ranked and showed sufficient ability to bind the zinc feature in active site, were further refined by applying drug-like criteria such as Lipiniski's "rule of five" and ADMET filters. Finally, the two candidate compounds (ZINC39323901 and ZINC01034774) were allowed to dock using CDOCKER and GOLD in the active site of FTase enzyme to optimize hit selection.

Identification of bacteria synthesizing ribosomal RNA in response to uranium addition during biostimulation at the Rifle, CO Integrated Field Research site

DOE PAGES

McGuinness, Lora R.; Wilkins, Michael J.; Williams, Kenneth H.; ...

2015-09-18

Understanding which organisms are capable of reducing uranium at historically contaminated sites provides crucial information needed to evaluate treatment options and outcomes. One approach is determination of the bacteria which directly respond to uranium addition. In this research, uranium amendments were made to groundwater samples from a site of ongoing biostimulation with acetate. The active microbes in the planktonic phase were deduced by monitoring ribosomes production via RT-PCR. The results indicated several microorganisms were synthesizing ribosomes in proportion with uranium amendment up to 2 μM. Concentrations of U (VI) >2 μM were generally found to inhibit ribosome synthesis. Two activemore » bacteria responding to uranium addition in the field were close relatives of Desulfobacter postgateii and Geobacter bemidjiensis. Since RNA content often increases with growth rate, our findings suggest it is possible to rapidly elucidate active bacteria responding to the addition of uranium in field samples and provides a more targeted approach to stimulate specific populations to enhance radionuclide reduction in contaminated sites.« less

Elemental composition of airborne particulates and source identification - An extensive one year survey. [in Cleveland, OH

NASA Technical Reports Server (NTRS)

King, R. B.; Fordyce, J. S.; Antoine, A. C.; Leibecki, H. F.; Neustadter, H. E.; Sidik, S. M.

1976-01-01

Concentrations of 60 chemical elements in the airborne particulate matter were measured at 16 sites in Cleveland, OH over a 1 year period during 1971 and 1972 (45 to 50 sampling days). Analytical methods used included instrumental neutron activation, emission spectroscopy, and combustion techniques. Uncertainties in the concentrations associated with the sampling procedures, the analytical methods, the use of several analytical facilities, and samples with concentrations below the detection limits are evaluated in detail. The data are discussed in relation to other studies and source origins. The trace constituent concentrations as a function of wind direction are used to suggest a practical method for air pollution source identification.

Identification of a DNA-binding site for the transcription factor Haa1, required for Saccharomyces cerevisiae response to acetic acid stress

PubMed Central

Mira, Nuno P.; Henriques, Sílvia F.; Keller, Greg; Teixeira, Miguel C.; Matos, Rute G.; Arraiano, Cecília M.; Winge, Dennis R.; Sá-Correia, Isabel

2011-01-01

The transcription factor Haa1 is the main player in reprogramming yeast genomic expression in response to acetic acid stress. Mapping of the promoter region of one of the Haa1-activated genes, TPO3, allowed the identification of an acetic acid responsive element (ACRE) to which Haa1 binds in vivo. The in silico analysis of the promoter regions of the genes of the Haa1-regulon led to the identification of an Haa1-responsive element (HRE) 5′-GNN(G/C)(A/C)(A/G)G(A/G/C)G-3′. Using surface plasmon resonance experiments and electrophoretic mobility shift assays it is demonstrated that Haa1 interacts with high affinity (KD of 2 nM) with the HRE motif present in the ACRE region of TPO3 promoter. No significant interaction was found between Haa1 and HRE motifs having adenine nucleotides at positions 6 and 8 (KD of 396 and 6780 nM, respectively) suggesting that Haa1p does not recognize these motifs in vivo. A lower affinity of Haa1 toward HRE motifs having mutations in the guanine nucleotides at position 7 and 9 (KD of 21 and 119 nM, respectively) was also observed. Altogether, the results obtained indicate that the minimal functional binding site of Haa1 is 5′-(G/C)(A/C)GG(G/C)G-3′. The Haa1-dependent transcriptional regulatory network active in yeast response to acetic acid stress is proposed. PMID:21586585

Development of Guidelines for Identification of SCC Sites and Estimation of Re-Inspection Intervals for SCC Direct Assessment

DOT National Transportation Integrated Search

2010-05-31

This report describes the development of a series of guidelines for the identification of SCC sites and the estimation of re-inspection intervals. These SCC Guidelines are designed to complement and supplement existing SCC Direct Assessment protocols...

LFP Oscillations in the Mesencephalic Locomotor Region during Voluntary Locomotion

PubMed Central

Noga, Brian R.; Sanchez, Francisco J.; Villamil, Luz M.; O’Toole, Christopher; Kasicki, Stefan; Olszewski, Maciej; Cabaj, Anna M.; Majczyński, Henryk; Sławińska, Urszula; Jordan, Larry M.

2017-01-01

Oscillatory rhythms in local field potentials (LFPs) are thought to coherently bind cooperating neuronal ensembles to produce behaviors, including locomotion. LFPs recorded from sites that trigger locomotion have been used as a basis for identification of appropriate targets for deep brain stimulation (DBS) to enhance locomotor recovery in patients with gait disorders. Theta band activity (6–12 Hz) is associated with locomotor activity in locomotion-inducing sites in the hypothalamus and in the hippocampus, but the LFPs that occur in the functionally defined mesencephalic locomotor region (MLR) during locomotion have not been determined. Here we record the oscillatory activity during treadmill locomotion in MLR sites effective for inducing locomotion with electrical stimulation in rats. The results show the presence of oscillatory theta rhythms in the LFPs recorded from the most effective MLR stimulus sites (at threshold ≤60 μA). Theta activity increased at the onset of locomotion, and its power was correlated with the speed of locomotion. In animals with higher thresholds (>60 μA), the correlation between locomotor speed and theta LFP oscillations was less robust. Changes in the gamma band (previously recorded in vitro in the pedunculopontine nucleus (PPN), thought to be a part of the MLR) were relatively small. Controlled locomotion was best achieved at 10–20 Hz frequencies of MLR stimulation. Our results indicate that theta and not delta or gamma band oscillation is a suitable biomarker for identifying the functional MLR sites. PMID:28579945

Evaluation of ERTS-1 imagery in mapping and managing soil and range resources in the Sand Hills Region of Nebraska

NASA Technical Reports Server (NTRS)

Seevers, P. M.; Drew, J. V.

1973-01-01

Interpretations of high altitude photography of test sites in the Sandhills of Nebraska permitted identification of subirrigated range sites as well as complexes of choppy sands and sands range sites, units composing approximately 85% of the Sandhills rangeland. These range sites form the basic units necessary for the interpretation of range condition classes used in grazing management. Analysis of ERTS-1 imagery acquired during August, September and October, 1972 indicated potential for the identification of gross differences in forage density within given range sites identified on early season aerial photography.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slade, Daniel J.; Fang, Pengfei; Dreyton, Christina J.

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ionsmore » that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs.« less

Identification of novel amino acid residues of influenza virus PA-X that are important for PA-X shutoff activity by using yeast.

PubMed

Oishi, Kohei; Yamayoshi, Seiya; Kawaoka, Yoshihiro

2018-03-01

The influenza A virus protein PA-X comprises an N-terminal PA region and a C-terminal PA-X-specific region. PA-X suppresses host gene expression, termed shutoff, via mRNA cleavage. Although the endonuclease active site in the N-terminal PA region of PA-X and basic amino acids in the C-terminal PA-X-specific region are known to be important for PA-X shutoff activity, other amino acids may also play a role. Here, we used yeast to identify novel amino acids of PA-X that are important for PA-X shutoff activity. Unlike wild-type PA-X, most PA-X mutants predominantly localized in the cytoplasm, indicating that these mutations decreased the shutoff activity of PA-X by affecting PA-X translocation to the nucleus. Mapping of the identified amino acids onto the N-terminal structure of PA revealed that some of them likely contribute to the formation of the endonuclease active site of PA. Copyright © 2018. Published by Elsevier Inc.

Epitope Structure of the Carbohydrate Recognition Domain of Asialoglycoprotein Receptor to a Monoclonal Antibody Revealed by High-Resolution Proteolytic Excision Mass Spectrometry

NASA Astrophysics Data System (ADS)

Stefanescu, Raluca; Born, Rita; Moise, Adrian; Ernst, Beat; Przybylski, Michael

2011-01-01

Recent studies suggest that the H1 subunit of the carbohydrate recognition domain (H1CRD) of the asialoglycoprotein receptor is used as an entry site into hepatocytes by hepatitis A and B viruses and Marburg virus. Thus, molecules binding specifically to the CRD might exert inhibition towards these diseases by blocking the virus entry site. We report here the identification of the epitope structure of H1CRD to a monoclonal antibody by proteolytic epitope excision of the immune complex and high-resolution MALDI-FTICR mass spectrometry. As a prerequisite of the epitope determination, the primary structure of the H1CRD antigen was characterised by ESI-FTICR-MS of the intact protein and by LC-MS/MS of tryptic digest mixtures. Molecular mass determination and proteolytic fragments provided the identification of two intramolecular disulfide bridges (seven Cys residues), and a Cys-mercaptoethanol adduct formed by treatment with β-mercaptoethanol during protein extraction. The H1CRD antigen binds to the monoclonal antibody in both native and Cys-alkylated form. For identification of the epitope, the antibody was immobilized on N-hydroxysuccinimide (NHS)-activated Sepharose. Epitope excision and epitope extraction with trypsin and FTICR-MS of affinity-bound peptides provided the identification of two specific epitope peptides (5-16) and (17-23) that showed high affinity to the antibody. Affinity studies of the synthetic epitope peptides revealed independent binding of each peptide to the antibody.

Activity-based proteome profiling of potential cellular targets of Orlistat--an FDA-approved drug with anti-tumor activities.

PubMed

Yang, Peng-Yu; Liu, Kai; Ngai, Mun Hong; Lear, Martin J; Wenk, Markus R; Yao, Shao Q

2010-01-20

Orlistat, or tetrahydrolipstatin (THL), is an FDA-approved antiobesity drug with potential antitumor activities. Cellular off-targets and potential side effects of Orlistat in cancer therapies, however, have not been extensively explored thus far. In this study, we report the total of synthesis of THL-like protein-reactive probes, in which extremely conservative modifications (i.e., an alkyne handle) were introduced in the parental THL structure to maintain the native biological properties of Orlistat, while providing the necessary functionality for target identification via the bio-orthogonal click chemistry. With these natural productlike, cell-permeable probes, we were able to demonstrate, for the first time, this chemical proteomic approach is suitable for the identification of previously unknown cellular targets of Orlistat. In addition to the expected fatty acid synthase (FAS), we identified a total of eight new targets, some of which were further validated by experiments including Western blotting, recombinant protein expression, and site-directed mutagenesis. Our findings have important implications in the consideration of Orlistat as a potential anticancer drug at its early stages of development for cancer therapy. Our strategy should be broadly useful for off-target identification against quite a number of existing drugs and/or candidates, which are also covalent modifiers of their biological targets.

Computation-Facilitated Assignment of Function in the Enolase Superfamily: A Regiochemically Distinct Galactarate Dehydratase from Oceanobacillus iheyensis†

PubMed Central

Rakus, John F.; Kalyanaraman, Chakrapani; Fedorov, Alexander A.; Fedorov, Elena V.; Mills-Groninger, Fiona P.; Toro, Rafael; Bonanno, Jeffrey; Bain, Kevin; Sauder, J. Michael; Burley, Stephen K.; Almo, Steven C.; Jacobson, Matthew P.; Gerlt, John A.

2009-01-01

The structure of an uncharacterized member of the enolase superfamily from Oceanobacillus iheyensis (GI: 23100298; IMG locus tag Ob2843; PDB Code 2OQY) was determined by the New York SGX Research Center for Structural Genomics (NYSGXRC). The structure contained two Mg2+ ions located 10.4 Å from one another, with one located in the canonical position in the (β/α)7β-barrel domain (although the ligand at the end of the fifth β-strand is His, unprecedented in structurally characterized members of the superfamily); the second is located in a novel site within the capping domain. In silico docking of a library of mono- and diacid sugars to the active site predicted a diacid sugar as a likely substrate. Activity screening of a physical library of acid sugars identified galactarate as the substrate (kcat = 6.8 s−1, KM = 620 μM; kcat/KM = 1.1 × 104 M−1 s−1), allowing functional assignment of Ob2843 as galactarate dehydratase (GalrD-II) The structure of a complex of the catalytically impaired Y90F mutant with Mg2+ and galactarate allowed identification of a Tyr 164-Arg 162 dyad as the base that initiates the reaction by abstraction of the α-proton and Tyr 90 as the acid that facilitates departure of the β-OH leaving group. The enzyme product is 2-keto-3-deoxy-D-threo-4,5-dihydroxyadipate, the enantiomer of the product obtained in the GalrD reaction catalyzed by a previously characterized bifunctional L-talarate/galactarate dehydratase (TalrD/GalrD). On the basis of the different active site structures and different regiochemistries, we recognize that these functions represent an example of apparent, not actual, convergent evolution of function. The structure of GalrD-II and its active site architecture allow identification of the seventh functionally and structurally characterized subgroup in the enolase superfamily. This study provides an additional example that an integrated sequence/structure-based strategy employing computational approaches is a viable approach for directing functional assignment of unknown enzymes discovered in genome projects. PMID:19883118

INVESTIGATING THE EFFICACY OF CLINICAL TRIAL MONITORING STRATEGIES: Design and Implementation of the Cluster Randomized START Monitoring Substudy

PubMed Central

Hullsiek, Katherine Huppler; Kagan, Jonathan M; Engen, Nicole; Grarup, Jesper; Hudson, Fleur; Denning, Eileen T; Carey, Catherine; Courtney-Rodgers, David; Finley, Elizabeth B; Jansson, Per O; Pearson, Mary T; Peavy, Dwight E; Belloso, Waldo H

2014-01-01

Background Trial monitoring protects participant safety and study integrity. While monitors commonly go on-site to verify source data, there is little evidence that this practice is efficient or effective. An ongoing international HIV treatment trial (START) provides an opportunity to explore the usefulness of different monitoring approaches. Methods All START sites are centrally monitored and required to follow a local monitoring plan requiring specific quality assurance activities. Additionally, sites were randomized (1:1) to receive, or not receive, annual on-site monitoring. The study will determine if on-site monitoring increases the identification of major protocol deviations (eligibility or consent violations, improper study drug use, primary or serious event underreporting, data alteration or fraud). Results The START study completed enrollment in December 2013, with planned follow-up through December 2016. The monitoring study is ongoing at 196 sites in 34 countries. Results are expected when the START study concludes in December 2016. PMID:25973346

Novel synthesis and structural characterization of a high-affinity paramagnetic kinase probe for the identification of non-ATP site binders by nuclear magnetic resonance.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moy, Franklin J.; Lee, Arthur; Gavrin, Lori Krim

2010-07-23

To aid in the pursuit of selective kinase inhibitors, we have developed a unique ATP site binder tool for the detection of binders outside the ATP site by nuclear magnetic resonance (NMR). We report here the novel synthesis that led to this paramagnetic spin-labeled pyrazolopyrimidine probe (1), which exhibits nanomolar inhibitory activity against multiple kinases. We demonstrate the application of this probe by performing NMR binding experiments with Lck and Src kinases and utilize it to detect the binding of two compounds proximal to the ATP site. The complex structure of the probe with Lck is also presented, revealing howmore » the probe fits in the ATP site and the specific interactions it has with the protein. We believe that this spin-labeled probe is a valuable tool that holds broad applicability in a screen for non-ATP site binders.« less

Identification of the hydrophobic strand in the A–B loop of leptin as major binding site III: implications for large-scale preparation of potent recombinant human and ovine leptin antagonists

PubMed Central

Niv-Spector, Leonora; Gonen-Berger, Dana; Gourdou, Isabelle; Biener, Eva; Gussakovsky, Eugene E.; Benomar, Yackir; Ramanujan, Krishnan V.; Taouis, Mohammed; Herman, Brian; Callebaut, Isabelle; Djiane, Jean; Gertler, Arieh

2005-01-01

Interaction of leptin with its receptors resembles that of interleukin-6 and granulocyte colony-stimulating factor, which interact with their receptors through binding sites I–III. Site III plays a pivotal role in receptors' dimerization or tetramerization and subsequent activation. Leptin's site III also mediates the formation of an active multimeric complex through its interaction with the IGD (immunoglobulin-like domain) of LEPRs (leptin receptors). Using a sensitive hydrophobic cluster analysis of leptin's and LEPR's sequences, we identified hydrophobic stretches in leptin's A–B loop (amino acids 39–42) and in the N-terminal end of LEPR's IGD (amino acids 325–328) that are predicted to participate in site III and to interact with each other in a β-sheet-like configuration. To verify this hypothesis, we prepared and purified to homogeneity (as verified by SDS/PAGE, gel filtration and reverse-phase chromatography) several alanine muteins of amino acids 39–42 in human and ovine leptins. CD analyses revealed that those mutations hardly affect the secondary structure. All muteins acted as true antagonists, i.e. they bound LEPR with an affinity similar to the wild-type hormone, had no agonistic activity and specifically inhibited leptin action in several leptin-responsive in vitro bioassays. Alanine mutagenesis of LEPR's IGD (amino acids 325–328) drastically reduced its biological but not binding activity, indicating the importance of this region for interaction with leptin's site III. FRET (fluorescence resonance energy transfer) microscopy experiments have documented that the transient FRET signalling occurring upon exposure to leptin results not from binding of the ligand, but from ligand-induced oligomerization of LEPRs mediated by leptin's site III. PMID:15952938

Molecular identification of T. brucei s.l. in tsetse flies after long-term permanence in field traps.

PubMed

Gomes, Joana; Leão, Celia; Ferreira, Filipa; Afonso, Maria Odete; Santos, Catarina; Josenando, Theophile; Seixas, Jorge; Atouguia, Jorge; Centeno-Lima, Sonia

2009-10-24

Tsetse flies (Glossina spp.) are responsible for the transmission of trypanosomes, agents of animal and Human African Trypanosomiasis (HAT). These diseases are associated with considerable animal and human economical loss, morbidity and mortality. The correct identification of trypanosomes species infecting tsetse flies is crucial for adequate control measures. Identification presently requires technically difficult, cumbersome and expensive on-site fly dissection. To obviate this difficulty we explored the possibility of correctly identifying trypanosomes in tsetse collected, under field conditions, only for number determination. Tsetse flies, that remained exposed for weeks in field traps in the Vista Alegre HAT focus in Angola, were obtained. The flies were not dissected on site and were stored at room temperature for months. DNA extraction using the whole tsetse bodies and PCR analysis were performed in 73 randomly chosen flies. Despite the extensive degradation of the tsetse, DNA extraction was conducted successfully in 62 out of the 73 flies. PCR analysis detected the presence of T. brucei s.l DNA in 3.2 % of the tsetse. This approach could be cost-effective and suitable for vector related HAT control activities in the context of countries where entomological trained personnel is missing and financial resources are limited.

Identification of site frequencies from building records

USGS Publications Warehouse

Celebi, M.

2003-01-01

A simple procedure to identify site frequencies using earthquake response records from roofs and basements of buildings is presented. For this purpose, data from five different buildings are analyzed using only spectral analyses techniques. Additional data such as free-field records in close proximity to the buildings and site characterization data are also used to estimate site frequencies and thereby to provide convincing evidence and confirmation of the site frequencies inferred from the building records. Furthermore, simple code-formula is used to calculate site frequencies and compare them with the identified site frequencies from records. Results show that the simple procedure is effective in identification of site frequencies and provides relatively reliable estimates of site frequencies when compared with other methods. Therefore the simple procedure for estimating site frequencies using earthquake records can be useful in adding to the database of site frequencies. Such databases can be used to better estimate site frequencies of those sites with similar geological structures.

Genome-Independent Identification of RNA Editing by Mutual Information (GIREMI) | Informatics Technology for Cancer Research (ITCR)

Cancer.gov

Identification of single-nucleotide variants in RNA-seq data. Current version focuses on detection of RNA editing sites without requiring genome sequence data. New version is under development to separately identify RNA editing sites and genetic variants using RNA-seq data alone.

Identification of a novel K311 ubiquitination site critical for androgen receptor transcriptional activity

PubMed Central

Cork, David M.W.; Darby, Steven; Ryan-Munden, Claudia A.; Nakjang, Sirintra; Mendes Côrtes, Leticia; Treumann, Achim; Gaughan, Luke

2017-01-01

Abstract The androgen receptor (AR) is the main driver of prostate cancer (PC) development and progression, and the primary therapeutic target in PC. To date, two functional ubiquitination sites have been identified on AR, both located in its C-terminal ligand binding domain (LBD). Recent reports highlight the emergence of AR splice variants lacking the LBD that can arise during disease progression and contribute to castrate resistance. Here, we report a novel N-terminal ubiquitination site at lysine 311. Ubiquitination of this site plays a role in AR stability and is critical for its transcriptional activity. Inactivation of this site causes AR to accumulate on chromatin and inactivates its transcriptional function as a consequence of inability to bind to p300. Additionally, mutation at lysine 311 affects cellular transcriptome altering the expression of genes involved in chromatin organization, signaling, adhesion, motility, development and metabolism. Even though this site is present in clinically relevant AR-variants it can only be ubiquitinated in cells when AR retains LBD suggesting a role for AR C-terminus in E2/E3 substrate recognition. We report that as a consequence AR variants lacking the LBD cannot be ubiquitinated in the cellular environment and their protein turnover must be regulated via an alternate pathway. PMID:27903893

Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

PubMed Central

Gupta, Gagan Deep; Kumar, Vinay

2012-01-01

Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

Gingival crevicular fluid alkaline phosphatase activity as a non-invasive biomarker of skeletal maturation.

PubMed

Perinetti, G; Baccetti, T; Contardo, L; Di Lenarda, R

2011-02-01

To evaluate the gingival crevicular fluid (GCF) alkaline phosphatase (ALP) activity in growing subjects in relation to the stages of individual skeletal maturation. The Department of Biomedicine, University of Trieste. Seventy-two healthy growing subjects (45 women and 27 men; range, 7.8-17.7 years). Double-blind, prospective, cross-sectional design. Samples of GCF were collected from each subject at the mesial and distal sites of both of the central incisors, in the maxilla and mandible. Skeletal maturation phase was assessed through the cervical vertebral maturation (CVM) method. Enzymatic activity was determined spectrophotometrically. The relationship between GCF ALP activity and CVM stages was significant. In particular, a twofold peak in enzyme activity was seen at the CS3 and CS4 pubertal stages, compared to the pre-pubertal stages (CS1 and CS2) and post-pubertal stages (CS5 and CS6), at both the maxillary and mandibular sites. No differences were seen between the maxillary and mandibular sites, or between the sexes. As an adjunct to standard methods based upon radiographic parameters, the GCF ALP may be a candidate as a non-invasive clinical biomarker for the identification of the pubertal growth spurt in periodontally healthy subjects scheduled for orthodontic treatment. © 2010 John Wiley & Sons A/S.

Searching for transcription factor binding sites in vector spaces

PubMed Central

2012-01-01

Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338

Work plan for the identification of techniques for in-situ sensing of layering/interfaces of Hanford high level waste tank

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vargo, G.F. Jr.

1995-06-16

The purpose of this work scope is to identify a specific potential technology/device/instrument/ideas that would provide the tank waste data. A method is needed for identifying layering and physical state within the large waste tanks at the Hanford site in Washington State. These interfaces and state changes can adversely impact sampling and characterization activities.

Multimodal Intervention Trial for Cognitive Deficits in Neurofibromatosis Type 1: Efficacy of computerized Cognitive Training and Stimulant Medication

DTIC Science & Technology

2016-10-01

created research database , submitted for and obtained IRB approval for the coordinating site (Children’s National), and enrolled B participants...intellectual quotient, executive functioning, and academic perfonnance In children with NFl over time. Given the high incidence and burdens of...identification and training of study personnel and database initial activities (months 2·6); 3) participant recruitment, therapy, and participant

High-throughput Screening Identification of Poliovirus RNA-dependent RNA Polymerase Inhibitors

PubMed Central

Campagnola, Grace; Gong, Peng; Peersen, Olve B.

2011-01-01

Viral RNA-dependent RNA polymerase (RdRP) enzymes are essential for the replication of positive-strand RNA viruses and established targets for the development of selective antiviral therapeutics. In this work we have carried out a high-throughput screen of 154,267 compounds to identify poliovirus polymerase inhibitors using a fluorescence based RNA elongation assay. Screening and subsequent validation experiments using kinetic methods and RNA product analysis resulted in the identification of seven inhibitors that affect the RNA binding, initiation, or elongation activity of the polymerase. X-ray crystallography data show clear density for five of the compounds in the active site of the poliovirus polymerase elongation complex. The inhibitors occupy the NTP binding site by stacking on the priming nucleotide and interacting with the templating base, yet competition studies show fairly weak IC50 values in the low μM range. A comparison with nucleotide bound structures suggests that weak binding is likely due to the lack of a triphosphate group on the inhibitors. Consequently, the inhibitors are primarily effective at blocking polymerase initiation and do not effectively compete with NTP binding during processive elongation. These findings are discussed in the context of the polymerase elongation complex structure and allosteric control of the viral RdRP catalytic cycle. PMID:21722674

novPTMenzy: a database for enzymes involved in novel post-translational modifications

PubMed Central

Khater, Shradha; Mohanty, Debasisa

2015-01-01

With the recent discoveries of novel post-translational modifications (PTMs) which play important roles in signaling and biosynthetic pathways, identification of such PTM catalyzing enzymes by genome mining has been an area of major interest. Unlike well-known PTMs like phosphorylation, glycosylation, SUMOylation, no bioinformatics resources are available for enzymes associated with novel and unusual PTMs. Therefore, we have developed the novPTMenzy database which catalogs information on the sequence, structure, active site and genomic neighborhood of experimentally characterized enzymes involved in five novel PTMs, namely AMPylation, Eliminylation, Sulfation, Hydroxylation and Deamidation. Based on a comprehensive analysis of the sequence and structural features of these known PTM catalyzing enzymes, we have created Hidden Markov Model profiles for the identification of similar PTM catalyzing enzymatic domains in genomic sequences. We have also created predictive rules for grouping them into functional subfamilies and deciphering their mechanistic details by structure-based analysis of their active site pockets. These analytical modules have been made available as user friendly search interfaces of novPTMenzy database. It also has a specialized analysis interface for some PTMs like AMPylation and Eliminylation. The novPTMenzy database is a unique resource that can aid in discovery of unusual PTM catalyzing enzymes in newly sequenced genomes. Database URL: http://www.nii.ac.in/novptmenzy.html PMID:25931459

Comprehensive identification of novel proteins and N-glycosylation sites in royal jelly

PubMed Central

2014-01-01

Background Royal jelly (RJ) is a proteinaceous secretion produced from the hypopharyngeal and mandibular glands of nurse bees. It plays vital roles in honeybee biology and in the improvement of human health. However, some proteins remain unknown in RJ, and mapping N-glycosylation modification sites on RJ proteins demands further investigation. We used two different liquid chromatography-tandem mass spectrometry techniques, complementary N-glycopeptide enrichment strategies, and bioinformatic approaches to gain a better understanding of novel and glycosylated proteins in RJ. Results A total of 25 N-glycosylated proteins, carrying 53 N-glycosylation sites, were identified in RJ proteins, of which 42 N-linked glycosylation sites were mapped as novel on RJ proteins. Most of the glycosylated proteins were related to metabolic activities and health improvement. The 13 newly identified proteins were also mainly associated with metabolic processes and health improvement activities. Conclusion Our in-depth, large-scale mapping of novel glycosylation sites represents a crucial step toward systematically revealing the functionality of N-glycosylated RJ proteins, and is potentially useful for producing a protein with desirable pharmacokinetic and biological activity using a genetic engineering approach. The newly-identified proteins significantly extend the proteome coverage of RJ. These findings contribute vital and new knowledge to our understanding of the innate biochemical nature of RJ at both the proteome and glycoproteome levels. PMID:24529077

Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection

PubMed Central

Fedrigo, Olivier; Babbitt, Courtney C.; Wortham, Matthew; Tewari, Alok K.; London, Darin; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Parker, Stephen C. J.; Margulies, Elliott H.; Wray, Gregory A.; Furey, Terrence S.; Crawford, Gregory E.

2012-01-01

Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS) sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species. PMID:22761590

Photoaffinity labeling in target- and binding-site identification

PubMed Central

Smith, Ewan; Collins, Ian

2015-01-01

Photoaffinity labeling (PAL) using a chemical probe to covalently bind its target in response to activation by light has become a frequently used tool in drug discovery for identifying new drug targets and molecular interactions, and for probing the location and structure of binding sites. Methods to identify the specific target proteins of hit molecules from phenotypic screens are highly valuable in early drug discovery. In this review, we summarize the principles of PAL including probe design and experimental techniques for in vitro and live cell investigations. We emphasize the need to optimize and validate probes and highlight examples of the successful application of PAL across multiple disease areas. PMID:25686004

Systems-level identification of PKA-dependent signaling in epithelial cells.

PubMed

Isobe, Kiyoshi; Jung, Hyun Jun; Yang, Chin-Rang; Claxton, J'Neka; Sandoval, Pablo; Burg, Maurice B; Raghuram, Viswanathan; Knepper, Mark A

2017-10-17

G protein stimulatory α-subunit (G αs )-coupled heptahelical receptors regulate cell processes largely through activation of protein kinase A (PKA). To identify signaling processes downstream of PKA, we deleted both PKA catalytic subunits using CRISPR-Cas9, followed by a "multiomic" analysis in mouse kidney epithelial cells expressing the G αs -coupled V2 vasopressin receptor. RNA-seq (sequencing)-based transcriptomics and SILAC (stable isotope labeling of amino acids in cell culture)-based quantitative proteomics revealed a complete loss of expression of the water-channel gene Aqp2 in PKA knockout cells. SILAC-based quantitative phosphoproteomics identified 229 PKA phosphorylation sites. Most of these PKA targets are thus far unannotated in public databases. Surprisingly, 1,915 phosphorylation sites with the motif x-(S/T)-P showed increased phosphooccupancy, pointing to increased activity of one or more MAP kinases in PKA knockout cells. Indeed, phosphorylation changes associated with activation of ERK2 were seen in PKA knockout cells. The ERK2 site is downstream of a direct PKA site in the Rap1GAP, Sipa1l1, that indirectly inhibits Raf1. In addition, a direct PKA site that inhibits the MAP kinase kinase kinase Map3k5 (ASK1) is upstream of JNK1 activation. The datasets were integrated to identify a causal network describing PKA signaling that explains vasopressin-mediated regulation of membrane trafficking and gene transcription. The model predicts that, through PKA activation, vasopressin stimulates AQP2 exocytosis by inhibiting MAP kinase signaling. The model also predicts that, through PKA activation, vasopressin stimulates Aqp2 transcription through induction of nuclear translocation of the acetyltransferase EP300, which increases histone H3K27 acetylation of vasopressin-responsive genes (confirmed by ChIP-seq).

Identification of Surface-Exposed Protein Radicals and A Substrate Oxidation Site in A-Class Dye-Decolorizing Peroxidase from Thermomonospora curvata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shrestha, Ruben; Chen, Xuejie; Ramyar, Kasra X.

Dye-decolorizing peroxidases (DyPs) are a family of heme peroxidases in which a catalytic distal aspartate is involved in H 2O 2 activation to catalyze oxidations under acidic conditions. They have received much attention due to their potential applications in lignin compound degradation and biofuel production from biomass. However, the mode of oxidation in bacterial DyPs remains unknown. We have recently reported that the bacterial TcDyP from Thermomonospora curvata is among the most active DyPs and shows activity toward phenolic lignin model compounds. On the basis of the X-ray crystal structure solved at 1.75 Å, sigmoidal steady-state kinetics with Reactive Bluemore » 19 (RB19), and formation of compound II like product in the absence of reducing substrates observed with stopped-flow spectroscopy and electron paramagnetic resonance (EPR), we hypothesized that the TcDyP catalyzes oxidation of large-size substrates via multiple surface-exposed protein radicals. Among 7 tryptophans and 3 tyrosines in TcDyP consisting of 376 residues for the matured protein, W263, W376, and Y332 were identified as surface-exposed protein radicals. Only the W263 was also characterized as one of the surface-exposed oxidation sites. SDS-PAGE and size-exclusion chromatography demonstrated that W376 represents an off-pathway destination for electron transfer, resulting in the cross-linking of proteins in the absence of substrates. Mutation of W376 improved compound I stability and overall catalytic efficiency toward RB19. While Y332 is highly conserved across all four classes of DyPs, its catalytic function in A-class TcDyP is minimal, possibly due to its extremely small solvent-accessible areas. Identification of surface-exposed protein radicals and substrate oxidation sites is important for understanding the DyP mechanism and modulating its catalytic functions for improved activity on phenolic lignin.« less

Phosphorylation of measles virus nucleoprotein upregulates the transcriptional activity of minigenomic RNA.

PubMed

Hagiwara, Kyoji; Sato, Hiroki; Inoue, Yoshihisa; Watanabe, Akira; Yoneda, Misako; Ikeda, Fusako; Fujita, Kentaro; Fukuda, Hiroyuki; Takamura, Chizuko; Kozuka-Hata, Hiroko; Oyama, Masaaki; Sugano, Sumio; Ohmi, Shinobu; Kai, Chieko

2008-05-01

We report the first identification of phosphorylation sites of the nucleoprotein (N) of the family Paramyxoviridae. The N protein is known to be the most abundant protein in infected cells; it constructs the N-RNA complex (nucleocapsid) and supports transcription and replication of viral genomic RNA. To determine the role of phosphorylation of the N protein, we expressed the N protein of the HL strain of measles virus (MV) in mammalian cells and purified the nucleocapsid. After separation of the C-terminal region from the core region, phosphorylated amino acids were assayed using MALDI-TOF/TOF and ESI-Q-TOF MS analyses. Two amino acids, S479 and S510, were shown to be phosphorylated by both methods of analysis. Metabolic labeling of the N protein with (32)P demonstrated that these two sites are the major phosphorylated sites within the MV-N protein. In transcriptional analysis using negative-strand minigenomic RNA containing the ORF of the luciferase gene, mutants of each phosphorylation site showed approximately 80% reduction in luciferase activity compared with the wild-type N, suggesting that the phosphorylation of N protein is important in the activation of the transcription of viral mRNA and/or replication of the genome in vivo.

PKA regulates calcineurin function through the phosphorylation of RCAN1: Identification of a novel phosphorylation site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Seon Sook; Lee, Eun Hye; Lee, Kooyeon

2015-04-17

Calcineurin is a calcium/calmodulin-dependent phosphatase that has been implicated in T cell activation through the induction of nuclear factors of activated T cells (NFAT). We have previously suggested that endogenous regulator of calcineurin (RCAN1, also known as DSCR1) is targeted by protein kinase A (PKA) for the control of calcineurin activity. In the present study, we characterized the PKA-mediated phosphorylation site in RCAN1 by mass spectrometric analysis and revealed that PKA directly phosphorylated RCAN1 at the Ser 93. PKA-induced phosphorylation and the increase in the half-life of the RCAN1 protein were prevented by the substitution of Ser 93 with Alamore » (S93A). Furthermore, the PKA-mediated phosphorylation of RCAN1 at Ser 93 potentiated the inhibition of calcineurin-dependent pro-inflammatory cytokine gene expression by RCAN1. Our results suggest the presence of a novel phosphorylation site in RCAN1 and that its phosphorylation influences calcineurin-dependent inflammatory target gene expression. - Highlights: • We identify novel phosphorylation sites in RCAN1 by LC-MS/MS analysis. • PKA-dependent phosphorylation of RCAN1 at Ser 93 inhibits calcineurin-mediated intracellular signaling. • We show the immunosuppressive function of RCAN1 phosphorylation at Ser 93 in suppressing cytokine expression.« less

Identification and characterization of Kaposi's sarcoma-associated herpesvirus open reading frame 11 promotor activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Lei

2008-01-01

Open reading frame 11 (ORF11) of Kaposi's sarcoma-associated herpesvirus belongs to a herpesviral homologous protein family shared by some members of the gamma- herpesvirus subfamily. Little is known about this ORF11 homologous protein family. We have characterized an unknown open reading frame, ORF11, located adjacent and in the opposite orientation to a well-characterized viral IL-6 gene. Northern blot analysis reveals that ORF11 is expressed during the KSHV lytic cycle with delayed-early transcription kinetics. We have determined the 5{prime} and 3{prime} untranslated region of the unspliced ORF11 transcript and identified both the transcription start site and the transcription termination site. Coremore » promoter region, representing ORF11 promoter activity, was mapped to a 159nt fragment 5{prime} most proximal to the transcription start site. A functional TATA box was identified in the core promoter region. Interestingly, we found that ORF11 transcriptional activation is not responsive to Rta, the KSHV lytic switch protein. We also discovered that part of the ORF11 promoter region, the 209nt fragment upstream of the transcription start site, was repressed by phorbol esters. Our data help to understand transcription regulation of ORF11 and to elucidate roles of ORF11 in KSHV pathogenesis and life cycle.« less

Molecular modeling and identification of novel glucokinase activators through stepwise virtual screening.

PubMed

Behera, Pabitra Mohan; Behera, Deepak Kumar; Satpati, Suresh; Agnihotri, Geetanjali; Nayak, Sanghamitra; Padhi, Payodhar; Dixit, Anshuman

2015-04-01

The glucose phosphorylating enzyme glucokinase (GK) is a 50kD monomeric protein having 465 amino acids. It maintains glucose homeostasis inside cells, acts as a glucose sensor in pancreatic β-cells and as a rate controlling enzyme for hepatic glucose clearance and glycogen synthesis. It has two binding sites, one for binding d-glucose and the other for a putative allosteric activator named glucokinase activator (GKA). The GKAs interact with the same region of the GK enzyme that is commonly affected by naturally occurring mutations in humans. However, many GKAs do not bind to GK in the absence of glucose. Recently, it has been reported that GKAs are highly effective in patients with type 2 diabetes mellitus. In this milieu a molecular modeling study has been carried out on three natural variants of GK that lie in the GKA binding site and are known to cause maturity onset diabetes of young (MODY). Additionally, a 10ns molecular dynamics simulation was done on each of the modeled variant in order to explore the flexibility of this site. Subsequently, a systematic virtual screening study was done to identify compounds which can bind with high affinity at GKA binding site of mutant GK. Copyright © 2015 Elsevier Inc. All rights reserved.

qPMS9: An Efficient Algorithm for Quorum Planted Motif Search

NASA Astrophysics Data System (ADS)

Nicolae, Marius; Rajasekaran, Sanguthevar

2015-01-01

Discovering patterns in biological sequences is a crucial problem. For example, the identification of patterns in DNA sequences has resulted in the determination of open reading frames, identification of gene promoter elements, intron/exon splicing sites, and SH RNAs, location of RNA degradation signals, identification of alternative splicing sites, etc. In protein sequences, patterns have led to domain identification, location of protease cleavage sites, identification of signal peptides, protein interactions, determination of protein degradation elements, identification of protein trafficking elements, discovery of short functional motifs, etc. In this paper we focus on the identification of an important class of patterns, namely, motifs. We study the (l, d) motif search problem or Planted Motif Search (PMS). PMS receives as input n strings and two integers l and d. It returns all sequences M of length l that occur in each input string, where each occurrence differs from M in at most d positions. Another formulation is quorum PMS (qPMS), where the motif appears in at least q% of the strings. We introduce qPMS9, a parallel exact qPMS algorithm that offers significant runtime improvements on DNA and protein datasets. qPMS9 solves the challenging DNA (l, d)-instances (28, 12) and (30, 13). The source code is available at https://code.google.com/p/qpms9/.

Catalytic site identification--a web server to identify catalytic site structural matches throughout PDB.

PubMed

Kirshner, Daniel A; Nilmeier, Jerome P; Lightstone, Felice C

2013-07-01

The catalytic site identification web server provides the innovative capability to find structural matches to a user-specified catalytic site among all Protein Data Bank proteins rapidly (in less than a minute). The server also can examine a user-specified protein structure or model to identify structural matches to a library of catalytic sites. Finally, the server provides a database of pre-calculated matches between all Protein Data Bank proteins and the library of catalytic sites. The database has been used to derive a set of hypothesized novel enzymatic function annotations. In all cases, matches and putative binding sites (protein structure and surfaces) can be visualized interactively online. The website can be accessed at http://catsid.llnl.gov.

GRID-seq reveals the global RNA-chromatin interactome

PubMed Central

Li, Xiao; Zhou, Bing; Chen, Liang; Gou, Lan-Tao; Li, Hairi; Fu, Xiang-Dong

2017-01-01

Higher eukaryotic genomes are bound by a large number of coding and non-coding RNAs, but approaches to comprehensively map the identity and binding sites of these RNAs are lacking. Here we report a method to in situ capture global RNA interactions with DNA by deep sequencing (GRID-seq), which enables the comprehensive identification of the entire repertoire of chromatin-interacting RNAs and their respective binding sites. In human, mouse and Drosophila cells, we detected a large set of tissue-specific coding and non-coding RNAs that are bound to active promoters and enhancers, especially super-enhancers. Assuming that most mRNA-chromatin interactions indicate the physical proximity of a promoter and an enhancer, we constructed a three-dimensional global connectivity map of promoters and enhancers, revealing transcription activity-linked genomic interactions in the nucleus. PMID:28922346

Automated Rocket Propulsion Test Management

NASA Technical Reports Server (NTRS)

Walters, Ian; Nelson, Cheryl; Jones, Helene

2007-01-01

The Rocket Propulsion Test-Automated Management System provides a central location for managing activities associated with Rocket Propulsion Test Management Board, National Rocket Propulsion Test Alliance, and the Senior Steering Group business management activities. A set of authorized users, both on-site and off-site with regard to Stennis Space Center (SSC), can access the system through a Web interface. Web-based forms are used for user input with generation and electronic distribution of reports easily accessible. Major functions managed by this software include meeting agenda management, meeting minutes, action requests, action items, directives, and recommendations. Additional functions include electronic review, approval, and signatures. A repository/library of documents is available for users, and all items are tracked in the system by unique identification numbers and status (open, closed, percent complete, etc.). The system also provides queries and version control for input of all items.

Site-to-site interdomain communication may mediate different loss-of-function mechanisms in a cancer-associated NQO1 polymorphism

NASA Astrophysics Data System (ADS)

Medina-Carmona, Encarnación; Neira, Jose L.; Salido, Eduardo; Fuchs, Julian E.; Palomino-Morales, Rogelio; Timson, David J.; Pey, Angel L.

2017-03-01

Disease associated genetic variations often cause intracellular enzyme inactivation, dysregulation and instability. However, allosteric communication of mutational effects to distant functional sites leading to loss-of-function remains poorly understood. We characterize here interdomain site-to-site communication by which a common cancer-associated single nucleotide polymorphism (c.C609T/p.P187S) reduces the activity and stability in vivo of NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a FAD-dependent, two-domain multifunctional stress protein acting as a Phase II enzyme, activating cancer pro-drugs and stabilizing p53 and p73α oncosuppressors. We show that p.P187S causes structural and dynamic changes communicated to functional sites far from the mutated site, affecting the FAD binding site located at the N-terminal domain (NTD) and accelerating proteasomal degradation through dynamic effects on the C-terminal domain (CTD). Structural protein:protein interaction studies reveal that the cancer-associated polymorphism does not abolish the interaction with p73α, indicating that oncosuppressor destabilization largely mirrors the low intracellular stability of p.P187S. In conclusion, we show how a single disease associated amino acid change may allosterically perturb several functional sites in an oligomeric and multidomain protein. These results have important implications for the understanding of loss-of-function genetic diseases and the identification of novel structural hot spots as targets for pharmacological intervention.

Carbohydrate binding sites in a pancreatic alpha-amylase-substrate complex, derived from X-ray structure analysis at 2.1 A resolution.

PubMed Central

Qian, M.; Haser, R.; Payan, F.

1995-01-01

The X-ray structure analysis of a crystal of pig pancreatic alpha-amylase (PPA, EC 3.2.1.1.) that was soaked with the substrate maltopentaose showed electron density corresponding to two independent carbohydrate recognition sites on the surface of the molecule. Both binding sites are distinct from the active site described in detail in our previous high-resolution study of a complex between PPA and a carbohydrate inhibitor (Qian M, Buisson G, Duée E, Haser H, Payan F, 1994, Biochemistry 33:6284-6294). One of the binding sites previously identified in a 5-A-resolution electron density map, lies at a distance of 20 A from the active site cleft and can accommodate two glucose units. The second affinity site for sugar units is located close to the calcium binding site. The crystal structure of the maltopentaose complex was refined at 2.1 A resolution, to an R-factor of 17.5%, with an RMS deviation in bond distances of 0.007 A. The model includes all 496 residues of the enzyme, 1 calcium ion, 1 chloride ion, 425 water molecules, and 3 bound sugar rings. The binding sites are characterized and described in detail. The present complex structure provides the evidence of an increased stability of the structure upon interaction with the substrate and allows identification of an N-terminal pyrrolidonecarboxylic acid in PPA. PMID:7613472

Temporary disaster debris management site identification using binomial cluster analysis and GIS.

PubMed

Grzeda, Stanislaw; Mazzuchi, Thomas A; Sarkani, Shahram

2014-04-01

An essential component of disaster planning and preparation is the identification and selection of temporary disaster debris management sites (DMS). However, since DMS identification is a complex process involving numerous variable constraints, many regional, county and municipal jurisdictions initiate this process during the post-disaster response and recovery phases, typically a period of severely stressed resources. Hence, a pre-disaster approach in identifying the most likely sites based on the number of locational constraints would significantly contribute to disaster debris management planning. As disasters vary in their nature, location and extent, an effective approach must facilitate scalability, flexibility and adaptability to variable local requirements, while also being generalisable to other regions and geographical extents. This study demonstrates the use of binomial cluster analysis in potential DMS identification in a case study conducted in Hamilton County, Indiana. © 2014 The Author(s). Disasters © Overseas Development Institute, 2014.

Brain Region and Isoform-Specific Phosphorylation Alters Kalirin SH2 Domain Interaction Sites and Calpain Sensitivity

PubMed Central

Miller, Megan B.; Yan, Yan; Machida, Kazuya; Kiraly, Drew D.; Levy, Aaron D.; Wu, Yi I.; Lam, TuKiet T.; Abbott, Thomas; Koleske, Anthony J.; Eipper, Betty A.; Mains, Richard E.

2017-01-01

Kalirin7 (Kal7), a postsynaptic Rho GDP/GTP exchange factor (RhoGEF), plays a crucial role in long term potentiation and in the effects of cocaine on behavior and spine morphology. The KALRN gene has been linked to schizophrenia and other disorders of synaptic function. Mass spectrometry was used to quantify phosphorylation at 26 sites in Kal7 from individual adult rat nucleus accumbens and prefrontal cortex before and after exposure to acute or chronic cocaine. Region- and isoform-specific phosphorylation was observed along with region-specific effects of cocaine on Kal7 phosphorylation. Evaluation of the functional significance of multi-site phosphorylation in a complex protein like Kalirin is difficult. With the identification of five tyrosine phosphorylation (pY) sites, a panel of 71 SH2 domains was screened, identifying subsets that interacted with multiple pY sites in Kal7. In addition to this type of reversible interaction, endoproteolytic cleavage by calpain plays an essential role in long-term potentiation. Calpain cleaved Kal7 at two sites, separating the N-terminal domain, which affects spine length, and the PDZ binding motif from the GEF domain. Mutations preventing phosphorylation did not affect calpain sensitivity or GEF activity; phosphomimetic mutations at specific sites altered protein stability, increased calpain sensitivity and reduced GEF activity. PMID:28418645

Structure of the catalytic sites in Fe/N/C-catalysts for O2-reduction in PEM fuel cells.

PubMed

Kramm, Ulrike I; Herranz, Juan; Larouche, Nicholas; Arruda, Thomas M; Lefèvre, Michel; Jaouen, Frédéric; Bogdanoff, Peter; Fiechter, Sebastian; Abs-Wurmbach, Irmgard; Mukerjee, Sanjeev; Dodelet, Jean-Pol

2012-09-07

Fe-based catalytic sites for the reduction of oxygen in acidic medium have been identified by (57)Fe Mössbauer spectroscopy of Fe/N/C catalysts containing 0.03 to 1.55 wt% Fe, which were prepared by impregnation of iron acetate on carbon black followed by heat-treatment in NH(3) at 950 °C. Four different Fe-species were detected at all iron concentrations: three doublets assigned to molecular FeN(4)-like sites with their ferrous ions in a low (D1), intermediate (D2) or high (D3) spin state, and two other doublets assigned to a single Fe-species (D4 and D5) consisting of surface oxidized nitride nanoparticles (Fe(x)N, with x≤ 2.1). A fifth Fe-species appears only in those catalysts with Fe-contents ≥0.27 wt%. It is characterized by a very broad singlet, which has been assigned to incomplete FeN(4)-like sites that quickly dissolve in contact with an acid. Among the five Fe-species identified in these catalysts, only D1 and D3 display catalytic activity for the oxygen reduction reaction (ORR) in the acid medium, with D3 featuring a composite structure with a protonated neighbour basic nitrogen and being by far the most active species, with an estimated turn over frequency for the ORR of 11.4 e(-) per site per s at 0.8 V vs. RHE. Moreover, all D1 sites and between 1/2 and 2/3 of the D3 sites are acid-resistant. A scheme for the mechanism of site formation upon heat-treatment is also proposed. This identification of the ORR-active sites in these catalysts is of crucial importance to design strategies to improve the catalytic activity and stability of these materials.

Oxime amides as a novel zinc binding group in histone deacetylase inhibitors: synthesis, biological activity, and computational evaluation.

PubMed

Botta, Cinzia B; Cabri, Walter; Cini, Elena; De Cesare, Lucia; Fattorusso, Caterina; Giannini, Giuseppe; Persico, Marco; Petrella, Antonello; Rondinelli, Francesca; Rodriquez, Manuela; Russo, Adele; Taddei, Maurizio

2011-04-14

Several oxime containing molecules, characterized by a SAHA-like structure, were explored to select a potentially new biasing binding element for the zinc in HDAC catalytic site. All compounds were evaluated for their in vitro inhibitory activity against the 11 human HDACs isoforms. After identification of a "hit" molecule, a programmed variation at the cap group and at the linker was carried out in order to increase HDAC inhibition and/or paralogue selectivity. Some of the new derivatives showed increased activity against a number of HDAC isoforms, even if their overall activity range is still far from the inhibition values reported for SAHA. Moreover, different from what was reported for their hydroxamic acid analogues the new α-oxime amide derivatives do not select between class I and class II HDACs; rather they target specific isoforms in each class. These somehow contradictory results were finally rationalized by a computational assisted SAR, which gave us the chance to understand how the oxime derivatives interact with the catalytic site and justify the observed activity profile.

Ancient DNA analysis of Indigenous rockfish use on the Pacific Coast: Implications for marine conservation areas and fisheries management

PubMed Central

McKechnie, Iain; Yang, Dongya Y.

2018-01-01

Rockfish (Sebastes spp.) are a common marine fish in nearshore and continental shelf environments in the North Pacific Ocean. They are frequently identified in coastal archaeological sites in western North America; however, the morphological similarity of rockfish species limits conventional zooarchaeological identifications to the genus level. This study applies ancient DNA analysis to 96 archaeological rockfish specimens from four sites on separate islands in an archipelago on western Vancouver Island, British Columbia, Canada. Two of the archaeological sites are located within a marine protected area specifically designed to facilitate the recovery of inshore rockfish populations; two sites are located outside this boundary and remain subject to considerable fishing pressure. Using mitochondrial 16S and control region DNA sequences, we identify at least twelve different rockfish species utilized during the past 2,500 years. Identification of rockfish at closely spaced and contemporaneously occupied sites confirms that a variety of Sebastes species were consistently exploited at each site, with more exposed areas having a higher number of species present. Identification results indicate that four of the twelve species did not occur within the conservation area boundary and, instead, were found in sites where commercial and recreational fishing continues to be permitted. This study demonstrates that ancient DNA identifications of archaeological assemblages can complement and expand perspective on modern day fisheries conservation and management in this National Park Reserve and First Nations ancestral territory. PMID:29438388

Ancient DNA analysis of Indigenous rockfish use on the Pacific Coast: Implications for marine conservation areas and fisheries management.

PubMed

Rodrigues, Antonia T; McKechnie, Iain; Yang, Dongya Y

2018-01-01

Rockfish (Sebastes spp.) are a common marine fish in nearshore and continental shelf environments in the North Pacific Ocean. They are frequently identified in coastal archaeological sites in western North America; however, the morphological similarity of rockfish species limits conventional zooarchaeological identifications to the genus level. This study applies ancient DNA analysis to 96 archaeological rockfish specimens from four sites on separate islands in an archipelago on western Vancouver Island, British Columbia, Canada. Two of the archaeological sites are located within a marine protected area specifically designed to facilitate the recovery of inshore rockfish populations; two sites are located outside this boundary and remain subject to considerable fishing pressure. Using mitochondrial 16S and control region DNA sequences, we identify at least twelve different rockfish species utilized during the past 2,500 years. Identification of rockfish at closely spaced and contemporaneously occupied sites confirms that a variety of Sebastes species were consistently exploited at each site, with more exposed areas having a higher number of species present. Identification results indicate that four of the twelve species did not occur within the conservation area boundary and, instead, were found in sites where commercial and recreational fishing continues to be permitted. This study demonstrates that ancient DNA identifications of archaeological assemblages can complement and expand perspective on modern day fisheries conservation and management in this National Park Reserve and First Nations ancestral territory.

On multi-site damage identification using single-site training data

NASA Astrophysics Data System (ADS)

Barthorpe, R. J.; Manson, G.; Worden, K.

2017-11-01

This paper proposes a methodology for developing multi-site damage location systems for engineering structures that can be trained using single-site damaged state data only. The methodology involves training a sequence of binary classifiers based upon single-site damage data and combining the developed classifiers into a robust multi-class damage locator. In this way, the multi-site damage identification problem may be decomposed into a sequence of binary decisions. In this paper Support Vector Classifiers are adopted as the means of making these binary decisions. The proposed methodology represents an advancement on the state of the art in the field of multi-site damage identification which require either: (1) full damaged state data from single- and multi-site damage cases or (2) the development of a physics-based model to make multi-site model predictions. The potential benefit of the proposed methodology is that a significantly reduced number of recorded damage states may be required in order to train a multi-site damage locator without recourse to physics-based model predictions. In this paper it is first demonstrated that Support Vector Classification represents an appropriate approach to the multi-site damage location problem, with methods for combining binary classifiers discussed. Next, the proposed methodology is demonstrated and evaluated through application to a real engineering structure - a Piper Tomahawk trainer aircraft wing - with its performance compared to classifiers trained using the full damaged-state dataset.

Target identification, lead optimization and antitumor evaluation of some new 1,2,4-triazines as c-Met kinase inhibitors.

PubMed

El-Wakil, Marwa H; Ashour, Hayam M; Saudi, Manal N; Hassan, Ahmed M; Labouta, Ibrahim M

2017-08-01

In silico target fishing approach using PharmMapper server identified c-Met kinase as the selective target for our previously synthesized compound NCI 748494/1. This approach was validated by in vitro kinase assay which showed that NCI 748494/1 possessed promising inhibitory activity against c-Met kinase (IC 50 =31.70μM). Assessment of ADMET profiling, drug-likeness, drug score as well as docking simulation for the binding pose of that compound in the active site of c-Met kinase domain revealed that NCI 748494/1 could be considered as a promising drug lead. Based on target identification and validation, it was observed that there is structure similarity between NCI 748494/1 and the reported type II c-Met kinase inhibitor BMS-777607. Optimization of our lead NCI 748494/1 furnished newly synthesized 1,2,4-triazine derivatives based on well-established structure-activity relationships, whereas three compounds namely; 4d, 7a and 8c displayed excellent in vitro cytotoxicity against three c-Met addicted cancer cell lines; A549 (lung adenocarcinoma), HT-29 (colon cancer) and MKN-45 (gastric carcinoma); with IC 50 values in the range 0.01-1.86µM. In vitro c-Met kinase assay showed 8c to possess the highest c-Met kinase inhibition profile (IC 50 =4.31µM). Docking of the active compounds in c-Met kinase active site revealed strong binding interactions comparable to the lead NCI 748494/1 and BMS-777607, suggesting that c-Met inhibition is very likely to be the mechanism of the antitumor effect of these derivatives. Copyright © 2017 Elsevier Inc. All rights reserved.

Enhanced characterization of singly protonated phosphopeptide ions by femtosecond laser-induced ionization/dissociation tandem mass spectrometry (fs-LID-MS/MS).

PubMed

Smith, Scott A; Kalcic, Christine L; Safran, Kyle A; Stemmer, Paul M; Dantus, Marcos; Reid, Gavin E

2010-12-01

To develop an improved understanding of the regulatory role that post-translational modifications (PTMs) involving phosphorylation play in the maintenance of normal cellular function, tandem mass spectrometry (MS/MS) strategies coupled with ion activation techniques such as collision-induced dissociation (CID) and electron-transfer dissociation (ETD) are typically employed to identify the presence and site-specific locations of the phosphate moieties within a given phosphoprotein of interest. However, the ability of these techniques to obtain sufficient structural information for unambiguous phosphopeptide identification and characterization is highly dependent on the ion activation method employed and the properties of the precursor ion that is subjected to dissociation. Herein, we describe the application of a recently developed alternative ion activation technique for phosphopeptide analysis, termed femtosecond laser-induced ionization/dissociation (fs-LID). In contrast to CID and ETD, fs-LID is shown to be particularly suited to the analysis of singly protonated phosphopeptide ions, yielding a wide range of product ions including a, b, c, x, y, and z sequence ions, as well as ions that are potentially diagnostic of the positions of phosphorylation (e.g., 'a(n)+1-98'). Importantly, the lack of phosphate moiety losses or phosphate group 'scrambling' provides unambiguous information for sequence identification and phosphorylation site characterization. Therefore, fs-LID-MS/MS can serve as a complementary technique to established methodologies for phosphoproteomic analysis. Copyright © 2010. Published by Elsevier Inc.

Bombing Target Identification from Limited Transect Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roberts, Barry L.; Hathaway, John E.; Pulsipher, Brent A.

2006-08-07

A series of sensor data combined with geostatistical techniques were used to determine likely target areas for a historic military aerial bombing range. Primary data consisted of magnetic anomaly information from limited magnetometer transects across the site. Secondary data included airborne LIDAR, orthophotography, and other general site characterization information. Identification of likely target areas relied primarily upon kriging estimates of magnetic anomaly densities across the site. Secondary information, such as impact crater locations, was used to refine the boundary delineations.

Heparin/heparan sulfate 6-O-sulfatase from Flavobacterium heparinum: integrated structural and biochemical investigation of enzyme active site and substrate specificity.

PubMed

Myette, James R; Soundararajan, Venkataramanan; Shriver, Zachary; Raman, Rahul; Sasisekharan, Ram

2009-12-11

Heparin and heparan sulfate glycosaminoglycans (HSGAGs) comprise a chemically heterogeneous class of sulfated polysaccharides. The development of structure-activity relationships for this class of polysaccharides requires the identification and characterization of degrading enzymes with defined substrate specificity and enzymatic activity. Toward this end, we report here the molecular cloning and extensive structure-function analysis of a 6-O-sulfatase from the Gram-negative bacterium Flavobacterium heparinum. In addition, we report the recombinant expression of this enzyme in Escherichia coli in a soluble, active form and identify it as a specific HSGAG sulfatase. We further define the mechanism of action of the enzyme through biochemical and structural studies. Through the use of defined substrates, we investigate the kinetic properties of the enzyme. This analysis was complemented by homology-based molecular modeling studies that sought to rationalize the substrate specificity of the enzyme and mode of action through an analysis of the active-site topology of the enzyme including identifying key enzyme-substrate interactions and assigning key amino acids within the active site of the enzyme. Taken together, our structural and biochemical studies indicate that 6-O-sulfatase is a predominantly exolytic enzyme that specifically acts on N-sulfated or N-acetylated 6-O-sulfated glucosamines present at the non-reducing end of HSGAG oligosaccharide substrates. This requirement for the N-acetyl or N-sulfo groups on the glucosamine substrate can be explained through eliciting favorable interactions with key residues within the active site of the enzyme. These findings provide a framework that enables the use of 6-O-sulfatase as a tool for HSGAG structure-activity studies as well as expand our biochemical and structural understanding of this important class of enzymes.

Structure of L-Xylulose-5-Phosphate 3-Epimerase (UlaE) from the Anaerobic L-Ascorbate Utilization Pathway of Escherichia coli: Identification of a Novel Phosphate Binding Motif within a TIM Barrel Fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Rong; Pineda, Marco; Ajamian, Eunice

2009-01-15

Three catabolic enzymes, UlaD, UlaE, and UlaF, are involved in a pathway leading to fermentation of L-ascorbate under anaerobic conditions. UlaD catalyzes a {beta}-keto acid decarboxylation reaction to produce L-xylulose-5-phosphate, which undergoes successive epimerization reactions with UlaE (L-xylulose-5-phosphate 3-epimerase) and UlaF (L-ribulose-5-phosphate 4-epimerase), yielding D-xylulose-5-phosphate, an intermediate in the pentose phosphate pathway. We describe here crystallographic studies of UlaE from Escherichia coli O157:H7 that complete the structural characterization of this pathway. UlaE has a triosephosphate isomerase (TIM) barrel fold and forms dimers. The active site is located at the C-terminal ends of the parallel {beta}-strands. The enzyme binds Zn{sup 2+},more » which is coordinated by Glu155, Asp185, His211, and Glu251. We identified a phosphate-binding site formed by residues from the {beta}1/{alpha}1 loop and {alpha}3' helix in the N-terminal region. This site differs from the well-characterized phosphate-binding motif found in several TIM barrel superfamilies that is located at strands {beta}7 and {beta}8. The intrinsic flexibility of the active site region is reflected by two different conformations of loops forming part of the substrate-binding site. Based on computational docking of the L-xylulose 5-phosphate substrate to UlaE and structural similarities of the active site of this enzyme to the active sites of other epimerases, a metal-dependent epimerization mechanism for UlaE is proposed, and Glu155 and Glu251 are implicated as catalytic residues. Mutation and activity measurements for structurally equivalent residues in related epimerases supported this mechanistic proposal.« less

Thirteen Week Oral Toxicity Study of WR238605 with a Thirteen Week Recovery Period in Rats. Volume 2 of 3

DTIC Science & Technology

1993-06-18

Standards, Part 2. IFCC Method for Aspartate Aminotransferase, Amsterdam, Elsevier Scientific Publishing Company (1975) Alanine Aminotransferase (ALT...Activity 7b. ADDRESS (Orty, State, and ZIP Code) ATTN: SGRD-RMA-RCD Fort Detrick Frederick, M0 21702 9. PROCUREMENT INSTRUMENT IDENTIFICATION ...Study No. 097 and Study No. 098 ANALYSTS: THOMAS TOLHURST A. KARL LARSEN, JR. STUDY SITE: FORENSIC TOXICOLOGY LABORATORY COLLEGE OF PHARMACY

Identification of a unique Ca2+-binding site in rat acid-sensing ion channel 3.

PubMed

Zuo, Zhicheng; Smith, Rachel N; Chen, Zhenglan; Agharkar, Amruta S; Snell, Heather D; Huang, Renqi; Liu, Jin; Gonzales, Eric B

2018-05-25

Acid-sensing ion channels (ASICs) evolved to sense changes in extracellular acidity with the divalent cation calcium (Ca 2+ ) as an allosteric modulator and channel blocker. The channel-blocking activity is most apparent in ASIC3, as removing Ca 2+ results in channel opening, with the site's location remaining unresolved. Here we show that a ring of rat ASIC3 (rASIC3) glutamates (Glu435), located above the channel gate, modulates proton sensitivity and contributes to the formation of the elusive Ca 2+ block site. Mutation of this residue to glycine, the equivalent residue in chicken ASIC1, diminished the rASIC3 Ca 2+ block effect. Atomistic molecular dynamic simulations corroborate the involvement of this acidic residue in forming a high-affinity Ca 2+ site atop the channel pore. Furthermore, the reported observations provide clarity for past controversies regarding ASIC channel gating. Our findings enhance understanding of ASIC gating mechanisms and provide structural and energetic insights into this unique calcium-binding site.

Design and implementation of an identification system in construction site safety for proactive accident prevention.

PubMed

Yang, Huanjia; Chew, David A S; Wu, Weiwei; Zhou, Zhipeng; Li, Qiming

2012-09-01

Identifying accident precursors using real-time identity information has great potential to improve safety performance in construction industry, which is still suffering from day to day records of accident fatality and injury. Based on the requirements analysis for identifying precursor and the discussion of enabling technology solutions for acquiring and sharing real-time automatic identification information on construction site, this paper proposes an identification system design for proactive accident prevention to improve construction site safety. Firstly, a case study is conducted to analyze the automatic identification requirements for identifying accident precursors in construction site. Results show that it mainly consists of three aspects, namely access control, training and inspection information and operation authority. The system is then designed to fulfill these requirements based on ZigBee enabled wireless sensor network (WSN), radio frequency identification (RFID) technology and an integrated ZigBee RFID sensor network structure. At the same time, an information database is also designed and implemented, which includes 15 tables, 54 queries and several reports and forms. In the end, a demonstration system based on the proposed system design is developed as a proof of concept prototype. The contributions of this study include the requirement analysis and technical design of a real-time identity information tracking solution for proactive accident prevention on construction sites. The technical solution proposed in this paper has a significant importance in improving safety performance on construction sites. Moreover, this study can serve as a reference design for future system integrations where more functions, such as environment monitoring and location tracking, can be added. Copyright © 2011 Elsevier Ltd. All rights reserved.

Factors associated with biopsy site identification, postponement of surgery, and patient confidence in a dermatologic surgery practice.

PubMed

Zhang, Junqian; Rosen, Alex; Orenstein, Lauren; Van Voorhees, Abby; Miller, Christopher J; Sobanko, Joseph F; Shin, Thuzar M; Etzkorn, Jeremy R

2016-06-01

Biopsy site identification is critical to avoid wrong-site surgery and may impact patient-centered outcomes. We sought to evaluate risk factors for biopsy site misidentification, postponement of surgery, and patient confidence in surgical site selection and to assess the near-miss rate for wrong-site surgeries. This was a prospective observational cohort study. Near-miss wrong-site surgeries were detected and averted in 1.3% (3 of 239) of patients with biopsy site photographs. Risk factors for biopsy site misidentification by patients were 6 weeks or longer between biopsy and surgery (odds ratio [OR] 2.19, 95% confidence interval [CI] 1.12-4.27; P = .028) and patient inability to see biopsy site (OR 3.95, 95% CI 1.50-10.37; P = .002). Risk factors for physician misidentification were 6 or more weeks between biopsy and surgery (OR 3.68, 95% CI 1.40-9.66; P = .007) and biopsy specimens from multiple sites (OR 4.39, 95% CI 1.67-11.54; P = .003). Postponement of surgery was associated with absence of a biopsy site photograph (OR 12.5, 95% CI 2.79-62.21; P < .001). Patient confidence in surgical site identification was associated with the presence of a biopsy site photograph (OR 5.48, 95% CI 1.96-15.30; P = .001). This was a single-site observational study. Biopsy site photography is associated with reduced rates of postponed surgeries and improved rates of patient confidence in surgical site selection. Risk factors for biopsy site misidentification should be considered before definitive treatment. Copyright © 2015 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

Rapid assessment of environmental health risks posed by mining operations in low- and middle-income countries: selected case studies.

PubMed

Caravanos, Jack; Ericson, Bret; Ponce-Canchihuamán, Johny; Hanrahan, David; Block, Meredith; Susilorini, Budi; Fuller, Richard

2013-11-01

Previous studies have evaluated associated health risks and human exposure pathways at mining sites. Others have provided estimates of the scale of the issue based in part on surveys. However, a global census of mining-related hazardous waste sites has been lacking. The Toxic Sites Identification Program (TSIP) implemented by Blacksmith Institute (New York, NY, USA) since 2009 is an ongoing effort to catalogue a wide range of chemically contaminated sites with a potential human health risk (Ericson et al., Environ Monit Assess doi:10.1007/s 10661-012-2665-2, 2012). The TSIP utilizes a rapid assessment instrument, the Initial Site Screening (ISS), to quickly and affordably identify key site criteria including human exposure pathways, estimated populations at risk, and sampling information. The resulting ISS allows for comparison between sites exhibiting different contaminants and pollution sources. This paper explores the results of a subset of ISSs completed at 131 artisanal and small-scale gold mining areas and 275 industrial mining and ore processing sites in 45 countries. The authors show that the ISS captures key data points, allowing for prioritization of sites for further investigation or remedial activity.

Identification of the srtC1 Transcription Start Site and Catalytically Essential Residues Required for Actinomyces oris T14V SrtC1 Activity

DTIC Science & Technology

2011-07-27

domain (type 2 phosphatidic acid phosphatase) and may be a PAP2 like superfamily member. In order to localize the promoter(s) for these three genes...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 which amino acid residue(s) was critical for the enzyme activity. This enzyme possesses a...analyzed the role of eight conserved amino acid residues. The amino acids to be mutated were chosen based on the sequence alignment of several class C

CASEIN KINASE-MEDIATED PHOSPHORYLATION OF SERINE 839 IS NECESSARY FOR BASOLATERAL LOCALIZATION OF THE Ca2+-ACTIVATED NON-SELECTIVE CATION CHANNEL TRPM4

PubMed Central

Cerda, Oscar; Cáceres, Mónica; Park, Kang-Sik; Leiva-Salcedo, Elías; Romero, Aníbal; Varela, Diego

2014-01-01

TRPM4 is a Ca2+-activated non-selective cation channel expressed in a wide range of human tissues. TRPM4 participates in a variety of physiological processes such as T cell activation, myogenic vasoconstriction and allergic reactions. TRPM4 Ca2+ sensitivity is enhanced by calmodulin (CaM) and phosphathydilinositol 4, 5-biphosphate (PI(4,5)P2) binding, as well as, under certain conditions, PKC activation. However, information as to the mechanisms of modulation of this channel remain unknown, including direct identification of phosphorylation sites on TRPM4 and their role in channel features. Here, we use mass-spectrometric-based proteomic approaches (immunoprecipitation and tandem mass spectrometry), to unambiguously identify S839 as a phosphorylation site present on human TRPM4 expressed in a human cell line. Site-directed mutagenesis employing a serine to alanine mutation to eliminate phosphorylation, and a phospho-mimetic aspartate mutation, as well as biochemical and immunocytochemical experiments, revealed a role for S839 phosphorylation in the basolateral expression of TRPM4 channels in epithelial cells. Moreover, we demonstrated that casein kinase 1 (CK1) phosphorylates S839 and is responsible for the basolateral localization of TRPM4. PMID:25231975

Casein kinase-mediated phosphorylation of serine 839 is necessary for basolateral localization of the Ca²⁺-activated non-selective cation channel TRPM4.

PubMed

Cerda, Oscar; Cáceres, Mónica; Park, Kang-Sik; Leiva-Salcedo, Elías; Romero, Aníbal; Varela, Diego; Trimmer, James S; Stutzin, Andrés

2015-08-01

Transient receptor potential melastatin-like 4 (TRPM4) is a Ca(2+)-activated non-selective cation channel expressed in a wide range of human tissues. TRPM4 participates in a variety of physiological processes such as T cell activation, myogenic vasoconstriction, and allergic reactions. TRPM4 Ca(2+) sensitivity is enhanced by calmodulin (CaM) and phosphathydilinositol 4, 5-bisphosphate (PI(4,5)P2) binding, as well as, under certain conditions, PKC activation. However, information as to the mechanisms of modulation of this channel remains unknown, including direct identification of phosphorylation sites on TRPM4 and their role in channel features. Here, we use mass-spectrometric-based proteomic approaches (immunoprecipitation and tandem mass spectrometry) to unambiguously identify S839 as a phosphorylation site present on human TRPM4 expressed in a human cell line. Site-directed mutagenesis employing a serine to alanine mutation to eliminate phosphorylation, and a phospho-mimetic aspartate mutation, as well as biochemical and immunocytochemical experiments, revealed a role for S839 phosphorylation in the basolateral expression of TRPM4 channels in epithelial cells. Moreover, we demonstrated that casein kinase 1 (CK1) phosphorylates S839 and is responsible for the basolateral localization of TRPM4.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Ting; Ooi, Amy; Lee, Hooi Chen

An orthorhombic crystal form of the SARS CoV main proteinase diffracting to a resolution of 1.9 Å is reported. The conformation of residues in the catalytic site indicates an active enzyme. The 34 kDa main proteinase (M{sup pro}) from the severe acute respiratory syndrome coronavirus (SARS-CoV) plays an important role in the virus life cycle through the specific processing of viral polyproteins. As such, SARS-CoV M{sup pro} is a key target for the identification of specific inhibitors directed against the SARS virus. With a view to facilitating the development of such compounds, crystals were obtained of the enzyme at pHmore » 6.5 in the orthorhombic space group P2{sub 1}2{sub 1}2 that diffract to a resolution of 1.9 Å. These crystals contain one monomer per asymmetric unit and the biologically active dimer is generated via the crystallographic twofold axis. The conformation of the catalytic site indicates that the enzyme is active in the crystalline form and thus suitable for structure-based inhibition studies.« less

Identification of the functional binding pocket for compounds targeting small-conductance Ca2+-activated potassium channels

PubMed Central

Zhang, Miao; Pascal, John M.; Schumann, Marcel; Armen, Roger S.; Zhang, Ji-fang

2012-01-01

Small- and intermediate-conductance Ca2+-activated potassium channels, activated by Ca2+-bound calmodulin, play an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potentials for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-EBIO class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class. PMID:22929778

Identification of the functional binding pocket for compounds targeting small-conductance Ca²⁺-activated potassium channels.

PubMed

Zhang, Miao; Pascal, John M; Schumann, Marcel; Armen, Roger S; Zhang, Ji-Fang

2012-01-01

Small- and intermediate-conductance Ca(2+)-activated potassium channels, activated by Ca(2+)-bound calmodulin, have an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potential for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-ethyl-2-benzimidazolinone (1-EBIO) class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class.

The impact of human activities in the Wulan Delta Estuary, Indonesia

NASA Astrophysics Data System (ADS)

Fadlillah, L. N.; Sunarto; Widyastuti, M.; Marfai, M. A.

2018-04-01

The increasing of human population in the watershed and the coastal area and the need of life exert pressure in the delta that provides various resources. Wulan Delta is one of active Delta in Central Java, Indonesia. It has been experienced multiple pressures because of natural factors and human factors. In order to provide the scientific solution and to analyze the impact of human intervention in delta, we collected several pieces of evidence based on secondary data and primary data. The secondary data is water quality data on sites 6 and 7, meanwhile the secondary data is the water quality data in site 1 to 5. This paper present a review and problems identification in Wulan Delta, based on hydrological condition, land use, and human activities in the delta. Meanwhile, the human intervention in the land which is land use exchange leads to several problems such as the land use changes, high sediment load, and water degradation. Almost 80% of Delta has been transformed into the fish pond by local communities.

New insights into the catalytic mechanism of Bombyx mori prostaglandin E synthase gained from structure–function analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp; Suzuki, Mamoru; Higashiura, Akifumi

2013-11-01

Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolutionmore » of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.« less

Identification of Caspase Cleavage Sites in KSHV Latency-Associated Nuclear Antigen and Their Effects on Caspase-Related Host Defense Responses.

PubMed

Davis, David A; Naiman, Nicole E; Wang, Victoria; Shrestha, Prabha; Haque, Muzammel; Hu, Duosha; Anagho, Holda A; Carey, Robert F; Davidoff, Katharine S; Yarchoan, Robert

2015-07-01

Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus-8, is the causative agent of three hyperproliferative disorders: Kaposi's sarcoma, primary effusion lymphoma (PEL) and multicentric Castleman's disease. During viral latency a small subset of viral genes are produced, including KSHV latency-associated nuclear antigen (LANA), which help the virus thwart cellular defense responses. We found that exposure of KSHV-infected cells to oxidative stress, or other inducers of apoptosis and caspase activation, led to processing of LANA and that this processing could be inhibited with the pan-caspase inhibitor Z-VAD-FMK. Using sequence, peptide, and mutational analysis, two caspase cleavage sites within LANA were identified: a site for caspase-3 type caspases at the N-terminus and a site for caspase-1 and-3 type caspases at the C-terminus. Using LANA expression plasmids, we demonstrated that mutation of these cleavage sites prevents caspase-1 and caspase-3 processing of LANA. This indicates that these are the principal sites that are susceptible to caspase cleavage. Using peptides spanning the identified LANA cleavage sites, we show that caspase activity can be inhibited in vitro and that a cell-permeable peptide spanning the C-terminal cleavage site could inhibit cleavage of poly (ADP-ribose) polymerase and increase viability in cells undergoing etoposide-induced apoptosis. The C-terminal peptide of LANA also inhibited interleukin-1 beta (IL-1β) production from lipopolysaccharide-treated THP-1 cells by more than 50%. Furthermore, mutation of the two cleavage sites in LANA led to a significant increase in IL-1β production in transfected THP-1 cells; this provides evidence that these sites function to blunt the inflammasome, which is known to be activated in latently infected PEL cells. These results suggest that specific caspase cleavage sites in KSHV LANA function to blunt apoptosis as well as interfere with the caspase-1-mediated inflammasome, thus thwarting key cellular defense mechanisms.

Structure of the catalytic sites in Fe/N/C-catalysts for O2-reduction in PEM fuel cells

PubMed Central

Kramm, Ulrike I.; Herranz, Juan; Larouche, Nicholas; Arruda, Thomas M.; Lefèvre, Michel; Jaouen, Frédéric; Bogdanoff, Peter; Fiechter, Sebastian; Abs-Wurmbach, Irmgard; Mukerjee, Sanjeev; Dodelet, Jean-Pol

2012-01-01

Fe-based catalytic sites for the reduction of oxygen in acidic medium have been identified by 57Fe Mössbauer spectroscopy of Fe/N/C catalysts containing 0.03 to 1.55 wt% Fe, which were prepared by impregnation of iron acetate on carbon black followed by heat-treatment in NH3 at 950°C. Four different Fe-species were detected at all iron concentrations: three doublets assigned to molecular FeN4-like sites with their ferrous ion in low (D1), medium (D2) or high spin state (D3), and two other doublets assigned to a single Fe-species (D4 and D5) consisting of surface oxidized nitride nanoparticles (FexN, with x≤2.1). A fifth Fe-species appears only in those catalysts with Fe-contents ≥ 0.27 wt%. It is characterized by a very broad singlet, which has been assigned to incomplete FeN4-like sites that quickly dissolve in contact with an acid. Among the five Fe-species identified in these catalysts, only D1 and D3 display catalytic activity for the oxygen reduction reaction (ORR) in the acid medium, with D3 featuring a composite structure with a protonated neighbour basic nitrogen and being by far the most active species, with an estimated turn over frequency for the ORR of 11.4 e− site−1 s−1 at 0.8V vs RHE. Moreover, all D1 sites and between 1/2 to 2/3 of the D3 sites are acid-resistant. A scheme for the mechanism of site formation upon heat-treatment is also proposed. This identification of the ORR-active sites in these catalysts is of crucial importance to design strategies to improve the catalytic activity and stability of these materials. PMID:22824866

Silver complexation and tandem mass spectrometry for differentiation of isomeric flavonoid diglycosides.

PubMed

Zhang, Junmei; Brodbelt, Jennifer S

2005-03-15

For detection and differentiation of isomeric flavonoids, electrospray ionization mass spectrometry is used to generate silver complexes of the type (Ag + flavonoid)+. Collisionally activated dissociation (CAD) of the resulting 1:1 silver/flavonoid complexes allows isomer differentiation of flavonoids. Eighteen flavonoid diglycosides constituting seven isomeric series are distinguishable from each other based on the CAD patterns of their silver complexes. Characteristic dissociation pathways allow identification of the site of glycosylation, the type of disaccharide (rutinose versus neohesperidose), and the type of aglycon (flavonol versus flavone versus flavanone). This silver complexation method is more universal than previous metal complexation methods, as intense silver complexes are observed even for flavonoids that lack the typical metal chelation sites. To demonstrate the feasibility of using silver complexation and tandem mass spectrometry to characterize flavonoids in complex mixtures, flavonoids extracted from grapefruit juice are separated by high-performance liquid chromatography and analyzed via a postcolumn complexation ESI-MS/MS strategy. Diagnostic fragmentation pathways of the silver complexes of the individual eluting flavonoids allow successful identification of the six flavonoids in the extract.

77 FR 51811 - Draft Guidance for Industry on Self-Identification of Generic Drug Facilities, Sites, and...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-27

... as it prepares to meet the self- identification requirement. It explains who is required to self... describing how FDA will implement the self- identification requirement contained in GDUFA. As required by... industry as it prepares to meet the self-identification requirement. The guidance explains who is required...

Improving the healthcare response to domestic violence and abuse in sexual health clinics: feasibility study of a training, support and referral intervention

PubMed Central

Sohal, Alex Hardip; Pathak, Neha; Blake, Sarah; Apea, Vanessa; Berry, Judith; Bailey, Jayne; Griffiths, Chris; Feder, Gene

2018-01-01

Objectives Sexual health and gynaecological problems are the most consistent and largest physical health differences between abused and non-abused female populations. Sexual health services are well placed to identify and support patients experiencing domestic violence and abuse (DVA). Most sexual health professionals have had minimal DVA training despite English National Institute for Health and Care Excellence recommendations. We sought to determine the feasibility of an evidence-based complex DVA training intervention in female sexual health walk-in services (IRIS ADViSE: Identification and Referral to Improve Safety whilst Assessing Domestic Violence in Sexual Health Environments). Methods An adaptive mixed method pilot study in the female walk-in service of two sexual health clinics. Following implementation and evaluation at site 1, the intervention was refined before implementation at site 2. The intervention comprised electronic prompts, multidisciplinary training sessions, clinic materials and simple referral pathways to IRIS ADViSE advocate-educators (AEs). The pilot lasted 7 weeks at site 1 and 12 weeks at site 2. Feasibility outcomes were to assign a supportive DVA clinical lead, an IRIS ADViSE AE employed by a local DVA service provider, adapt electronic records, develop local referral pathways, assess whether enquiry, identification and referral rates were measurable. Results Both sites achieved all feasibility outcomes: appointing a supportive DVA clinical lead and IRIS ADViSE AE, establishing links with a local DVA provider, adapting electronic records, developing local referral pathways and rates of enquiry, identification and referral were found to be measurable. Site 1: 10% enquiry rate (n=267), 4% identification rate (n=16) and eight AE referrals. Site 2: 61% enquiry rate (n=1090), a 7% identification rate (n=79) and eight AE referrals. Conclusions IRIS ADViSE can be successfully developed and implemented in sexual health clinics. It fulfils the unmet need for DVA training. Longer-term evaluation is recommended. PMID:28724743

Identification of Conserved Water Sites in Protein Structures for Drug Design.

PubMed

Jukič, Marko; Konc, Janez; Gobec, Stanislav; Janežič, Dušanka

2017-12-26

Identification of conserved waters in protein structures is a challenging task with applications in molecular docking and protein stability prediction. As an alternative to computationally demanding simulations of proteins in water, experimental cocrystallized waters in the Protein Data Bank (PDB) in combination with a local structure alignment algorithm can be used for reliable prediction of conserved water sites. We developed the ProBiS H2O approach based on the previously developed ProBiS algorithm, which enables identification of conserved water sites in proteins using experimental protein structures from the PDB or a set of custom protein structures available to the user. With a protein structure, a binding site, or an individual water molecule as a query, ProBiS H2O collects similar proteins from the PDB and performs local or binding site-specific superimpositions of the query structure with similar proteins using the ProBiS algorithm. It collects the experimental water molecules from the similar proteins and transposes them to the query protein. Transposed waters are clustered by their mutual proximity, which enables identification of discrete sites in the query protein with high water conservation. ProBiS H2O is a robust and fast new approach that uses existing experimental structural data to identify conserved water sites on the interfaces of protein complexes, for example protein-small molecule interfaces, and elsewhere on the protein structures. It has been successfully validated in several reported proteins in which conserved water molecules were found to play an important role in ligand binding with applications in drug design.

Recognition of RNA Editing Sites Is Directed by Unique Proteins in Chloroplasts: Biochemical Identification of cis-Acting Elements and trans-Acting Factors Involved in RNA Editing in Tobacco and Pea Chloroplasts

PubMed Central

Miyamoto, Tetsuya; Obokata, Junichi; Sugiura, Masahiro

2002-01-01

RNA editing in higher-plant chloroplasts involves C-to-U conversions at specific sites. Although in vivo analyses have been performed, little is known about the biochemical aspects of chloroplast editing reactions. Here we improved our original in vitro system and devised a procedure for preparing active chloroplast extracts not only from tobacco plants but also from pea plants. Using our tobacco in vitro system, cis-acting elements were defined for psbE and petB mRNAs. Distinct proteins were found to bind specifically to each cis-element, a 56-kDa protein to the psbE site and a 70-kDa species to the petB site. Pea chloroplasts lack the corresponding editing site in psbE since T is already present in the DNA. Parallel in vitro analyses with tobacco and pea extracts revealed that the pea plant has no editing activity for psbE mRNAs and lacks the 56-kDa protein, whereas petB mRNAs are edited and the 70-kDa protein is also present. Therefore, coevolution of an editing site and its cognate trans-factor was demonstrated biochemically in psbE mRNA editing between tobacco and pea plants. PMID:12215530

Identification and characterization of a receptor for tissue ferritin on activated rat lipocytes.

PubMed Central

Ramm, G A; Britton, R S; O'Neill, R; Bacon, B R

1994-01-01

Hepatic iron overload causes lipocyte activation with resultant fibrogenesis. This study examines whether rat lipocytes express ferritin receptors, which could be involved in paracellular iron movement and in cellular regulation. Lipocytes from normal rat liver were cultured on plastic and incubated with 125I-labeled rat liver ferritin (RLF) +/- a 100-fold excess of either unlabeled RLF or human heart ferritin, human liver ferritin, human recombinant H-ferritin, a mutant human recombinant L-ferritin, or a variety of nonspecific proteins. Specific binding sites for ferritin were demonstrated by displacement of 125I-RLF by RLF (64.5 +/- 4.3%) and by other ferritins (55-60%), but not by recombinant L-ferritin. Scatchard analysis demonstrated a single class of binding sites with a Kd of 5.1 +/- 2.9 x 10(-10) M, maximum binding capacity of 4.7 +/- 1.3 x 10(-12) M, and 5,000-10,000 receptor sites/cell. Ferritin receptor expression was observed only in activated lipocytes. Internalization of RLF was observed within 15 min using FITC-RLF and confocal microscopy. This study demonstrates that (a) activated lipocytes express a specific high affinity ferritin receptor; (b) the binding appears to be dependent on the H-ferritin subunit; and (c) lipocytes internalize ferritin. Expression of ferritin receptors in activated lipocytes suggests that the receptor may either be involved in the activation cascade or may be a marker of activation. Images PMID:8040296

Health and safety plan for the Remedial Investigation and Site Investigation of Waste Area Grouping 2 at the Oak Ridge National Laboratory, Oak Ridge, Tennessee. Environmental Restoration Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cofer, G.H.; Holt, V.L.; Roupe, G.W.

1993-11-01

This health and safety plan (HASP) was developed by the members of the Measurement Applications and Development Group of the Health Science Research Division at the Oak Ridge National Laboratory (ORNL). This plan was prepared to ensure that health and safety related items for the Waste Area Grouping (WAG) 2 Remedial Investigation (RI)/Feasibility Study and Site Investigation projects conform with the requirements of 29 CFR 1910.120 (April 18, 1992). The RI Plan calls for the characterization, monitoring, risk assessment, and identification of remedial needs and alternatives that have been structured and staged with short-term and long-term objectives. In early FYmore » 1992, the WAG 2 RI was integrated with the ORNL Environmental Restoration (ER) Site Investigations program in order to achieve the complimentary objectives of the projects more effectively by providing an integrated basis of support. The combined effort was named the WAG 2 Remedial Investigation and Site Investigations Program (WAG 2 RI&SI). The Site Investigation activities are a series of monitoring efforts and directed investigations that support other ER activities by providing information about (1) watershed hydrogeology; (2) contaminants, pathways, and fluxes for groundwater at ORNL; (3) shallow subsurface areas that can act as secondary sources of contaminants; and (4) biological populations and contaminants in biota, in addition to other support and coordination activities.« less

Interpreting Intra-site Spatial Patterns in Seasonal Contexts: an Ethnoarchaeological Case Study from the Western Alps.

PubMed

Carrer, Francesco

2017-01-01

This paper deals with the ethnoarchaeological analysis of the spatial pattern of artefacts and ecofacts within two traditional pastoral huts (a dwelling and a seasonal dairy) in the uplands of Val Maudagna (Cuneo province, Italian western Alps). The composition of the ethnoarchaeological assemblages of the two huts was studied and compared; point pattern analysis was applied to identify spatial processes mirrored in the interactions between objects; Moran's I correlogram and empirical variogram were used to investigate the effects of trampling on the displacement of objects on the floor. The results were compared with information provided by the herder who still used the huts. The quantitative and ethnographical data enabled inferences to be made that can help in the interpretation of archaeological seasonal sites. The function of a seasonal site can be recognized, as can the impact of delayed curation on the composition of the assemblage and the importance of the intensity of occupation compared with the frequency of occupation. The spatial organization of activities is reflected in the spatial patterns of objects, with clearer identification of activity areas in intensively occupied sites, and there is evidence for the behaviour behind the spatial segregation of activities. Trampling is a crucial post-depositional factor in the displacement of artefacts and ecofacts, especially in non-intensively exploited sites. From a methodological point of view, this research is another example that highlights the importance of integrating quantitative methods (especially spatial analysis and geostatistical methods) and ethnoarchaeological data in order to improve the interpretation of archaeological sites and assemblages.

Waste inspection tomography (WIT)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernardi, R.T.

1996-12-31

WIT is a self-sufficient mobile semitrailer for nondestructive evaluation and nondestructive assay of nuclear waste drums using x-ray and gamma-ray tomography. The recently completed Phase I included the design, fabrication, and initial testing of all WIT subsystems installed on-board the trailer. Initial test results include 2 MeV digital radiography, computed tomography, Anger camera imaging, single photon emission computed tomography, gamma-ray spectroscopy, collimated gamma scanning, and active and passive computed tomography using a 1.4 mCi source of {sup 166}Ho. These techniques were initially demonstrated on a 55-gallon phantom drum with 3 simulated waste matrices of combustibles, heterogeneous metals, and cement usingmore » check sources of gamma active isotopes such as {sup 137}Cs and {sup 133}Ba with 9-250 {mu}Ci activities. Waste matrix identification, isotopic identification, and attenuation-corrected gamma activity determination were demonstrated nondestructively and noninvasively in Phase I. Currently ongoing Phase II involves DOE site field test demonstrations at LLNL, RFETS, and INEL with real nuclear waste drums. Current WIT experience includes 55 gallon drums of cement, graphite, sludge, glass, metals, and combustibles. Thus far WIT has inspected drums with 0-20 gms of {sup 239}Pu.« less

Fatty Acid-binding Proteins Interact with Comparative Gene Identification-58 Linking Lipolysis with Lipid Ligand Shuttling*

PubMed Central

Hofer, Peter; Boeszoermenyi, Andras; Jaeger, Doris; Feiler, Ursula; Arthanari, Haribabu; Mayer, Nicole; Zehender, Fabian; Rechberger, Gerald; Oberer, Monika; Zimmermann, Robert; Lass, Achim; Haemmerle, Guenter; Breinbauer, Rolf; Zechner, Rudolf; Preiss-Landl, Karina

2015-01-01

The coordinated breakdown of intracellular triglyceride (TG) stores requires the exquisitely regulated interaction of lipolytic enzymes with regulatory, accessory, and scaffolding proteins. Together they form a dynamic multiprotein network designated as the “lipolysome.” Adipose triglyceride lipase (Atgl) catalyzes the initiating step of TG hydrolysis and requires comparative gene identification-58 (Cgi-58) as a potent activator of enzyme activity. Here, we identify adipocyte-type fatty acid-binding protein (A-Fabp) and other members of the fatty acid-binding protein (Fabp) family as interaction partners of Cgi-58. Co-immunoprecipitation, microscale thermophoresis, and solid phase assays proved direct protein/protein interaction between A-Fabp and Cgi-58. Using nuclear magnetic resonance titration experiments and site-directed mutagenesis, we located a potential contact region on A-Fabp. In functional terms, A-Fabp stimulates Atgl-catalyzed TG hydrolysis in a Cgi-58-dependent manner. Additionally, transcriptional transactivation assays with a luciferase reporter system revealed that Fabps enhance the ability of Atgl/Cgi-58-mediated lipolysis to induce the activity of peroxisome proliferator-activated receptors. Our studies identify Fabps as crucial structural and functional components of the lipolysome. PMID:25953897

19 CFR 123.73 - Application to participate.

Code of Federal Regulations, 2010 CFR

2010-04-01

... number(s), conveyance-specific identifying markings, e.g., vehicle identification numbers (VINs), and any... information: (a) General business identification and site condition information. The name and address of the... individual LBCIP-authorized drivers; (c) Conveyance identification information. A listing of the conveyances...

Redirection of the Reaction Specificity of a Thermophilic Acetolactate Synthase toward Acetaldehyde Formation

PubMed Central

Cheng, Maria; Yoshiyasu, Hayato; Okano, Kenji; Ohtake, Hisao; Honda, Kohsuke

2016-01-01

Acetolactate synthase and pyruvate decarboxylase are thiamine pyrophosphate-dependent enzymes that convert pyruvate into acetolactate and acetaldehyde, respectively. Although the former are encoded in the genomes of many thermophiles and hyperthermophiles, the latter has been found only in mesophilic organisms. In this study, the reaction specificity of acetolactate synthase from Thermus thermophilus was redirected to catalyze acetaldehyde formation to develop a thermophilic pyruvate decarboxylase. Error-prone PCR and mutant library screening led to the identification of a quadruple mutant with 3.1-fold higher acetaldehyde-forming activity than the wild-type. Site-directed mutagenesis experiments revealed that the increased activity of the mutant was due to H474R amino acid substitution, which likely generated two new hydrogen bonds near the thiamine pyrophosphate-binding site. These hydrogen bonds might result in the better accessibility of H+ to the substrate-cofactor-enzyme intermediate and a shift in the reaction specificity of the enzyme. PMID:26731734

Improved production of genetically modified fetuses with homogeneous transgene expression after transgene integration site analysis and recloning in cattle.

PubMed

Bressan, Fabiana Fernandes; Dos Santos Miranda, Moyses; Perecin, Felipe; De Bem, Tiago Henrique; Pereira, Flavia Thomaz Verechia; Russo-Carbolante, Elisa Maria; Alves, Daiani; Strauss, Bryan; Bajgelman, Marcio; Krieger, José Eduardo; Binelli, Mario; Meirelles, Flavio Vieira

2011-02-01

Animal cloning by nuclear transfer (NT) has made the production of transgenic animals using genetically modified donor cells possible and ensures the presence of the gene construct in the offspring. The identification of transgene insertion sites in donor cells before cloning may avoid the production of animals that carry undesirable characteristics due to positional effects. This article compares blastocyst development and competence to establish pregnancies of bovine cloned embryos reconstructed with lentivirus-mediated transgenic fibroblasts containing either random integration of a transgene (random integration group) or nuclear transfer derived transgenic fibroblasts with known transgene insertion sites submitted to recloning (recloned group). In the random integration group, eGFP-expressing bovine fetal fibroblasts were selected by fluorescence activated cell sorting (FACS) and used as nuclei donor cells for NT. In the recloned group, a fibroblast cell line derived from a transgenic cloned fetus was characterized regarding transgene insertion and submitted to recloning. The recloned group had higher blastocyst production (25.38 vs. 14.42%) and higher percentage of 30-day pregnancies (14.29 vs. 2.56%) when compared to the random integration group. Relative eGFP expression analysis in fibroblasts derived from each cloned embryo revealed more homogeneous expression in the recloned group. In conclusion, the use of cell lines recovered from transgenic fetuses after identification of the transgene integration site allowed for the production of cells and fetuses with stable transgene expression, and recloning may improve transgenic animal yields.

Spatial distribution and source identification of indicator polychlorinated biphenyls in soil collected from the coastal multi-industrial city of Ulsan, South Korea for three consecutive years.

PubMed

Nguyen, Tuyet Nam Thi; Kwon, Hye-Ok; Lee, Yun-Se; Kim, Leesun; Lee, Sung-Eun; Choi, Sung-Deuk

2016-11-01

The concentrations, profiles, and source-receptor relationships of seven indicator polychlorinated biphenyls (PCBs) (#28, 52, 101, 118, 138, 153, and 180) found in soil at 25 rural, urban, and industrial sites in Ulsan, South Korea were investigated. For this study, 75 soil samples were collected, 25 each in January of 2011, 2012, and 2013. Principal component analysis was used to evaluate the influence of the emission sources on the soil samples. The concentrations of total seven PCBs (Σ7 PCBs) ranged between 0.034 ng/g and 143 ng/g (mean: 5.10 ng/g, median: 0.440 ng/g), which indicated slight or moderate contamination levels, respectively, compared to those in the other countries or other cities in Korea. The concentrations of Σ7 PCBs at the industrial and urban sites were significantly higher than those at the rural sites, due to the direct influence of emission sources related to industrial activities rather than urban emission sources. Generally, the profiles of PCBs were dominated by penta- and hexa-chlorinated biphenyls at all the study sites, suggesting common sources of PCBs in Ulsan. PCB source identification indicated that leakage from transformer oils in the major industrial complexes and PCB-containing paints used in the automobile and shipbuilding industrial complexes were possibly the main sources of indicator PCBs in the study areas. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mechanochemical activation and gallium and indiaarsenides surface catalycity

NASA Astrophysics Data System (ADS)

Kirovskaya, I. A.; Mironova, E. V.; Umansky, I. V.; Brueva, O. Yu; Murashova, A. O.; Yureva, A. V.

2018-01-01

The present work has been carried out in terms of determining the possibilities for a clearer identification of the active sites nature, intermediate surface compounds nature, functional groups during adsorption and catalysis, activation of the diamond-like semiconductors surface (in particular, the AIIIBV type) based on mechanochemical studies of the “reaction medium (H2O, iso-C3H7OH) - dispersible semiconductor (GaAs, InAs)” systems. As a result, according to the read kinetic curves of dispersion in water, both acidification and alkalinization of the medium have been established and explained; increased activity of the newly formed surface has been noted; intermediate surface compounds, functional groups appearing on the real surface and under H2O adsorption conditions, adsorption and catalytic decomposition of iso-C3H7OH have been found (with explanation of the origin). The unconcealed role of coordinatively unsaturated atoms as active sites of these processes has been shown; the relative catalytic activity of the semiconductors studied has been evaluated. Practical recommendations on the preferred use of gallium arsenide in semiconductor gas analysis and semiconductor catalysis have been given in literature searches, great care should be taken in constructing both.

Structure-Activity Relationship and Molecular Mechanics Reveal the Importance of Ring Entropy in the Biosynthesis and Activity of a Natural Product.

PubMed

Tran, Hai L; Lexa, Katrina W; Julien, Olivier; Young, Travis S; Walsh, Christopher T; Jacobson, Matthew P; Wells, James A

2017-02-22

Macrocycles are appealing drug candidates due to their high affinity, specificity, and favorable pharmacological properties. In this study, we explored the effects of chemical modifications to a natural product macrocycle upon its activity, 3D geometry, and conformational entropy. We chose thiocillin as a model system, a thiopeptide in the ribosomally encoded family of natural products that exhibits potent antimicrobial effects against Gram-positive bacteria. Since thiocillin is derived from a genetically encoded peptide scaffold, site-directed mutagenesis allows for rapid generation of analogues. To understand thiocillin's structure-activity relationship, we generated a site-saturation mutagenesis library covering each position along thiocillin's macrocyclic ring. We report the identification of eight unique compounds more potent than wild-type thiocillin, the best having an 8-fold improvement in potency. Computational modeling of thiocillin's macrocyclic structure revealed a striking requirement for a low-entropy macrocycle for activity. The populated ensembles of the active mutants showed a rigid structure with few adoptable conformations while inactive mutants showed a more flexible macrocycle which is unfavorable for binding. This finding highlights the importance of macrocyclization in combination with rigidifying post-translational modifications to achieve high-potency binding.

Protein arginine deiminase 2 binds calcium in an ordered fashion: Implications for inhibitor design

DOE PAGES

Slade, Daniel J.; Fang, Pengfei; Dreyton, Christina J.; ...

2015-01-26

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ionsmore » that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs.« less

Protein Arginine Deiminase 2 Binds Calcium in an Ordered Fashion: Implications for Inhibitor Design

PubMed Central

2015-01-01

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ions that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs. PMID:25621824

Engineering substrate promiscuity in halophilic alcohol dehydrogenase (HvADH2) by in silico design.

PubMed

Cassidy, Jennifer; Bruen, Larah; Rosini, Elena; Molla, Gianluca; Pollegioni, Loredano; Paradisi, Francesca

2017-01-01

An alcohol dehydrogenase from the halophilic archaeon Haloferax volcanii (HvADH2) has been engineered by rational design to broaden its substrate scope towards the conversion of a range of aromatic substrates, including flurbiprofenol, that is an intermediate of the non-steroidal anti-inflammatory drug, flurbiprofen. Wild-type HvADH2 showed minimal activity with flurbiprofenol (11.1 mU/mg). A homology model of HvADH2 was built and docking experiments with this substrate revealed that the biphenyl rings of flurbiprofenol formed strong interactions with residues F85 and F108, preventing its optimal binding in the active site. Mutations at position 85 however did not increase activity. Site directed mutagenesis at position F108 allowed the identification of three variants showing a significant (up to 2.3-fold) enhancement of activity towards flurbiprofenol, when compared to wild-type HvADH2. Interestingly, F108G variant did not show the classic inhibition in the presence of (R)-enantiomer when tested with rac-1-phenylethanol, underling its potential in racemic resolution of secondary alcohols.

A structure-based virtual screening approach toward the discovery of histone deacetylase inhibitors: identification of promising zinc-chelating groups.

PubMed

Park, Hwangseo; Kim, Sukyoung; Kim, Yong Eun; Lim, Soo-Jeong

2010-04-06

The inhibitors of histone deacetylases (HDACs) have drawn a great deal of attention due to their promising potential as small-molecule therapeutics for the treatment of cancer. By means of virtual screening with docking simulations under consideration of the effects of ligand solvation, we were able to identify six novel HDAC inhibitors with IC(50) values ranging from 1 to 100 muM. These newly identified inhibitors are structurally diverse and have various chelating groups for the active site zinc ion, including N-[1,3,4]thiadiazol-2-yl sulfonamide, N-thiazol-2-yl sulfonamide, and hydroxamic acid moieties. The former two groups are included in many drugs in current clinical use and have not yet been reported as HDAC inhibitors. Therefore, they can be considered as new inhibitor scaffolds for the development of anticancer drugs by structure-activity relationship studies to improve the inhibitory activities against HDACs. Interactions with the HDAC1 active site residues responsible for stabilizing these new inhibitors are addressed in detail.

Lipid Interaction Sites on Channels, Transporters and Receptors: Recent Insights from Molecular Dynamics Simulations

PubMed Central

Hedger, George; Sansom, Mark S. P.

2017-01-01

Lipid molecules are able to selectively interact with specific sites on integral membrane proteins, and modulate their structure and function. Identification and characterisation of these sites is of importance for our understanding of the molecular basis of membrane protein function and stability, and may facilitate the design of lipid-like drug molecules. Molecular dynamics simulations provide a powerful tool for the identification of these sites, complementing advances in membrane protein structural biology and biophysics. We describe recent notable biomolecular simulation studies which have identified lipid interaction sites on a range of different membrane proteins. The sites identified in these simulation studies agree well with those identified by complementary experimental techniques. This demonstrates the power of the molecular dynamics approach in the prediction and characterization of lipid interaction sites on integral membrane proteins. PMID:26946244

Proviruses with Long-Term Stable Expression Accumulate in Transcriptionally Active Chromatin Close to the Gene Regulatory Elements: Comparison of ASLV-, HIV- and MLV-Derived Vectors

PubMed Central

Miklík, Dalibor; Šenigl, Filip; Hejnar, Jiří

2018-01-01

Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species. PMID:29517993

A composite docking approach for the identification and characterization of ectosteric inhibitors of cathepsin K.

PubMed

Law, Simon; Panwar, Preety; Li, Jody; Aguda, Adeleke H; Jamroz, Andrew; Guido, Rafael V C; Brömme, Dieter

2017-01-01

Cathepsin K (CatK) is a cysteine protease that plays an important role in mammalian intra- and extracellular protein turnover and is known for its unique and potent collagenase activity. Through studies on the mechanism of its collagenase activity, selective ectosteric sites were identified that are remote from the active site. Inhibitors targeting these ectosteric sites are collagenase selective and do not interfere with other proteolytic activities of the enzyme. Potential ectosteric inhibitors were identified using a computational approach to screen the druggable subset of and the entire 281,987 compounds comprising Chemical Repository library of the National Cancer Institute-Developmental Therapeutics Program (NCI-DTP). Compounds were scored based on their affinity for the ectosteric site. Here we compared the scores of three individual molecular docking methods with that of a composite score of all three methods together. The composite docking method was up to five-fold more effective at identifying potent collagenase inhibitors (IC50 < 20 μM) than the individual methods. Of 160 top compounds tested in enzymatic assays, 28 compounds revealed blocking of the collagenase activity of CatK at 100 μM. Two compounds exhibited IC50 values below 5 μM corresponding to a molar protease:inhibitor concentration of <1:12. Both compounds were subsequently tested in osteoclast bone resorption assays where the most potent inhibitor, 10-[2-[bis(2-hydroxyethyl)amino]ethyl]-7,8-diethylbenzo[g]pteridine-2,4-dione, (NSC-374902), displayed an inhibition of bone resorption with an IC50-value of approximately 300 nM and no cell toxicity effects.

A composite docking approach for the identification and characterization of ectosteric inhibitors of cathepsin K

PubMed Central

Law, Simon; Panwar, Preety; Li, Jody; Aguda, Adeleke H.; Jamroz, Andrew; Guido, Rafael V. C.

2017-01-01

Cathepsin K (CatK) is a cysteine protease that plays an important role in mammalian intra- and extracellular protein turnover and is known for its unique and potent collagenase activity. Through studies on the mechanism of its collagenase activity, selective ectosteric sites were identified that are remote from the active site. Inhibitors targeting these ectosteric sites are collagenase selective and do not interfere with other proteolytic activities of the enzyme. Potential ectosteric inhibitors were identified using a computational approach to screen the druggable subset of and the entire 281,987 compounds comprising Chemical Repository library of the National Cancer Institute-Developmental Therapeutics Program (NCI-DTP). Compounds were scored based on their affinity for the ectosteric site. Here we compared the scores of three individual molecular docking methods with that of a composite score of all three methods together. The composite docking method was up to five-fold more effective at identifying potent collagenase inhibitors (IC50 < 20 μM) than the individual methods. Of 160 top compounds tested in enzymatic assays, 28 compounds revealed blocking of the collagenase activity of CatK at 100 μM. Two compounds exhibited IC50 values below 5 μM corresponding to a molar protease:inhibitor concentration of <1:12. Both compounds were subsequently tested in osteoclast bone resorption assays where the most potent inhibitor, 10-[2-[bis(2-hydroxyethyl)amino]ethyl]-7,8-diethylbenzo[g]pteridine-2,4-dione, (NSC-374902), displayed an inhibition of bone resorption with an IC50-value of approximately 300 nM and no cell toxicity effects. PMID:29088253

The use of ene adducts to study and engineer enoyl-thioester reductases.

PubMed

Rosenthal, Raoul G; Vögeli, Bastian; Quade, Nick; Capitani, Guido; Kiefer, Patrick; Vorholt, Julia A; Ebert, Marc-Olivier; Erb, Tobias J

2015-06-01

An improved understanding of enzymes' catalytic proficiency and stereoselectivity would further enable applications in chemistry, biocatalysis and industrial biotechnology. We use a chemical probe to dissect individual catalytic steps of enoyl-thioester reductases (Etrs), validating an active site tyrosine as the cryptic proton donor and explaining how it had eluded definitive identification. This information enabled the rational redesign of Etr, yielding mutants that create products with inverted stereochemistry at wild type-like turnover frequency.

Seismic Hazard Assessment for a Characteristic Earthquake Scenario: Probabilistic-Deterministic Method

NASA Astrophysics Data System (ADS)

mouloud, Hamidatou

2016-04-01

The objective of this paper is to analyze the seismic activity and the statistical treatment of seismicity catalog the Constantine region between 1357 and 2014 with 7007 seismic event. Our research is a contribution to improving the seismic risk management by evaluating the seismic hazard in the North-East Algeria. In the present study, Earthquake hazard maps for the Constantine region are calculated. Probabilistic seismic hazard analysis (PSHA) is classically performed through the Cornell approach by using a uniform earthquake distribution over the source area and a given magnitude range. This study aims at extending the PSHA approach to the case of a characteristic earthquake scenario associated with an active fault. The approach integrates PSHA with a high-frequency deterministic technique for the prediction of peak and spectral ground motion parameters in a characteristic earthquake. The method is based on the site-dependent evaluation of the probability of exceedance for the chosen strong-motion parameter. We proposed five sismotectonique zones. Four steps are necessary: (i) identification of potential sources of future earthquakes, (ii) assessment of their geological, geophysical and geometric, (iii) identification of the attenuation pattern of seismic motion, (iv) calculation of the hazard at a site and finally (v) hazard mapping for a region. In this study, the procedure of the earthquake hazard evaluation recently developed by Kijko and Sellevoll (1992) is used to estimate seismic hazard parameters in the northern part of Algeria.

The Fe-V Cofactor of Vanadium Nitrogenase Contains an Interstitial Carbon Atom.

PubMed

Rees, Julian A; Bjornsson, Ragnar; Schlesier, Julia; Sippel, Daniel; Einsle, Oliver; DeBeer, Serena

2015-11-02

The first direct evidence is provided for the presence of an interstitial carbide in the Fe-V cofactor of Azotobacter vinelandii vanadium nitrogenase. As for our identification of the central carbide in the Fe-Mo cofactor, we employed Fe Kβ valence-to-core X-ray emission spectroscopy and density functional theory calculations, and herein report the highly similar spectra of both variants of the cofactor-containing protein. The identification of an analogous carbide, and thus an atomically homologous active site in vanadium nitrogenase, highlights the importance and influence of both the interstitial carbide and the identity of the heteroatom on the electronic structure and catalytic activity of the enzyme. © 2015 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of the Creative Commons Attribution Non-Commercial NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Nicotinamide riboside kinase structures reveal new pathways to NAD+.

PubMed

Tempel, Wolfram; Rabeh, Wael M; Bogan, Katrina L; Belenky, Peter; Wojcik, Marzena; Seidle, Heather F; Nedyalkova, Lyudmila; Yang, Tianle; Sauve, Anthony A; Park, Hee-Won; Brenner, Charles

2007-10-02

The eukaryotic nicotinamide riboside kinase (Nrk) pathway, which is induced in response to nerve damage and promotes replicative life span in yeast, converts nicotinamide riboside to nicotinamide adenine dinucleotide (NAD+) by phosphorylation and adenylylation. Crystal structures of human Nrk1 bound to nucleoside and nucleotide substrates and products revealed an enzyme structurally similar to Rossmann fold metabolite kinases and allowed the identification of active site residues, which were shown to be essential for human Nrk1 and Nrk2 activity in vivo. Although the structures account for the 500-fold discrimination between nicotinamide riboside and pyrimidine nucleosides, no enzyme feature was identified to recognize the distinctive carboxamide group of nicotinamide riboside. Indeed, nicotinic acid riboside is a specific substrate of human Nrk enzymes and is utilized in yeast in a novel biosynthetic pathway that depends on Nrk and NAD+ synthetase. Additionally, nicotinic acid riboside is utilized in vivo by Urh1, Pnp1, and Preiss-Handler salvage. Thus, crystal structures of Nrk1 led to the identification of new pathways to NAD+.

A novel protein kinase D phosphorylation site in the tumor suppressor Rab interactor 1 is critical for coordination of cell migration.

PubMed

Ziegler, Susanne; Eiseler, Tim; Scholz, Rolf-Peter; Beck, Alexander; Link, Gisela; Hausser, Angelika

2011-03-01

The multifunctional signal adapter protein Ras and Rab interactor 1 (RIN1) is a Ras effector protein involved in the regulation of epithelial cell processes such as cell migration and endocytosis. RIN1 signals via two downstream pathways, namely the activation of Rab5 and Abl family kinases. Protein kinase D (PKD) phosphorylates RIN1 at serine 351 in vitro, thereby regulating interaction with 14-3-3 proteins. Here, we report the identification of serine 292 in RIN1 as an in vivo PKD phosphorylation site. PKD-mediated phosphorylation at this site was confirmed with a phospho-specific antibody and by mass spectrometry. We demonstrate that phosphorylation at serine 292 controls RIN1-mediated inhibition of cell migration by modulating the activation of Abl kinases. We further provide evidence that RIN1 in vivo phosphorylation at serine 351 occurs independently of PKD. Collectively, our data identify a novel PKD signaling pathway through RIN1 and Abl kinases that is involved in the regulation of actin remodeling and cell migration.

Identification of a Second Site of Pyrrolizidine Alkaloid Biosynthesis in Comfrey to Boost Plant Defense in Floral Stage1,2[OPEN

PubMed Central

Stegemann, Thomas; Sievert, Christian

2017-01-01

Pyrrolizidine alkaloids (PAs) are toxic secondary metabolites that are found in several distantly related families of the angiosperms. The first specific step in PA biosynthesis is catalyzed by homospermidine synthase (HSS), which has been recruited several times independently by duplication of the gene encoding deoxyhypusine synthase, an enzyme involved in the posttranslational activation of the eukaryotic initiation factor 5A. HSS shows highly diverse spatiotemporal gene expression in various PA-producing species. In comfrey (Symphytum officinale; Boraginaceae), PAs are reported to be synthesized in the roots, with HSS being localized in cells of the root endodermis. Here, we show that comfrey plants activate a second site of HSS expression when inflorescences start to develop. HSS has been localized in the bundle sheath cells of specific leaves. Tracer feeding experiments have confirmed that these young leaves express not only HSS but the whole PA biosynthetic route. This second site of PA biosynthesis results in drastically increased PA levels within the inflorescences. The boost of PA biosynthesis is proposed to guarantee optimal protection especially of the reproductive structures. PMID:28275146

Vapor-Phase Hydrodeoxygenation of Guaiacol to Aromatics over Pt/HBeta: Identification of the Role of Acid Sites and Metal Sites on the Reaction Pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nie, Lei; Peng, Bo; Zhu, Xinli

Hydrodeoxygenation of guaiacol, a phenolic compound derived from lignin fraction of biomass, over a Pt/HBeta catalyst at 350 °C and atmospheric pressure produces benzene, toluene, xylenes, and C9+ aromatics with yield of 42%, 29%, 12%, and 5%, respectively. Reaction pathways for conversion of two functional groups (hydroxyl and methoxyl) over the bifunctional catalyst were studied. Both guaiacol and intermediate products (catechol and cyclopentanone) were fed onto zeolite HBeta and Pt/SiO2 to identify the individual role of acid site and metal site. Acid sites (mainly Brønsted acid site, BAS) catalyze transalkylation and dehydroxylation reactions in sequence, producing phenol, cresols and xylenolsmore » as the major products at high conversion. Pt sites catalyze demethylation reaction resulting in catechol as the primary product, which can either be deoxygenated to phenol followed by phenol to benzene, or decarbonylated to cyclopentanone and further to butane. The close proximity of Pt and BAS in bifunctional Pt/HBeta enables both transalkylation and deoxygenation reactions with inhibited demethylation and decarbonylation reactions, producing aromatics as major final products with a total yield > 85%. Both activity and stability of bifunctional Pt/HBeta during hydrodeoxygenation of guaiacol is improved compared to HBeta and Pt/SiO2. The addition of water to the feed further improves the activity and stability via hydrolysis of O-CH3 bond of guaiacol on BAS and removing coke around Pt.« less

Identification of an inhibitory Zn2+ binding site on the human glycine receptor α1 subunit

PubMed Central

Harvey, Robert J; Thomas, Philip; James, Colin H; Wilderspin, Andrew; Smart, Trevor G

1999-01-01

Whole-cell glycine-activated currents were recorded from human embryonic kidney (HEK) cells expressing wild-type and mutant recombinant homomeric glycine receptors (GlyRs) to locate the inhibitory binding site for Zn2+ ions on the human α1 subunit. Glycine-activated currents were potentiated by low concentrations of Zn2+ (<10 μm) and inhibited by higher concentrations (>100 μm) on wild-type α1 subunit GlyRs. Lowering the external pH from 7.4 to 5.4 inhibited the glycine responses in a competitive manner. The inhibition caused by Zn2+ was abolished leaving an overt potentiating effect at 10 μm Zn2+ that was exacerbated at 100 μm Zn2+. The identification of residues involved in the formation of the inhibitory binding site was also assessed using diethylpyrocarbonate (DEPC), which modifies histidines. DEPC (1 mm) abolished Zn2+-induced inhibition and also the potentiation of glycine-activated currents by Zn2+. The reduction in glycine-induced whole-cell currents in the presence of high (100 μm) concentrations of Zn2+ did not increase the rate of glycine receptor desensitisation. Systematic mutation of extracellular histidine residues in the GlyR α1 subunit revealed that mutations H107A or H109A completely abolished inhibition of glycine-gated currents by Zn2+. However, mutation of other external histidines, H210, H215 and H419, failed to prevent inhibition by Zn2+ of glycine-gated currents. Thus, H107 and H109 in the extracellular domain of the human GlyR α1 subunit are major determinants of the inhibitory Zn2+ binding site. An examination of Zn2+ co-ordination in metalloenzymes revealed that the histidine- hydrophobic residue-histidine motif found to be responsible for binding Zn2+ in the human GlyR α1 subunit is also shared by some of these enzymes. Further comparison of the structure and location of this motif with a generic model of the GlyR α1 subunit suggests that H107 and H109 participate in the formation of the inhibitory Zn2+ binding site at the apex of a β sheet in the N-terminal extracellular domain. PMID:10517800

Synergism of virtual screening and medicinal chemistry: identification and optimization of allosteric antagonists of metabotropic glutamate receptor 1.

PubMed

Noeske, Tobias; Trifanova, Dina; Kauss, Valerjans; Renner, Steffen; Parsons, Christopher G; Schneider, Gisbert; Weil, Tanja

2009-08-01

We report the identification of novel potent and selective metabotropic glutamate receptor 1 (mGluR1) antagonists by virtual screening and subsequent hit optimization. For ligand-based virtual screening, molecules were represented by a topological pharmacophore descriptor (CATS-2D) and clustered by a self-organizing map (SOM). The most promising compounds were tested in mGluR1 functional and binding assays. We identified a potent chemotype exhibiting selective antagonistic activity at mGluR1 (functional IC(50)=0.74+/-0.29 microM). Hit optimization yielded lead structure 16 with an affinity of K(i)=0.024+/-0.001 microM and greater than 1000-fold selectivity for mGluR1 versus mGluR5. Homology-based receptor modelling suggests a binding site compatible with previously reported mutation studies. Our study demonstrates the usefulness of ligand-based virtual screening for scaffold-hopping and rapid lead structure identification in early drug discovery projects.

Identification of residues that control Li+ versus Na+ dependent Ca2+ exchange at the transport site of the mitochondrial NCLX.

PubMed

Roy, Soumitra; Dey, Kuntal; Hershfinkel, Michal; Ohana, Ehud; Sekler, Israel

2017-06-01

The Na + /Ca 2+ /Li + exchanger (NCLX) is a member of the Na + /Ca 2+ exchanger family. NCLX is unique in its capacity to transport both Na + and Li + , unlike other members, which are Na + selective. The major aim of this study was twofold, i.e., to identify NCLX residues that confer Li + or Na + selective Ca 2+ transport and map their putative location on NCLX cation transport site. We combined molecular modeling to map transport site of NCLX with euryarchaeal H + /Ca 2+ exchanger, CAX_Af, and fluorescence analysis to monitor Li + versus Na + dependent mitochondrial Ca 2+ efflux of transport site mutants of NCLX in permeabilized cells. Mutation of Asn149, Pro152, Asp153, Gly176, Asn467, Ser468, Gly494 and Asn498 partially or strongly abolished mitochondrial Ca 2+ exchange activity in intact cells. In permeabilized cells, N149A, P152A, D153A, N467Q, S468T and G494S demonstrated normal Li + /Ca 2+ exchange activity but a reduced Na + /Ca 2+ exchange activity. On the other hand, D471A showed dramatically reduced Li + /Ca 2+ exchange, but Na + /Ca 2+ exchange activity was unaffected. Finally, simultaneous mutation of four putative Ca 2+ binding residues was required to completely abolish both Na + /Ca 2+ and Li + /Ca 2+ exchange activities. We identified distinct Na + and Li + selective residues in the NCLX transport site. We propose that functional segregation in Li + and Na + sites reflects the functional properties of NCLX required for Ca 2+ exchange under the unique membrane potential and ion gradient across the inner mitochondrial membrane. The results of this study provide functional insights into the unique Li + and Na + selectivity of the mitochondrial exchanger. This article is part of a Special Issue entitled: ECS Meeting edited by Claus Heizmann, Joachim Krebs and Jacques Haiech. Copyright © 2017 Elsevier B.V. All rights reserved.

How allosteric control of Staphylococcus aureus penicillin binding protein 2a enables methicillin resistance and physiological function

PubMed Central

Otero, Lisandro H.; Rojas-Altuve, Alzoray; Llarrull, Leticia I.; Carrasco-López, Cesar; Kumarasiri, Malika; Lastochkin, Elena; Fishovitz, Jennifer; Dawley, Matthew; Hesek, Dusan; Lee, Mijoon; Johnson, Jarrod W.; Fisher, Jed F.; Chang, Mayland; Mobashery, Shahriar; Hermoso, Juan A.

2013-01-01

The expression of penicillin binding protein 2a (PBP2a) is the basis for the broad clinical resistance to the β-lactam antibiotics by methicillin-resistant Staphylococcus aureus (MRSA). The high-molecular mass penicillin binding proteins of bacteria catalyze in separate domains the transglycosylase and transpeptidase activities required for the biosynthesis of the peptidoglycan polymer that comprises the bacterial cell wall. In bacteria susceptible to β-lactam antibiotics, the transpeptidase activity of their penicillin binding proteins (PBPs) is lost as a result of irreversible acylation of an active site serine by the β-lactam antibiotics. In contrast, the PBP2a of MRSA is resistant to β-lactam acylation and successfully catalyzes the dd-transpeptidation reaction necessary to complete the cell wall. The inability to contain MRSA infection with β-lactam antibiotics is a continuing public health concern. We report herein the identification of an allosteric binding domain—a remarkable 60 Å distant from the dd-transpeptidase active site—discovered by crystallographic analysis of a soluble construct of PBP2a. When this allosteric site is occupied, a multiresidue conformational change culminates in the opening of the active site to permit substrate entry. This same crystallographic analysis also reveals the identity of three allosteric ligands: muramic acid (a saccharide component of the peptidoglycan), the cell wall peptidoglycan, and ceftaroline, a recently approved anti-MRSA β-lactam antibiotic. The ability of an anti-MRSA β-lactam antibiotic to stimulate allosteric opening of the active site, thus predisposing PBP2a to inactivation by a second β-lactam molecule, opens an unprecedented realm for β-lactam antibiotic structure-based design. PMID:24085846

A Single Glycan at the 99-Loop of Human Kallikrein-related Peptidase 2 Regulates Activation and Enzymatic Activity*

PubMed Central

Guo, Shihui; Skala, Wolfgang; Magdolen, Viktor; Briza, Peter; Biniossek, Martin L.; Schilling, Oliver; Kellermann, Josef; Brandstetter, Hans; Goettig, Peter

2016-01-01

Human kallikrein-related peptidase 2 (KLK2) is a key serine protease in semen liquefaction and prostate cancer together with KLK3/prostate-specific antigen. In order to decipher the function of its potential N-glycosylation site, we produced pro-KLK2 in Leishmania tarentolae cells and compared it with its non-glycosylated counterpart from Escherichia coli expression. Mass spectrometry revealed that Asn-95 carries a core glycan, consisting of two GlcNAc and three hexoses. Autocatalytic activation was retarded in glyco-pro-KLK2, whereas the activated glyco-form exhibited an increased proteolytic resistance. The specificity patterns obtained by the PICS (proteomic identification of protease cleavage sites) method are similar for both KLK2 variants, with a major preference for P1-Arg. However, glycosylation changes the enzymatic activity of KLK2 in a drastically substrate-dependent manner. Although glyco-KLK2 has a considerably lower catalytic efficiency than glycan-free KLK2 toward peptidic substrates with P2-Phe, the situation was reverted toward protein substrates, such as glyco-pro-KLK2 itself. These findings can be rationalized by the glycan-carrying 99-loop that prefers to cover the active site like a lid. By contrast, the non-glycosylated 99-loop seems to favor a wide open conformation, which mostly increases the apparent affinity for the substrates (i.e. by a reduction of Km). Also, the cleavage pattern and kinetics in autolytic inactivation of both KLK2 variants can be explained by a shift of the target sites due to the presence of the glycan. These striking effects of glycosylation pave the way to a deeper understanding of kallikrein-related peptidase biology and pathology. PMID:26582203

Ligand-Assisted Protein Structure (LAPS): An Experimental Paradigm for Characterizing Cannabinoid-Receptor Ligand-Binding Domains.

PubMed

Janero, David R; Korde, Anisha; Makriyannis, Alexandros

2017-01-01

Detailed characterization of the ligand-binding motifs and structure-function correlates of the principal GPCRs of the endocannabinoid-signaling system, the cannabinoid 1 (CB1R) and cannabinoid 2 (CB2R) receptors, is essential to inform the rational design of drugs that modulate CB1R- and CB2R-dependent biosignaling for therapeutic gain. We discuss herein an experimental paradigm termed "ligand-assisted protein structure" (LAPS) that affords a means of characterizing, at the amino acid level, CB1R and CB2R structural features key to ligand engagement and receptor-dependent information transmission. For this purpose, LAPS integrates three key disciplines and methodologies: (a) medicinal chemistry: design and synthesis of high-affinity, pharmacologically active probes as reporters capable of reacting irreversibly with particular amino acids at (or in the immediate vicinity of) the ligand-binding domain of the functionally active receptor; (b) molecular and cellular biology: introduction of discrete, conservative point mutations into the target GPCR and determination of their effect on probe binding and pharmacological activity; (c) analytical chemistry: identification of the site(s) of probe-GPCR interaction through focused, bottom-up, amino acid-level proteomic identification of the probe-receptor complex using liquid chromatography tandem mass spectrometry. Subsequent in silico methods including ligand docking and computational modeling provide supplementary data on the probe-receptor interaction as defined by LAPS. Examples of LAPS as applied to human CB2R orthosteric binding site characterization for a biarylpyrazole antagonist/inverse agonist and a classical cannabinoid agonist belonging to distinct chemical classes of cannabinergic compounds are given as paradigms for further application of this methodology to other therapeutic protein targets. LAPS is well positioned to complement other experimental and in silico methods in contemporary structural biology such as X-ray crystallography. © 2017 Elsevier Inc. All rights reserved.

The concept of value stream mapping to reduce of work-time waste as applied the smart construction management

NASA Astrophysics Data System (ADS)

Elizar, Suripin, Wibowo, Mochamad Agung

2017-11-01

Delays in construction sites occur due to systematic additions of time waste in various activities that are part of the construction process. Work-time waste is non-adding value activity which used to differentiate between physical construction waste found on site and other waste which occurs during the construction process. The aim of this study is identification using the concept of Value Stream Mapping (VSM) to reduce of work-time waste as applied the smart construction management.VSM analysis is a method of business process improvement. The application of VSM began in the manufacturing community. The research method base on theoretically informed case study and literature review. The data have collected using questionnaire through personal interviews from 383 respondents on construction project in Indonesia. The results show that concept of VSM can identify causes of work-time waste. Base on result of questioners and quantitative approach analysis was obtained 29 variables that influence of work-time waste or non-value-adding activities. Base on three cases of construction project founded that average 14.88% of working time was classified as waste. Finally, the concept of VSM can recommend to identification of systematic for reveal current practices and opportunities for improvement towards global challenges. The concept of value stream mapping can help optimize to reduce work-time waste and improve quality standard of construction management. The concept is also can help manager to make a decision to reduce work-time waste so as to obtain of result in more efficient for performance and sustainable construction project.

Discovery of PF-06928215 as a high affinity inhibitor of cGAS enabled by a novel fluorescence polarization assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hall, Justin; Brault, Amy; Vincent, Fabien

Cyclic GMP-AMP synthase (cGAS) initiates the innate immune system in response to cytosolic dsDNA. After binding and activation from dsDNA, cGAS uses ATP and GTP to synthesize 2', 3' -cGAMP (cGAMP), a cyclic dinucleotide second messenger with mixed 2'-5' and 3'-5' phosphodiester bonds. Inappropriate stimulation of cGAS has been implicated in autoimmune disease such as systemic lupus erythematosus, thus inhibition of cGAS may be of therapeutic benefit in some diseases; however, the size and polarity of the cGAS active site makes it a challenging target for the development of conventional substrate-competitive inhibitors. We report here the development of a highmore » affinity (K D = 200 nM) inhibitor from a low affinity fragment hit with supporting biochemical and structural data showing these molecules bind to the cGAS active site. We also report a new high throughput cGAS fluorescence polarization (FP)-based assay to enable the rapid identification and optimization of cGAS inhibitors. This FP assay uses Cy5-labelled cGAMP in combination with a novel high affinity monoclonal antibody that specifically recognizes cGAMP with no cross reactivity to cAMP, cGMP, ATP, or GTP. Given its role in the innate immune response, cGAS is a promising therapeutic target for autoinflammatory disease. Our results demonstrate its druggability, provide a high affinity tool compound, and establish a high throughput assay for the identification of next generation cGAS inhibitors.« less

Fine epitope signature of antibody neutralization breadth at the HIV-1 envelope CD4-binding site.

PubMed

Cheng, Hao D; Grimm, Sebastian K; Gilman, Morgan Sa; Gwom, Luc Christian; Sok, Devin; Sundling, Christopher; Donofrio, Gina; Hedestam, Gunilla B Karlsson; Bonsignori, Mattia; Haynes, Barton F; Lahey, Timothy P; Maro, Isaac; von Reyn, C Fordham; Gorny, Miroslaw K; Zolla-Pazner, Susan; Walker, Bruce D; Alter, Galit; Burton, Dennis R; Robb, Merlin L; Krebs, Shelly J; Seaman, Michael S; Bailey-Kellogg, Chris; Ackerman, Margaret E

2018-03-08

Major advances in donor identification, antigen probe design, and experimental methods to clone pathogen-specific antibodies have led to an exponential growth in the number of newly characterized broadly neutralizing antibodies (bnAbs) that recognize the HIV-1 envelope glycoprotein. Characterization of these bnAbs has defined new epitopes and novel modes of recognition that can result in potent neutralization of HIV-1. However, the translation of envelope recognition profiles in biophysical assays into an understanding of in vivo activity has lagged behind, and identification of subjects and mAbs with potent antiviral activity has remained reliant on empirical evaluation of neutralization potency and breadth. To begin to address this discrepancy between recombinant protein recognition and virus neutralization, we studied the fine epitope specificity of a panel of CD4-binding site (CD4bs) antibodies to define the molecular recognition features of functionally potent humoral responses targeting the HIV-1 envelope site bound by CD4. Whereas previous studies have used neutralization data and machine-learning methods to provide epitope maps, here, this approach was reversed, demonstrating that simple binding assays of fine epitope specificity can prospectively identify broadly neutralizing CD4bs-specific mAbs. Building on this result, we show that epitope mapping and prediction of neutralization breadth can also be accomplished in the assessment of polyclonal serum responses. Thus, this study identifies a set of CD4bs bnAb signature amino acid residues and demonstrates that sensitivity to mutations at signature positions is sufficient to predict neutralization breadth of polyclonal sera with a high degree of accuracy across cohorts and across clades.

Detection of recurrent activation patterns across focal seizures: Application to seizure onset zone identification.

PubMed

Vila-Vidal, Manel; Principe, Alessandro; Ley, Miguel; Deco, Gustavo; Tauste Campo, Adrià; Rocamora, Rodrigo

2017-06-01

We introduce a method that quantifies the consistent involvement of intracranially monitored regions in recurrent focal seizures. We evaluated the consistency of two ictal spectral activation patterns (mean power change and power change onset time) in intracranial recordings across focal seizures from seven patients with clinically marked seizure onset zone (SOZ). We examined SOZ discrimination using both patterns in different frequency bands and periods of interest. Activation patterns were proved to be consistent across more than 80% of recurrent ictal epochs. In all patients, whole-seizure mean activations were significantly higher for SOZ than non-SOZ regions (P<0.05) while activation onset times were significantly lower for SOZ than for non-SOZ regions (P<0.001) in six patients. Alpha-beta bands (8-20Hz) achieved the highest patient-average effect size on the whole-seizure period while gamma band (20-70Hz) achieved the highest discrimination values between SOZ and non-SOZ sites near seizure onset (0-5s). Consistent spectral activation patterns in focal epilepsies discriminate the SOZ with high effect sizes upon appropriate selection of frequency bands and activation periods. The present method may be used to improve epileptogenic identification as well as pinpoint additional regions that are functionally altered during ictal events. Copyright © 2017 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.

Master Plans for Park Sites.

ERIC Educational Resources Information Center

Van Meter, Jerry R.

This booklet is a general guide to park site planning. The four basic steps involved in developing a park site are a) determination of the uses of the site, b) analysis of the site potential for these uses, c) identification of the functional relationship among the uses, and d) coordination of the uses to the park sites. Uses of park sites are…

An approach to functionally relevant clustering of the protein universe: Active site profile‐based clustering of protein structures and sequences

PubMed Central

Knutson, Stacy T.; Westwood, Brian M.; Leuthaeuser, Janelle B.; Turner, Brandon E.; Nguyendac, Don; Shea, Gabrielle; Kumar, Kiran; Hayden, Julia D.; Harper, Angela F.; Brown, Shoshana D.; Morris, John H.; Ferrin, Thomas E.; Babbitt, Patricia C.

2017-01-01

Abstract Protein function identification remains a significant problem. Solving this problem at the molecular functional level would allow mechanistic determinant identification—amino acids that distinguish details between functional families within a superfamily. Active site profiling was developed to identify mechanistic determinants. DASP and DASP2 were developed as tools to search sequence databases using active site profiling. Here, TuLIP (Two‐Level Iterative clustering Process) is introduced as an iterative, divisive clustering process that utilizes active site profiling to separate structurally characterized superfamily members into functionally relevant clusters. Underlying TuLIP is the observation that functionally relevant families (curated by Structure‐Function Linkage Database, SFLD) self‐identify in DASP2 searches; clusters containing multiple functional families do not. Each TuLIP iteration produces candidate clusters, each evaluated to determine if it self‐identifies using DASP2. If so, it is deemed a functionally relevant group. Divisive clustering continues until each structure is either a functionally relevant group member or a singlet. TuLIP is validated on enolase and glutathione transferase structures, superfamilies well‐curated by SFLD. Correlation is strong; small numbers of structures prevent statistically significant analysis. TuLIP‐identified enolase clusters are used in DASP2 GenBank searches to identify sequences sharing functional site features. Analysis shows a true positive rate of 96%, false negative rate of 4%, and maximum false positive rate of 4%. F‐measure and performance analysis on the enolase search results and comparison to GEMMA and SCI‐PHY demonstrate that TuLIP avoids the over‐division problem of these methods. Mechanistic determinants for enolase families are evaluated and shown to correlate well with literature results. PMID:28054422

Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

PubMed

Kang, J J; Yokoi, T J; Holland, M J

1995-12-01

The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

Identification of the prooxidant site of human ceruloplasmin: a model for oxidative damage by copper bound to protein surfaces

NASA Technical Reports Server (NTRS)

Mukhopadhyay, C. K.; Mazumder, B.; Lindley, P. F.; Fox, P. L.

1997-01-01

Free transition metal ions oxidize lipids and lipoproteins in vitro; however, recent evidence suggests that free metal ion-independent mechanisms are more likely in vivo. We have shown previously that human ceruloplasmin (Cp), a serum protein containing seven Cu atoms, induces low density lipoprotein oxidation in vitro and that the activity depends on the presence of a single, chelatable Cu atom. We here use biochemical and molecular approaches to determine the site responsible for Cp prooxidant activity. Experiments with the His-specific reagent diethylpyrocarbonate (DEPC) showed that one or more His residues was specifically required. Quantitative [14C]DEPC binding studies indicated the importance of a single His residue because only one was exposed upon removal of the prooxidant Cu. Plasmin digestion of [14C]DEPC-treated Cp (and N-terminal sequence analysis of the fragments) showed that the critical His was in a 17-kDa region containing four His residues in the second major sequence homology domain of Cp. A full length human Cp cDNA was modified by site-directed mutagenesis to give His-to-Ala substitutions at each of the four positions and was transfected into COS-7 cells, and low density lipoprotein oxidation was measured. The prooxidant site was localized to a region containing His426 because CpH426A almost completely lacked prooxidant activity whereas the other mutants expressed normal activity. These observations support the hypothesis that Cu bound at specific sites on protein surfaces can cause oxidative damage to macromolecules in their environment. Cp may serve as a model protein for understanding mechanisms of oxidant damage by copper-containing (or -binding) proteins such as Cu, Zn superoxide dismutase, and amyloid precursor protein.

Global Impact of Oncogenic Src on a Phosphotyrosine Proteome

PubMed Central

Luo, Weifeng; Slebos, Robbert J.; Hill, Salisha; Li, Ming; Brábek, Jan; Amanchy, Ramars; Chaerkady, Raghothama; Pandey, Akhilesh; Ham, Amy-Joan L.; Hanks, Steven K.

2008-01-01

Elevated activity of Src, the first characterized protein-tyrosine kinase, is associated with progression of many human cancers, and Src has attracted interest as a therapeutic target. Src is known to act in various receptor signaling systems to impact cell behavior, yet it remains likely that the spectrum of Src protein substrates relevant to cancer is incompletely understood. To better understand the cellular impact of deregulated Src kinase activity, we extensively applied a mass spectrometry shotgun phosphotyrosine (pTyr) proteomics strategy to obtain global pTyr profiles of Src-transformed mouse fibroblasts as well as their nontransformed counterparts. A total of 867 peptides representing 563 distinct pTyr sites on 374 different proteins were identified from the Src-transformed cells, while 514 peptides representing 275 pTyr sites on 167 proteins were identified from nontransformed cells. Distinct characteristics of the two profiles were revealed by spectral counting, indicative of pTyr site relative abundance, and by complementary quantitative analysis using stable isotope labeling with amino acids in cell culture (SILAC). While both pTyr profiles are replete with sites on signaling and adhesion/cytoskeletal regulatory proteins, the Src-transformed profile is more diverse with enrichment in sites on metabolic enzymes and RNA and protein synthesis and processing machinery. Forty-three pTyr sites (32 proteins) are predicted as major biologically relevant Src targets on the basis of frequent identification in both cell populations. This select group, of particular interest as diagnostic biomarkers, includes well-established Src sites on signaling/adhesion/cytoskeletal proteins, but also uncharacterized sites of potential relevance to the transformed cell phenotype. PMID:18563927

Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

NASA Astrophysics Data System (ADS)

Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

2013-08-01

The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

Cell type-selective disease-association of genes under high regulatory load

PubMed Central

Galhardo, Mafalda; Berninger, Philipp; Nguyen, Thanh-Phuong; Sauter, Thomas; Sinkkonen, Lasse

2015-01-01

We previously showed that disease-linked metabolic genes are often under combinatorial regulation. Using the genome-wide ChIP-Seq binding profiles for 93 transcription factors in nine different cell lines, we show that genes under high regulatory load are significantly enriched for disease-association across cell types. We find that transcription factor load correlates with the enhancer load of the genes and thereby allows the identification of genes under high regulatory load by epigenomic mapping of active enhancers. Identification of the high enhancer load genes across 139 samples from 96 different cell and tissue types reveals a consistent enrichment for disease-associated genes in a cell type-selective manner. The underlying genes are not limited to super-enhancer genes and show several types of disease-association evidence beyond genetic variation (such as biomarkers). Interestingly, the high regulatory load genes are involved in more KEGG pathways than expected by chance, exhibit increased betweenness centrality in the interaction network of liver disease genes, and carry longer 3′ UTRs with more microRNA (miRNA) binding sites than genes on average, suggesting a role as hubs integrating signals within regulatory networks. In summary, epigenetic mapping of active enhancers presents a promising and unbiased approach for identification of novel disease genes in a cell type-selective manner. PMID:26338775

Engineering peptide ligase specificity by proteomic identification of ligation sites.

PubMed

Weeks, Amy M; Wells, James A

2018-01-01

Enzyme-catalyzed peptide ligation is a powerful tool for site-specific protein bioconjugation, but stringent enzyme-substrate specificity limits its utility. We developed an approach for comprehensively characterizing peptide ligase specificity for N termini using proteome-derived peptide libraries. We used this strategy to characterize the ligation efficiency for >25,000 enzyme-substrate pairs in the context of the engineered peptide ligase subtiligase and identified a family of 72 mutant subtiligases with activity toward N-terminal sequences that were previously recalcitrant to modification. We applied these mutants individually for site-specific bioconjugation of purified proteins, including antibodies, and in algorithmically selected combinations for sequencing of the cellular N terminome with reduced sequence bias. We also developed a web application to enable algorithmic selection of the most efficient subtiligase variant(s) for bioconjugation to user-defined sequences. Our methods provide a new toolbox of enzymes for site-specific protein modification and a general approach for rapidly defining and engineering peptide ligase specificity.

Background and Source Term Identification in Active Neutron Interrogation Methods

DTIC Science & Technology

2011-03-24

interactions occurred to observe gamma ray peaks and not unduly increase simulation time. Not knowing the uranium enrichment modeled by Gozani, pure U...neutron interactions can occur. The uranium targets, though, should have increased neutron fluencies as the energy levels become below 2 MeV. This is...Assessment Monitor Site (TEAMS) at Kirtland AFB, NM. Iron (Fe-56), lead (Pb-207), polyethylene (C2H4 –– > C-12 & H-1), and uranium (U-235 and U-238) were

Finding Faults: Tohoku and other Active Megathrusts/Megasplays

NASA Astrophysics Data System (ADS)

Moore, J. C.; Conin, M.; Cook, B. J.; Kirkpatrick, J. D.; Remitti, F.; Chester, F.; Nakamura, Y.; Lin, W.; Saito, S.; Scientific Team, E.

2012-12-01

Current subduction-fault drilling procedure is to drill a logging hole, identify target faults, then core and instrument them. Seismic data may constrain faults but the additional resolution of borehole logs is necessary for efficient coring and instrumentation under difficult conditions and tight schedules. Thus, refining the methodology of identifying faults in logging data has become important, and thus comparison of log signatures of faults in different locations is worthwhile. At the C0019 (JFAST) drill site, the Tohoku megathrust was principally identified as a decollement where steep cylindrically-folded bedding abruptly flattens below the basal detachment. A similar structural contrast occurs across a megasplay fault in the NanTroSEIZE transect (Site C0004). At the Tohoku decollement, a high gamma-ray value from a pelagic clay layer, predicted as a likely decollement sediment type, strengthens the megathrust interpretation. The original identification of the pelagic clay as a decollement candidate was based on results of previous coring of an oceanic reference site. Negative density anomalies, often seen as low resistivity zones, identified a subsidiary fault in the deformed prism overlying the Tohoku megathrust. Elsewhere, at Barbados, Nankai (Moroto), and Costa Rica, negative density anomalies are associated with the decollement and other faults in hanging walls. Log-based density anomalies in fault zones provide a basis for recognizing in-situ fault zone dilation. At the Tohoku Site C0019, breakouts are present above but not below the megathrust. Changes in breakout orientation and width (stress magnitude) occur across megasplay faults at Sites C0004 and C0010 in the NantroSEIZE transect. Annular pressure anomalies are not apparent at the Tohoku megathrust, but are variably associated with faults and fracture zones drilled along the NanTroSEIZE transect. Overall, images of changes in structural features, negative density anomalies, and changes in breakout occurrence and orientation provide the most common log criteria for recognizing major thrust zones in ocean drilling holes at convergent margins. In the case of JFAST, identification of faults by logging was confirmed during subsequent coring activities, and logging data was critical for successful placement of the observatory down hole.

Gingival crevicular fluid protein content and alkaline phosphatase activity in relation to pubertal growth phase.

PubMed

Perinetti, Giuseppe; Franchi, Lorenzo; Castaldo, Attilio; Contardo, Luca

2012-11-01

To evaluate gingival crevicular fluid (GCF) protein content and alkaline phosphatase (ALP) activity in growing subjects in relation to stages of skeletal maturation, ie, the growth phase, as prepubertal, pubertal, and postpubertal. Fifty healthy growing subjects (31 girls and 19 boys; age range, 7.8-17.7 years) were enrolled in this study that followed a double-blind, prospective, cross-sectional design. Collection of GCF was performed at the mesial and distal sites of both central incisors, for the maxilla and mandible. Growth phase was assessed through the cervical vertebral maturation method. GCF parameters were expressed as total protein content, total ALP activity, and normalized ALP activity. The total GCF protein content was similar between the different growth phases. On the contrary, the total ALP activity showed a peak for the pubertal growth phase. The normalized GCF ALP activity was only poorly associated with growth phase. No differences were seen between the maxillary and mandibular sites, or between the sexes, for any GCF parameter. The total GCF protein content is not sensitive to the growth phase. However, GCF ALP activity has potential as a diagnostic aid for identification of the pubertal growth phase in individual subjects when expressed as total, but not normalized, values.

Real-time bioacoustics monitoring and automated species identification.

PubMed

Aide, T Mitchell; Corrada-Bravo, Carlos; Campos-Cerqueira, Marconi; Milan, Carlos; Vega, Giovany; Alvarez, Rafael

2013-01-01

Traditionally, animal species diversity and abundance is assessed using a variety of methods that are generally costly, limited in space and time, and most importantly, they rarely include a permanent record. Given the urgency of climate change and the loss of habitat, it is vital that we use new technologies to improve and expand global biodiversity monitoring to thousands of sites around the world. In this article, we describe the acoustical component of the Automated Remote Biodiversity Monitoring Network (ARBIMON), a novel combination of hardware and software for automating data acquisition, data management, and species identification based on audio recordings. The major components of the cyberinfrastructure include: a solar powered remote monitoring station that sends 1-min recordings every 10 min to a base station, which relays the recordings in real-time to the project server, where the recordings are processed and uploaded to the project website (arbimon.net). Along with a module for viewing, listening, and annotating recordings, the website includes a species identification interface to help users create machine learning algorithms to automate species identification. To demonstrate the system we present data on the vocal activity patterns of birds, frogs, insects, and mammals from Puerto Rico and Costa Rica.

Klebsiella aerogenes UreF: Identification of the UreG Binding Site and Role in Enhancing the Fidelity of Urease Activation†

PubMed Central

Boer, Jodi L.; Hausinger, Robert P.

2012-01-01

The Ni-containing active site of Klebsiella aerogenes urease is assembled through the concerted action of the UreD, UreE, UreF, and UreG accessory proteins. UreE functions as a metallochaperone that delivers Ni to a complex of UreD—UreF—UreG bound to urease apoprotein, with UreG serving as a GTPase during enzyme activation. The present study focuses on the role of UreF, previously proposed to act as a GTPase activating protein (GAP) of UreG. Sixteen conserved UreF surface residues that may play roles in protein:protein interactions were independently changed to Ala. When produced in the context of the entire urease gene cluster, cell-free extracts of nine site-directed mutants had less than 10% of the wild-type urease activity. Enrichment of the variant forms of UreF, as the UreE-F fusion proteins, uniformly resulted in co-purification of UreD and urease apoprotein; whereas UreG bound to only a subset of the species. Notably, reduced interaction with UreG correlated with the low activity mutants. The affected residues in UreF map to a distinct surface on the crystal structure, defining the UreG binding site. In contrast to the hypothesis that UreF is a GAP, the UreD—UreF—UreG—urease apoprotein complex containing K165A UreF exhibited significantly greater levels of GTPase activity than that containing the wild-type protein. Additional studies demonstrated the UreG GTPase activity was largely uncoupled from urease activation for the complex containing this UreF variant. Further experiments with these complexes provided evidence that UreF gates the GTPase activity of UreG to enhance the fidelity of urease metallocenter assembly, especially in the presence of the non-cognate metal Zn. PMID:22369361

Human embryonic stem cell phosphoproteome revealed by electron transfer dissociation tandem mass spectrometry.

PubMed

Swaney, Danielle L; Wenger, Craig D; Thomson, James A; Coon, Joshua J

2009-01-27

Protein phosphorylation is central to the understanding of cellular signaling, and cellular signaling is suggested to play a major role in the regulation of human embryonic stem (ES) cell pluripotency. Here, we describe the use of conventional tandem mass spectrometry-based sequencing technology--collision-activated dissociation (CAD)--and the more recently developed method electron transfer dissociation (ETD) to characterize the human ES cell phosphoproteome. In total, these experiments resulted in the identification of 11,995 unique phosphopeptides, corresponding to 10,844 nonredundant phosphorylation sites, at a 1% false discovery rate (FDR). Among these phosphorylation sites are 5 localized to 2 pluripotency critical transcription factors--OCT4 and SOX2. From these experiments, we conclude that ETD identifies a larger number of unique phosphopeptides than CAD (8,087 to 3,868), more frequently localizes the phosphorylation site to a specific residue (49.8% compared with 29.6%), and sequences whole classes of phosphopeptides previously unobserved.

Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions

NASA Astrophysics Data System (ADS)

Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

2016-11-01

Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

Identification of a novel phosphorylation site in c-jun directly targeted in vitro by protein kinase D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waldron, Richard T.; Whitelegge, Julian P.; Faull, Kym F.

Protein kinase D (PKD) phosphorylates the c-jun amino-terminal in vitro at site(s) distinct from JNK [C. Hurd, R.T. Waldron, E. Rozengurt, Protein kinase D complexes with c-jun N-terminal kinase via activation loop phosphorylation and phosphorylates the c-jun N-terminus, Oncogene 21 (2002) 2154-2160], but the sites have not been identified. Here, metabolic {sup 32}P-labeling of c-jun protein in COS-7 cells indicated that PKD phosphorylates c-jun in vivo at a site(s) between aa 43-93, a region containing important functional elements. On this basis, the PKD-mediated phosphorylation site(s) was further characterized in vitro using GST-c-jun fusion proteins. PKD did not incorporate phosphate intomore » Ser63 and Ser73, the JNK sites in GST-c-jun(1-89). Rather, PKD and JNK could sequentially phosphorylate distinct site(s) simultaneously. By mass spectrometry of tryptic phosphopeptides, Ser58 interposed between the JNK-binding portion of the delta domain and the adjacent TAD1 was identified as a prominent site phosphorylated in vitro by PKD. These data were further supported by kinase reactions using truncations or point-mutations of GST-c-jun. Together, these data suggest that PKD-mediated phosphorylation modulates c-jun at the level of its N-terminal functional domains.« less

77 FR 5489 - Identification of Human Cell Lines Project

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-03

...-01] Identification of Human Cell Lines Project AGENCY: National Institute of Standards and Technology... cell line samples as part of the Identification of Human Cell Lines Project. All data and corresponding... cell lines accepted on the NIST Applied Genetics Group Web site at http://www.nist.gov/mml/biochemical...

Identification of novel inhibitors of human Chk1 using pharmacophore-based virtual screening and their evaluation as potential anti-cancer agents

NASA Astrophysics Data System (ADS)

Kumar, Vikash; Khan, Saman; Gupta, Priyanka; Rastogi, Namrata; Mishra, Durga Prasad; Ahmed, Shakil; Siddiqi, Mohammad Imran

2014-12-01

Kinases are one of the major players in cancer development and progression. Serine threonine kinases such as human checkpoint kinase-1 (Chk1), Mek1 and cyclin-dependent kinases have been identified as promising targets for cancer treatment. Chk1 is an important kinase with vital role in cell cycle arrest and many potent inhibitors targeted to Chk1 have been reported and few are currently in clinical trials. Considering the emerging importance of Chk1 inhibitors in cancer treatment there is a need to widen the chemical space of Chk1 inhibitors. In this study, we are reporting an integrated in silico approach to identify novel competitive Chk1 inhibitors. A 4-features pharmacophore model was derived from a co-crystallized structure of known potent Chk1 inhibitor and subjected to screen Maybridge compound library. Hits obtained from the screening were docked into the Chk1 active site and filtered on the basis of docking score and the number of pharmacophoric features showing conserved interaction within the active site of Chk1. Further, five compounds from the top ranking hits were subjected to in vitro evaluation as Chk1 inhibitor. After the kinase assay, four compounds were found to be active against human Chk1 (IC50 range from 4.2 to 12.5 µM). Subsequent study using the cdc25-22 mutant yeast cells revealed that one of compound (SPB07479; IC50 = 4.24 µM) promoted the formation of multinucleated cells, therefore overriding the cell cycle checkpoint. Validation studies using normal and human cancer cell lines, indicated that SPB07479 significantly inhibited proliferation of cervical cancer cells as a single agent and chemosensitized glioma and pancreatic cancer cell lines to standard chemotherapy while sparing normal cells. Additionally SPB07479 did not show significant cytotoxicity in normal cells. In conclusion we report that SPB07479 appear promising for further development of Chk1 inhibitors. This study also highlights the role of conserved water molecules in the active site of Chk1 for the successful identification of novel inhibitors.

Apigenin Restricts FMDV Infection and Inhibits Viral IRES Driven Translational Activity

PubMed Central

Qian, Suhong; Fan, Wenchun; Qian, Ping; Zhang, Dong; Wei, Yurong; Chen, Huanchun; Li, Xiangmin

2015-01-01

Foot-and-mouth disease (FMD) is a highly contagious disease of domestic and wild ruminants that is caused by FMD virus (FMDV). FMD outbreaks have occurred in livestock-containing regions worldwide. Apigenin, which is a flavonoid naturally existing in plant, possesses various pharmacological effects, including anti-inflammatory, anticancer, antioxidant and antiviral activities. Results show that apigenin can inhibit FMDV-mediated cytopathogenic effect and FMDV replication in vitro. Further studies demonstrate the following: (i) apigenin inhibits FMDV infection at the viral post-entry stage; (ii) apigenin does not exhibit direct extracellular virucidal activity; and (iii) apigenin interferes with the translational activity of FMDV driven by internal ribosome entry site. Studies on applying apigein in vivo are required for drug development and further identification of potential drug targets against FDMV infection. PMID:25835532

Apigenin restricts FMDV infection and inhibits viral IRES driven translational activity.

PubMed

Qian, Suhong; Fan, Wenchun; Qian, Ping; Zhang, Dong; Wei, Yurong; Chen, Huanchun; Li, Xiangmin

2015-03-31

Foot-and-mouth disease (FMD) is a highly contagious disease of domestic and wild ruminants that is caused by FMD virus (FMDV). FMD outbreaks have occurred in livestock-containing regions worldwide. Apigenin, which is a flavonoid naturally existing in plant, possesses various pharmacological effects, including anti-inflammatory, anticancer, antioxidant and antiviral activities. Results show that apigenin can inhibit FMDV-mediated cytopathogenic effect and FMDV replication in vitro. Further studies demonstrate the following: (i) apigenin inhibits FMDV infection at the viral post-entry stage; (ii) apigenin does not exhibit direct extracellular virucidal activity; and (iii) apigenin interferes with the translational activity of FMDV driven by internal ribosome entry site. Studies on applying apigein in vivo are required for drug development and further identification of potential drug targets against FDMV infection.

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

Closure report for Corrective Action Unit 211, Area 15 EPA Farm waste sites, Nevada Test Site, Nevada

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1998-04-01

This Closure Report summarizes the corrective actions which were completed at the Corrective Action Sites within Corrective Action Unit 211 Area 15 Farm Waste Sties at the Nevada Test Site. Current site descriptions, observations and identification of wastes removed are included on FFACO Corrective Action Site housekeeping closure verification forms.

Why and how might genetic and phylogenetic diversity be reflected in the identification of key biodiversity areas?

PubMed

Brooks, T M; Cuttelod, A; Faith, D P; Garcia-Moreno, J; Langhammer, P; Pérez-Espona, S

2015-02-19

'Key biodiversity areas' are defined as sites contributing significantly to the global persistence of biodiversity. The identification of these sites builds from existing approaches based on measures of species and ecosystem diversity and process. Here, we therefore build from the work of Sgró et al. (2011 Evol. Appl. 4, 326-337. (doi:10.1111/j.1752-4571.2010.00157.x)) to extend a framework for how components of genetic diversity might be considered in the identification of key biodiversity areas. We make three recommendations to inform the ongoing process of consolidating a key biodiversity areas standard: (i) thresholds for the threatened species criterion currently consider a site's share of a threatened species' population; expand these to include the proportion of the species' genetic diversity unique to a site; (ii) expand criterion for 'threatened species' to consider 'threatened taxa' and (iii) expand the centre of endemism criterion to identify as key biodiversity areas those sites holding a threshold proportion of the compositional or phylogenetic diversity of species (within a taxonomic group) whose restricted ranges collectively define a centre of endemism. We also recommend consideration of occurrence of EDGE species (i.e. threatened phylogenetic diversity) in key biodiversity areas to prioritize species-specific conservation actions among sites.

Why and how might genetic and phylogenetic diversity be reflected in the identification of key biodiversity areas?

PubMed Central

Brooks, T. M.; Cuttelod, A.; Faith, D. P.; Garcia-Moreno, J.; Langhammer, P.; Pérez-Espona, S.

2015-01-01

‘Key biodiversity areas' are defined as sites contributing significantly to the global persistence of biodiversity. The identification of these sites builds from existing approaches based on measures of species and ecosystem diversity and process. Here, we therefore build from the work of Sgró et al. (2011 Evol. Appl. 4, 326–337. (doi:10.1111/j.1752-4571.2010.00157.x)) to extend a framework for how components of genetic diversity might be considered in the identification of key biodiversity areas. We make three recommendations to inform the ongoing process of consolidating a key biodiversity areas standard: (i) thresholds for the threatened species criterion currently consider a site's share of a threatened species' population; expand these to include the proportion of the species' genetic diversity unique to a site; (ii) expand criterion for ‘threatened species' to consider ‘threatened taxa’ and (iii) expand the centre of endemism criterion to identify as key biodiversity areas those sites holding a threshold proportion of the compositional or phylogenetic diversity of species (within a taxonomic group) whose restricted ranges collectively define a centre of endemism. We also recommend consideration of occurrence of EDGE species (i.e. threatened phylogenetic diversity) in key biodiversity areas to prioritize species-specific conservation actions among sites. PMID:25561678

Identification of Multiple Phosphorylation Sites on Maize Endosperm Starch Branching Enzyme IIb, a Key Enzyme in Amylopectin Biosynthesis

PubMed Central

Makhmoudova, Amina; Williams, Declan; Brewer, Dyanne; Massey, Sarah; Patterson, Jenelle; Silva, Anjali; Vassall, Kenrick A.; Liu, Fushan; Subedi, Sanjeena; Harauz, George; Siu, K. W. Michael; Tetlow, Ian J.; Emes, Michael J.

2014-01-01

Starch branching enzyme IIb (SBEIIb) plays a crucial role in amylopectin biosynthesis in maize endosperm by defining the structural and functional properties of storage starch and is regulated by protein phosphorylation. Native and recombinant maize SBEIIb were used as substrates for amyloplast protein kinases to identify phosphorylation sites on the protein. A multidisciplinary approach involving bioinformatics, site-directed mutagenesis, and mass spectrometry identified three phosphorylation sites at Ser residues: Ser649, Ser286, and Ser297. Two Ca2+-dependent protein kinase activities were partially purified from amyloplasts, termed K1, responsible for Ser649 and Ser286 phosphorylation, and K2, responsible for Ser649 and Ser297 phosphorylation. The Ser286 and Ser297 phosphorylation sites are conserved in all plant branching enzymes and are located at opposite openings of the 8-stranded parallel β-barrel of the active site, which is involved with substrate binding and catalysis. Molecular dynamics simulation analysis indicates that phospho-Ser297 forms a stable salt bridge with Arg665, part of a conserved Cys-containing domain in plant branching enzymes. Ser649 conservation appears confined to the enzyme in cereals and is not universal, and is presumably associated with functions specific to seed storage. The implications of SBEIIb phosphorylation are considered in terms of the role of the enzyme and the importance of starch biosynthesis for yield and biotechnological application. PMID:24550386

KIRMES: kernel-based identification of regulatory modules in euchromatic sequences.

PubMed

Schultheiss, Sebastian J; Busch, Wolfgang; Lohmann, Jan U; Kohlbacher, Oliver; Rätsch, Gunnar

2009-08-15

Understanding transcriptional regulation is one of the main challenges in computational biology. An important problem is the identification of transcription factor (TF) binding sites in promoter regions of potential TF target genes. It is typically approached by position weight matrix-based motif identification algorithms using Gibbs sampling, or heuristics to extend seed oligos. Such algorithms succeed in identifying single, relatively well-conserved binding sites, but tend to fail when it comes to the identification of combinations of several degenerate binding sites, as those often found in cis-regulatory modules. We propose a new algorithm that combines the benefits of existing motif finding with the ones of support vector machines (SVMs) to find degenerate motifs in order to improve the modeling of regulatory modules. In experiments on microarray data from Arabidopsis thaliana, we were able to show that the newly developed strategy significantly improves the recognition of TF targets. The python source code (open source-licensed under GPL), the data for the experiments and a Galaxy-based web service are available at http://www.fml.mpg.de/raetsch/suppl/kirmes/.

Improving the healthcare response to domestic violence and abuse in sexual health clinics: feasibility study of a training, support and referral intervention.

PubMed

Sohal, Alex Hardip; Pathak, Neha; Blake, Sarah; Apea, Vanessa; Berry, Judith; Bailey, Jayne; Griffiths, Chris; Feder, Gene

2018-03-01

Sexual health and gynaecological problems are the most consistent and largest physical health differences between abused and non-abused female populations. Sexual health services are well placed to identify and support patients experiencing domestic violence and abuse (DVA). Most sexual health professionals have had minimal DVA training despite English National Institute for Health and Care Excellence recommendations. We sought to determine the feasibility of an evidence-based complex DVA training intervention in female sexual health walk-in services (IRIS ADViSE: Identification and Referral to Improve Safety whilst Assessing Domestic Violence in Sexual Health Environments). An adaptive mixed method pilot study in the female walk-in service of two sexual health clinics. Following implementation and evaluation at site 1, the intervention was refined before implementation at site 2. The intervention comprised electronic prompts, multidisciplinary training sessions, clinic materials and simple referral pathways to IRIS ADViSE advocate-educators (AEs). The pilot lasted 7 weeks at site 1 and 12 weeks at site 2. Feasibility outcomes were to assign a supportive DVA clinical lead, an IRIS ADViSE AE employed by a local DVA service provider, adapt electronic records, develop local referral pathways, assess whether enquiry, identification and referral rates were measurable. Both sites achieved all feasibility outcomes: appointing a supportive DVA clinical lead and IRIS ADViSE AE, establishing links with a local DVA provider, adapting electronic records, developing local referral pathways and rates of enquiry, identification and referral were found to be measurable. Site 1: 10% enquiry rate (n=267), 4% identification rate (n=16) and eight AE referrals. Site 2: 61% enquiry rate (n=1090), a 7% identification rate (n=79) and eight AE referrals. IRIS ADViSE can be successfully developed and implemented in sexual health clinics. It fulfils the unmet need for DVA training. Longer-term evaluation is recommended. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

State geothermal commercialization programs in seven Rocky Mountain states. Semiannual progress report, July-December 1980

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lunis, B. C.; Toth, W. J.

The activities and findings of the seven state commercialization teams participating in the Rocky Mountain Basin and Range commercialization program are described. Background information is provided; program objectives and the technical approach that is used are discussed; and the benefits of the program are described. The summary of findings is presented. Prospect identification, area development plans, site specific development analyses, time-phased project plans, the aggregated prospective geothermal energy use, and institutional analyses are discussed. Public outreach activities are covered and findings and recommendations are summarized. The commercialization activities carried out by the respective state teams are described for the following:more » Colorado, Montana, New Mexico, North Dakota, South Dakota, Utah, and Wyoming.« less

Concealed Accessory Pathways with a Single Ventricular and Two Discrete Atrial Insertion Sites.

PubMed

Kipp, Ryan T; Abu Sham'a, Raed; Hiroyuki, Ito; Han, Frederick T; Refaat, Marwan; Hsu, Jonathan C; Field, Michael E; Kopp, Douglas E; Marcus, Gregory M; Scheinman, Melvin M; Hoffmayer, Kurt S

2017-03-01

Atrioventricular reciprocating tachycardia (AVRT) utilizing a concealed accessory pathway is common. It is well appreciated that some patients may have multiple accessory pathways with separate atrial and ventricular insertion sites. We present three cases of AVRT utilizing concealed pathways with evidence that each utilizing a single ventricular insertion and two discrete atrial insertion sites. In case one, two discrete atrial insertion sites were mapped in two separate procedures, and only during the second ablation was the Kent potential identified. Ablation of the Kent potential at this site remote from the two atrial insertion sites resulted in the termination of the retrograde conduction in both pathways. Case two presented with supraventricular tachycardia (SVT) with alternating eccentric atrial activation patterns without alteration in the tachycardia cycle length. The two distinct atrial insertion sites during orthodromic AVRT and ventricular pacing were targeted and each of the two atrial insertion sites were successfully mapped and ablated. In case three, retrograde decremental conduction utilizing both atrial insertion sites was identified prior to ablation. After mapping and ablation of the first discrete atrial insertion site, tachycardia persisted utilizing the second atrial insertion site. Only after ablation of the second atrial insertion site was SVT noninducible, and VA conduction was no longer present. Concealed retrograde accessory pathways with discrete atrial insertion sites may have a common ventricular insertion site. Identification and ablation of the ventricular insertion site or the separate discrete atrial insertion sites result in successful treatment. © 2017 Wiley Periodicals, Inc.

In silico identification of a therapeutic target for photo-activated disinfection with indocyanine green: Modeling and virtual screening analysis of Arg-gingipain from Porphyromonas gingivalis.

PubMed

Pourhajibagher, Maryam; Bahador, Abbas

2017-06-01

Porphyromonas gingivalis is a momentous bacterial etiological agent associated with periodontitis, peri-implantitis as well as endodontic infections. The potential advantage of Photo-activated disinfection (PAD) as a promising novel approach is the choice of a suitable target site, specific photosensitizer, and wavelength of light for delivery of the light from source to target. Since Arg-gingipain is a cysteine proteinase that is involved in the virulence of P. gingivalis, it was evaluated as a target site for PAD with indocyanine green (ICG) as a photosensitizer. In this study, we used a range of in silico strategies, bioinformatics tools, biological databases, and computer simulation molecular modeling to evaluate the capacity of Arg-gingipain. The predicted structure of Arg-gingipain indicated that it is located outside the cell and has nine domains and 17 ligands, including two calcium ions and three sodium ions with positive charges which can be a site of interaction for anionic ICG. Based on the results of this study, anionic ICG desires to bind and interact with residues of Arg-gingipain during PAD as a main site to enhance the yield of treatment of endo-periodontal lesions. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of Ser-543 as the major regulatory phosphorylation site in spinach leaf nitrate reductase

NASA Technical Reports Server (NTRS)

Bachmann, M.; Shiraishi, N.; Campbell, W. H.; Yoo, B. C.; Harmon, A. C.; Huber, S. C.; Davies, E. (Principal Investigator)

1996-01-01

Spinach leaf NADH:nitrate reductase (NR) responds to light/dark signals and photosynthetic activity in part as a result of rapid regulation by reversible protein phosphorylation. We have identified the major regulatory phosphorylation site as Ser-543, which is located in the hinge 1 region connecting the cytochrome b domain with the molybdenum-pterin cofactor binding domain of NR, using recombinant NR fragments containing or lacking the phosphorylation site sequence. Studies with NR partial reactions indicated that the block in electron flow caused by phosphorylation also could be localized to the hinge 1 region. A synthetic peptide (NR6) based on the phosphorylation site sequence was phosphorylated readily by NR kinase (NRk) in vitro. NR6 kinase activity tracked the ATP-dependent inactivation of NR during several chromatographic steps and completely inhibited inactivation/phosphorylation of native NR in vitro. Two forms of NRk were resolved by using anion exchange chromatography. Studies with synthetic peptide analogs indicated that both forms of NRk had similar specificity determinants, requiring a basic residue at P-3 (i.e., three amino acids N-terminal to the phosphorylated serine) and a hydrophobic residue at P-5. Both forms are strictly calcium dependent but belong to distinct families of protein kinases because they are distinct immunochemically.

Identification of functional residues essential for dehalogenation by the non-stereospecific α-haloalkanoic acid dehalogenase from Rhizobium sp. RC1.

PubMed

Hamid, Azzmer Azzar Abdul; Hamid, Tengku Haziyamin Tengku Abdul; Wahab, Roswanira Abdul; Huyop, Fahrul

2015-03-01

The non-stereospecific α-haloalkanoic acid dehalogenase DehE from Rhizobium sp. RC1 catalyzes the removal of the halide from α-haloalkanoic acid D,L-stereoisomers and, by doing so, converts them into hydroxyalkanoic acid L,D-stereoisomers, respectively. DehE has been extensively studied to determine its potential to act as a bioremediation agent, but its structure/function relationship has not been characterized. For this study, we explored the functional relevance of several putative active-site amino acids by site-specific mutagenesis. Ten active-site residues were mutated individually, and the dehalogenase activity of each of the 10 resulting mutants in soluble cell lysates against D- and L-2-chloropropionic acid was assessed. Interestingly, the mutants W34→A,F37→A, and S188→A had diminished activity, suggesting that these residues are functionally relevant. Notably, the D189→N mutant had no activity, which strongly implies that it is a catalytically important residue. Given our data, we propose a dehalogenation mechanism for DehE, which is the same as that suggested for other non-stereospecific α-haloalkanoic acid dehalogenases. To the best of our knowledge, this is the first report detailing a functional aspect for DehE, and our results could help pave the way for the bioengineering of haloalkanoic acid dehalogenases with improved catalytic properties. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

PROTEIN ADDUCTS AS BIOMAKERS OF EXPOSURE TO ORGANOPHOSPHORUS COMPOUNDS

PubMed Central

Marsillach, Judit; Costa, Lucio G.; Furlong, Clement E.

2013-01-01

Exposure to organophosphorus (OP) compounds can lead to serious neurological damage or death. Following bioactivation by the liver cytochromes P450, the OP metabolites produced are potent inhibitors of serine active-site enzymes including esterases, proteases and lipases. OPs may form adducts on other cellular proteins. Blood cholinesterases (ChEs) have long served as biomarkers of OP exposure in humans. However, the enzymatic assays used for biomonitoring OP exposures have several drawbacks. A more useful approach will focus on multiple biomarkers and avoid problems with the enzymatic activity assays. OP inhibitory effects result from a covalent bond with the active-site serine of the target enzymes. The serine OP adducts become irreversible following a process referred to as aging where one alkyl group dissociates over variable lengths of time depending on the OP adduct. The OP-adducted enzyme then remains in circulation until it is degraded, allowing for a longer window of detection compared with direct analysis of OPs or their metabolites. Mass spectrometry (MS) provides a very sensitive method for identification of post-translational protein modifications. MS analyses of the percentage adduction of the active-site serine of biomarker proteins such as ChEs will eliminate the need for basal activity levels of the individual and will provide for a more accurate determination of OP exposure. MS analysis of biomarker proteins also provides information about the OP that has caused inhibition. Other useful biomarker proteins include other serine hydrolases, albumin, tubulin and transferrin. PMID:23261756

Identification of essential active-site residues in the cyanogenic beta-glucosidase (linamarase) from cassava (Manihot esculenta Crantz) by site-directed mutagenesis.

PubMed Central

Keresztessy, Z; Brown, K; Dunn, M A; Hughes, M A

2001-01-01

The coding sequence of the mature cyanogenic beta-glucosidase (beta-glucoside glucohydrolase, EC 3.2.1.21; linamarase) was cloned into the vector pYX243 modified to contain the SUC2 yeast secretion signal sequence and expressed in Saccharomyces cerevisiae. The recombinant enzyme is active, glycosylated and showed similar stability to the plant protein. Michaelis constants for hydrolysis of the natural substrate, linamarin (K(m)=1.06 mM) and the synthetic p-nitrophenyl beta-D-glucopyranoside (PNP-Glc; K(m)=0.36 mM), as well as apparent pK(a) values of the free enzyme and the enzyme-substrate complexes (pK(E)(1)=4.4-4.8, pK(E)(2)=6.7-7.2, pK(ES)(1)=3.9-4.4, pK(ES)(2)=8.3) were very similar to those of the plant enzyme. Site-directed mutagenesis was carried out to study the function of active-site residues based on a homology model generated for the enzyme using the MODELLER program. Changing Glu-413 to Gly destroyed enzyme activity, consistent with it being the catalytic nucleophile. The Gln-339Glu mutation also abolished activity, confirming a function in positioning the catalytic diad. The Ala-201Val mutation shifted the pK(a) of the acid/base catalyst Glu-198 from 7.22 to 7.44, reflecting a change in its hydrophobic environment. A Phe-269Asn change increased K(m) for linamarin hydrolysis 16-fold (16.1 mM) and that for PNP-Glc only 2.5-fold (0.84 mM), demonstrating that Phe-269 contributes to the cyanogenic specificity of the cassava beta-glucosidase. PMID:11139381

oPOSSUM: identification of over-represented transcription factor binding sites in co-expressed genes

PubMed Central

Ho Sui, Shannan J.; Mortimer, James R.; Arenillas, David J.; Brumm, Jochen; Walsh, Christopher J.; Kennedy, Brian P.; Wasserman, Wyeth W.

2005-01-01

Targeted transcript profiling studies can identify sets of co-expressed genes; however, identification of the underlying functional mechanism(s) is a significant challenge. Established methods for the analysis of gene annotations, particularly those based on the Gene Ontology, can identify functional linkages between genes. Similar methods for the identification of over-represented transcription factor binding sites (TFBSs) have been successful in yeast, but extension to human genomics has largely proved ineffective. Creation of a system for the efficient identification of common regulatory mechanisms in a subset of co-expressed human genes promises to break a roadblock in functional genomics research. We have developed an integrated system that searches for evidence of co-regulation by one or more transcription factors (TFs). oPOSSUM combines a pre-computed database of conserved TFBSs in human and mouse promoters with statistical methods for identification of sites over-represented in a set of co-expressed genes. The algorithm successfully identified mediating TFs in control sets of tissue-specific genes and in sets of co-expressed genes from three transcript profiling studies. Simulation studies indicate that oPOSSUM produces few false positives using empirically defined thresholds and can tolerate up to 50% noise in a set of co-expressed genes. PMID:15933209

Approaches to systematic assessment of environmental exposures posed at hazardous waste sites in the developing world: the Toxic Sites Identification Program.

PubMed

Ericson, Bret; Caravanos, Jack; Chatham-Stephens, Kevin; Landrigan, Philip; Fuller, Richard

2013-02-01

In the developing world, environmental chemical exposures due to hazardous waste sites are poorly documented. We describe the approach taken by the Blacksmith Institute's Toxic Sites Identification Program in documenting environmental chemical exposures due to hazardous waste sites globally, identifying sites of concern and quantifying pathways, populations, and severity of exposure. A network of local environmental investigators was identified and trained to conduct hazardous waste site investigations and assessments. To date, 2,095 contaminated sites have been identified within 47 countries having an estimated population at risk of 71,500,000. Trained researchers and investigators have visited 1,400 of those sites. Heavy metals are the leading primary exposures, with water supply and ambient air being the primary routes of exposure. Even though chemical production has occurred largely in the developed world to date, many hazardous waste sites in the developing world pose significant hazards to the health of large portions of the population. Further research is needed to quantify potential health and economic consequences and identify cost-effective approaches to remediation.

Identification of an inducible regulator of c-myb expression during T-cell activation.

PubMed Central

Phan, S C; Feeley, B; Withers, D; Boxer, L M

1996-01-01

Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306

Identification of Tyrosine 972 as a Novel Site of Jak2 Tyrosine Kinase Phosphorylation and its Role in Jak2 Activation

PubMed Central

McDoom, Issam; Ma, Xianyue; Kirabo, Annet; Lee, Kuang-Yung; Ostrov, David A.; Sayeski, Peter P.

2013-01-01

Jak2 is a 130 kDa tyrosine kinase that is important in a number of cellular signaling pathways. Its function is intrinsically regulated by the phosphorylation of a handful of its 49 tyrosines. Here, we report that tyrosine 972 (Y972) is a novel site of Jak2 phosphorylation, and hence auto-regulation. Specifically, we found that Y972 is phosphorylated and confirmed that this residue resides on the surface of the protein. Using expression plasmids that expressed either wild type Jak2 or a full length Jak2 cDNA containing a single Y972F substitution mutation, we investigated the consequences of losing Y972 phosphorylation on Jak2 function. We determined that the loss of Y972 phosphorylation significantly reduced both Jak2 total tyrosine phosphorylation and phosphorylation of Y1007/Y1008. Additionally, Y972 phosphorylation was shown to be important for maximal kinase function. Interestingly, in response to classical cytokine activation, the Jak2-Y972F mutant exhibited a moderately impaired level of activation when compared to wild type protein. However, when Jak2 was activated via a GPCR ligand, the ability of the Y972F mutant to activate was completely lost, therefore suggesting a differential role of Y972 in Jak2 activation. Finally, we found that phosphorylation of Y972 enhances Jak2 kinase function via a mechanism that appears to stabilize the active conformation of the protein. Collectively, our results suggest that Y972 is a novel site of Jak2 phosphorylation and plays an important differential role in ligand-dependent Jak2 activation via a mechanism that involves stabilization of the Jak2 active conformation. PMID:18636744

Sent packing: protein engineering generates a new crystal form of Pseudomonas aeruginosa DsbA1 with increased catalytic surface accessibility

DOE Office of Scientific and Technical Information (OSTI.GOV)

McMahon, Roisin M., E-mail: r.mcmahon1@uq.edu.au; Coinçon, Mathieu; Tay, Stephanie

The crystal structure of a P. aeruginosa DsbA1 variant is more suitable for fragment-based lead discovery efforts to identify inhibitors of this antimicrobial drug target. In the reported structures the active site of the protein can simultaneously bind multiple ligands introduced in the crystallization solution or via soaking. Pseudomonas aeruginosa is an opportunistic human pathogen for which new antimicrobial drug options are urgently sought. P. aeruginosa disulfide-bond protein A1 (PaDsbA1) plays a pivotal role in catalyzing the oxidative folding of multiple virulence proteins and as such holds great promise as a drug target. As part of a fragment-based lead discoverymore » approach to PaDsbA1 inhibitor development, the identification of a crystal form of PaDsbA1 that was more suitable for fragment-soaking experiments was sought. A previously identified crystallization condition for this protein was unsuitable, as in this crystal form of PaDsbA1 the active-site surface loops are engaged in the crystal packing, occluding access to the target site. A single residue involved in crystal-packing interactions was substituted with an amino acid commonly found at this position in closely related enzymes, and this variant was successfully used to generate a new crystal form of PaDsbA1 in which the active-site surface is more accessible for soaking experiments. The PaDsbA1 variant displays identical redox character and in vitro activity to wild-type PaDsbA1 and is structurally highly similar. Two crystal structures of the PaDsbA1 variant were determined in complex with small molecules bound to the protein active site. These small molecules (MES, glycerol and ethylene glycol) were derived from the crystallization or cryoprotectant solutions and provide a proof of principle that the reported crystal form will be amenable to co-crystallization and soaking with small molecules designed to target the protein active-site surface.« less

Identification of pH-sensing Sites in the Light Harvesting Complex Stress-related 3 Protein Essential for Triggering Non-photochemical Quenching in Chlamydomonas reinhardtii

DOE PAGES

Ballottari, Matteo; Truong, Thuy B.; De Re, Eleonora; ...

2016-01-27

Light harvesting complex stress-related 3 (LHCSR3) is the protein essential for photoprotective excess energy dissipation (non-photochemical quenching, NPQ) in the model green alga Chlamydomonas reinhardtii. Activation of NPQ requires low pH in the thylakoid lumen, which is induced in excess light conditions and sensed by lumen-exposed acidic residues. In this work we have used site-specific mutagenesis in vivo and in vitro for identification of the residues in LHCSR3 that are responsible for sensing lumen pH. Lumen-exposed protonatable residues, aspartate and glutamate, were mutated to asparagine and glutamine, respectively. By expression in a mutant lacking all LHCSR isoforms, residues Asp 117,more » Glu 221, and Glu 224 were shown to be essential for LHCSR3-dependent NPQ induction in C. reinhardtii. Analysis of recombinant proteins carrying the same mutations refolded in vitro with pigments showed that the capacity of responding to low pH by decreasing the fluorescence lifetime, present in the wild-type protein, was lost. Consistent with a role in pH sensing, the mutations led to a substantial reduction in binding the NPQ inhibitor dicyclohexylcarbodiimide.« less

Genome-Wide Cell Type-Specific Mapping of In Vivo Chromatin Protein Binding Using an FLP-Inducible DamID System in Drosophila.

PubMed

Pindyurin, Alexey V

2017-01-01

A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.

Identification of pH-sensing Sites in the Light Harvesting Complex Stress-related 3 Protein Essential for Triggering Non-photochemical Quenching in Chlamydomonas reinhardtii

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ballottari, Matteo; Truong, Thuy B.; De Re, Eleonora

Light harvesting complex stress-related 3 (LHCSR3) is the protein essential for photoprotective excess energy dissipation (non-photochemical quenching, NPQ) in the model green alga Chlamydomonas reinhardtii. Activation of NPQ requires low pH in the thylakoid lumen, which is induced in excess light conditions and sensed by lumen-exposed acidic residues. In this work we have used site-specific mutagenesis in vivo and in vitro for identification of the residues in LHCSR3 that are responsible for sensing lumen pH. Lumen-exposed protonatable residues, aspartate and glutamate, were mutated to asparagine and glutamine, respectively. By expression in a mutant lacking all LHCSR isoforms, residues Asp 117,more » Glu 221, and Glu 224 were shown to be essential for LHCSR3-dependent NPQ induction in C. reinhardtii. Analysis of recombinant proteins carrying the same mutations refolded in vitro with pigments showed that the capacity of responding to low pH by decreasing the fluorescence lifetime, present in the wild-type protein, was lost. Consistent with a role in pH sensing, the mutations led to a substantial reduction in binding the NPQ inhibitor dicyclohexylcarbodiimide.« less

Identification of pH-sensing Sites in the Light Harvesting Complex Stress-related 3 Protein Essential for Triggering Non-photochemical Quenching in Chlamydomonas reinhardtii.

PubMed

Ballottari, Matteo; Truong, Thuy B; De Re, Eleonora; Erickson, Erika; Stella, Giulio R; Fleming, Graham R; Bassi, Roberto; Niyogi, Krishna K

2016-04-01

Light harvesting complex stress-related 3 (LHCSR3) is the protein essential for photoprotective excess energy dissipation (non-photochemical quenching, NPQ) in the model green algaChlamydomonas reinhardtii Activation of NPQ requires low pH in the thylakoid lumen, which is induced in excess light conditions and sensed by lumen-exposed acidic residues. In this work we have used site-specific mutagenesisin vivoandin vitrofor identification of the residues in LHCSR3 that are responsible for sensing lumen pH. Lumen-exposed protonatable residues, aspartate and glutamate, were mutated to asparagine and glutamine, respectively. By expression in a mutant lacking all LHCSR isoforms, residues Asp(117), Glu(221), and Glu(224)were shown to be essential for LHCSR3-dependent NPQ induction inC. reinhardtii Analysis of recombinant proteins carrying the same mutations refoldedin vitrowith pigments showed that the capacity of responding to low pH by decreasing the fluorescence lifetime, present in the wild-type protein, was lost. Consistent with a role in pH sensing, the mutations led to a substantial reduction in binding the NPQ inhibitor dicyclohexylcarbodiimide. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of potential glutaminyl cyclase inhibitors from lead-like libraries by in silico and in vitro fragment-based screening.

PubMed

Szaszkó, Mária; Hajdú, István; Flachner, Beáta; Dobi, Krisztina; Magyar, Csaba; Simon, István; Lőrincz, Zsolt; Kapui, Zoltán; Pázmány, Tamás; Cseh, Sándor; Dormán, György

2017-02-01

A glutaminyl cyclase (QC) fragment library was in silico selected by disconnection of the structure of known QC inhibitors and by lead-like 2D virtual screening of the same set. The resulting fragment library (204 compounds) was acquired from commercial suppliers and pre-screened by differential scanning fluorimetry followed by functional in vitro assays. In this way, 10 fragment hits were identified ([Formula: see text]5 % hit rate, best inhibitory activity: 16 [Formula: see text]). The in vitro hits were then docked to the active site of QC, and the best scoring compounds were analyzed for binding interactions. Two fragments bound to different regions in a complementary manner, and thus, linking those fragments offered a rational strategy to generate novel QC inhibitors. Based on the structure of the virtual linked fragment, a 77-membered QC target focused library was selected from vendor databases and docked to the active site of QC. A PubChem search confirmed that the best scoring analogues are novel, potential QC inhibitors.

Genomic Organization and Identification of Promoter Regions for the BDNF Gene in the Pond Turtle Trachemys scripta elegans

PubMed Central

Zheng, Zhaoqing; Keifer, Joyce

2014-01-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176

Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

PubMed

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

Harmane and harmalan are bioactive components of classical clonidine-displacing substance.

PubMed

Parker, Christine A; Anderson, Neil J; Robinson, Emma S J; Price, Rhiannon; Tyacke, Robin J; Husbands, Stephen M; Dillon, Michael P; Eglen, Richard M; Hudson, Alan L; Nutt, David J; Crump, Matthew P; Crosby, John

2004-12-28

Elucidation of the structure of the endogenous ligand(s) for imidazoline binding sites, clonidine-displacing substance (CDS), has been a major goal for many years. Crude CDS from bovine lung was purified by reverse-phase high-pressure liquid chromatography. Electrospray mass spectrometry (ESMS) and nuclear magnetic resonance ((1)H NMR) analysis revealed the presence of L-tryptophan and 1-carboxy-1-methyltetrahydro-beta-carboline in the active CDS extract. Competition radioligand binding studies, however, failed to show displacement of specific [(3)H]clonidine binding to rat brain membranes for either compound. Further purification of the bovine lung extract allowed the isolation of the beta-carbolines harmane and harmalan as confirmed by ESMS, (1)H NMR, and comparison with synthetic standards. Both compounds exhibited a high (nanomolar) affinity for both type 1 and type 2 imidazoline binding sites, and the synthetic standards were shown to coelute with the active classical CDS extracts. We therefore propose that the beta-carbolines harmane and harmalan represent active components of classical CDS. The identification of these compounds will allow us to establish clear physiological roles for CDS.

Design, synthesis and evaluation of photoactivatable derivatives of microtubule (MT)-active [1,2,4]triazolo[1,5-a]pyrimidines.

PubMed

Oukoloff, Killian; Kovalevich, Jane; Cornec, Anne-Sophie; Yao, Yuemang; Owyang, Zachary A; James, Michael; Trojanowski, John Q; Lee, Virginia M-Y; Smith, Amos B; Brunden, Kurt R; Ballatore, Carlo

2018-05-05

The [1,2,4]triazolo[1,5-a]pyrimidines comprise a promising class of non-naturally occurring microtubule (MT)-active compounds. Prior studies revealed that different triazolopyrimidine substitutions can yield molecules that either promote MT stabilization or disrupt MT integrity. These differences can have important ramifications in the therapeutic applications of triazolopyrimidines and suggest that different analogues may exhibit different binding modes within the same site or possibly interact with tubulin/MTs at alternative binding sites. To help discern these possibilities, a series of photoactivatable triazolopyrimidine congeners was designed, synthesized and evaluated in cellular assays with the goal of identifying candidate probes for photoaffinity labeling experiments. These studies led to the identification of different derivatives that incorporate a diazirine ring in the amine substituent at position 7 of the triazolopyrimidine heterocycle, resulting in molecules that either promote stabilization of MTs or disrupt MT integrity. These photoactivatable candidate probes hold promise to investigate the mode of action of MT-active triazolopyrimidines. Copyright © 2018 Elsevier Ltd. All rights reserved.

Simultaneous structure-activity studies and arming of natural products by C-H amination reveal cellular targets of eupalmerin acetate.

PubMed

Li, Jing; Cisar, Justin S; Zhou, Cong-Ying; Vera, Brunilda; Williams, Howard; Rodríguez, Abimael D; Cravatt, Benjamin F; Romo, Daniel

2013-06-01

Natural products have a venerable history of, and enduring potential for the discovery of useful biological activity. To fully exploit this, the development of chemical methodology that can functionalize unique sites within these complex structures is highly desirable. Here, we describe the use of rhodium(II)-catalysed C-H amination reactions developed by Du Bois to carry out simultaneous structure-activity relationship studies and arming (alkynylation) of natural products at 'unfunctionalized' positions. Allylic and benzylic C-H bonds in the natural products undergo amination while olefins undergo aziridination, and tertiary amine-containing natural products are converted to amidines by a C-H amination-oxidation sequence or to hydrazine sulfamate zwitterions by an unusual N-amination. The alkynylated derivatives are ready for conversion into cellular probes that can be used for mechanism-of-action studies. Chemo- and site-selectivity was studied with a diverse library of natural products. For one of these-the marine-derived anticancer diterpene, eupalmerin acetate-quantitative proteome profiling led to the identification of several protein targets in HL-60 cells, suggesting a polypharmacological mode of action.

Characterization and Structural Studies of the Plasmodium falciparum Ubiquitin and Nedd8 Hydrolase UCHL3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Artavanis-Tsakonas, Katerina; Weihofen, Wilhelm A.; Antos, John M.

Like their human hosts, Plasmodium falciparum parasites rely on the ubiquitin-proteasome system for survival. We previously identified PfUCHL3, a deubiquitinating enzyme, and here we characterize its activity and changes in active site architecture upon binding to ubiquitin. We find strong evidence that PfUCHL3 is essential to parasite survival. The crystal structures of both PfUCHL3 alone and in complex with the ubiquitin-based suicide substrate UbVME suggest a rather rigid active site crossover loop that likely plays a role in restricting the size of ubiquitin adduct substrates. Molecular dynamics simulations of the structures and a model of the PfUCHL3-PfNedd8 complex allowed themore » identification of shared key interactions of ubiquitin and PfNedd8 with PfUCHL3, explaining the dual specificity of this enzyme. Distinct differences observed in ubiquitin binding between PfUCHL3 and its human counterpart make it likely that the parasitic DUB can be selectively targeted while leaving the human enzyme unaffected.« less

Simultaneous structure-activity studies and arming of natural products by C-H amination reveal cellular targets of eupalmerin acetate

NASA Astrophysics Data System (ADS)

Li, Jing; Cisar, Justin S.; Zhou, Cong-Ying; Vera, Brunilda; Williams, Howard; Rodríguez, Abimael D.; Cravatt, Benjamin F.; Romo, Daniel

2013-06-01

Natural products have a venerable history of, and enduring potential for the discovery of useful biological activity. To fully exploit this, the development of chemical methodology that can functionalize unique sites within these complex structures is highly desirable. Here, we describe the use of rhodium(II)-catalysed C-H amination reactions developed by Du Bois to carry out simultaneous structure-activity relationship studies and arming (alkynylation) of natural products at ‘unfunctionalized’ positions. Allylic and benzylic C-H bonds in the natural products undergo amination while olefins undergo aziridination, and tertiary amine-containing natural products are converted to amidines by a C-H amination-oxidation sequence or to hydrazine sulfamate zwitterions by an unusual N-amination. The alkynylated derivatives are ready for conversion into cellular probes that can be used for mechanism-of-action studies. Chemo- and site-selectivity was studied with a diverse library of natural products. For one of these—the marine-derived anticancer diterpene, eupalmerin acetate—quantitative proteome profiling led to the identification of several protein targets in HL-60 cells, suggesting a polypharmacological mode of action.

Engineering the "Missing Link" in Biosynthetic (-)-Menthol Production: Bacterial Isopulegone Isomerase.

PubMed

Currin, Andrew; Dunstan, Mark S; Johannissen, Linus O; Hollywood, Katherine A; Vinaixa, Maria; Jervis, Adrian J; Swainston, Neil; Rattray, Nicholas J W; Gardiner, John M; Kell, Douglas B; Takano, Eriko; Toogood, Helen S; Scrutton, Nigel S

2018-03-02

The realization of a synthetic biology approach to microbial (1 R ,2 S ,5 R )-( - )-menthol ( 1 ) production relies on the identification of a gene encoding an isopulegone isomerase (IPGI), the only enzyme in the Mentha piperita biosynthetic pathway as yet unidentified. We demonstrate that Δ5-3-ketosteroid isomerase (KSI) from Pseudomonas putida can act as an IPGI, producing ( R )-(+)-pulegone (( R )- 2 ) from (+)- cis -isopulegone ( 3 ). Using a robotics-driven semirational design strategy, we identified a key KSI variant encoding four active site mutations, which confer a 4.3-fold increase in activity over the wild-type enzyme. This was assisted by the generation of crystal structures of four KSI variants, combined with molecular modeling of 3 binding to identify key active site residue targets. The KSI variant was demonstrated to function efficiently within cascade biocatalytic reactions with downstream Mentha enzymes pulegone reductase and (-)-menthone:(-)-menthol reductase to generate 1 from 3 . This study introduces the use of a recombinant IPGI, engineered to function efficiently within a biosynthetic pathway for the production of 1 in microorganisms.

RCRA, Superfund and EPCRA hotline training module. Introduction to: Applicable or relevant and appropriate requirements (updated February 1998)

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1998-06-01

Topics addressed include the following: Regulatory Summary (Role and Definition of Applicable or Relevant and Appropriate Requirements); Types of ARARs; Extent of ARARs: On-Site vs. Off-Site Management; Remedial vs. Removal Actions; To-Be-Considered Guidelines and Other Controls; ARAR Identification (ARAR Identification Process); Federal ARARs: RCRA, CAA, CWA, SDWA, TSCA; State and Local ARARs and ARAR Waivers; and Module Summary.

Kinase Identification with Supervised Laplacian Regularized Least Squares

PubMed Central

Zhang, He; Wang, Minghui

2015-01-01

Phosphorylation is catalyzed by protein kinases and is irreplaceable in regulating biological processes. Identification of phosphorylation sites with their corresponding kinases contributes to the understanding of molecular mechanisms. Mass spectrometry analysis of phosphor-proteomes generates a large number of phosphorylated sites. However, experimental methods are costly and time-consuming, and most phosphorylation sites determined by experimental methods lack kinase information. Therefore, computational methods are urgently needed to address the kinase identification problem. To this end, we propose a new kernel-based machine learning method called Supervised Laplacian Regularized Least Squares (SLapRLS), which adopts a new method to construct kernels based on the similarity matrix and minimizes both structure risk and overall inconsistency between labels and similarities. The results predicted using both Phospho.ELM and an additional independent test dataset indicate that SLapRLS can more effectively identify kinases compared to other existing algorithms. PMID:26448296

Kinase Identification with Supervised Laplacian Regularized Least Squares.

PubMed

Li, Ao; Xu, Xiaoyi; Zhang, He; Wang, Minghui

2015-01-01

Phosphorylation is catalyzed by protein kinases and is irreplaceable in regulating biological processes. Identification of phosphorylation sites with their corresponding kinases contributes to the understanding of molecular mechanisms. Mass spectrometry analysis of phosphor-proteomes generates a large number of phosphorylated sites. However, experimental methods are costly and time-consuming, and most phosphorylation sites determined by experimental methods lack kinase information. Therefore, computational methods are urgently needed to address the kinase identification problem. To this end, we propose a new kernel-based machine learning method called Supervised Laplacian Regularized Least Squares (SLapRLS), which adopts a new method to construct kernels based on the similarity matrix and minimizes both structure risk and overall inconsistency between labels and similarities. The results predicted using both Phospho.ELM and an additional independent test dataset indicate that SLapRLS can more effectively identify kinases compared to other existing algorithms.

10 CFR 707.7 - Random drug testing requirements and identification of testing designated positions.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 4 2012-01-01 2012-01-01 false Random drug testing requirements and identification of... PROGRAMS AT DOE SITES Procedures § 707.7 Random drug testing requirements and identification of testing... evidence of the use of illegal drugs of employees in testing designated positions identified in this...

10 CFR 707.7 - Random drug testing requirements and identification of testing designated positions.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 4 2014-01-01 2014-01-01 false Random drug testing requirements and identification of... PROGRAMS AT DOE SITES Procedures § 707.7 Random drug testing requirements and identification of testing... evidence of the use of illegal drugs of employees in testing designated positions identified in this...

10 CFR 707.7 - Random drug testing requirements and identification of testing designated positions.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 4 2011-01-01 2011-01-01 false Random drug testing requirements and identification of... PROGRAMS AT DOE SITES Procedures § 707.7 Random drug testing requirements and identification of testing... evidence of the use of illegal drugs of employees in testing designated positions identified in this...

10 CFR 707.7 - Random drug testing requirements and identification of testing designated positions.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 4 2013-01-01 2013-01-01 false Random drug testing requirements and identification of... PROGRAMS AT DOE SITES Procedures § 707.7 Random drug testing requirements and identification of testing... evidence of the use of illegal drugs of employees in testing designated positions identified in this...

10 CFR 707.7 - Random drug testing requirements and identification of testing designated positions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Random drug testing requirements and identification of... PROGRAMS AT DOE SITES Procedures § 707.7 Random drug testing requirements and identification of testing... evidence of the use of illegal drugs of employees in testing designated positions identified in this...

Mapping the Substrate Binding Site of Phenylacetone Monooxygenase from Thermobifida fusca by Mutational Analysis▿†

PubMed Central

Dudek, Hanna M.; de Gonzalo, Gonzalo; Torres Pazmiño, Daniel E.; Stępniak, Piotr; Wyrwicz, Lucjan S.; Rychlewski, Leszek; Fraaije, Marco W.

2011-01-01

Baeyer-Villiger monooxygenases catalyze oxidations that are of interest for biocatalytic applications. Among these enzymes, phenylacetone monooxygenase (PAMO) from Thermobifida fusca is the only protein showing remarkable stability. While related enzymes often present a broad substrate scope, PAMO accepts only a limited number of substrates. Due to the absence of a substrate in the elucidated crystal structure of PAMO, the substrate binding site of this protein has not yet been defined. In this study, a structural model of cyclopentanone monooxygenase, which acts on a broad range of compounds, has been prepared and compared with the structure of PAMO. This revealed 15 amino acid positions in the active site of PAMO that may account for its relatively narrow substrate specificity. We designed and analyzed 30 single and multiple mutants in order to verify the role of these positions. Extensive substrate screening revealed several mutants that displayed increased activity and altered regio- or enantioselectivity in Baeyer-Villiger reactions and sulfoxidations. Further substrate profiling resulted in the identification of mutants with improved catalytic properties toward synthetically attractive compounds. Moreover, the thermostability of the mutants was not compromised in comparison to that of the wild-type enzyme. Our data demonstrate that the positions identified within the active site of PAMO, namely, V54, I67, Q152, and A435, contribute to the substrate specificity of this enzyme. These findings will aid in more dedicated and effective redesign of PAMO and related monooxygenases toward an expanded substrate scope. PMID:21724896

Selective Enrichment and Direct Analysis of Protein S-Palmitoylation Sites.

PubMed

Thinon, Emmanuelle; Fernandez, Joseph P; Molina, Henrik; Hang, Howard C

2018-05-04

S-Fatty-acylation is the covalent attachment of long chain fatty acids, predominately palmitate (C16:0, S-palmitoylation), to cysteine (Cys) residues via a thioester linkage on proteins. This post-translational and reversible lipid modification regulates protein function and localization in eukaryotes and is important in mammalian physiology and human diseases. While chemical labeling methods have improved the detection and enrichment of S-fatty-acylated proteins, mapping sites of modification and characterizing the endogenously attached fatty acids are still challenging. Here, we describe the integration and optimization of fatty acid chemical reporter labeling with hydroxylamine-mediated enrichment of S-fatty-acylated proteins and direct tagging of modified Cys residues to selectively map lipid modification sites. This afforded improved enrichment and direct identification of many protein S-fatty-acylation sites compared to previously described methods. Notably, we directly identified the S-fatty-acylation sites of IFITM3, an important interferon-stimulated inhibitor of virus entry, and we further demonstrated that the highly conserved Cys residues are primarily modified by palmitic acid. The methods described here should facilitate the direct analysis of protein S-fatty-acylation sites and their endogenously attached fatty acids in diverse cell types and activation states important for mammalian physiology and diseases.

Identification of U2AF(35)-dependent exons by RNA-Seq reveals a link between 3′ splice-site organization and activity of U2AF-related proteins

PubMed Central

Kralovicova, Jana; Knut, Marcin; Cross, Nicholas C. P.; Vorechovsky, Igor

2015-01-01

The auxiliary factor of U2 small nuclear RNA (U2AF) is a heterodimer consisting of 65- and 35-kD proteins that bind the polypyrimidine tract (PPT) and AG dinucleotides at the 3′ splice site (3′ss). The gene encoding U2AF35 (U2AF1) is alternatively spliced, giving rise to two isoforms U2AF35a and U2AF35b. Here, we knocked down U2AF35 and each isoform and characterized transcriptomes of HEK293 cells with varying U2AF35/U2AF65 and U2AF35a/b ratios. Depletion of both isoforms preferentially modified alternative RNA processing events without widespread failure to recognize 3′ss or constitutive exons. Over a third of differentially used exons were terminal, resulting largely from the use of known alternative polyadenylation (APA) sites. Intronic APA sites activated in depleted cultures were mostly proximal whereas tandem 3′UTR APA was biased toward distal sites. Exons upregulated in depleted cells were preceded by longer AG exclusion zones and PPTs than downregulated or control exons and were largely activated by PUF60 and repressed by CAPERα. The U2AF(35) repression and activation was associated with a significant interchange in the average probabilities to form single-stranded RNA in the optimal PPT and branch site locations and sequences further upstream. Although most differentially used exons were responsive to both U2AF subunits and their inclusion correlated with U2AF levels, a small number of transcripts exhibited distinct responses to U2AF35a and U2AF35b, supporting the existence of isoform-specific interactions. These results provide new insights into function of U2AF and U2AF35 in alternative RNA processing. PMID:25779042

Direct Substrate Identification with an Analog Sensitive (AS) Viral Cyclin-Dependent Kinase (v-Cdk).

PubMed

Umaña, Angie C; Iwahori, Satoko; Kalejta, Robert F

2018-01-19

Viral cyclin-dependent kinases (v-Cdks) functionally emulate their cellular Cdk counterparts. Such viral mimicry is an established phenomenon that we extend here through chemical genetics. Kinases contain gatekeeper residues that limit the size of molecules that can be accommodated within the enzyme active site. Mutating gatekeeper residues to smaller amino acids allows larger molecules access to the active site. Such mutants can utilize bio-orthoganol ATPs for phosphate transfer and are inhibited by compounds ineffective against the wild type protein, and thus are referred to as analog-sensitive (AS) kinases. We identified the gatekeeper residues of the v-Cdks encoded by Epstein-Barr virus (EBV) and human cytomegalovirus (HCMV) and mutated them to generate AS kinases. The AS-v-Cdks are functional and utilize different ATP derivatives with a specificity closely matching their cellular ortholog, AS-Cdk2. The AS derivative of the EBV v-Cdk was used to transfer a thiolated phosphate group to targeted proteins which were then purified through covalent capture and identified by mass spectrometry. Pathway analysis of these newly identified direct substrates of the EBV v-Cdk extends the potential influence of this kinase into all stages of gene expression (transcription, splicing, mRNA export, and translation). Our work demonstrates the biochemical similarity of the cellular and viral Cdks, as well as the utility of AS v-Cdks for substrate identification to increase our understanding of both viral infections and Cdk biology.

Further Interpretation of the Relationship between Faunal Community and Seafloor Geology at Southern Hydrate Ridge, Cascadia Margin: Exploring Machine Learning

NASA Astrophysics Data System (ADS)

Bigham, K.; Kelley, D. S.; Marburg, A.; Delaney, J. R.

2017-12-01

In 2011, high-resolution, georeferenced photomoasiacs were taken of Einstein's Grotto, an active methane hydrate seep within the field at Southern Hydrate Ridge located 90 km west of Newport, Oregon at a water depth of 800 m. Methods used to analyze the relationships between the seep site, seafloor geology, and the spatial distribution and abundances of microbial and macrofaunal communities at Einstein's Grotto were expanded to three other sites over the 200 by 300 m active seep field. These seeps were documented in the same survey in 2011 conducted by the remotely operated vehicle ROPOS on board the R/V Thompson. Over 10,000 high definition images allowed for the further quantification and characterization of the diversity and structure of the faunal community at this seep field. The new results support the study's initial findings of high variability in the distribution and abundance of seep organisms across the field, with correlation to seafloor geology. The manual classification of organisms was also used to train a series of convolutional neural networks in Nvidia DIGITS and Google Tensorflow environments for automated identification. The developed networks proved highly accurate at background/non-background segmentation ( 96%) and slightly less reliable for fauna identification ( 89%). This study provides a baseline for the faunal community at the Southern Hydrate Ridge methane seeps and a more efficient computer assisted method for processing follow on studies.

Hydrogen production by the naked active site of the di-iron hydrogenases in water.

PubMed

Zipoli, Federico; Car, Roberto; Cohen, Morrel H; Selloni, Annabella

2009-10-01

We explored the reactivity of the active center of the [FeFe]-hydrogenases detached from the enzyme and immersed in acidified water by first-principles Car-Parrinello molecular-dynamics simulations. We focused on the identification of the structures that are stable and metastable in acidified water and on their activity for hydrogen production. Our calculations revealed that the naked active center could be an efficient catalyst provided that electrons are transferred to the cluster. We found that both bridging and terminal isomers are present at equilibrium and that the bridging configuration is essential for efficient hydrogen production. The formation of the hydrogen molecule occurs via sequential protonations of the distal iron and of the N-atom of the S-CH(2)-NH-CH(2)-S chelating group. H(2) desorption does not involve a significant energy barrier, making the process very efficient at room temperature. We established that the bottleneck in the reaction is the direct proton transfer from water to the vacant site of the distal iron. Moreover, we found that even if the terminal isomer is present at the equilibrium, its strong local hydrophobicity prevents poisoning of the cluster.

Identification of the catalytic triad of the lipase/acyltransferase from Aeromonas hydrophila.

PubMed Central

Brumlik, M J; Buckley, J T

1996-01-01

Aeromonas hydrophila secretes a lipolytic enzyme that has several properties in common with the mammalian enzyme lecithin-cholesterol acyltransferase. We have recently shown that it is a member of a newly described group of proteins that contain five similar blocks of sequence arranged in the same order in their primary structures (C. Upton and J. T. Buckley, Trends Biochem. Sci. 233:178-179, 1995). Assuming that, like other lipases, these enzymes have a Ser-Asp-His catalytic triad, we used these blocks to predict which aspartic acid and histidine would be at the active site of the Aeromonas enzyme. Targeted residues were replaced with other amino acids by site-directed mutagenesis, and the effects on secretion and activity were assessed. Changing His-291 to asparagine completely abolished enzyme activity, although secretion by the bacteria was not affected. Only very small amounts of the D116N mutant appeared in the culture supernatant, likely because it is sensitive to periplasmic proteases it encounters en route. Assays of crude preparations containing this variant showed no detectable enzyme activity. We conclude that, together with Ser-16, which we have identified previously, Asp-116 and His-291 compose the catalytic triad of the enzyme. PMID:8606184

Ub-ISAP: a streamlined UNIX pipeline for mining unique viral vector integration sites from next generation sequencing data.

PubMed

Kamboj, Atul; Hallwirth, Claus V; Alexander, Ian E; McCowage, Geoffrey B; Kramer, Belinda

2017-06-17

The analysis of viral vector genomic integration sites is an important component in assessing the safety and efficiency of patient treatment using gene therapy. Alongside this clinical application, integration site identification is a key step in the genetic mapping of viral elements in mutagenesis screens that aim to elucidate gene function. We have developed a UNIX-based vector integration site analysis pipeline (Ub-ISAP) that utilises a UNIX-based workflow for automated integration site identification and annotation of both single and paired-end sequencing reads. Reads that contain viral sequences of interest are selected and aligned to the host genome, and unique integration sites are then classified as transcription start site-proximal, intragenic or intergenic. Ub-ISAP provides a reliable and efficient pipeline to generate large datasets for assessing the safety and efficiency of integrating vectors in clinical settings, with broader applications in cancer research. Ub-ISAP is available as an open source software package at https://sourceforge.net/projects/ub-isap/ .

The human apolipoprotein AV gene is regulated by peroxisome proliferator-activated receptor-alpha and contains a novel farnesoid X-activated receptor response element.

PubMed

Prieur, Xavier; Coste, Herve; Rodriguez, Joan C

2003-07-11

The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.

Selection and Characterization of Landing Sites for Chandrayaan-2 Lander

NASA Astrophysics Data System (ADS)

Gopala Krishna, Barla; Amitabh, Amitabh; Srinivasan, T. P.; Karidhal, Ritu; Nagesh, G.; Manjusha, N.

2016-07-01

Indian Space Research Organisation has planned the second mission to moon known as Chandrayaan-2, which consists of an Orbiter, a Lander and a Rover. This will be the first soft landing mission of India on lunar surface. The Orbiter, Lander and Rover individually will carry scientific payloads that enhance the scientific objectives of Chandrayaan-2. The Lander soft lands on the lunar surface and subsequently Lander & Rover will carry on with the payload activities on the moon surface. Landing Site identification based on the scientific and engineering constrains of lander plays an important role in success of a mission. The Lander poses some constraints because of its engineering design for the selection of the landing site and on the other hand the landing site / region imparts some constrain on the Lander. The various constraints that have to be considered for the study of the landing site are Local slope, Sun illumination during mission life, Radio communication with the Earth, Global slope towards equator, Boulders size, Crater density and boulder distribution. This paper describes the characterization activities of the different landing locations which have been studied for Chandrayaan-2 Lander. The sites have been studied both in the South Polar and North Polar regions of the moon on the near side. The Engineering Constraints at the sites due to the Lander, Factors that affect mission life (i.e. illumination at the location), Factors influencing communication to earth (i.e. RF visibility) & Shadow movements have been studied at these locations and zones that are favourable for landing have been short listed. This paper gives methodology of these studies along with the results of the characteristics of all the sites and the recommendations for further action in finalizing the landing area.

Synthesis and Pharmacological Characterization of C4-(Thiotriazolyl)-substituted-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylates. Identification of (1R,2S,4R,5R,6R)-2-Amino-4-(1H-1,2,4-triazol-3-ylsulfanyl)bicyclo[3.1.0]hexane-2,6-dicarboxylic Acid (LY2812223), a Highly Potent, Functionally Selective mGlu2 Receptor Agonist.

PubMed

Monn, James A; Prieto, Lourdes; Taboada, Lorena; Hao, Junliang; Reinhard, Matthew R; Henry, Steven S; Beadle, Christopher D; Walton, Lesley; Man, Teresa; Rudyk, Helene; Clark, Barry; Tupper, David; Baker, S Richard; Lamas, Carlos; Montero, Carlos; Marcos, Alicia; Blanco, Jaime; Bures, Mark; Clawson, David K; Atwell, Shane; Lu, Frances; Wang, Jing; Russell, Marijane; Heinz, Beverly A; Wang, Xushan; Carter, Joan H; Getman, Brian G; Catlow, John T; Swanson, Steven; Johnson, Bryan G; Shaw, David B; McKinzie, David L

2015-09-24

Identification of orthosteric mGlu(2/3) receptor agonists capable of discriminating between individual mGlu2 and mGlu3 subtypes has been highly challenging owing to the glutamate-site sequence homology between these proteins. Herein we detail the preparation and characterization of a series of molecules related to (1S,2S,5R,6S)-2-aminobicyclo[3.1.0]hexane-2,6-dicarboxylate 1 (LY354740) bearing C4-thiotriazole substituents. On the basis of second messenger responses in cells expressing other recombinant human mGlu2/3 subtypes, a number of high potency and efficacy mGlu2 receptor agonists exhibiting low potency mGlu3 partial agonist/antagonist activity were identified. From this, (1R,2S,4R,5R,6R)-2-amino-4-(1H-1,2,4-triazol-3-ylsulfanyl)bicyclo[3.1.0]hexane-2,6-dicarboxylic acid 14a (LY2812223) was further characterized. Cocrystallization of 14a with the amino terminal domains of hmGlu2 and hmGlu3 combined with site-directed mutation studies has clarified the underlying molecular basis of this unique pharmacology. Evaluation of 14a in a rat model responsive to mGlu2 receptor activation coupled with a measure of central drug disposition provides evidence that this molecule engages and activates central mGlu2 receptors in vivo.

Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

PubMed Central

Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

2012-01-01

The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

Seasonal and diel patterns in cetacean use and foraging at a potential marine renewable energy site.

PubMed

Nuuttila, Hanna K; Bertelli, Chiara M; Mendzil, Anouska; Dearle, Nessa

2018-04-01

Marine renewable energy (MRE) developments often coincide with sites frequented by small cetaceans. To understand habitat use and assess potential impact from development, echolocation clicks were recorded with acoustic click loggers (C-PODs) in Swansea Bay, Wales (UK). General Additive Models (GAMs) were applied to assess the effects of covariates including month, hour, tidal range and temperature. Analysis of inter-click intervals allowed the identification of potential foraging events as well as patterns of presence and absence. Data revealed year-round presence of porpoise, with distinct seasonal and diel patterns. Occasional acoustic encounters of dolphins were also recorded. This study provides further evidence of the need for assessing temporal trends in cetacean presence and habitat use in areas considered for development. These findings could assist MRE companies to monitor and mitigate against disturbance from construction, operation and decommissioning activities by avoiding times when porpoise presence and foraging activity is highest in the area. Copyright © 2017 Elsevier Ltd. All rights reserved.

Odilorhabdins, Antibacterial Agents that Cause Miscoding by Binding at a New Ribosomal Site.

PubMed

Pantel, Lucile; Florin, Tanja; Dobosz-Bartoszek, Malgorzata; Racine, Emilie; Sarciaux, Matthieu; Serri, Marine; Houard, Jessica; Campagne, Jean-Marc; de Figueiredo, Renata Marcia; Midrier, Camille; Gaudriault, Sophie; Givaudan, Alain; Lanois, Anne; Forst, Steve; Aumelas, André; Cotteaux-Lautard, Christelle; Bolla, Jean-Michel; Vingsbo Lundberg, Carina; Huseby, Douglas L; Hughes, Diarmaid; Villain-Guillot, Philippe; Mankin, Alexander S; Polikanov, Yury S; Gualtieri, Maxime

2018-04-05

Growing resistance of pathogenic bacteria and shortage of antibiotic discovery platforms challenge the use of antibiotics in the clinic. This threat calls for exploration of unconventional sources of antibiotics and identification of inhibitors able to eradicate resistant bacteria. Here we describe a different class of antibiotics, odilorhabdins (ODLs), produced by the enzymes of the non-ribosomal peptide synthetase gene cluster of the nematode-symbiotic bacterium Xenorhabdus nematophila. ODLs show activity against Gram-positive and Gram-negative pathogens, including carbapenem-resistant Enterobacteriaceae, and can eradicate infections in animal models. We demonstrate that the bactericidal ODLs interfere with protein synthesis. Genetic and structural analyses reveal that ODLs bind to the small ribosomal subunit at a site not exploited by current antibiotics. ODLs induce miscoding and promote hungry codon readthrough, amino acid misincorporation, and premature stop codon bypass. We propose that ODLs' miscoding activity reflects their ability to increase the affinity of non-cognate aminoacyl-tRNAs to the ribosome. Copyright © 2018 Elsevier Inc. All rights reserved.

Identification of Luminal Breast Cancers that Establish a Tumor Supportive Macroenvironment Defined by Pro-Angiogenic Platelets and Bone Marrow Derived Cells

PubMed Central

Kuznetsov, Hanna S.; Marsh, Timothy; Markens, Beth A.; Castaño, Zafira; Greene-Colozzi, April; Hay, Samantha A.; Brown, Victoria E.; Richardson, Andrea L.; Signoretti, Sabina; Battinelli, Elisabeth M.; McAllister, Sandra S.

2012-01-01

Breast cancer recurrence rates vary following treatment, suggesting that tumor cells disseminate early from primary sites but remain indolent indefinitely before progressing to symptomatic disease. The reasons why some indolent disseminated tumors erupt into overt disease are unknown. We discovered a novel process by which certain luminal breast cancer cells and patient tumor specimens (LBC “instigators”) establish a systemic macroenvironment that supports outgrowth of otherwise-indolent disseminated tumors (“responders”). Instigating LBCs secrete cytokines that are absorbed by platelets, which are recruited to responding tumor sites where they aid vessel formation. Instigator-activated bone marrow cells (BMCs) enrich responding tumor cell expression of CD24, an adhesion molecule for platelets, and provide a source of VEGFR2+ tumor vessel cells. This cascade results in growth of responder adenocarcinomas and is abolished when platelet activation is inhibited by aspirin. These findings highlight the macroenvironment as an important component of disease progression that can be exploited therapeutically. PMID:22896036

Atomic-scale identification of Pd leaching in nanoparticle catalyzed C–C coupling: Effects of particle surface disorder

DOE PAGES

Briggs, Beverly D.; Bedford, Nicholas M.; Seifert, Soenke; ...

2015-07-23

C–C coupling reactions are of great importance in the synthesis of numerous organic compounds, where Pd nanoparticle catalyzed systems represent new materials to efficiently drive these reactions. Despite their pervasive utility, the catalytic mechanism of these particle-based reactions remains highly contested. Herein we present evidence of an atom leaching mechanism for Stille coupling under aqueous conditions using peptide-capped Pd nanoparticles. EXAFS analysis revealed Pd coordination changes in the nanoparticle consistent with Pd atom abstraction, where sizing analysis by SAXS confirmed particle size changes associated with a leaching process. It is likely that recently discovered highly disordered surface Pd atoms aremore » the favored catalytic active sites and are leached during oxidative addition, resulting in smaller particles. Thus, probing the mechanism of nanoparticle-driven C–C coupling reactions through structural analyses provides fundamental information concerning these active sites and their reactivity at the atomic-scale, which can be used to improve catalytic performance to meet important sustainability goals.« less

Evolution of the herpes thymidine kinase: identification and comparison of the equine herpesvirus 1 thymidine kinase gene reveals similarity to a cell-encoded thymidylate kinase.

PubMed Central

Robertson, G R; Whalley, J M

1988-01-01

We have identified the equine herpesvirus 1 (EHV-1) thymidine kinase gene (TK) by DNA-mediated transformation and by DNA sequencing. Alignment of the amino acid sequence of the EHV-1 TK with the TKs from 3 other herpesviruses revealed regions of homology, some of which correspond to the previously identified substrate binding sites, while others have as yet, no assigned function. In particular, the strict conservation of an aspartate within the proposed nucleoside binding site suggests a role in ATP binding for this residue. Comparison of 5 herpes TKs with the thymidylate kinase of yeast revealed significant similarity which was strongest in those regions important to catalytic activity of the herpes TKs, and, therefore we propose that the herpes TK may be derived from a cellular thymidylate kinase. The implications for the evolution of enzyme activities within a pathway of nucleotide metabolism are discussed. PMID:2849761

Readability of branding symbols in horses and histomorphological alterations at the branding site.

PubMed

Aurich, J E; Wohlsein, P; Wulf, M; Nees, M; Baumgärtner, W; Becker-Birck, M; Aurich, C

2013-03-01

Identification of horses has traditionally been facilitated by hot iron branding, but the extent by which branding symbols and numbers can be identified has not been investigated. The local pathological changes induced by branding are also unknown. This study analysed the readability of branding symbols and histomorphological alterations at the branding sites. A total of 248 horses in an equestrian championship were available for identification of symbols and numbers. A further 28 horses, euthanased for other reasons, provided histological examination of the branding site. All except one horse had evidence of histological changes at the brand site, including epidermal hyperplasia, increase of dermal collagenous fibrous tissue and loss of adnexal structures. In two foals, an ulcerative to necrotizing dermatitis was observed and interpreted as a complication of recent branding lesions. Despite the fact that hot iron branding caused lesions compatible with third degree thermal injury, it did not allow unambiguous identification of a large proportion of older horses. While the breed-specific symbol was consistently identified by three independent investigators in 84% of the horses, the double-digit branding number was read correctly by all three investigators in less than 40%. In conclusion, hot iron branding in horses causes lesions compatible with third degree thermal injury but does not always allow identification of horses. Copyright © 2012 Elsevier Ltd. All rights reserved.

Evaluation of normal findings using a detailed and focused technique for transcutaneous abdominal ultrasonography in the horse

PubMed Central

2014-01-01

Background Ultrasonography is an important diagnostic tool in the investigation of abdominal disease in the horse. Several factors may affect the ability to image different structures within the abdomen. The aim of the study was to describe the repeatability of identification of abdominal structures in normal horses using a detailed ultrasonographic examination technique and using a focused, limited preparation technique. Methods A detailed abdominal ultrasound examination was performed in five normal horses, repeated on five occasions (total of 25 examinations). The abdomen was divided into ten different imaging sites, and structures identified in each site were recorded. Five imaging sites were then selected for a single focused ultrasound examination in 20 normal horses. Limited patient preparation was performed. Structures were recorded as ‘identified’ if ultrasonographic features could be distinguished. The location of organs and their frequency of identification were recorded. Data from both phases were analysed to determine repeatability of identification of structures in each examination (irrespective of imaging site), and for each imaging site. Results Caecum, colon, spleen, liver and right kidney were repeatably identified using the detailed technique, and had defined locations. Large colon and right kidney were identified in 100% of examinations with both techniques. Liver, spleen, caecum, duodenum and other small intestine were identified more frequently with the detailed examination. Small intestine was most frequently identified in the ventral abdomen, its identification varied markedly within and between horses, and required repeated examinations in some horses. Left kidney could not be identified in every horse using either technique. Sacculated colon was identified in all ventral sites, and was infrequently identified in dorsal sites. Conclusions Caecum, sacculated large intestine, spleen, liver and right kidney were consistently identified with both techniques. There were some normal variations which should be considered when interpreting ultrasonographic findings in clinical cases: left kidney was not always identified, sacculated colon was occasionally identified in dorsal flank sites. Multiple imaging sites and repeated examinations may be required to identify small intestine. A focused examination identified most key structures, but has some limitations compared to a detailed examination. PMID:25238559

Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.

PubMed

Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O

2010-08-01

Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.

GUIDE-Seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases

PubMed Central

Nguyen, Nhu T.; Liebers, Matthew; Topkar, Ved V.; Thapar, Vishal; Wyvekens, Nicolas; Khayter, Cyd; Iafrate, A. John; Le, Long P.; Aryee, Martin J.; Joung, J. Keith

2014-01-01

CRISPR RNA-guided nucleases (RGNs) are widely used genome-editing reagents, but methods to delineate their genome-wide off-target cleavage activities have been lacking. Here we describe an approach for global detection of DNA double-stranded breaks (DSBs) introduced by RGNs and potentially other nucleases. This method, called Genome-wide Unbiased Identification of DSBs Enabled by Sequencing (GUIDE-Seq), relies on capture of double-stranded oligodeoxynucleotides into breaks Application of GUIDE-Seq to thirteen RGNs in two human cell lines revealed wide variability in RGN off-target activities and unappreciated characteristics of off-target sequences. The majority of identified sites were not detected by existing computational methods or ChIP-Seq. GUIDE-Seq also identified RGN-independent genomic breakpoint ‘hotspots’. Finally, GUIDE-Seq revealed that truncated guide RNAs exhibit substantially reduced RGN-induced off-target DSBs. Our experiments define the most rigorous framework for genome-wide identification of RGN off-target effects to date and provide a method for evaluating the safety of these nucleases prior to clinical use. PMID:25513782

Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.

PubMed

Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin

2017-10-01

Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.

Investigation and identification of functional post-translational modification sites associated with drug binding and protein-protein interactions.

PubMed

Su, Min-Gang; Weng, Julia Tzu-Ya; Hsu, Justin Bo-Kai; Huang, Kai-Yao; Chi, Yu-Hsiang; Lee, Tzong-Yi

2017-12-21

Protein post-translational modification (PTM) plays an essential role in various cellular processes that modulates the physical and chemical properties, folding, conformation, stability and activity of proteins, thereby modifying the functions of proteins. The improved throughput of mass spectrometry (MS) or MS/MS technology has not only brought about a surge in proteome-scale studies, but also contributed to a fruitful list of identified PTMs. However, with the increase in the number of identified PTMs, perhaps the more crucial question is what kind of biological mechanisms these PTMs are involved in. This is particularly important in light of the fact that most protein-based pharmaceuticals deliver their therapeutic effects through some form of PTM. Yet, our understanding is still limited with respect to the local effects and frequency of PTM sites near pharmaceutical binding sites and the interfaces of protein-protein interaction (PPI). Understanding PTM's function is critical to our ability to manipulate the biological mechanisms of protein. In this study, to understand the regulation of protein functions by PTMs, we mapped 25,835 PTM sites to proteins with available three-dimensional (3D) structural information in the Protein Data Bank (PDB), including 1785 modified PTM sites on the 3D structure. Based on the acquired structural PTM sites, we proposed to use five properties for the structural characterization of PTM substrate sites: the spatial composition of amino acids, residues and side-chain orientations surrounding the PTM substrate sites, as well as the secondary structure, division of acidity and alkaline residues, and solvent-accessible surface area. We further mapped the structural PTM sites to the structures of drug binding and PPI sites, identifying a total of 1917 PTM sites that may affect PPI and 3951 PTM sites associated with drug-target binding. An integrated analytical platform (CruxPTM), with a variety of methods and online molecular docking tools for exploring the structural characteristics of PTMs, is presented. In addition, all tertiary structures of PTM sites on proteins can be visualized using the JSmol program. Resolving the function of PTM sites is important for understanding the role that proteins play in biological mechanisms. Our work attempted to delineate the structural correlation between PTM sites and PPI or drug-target binding. CurxPTM could help scientists narrow the scope of their PTM research and enhance the efficiency of PTM identification in the face of big proteome data. CruxPTM is now available at http://csb.cse.yzu.edu.tw/CruxPTM/ .

9 CFR 130.15 - User fees for veterinary diagnostic isolation and identification tests performed at NVSL...

Code of Federal Regulations, 2011 CFR

2011-01-01

... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false User fees for veterinary diagnostic isolation and identification tests performed at NVSL (excluding FADDL) or other authorized site. 130.15... AGRICULTURE USER FEES USER FEES § 130.15 User fees for veterinary diagnostic isolation and identification...

9 CFR 130.15 - User fees for veterinary diagnostic isolation and identification tests performed at NVSL...

Code of Federal Regulations, 2010 CFR

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false User fees for veterinary diagnostic isolation and identification tests performed at NVSL (excluding FADDL) or other authorized site. 130.15... AGRICULTURE USER FEES USER FEES § 130.15 User fees for veterinary diagnostic isolation and identification...

Discovery and Optimization of Allosteric Inhibitors of Mutant Isocitrate Dehydrogenase 1 (R132H IDH1) Displaying Activity in Human Acute Myeloid Leukemia Cells.

PubMed

Jones, Stuart; Ahmet, Jonathan; Ayton, Kelly; Ball, Matthew; Cockerill, Mark; Fairweather, Emma; Hamilton, Nicola; Harper, Paul; Hitchin, James; Jordan, Allan; Levy, Colin; Lopez, Ruth; McKenzie, Eddie; Packer, Martin; Plant, Darren; Simpson, Iain; Simpson, Peter; Sinclair, Ian; Somervaille, Tim C P; Small, Helen; Spencer, Gary J; Thomson, Graeme; Tonge, Michael; Waddell, Ian; Walsh, Jarrod; Waszkowycz, Bohdan; Wigglesworth, Mark; Wiseman, Daniel H; Ogilvie, Donald

2016-12-22

A collaborative high throughput screen of 1.35 million compounds against mutant (R132H) isocitrate dehydrogenase IDH1 led to the identification of a novel series of inhibitors. Elucidation of the bound ligand crystal structure showed that the inhibitors exhibited a novel binding mode in a previously identified allosteric site of IDH1 (R132H). This information guided the optimization of the series yielding submicromolar enzyme inhibitors with promising cellular activity. Encouragingly, one compound from this series was found to induce myeloid differentiation in primary human IDH1 R132H AML cells in vitro.

Mojo Hand, a TALEN design tool for genome editing applications.

PubMed

Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C

2013-01-16

Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.

Scale-Up Synthesis and Identification of GLYX-13, a NMDAR Glycine-Site Partial Agonist for the Treatment of Major Depressive Disorder.

PubMed

Li, Wenchao; Liu, Jingjian; Fan, Minghua; Li, Zhongtang; Chen, Yin; Zhang, Guisen; Huang, Zhuo; Zhang, Liangren

2018-04-24

GLYX-13, a NMDAR glycine-site partial agonist, was discovered as a promising antidepressant with rapidly acting effects but no ketamine-like side effects. However, the reported synthetic process route had deficiencies of low yield and the use of unfriendly reagents. Here, we report a scaled-up synthesis of GLYX-13 with an overall yield of 30% on the hectogram scale with a column chromatography-free strategy, where the coupling and deprotection reaction conditions were systematically optimized. Meanwhile, the absolute configuration of precursor compound of GLYX-13 was identified by X-ray single crystal diffraction. Finally, the activity of GLYX-13 was verified in the cortical neurons of mice through whole-cell voltage-clamp technique.

Molecular Basis for Modulation of Metabotropic Glutamate Receptors and Their Drug Actions by Extracellular Ca2+

PubMed Central

Zou, Juan; Jiang, Jason Y.; Yang, Jenny J.

2017-01-01

Metabotropic glutamate receptors (mGluRs) associated with the slow phase of the glutamatergic signaling pathway in neurons of the central nervous system have gained importance as drug targets for chronic neurodegenerative diseases. While extracellular Ca2+ was reported to exhibit direct activation and modulation via an allosteric site, the identification of those binding sites was challenged by weak binding. Herein, we review the discovery of extracellular Ca2+ in regulation of mGluRs, summarize the recent developments in probing Ca2+ binding and its co-regulation of the receptor based on structural and biochemical analysis, and discuss the molecular basis for Ca2+ to regulate various classes of drug action as well as its importance as an allosteric modulator in mGluRs. PMID:28335551

Utilizing random Forest QSAR models with optimized parameters for target identification and its application to target-fishing server.

PubMed

Lee, Kyoungyeul; Lee, Minho; Kim, Dongsup

2017-12-28

The identification of target molecules is important for understanding the mechanism of "target deconvolution" in phenotypic screening and "polypharmacology" of drugs. Because conventional methods of identifying targets require time and cost, in-silico target identification has been considered an alternative solution. One of the well-known in-silico methods of identifying targets involves structure activity relationships (SARs). SARs have advantages such as low computational cost and high feasibility; however, the data dependency in the SAR approach causes imbalance of active data and ambiguity of inactive data throughout targets. We developed a ligand-based virtual screening model comprising 1121 target SAR models built using a random forest algorithm. The performance of each target model was tested by employing the ROC curve and the mean score using an internal five-fold cross validation. Moreover, recall rates for top-k targets were calculated to assess the performance of target ranking. A benchmark model using an optimized sampling method and parameters was examined via external validation set. The result shows recall rates of 67.6% and 73.9% for top-11 (1% of the total targets) and top-33, respectively. We provide a website for users to search the top-k targets for query ligands available publicly at http://rfqsar.kaist.ac.kr . The target models that we built can be used for both predicting the activity of ligands toward each target and ranking candidate targets for a query ligand using a unified scoring scheme. The scores are additionally fitted to the probability so that users can estimate how likely a ligand-target interaction is active. The user interface of our web site is user friendly and intuitive, offering useful information and cross references.

Identification of the fatty acid activation site on human ClC-2.

PubMed

Cuppoletti, John; Tewari, Kirti P; Chakrabarti, Jayati; Malinowska, Danuta H

2017-06-01

Fatty acids (including lubiprostone and cobiprostone) are human ClC-2 (hClC-2) Cl - channel activators. Molecular and cellular mechanisms underlying this activation were examined. Role of a four-amino acid PKA activation site, RGET 691 , of hClC-2 was investigated using wild-type (WT) and mutant (AGET, RGEA, and AGAA) hClC-2 expressed in 293EBNA cells as well as involvement of PKA, intracellular cAMP concentration ([cAMP] i ), EP 2 , or EP 4 receptor agonist activity. All fatty acids [lubiprostone, cobiprostone, eicosatetraynoic acid (ETYA), oleic acid, and elaidic acid] caused significant rightward shifts in concentration-dependent Cl - current activation (increasing EC 50 s) with mutant compared with WT hClC-2 channels, without changing time and voltage dependence, current-voltage rectification, or methadone inhibition of the channel. As with lubiprostone, cobiprostone activation of hClC-2 occurred with PKA inhibitor (myristoylated protein kinase inhibitor) present or when using double PKA activation site (RRAA 655 /RGEA 691 ) mutant. Cobiprostone did not activate human CFTR. Fatty acids did not increase [cAMP] i in hClC-2/293EBNA or T84 cells. Using T84 CFTR knockdown cells, cobiprostone increased hClC-2 Cl - currents without increasing [cAMP] i, while PGE 2 and forskolin-IBMX increased both. Fatty acids were not agonists of EP 2 or EP 4 receptors. L-161,982, a supposed EP 4 -selective inhibitor, had no effect on lubiprostone-activated hClC-2 Cl - currents but significantly decreased T84 cell barrier function measured by transepithelial resistance and fluorescent dextran transepithelial movement. The present findings show that RGET 691 of hClC-2 (possible binding site) plays an important functional role in fatty acid activation of hClC-2. PKA, [cAMP] i , and EP 2 or EP 4 receptors are not involved. These studies provide the molecular basis for fatty acid regulation of hClC-2. Copyright © 2017 the American Physiological Society.

[Active miniature inverted-repeat transposable elements transposon in plants: a review].

PubMed

Hu, Bingjie; Zhou, Mingbing

2018-02-25

Miniature inverted-repeat transposable elements transposon is a special transposon that could transpose by "cut-paste" mechanism, which is one of characteristics of DNA transposons. Otherwise, the copy number of MITEs is very high, which is one of characteristics of RNA transposons. Many MITE families have been reported, but little about active MITEs. We summarize recent advances in studying active MITEs. Most the MITEs belong to the Tourist-like family, such as mPing, mGing, PhTourist1, Tmi1 and PhTst-3. Additionally, DTstu1 and MITE-39 belong to Stowaway-like family, and AhMITEs1 belongs to Mutator-like family. Moreover, we summarize the structure (terminal inverse repeats and target site duplications), copy number, evolution pattern and transposition characteristics of these active MITEs, to provide the foundation for the identification of other active MITEs and subsequent research on MITE transposition and amplification mechanism.

Crystal Structure of the CTP1L Endolysin Reveals How Its Activity Is Regulated by a Secondary Translation Product*

PubMed Central

Dunne, Matthew; Leicht, Stefan; Krichel, Boris; Thompson, Andrew; Gómez-Torres, Natalia; Garde, Sonia; Narbad, Arjan; Mayer, Melinda J.

2016-01-01

Bacteriophages produce endolysins, which lyse the bacterial host cell to release newly produced virions. The timing of lysis is regulated and is thought to involve the activation of a molecular switch. We present a crystal structure of the activated endolysin CTP1L that targets Clostridium tyrobutyricum, consisting of a complex between the full-length protein and an N-terminally truncated C-terminal cell wall binding domain (CBD). The truncated CBD is produced through an internal translation start site within the endolysin gene. Mutants affecting the internal translation site change the oligomeric state of the endolysin and reduce lytic activity. The activity can be modulated by reconstitution of the full-length endolysin-CBD complex with free CBD. The same oligomerization mechanism applies to the CD27L endolysin that targets Clostridium difficile and the CS74L endolysin that targets Clostridium sporogenes. When the CTP1L endolysin gene is introduced into the commensal bacterium Lactococcus lactis, the truncated CBD is also produced, showing that the alternative start codon can be used in other bacterial species. The identification of a translational switch affecting oligomerization presented here has implications for the design of effective endolysins for the treatment of bacterial infections. PMID:26683375

Transcription Factor Information System (TFIS): A Tool for Detection of Transcription Factor Binding Sites.

PubMed

Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C

2017-09-01

Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).

Multiple myeloma phosphotyrosine proteomic profile associated with FGFR3 expression, ligand activation, and drug inhibition

PubMed Central

St-Germain, Jonathan R.; Taylor, Paul; Tong, Jiefei; Jin, Lily L.; Nikolic, Ana; Stewart, Ian I.; Ewing, Robert M.; Dharsee, Moyez; Li, Zhihua; Trudel, Suzanne; Moran, Michael F.

2009-01-01

Signaling by growth factor receptor tyrosine kinases is manifest through networks of proteins that are substrates and/or bind to the activated receptors. FGF receptor-3 (FGFR3) is a drug target in a subset of human multiple myelomas (MM) and is mutationally activated in some cervical and colon and many bladder cancers and in certain skeletal dysplasias. To define the FGFR3 network in multiple myeloma, mass spectrometry was used to identify and quantify phosphotyrosine (pY) sites modulated by FGFR3 activation and inhibition in myeloma-derived KMS11 cells. Label-free quantification of peptide ion currents indicated the activation of FGFR3 by phosphorylation of tandem tyrosines in the kinase domain activation loop when cellular pY phosphatases were inhibited by pervanadate. Among the 175 proteins that accumulated pY in response to pervanadate was a subset of 52 including FGFR3 that contained a total of 61 pY sites that were sensitive to inhibition by the FGFR3 inhibitor PD173074. The FGFR3 isoform containing the tandem pY motif in its activation loop was targeted by PD173074. Forty of the drug-sensitive pY sites, including two located within the 35-residue cytoplasmic domain of the transmembrane growth factor binding proteoglycan (and multiple myeloma biomarker) Syndecan-1/CD138, were also stimulated in cells treated with the ligand FGF1, providing additional validation of their link to FGFR3. The identification of these overlapping sets of co-modulated tyrosine phosphorylations presents an outline of an FGFR3 network in the MM model and demonstrates the potential for pharmacodynamic monitoring by label-free quantitative phospho-proteomics. PMID:19901323

Cell type-selective disease-association of genes under high regulatory load.

PubMed

Galhardo, Mafalda; Berninger, Philipp; Nguyen, Thanh-Phuong; Sauter, Thomas; Sinkkonen, Lasse

2015-10-15

We previously showed that disease-linked metabolic genes are often under combinatorial regulation. Using the genome-wide ChIP-Seq binding profiles for 93 transcription factors in nine different cell lines, we show that genes under high regulatory load are significantly enriched for disease-association across cell types. We find that transcription factor load correlates with the enhancer load of the genes and thereby allows the identification of genes under high regulatory load by epigenomic mapping of active enhancers. Identification of the high enhancer load genes across 139 samples from 96 different cell and tissue types reveals a consistent enrichment for disease-associated genes in a cell type-selective manner. The underlying genes are not limited to super-enhancer genes and show several types of disease-association evidence beyond genetic variation (such as biomarkers). Interestingly, the high regulatory load genes are involved in more KEGG pathways than expected by chance, exhibit increased betweenness centrality in the interaction network of liver disease genes, and carry longer 3' UTRs with more microRNA (miRNA) binding sites than genes on average, suggesting a role as hubs integrating signals within regulatory networks. In summary, epigenetic mapping of active enhancers presents a promising and unbiased approach for identification of novel disease genes in a cell type-selective manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity

PubMed Central

Rand, Tim A.; Ginalski, Krzysztof; Grishin, Nick V.; Wang, Xiaodong

2004-01-01

RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2. PMID:15452342

Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity.

PubMed

Rand, Tim A; Ginalski, Krzysztof; Grishin, Nick V; Wang, Xiaodong

2004-10-05

RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2.

A Robust Analytical Approach for the Identification of Specific Protein Carbonylation Sites: Metal-Catalyzed Oxidations of Human Serum Albumin

PubMed Central

Ugur, Zafer; Gronert, Scott

2017-01-01

The formation of protein carbonyls in the metal-catalyzed oxidation of human serum albumin (HSA) is characterized using a new analytical approach that involves tagging the modification site with multiple hydrazide reagents. Protein carbonyl formation at lysine and arginine residues was catalyzed with copper and iron ions, and the resulting oxidation patterns in HSA are contrasted. A total of 18 modification sites were identified with iron ion catalysis and 14 with copper ion catalysis. However, with the more stringent requirement of identification with at least two tagging reagents, the number of validated modification sites drops to 10 for iron and 9 for copper. Of the 14 total validated sites, there were only five in common for the two metal ions. The results illustrate the value of using multiple tagging agents and highlight the selective and specific nature of metal-catalyzed protein oxidations. PMID:28303033

Report of sampling and analysis results, Addison Army housing units, Addison, Illinois. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1990-09-01

The objectives of this sampling and analysis effort include further characterization of environmental contamination identified in an enhanced preliminary assessment carried out in 1989. The specific activities performed at this site were identification, evaluation of the condition, and collection of samples from specific suspected asbestos-containing materials, including floor tiles, pipe run and pipe fitting insulation, dust in the ductwork, and exterior siding, where present. These evaluation were necessary to clarify potential environmental issues identified in the earlier report, prior to the sale or realignment of the property.

Identification and Characterization of a Novel Member of the Radical AdoMet Enzyme Superfamily and Implications for the Biosynthesis of the Hmd Hydrogenase Active Site Cofactor▿ †

PubMed Central

McGlynn, Shawn E.; Boyd, Eric S.; Shepard, Eric M.; Lange, Rachel K.; Gerlach, Robin; Broderick, Joan B.; Peters, John W.

2010-01-01

The genetic context, phylogeny, and biochemistry of a gene flanking the H2-forming methylene-H4-methanopterin dehydrogenase gene (hmdA), here designated hmdB, indicate that it is a new member of the radical S-adenosylmethionine enzyme superfamily. In contrast to the characteristic CX3CX2C or CX2CX4C motif defining this family, HmdB contains a unique CX5CX2C motif. PMID:19897660

The MER Mossbauer Spectrometers: 40 Months of Operation on the Martian Surface

NASA Technical Reports Server (NTRS)

Fleischer, Iris; Rodionov, D.; Schroeder, C.; Morris, R.; Yen, A.; Ming, D.; McCoy, T.; Mittlefehldt, D.; Gellert, R.; Cohen, B.;

Substrate and Substrate-Mimetic Chaperone Binding Sites in Human α-Galactosidase A Revealed by Affinity-Mass Spectrometry

NASA Astrophysics Data System (ADS)

Moise, Adrian; Maeser, Stefan; Rawer, Stephan; Eggers, Frederike; Murphy, Mary; Bornheim, Jeff; Przybylski, Michael

2016-06-01

Fabry disease (FD) is a rare metabolic disorder of a group of lysosomal storage diseases, caused by deficiency or reduced activity of the enzyme α-galactosidase. Human α-galactosidase A (hαGAL) hydrolyses the terminal α-galactosyl moiety from glycosphingolipids, predominantly globotriaosylceramide (Gb3). Enzyme deficiency leads to incomplete or blocked breakdown and progressive accumulation of Gb3, with detrimental effects on normal organ functions. FD is successfully treated by enzyme replacement therapy (ERT) with purified recombinant hαGAL. An emerging treatment strategy, pharmacologic chaperone therapy (PCT), employs small molecules that can increase and/or reconstitute the activity of lysosomal enzyme trafficking by stabilizing misfolded isoforms. One such chaperone, 1-deoxygalactonojirimycin (DGJ), is a structural galactose analogue currently validated in clinical trials. DGJ is an active-site-chaperone that binds at the same or similar location as galactose; however, the molecular determination of chaperone binding sites in lysosomal enzymes represents a considerable challenge. Here we report the identification of the galactose and DGJ binding sites in recombinant α-galactosidase through a new affinity-mass spectrometry-based approach that employs selective proteolytic digestion of the enzyme-galactose or -inhibitor complex. Binding site peptides identified by mass spectrometry, [39-49], [83-100], and [141-168], contain the essential ligand-contacting amino acids, in agreement with the known X-ray crystal structures. The inhibitory effect of DGJ on galactose recognition was directly characterized through competitive binding experiments and mass spectrometry. The methods successfully employed in this study should have high potential for the characterization of (mutated) enzyme-substrate and -chaperone interactions, and for identifying chaperones without inhibitory effects.

Improving Protocols for Protein Mapping through Proper Comparison to Crystallography Data

PubMed Central

Lexa, Katrina W.; Carlson, Heather A.

2013-01-01

Computational approaches to fragment-based drug design (FBDD) can complement experiments and facilitate the identification of potential hot spots along the protein surface. However, the evaluation of computational methods for mapping binding sites frequently focuses upon the ability to reproduce crystallographic coordinates to within a low RMSD threshold. This dependency on the deposited coordinate data overlooks the original electron density from the experiment, thus techniques may be developed based upon subjective - or even erroneous - atomic coordinates. This can become a significant drawback in applications to systems where the location of hot spots is unknown. Based on comparison to crystallographic density, we previously showed that mixed-solvent molecular dynamics (MixMD) accurately identifies the active site for HEWL, with acetonitrile as an organic solvent. Here, we concentrated on the influence of protic solvent on simulation and refined the optimal MixMD approach for extrapolation of the method to systems without established sites. Our results establish an accurate approach for comparing simulations to experiment. We have outlined the most efficient strategy for MixMD, based on simulation length and number of runs. The development outlined here makes MixMD a robust method which should prove useful across a broad range of target structures. Lastly, our results with MixMD match experimental data so well that consistency between simulations and density may be a useful way to aid the identification of probes vs waters during the refinement of future MSCS crystallographic structures. PMID:23327200

Distribution and Local Movement of Humpback Whales in Okinawan Waters Depend on Sex and Reproductive Status.

PubMed

Kobayashi, Nozomi; Okabe, Haruna; Kawazu, Isao; Higashi, Naoto; Kato, Keisuke; Miyahara, Hirokazu; Nakamura, Gen; Kato, Hidehiro; Uchida, Senzo

2017-02-01

The distribution and local movement patterns of humpback whales in waters off the west coast of Okinawa Island, southwest Japan, were investigated using line transect and photo-identification methodologies. Line transect surveys were conducted from 2011 to 2014 and photo-identification survey from 2006 to 2012. During the surveys, humpback whales aggregated in the areas around Ie and Kerama Islands, and tended to travel along the inshore coast of Okinawa Island when they move locally between those two sites. A total of 496 humpback whales of the known sex were photo-identified (322 males, 75 females and 99 females with a calf). Of these, 24.8% were confirmed moving locally between the sites of Ie and Kerama Islands within the same season. Frequency rates of the local movement for males, females and females with a calf were 41.9, 25.0, and 15.1%, respectively; the frequency of local movement for males was significantly higher than that for females and females with a calf. These results indicate that male humpback whales tend to move more actively between the local breeding sites as compared to females and females with a calf. We speculate that the males search for more opportunities to mate, whereas females with a calf tend to remain in the same areas to nurse their calves. These findings extend our knowledge of the habitat use and reproductive ecology of humpback whales in Okinawan waters, which remain poorly understood.

Activity-specific ecological niche models for planning reintroductions of California condors (Gymnogyps californianus)

USGS Publications Warehouse

D'Elia, Jesse; Haig, Susan M.; Johnson, Matthew J.; Marcot, Bruce G.; Young, Richard

2015-01-01

Ecological niche models can be a useful tool to identify candidate reintroduction sites for endangered species but have been infrequently used for this purpose. In this paper, we (1) develop activity-specific ecological niche models (nesting, roosting, and feeding) for the critically endangered California condor (Gymnogyps californianus) to aid in reintroduction planning in California, Oregon, and Washington, USA, (2) test the accuracy of these models using empirical data withheld from model development, and (3) integrate model results with information on condor movement ecology and biology to produce predictive maps of reintroduction site suitability. Our approach, which disentangles niche models into activity-specific components, has applications for other species where it is routinely assumed (often incorrectly) that individuals fulfill all requirements for life within a single environmental space. Ecological niche models conformed to our understanding of California condor ecology, had good predictive performance when tested with data withheld from model development, and aided in the identification of several candidate reintroduction areas outside of the current distribution of the species. Our results suggest there are large unoccupied regions of the California condor’s historical range that have retained ecological features similar to currently occupied habitats, and thus could be considered for future reintroduction efforts. Combining our activity-specific ENMs with ground reconnaissance and information on other threat factors that could not be directly incorporated into empirical ENMs will ultimately improve our ability to select successful reintroduction sites for the California condor.

Spectral-analysis-based extraction of land disturbances arising from oil and gas development in diverse landscapes

NASA Astrophysics Data System (ADS)

Zhang, Ying; Lantz, Nicholas; Guindon, Bert; Jiao, Xianfen

2017-01-01

Accurate and frequent monitoring of land surface changes arising from oil and gas exploration and extraction is a key requirement for the responsible and sustainable development of these resources. Petroleum deposits typically extend over large geographic regions but much of the infrastructure required for oil and gas recovery takes the form of numerous small-scale features (e.g., well sites, access roads, etc.) scattered over the landscape. Increasing exploitation of oil and gas deposits will increase the presence of these disturbances in heavily populated regions. An object-based approach is proposed to utilize RapidEye satellite imagery to delineate well sites and related access roads in diverse complex landscapes, where land surface changes also arise from other human activities, such as forest logging and agriculture. A simplified object-based change vector approach, adaptable to operational use, is introduced to identify the disturbances on land based on red-green spectral response and spatial attributes of candidate object size and proximity to roads. Testing of the techniques has been undertaken with RapidEye multitemporal imagery in two test sites located at Alberta, Canada: one was a predominant natural forest landscape and the other landscape dominated by intensive agricultural activities. Accuracies of 84% and 73%, respectively, have been achieved for the identification of well site and access road infrastructure of the two sites based on fully automated processing. Limited manual relabeling of selected image segments can improve these accuracies to 95%.

Mechanism of Flavoprotein l-6-Hydroxynicotine Oxidase: pH and Solvent Isotope Effects and Identification of Key Active Site Residues.

PubMed

Fitzpatrick, Paul F; Chadegani, Fatemeh; Zhang, Shengnan; Dougherty, Vi

2017-02-14

The flavoenzyme l-6-hydroxynicotine oxidase is a member of the monoamine oxidase family that catalyzes the oxidation of (S)-6-hydroxynicotine to 6-hydroxypseudooxynicotine during microbial catabolism of nicotine. While the enzyme has long been understood to catalyze oxidation of the carbon-carbon bond, it has recently been shown to catalyze oxidation of a carbon-nitrogen bond [Fitzpatrick, P. F., et al. (2016) Biochemistry 55, 697-703]. The effects of pH and mutagenesis of active site residues have now been utilized to study the mechanism and roles of active site residues. Asn166 and Tyr311 bind the substrate, while Lys287 forms a water-mediated hydrogen bond with flavin N5. The N166A and Y311F mutations result in ∼30- and ∼4-fold decreases in k cat /K m and k red for (S)-6-hydroxynicotine, respectively, with larger effects on the k cat /K m value for (S)-6-hydroxynornicotine. The K287M mutation results in ∼10-fold decreases in these parameters and a 6000-fold decrease in the k cat /K m value for oxygen. The shapes of the pH profiles are not altered by the N166A and Y311F mutations. There is no solvent isotope effect on the k cat /K m value for amines. The results are consistent with a model in which both the charged and neutral forms of the amine can bind, with the former rapidly losing a proton to a hydrogen bond network of water and amino acids in the active site prior to the transfer of hydride to the flavin.

Glutamic acid is an active site residue of angiotensin I-converting enzyme. Use of the Lossen rearrangement for identification of dicarboxylic acid residues.

PubMed

Harris, R B; Wilson, I B

1983-01-25

A set of chemical reactions was used to show that one glutamic acid residue at the active site of bovine lung angiotensin I-converting enzyme is esterified with the alkylating agent p-[N,N-bis(chloroethyl)amino] phenylbutyryl-L-Pro (chlorambucyl-L-Pro), an affinity label for this enzyme (Harris, R. B., and Wilson, I. B. (1982) J. Biol. Chem. 257, 811-815). The same procedure was used to confirm that a glutamic acid residue of carboxypeptidase A alpha is esterified by reaction with bromoacetyl-N-methyl-L-phenylalanine (Haas, G. M., and Neurath, H. (1971) Biochemistry 10, 3535-3546). In the procedure described in this paper, the esterified residue at the active site is converted to the hydroxamic acid by reaction with hydroxylamine and the hydroxamic acid is subject to the Lossen rearrangement. If a glutamic acid residue was esterified, 1 eq of 2,4-diaminobutyric acid will be formed. Aspartyl esters will give 2,3-diaminopropionic acid. The diamino acids can be quantitatively measured using the short column of an amino acid analyzer if the amount of lysine and histidine is largely decreased by modification with suitable side chain protecting groups. With carboxypeptidase A, the reactions were done on the whole undigested enzyme. With the converting enzyme, we first cleaved the esterified enzyme with cyanogen bromide. Twenty-nine cleavage peptides were separated on high performance liquid chromatography and one of these contained all of the bound radioactive inhibitor. This active site peptide was then subjected to the derivatization and Lossen procedures, and 1 eq of 2,4-diaminobutyric acid was obtained.

Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein.

PubMed Central

Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L

1993-01-01

The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364

Using centralized laboratory data to monitor trends in herpes simplex virus type 1 and 2 infection in British Columbia and the changing etiology of genital herpes.

PubMed

Gilbert, Mark; Li, Xuan; Petric, Martin; Krajden, Mel; Isaac-Renton, Judith L; Ogilvie, Gina; Rekart, Michael L

2011-01-01

Understanding the regional epidemiology of genital Herpes Simplex Virus (HSV) infections is important for clinical and public health practice, due to the increasing availability of type-specific serologic testing in Canada and the contribution of genital HSV-2 infection to ongoing HIV transmission. We used centralized laboratory data to describe trends in viral identifications of genital HSV in BC and assess the utility of these data for ongoing population surveillance. Records of viral identifications (1997-2005) were extracted from the Provincial Public Health Microbiology & Reference Laboratory database. Classification as genital or other site was based on documented specimen site. We conducted a descriptive analysis of trends over time, and calculated odds of HSV-1 infection among individuals with genital herpes. Of 48,183 viral identifications, 56.8% were genital, 10.0% were peri-oral and 9.1% cutaneous; site was unknown for 22.9%. Among genital identifications, HSV-1 infection was more likely in females, younger age groups, and later time periods. The proportion of genital herpes due to HSV-1 increased over time from 31.4% to 42.8% in BC. Our analysis of population-level laboratory data demonstrates that the proportion of genital herpes due to HSV-1 is increasing over time in BC, particularly among women and younger age groups; this has implications for clinical practice including the interpretation of type-specific serology. Provincial viral identification data are useful for monitoring the distribution of genital HSV-1 and HSV-2 infections over time. Improving clinical documentation of specimen site would improve the utility of these data.

pGlyco 2.0 enables precision N-glycoproteomics with comprehensive quality control and one-step mass spectrometry for intact glycopeptide identification.

PubMed

Liu, Ming-Qi; Zeng, Wen-Feng; Fang, Pan; Cao, Wei-Qian; Liu, Chao; Yan, Guo-Quan; Zhang, Yang; Peng, Chao; Wu, Jian-Qiang; Zhang, Xiao-Jin; Tu, Hui-Jun; Chi, Hao; Sun, Rui-Xiang; Cao, Yong; Dong, Meng-Qiu; Jiang, Bi-Yun; Huang, Jiang-Ming; Shen, Hua-Li; Wong, Catherine C L; He, Si-Min; Yang, Peng-Yuan

2017-09-05

The precise and large-scale identification of intact glycopeptides is a critical step in glycoproteomics. Owing to the complexity of glycosylation, the current overall throughput, data quality and accessibility of intact glycopeptide identification lack behind those in routine proteomic analyses. Here, we propose a workflow for the precise high-throughput identification of intact N-glycopeptides at the proteome scale using stepped-energy fragmentation and a dedicated search engine. pGlyco 2.0 conducts comprehensive quality control including false discovery rate evaluation at all three levels of matches to glycans, peptides and glycopeptides, improving the current level of accuracy of intact glycopeptide identification. The N-glycoproteome of samples metabolically labeled with 15 N/ 13 C were analyzed quantitatively and utilized to validate the glycopeptide identification, which could be used as a novel benchmark pipeline to compare different search engines. Finally, we report a large-scale glycoproteome dataset consisting of 10,009 distinct site-specific N-glycans on 1988 glycosylation sites from 955 glycoproteins in five mouse tissues.Protein glycosylation is a heterogeneous post-translational modification that generates greater proteomic diversity that is difficult to analyze. Here the authors describe pGlyco 2.0, a workflow for the precise one step identification of intact N-glycopeptides at the proteome scale.

Thermo-kinetic analysis space expansion for cyclophilin-ligand interactions - identification of a new nonpeptide inhibitor using Biacore™ T200.

PubMed

Wear, Martin A; Nowicki, Matthew W; Blackburn, Elizabeth A; McNae, Iain W; Walkinshaw, Malcolm D

2017-04-01

We have established a refined methodology for generating surface plasmon resonance sensor surfaces of recombinant his-tagged human cyclophilin-A. Our orientation-specific stabilisation approach captures his-tagged protein under 'physiological conditions' (150 mm NaCl, pH 7.5) and covalently stabilises it on Ni 2+ -nitrilotriacetic acid surfaces, very briefly activated for primary amine-coupling reactions, producing very stable and active surfaces (≥ 95% specific activity) of cyclophilin-A. Variation in protein concentration with the same contact time allows straightforward generation of variable density surfaces, with essentially no loss of activity, making the protocol easily adaptable for studying numerous interactions; from very small fragments, ~ 100 Da, to large protein ligands. This new method results in an increased stability and activity of the immobilised protein and allowed us to expand the thermo-kinetic analysis space, and to determine accurate and robust thermodynamic parameters for the cyclophilin-A-cyclosporin-A interaction. Furthermore, the increased sensitivity of the surface allowed identification of a new nonpeptide inhibitor of cyclophilin-A, from a screen of a fragment library. This fragment, 2,3-diaminopyridine, bound specifically with a mean affinity of 248 ± 60 μm. The X-ray structure of this 109-Da fragment bound in the active site of cyclophilin-A was solved to a resolution of 1.25 Å (PDB: 5LUD), providing new insight into the molecular details for a potential new series of nonpeptide cyclophilin-A inhibitors.

Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.

PubMed Central

Harris, M E; Pace, N R

1995-01-01

The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250

A novel site-specific recombination system derived from bacteriophage phiMR11.

PubMed

Rashel, Mohammad; Uchiyama, Jumpei; Ujihara, Takako; Takemura, Iyo; Hoshiba, Hiroshi; Matsuzaki, Shigenobu

2008-04-04

We report identification of a novel site-specific DNA recombination system that functions in both in vivo and in vitro, derived from lysogenic Staphylococcus aureus phage phiMR11. In silico analysis of the phiMR11 genome indicated orf1 as a putative integrase gene. Phage and bacterial attachment sites (attP and attB, respectively) and attachment junctions were determined and their nucleotide sequences decoded. Sequences of attP and attB were mostly different to each other except for a two bp common core that was the crossover point. We found several inverted repeats adjacent to the core sequence of attP as potential protein binding sites. The precise and efficient integration properties of phiMR11 integrase were shown on attP and attB in Escherichia coli and the minimum size of attP was found to be 34bp. In in vitro assays using crude or purified integrase, only buffer and substrate DNAs were required for the recombination reaction, indicating that other bacterially encoded factors are not essential for activity.

Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells.

PubMed

Le Billan, Florian; Khan, Junaid A; Lamribet, Khadija; Viengchareun, Say; Bouligand, Jérôme; Fagart, Jérôme; Lombès, Marc

2015-09-01

Aldosterone exerts its effects mainly by activating the mineralocorticoid receptor (MR), a transcription factor that regulates gene expression through complex and dynamic interactions with coregulators and transcriptional machinery, leading to fine-tuned control of vectorial ionic transport in the distal nephron. To identify genome-wide aldosterone-regulated MR targets in human renal cells, we set up a chromatin immunoprecipitation (ChIP) assay by using a specific anti-MR antibody in a differentiated human renal cell line expressing green fluorescent protein (GFP)-MR. This approach, coupled with high-throughput sequencing, allowed identification of 974 genomic MR targets. Computational analysis identified an MR response element (MRE) including single or multiple half-sites and palindromic motifs in which the AGtACAgxatGTtCt sequence was the most prevalent motif. Most genomic MR-binding sites (MBSs) are located >10 kb from the transcriptional start sites of target genes (84%). Specific aldosterone-induced recruitment of MR on the first most relevant genomic sequences was further validated by ChIP-quantitative (q)PCR and correlated with concomitant and positive aldosterone-activated transcriptional regulation of the corresponding gene, as assayed by RT-qPCR. It was notable that most MBSs lacked MREs but harbored DNA recognition motifs for other transcription factors (FOX, EGR1, AP1, PAX5) suggesting functional interaction. This work provides new insights into aldosterone MR-mediated renal signaling and opens relevant perspectives for mineralocorticoid-related pathophysiology. © FASEB.

Diversity of Arbuscular Mycorrhizal Fungi Associated with a Sb Accumulator Plant, Ramie (Boehmeria nivea), in an Active Sb Mining.

PubMed

Wei, Yuan; Chen, ZhiPeng; Wu, FengChang; Li, JiNing; ShangGuan, YuXian; Li, FaSheng; Zeng, Qing Ru; Hou, Hong

2015-08-01

Arbuscular mycorrhizal fungi (AMF) have great potential for assisting heavy metal hyperaccumulators in the remediation of contaminated soils. However, little information is available about the symbiosis of AMF associated with an antimony (Sb) accumulator plant under natural conditions. Therefore, the objective of this study was to investigate the colonization and molecular diversity of AMF associated with the Sb accumulator ramie (Boehmeria nivea) growing in Sb-contaminated soils. Four Sb mine spoils and one adjacent reference area were selected from Xikuangshan in southern China. PCR-DGGE was used to analyze the AMF community composition in ramie roots. Morphological identification was also used to analyze the species in the rhizosphere soil of ramie. Results obtained showed that mycorrhizal symbiosis was established successfully even in the most heavily polluted sites. From the unpolluted site Ref to the highest polluted site T4, the spore numbers and AMF diversity increased at first and then decreased. Colonization increased consistently with the increasing Sb concentrations in the soil. A total of 14 species were identified by morphological analysis. From the total number of species, 4 (29%) belonged to Glomus, 2 (14%) belonged to Acaulospora, 2 (14%) belonged to Funneliformis, 1 (7%) belonged to Claroideoglomus, 1 (7%) belonged to Gigaspora, 1 (7%) belonged to Paraglomus, 1 (7%) belonging to Rhizophagus, 1 (7%) belonging to Sclervocystis, and 1 (7%) belonged to Scutellospora. Some AMF sequences were present even in the most polluted site. Morphological identification and phylogenetic analysis both revealed that most species were affiliated withGlomus, suggesting that Glomus was the dominant genus in this AMF community. This study demonstrated that ramie associated with AMF may have great potential for remediation of Sb-contaminated soils.

Identification of Algerian Field-Caught Phlebotomine Sand Fly Vectors by MALDI-TOF MS

PubMed Central

Lafri, Ismail; Almeras, Lionel; Bitam, Idir; Caputo, Aurelia; Yssouf, Amina; Forestier, Claire-Lise; Izri, Arezki; Raoult, Didier; Parola, Philippe

2016-01-01

Background Phlebotomine sand flies are known to transmit Leishmania parasites, bacteria and viruses that affect humans and animals in many countries worldwide. Precise sand fly identification is essential to prevent phlebotomine-borne diseases. Over the past two decades, progress in matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has emerged as an accurate tool for arthropod identification. The objective of the present study was to investigate the usefulness of MALDI-TOF MS as a tool for identifying field-caught phlebotomine. Methodology/Principal Findings Sand flies were captured in four sites in north Algeria. A subset was morphologically and genetically identified. Six species were found in these areas and a total of 28 stored frozen specimens were used for the creation of the reference spectrum database. The relevance of this original method for sand fly identification was validated by two successive blind tests including the morphological identification of 80 new specimens which were stored at -80°C, and 292 unknown specimens, including engorged specimens, which were preserved under different conditions. Intra-species reproducibility and inter-species specificity of the protein profiles were obtained, allowing us to distinguish specimens at the gender level. Querying of the sand fly database using the MS spectra from the blind test groups revealed concordant results between morphological and MALDI-TOF MS identification. However, MS identification results were less efficient for specimens which were engorged or stored in alcohol. Identification of 362 phlebotomine sand flies, captured at four Algerian sites, by MALDI-TOF MS, revealed that the subgenus Larroussius was predominant at all the study sites, except for in M’sila where P. (Phlebotomus) papatasi was the only sand fly species detected. Conclusion The present study highlights the application of MALDI-TOF MS for monitoring sand fly fauna captured in the field. The low cost, reliability and rapidity of MALDI-TOF MS analyses opens up new ways in the management of phlebotomine sand fly-borne diseases. PMID:26771833

Identification of Algerian Field-Caught Phlebotomine Sand Fly Vectors by MALDI-TOF MS.

PubMed

Lafri, Ismail; Almeras, Lionel; Bitam, Idir; Caputo, Aurelia; Yssouf, Amina; Forestier, Claire-Lise; Izri, Arezki; Raoult, Didier; Parola, Philippe

2016-01-01

Phlebotomine sand flies are known to transmit Leishmania parasites, bacteria and viruses that affect humans and animals in many countries worldwide. Precise sand fly identification is essential to prevent phlebotomine-borne diseases. Over the past two decades, progress in matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has emerged as an accurate tool for arthropod identification. The objective of the present study was to investigate the usefulness of MALDI-TOF MS as a tool for identifying field-caught phlebotomine. Sand flies were captured in four sites in north Algeria. A subset was morphologically and genetically identified. Six species were found in these areas and a total of 28 stored frozen specimens were used for the creation of the reference spectrum database. The relevance of this original method for sand fly identification was validated by two successive blind tests including the morphological identification of 80 new specimens which were stored at -80°C, and 292 unknown specimens, including engorged specimens, which were preserved under different conditions. Intra-species reproducibility and inter-species specificity of the protein profiles were obtained, allowing us to distinguish specimens at the gender level. Querying of the sand fly database using the MS spectra from the blind test groups revealed concordant results between morphological and MALDI-TOF MS identification. However, MS identification results were less efficient for specimens which were engorged or stored in alcohol. Identification of 362 phlebotomine sand flies, captured at four Algerian sites, by MALDI-TOF MS, revealed that the subgenus Larroussius was predominant at all the study sites, except for in M'sila where P. (Phlebotomus) papatasi was the only sand fly species detected. The present study highlights the application of MALDI-TOF MS for monitoring sand fly fauna captured in the field. The low cost, reliability and rapidity of MALDI-TOF MS analyses opens up new ways in the management of phlebotomine sand fly-borne diseases.

Identification of amino acid residues important to the neuraminidase activity of the HN glycoprotein of Newcastle disease virus.

PubMed

Iorio, R M; Syddall, R J; Glickman, R L; Riel, A M; Sheehan, J P; Bratt, M A

1989-11-01

Monoclonal antibodies (MAbs) to three overlapping antigenic sites (designated 12, 2, and 23) on the hemagglutinin-neuraminidase glycoprotein (HN) of Newcastle disease virus (NDV) were previously shown to inhibit neuraminidase activity (NA) on neuraminlactose (R. M. Iorio and M. A. Bratt, 1984a, J. Immunol. 133, 2215-2219; R. M. Iorio et al., 1989, Virus Res. 13, 245-262). However, a competitive inhibitor of NA blocks the binding of only MAbs to site 23, suggesting that the domain they recognize may be closely related to the NA site. Antigenic variants selected with site 23 MAbs have single amino acid substitutions at HN residues 192, 193, or 200. Virions of variants, which have a substitution at residue 193 or 200, have alterations in NA which are not attributable to a commensurate change in HN content. A revertant of a temperature-sensitive mutant, which has markedly diminished NA relative to the wild type, has an amino acid substitution at residue 175. A second step revertant having partially restored NA has an additional substitution at residue 192 identical to that in one of the site 23 variants, which, in turn, also makes the revertant resistant to neutralization by site 23 MAbs. Thus, an amino acid substitution at residue 175, 193, or 200 of the HN of NDV can have marked effects on the NA of the protein. The amino acids in the region around residue 175 are highly conserved between the HNs of NDV and other paramyxoviruses, suggesting that this domain is important to the integrity of the NA site in this group of viruses.

The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

PubMed

Jiang, Jiming

2015-04-01

Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

[The application of genome editing in identification of plant gene function and crop breeding].

PubMed

Zhou, Xiang-chun; Xing, Yong-zhong

2016-03-01

Plant genome can be modified via current biotechnology with high specificity and excellent efficiency. Zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN) and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system are the key engineered nucleases used in the genome editing. Genome editing techniques enable gene targeted mutagenesis, gene knock-out, gene insertion or replacement at the target sites during the endogenous DNA repair process, including non-homologous end joining (NHEJ) and homologous recombination (HR), triggered by the induction of DNA double-strand break (DSB). Genome editing has been successfully applied in the genome modification of diverse plant species, such as Arabidopsis thaliana, Oryza sativa, and Nicotiana tabacum. In this review, we summarize the application of genome editing in identification of plant gene function and crop breeding. Moreover, we also discuss the improving points of genome editing in crop precision genetic improvement for further study.

Les fards rouges cosmétiques et rituels a base de cinabre et d'ocre de l'époque punique en Tunisie: analyse, identification et caractérisation.

PubMed

Alatrache, A; Mahjoub, H; Ayed, N; Ben Younes, H

2001-10-01

Natural antique colorants include mainly red pigments such as cinnabar and ochre. These archeological pigments were used especially as funeral and cosmetic makeup and are a material proof of handicraft activities and exchanges. The identification and characterization of a group of punic colorants, corresponding to samples discovered during excavations at several Tunisian archeological sites (Cartage, Ksour Essef, Kerkouane, Bekalta, Makthar, Bou Arada), were conducted using the least destructive analysis techniques such us scanning electron microscopy coupled to X-ray fluorescence microprobe, direct current plasma emission spectroscopy, atomic absorption spectrometry, Fourier transform infrared spectrometry and X-ray diffraction. Eleven natural red colorants from punic period were subject to this investigation and were compared to contemporary substances. Five colorants were cinnabar and the other six were ochre.

FISH-aimed karyotyping and characterization of Renner complexes in permanent heterozygote Rhoeo spathacea.

PubMed

Golczyk, Hieronim; Hasterok, Robert; Joachimiak, Andrzej J

2005-02-01

Fluorescence in situ hybridization (FISH) using 25S rDNA, 5S rDNA, and telomere sequences as probes was carried out in the complex permanent heterozygote Rhoeo spathacea. Telomere sites were exclusively terminal. All 10 25S rDNA loci were located distally and appeared transcriptionally active after silver staining. Six distal and 2 interstitial 5S rDNA sites were detected; 2 of the distal sites strictly colocalized with 25S rDNA loci. The 2 intercalary 5S rDNA loci occurred in short arms of 2 chromosomes that conjoined at meiosis. Chromosomes differed as to the amount of AT-rich centric heterochromatin, suggesting involvement of pericentromeric regions in translocations. The possibility of Robertsonian-like rearrangements was discussed. Double target FISH with ribosomal probes along with DAPI fluorescence gave the basis for full chromosome identification in mitosis. The 2 Renner complexes are structurally balanced, both having 5 25S and 4 5S rDNA sites. Centromere clustering, telomere association, a high number of NOR sites, and a strong tendency for formation of joint nucleoli contribute to the preservation of highly polarized Rabl arrangement at interphase. These findings were discussed in relation to meiotic catenation in Rhoeo.

Mapping of contact sites in complex formation between light-activated rhodopsin and transducin by covalent crosslinking: Use of a chemically preactivated reagent

PubMed Central

Itoh, Yoshiki; Cai, Kewen; Khorana, H. Gobind

2001-01-01

Contact sites in interaction between light-activated rhodopsin and transducin (T) have been investigated by using a chemically preactivated crosslinking reagent, N-succinimidyl 3-(2-pyridyldithio)propionate. The 3 propionyl-N-succinimidyl group in the reagent was attached by a disulfide exchange reaction to rhodopsin mutants containing single reactive cysteine groups in the cytoplasmic loops. Complex formation between the derivatized rhodopsin mutants and T was carried out by illumination at λ > 495 nm. Subsequent increase in pH (from 6 to 7.5 or higher) of the complex resulted in crosslinking of rhodopsin to the Tα subunit. Crosslinking to Tα was demonstrated for the rhodopsin mutants K141C, S240C, and K248C, and the crosslinked sites in Tα were identified for the rhodopsin mutant S240C. The peptides carrying the crosslinking moiety were isolated from the trypsin-digested peptide mixture, and their identification was carried out by matrix-assisted laser desorption ionization–time of flight mass spectrometry. The main site of crosslinking is within the peptide sequence, Leu-19–Arg-28 at the N-terminal region of Tα. The total results show that both the N and the C termini of Tα are in close vicinity to the third cytoplasmic loop of rhodopsin in the complex between rhodopsin and T. PMID:11320238

Molecular Insights into the Potential Toxicological Interaction of 2-Mercaptothiazoline with the Antioxidant Enzyme—Catalase

PubMed Central

Huang, Zhenxing; Huang, Ming; Mi, Chenyu; Wang, Tao; Chen, Dong; Teng, Yue

2016-01-01

2-mercaptothiazoline (2-MT) is widely used in many industrial fields, but its residue is potentially harmful to the environment. In this study, to evaluate the biological toxicity of 2-MT at protein level, the interaction between 2-MT and the pivotal antioxidant enzyme—catalase (CAT) was investigated using multiple spectroscopic techniques and molecular modeling. The results indicated that the CAT fluorescence quenching caused by 2-MT should be dominated by a static quenching mechanism through formation of a 2-MT/CAT complex. Furthermore, the identifications of the binding constant, binding forces, and the number of binding sites demonstrated that 2-MT could spontaneously interact with CAT at one binding site mainly via Van der Waals’ forces and hydrogen bonding. Based on the molecular docking simulation and conformation dynamic characterization, it was found that 2-MT could bind into the junctional region of CAT subdomains and that the binding site was close to enzyme active sites, which induced secondary structural and micro-environmental changes in CAT. The experiments on 2-MT toxicity verified that 2-MT significantly inhibited CAT activity via its molecular interaction, where 2-MT concentration and exposure time both affected the inhibitory action. Therefore, the present investigation provides useful information for understanding the toxicological mechanism of 2-MT at the molecular level. PMID:27537873

Contamination of soil and the medicinal plant Phyllanthus niruri Linn. with cadmium in ceramic industrial areas.

PubMed

Santos, Vanessa Santana Vieira; Arantes, Karen Magalhães; Gonçalves, Ester Luiza; Campos, Carlos Fernando; de Campos Júnior, Edimar Olegário; de Oliveira, Antônio Marcos Machado; Pereira, Boscolli Barbosa

2018-04-22

Phyllanthus niruri is a plant that is used to prevent calcium oxalate crystallisation and to block the stone formation in urolithiasis. Contaminants in the environment can be readily taken up by medicinal plants due to their ability to absorb chemicals into their tissues. If contaminated plants are ingested, they have the potential to negatively affect human and environmental health. The aim of this study was to assess contamination in the soil and the medicinal plant P. niruri by cadmium (Cd) in ceramic industrial areas of Monte Carmelo, Brazil. Soil samples and plant samples (divided in root, shoot and leaves) were collected from a contaminated monitoring site and from a rural area (which was used as a reference site for comparative purposes). The Cd concentrations of the samples were analysed with an atomic absorption spectrometer. P. niruri was found to be sensitive to soil contamination by Cd that was attributed to ceramic industrial emissions. The results revealed that Cd bioaccumulation in the roots and shoots of P. niruri was associated with a significant increase (p < 0.05) in the concentration of active lignan compounds (phyllanthin and hypophyllanthin) in the leaves. The identification of high concentrations of Cd and active lignan compounds suggests a risk of contamination of the site and the risk of a high dose of Cd to people exposed at the site.

Detection, breakpoint identification and detailed characterisation of a CNV at the FRA16D site using SNP assays.

PubMed

Winchester, L; Newbury, D F; Monaco, A P; Ragoussis, J

2008-01-01

Copy Number Variants (CNV) and other submicroscopic structural changes are now recognised to be widespread across the human genome. We show that SNP data generated for association study can be utilised for the identification of deletion CNVs. During analysis of data for an SNP association study for Specific Language Impairment (SLI) a deletion was identified. SLI adversely affects the language development of children in the absence of any obvious cause. Previous studies have found linkage to a region on chromosome 16. The deletion was located in a known fragile site FRA16D in intron 5-6 of the WWOX gene (also known as FOR). Changes in the FRA16D site have been previously linked to cancer and are often characterised in cell lines. A long-range PCR assay was used to confirm the existence of the deletion. We also show the breakpoint identification and large-scale characterisation of this CNV in a normal human sample set. Copyright 2009 S. Karger AG, Basel.

Remote identification of potential polar bear maternal denning habitat in northern Alaska using airborne LiDAR

NASA Astrophysics Data System (ADS)

Jones, B. M.; Durner, G. M.; Stoker, J.; Shideler, R.; Perham, C.; Liston, G. E.

2013-12-01

Polar bear (Ursus maritimus) populations throughout the Arctic are being threatened by reductions in critical sea ice habitat. Throughout much of their range, polar bears give birth to their young in winter dens that are excavated in snowdrifts. New-born cubs, which are unable to survive exposure to Arctic winter weather, require 2-3 months of the relatively warm, stable, and undisturbed environment of the den for their growth. In the southern Beaufort Sea (BS), polar bears may den on the Alaskan Arctic Coastal Plain (ACP).The proportion of dens occurring on land has increased because of reductions in stable multi-year ice, increases in unconsolidated ice, and lengthening of the fall open-water period. Large portions of the ACP are currently being used for oil and gas activities and proposed projects will likely expand this footprint in the near future. Since petroleum exploration and development activities increase during winter there is the potential for human activities to disturb polar bears in maternal dens. Thus, maps showing the potential distribution of terrestrial denning habitat can help to mitigate negative interactions. Prior remote sensing efforts have consisted of manual interpretation of vertical aerial photography and automated classification of Interferometric Synthetic Aperture (IfSAR) derived digital terrain models (DTM) (5-m spatial resolution) focused on the identification of snowdrift forming landscape features. In this study, we assess the feasibility of airborne Light Detection and Ranging (LiDAR) data (2-m spatial resolution) for the automated classification of potential polar bear maternal denning habitat in a 1,400 km2 area on the central portion of the ACP. The study region spans the BS coast from the Prudhoe Bay oilfield in the west to near Point Thompson in the east and extends inland from 10 to 30 km. Approximately 800 km2 of the study area contains 19 known den locations, 51 field survey sites with information on bank height and slope that were previously used to identify potential habitat, photo-interpreted denning habitat, and an IfSAR DTM. When compared to the known den locations, the photo-interpreted dataset identified all 19 sites (100%), the classified IfSAR dataset identified 18 of the 19 sites (95%), and the classified LiDAR data identified all 19 sites (100%). When compared to the 51 field survey locations located along coast, river, and lake banks, the photo-interpreted dataset correctly identified 88%, the IfSAR 75%, and the LiDAR 96%. While all methods performed reasonably well, LiDAR performed best and in addition to identifying potential habitat along river, coast, and lake bluffs, it also resolved potential habitat along pingos, erosional landscape remnants, beaded stream gulches, thermo-erosional gullies, thermokarst pits, sand dunes, and human infrastructure. These comparisons highlight the utility of using LiDAR data for the identification of potential polar bear maternal denning habitat on the Alaskan ACP.

Identification and Characterization of BMS-955176, a Second-Generation HIV-1 Maturation Inhibitor with Improved Potency, Antiviral Spectrum, and Gag Polymorphic Coverage.

PubMed

Nowicka-Sans, Beata; Protack, Tricia; Lin, Zeyu; Li, Zhufang; Zhang, Sharon; Sun, Yongnian; Samanta, Himadri; Terry, Brian; Liu, Zheng; Chen, Yan; Sin, Ny; Sit, Sing-Yuen; Swidorski, Jacob J; Chen, Jie; Venables, Brian L; Healy, Matthew; Meanwell, Nicholas A; Cockett, Mark; Hanumegowda, Umesh; Regueiro-Ren, Alicia; Krystal, Mark; Dicker, Ira B

2016-07-01

BMS-955176 is a second-generation human immunodeficiency virus type 1 (HIV-1) maturation inhibitor (MI). A first-generation MI, bevirimat, showed clinical efficacy in early-phase studies, but ∼50% of subjects had viruses with reduced susceptibility associated with naturally occurring polymorphisms in Gag near the site of MI action. MI potency was optimized using a panel of engineered reporter viruses containing site-directed polymorphic changes in Gag that reduce susceptibility to bevirimat (including V362I, V370A/M/Δ, and T371A/Δ), leading incrementally to the identification of BMS-955176. BMS-955176 exhibits potent activity (50% effective concentration [EC50], 3.9 ± 3.4 nM [mean ± standard deviation]) toward a library (n = 87) of gag/pr recombinant viruses representing 96.5% of subtype B polymorphic Gag diversity near the CA/SP1 cleavage site. BMS-955176 exhibited a median EC50 of 21 nM toward a library of subtype B clinical isolates assayed in peripheral blood mononuclear cells (PBMCs). Potent activity was maintained against a panel of reverse transcriptase, protease, and integrase inhibitor-resistant viruses, with EC50s similar to those for the wild-type virus. A 5.4-fold reduction in EC50 occurred in the presence of 40% human serum plus 27 mg/ml of human serum albumin (HSA), which corresponded well to an in vitro measurement of 86% human serum binding. Time-of-addition and pseudotype reporter virus studies confirm a mechanism of action for the compound that occurs late in the virus replication cycle. BMS-955176 inhibits HIV-1 protease cleavage at the CA/SP1 junction within Gag in virus-like particles (VLPs) and in HIV-1-infected cells, and it binds reversibly and with high affinity to assembled Gag in purified HIV-1 VLPs. Finally, in vitro combination studies showed no antagonistic interactions with representative antiretrovirals (ARVs) of other mechanistic classes. In conclusion, BMS-955176 is a second-generation MI with potent in vitro anti-HIV-1 activity and a greatly improved preclinical profile compared to that of bevirimat. Copyright © 2016 Nowicka-Sans et al.

Identification of candidate transcription factor binding sites in the cattle genome

USDA-ARS?s Scientific Manuscript database

A resource that provides candidate transcription factor binding sites does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future 'omics studies to develop transcriptional regulation hypotheses. In order to generate this resour...

Identification of catalytic sites for oxygen reduction and oxygen evolution in N-doped graphene materials: Development of highly efficient metal-free bifunctional electrocatalyst

PubMed Central

Yang, Hong Bin; Miao, Jianwei; Hung, Sung-Fu; Chen, Jiazang; Tao, Hua Bing; Wang, Xizu; Zhang, Liping; Chen, Rong; Gao, Jiajian; Chen, Hao Ming; Dai, Liming; Liu, Bin

2016-01-01

Oxygen reduction reaction (ORR) and oxygen evolution reaction (OER) are critical to renewable energy conversion and storage technologies. Heteroatom-doped carbon nanomaterials have been reported to be efficient metal-free electrocatalysts for ORR in fuel cells for energy conversion, as well as ORR and OER in metal-air batteries for energy storage. We reported that metal-free three-dimensional (3D) graphene nanoribbon networks (N-GRW) doped with nitrogen exhibited superb bifunctional electrocatalytic activities for both ORR and OER, with an excellent stability in alkaline electrolytes (for example, KOH). For the first time, it was experimentally demonstrated that the electron-donating quaternary N sites were responsible for ORR, whereas the electron-withdrawing pyridinic N moieties in N-GRW served as active sites for OER. The unique 3D nanoarchitecture provided a high density of the ORR and OER active sites and facilitated the electrolyte and electron transports. As a result, the as-prepared N-GRW holds great potential as a low-cost, highly efficient air cathode in rechargeable metal-air batteries. Rechargeable zinc-air batteries with the N-GRW air electrode in a two-electrode configuration exhibited an open-circuit voltage of 1.46 V, a specific capacity of 873 mAh g−1, and a peak power density of 65 mW cm−2, which could be continuously charged and discharged with an excellent cycling stability. Our work should open up new avenues for the development of various carbon-based metal-free bifunctional electrocatalysts of practical significance. PMID:27152333

Identification of a Catalase-Phenol Oxidase in Betalain Biosynthesis in Red Amaranth (Amaranthus cruentus)

PubMed Central

Teng, Xiao-Lu; Chen, Ning; Xiao, Xing-Guo

2016-01-01

Betalains are a group of nitrogen-containing pigments that color plants in most families of Caryophyllales. Their biosynthesis has long been proposed to begin with hydroxylation of L-tyrosine to L-DOPA through monophenolase activity of tyrosinase, but biochemical evidence in vivo remains lacking. Here we report that a Group 4 catalase, catalase-phenol oxidase (named as AcCATPO), was identified, purified and characterized from leaves of Amaranthus cruentus, a betalain plant. The purified enzyme appeared to be a homotrimeric protein composed of subunits of about 58 kDa, and demonstrated not only the catalase activity toward H2O2, but also the monophenolase activity toward L-tyrosine and diphenolase activity toward L-DOPA. Its catalase and phenol oxidase activities were inhibited by common classic catalase and tyrosinase inhibitors, respectively. All its peptide fragments identified by nano-LC-MS/MS were targeted to catalases, and matched with a cDNA-encoded polypeptide which contains both classic catalase and phenol oxidase active sites. These sites were also present in catalases of non-betalain plants analyzed. AcCATPO transcript abundance was positively correlated with the ratio of betaxanthin to betacyanin in both green and red leaf sectors of A. tricolor. These data shows that the fourth group catalase, catalase-phenol oxidase, is present in plant, and might be involved in betaxanthin biosynthesis. PMID:26779247

HPLC-Based Activity Profiling: Discovery of Piperine as a Positive GABAA Receptor Modulator Targeting a Benzodiazepine-Independent Binding Site

PubMed Central

Zaugg, Janine; Baburin, Igor; Strommer, Barbara; Kim, Hyun-Jung; Hering, Steffen; Hamburger, Matthias

2011-01-01

A plant extract library was screened for GABAA receptor activity making use of a two-microelectrode voltage clamp assay on Xenopus laevis oocytes. An ethyl acetate extract of black pepper fruits [Piper nigrum L. (Piperaceae) 100 μg/mL] potentiated GABA-induced chloride currents through GABAA receptors (composed of α1, β2, and γ2S subunits) by 169.1 ± 2.4%. With the aid of an HPLC-based activity profiling approach, piperine (5) was identified as the main active compound, together with 12 structurally related less active or inactive piperamides (1–4, 6–13). Identification was achieved by on-line high-resolution mass spectrometry and off-line microprobe 1D and 2D NMR spectroscopy, using only milligram amounts of extract. Compound 5 induced a maximum potentiation of the chloride currents by 301.9 ± 26.5% with an EC50 of 52.4 ± 9.4 μM. A comparison of the modulatory activity of 5 and other naturally occurring piperamides enabled insights into structural features critical for GABAA receptor modulation. The stimulation of chloride currents through GABAA receptors by compound 5 was not antagonized by flumazenil (10 μM). These data show that piperine (5) represents a new scaffold of positive allosteric GABAA receptor modulators targeting a benzodiazepine-independent binding site. PMID:20085307

Human embryonic stem cell phosphoproteome revealed by electron transfer dissociation tandem mass spectrometry

PubMed Central

Swaney, Danielle L.; Wenger, Craig D.; Thomson, James A.; Coon, Joshua J.

2009-01-01

Protein phosphorylation is central to the understanding of cellular signaling, and cellular signaling is suggested to play a major role in the regulation of human embryonic stem (ES) cell pluripotency. Here, we describe the use of conventional tandem mass spectrometry-based sequencing technology—collision-activated dissociation (CAD)—and the more recently developed method electron transfer dissociation (ETD) to characterize the human ES cell phosphoproteome. In total, these experiments resulted in the identification of 11,995 unique phosphopeptides, corresponding to 10,844 nonredundant phosphorylation sites, at a 1% false discovery rate (FDR). Among these phosphorylation sites are 5 localized to 2 pluripotency critical transcription factors—OCT4 and SOX2. From these experiments, we conclude that ETD identifies a larger number of unique phosphopeptides than CAD (8,087 to 3,868), more frequently localizes the phosphorylation site to a specific residue (49.8% compared with 29.6%), and sequences whole classes of phosphopeptides previously unobserved. PMID:19144917

Effectiveness of scat detection dogs for detecting forest carnivores

USGS Publications Warehouse

Long, Robert A.; Donovan, T.M.; MacKay, Paula; Zielinski, William J.; Buzas, Jeffrey S.

2007-01-01

We assessed the detection and accuracy rates of detection dogs trained to locate scats from free-ranging black bears (Ursus americanus), fishers (Martes pennanti), and bobcats (Lynx rufus). During the summers of 2003-2004, 5 detection teams located 1,565 scats (747 putative black bear, 665 putative fisher, and 153 putative bobcat) at 168 survey sites throughout Vermont, USA. Of 347 scats genetically analyzed for species identification, 179 (51.6%) yielded a positive identification, 131 (37.8%) failed to yield DNA information, and 37 (10.7%) yielded DNA but provided no species confirmation. For 70 survey sites where confirmation of a putative target species' scat was not possible, we assessed the probability that ???1 of the scats collected at the site was deposited by the target species (probability of correct identification; P ID). Based on species confirmations or PID values, we detected bears at 57.1% (96) of sites, fishers at 61.3% (103) of sites, and bobcats at 12.5%o (21) of sites. We estimated that the mean probability of detecting the target species (when present) during a single visit to a site was 0.86 for black bears, 0.95 for fishers, and 0.40 for bobcats. The probability of detecting black bears was largely unaffected by site- or visit-specific covariates, but the probability of detecting fishers varied by detection team. We found little or no effect of topographic ruggedness, vegetation density, or local weather (e.g., temp, humidity) on detection probability for fishers or black bears (data were insufficient for bobcat analyses). Detection dogs were highly effective at locating scats from forest carnivores and provided an efficient and accurate method for collecting detection-nondetection data on multiple species.

Quantitative site-specific reactivity profiling of S-nitrosylation in mouse skeletal muscle using cysteinyl peptide enrichment coupled with mass spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Dian; Shukla, Anil K.; Chen, Baowei

2013-04-01

S-nitrosylation (SNO) is an important reversible thiol oxidation event that has been increasingly recognized for its role in cell signaling. While many proteins susceptible to S-nitrosylation have been reported, site-specific identification of physiologically relevant SNO modifications remains an analytical challenge due to the low-abundance and labile nature of the modification. Herein we present further improvement and optimization of the recently reported, resin-assisted cysteinyl peptide enrichment protocol for SNO identification and the extension of this application to mouse skeletal muscle to identify specific sites sensitive to S-nitrosylation by quantitative reactivity profiling. The results of our data indicate that the protein- andmore » peptide-level enrichment protocols provide comparable specificity and coverage of SNO-peptide identifications. S-nitrosylation reactivity profiling was performed by quantitatively comparing the site-specific SNO modification levels in samples treated with S-nitrosoglutathione (GSNO), an NO donor, at two different physiologically relevant concentrations (i.e., 10 μM and 100 μM). The reactivity profiling experiments overall identified 489 SNO-modified cysteine sites from 197 proteins with the specificity of 95.2% at the unique-peptide-level based on the percentage of Cys-peptides. Among these sites, 260 sites from 135 proteins were observed with relatively high reactivity to S-nitrosylation; such SNO-sensitive sites are more likely to be physiologically relevant. Many of the SNO-sensitive proteins are preferentially localized in mitochondria, contractile fiber and actin cytoskeleton, suggesting the susceptibility of these subcellular compartments to redox regulation. Moreover, the SNO-sensitive proteins seem to be primarily involved in metabolic pathways, including TCA cycle, glycolysis/gluconeogenesis, glutathione metabolism, and fatty acid metabolism, suggesting the importance of redox regulation in muscle metabolism and insulin action.« less

21 CFR 882.5900 - Preformed craniosynostosis strip.

Code of Federal Regulations, 2012 CFR

2012-04-01

... craniosynostosis strip. (a) Identification. A preformed craniosynostosis strip is a plastic strip used to cover bone edges of craniectomy sites (sites where the skull has been cut) to prevent the bone from regrowing...

21 CFR 882.5900 - Preformed craniosynostosis strip.

Code of Federal Regulations, 2014 CFR

2014-04-01

... craniosynostosis strip. (a) Identification. A preformed craniosynostosis strip is a plastic strip used to cover bone edges of craniectomy sites (sites where the skull has been cut) to prevent the bone from regrowing...

21 CFR 882.5900 - Preformed craniosynostosis strip.

Code of Federal Regulations, 2013 CFR

2013-04-01

... craniosynostosis strip. (a) Identification. A preformed craniosynostosis strip is a plastic strip used to cover bone edges of craniectomy sites (sites where the skull has been cut) to prevent the bone from regrowing...

21 CFR 882.5900 - Preformed craniosynostosis strip.

Code of Federal Regulations, 2011 CFR

2011-04-01

... craniosynostosis strip. (a) Identification. A preformed craniosynostosis strip is a plastic strip used to cover bone edges of craniectomy sites (sites where the skull has been cut) to prevent the bone from regrowing...

Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

PubMed Central

Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

2013-01-01

Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

Identification of an Intronic Splicing Enhancer Essential for the Inclusion of FGFR2 Exon IIIc*S⃞

PubMed Central

Seth, Puneet; Miller, Heather B.; Lasda, Erika L.; Pearson, James L.; Garcia-Blanco, Mariano A.

2008-01-01

The ligand specificity of fibroblast growth factor receptor 2 (FGFR2) is determined by the alternative splicing of exons 8 (IIIb) or 9 (IIIc). Exon IIIb is included in epithelial cells, whereas exon IIIc is included in mesenchymal cells. Although a number of cis elements and trans factors have been identified that play a role in exon IIIb inclusion in epithelium, little is known about the activation of exon IIIc in mesenchyme. We report here the identification of a splicing enhancer required for IIIc inclusion. This 24-nucleotide (nt) downstream intronic splicing enhancer (DISE) is located within intron 9 immediately downstream of exon IIIc. DISE was able to activate the inclusion of heterologous exons rat FGFR2 IIIb and human β-globin exon 2 in cell lines from different tissues and species and also in HeLa cell nuclear extracts in vitro. DISE was capable of replacing the intronic activator sequence 1 (IAS1), a known IIIb splicing enhancer and vice versa. This fact, together with the requirement for DISE to be close to the 5′-splice site and the ability of DISE to promote binding of U1 snRNP, suggested that IAS1 and DISE belong to the same class of cis-acting elements. PMID:18256031

Identification of amino acid residues involved in substrate specificity of plant acyl-ACP thioesterases using a bioinformatics-guided approach

PubMed Central

Mayer, Kimberly M; Shanklin, John

2007-01-01

Background The large amount of available sequence information for the plant acyl-ACP thioesterases (TEs) made it possible to use a bioinformatics-guided approach to identify amino acid residues involved in substrate specificity. The Conserved Property Difference Locator (CPDL) program allowed the identification of putative specificity-determining residues that differ between the FatA and FatB TE classes. Six of the FatA residue differences identified by CPDL were incorporated into the FatB-like parent via site-directed mutagenesis and the effect of each on TE activity was determined. Variants were expressed in E. coli strain K27 that allows determination of enzyme activity by GCMS analysis of fatty acids released into the medium. Results Substitutions at four of the positions (74, 86, 141, and 174) changed substrate specificity to varying degrees while changes at the remaining two positions, 110 and 221, essentially inactivated the thioesterase. The effects of substitutions at positions 74, 141, and 174 (3-MUT) or 74, 86, 141, 174 (4-MUT) were not additive with respect to specificity. Conclusion Four of six putative specificity determining positions in plant TEs, identified with the use of CPDL, were validated experimentally; a novel colorimetric screen that discriminates between active and inactive TEs is also presented. PMID:17201914

A machine-learning approach for predicting palmitoylation sites from integrated sequence-based features.

PubMed

Li, Liqi; Luo, Qifa; Xiao, Weidong; Li, Jinhui; Zhou, Shiwen; Li, Yongsheng; Zheng, Xiaoqi; Yang, Hua

2017-02-01

Palmitoylation is the covalent attachment of lipids to amino acid residues in proteins. As an important form of protein posttranslational modification, it increases the hydrophobicity of proteins, which contributes to the protein transportation, organelle localization, and functions, therefore plays an important role in a variety of cell biological processes. Identification of palmitoylation sites is necessary for understanding protein-protein interaction, protein stability, and activity. Since conventional experimental techniques to determine palmitoylation sites in proteins are both labor intensive and costly, a fast and accurate computational approach to predict palmitoylation sites from protein sequences is in urgent need. In this study, a support vector machine (SVM)-based method was proposed through integrating PSI-BLAST profile, physicochemical properties, [Formula: see text]-mer amino acid compositions (AACs), and [Formula: see text]-mer pseudo AACs into the principal feature vector. A recursive feature selection scheme was subsequently implemented to single out the most discriminative features. Finally, an SVM method was implemented to predict palmitoylation sites in proteins based on the optimal features. The proposed method achieved an accuracy of 99.41% and Matthews Correlation Coefficient of 0.9773 for a benchmark dataset. The result indicates the efficiency and accuracy of our method in prediction of palmitoylation sites based on protein sequences.

BIOGENIC VOLATILE ORGANIC COMPOUND EMISSIONS (BVOCS) I. IDENTIFICATIONS FROM THREE CONTINENTAL SITES IN THE U.S.

EPA Science Inventory

Vegetation composition and biomass were surveyed for three specific sites in Atlanta, GA; near Rhinelander, WI; and near Hayden, CO. At each research site, emissions of biogenic volatile organic compounds (BVOCs) from the dominant vegetation species were sampled by enclosing bran...

40 CFR 270.110 - What must I include in my application for a RAP?

Code of Federal Regulations, 2010 CFR

2010-07-01

... EPA identification number of the remediation waste management site; (b) The name, address, and... States Geological Survey (USGS) or county map showing the location of the remediation waste management site; (e) A scaled drawing of the remediation waste management site showing: (1) The remediation waste...

Identification and characterization of PPARα ligands in the hippocampus

PubMed Central

Roy, Avik; Kundu, Madhuchhanda; Jana, Malabendu; Mishra, Rama K.; Yung, Yeni; Luan, Chi-Hao; Gonzalez, Frank J.; Pahan, Kalipada

2016-01-01

Peroxisome proliferator-activated receptor alpha (PPARα) regulates hepatic fatty acid catabolism and mediates the metabolic response to starvation. Recently, we have found that PPARα is constitutively activated in nuclei of hippocampal neurons and controls plasticity via direct transcriptional activation of CREB. Here, three endogenous ligands of PPARα, 3-hydroxy-(2,2)-dimethyl butyrate, hexadecanamide, and 9-octadecenamide were discovered in mouse brain hippocampus. Mass spectrometric detection of these compounds in mouse hippocampal nuclear extracts, in silico interaction studies, time-resolved FRET analyses, and thermal shift assay clearly indicated that these three compounds served as ligands of PPARα. Site-directed mutagenesis studies further revealed that PPARα Tyr 464 and Tyr 314 were involved in binding these hippocampal ligands. Moreover, these ligands activated PPARα and upregulated synaptic function of hippocampal neurons. These results highlight the discovery of hippocampal ligands of PPARα capable of modulating synaptic functions. PMID:27748752

Identification and characterization of PPARα ligands in the hippocampus.

PubMed

Roy, Avik; Kundu, Madhuchhanda; Jana, Malabendu; Mishra, Rama K; Yung, Yeni; Luan, Chi-Hao; Gonzalez, Frank J; Pahan, Kalipada

2016-12-01

Peroxisome proliferator-activated receptor-α (PPARα) regulates hepatic fatty acid catabolism and mediates the metabolic response to starvation. Recently we found that PPARα is constitutively activated in nuclei of hippocampal neurons and controls plasticity via direct transcriptional activation of CREB. Here we report the discovery of three endogenous PPARα ligands-3-hydroxy-(2,2)-dimethyl butyrate, hexadecanamide, and 9-octadecenamide-in mouse brain hippocampus. Mass spectrometric detection of these compounds in mouse hippocampal nuclear extracts, in silico interaction studies, time-resolved FRET analyses, and thermal shift assay results clearly indicated that these three compounds served as ligands of PPARα. Site-directed mutagenesis studies further revealed that PPARα Y464 and Y314 are involved in binding these hippocampal ligands. Moreover, these ligands activated PPARα and upregulated the synaptic function of hippocampal neurons. These results highlight the discovery of hippocampal ligands of PPARα capable of modulating synaptic functions.

Preliminary phytochemical screening and in vitro antioxidant activities of Parkinsonia aculeata Linn.

PubMed

Sharma, Sonia; Vig, Adarsh Pal

2014-01-01

Butanol and hexane leaves extracts of Parkinsonia aculeata L. (Fabaceae) were assessed for its antioxidant potential by in vitro methods. Phytochemical analysis and antioxidant activity of plant extracts were studied using different in vitro assays. UPLC analysis of extracts was carried out for the identification of chemical constituents. The total phenolic contents of the butanol and hexane leaf extract were 42 mgGAE/g and 34 mgGAE/g whereas flavonoid contents of these extracts were found to be 0.044 mgRE/g and 0.005 mgRE/g, respectively. Among both extracts, butanol extract shows maximum inhibition (%) of 93.88%, 80.02%, 52.06%, 94.68%, and 69.37% in DPPH, non-site-specific and site-specific, FTC, and TBA assays and absorbance of 0.852 and 0.522 in reducing power and CUPRAC assay at the highest concentration tested. The FRAP and TAC values of butanol extract were found to be 678 μM Fe(II)/g and 36 mgAAE/100 mg. UPLC analysis of extracts revealed the presence of various polyphenols. The tested plant extracts were found to possess potent antioxidant and free radical scavenging activity which may be due to the presence of flavonoids and polyphenols.

Evaluation of Final Radiological Conditions at Areas of the Niagara Falls Storage Site Remediated under the Formerly Utilized Sites Remedial Action Program - 12184

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clayton, Christopher; Kothari, Vijendra; Starr, Ken

2012-07-01

The U.S. Department of Energy (DOE) methods and protocols allow evaluation of remediation and final site conditions to determine if remediated sites remain protective. Two case studies are presented that involve the Niagara Falls Storage Site (NFSS) and associated vicinity properties (VPs), which are being remediated under the Formerly Utilized Sites Remedial Action Program (FUSRAP). These properties are a part of the former Lake Ontario Ordnance Works (LOOW). In response to stakeholders concerns about whether certain remediated NFSS VPs were putting them at risk, DOE met with stakeholders and agreed to evaluate protectiveness. Documentation in the DOE records collection adequatelymore » described assessed and final radiological conditions at the completed VPs. All FUSRAP wastes at the completed sites were cleaned up to meet DOE guidelines for unrestricted use. DOE compiled the results of the investigation in a report that was released for public comment. In conducting the review of site conditions, DOE found that stakeholders were also concerned about waste from the Separations Process Research Unit (SPRU) at the Knolls Atomic Power Laboratory (KAPL) that was handled at LOOW. DOE agreed to determine if SPRU waste remained at that needed to be remediated. DOE reviewed records of waste characterization, historical handling locations and methods, and assessment and remediation data. DOE concluded that the SPRU waste was remediated on the LOOW to levels that pose no unacceptable risk and allow unrestricted use and unlimited exposure. This work confirms the following points as tenets of an effective long-term surveillance and maintenance (LTS and M) program: - Stakeholder interaction must be open and transparent, and DOE must respond promptly to stakeholder concerns. - DOE, as the long-term custodian, must collect and preserve site records in order to demonstrate that remediated sites pose no unacceptable risk. - DOE must continue to maintain constructive relationships with the U.S. Army Corps of Engineers and state and federal regulators. After review of historical site documentation, DOE reports, and USACE radiological data, DOE concluded the following: - DOE had access to adequate documentation to evaluate site conditions at the former LOOW. This is important to confirm now, while institutional knowledge of early FUSRAP work remains available. - DOE remediated the completed VPs to conditions that are protective for unrestricted residential use. Sample and walkover gamma scan results indicate that no wastes remain that exceed cleanup criteria. - Process knowledge and field observations establish that Cs-137 is the predominant radionuclide in the KAPL waste stream. Cs-137, a strong gamma emitter, was used as an indicator for remediation of KAPL waste. Other radionuclides were present in much lower relative concentrations and were likely also removed during remediation of the VPs. - KAPL contaminants were removed during remedial activities at the former LOOW as either co-located or co-mingled with other radionuclides. - For the active VPs (VP-E, VP-E', and VP-G), results of DOE's cleanup of the accessible portions of these properties indicate that KAPL waste does not remain at concentrations greater than the DOE cleanup limit: - Inaccessible areas were not associated with historic KAPL waste handling. Therefore, it is unlikely that KAPL waste remains on the active VPs. - Because gamma activity was used by DOE during remediation/verification activities for excavation control, additional USACE cleanup of FUSRAP wastes on these properties will likely result in the remediation of any co-located residual KAPL wastes to acceptable levels or identification of KAPL waste that is not co-located. - Although USACE has not established a cleanup level for Cs-137 on the active NFSS VPs, DOE assessment and remediation data indicate that assessed Cs-137 was remediated and significant Cs-137 is unlikely to remain. Because of the low likelihood of encountering significant KAPL waste on the active NFSS VPs, additional remediation is not anticipated at these properties. - USACE assessment soil sampling results on the NFSS proper indicate that KAPL waste does not exceed the DOE cleanup level for Cs-137. USACE has not established a cleanup level for Cs-137 on NFSS proper. The USACE cleanup of FUSRAP wastes on the NFSS proper will likely result in the remediation of any co-located residual KAPL wastes or identification of KAPL waste that is not co-located. DOE is drafting a report of the investigation of KAPL waste at LOOW. The report will be released to the public for comment when the draft is complete. DOE responses to stakeholder inquiries resulted in a common understanding of site conditions and site risk. DOE expects additional interaction with stakeholders at the former LOOW as USACE completes remediation of the active VPs and the NFSS proper, and these relationships will hopefully have built trust between DOE and the stakeholders that DOE will perform its duties in an open and transparent manner that includes stakeholders as stewards for remediated FUSRAP sites. (authors)« less

Estimating the Efficiency of Phosphopeptide Identification by Tandem Mass Spectrometry

NASA Astrophysics Data System (ADS)

Hsu, Chuan-Chih; Xue, Liang; Arrington, Justine V.; Wang, Pengcheng; Paez Paez, Juan Sebastian; Zhou, Yuan; Zhu, Jian-Kang; Tao, W. Andy

2017-06-01

Mass spectrometry has played a significant role in the identification of unknown phosphoproteins and sites of phosphorylation in biological samples. Analyses of protein phosphorylation, particularly large scale phosphoproteomic experiments, have recently been enhanced by efficient enrichment, fast and accurate instrumentation, and better software, but challenges remain because of the low stoichiometry of phosphorylation and poor phosphopeptide ionization efficiency and fragmentation due to neutral loss. Phosphoproteomics has become an important dimension in systems biology studies, and it is essential to have efficient analytical tools to cover a broad range of signaling events. To evaluate current mass spectrometric performance, we present here a novel method to estimate the efficiency of phosphopeptide identification by tandem mass spectrometry. Phosphopeptides were directly isolated from whole plant cell extracts, dephosphorylated, and then incubated with one of three purified kinases—casein kinase II, mitogen-activated protein kinase 6, and SNF-related protein kinase 2.6—along with 16O4- and 18O4-ATP separately for in vitro kinase reactions. Phosphopeptides were enriched and analyzed by LC-MS. The phosphopeptide identification rate was estimated by comparing phosphopeptides identified by tandem mass spectrometry with phosphopeptide pairs generated by stable isotope labeled kinase reactions. Overall, we found that current high speed and high accuracy mass spectrometers can only identify 20%-40% of total phosphopeptides primarily due to relatively poor fragmentation, additional modifications, and low abundance, highlighting the urgent need for continuous efforts to improve phosphopeptide identification efficiency. [Figure not available: see fulltext.

Simultaneous Glycan-Peptide Characterization Using Hydrophilic Interaction Chromatography and Parallel Fragmentation by CID, Higher Energy Collisional Dissociation, and Electron Transfer Dissociation MS Applied to the N-Linked Glycoproteome of Campylobacter jejuni*

PubMed Central

Scott, Nichollas E.; Parker, Benjamin L.; Connolly, Angela M.; Paulech, Jana; Edwards, Alistair V. G.; Crossett, Ben; Falconer, Linda; Kolarich, Daniel; Djordjevic, Steven P.; Højrup, Peter; Packer, Nicolle H.; Larsen, Martin R.; Cordwell, Stuart J.

2011-01-01

Campylobacter jejuni is a gastrointestinal pathogen that is able to modify membrane and periplasmic proteins by the N-linked addition of a 7-residue glycan at the strict attachment motif (D/E)XNX(S/T). Strategies for a comprehensive analysis of the targets of glycosylation, however, are hampered by the resistance of the glycan-peptide bond to enzymatic digestion or β-elimination and have previously concentrated on soluble glycoproteins compatible with lectin affinity and gel-based approaches. We developed strategies for enriching C. jejuni HB93-13 glycopeptides using zwitterionic hydrophilic interaction chromatography and examined novel fragmentation, including collision-induced dissociation (CID) and higher energy collisional (C-trap) dissociation (HCD) as well as CID/electron transfer dissociation (ETD) mass spectrometry. CID/HCD enabled the identification of glycan structure and peptide backbone, allowing glycopeptide identification, whereas CID/ETD enabled the elucidation of glycosylation sites by maintaining the glycan-peptide linkage. A total of 130 glycopeptides, representing 75 glycosylation sites, were identified from LC-MS/MS using zwitterionic hydrophilic interaction chromatography coupled to CID/HCD and CID/ETD. CID/HCD provided the majority of the identifications (73 sites) compared with ETD (26 sites). We also examined soluble glycoproteins by soybean agglutinin affinity and two-dimensional electrophoresis and identified a further six glycosylation sites. This study more than doubles the number of confirmed N-linked glycosylation sites in C. jejuni and is the first to utilize HCD fragmentation for glycopeptide identification with intact glycan. We also show that hydrophobic integral membrane proteins are significant targets of glycosylation in this organism. Our data demonstrate that peptide-centric approaches coupled to novel mass spectrometric fragmentation techniques may be suitable for application to eukaryotic glycoproteins for simultaneous elucidation of glycan structures and peptide sequence. PMID:20360033

Simultaneous glycan-peptide characterization using hydrophilic interaction chromatography and parallel fragmentation by CID, higher energy collisional dissociation, and electron transfer dissociation MS applied to the N-linked glycoproteome of Campylobacter jejuni.

PubMed

Scott, Nichollas E; Parker, Benjamin L; Connolly, Angela M; Paulech, Jana; Edwards, Alistair V G; Crossett, Ben; Falconer, Linda; Kolarich, Daniel; Djordjevic, Steven P; Højrup, Peter; Packer, Nicolle H; Larsen, Martin R; Cordwell, Stuart J

2011-02-01

Campylobacter jejuni is a gastrointestinal pathogen that is able to modify membrane and periplasmic proteins by the N-linked addition of a 7-residue glycan at the strict attachment motif (D/E)XNX(S/T). Strategies for a comprehensive analysis of the targets of glycosylation, however, are hampered by the resistance of the glycan-peptide bond to enzymatic digestion or β-elimination and have previously concentrated on soluble glycoproteins compatible with lectin affinity and gel-based approaches. We developed strategies for enriching C. jejuni HB93-13 glycopeptides using zwitterionic hydrophilic interaction chromatography and examined novel fragmentation, including collision-induced dissociation (CID) and higher energy collisional (C-trap) dissociation (HCD) as well as CID/electron transfer dissociation (ETD) mass spectrometry. CID/HCD enabled the identification of glycan structure and peptide backbone, allowing glycopeptide identification, whereas CID/ETD enabled the elucidation of glycosylation sites by maintaining the glycan-peptide linkage. A total of 130 glycopeptides, representing 75 glycosylation sites, were identified from LC-MS/MS using zwitterionic hydrophilic interaction chromatography coupled to CID/HCD and CID/ETD. CID/HCD provided the majority of the identifications (73 sites) compared with ETD (26 sites). We also examined soluble glycoproteins by soybean agglutinin affinity and two-dimensional electrophoresis and identified a further six glycosylation sites. This study more than doubles the number of confirmed N-linked glycosylation sites in C. jejuni and is the first to utilize HCD fragmentation for glycopeptide identification with intact glycan. We also show that hydrophobic integral membrane proteins are significant targets of glycosylation in this organism. Our data demonstrate that peptide-centric approaches coupled to novel mass spectrometric fragmentation techniques may be suitable for application to eukaryotic glycoproteins for simultaneous elucidation of glycan structures and peptide sequence.

Reduction of Urease Activity by Interaction with the Flap Covering the Active Site

PubMed Central

Macomber, Lee; Minkara, Mona S.; Hausinger, Robert P.; Merz, Kenneth M.

2015-01-01

With the increasing appreciation for the human microbiome coupled with the global rise of antibiotic resistant organisms, it is imperative that new methods be developed to specifically target pathogens. To that end, a novel computational approach was devised to identify compounds that reduce the activity of urease, a medically important enzyme of Helicobacter pylori, Proteus mirabilis, and many other microorganisms. Urease contains a flexible loop that covers its active site; Glide was used to identify small molecules predicted to lock this loop in an open conformation. These compounds were screened against the model urease from Klebsiella aerogenes and the natural products epigallocatechin and quercetin were shown to inhibit at low and high micromolar concentrations, respectively. These molecules exhibit a strong time-dependent inactivation of urease that was not due to their oxygen sensitivity. Rather, these compounds appear to inactivate urease by reacting with a specific Cys residue located on the flexible loop. Substitution of this cysteine by alanine in the C319A variant increased the urease resistance to both epigallocatechin and quercetin, as predicted by the computational studies. Protein dynamics are integral to the function of many enzymes; thus, identification of compounds that lock an enzyme into a single conformation presents a useful approach to define potential inhibitors. PMID:25594724

Ultrasonographic visualization of bleeding sites can help control postpartum hemorrhage using intrauterine balloon tamponade.

PubMed

Kondoh, Eiji; Konishi, Mitsunaga; Kariya, Yoshitaka; Konishi, Ikuo

2015-01-01

Identification of precise bleeding sites is generally important to control hemorrhage. Nevertheless, the optimal technique to detect the bleeding sites has not yet been fully defined for patients with life-threatening post partum hemorrhage. We describe that ultrasonographic visualization of bleeding sites can help control post partum hemorrhage using intrauterine balloon tamponade. © 2014 Wiley Periodicals, Inc.

Identification of the HrpS binding site in the hrpL promoter and effect of the RpoN binding site of HrpS on the regulation of the type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Sundin, George W; Zhao, Youfu

2016-06-01

The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.

Timber Resources Inventory and Monitoring Joint Research Project

NASA Technical Reports Server (NTRS)

Hill, C. L.

1985-01-01

Primary objectives were to develop remote sensing analysis techniques for extracting forest related information from LANDSAT Multispectral Scanner (MMS) and Thematic Mapper data and to determine the extent to which International Paper Company information needs can be addressed with remote sensing information. The company actively manages 8.4 million acres of forest land. Traditionally, their forest inventories, updated on a three year cycle, are conducted through field surveys and aerial photography. The results reside in a digital forest data base containing 240 descriptive parameteres for individual forest stands. The information in the data base is used to develop seasonal and long range management strategies. Forest stand condition assessements (species composition, age, and density stratification) and identification of silvicultural activities (site preparation, planting, thinning, and harvest) are addressed.

Prdm9 controls activation of mammalian recombination hotspots.

PubMed

Parvanov, Emil D; Petkov, Petko M; Paigen, Kenneth

2010-02-12

Mammalian meiotic recombination, which preferentially occurs at specialized sites called hotspots, ensures the orderly segregation of meiotic chromosomes and creates genetic variation among offspring. A locus on mouse chromosome 17, which controls activation of recombination at multiple distant hotspots, has been mapped within a 181-kilobase interval, three of whose genes can be eliminated as candidates. The remaining gene, Prdm9, codes for a zinc finger containing histone H3K4 trimethylase that is expressed in early meiosis and whose deficiency results in sterility in both sexes. Mus musculus exhibits five alleles of Prdm9; human populations exhibit two predominant alleles and multiple minor alleles. The identification of Prdm9 as a protein regulating mammalian recombination hotspots initiates molecular studies of this important biological control system.

Structural basis for selective inhibition of Cyclooxygenase-1 (COX-1) by diarylisoxazoles mofezolac and 3-(5-chlorofuran-2-yl)-5-methyl-4-phenylisoxazole (P6).

PubMed

Cingolani, Gino; Panella, Andrea; Perrone, Maria Grazia; Vitale, Paola; Di Mauro, Giuseppe; Fortuna, Cosimo G; Armen, Roger S; Ferorelli, Savina; Smith, William L; Scilimati, Antonio

2017-09-29

The diarylisoxazole molecular scaffold is found in several NSAIDs, especially those with high selectivity for COX-1. Here, we have determined the structural basis for COX-1 binding to two diarylisoxazoles: mofezolac, which is polar and ionizable, and 3-(5-chlorofuran-2-yl)-5-methyl-4-phenylisoxazole (P6) that has very low polarity. X-ray analysis of the crystal structures of COX-1 bound to mofezolac and 3-(5-chlorofuran-2-yl)-5-methyl-4-phenylisoxazole allowed the identification of specific binding determinants within the enzyme active site, relevant to generate structure/activity relationships for diarylisoxazole NSAIDs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

A Xylenol Orange-Based Screening Assay for the Substrate Specificity of Flavin-Dependent para-Phenol Oxidases.

PubMed

Ewing, Tom A; van Noord, Aster; Paul, Caroline E; van Berkel, Willem J H

2018-01-14

Vanillyl alcohol oxidase (VAO) and eugenol oxidase (EUGO) are flavin-dependent enzymes that catalyse the oxidation of para -substituted phenols. This makes them potentially interesting biocatalysts for the conversion of lignin-derived aromatic monomers to value-added compounds. To facilitate their biocatalytic exploitation, it is important to develop methods by which variants of the enzymes can be rapidly screened for increased activity towards substrates of interest. Here, we present the development of a screening assay for the substrate specificity of para -phenol oxidases based on the detection of hydrogen peroxide using the ferric-xylenol orange complex method. The assay was used to screen the activity of VAO and EUGO towards a set of twenty-four potential substrates. This led to the identification of 4-cyclopentylphenol as a new substrate of VAO and EUGO and 4-cyclohexylphenol as a new substrate of VAO. Screening of a small library of VAO and EUGO active-site variants for alterations in their substrate specificity led to the identification of a VAO variant (T457Q) with increased activity towards vanillyl alcohol (4-hydroxy-3-methoxybenzyl alcohol) and a EUGO variant (V436I) with increased activity towards chavicol (4-allylphenol) and 4-cyclopentylphenol. This assay provides a quick and efficient method to screen the substrate specificity of para -phenol oxidases, facilitating the enzyme engineering of known para- phenol oxidases and the evaluation of the substrate specificity of novel para -phenol oxidases.

Identification and clarification of the role of key active site residues in bacterial glutathione S-transferase zeta/maleylpyruvate isomerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Ti; Li, De-Feng; Zhou, Ning-Yi, E-mail: n.zhou@pentium.whiov.ac.cn

2011-07-08

Highlights: {yields} Application of site-directed mutagenesis to probe the active site residues of glutathione-dependent maleylpyruvate isomerase. {yields} Two conserved residues, Arg8 and Arg176, in zeta class glutathione S-transferases are critical for maleylpyruvate orientation and enolization. {yields} Arg109, found exclusively in NagL, participates in k{sub cat} regulation. {yields} The T11A mutant exhibited a significantly decreased K{sub m} value for glutathione with little impact on maleylpyruvate kinetics. {yields} The Thr11 residue appears to have significance in the evolution of glutathione S-transferase classes. -- Abstract: The maleylpyruvate isomerase NagL from Ralstonia sp. strain U2, which has been structurally characterized previously, catalyzes the isomerizationmore » of maleylpyruvate to fumarylpyruvate. It belongs to the class zeta glutathione S-transferases (GSTZs), part of the cytosolic GST family (cGSTs). In this study, site-directed mutagenesis was conducted to probe the functions of 13 putative active site residues. Steady-state kinetic information for mutants in the reduced glutathione (GSH) binding site, suggested that (a) Gln64 and Asp102 interact directly with the glutamyl moiety of glutathione, (b) Gln49 and Gln64 are involved in a potential electron-sharing network that influences the ionization of the GSH thiol. The information also suggests that (c) His38, Asn108 and Arg109 interact with the GSH glycine moiety, (d) His104 has a role in the ionization of the GSH sulfur and the stabilization of the maleyl terminal carboxyl group in the reaction intermediate and (e) Arg110 influences the electron distribution in the active site and therefore the ionization of the GSH thiolate. Kinetic data for mutants altered in the substrate-binding site imply that (a) Arg8 and Arg176 are critical for maleylpyruvate orientation and enolization, and (b) Arg109 (exclusive to NagL) participates in k{sub cat} regulation. Surprisingly, the T11A mutant had a decreased GSH K{sub m} value, whereas little impact on maleylpyruvate kinetics was observed, suggesting that this residue plays an important role in GSH binding. An evolutionary trend in this residue appears to have developed not only in prokaryotic and eukaryotic GSTZs, but also among the wider class of cGSTs.« less

Identification and characterization of the active hydrothermal deposits in Okinawa Trough, SW Japan: Estimates from logging-while-drilling

NASA Astrophysics Data System (ADS)

Saito, S.; Sanada, Y.; Moe, K.; Kido, Y. N.; Hamada, Y.; Kumagai, H.; Nozaki, T.; Takai, K.; Suzuki, K.

2015-12-01

A scientific drilling expedition was conducted at an active hydrothermal field on the Iheya-North Knoll by D/V Chikyu in 2014 (Expedition 907) as a part of "Next-generation Technology for Ocean Resources Survey" of the Cross-ministerial Strategic Innovation Promotion Program. During the expedition logging while drilling (LWD) was deployed to constrain the area of the fluid reservoir beneath seafloor followed by three coring holes down to 150 meter below the seafloor (mbsf). The LWD system is composed of arcVISION for resistivity and natural gamma ray measurement and TeleScope for real-time transmission of drilling parameters and arcVISION data. Five sites (C9011-15) at the Iheya-North Original Site and one site (C9016) at Aki Site were drilled with LWD. At C9012 and C9016, the arcVISION detected temperature anomaly up to 84℃ at 234 mbsf and up to 39℃ at 80 mbsf, respectively. The temperature quickly increases at that depth and it would reflect the existence of high-temperature heat source along borehole. Due to the continuous fluid circulation during drilling, the measured temperature does not indicate in-situ temperature, but it reflects the heat disturbed by the cold circulated water instead. High quality resistivity and natural gamma ray data were acquired at six sites. The log curves at Site C9016 show characteristic response; the natural gamma ray log exhibits extremely high radiation (>500 gAPI) at 7-13 and 23-31 mbsf (Zone A). In the underlying interval of 31-40 mbsf, the resistivity log exhibits extremely low value (<0.2 ohm-m) (Zone B). Then the resistivity log exhibits higher value (~10 ohm-m) and the natural gamma ray log shows very low radiation (<50 gAPI) at the interval of 41-48 mbsf (Zone C). The log characteristics in Zone A, B, and C can be interpreted as a series of K-rich alteration zone, sulfide zone, and low-K hard (silicified) sediments, respectively. The LWD-based lithological interpretation was confirmed by the following core description. Zones A and B can be correlated to altered clay zone and sulfide zone including sphalerite, galena, chalcopyrite, and pyrite. Our results show that LWD is a powerful tool for the identification and characterization of submarine hydrothermal deposits and LWD survey enhances the successful recovery of sulfide samples.

Tear gasses CN, CR, and CS are potent activators of the human TRPA1 receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brone, Bert; Peeters, Pieter J.; Marrannes, Roger

2008-09-01

The TRPA1 channel is activated by a number of pungent chemicals, such as allylisothiocyanate, present in mustard oil and thiosulfinates present in garlic. Most of the known activating compounds contain reactive, electrophilic chemical groups, reacting with cysteine residues in the active site of the TRPA1 channel. This covalent modification results in activation of the channel and has been shown to be reversible for several ligands. Commonly used tear gasses CN, CR and CS are also pungent chemicals, and in this study we show that they are extremely potent and selective activators of the human TRPA1 receptor. To our knowledge, thesemore » are the most potent TRPA1 agonists known to date. The identification of the molecular target for these tear gasses may open up possibilities to alleviate the effects of tear gasses via treatment with TRPA1 antagonists. In addition these results may contribute to the basic knowledge of the TRPA1 channel that is gaining importance as a pharmacological target.« less

Neurotoxicity and other pharmacological activities of the snake venom phospholipase A2 OS2: The N-terminal region is more important than enzymatic activity

PubMed Central

Rouault, Morgane; Rash, Lachlan D.; Escoubas, Pierre; Boilard, Eric; Bollinger, James; Lomonte, Bruno; Maurin, Thomas; Guillaume, Carole; Canaan, Stéphane; Deregnaucourt, Christiane; Schrével, Joseph; Doglio, Alain; Gutiérrez, José María; Lazdunski, Michel; Gelb, Michael H.; Lambeau, Gérard

2009-01-01

Several snake venom secreted phospholipases A2 (sPLA2s) including OS2 exert a variety of pharmacological effects ranging from central neurotoxicity to anti-HIV activity by mechanisms that are not yet fully understood. To conclusively address the role of enzymatic activity and map the key structural elements of OS2 responsible for its pharmacological properties, we have prepared single point OS2 mutants at the catalytic site and large chimeras between OS2 and OS1, an homologous but non toxic sPLA2. Most importantly, we found that the enzymatic activity of the active site mutant H48Q is 500-fold lower than that of the wild-type protein, while central neurotoxicity is only 16-fold lower, providing convincing evidence that catalytic activity is at most a minor factor that determines central neurotoxicity. The chimera approach has identified the N-terminal region (residues 1–22) of OS2, but not the central one (residues 58–89), as crucial for both enzymatic activity and pharmacological effects. The C-terminal region of OS2 (residues 102–119) was found to be critical for enzymatic activity, but not for central neurotoxicity and anti-HIV activity, allowing us to further dissociate enzymatic activity and pharmacological effects. Finally, direct binding studies with the C-terminal chimera which poorly binds to phospholipids while it is still neurotoxic, led to the identification of a subset of brain N-type receptors which may be directly involved in central neurotoxicity. PMID:16669624

Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

NASA Astrophysics Data System (ADS)

Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

2014-07-01

Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors.

Atrial natriuretic peptide receptor heterogeneity and effects on cyclic GMP accumulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leitman, D.C.

1988-01-01

The effects of atrial natriuretic peptide (ANP), oxytocin (OT) and vasopressin (AVP) on guanylate cyclase activity and cyclic GMP accumulation were examined, since these hormones appear to be intimately associated with blood pressure and intravascular volume homeostasis. ANP was found to increase cyclic GMP accumulation in ten cell culture systems, which were derived from blood vessels, adrenal cortex, kidney, lung, testes and mammary gland. ANP receptors were characterized in intact cultured cells using {sup 125}I-ANP{sub 8-33}. Specific {sup 125}I-ANP binding was saturable and of high affinity. Scratchard analysis of the binding data for all cell types exhibited a straight line,more » indicating that these cells possessed a single class of binding sites. Despite the presence of linear Scatchard plots, these studies demonstrated that cultured cells possess two functionally and physically distinct ANP-binding sites. Most of the ANP-binding sites in cultured cells have a molecular size of 66,000 daltons under reducing conditions. The identification of cultured cell types in which hormones (ANP and oxytocin) regulate guanylate cyclase activity and increase cyclic GMP synthesis will provide valuable systems to determine the mechanisms of hormone-receptor coupling to guanylate cyclase and the cellular processes regulated by cyclic GMP.« less

Combined seismic and radar investigation to define ice properties and structure of a cold alpine site

NASA Astrophysics Data System (ADS)

Eisen, O.; Bohleber, P.; Drews, R.; Heilig, A.; Hofstede, C.

2009-04-01

The cold alpine saddle Colle Gnifetti, Monte Rosa, Swiss-Italian Alps resembles very much polar and subpolar ice masses in terms of glaciological conditions. It has been the site for several ice-core drilling campaigns over more than 20 years to determine paleoclimatological and glaciological conditions. To investigate the feasibility of geophysical methods for improved characterization of ice masses surrounding borehole and ice-core sites, a combined active reflection seismic and ground-penetrating radar pilot study has been carried out in summer 2008. Aims are the characterization of density, internal layering, seismic and radar wave speed and attenuation, identification of anisotropic features (like crystal orientation or bubble content and shape). Here we present the overall setup and first results. Seismic and GPR profiles were centered on an existing borehole location covering the full ice thickness of 62 m. Active seismics was carried out with 24-channel 3-m spacing recording, using a Seismic Impulse Source System (SISSY) along two profiles parallel and perpendicular to the ice-flow direction. The same profiles were complemented with GPR measurements utilizing 250, 500 MHz frequencies. Additionally, circular profiles with 250, 500 and 800 MHz were carried out circumferencing the borehole to detect anisotropic features.

Metastable Atom-Activated Dissociation Mass Spectrometry of Phosphorylated and Sulfonated Peptides in Negative Ion Mode

NASA Astrophysics Data System (ADS)

Cook, Shannon L.; Jackson, Glen P.

2011-06-01

The dissociation behavior of phosphorylated and sulfonated peptide anions was explored using metastable atom-activated dissociation mass spectrometry (MAD-MS) and collision-induced dissociation (CID). A beam of high kinetic energy helium (He) metastable atoms was exposed to isolated phosphorylated and sulfonated peptides in the 3- and 2- charge states. Unlike CID, where phosphate losses are dominant, the major dissociation channels observed using MAD were Cα - C peptide backbone cleavages and neutral losses of CO2, H2O, and [CO2 + H2O] from the charge reduced (oxidized) product ion, consistent with an electron detachment dissociation (EDD) mechanism such as Penning ionization. Regardless of charge state or modification, MAD provides ample backbone cleavages with little modification loss, which allows for unambiguous PTM site determination. The relative abundance of certain fragment ions in MAD is also demonstrated to be somewhat sensitive to the number and location of deprotonation sites, with backbone cleavage somewhat favored adjacent to deprotonated sites like aspartic acid residues. MAD provides a complementary dissociation technique to CID, ECD, ETD, and EDD for peptide sequencing and modification identification. MAD offers the unique ability to analyze highly acidic peptides that contain few to no basic amino acids in either negative or positive ion mode.

Human Trafficking Identification and Service Provision in the Medical and Social Service Sectors.

PubMed

Schwarz, Corinne; Unruh, Erik; Cronin, Katie; Evans-Simpson, Sarah; Britton, Hannah; Ramaswamy, Megha

2016-06-01

The medical sector presents a unique opportunity for identification and service to victims of human trafficking. In this article, we describe local and site-specific efforts to develop an intervention tool to be used in an urban hospital's emergency department in the midwestern United States. In the development of our tool, we focused on both identification and intervention to assist trafficked persons, through a largely collaborative process in which we engaged local stakeholders for developing site-specific points of intervention. In the process of developing our intervention, we highlight the importance of using existing resources and services in a specific community to address critical gaps in coverage for trafficked persons. For example, we focus on those who are victims of labor trafficking, in addition to those who are victims of sex trafficking. We offer a framework informed by rights-based approaches to anti-trafficking efforts that addresses the practical challenges of human trafficking victim identification while simultaneously working to provide resources and disseminate services to those victims.

Identification of Key Functional Residues in the Active Site of Human β1,4-Galactosyltransferase 7

PubMed Central

Talhaoui, Ibtissam; Bui, Catherine; Oriol, Rafael; Mulliert, Guillermo; Gulberti, Sandrine; Netter, Patrick; Coughtrie, Michael W. H.; Ouzzine, Mohamed; Fournel-Gigleux, Sylvie

2010-01-01

Glycosaminoglycans (GAGs) play a central role in many pathophysiological events, and exogenous xyloside substrates of β1,4-galactosyltransferase 7 (β4GalT7), a major enzyme of GAG biosynthesis, have interesting biomedical applications. To predict functional peptide regions important for substrate binding and activity of human β4GalT7, we conducted a phylogenetic analysis of the β1,4-galactosyltransferase family and generated a molecular model using the x-ray structure of Drosophila β4GalT7-UDP as template. Two evolutionary conserved motifs, 163DVD165 and 221FWGWGREDDE230, are central in the organization of the enzyme active site. This model was challenged by systematic engineering of point mutations, combined with in vitro and ex vivo functional assays. Investigation of the kinetic properties of purified recombinant wild-type β4GalT7 and selected mutants identified Trp224 as a key residue governing both donor and acceptor substrate binding. Our results also suggested the involvement of the canonical carboxylate residue Asp228 acting as general base in the reaction catalyzed by human β4GalT7. Importantly, ex vivo functional tests demonstrated that regulation of GAG synthesis is highly responsive to modification of these key active site amino acids. Interestingly, engineering mutants at position 224 allowed us to modify the affinity and to modulate the specificity of human β4GalT7 toward UDP-sugars and xyloside acceptors. Furthermore, the W224H mutant was able to sustain decorin GAG chain substitution but not GAG synthesis from exogenously added xyloside. Altogether, this study provides novel insight into human β4GalT7 active site functional domains, allowing manipulation of this enzyme critical for the regulation of GAG synthesis. A better understanding of the mechanism underlying GAG assembly paves the way toward GAG-based therapeutics. PMID:20843813

Chemocoding as an identification tool where morphological- and DNA-based methods fall short: Inga as a case study.

PubMed

Endara, María-José; Coley, Phyllis D; Wiggins, Natasha L; Forrister, Dale L; Younkin, Gordon C; Nicholls, James A; Pennington, R Toby; Dexter, Kyle G; Kidner, Catherine A; Stone, Graham N; Kursar, Thomas A

2018-04-01

The need for species identification and taxonomic discovery has led to the development of innovative technologies for large-scale plant identification. DNA barcoding has been useful, but fails to distinguish among many species in species-rich plant genera, particularly in tropical regions. Here, we show that chemical fingerprinting, or 'chemocoding', has great potential for plant identification in challenging tropical biomes. Using untargeted metabolomics in combination with multivariate analysis, we constructed species-level fingerprints, which we define as chemocoding. We evaluated the utility of chemocoding with species that were defined morphologically and subject to next-generation DNA sequencing in the diverse and recently radiated neotropical genus Inga (Leguminosae), both at single study sites and across broad geographic scales. Our results show that chemocoding is a robust method for distinguishing morphologically similar species at a single site and for identifying widespread species across continental-scale ranges. Given that species are the fundamental unit of analysis for conservation and biodiversity research, the development of accurate identification methods is essential. We suggest that chemocoding will be a valuable additional source of data for a quick identification of plants, especially for groups where other methods fall short. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

The Enzymatic and Structural Basis for Inhibition of Echinococcus granulosus Thioredoxin Glutathione Reductase by Gold(I).

PubMed

Salinas, Gustavo; Gao, Wei; Wang, Yang; Bonilla, Mariana; Yu, Long; Novikov, Andrey; Virginio, Veridiana G; Ferreira, Henrique B; Vieites, Marisol; Gladyshev, Vadim N; Gambino, Dinorah; Dai, Shaodong

2017-12-20

New drugs are needed to treat flatworm infections that cause severe human diseases such as schistosomiasis. The unique flatworm enzyme thioredoxin glutathione reductase (TGR), structurally different from the human enzyme, is a key drug target. Structural studies of the flatworm Echinococcus granulosus TGR, free and complexed with Au I -MPO, a novel gold inhibitor, together with inhibition assays were performed. Au I -MPO is a potent TGR inhibitor that achieves 75% inhibition at a 1:1 TGR:Au ratio and efficiently kills E. granulosus in vitro. The structures revealed salient insights: (i) unique monomer-monomer interactions, (ii) distinct binding sites for thioredoxin and the glutaredoxin (Grx) domain, (iii) a single glutathione disulfide reduction site in the Grx domain, (iv) rotation of the Grx domain toward the Sec-containing redox active site, and (v) a single gold atom bound to Cys 519 and Cys 573 in the Au I -TGR complex. Structural modeling suggests that these residues are involved in the stabilization of the Sec-containing C-terminus. Consistently, Cys→Ser mutations in these residues decreased TGR activities. Mass spectroscopy confirmed these cysteines are the primary binding site. The identification of a primary site for gold binding and the structural model provide a basis for gold compound optimization through scaffold adjustments. The structural study revealed that TGR functions are achieved not only through a mobile Sec-containing redox center but also by rotation of the Grx domain and distinct binding sites for Grx domain and thioredoxin. The conserved Cys 519 and Cys 573 residues targeted by gold assist catalysis through stabilization of the Sec-containing redox center. Antioxid. Redox Signal. 27, 1491-1504.

The Enzymatic and Structural Basis for Inhibition of Echinococcus granulosus Thioredoxin Glutathione Reductase by Gold(I)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salinas, Gustavo; Gao, Wei; Wang, Yang

Aims: New drugs are needed to treat flatworm infections that cause severe human diseases such as schistosomiasis. The unique flatworm enzyme thioredoxin glutathione reductase (TGR), structurally different from the human enzyme, is a key drug target. Structural studies of the flatworm Echinococcus granulosus TGR, free and complexed with AuI-MPO, a novel gold inhibitor, together with inhibition assays were performed. Results: AuI-MPO is a potent TGR inhibitor that achieves 75% inhibition at a 1:1 TGR:Au ratio and efficiently kills E. granulosus in vitro. The structures revealed salient insights: (i) unique monomer–monomer interactions, (ii) distinct binding sites for thioredoxin and the glutaredoxinmore » (Grx) domain, (iii) a single glutathione disulfide reduction site in the Grx domain, (iv) rotation of the Grx domain toward the Sec-containing redox active site, and (v) a single gold atom bound to Cys519 and Cys573 in the AuI-TGR complex. Structural modeling suggests that these residues are involved in the stabilization of the Sec-containing C-terminus. Consistently, Cys→Ser mutations in these residues decreased TGR activities. Mass spectroscopy confirmed these cysteines are the primary binding site. Innovation: The identification of a primary site for gold binding and the structural model provide a basis for gold compound optimization through scaffold adjustments. Conclusions: The structural study revealed that TGR functions are achieved not only through a mobile Sec-containing redox center but also by rotation of the Grx domain and distinct binding sites for Grx domain and thioredoxin. The conserved Cys519 and Cys573 residues targeted by gold assist catalysis through stabilization of the Sec-containing redox center. Antioxid. Redox Signal. 27, 1491–1504.« less

Evaluation of phosphorus site assessment tools: lessons from the USA

USDA-ARS?s Scientific Manuscript database

Critical source area identification through phosphorus (P) site assessment is a fundamental part of modern nutrient management planning in the U.S. To date, the P Index has been the primary tool for P site assessment adopted by US states, but there has been only patchy testing of the many versions ...

2 Internet-Savvy Students Help Track Down the Hacker of an NCAA Web Site.

ERIC Educational Resources Information Center

Wanat, Thomas

1997-01-01

A Duke University (North Carolina) student witnessing vandalism to the National Collegiate Athletic Association's (NCAA) World Wide Web site and a University of Massachusetts, Amherst student, both studying computer science, have contributed substantially to the identification of a computer hacker destroying the NCAA site. The students' rapid…

Genome-Wide Identification of Binding Sites Defines Distinct Functions for Caenorhabditis elegans PHA-4/FOXA in Development and Environmental Response

PubMed Central

Zhong, Mei; Niu, Wei; Lu, Zhi John; Sarov, Mihail; Murray, John I.; Janette, Judith; Raha, Debasish; Sheaffer, Karyn L.; Lam, Hugo Y. K.; Preston, Elicia; Slightham, Cindie; Hillier, LaDeana W.; Brock, Trisha; Agarwal, Ashish; Auerbach, Raymond; Hyman, Anthony A.; Gerstein, Mark; Mango, Susan E.; Kim, Stuart K.; Waterston, Robert H.; Reinke, Valerie; Snyder, Michael

2010-01-01

Transcription factors are key components of regulatory networks that control development, as well as the response to environmental stimuli. We have established an experimental pipeline in Caenorhabditis elegans that permits global identification of the binding sites for transcription factors using chromatin immunoprecipitation and deep sequencing. We describe and validate this strategy, and apply it to the transcription factor PHA-4, which plays critical roles in organ development and other cellular processes. We identified thousands of binding sites for PHA-4 during formation of the embryonic pharynx, and also found a role for this factor during the starvation response. Many binding sites were found to shift dramatically between embryos and starved larvae, from developmentally regulated genes to genes involved in metabolism. These results indicate distinct roles for this regulator in two different biological processes and demonstrate the versatility of transcription factors in mediating diverse biological roles. PMID:20174564

In-silico identification of the binding mode of synthesized adamantyl derivatives inside cholinesterase enzymes

PubMed Central

Al-Aboudi, Amal; Al-Qawasmeh, Raed A; Shahwan, Alaa; Mahmood, Uzma; Khalid, Asaad; Ul-Haq, Zaheer

2015-01-01

Aim: To investigate the binding mode of synthesized adamantly derivatives inside of cholinesterase enzymes using molecular docking simulations. Methods: A series of hybrid compounds containing adamantane and hydrazide moieties was designed and synthesized. Their inhibitory activities against acetylcholinesterase (AChE) and (butyrylcholinesterase) BChE were assessed in vitro. The binding mode of the compounds inside cholinesterase enzymes was investigated using Surflex-Dock package of Sybyl7.3 software. Results: A total of 26 adamantyl derivatives were synthesized. Among them, adamantane-1-carboxylic acid hydrazide had an almost equal inhibitory activity towards both enzymes, whereas 10 other compounds exhibited moderate inhibitory activity against BChE. The molecular docking studies demonstrated that hydrophobic interactions between the compounds and their surrounding residues in the active site played predominant roles, while hydrophilic interactions were also found. When the compounds were docked inside each enzyme, they exhibited stronger interactions with BChE over AChE, possibly due to the larger active site of BChE. The binding affinities of the compounds for BChE and AChE estimated were in agreement with the experimental data. Conclusion: The new adamantly derivatives selectively inhibit BChE with respect to AChE, thus making them good candidates for testing the hypothesis that BChE inhibitors would be more efficient and better tolerated than AChE inhibitors in the treatment of Alzheimer's disease. PMID:25937631

Hot Dry Rock Geothermal Energy Development Program. Annual report, fiscal year 1979

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cremer, G.M.; Duffield, R.B.; Smith, M.C.

1980-08-01

The Fenton Hill Project is still the principal center for developing methods, equipment, and instrumentation for creating and utilizing HDR geothermal reservoirs. The search for a second site for a similar experimental system in a different geological environment has been intensified, as have the identification and characterization of other HDR areas that may prove suitable for either experimental or commercial development. The Phase I fracture system was enlarged during FY79. Drilling of the injection well of the Phase II system began at Fenton Hill in April 1979. Environmental monitoring of the Fenton Hill area continued through FY79. The environmental studiesmore » indicate that the hot dry rock operations have caused no significant environmental impact. Other supporting activities included rock physics, rock mechanics, fracture mapping, and instrumentation development. Two closely related activities - evaluation of the potential HDR energy resource of the US and the selection of a site for development of a second experimental heat-extraction system generally similar to that at Fenton Hill - have resulted in the collection of geology, hydrology, and heat-flow data on some level of field activity in 30 states. The resource-evaluation activity included reconnaissance field studies and a listing and preliminary characterization of US geothermal areas in which HDR energy extraction methods may be applicable. The selection of Site 2 has taken into account such legal, institutional, and economic factors as land ownership and use, proximity to possible users, permitting and licensing requirements and procedures, environmental issues, areal extent of the geothermal area, and visibility to and apparent interest by potential industrial developers.« less

Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.

PubMed

Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J

1997-03-25

1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.

Regional Magnitude Research Supporting Broad-Area Monitoring of Small Seismic Events

DTIC Science & Technology

2007-09-01

detonated at the Nevada Test Site (NTS) and the Semipalatinsk Test Site (STS). Observations for both test sites show that Pn amplitudes yield scale 10...identification procedures, and yield, via direct comparison to test site results for high frequencies (>1 Hz). Coda techniques are known to be effective...2006). Source spectral modeling of regional P/S discriminants at nuclear test sites in China and the former Soviet Union, Bull. Seismol. Soc. Am

The amiodarone derivative KB130015 activates hERG1 potassium channels via a novel mechanism

PubMed Central

Gessner, Guido; Macianskiene, Regina; Starkus, John G.; Schönherr, Roland; Heinemann, Stefan H.

2010-01-01

Human ether à go-go related gene (hERG1) potassium channels underlie the repolarizing IKr current in the heart. Since they are targets of various drugs with cardiac side effects we tested whether the amiodarone derivative 2-methyl-3-(3,5-diiodo-4-carboxymethoxybenzyl)benzofuran (KB130015) blocks hERG1 channels like its parent compound. Using patch-clamp and two-electrode voltage-clamp techniques we found that KB130015 blocks native and recombinant hERG1 channels at high voltages, but it activates them at low voltages. The activating effect has an apparent EC50 value of 12 μM and is brought about by an about 4-fold acceleration of activation kinetics and a shift in voltage-dependent activation by −16 mV. Channel activation was not use-dependent and was independent of inactivation gating. KB130015 presumably binds to the hERG1 pore from the cytosolic side and functionally competes with hERG1 block by amiodarone, E4031 (N-[4-[[1-[2-(6-methyl-2-pyridinyl)ethyl] -4-piperidinyl] carbonyl] phenyl] methanesulfonamide dihydrochloride), and sertindole. Vice versa, amiodarone attenuates hERG1 activation by KB130015. Based on synergic channel activation by mallotoxin and KB130015 we conclude that the hERG1 pore contains at least two sites for activators that are functionally coupled among each other and to the cavity-blocker site. KB130015 and amiodarone may serve as lead structures for the identification of hERG1 pore-interacting drugs favoring channel activation vs. block. PMID:20097192

Reactive Oxygen Species (ROS)-Activated ATM-Dependent Phosphorylation of Cytoplasmic Substrates Identified by Large-Scale Phosphoproteomics Screen*

PubMed Central

Kozlov, Sergei V.; Waardenberg, Ashley J.; Engholm-Keller, Kasper; Arthur, Jonathan W.; Graham, Mark E.; Lavin, Martin

2016-01-01

Ataxia-telangiectasia, mutated (ATM) protein plays a central role in phosphorylating a network of proteins in response to DNA damage. These proteins function in signaling pathways designed to maintain the stability of the genome and minimize the risk of disease by controlling cell cycle checkpoints, initiating DNA repair, and regulating gene expression. ATM kinase can be activated by a variety of stimuli, including oxidative stress. Here, we confirmed activation of cytoplasmic ATM by autophosphorylation at multiple sites. Then we employed a global quantitative phosphoproteomics approach to identify cytoplasmic proteins altered in their phosphorylation state in control and ataxia-telangiectasia (A-T) cells in response to oxidative damage. We demonstrated that ATM was activated by oxidative damage in the cytoplasm as well as in the nucleus and identified a total of 9,833 phosphorylation sites, including 6,686 high-confidence sites mapping to 2,536 unique proteins. A total of 62 differentially phosphorylated peptides were identified; of these, 43 were phosphorylated in control but not in A-T cells, and 19 varied in their level of phosphorylation. Motif enrichment analysis of phosphopeptides revealed that consensus ATM serine glutamine sites were overrepresented. When considering phosphorylation events, only observed in control cells (not observed in A-T cells), with predicted ATM sites phosphoSerine/phosphoThreonine glutamine, we narrowed this list to 11 candidate ATM-dependent cytoplasmic proteins. Two of these 11 were previously described as ATM substrates (HMGA1 and UIMCI/RAP80), another five were identified in a whole cell extract phosphoproteomic screens, and the remaining four proteins had not been identified previously in DNA damage response screens. We validated the phosphorylation of three of these proteins (oxidative stress responsive 1 (OSR1), HDGF, and ccdc82) as ATM dependent after H2O2 exposure, and another protein (S100A11) demonstrated ATM-dependence for translocation from the cytoplasm to the nucleus. These data provide new insights into the activation of ATM by oxidative stress through identification of novel substrates for ATM in the cytoplasm. PMID:26699800

Utilizing knowledge base of amino acids structural neighborhoods to predict protein-protein interaction sites.

PubMed

Jelínek, Jan; Škoda, Petr; Hoksza, David

2017-12-06

Protein-protein interactions (PPI) play a key role in an investigation of various biochemical processes, and their identification is thus of great importance. Although computational prediction of which amino acids take part in a PPI has been an active field of research for some time, the quality of in-silico methods is still far from perfect. We have developed a novel prediction method called INSPiRE which benefits from a knowledge base built from data available in Protein Data Bank. All proteins involved in PPIs were converted into labeled graphs with nodes corresponding to amino acids and edges to pairs of neighboring amino acids. A structural neighborhood of each node was then encoded into a bit string and stored in the knowledge base. When predicting PPIs, INSPiRE labels amino acids of unknown proteins as interface or non-interface based on how often their structural neighborhood appears as interface or non-interface in the knowledge base. We evaluated INSPiRE's behavior with respect to different types and sizes of the structural neighborhood. Furthermore, we examined the suitability of several different features for labeling the nodes. Our evaluations showed that INSPiRE clearly outperforms existing methods with respect to Matthews correlation coefficient. In this paper we introduce a new knowledge-based method for identification of protein-protein interaction sites called INSPiRE. Its knowledge base utilizes structural patterns of known interaction sites in the Protein Data Bank which are then used for PPI prediction. Extensive experiments on several well-established datasets show that INSPiRE significantly surpasses existing PPI approaches.

Identification of trail pheromone of larva of eastern tent caterpillarMalacosoma americanum (Lepidoptera: Lasiocampidae).

PubMed

Crump, D; Silverstein, R M; Williams, H J; Fitzgerald, T D

1987-03-01

Previous studies have shown that larvae of the eastern tent caterpillar (Malacosoma americanum F.) mark trails, leading from their tent to feeding sites on host trees, with a pheromone secreted from the posterior tip of the abdominal sternum. 5β-Cholestane-3,24-dione (1) has been identified as an active component of the trail. The larvae have a threshold sensitivity to the pheromone of 10(-11) g/mm of trail. Several related compounds elicit the trail-following response. Two other species of tent caterpillars also responded positively to the pheromone in preliminary laboratory tests.

Cytogenetics of two sympatric Corydoras species (pisces, siluriformes, challichtyidae) of Southern Brazil.

PubMed

Artoni, R F; Terêncio, M L; Vicari, M R; Matiello, M C A; Cestari, M M; Bertollo, L A C

2006-02-01

Karyotypic data are presented for two sympatric Corydoras species of the Lagoa Dourada, namely, C. ehrhadti and C. paleatus, which are found in the upper Tibagi river basin (Ponta Grossa, State of Paraná, Brazil). The same diploid number and karyotypic formula were observed in both species/populations. A great similarity in the constitutive heterochromatin distribution and in the activity of nucleolar organizer regions was also found. The use of in situ hybridization with a fluorescent 18S rDNA probe allowed for the identification of the species/populations through the location of ribosomal sites.

Research on Large Whales off California, Oregon, and Washington in 2003

DTIC Science & Technology

2004-11-01

whale Fin whale Gray whale Humpback Killer whale Date VES Launch site Pers Activity Beg End Hours Nmi S# Tot IDs S# Tot IDs S# Tot IDs S# Tot IDs S...Humpback whale identifications are being compiled by DFO. Blue whale Fin whale Gray whale Humpback Killer whale Sperm whale Date VES Pers Beg End... Puget Sound 79 0 0 0 2 0 0 0 0 0 2 0 0 1 0 0 0 0 0 0 5 All 20 91 150 213 111 218 282 398 257 260 365 366 290 435 388 269 308 346 398 1,565

Virus-like attachment sites as structural landmarks of plants retrotransposons.

PubMed

Ochoa Cruz, Edgar Andres; Cruz, Guilherme Marcello Queiroga; Vieira, Andréia Prata; Van Sluys, Marie-Anne

2016-01-01

The genomic data available nowadays has enabled the study of repetitive sequences and their relationship to viruses. Among them, long terminal repeat retrotransposons (LTR-RTs) are the largest component of most plant genomes, the Gypsy and Copia superfamilies being the most common. Recently it has been found that Del lineage, an LTR-RT of Gypsy superfamily, has putative virus-like attachment (vl-att) sites. This signature, originally described for retroviruses, is recognized by retroviral integrase conferring specificity to the integration process. Here we retrieved 26,092 putative complete LTR-RTs from 10 lineages found in 10 fully sequenced angiosperm genomes and found putative vl-att sites that are a conserved structural landmark across these genomes. Furthermore, we reveal that each plant genome has a distinguishable LTR-RT lineage amplification pattern that could be related to the vl-att sites diversity. We used these patterns to generate a specific quick-response (QR) code for each genome that could be used as a barcode of identification of plants in the future. The universal distribution of vl-att sites represents a new structural feature common to plant LTR-RTs and retroviruses. This is an important finding that expands the information about the structural similarity between LTR-RT and retroviruses. We speculate that the sequence diversity of vl-att sites could be important for the life cycle of retrotransposons, as it was shown for retroviruses. All the structural vl-att site signatures are strong candidates for further functional studies. Moreover, this is the first identification of specific LTR-RT content and their amplification patterns in a large dataset of LTR-RT lineages and angiosperm genomes. These distribution patterns could be used in the future with biotechnological identification purposes.

Comparison of perioperative outcomes between endoscope-assisted technique and handheld acoustic Doppler for perforator identification in fasciocutaneous flaps.

PubMed

Huang, Jen-Wu; Huang, Chih-Sheng; Shih, Yu-Chung; Perng, Cherng-Kang; Lin, Yi-Ying; Wu, Szu-Hsien

2018-06-01

The endoscopic technique has been utilized to harvest muscle flaps and detect perforators of fasciocutaneous flaps. This study aimed to compare the perioperative outcomes between the endoscope-assisted technique and handheld acoustic Doppler for perforator identification in fasciocutaneous flaps.This retrospective case-control study included patients who underwent fasciocutaneous flap reconstruction for traumatic soft tissue defects. In the case group, perforator identification was assisted by the endoscope-assisted technique. In the control group, age- and sex-matched patients received handheld acoustic Doppler to detect perforators. Perioperative outcomes, flap characteristics, and postoperative complications were compared.There were 12 patients in the case group and 12 in the control group. Compared with the control group, the case group had a significantly shorter length of donor-site wounds (9 cm vs 12 cm, P = .023) and a significantly smaller proportion of patients receiving skin grafting at the donor sites (0% vs 41.7%, P = .037). The case group had a longer operative time, but the difference was not statistically significant (180 minutes vs 150 minutes, P = .367). The amount of blood loss, the time length of postoperative drainage, and complications did not significantly differ between the 2 groups.The endoscope-assisted technique for perforator identification of fasciocutaneous flaps provided less donor-site morbidity and a significantly shorter length of donor-site wounds than the conventional handheld acoustic Doppler, which suggests that this technique could be a valuable alternative when a precise design is indicated.

When is Mass Spectrometry Combined with Affinity Approaches Essential? A Case Study of Tyrosine Nitration in Proteins

NASA Astrophysics Data System (ADS)

Petre, Brînduşa-Alina; Ulrich, Martina; Stumbaum, Mihaela; Bernevic, Bogdan; Moise, Adrian; Döring, Gerd; Przybylski, Michael

2012-11-01

Tyrosine nitration in proteins occurs under physiologic conditions and is increased at disease conditions associated with oxidative stress, such as inflammation and Alzheimer's disease. Identification and quantification of tyrosine-nitrations are crucial for understanding nitration mechanism(s) and their functional consequences. Mass spectrometry (MS) is best suited to identify nitration sites, but is hampered by low stabilities and modification levels and possible structural changes induced by nitration. In this insight, we discuss methods for identifying and quantifying nitration sites by proteolytic affinity extraction using nitrotyrosine (NT)-specific antibodies, in combination with electrospray-MS. The efficiency of this approach is illustrated by identification of specific nitration sites in two proteins in eosinophil granules from several biological samples, eosinophil-cationic protein (ECP) and eosinophil-derived neurotoxin (EDN). Affinity extraction combined with Edman sequencing enabled the quantification of nitration levels, which were found to be 8 % and 15 % for ECP and EDN, respectively. Structure modeling utilizing available crystal structures and affinity studies using synthetic NT-peptides suggest a tyrosine nitration sequence motif comprising positively charged residues in the vicinity of the NT- residue, located at specific surface- accessible sites of the protein structure. Affinities of Tyr-nitrated peptides from ECP and EDN to NT-antibodies, determined by online bioaffinity- MS, provided nanomolar KD values. In contrast, false-positive identifications of nitrations were obtained in proteins from cystic fibrosis patients upon using NT-specific antibodies, and were shown to be hydroxy-tyrosine modifications. These results demonstrate affinity- mass spectrometry approaches to be essential for unequivocal identification of biological tyrosine nitrations.

The Active Sites of a Rod-Shaped Hollandite DeNOx Catalyst.

PubMed

Hu, Pingping; Schuster, Manfred Erwin; Huang, Zhiwei; Xu, Fei; Jin, Shifeng; Chen, Yaxin; Hua, Weiming; Su, Dang Sheng; Tang, Xingfu

2015-06-26

The identification of catalytically active sites (CASs) in heterogeneous catalysis is of vital importance to design and develop improved catalysts, but remains a great challenge. The CASs have been identified in the low-temperature selective catalytic reduction of nitrogen oxides by ammonia (SCR) over a hollandite manganese oxide (HMO) catalyst with a rod-shaped morphology and one-dimensional tunnels. Electron microscopy and synchrotron X-ray diffraction determine the surface and crystal structures of the one-dimensional HMO rods closed by {100} side facets and {001} top facets. A combination of X-ray absorption spectra, molecular probes with potassium and nitric oxide, and catalytic tests reveals that the CASs are located on the {100} side facets of the HMO rods rather than on the top facets or in the tunnels, and hence semi-tunnel structural motifs on the {100} facets are evidenced to be the CASs of the SCR reaction. This work paves the way to further investigate the intrinsic mechanisms of SCR reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Structure of HsaD, a steroid-degrading hydrolase, from Mycobacterium tuberculosis

PubMed Central

Lack, Nathan; Lowe, Edward D.; Liu, Jie; Eltis, Lindsay D.; Noble, Martin E. M.; Sim, Edith; Westwood, Isaac M.

2008-01-01

Tuberculosis is a major cause of death worldwide. Understanding of the pathogenicity of Mycobacterium tuberculosis has been advanced by gene analysis and has led to the identification of genes that are important for intracellular survival in macrophages. One of these genes encodes HsaD, a meta-cleavage product (MCP) hydrolase that catalyzes the hydrolytic cleavage of a carbon–carbon bond in cholesterol metabolism. This paper describes the production of HsaD as a recombinant protein and, following crystallization, the determination of its three-dimensional structure to 2.35 Å resolution by X-ray crystallography at the Diamond Light Source in Oxfordshire, England. To the authors’ knowledge, this study constitutes the first report of a structure determined at the new synchrotron facility. The volume of the active-site cleft of the HsaD enzyme is more than double the corresponding active-site volumes of related MCP hydrolases involved in the catabolism of aromatic compounds, consistent with the specificity of HsaD for steroids such as cholesterol. Knowledge of the structure of the enzyme facilitates the design of inhibitors. PMID:18097091

Structure of HsaD, a steroid-degrading hydrolase, from Mycobacterium tuberculosis.

PubMed

Lack, Nathan; Lowe, Edward D; Liu, Jie; Eltis, Lindsay D; Noble, Martin E M; Sim, Edith; Westwood, Isaac M

2008-01-01

Tuberculosis is a major cause of death worldwide. Understanding of the pathogenicity of Mycobacterium tuberculosis has been advanced by gene analysis and has led to the identification of genes that are important for intracellular survival in macrophages. One of these genes encodes HsaD, a meta-cleavage product (MCP) hydrolase that catalyzes the hydrolytic cleavage of a carbon-carbon bond in cholesterol metabolism. This paper describes the production of HsaD as a recombinant protein and, following crystallization, the determination of its three-dimensional structure to 2.35 A resolution by X-ray crystallography at the Diamond Light Source in Oxfordshire, England. To the authors' knowledge, this study constitutes the first report of a structure determined at the new synchrotron facility. The volume of the active-site cleft of the HsaD enzyme is more than double the corresponding active-site volumes of related MCP hydrolases involved in the catabolism of aromatic compounds, consistent with the specificity of HsaD for steroids such as cholesterol. Knowledge of the structure of the enzyme facilitates the design of inhibitors.

Exploiting conformational dynamics in drug discovery: design of C-terminal inhibitors of Hsp90 with improved activities

PubMed Central

Moroni, Elisabetta; Zhao, Huiping; Blagg, Brian S.J.; Colombo, Giorgio

2014-01-01

The interaction that occurs between molecules is a dynamic process that impacts both structural and conformational properties of the ligand and the ligand binding site. Herein, we investigate the dynamic cross-talk between a protein and the ligand as a source for new opportunities in ligand design. Analysis of the formation/disappearance of protein pockets produced in response to a first-generation inhibitor assisted in the identification of functional groups that could be introduced onto scaffolds to facilitate optimal binding, which allowed for increased binding with previously uncharacterized regions. MD simulations were used to elucidate primary changes that occur in the Hsp90 C-terminal binding pocket in the presence of first-generation ligands. This data was then used to design ligands that adapt to these receptor conformations, which provides access to an energy landscape that is not visible in a static model. The newly synthesized compounds demonstrated anti-proliferative activity at ~150 nanomolar concentration. The method identified herein may be used to design chemical probes that provide additional information on structural variations of Hsp90 C-terminal binding site. PMID:24397468

Cre-lox Univector acceptor vectors for functional screening in protoplasts: analysis of Arabidopsis donor cDNAs encoding ABSCISIC ACID INSENSITIVE1-Like protein phosphatases

PubMed Central

Jia, Fan; Gampala, Srinivas S.L.; Mittal, Amandeep; Luo, Qingjun; Rock, Christopher D.

2009-01-01

The 14,200 available full length Arabidopsis thaliana cDNAs in the Universal Plasmid System (UPS) donor vector pUNI51 should be applied broadly and efficiently to leverage a “functional map-space” of homologous plant genes. We have engineered Cre-lox UPS host acceptor vectors (pCR701- 705) with N-terminal epitope tags in frame with the loxH site and downstream from the maize Ubiquitin promoter for use in transient protoplast expression assays and particle bombardment transformation of monocots. As an example of the utility of these vectors, we recombined them with several Arabidopsis cDNAs encoding Ser/Thr protein phosphatase type 2C (PP2Cs) known from genetic studies or predicted by hierarchical clustering meta-analysis to be involved in ABA and stress responses. Our functional results in Zea mays mesophyll protoplasts on ABA-inducible expression effects on the Late Embryogenesis Abundant promoter ProEm:GUS reporter were consistent with predictions and resulted in identification of novel activities of some PP2Cs. Deployment of these vectors can facilitate functional genomics and proteomics and identification of novel gene activities. PMID:19499346

Identification of a Long-range Protein Network That Modulates Active Site Dynamics in Extremophilic Alcohol Dehydrogenases*

PubMed Central

Nagel, Zachary D.; Cun, Shujian; Klinman, Judith P.

2013-01-01

A tetrameric thermophilic alcohol dehydrogenase from Bacillus stearothermophilus (ht-ADH) has been mutated at an aromatic side chain in the active site (Trp-87). The ht-W87A mutation results in a loss of the Arrhenius break seen at 30 °C for the wild-type enzyme and an increase in cold lability that is attributed to destabilization of the active tetrameric form. Kinetic isotope effects (KIEs) are nearly temperature-independent over the experimental temperature range, and similar in magnitude to those measured above 30 °C for the wild-type enzyme. This suggests that the rigidification in the wild-type enzyme below 30 °C does not occur for ht-W87A. A mutation at the dimer-dimer interface in a thermolabile psychrophilic homologue of ht-ADH, ps-A25Y, leads to a more thermostable enzyme and a change in the rate-determining step at low temperature. The reciprocal mutation in ht-ADH, ht-Y25A, results in kinetic behavior similar to that of W87A. Collectively, the results indicate that flexibility at the active site is intimately connected to a subunit interaction 20 Å away. The convex Arrhenius curves previously reported for ht-ADH (Kohen, A., Cannio, R., Bartolucci, S., and Klinman, J. P. (1999) Nature 399, 496–499) are proposed to arise, at least in part, from a change in subunit interactions that rigidifies the substrate-binding domain below 30 °C, and impedes the ability of the enzyme to sample the catalytically relevant conformational landscape. These results implicate an evolutionarily conserved, long-range network of dynamical communication that controls C-H activation in the prokaryotic alcohol dehydrogenases. PMID:23525111

Nuclear Rocket Facility Decommissioning Project: Controlled Explosive Demolition of Neutron Activated Shield Wall

DOE Office of Scientific and Technical Information (OSTI.GOV)

Michael R. Kruzic

2007-09-16

Located in Area 25 of the Nevada Test Site (NTS), the Test Cell A (TCA) Facility was used in the early to mid-1960s for the testing of nuclear rocket engines, as part of the Nuclear Rocket Development Program, to further space travel. Nuclear rocket testing resulted in the activation of materials around the reactors and the release of fission products and fuel particles in the immediate area. Identified as Corrective Action Unit 115, the TCA facility was decontaminated and decommissioned (D&D) from December 2004 to July 2005 using the Streamlined Approach for Environmental Restoration (SAFER) process, under the ''Federal Facilitymore » Agreement and Consent Order''. The SAFER process allows environmental remediation and facility closure activities (i.e., decommissioning) to occur simultaneously provided technical decisions are made by an experienced decision maker within the site conceptual site model, identified in the Data Quality Objective process. Facility closure involved a seven-step decommissioning strategy. Key lessons learned from the project included: (1) Targeted preliminary investigation activities provided a more solid technical approach, reduced surprises and scope creep, and made the working environment safer for the D&D worker. (2) Early identification of risks and uncertainties provided opportunities for risk management and mitigation planning to address challenges and unanticipated conditions. (3) Team reviews provided an excellent mechanism to consider all aspects of the task, integrated safety into activity performance, increase team unity and ''buy-in'' and promoted innovative and time saving ideas. (4) Development of CED protocols ensured safety and control. (5) The same proven D&D strategy is now being employed on the larger ''sister'' facility, Test Cell C.« less

Thiamethoxam: Assessing flight activity of honeybees foraging on treated oilseed rape using radio frequency identification technology.

PubMed

Thompson, Helen; Coulson, Mike; Ruddle, Natalie; Wilkins, Selwyn; Harkin, Sarah

2016-02-01

The present study was designed to assess homing behavior of bees foraging on winter oilseed rape grown from seed treated with thiamethoxam (as Cruiser OSR), with 1 field drilled with thiamethoxam-treated seed and 2 control fields drilled with fungicide-only-treated seed. Twelve honeybee colonies were used per treatment group, 4 each located at the field edge (on-field site), at approximately 500 m and 1000 m from the field. A total of nearly 300 newly emerged bees per colony were fitted (tagged) with Mic3 radio frequency identification (RFID) transponders and introduced into each of the 36 study hives. The RFID readers fitted to the entrances of the test colonies were used to monitor the activity of the tagged bees for the duration of the 5-wk flowering period of the crop. These activity data were analyzed to assess any impact on flight activity of bees foraging on the treated compared with untreated crops. Honeybees were seen to be actively foraging within all 3 treatment groups during the exposure period. The data for the more than 3000 RFID-tagged bees and more than 90 000 foraging flights monitored throughout the exposure phase for the study follow the same trends across the treatment and controls and at each of the 3 apiary distances, indicating that there were no effects from foraging on the treated crop. Under the experimental conditions, there was no effect of foraging on thiamethoxam-treated oilseed rape on honeybee flight activity or on their ability to return to the hive. © 2015 SETAC.

A Novel Colletotrichum graminicola Raffinose Oxidase in the AA5 Family

PubMed Central

Mollerup, Filip; Parikka, Kirsti; Koutaniemi, Sanna; Boer, Harry; Juvonen, Minna; Master, Emma; Tenkanen, Maija; Kruus, Kristiina

2017-01-01

ABSTRACT We describe here the identification and characterization of a copper radical oxidase from auxiliary activities family 5 (AA5_2) that was distinguished by showing preferential activity toward raffinose. Despite the biotechnological potential of carbohydrate oxidases from family AA5, very few members have been characterized. The gene encoding raffinose oxidase from Colletotrichum graminicola (CgRaOx; EC 1.1.3.−) was identified utilizing a bioinformatics approach based on the known modular structure of a characterized AA5_2 galactose oxidase. CgRaOx was expressed in Pichia pastoris, and the purified enzyme displayed the highest activity on the trisaccharide raffinose, whereas the activity on the disaccharide melibiose was three times lower and more than ten times lower activity was detected on d-galactose at a 300 mM substrate concentration. Thus, the substrate preference of CgRaOx was distinguished clearly from the substrate preferences of the known galactose oxidases. The site of oxidation for raffinose was studied by 1H nuclear magnetic resonance and mass spectrometry, and we confirmed that the hydroxyl group at the C-6 position was oxidized to an aldehyde and that in addition uronic acid was produced as a side product. A new electrospray ionization mass spectrometry method for the identification of C-6 oxidized products was developed, and the formation mechanism of the uronic acid was studied. CgRaOx presented a novel activity pattern in the AA5 family. IMPORTANCE Currently, there are only a few characterized members of the CAZy AA5 protein family. These enzymes are interesting from an application point of view because of their ability to utilize the cheap and abundant oxidant O2 without the requirement of complex cofactors such as FAD or NAD(P). Here, we present the identification and characterization of a novel AA5 member from Colletotrichum graminicola. As discussed in the present study, the bioinformatics approach using the modular structure of galactose oxidase was successful in finding a C-6 hydroxyl carbohydrate oxidase having substrate preference for the trisaccharide raffinose. By the discovery of this activity, the diversity of the CAZy AA5 family is increasing. PMID:28778886

Homology modeling, binding site identification and docking study of human angiotensin II type I (Ang II-AT1) receptor.

PubMed

Vyas, Vivek K; Ghate, Manjunath; Patel, Kinjal; Qureshi, Gulamnizami; Shah, Surmil

2015-08-01

Ang II-AT1 receptors play an important role in mediating virtually all of the physiological actions of Ang II. Several drugs (SARTANs) are available, which can block the AT1 receptor effectively and lower the blood pressure in the patients with hypertension. Currently, there is no experimental Ang II-AT1 structure available; therefore, in this study we modeled Ang II-AT1 receptor structure using homology modeling followed by identification and characterization of binding sites and thereby assessing druggability of the receptor. Homology models were constructed using MODELLER and I-TASSER server, refined and validated using PROCHECK in which 96.9% of 318 residues were present in the favoured regions of the Ramachandran plots. Various Ang II-AT1 receptor antagonist drugs are available in the market as antihypertensive drug, so we have performed docking study with the binding site prediction algorithms to predict different binding pockets on the modeled proteins. The identification of 3D structures and binding sites for various known drugs will guide us for the structure-based drug design of novel compounds as Ang II-AT1 receptor antagonists for the treatment of hypertension. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Insights Into the Bifunctional Aphidicolan-16-ß-ol Synthase Through Rapid Biomolecular Modeling Approaches.

PubMed

Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B

2018-01-01

Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of the enzyme's active site and that the geranylgeranyl diphosphate derived pyrophosphate moiety remains in the ACS active site thereby directing the cyclization process. Our cumulative data confirm that amino acids constituting the G-loop of diterpene synthases are involved in the open to the closed, catalytically active enzyme conformation. This study demonstrates that a simple and rapid biomolecular modeling procedure can predict catalytically relevant amino acids. The approach reduces computational and experimental screening efforts for diterpene synthase structure-function analyses.

Insights into the bifunctional Aphidicolan-16-ß-ol synthase through rapid biomolecular modelling approaches

NASA Astrophysics Data System (ADS)

Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.

2018-04-01

Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of the enzyme’s active site and that the geranylgeranyl diphosphate derived pyrophosphate moiety remains in the ACS active site thereby directing the cyclization process. Our cumulative data confirm that amino acids constituting the G-loop of diterpene synthases are involved in the open to the closed, catalytically active enzyme conformation. This study demonstrates that a simple and rapid biomolecular modelling procedure can predict catalytically relevant amino acids. The approach reduces computational and experimental screening efforts for diterpene synthase structure-function analyses.

Restoration and Carbon Sequestration Potential of Sub-Humid Shrublands in a Changing Climate

NASA Astrophysics Data System (ADS)

Adhikari, A.; White, J. D.

2014-12-01

Over the past century, various anthropogenic activities have resulted into loss of more than 95% shrub cover from the Lower Rio Grande Valley (LRGV), TX, USA. Restoration of these shrublands has been a priority for two endangered felids, ocelots and jaguarondis, that require contiguous shrub cover. While woody shrub restoration may be considered the antithesis of shrub encroachment, this type of habitat restoration also provides a substantial opportunity of increasing carbon sequestration. Restoration of these shrublands by U.S. federal refuge managers during the past three decades have resulted some successful reestablishment of native shrub communities. We assessed restoration efficacy, carbon storage capacity, and future climate change impacts using combined remote sensing and modeling techniques. We first developed a canopy identification algorithm using a spectral vegetation index from the Digital Ortho Quarter Quadrangle data to estimate individual shrub canopy area. The area was used as input into allometric equations to estimate aboveground biomass for dominant shrub species across this region. The accuracy of the automated canopy identification by the algorithm was 79% when compared to the number of visually-determined, hand-digitized shrub canopies. From this analysis, we found that naturally regenerated sites had higher average shrub densities of 174/ha when compared with 156 individuals/ha for replanted sites. However, average biomass for naturally regenerated sites (3.28 Mg C/ha) stored less biomass compared to that of replanted sites (3.71 Mg C/ha). We found that average biomass per shrub in naturally regenerated sites was lower compared to that of replanted sites (p < 0.05). Shrub density and biomass estimated from the remote sensing data was used as input for the Physiological Principles in Predicting Growth model to predict future shrub biomass for three GCM scenarios projected by IPCC (2007). Modeling showed that the LRGV may produce lower biomass per ha for the projected higher emission scenarios compared to lower emission scenarios. We conclude that restoration efforts within LRGV have contributed to increasing shrub density and sequestering carbon in tissue biomass, but future climate change is likely to reduce its carbon sequestration potential.

TSSi--an R package for transcription start site identification from 5' mRNA tag data.

PubMed

Kreutz, C; Gehring, J S; Lang, D; Reski, R; Timmer, J; Rensing, S A

2012-06-15

High-throughput sequencing has become an essential experimental approach for the investigation of transcriptional mechanisms. For some applications like ChIP-seq, several approaches for the prediction of peak locations exist. However, these methods are not designed for the identification of transcription start sites (TSSs) because such datasets contain qualitatively different noise. In this application note, the R package TSSi is presented which provides a heuristic framework for the identification of TSSs based on 5' mRNA tag data. Probabilistic assumptions for the distribution of the data, i.e. for the observed positions of the mapped reads, as well as for systematic errors, i.e. for reads which map closely but not exactly to a real TSS, are made and can be adapted by the user. The framework also comprises a regularization procedure which can be applied as a preprocessing step to decrease the noise and thereby reduce the number of false predictions. The R package TSSi is available from the Bioconductor web site: www.bioconductor.org/packages/release/bioc/html/TSSi.html.

Development of an on-site screening system for amphetamine-type stimulant tablets with a portable attenuated total reflection Fourier transform infrared spectrometer.

PubMed

Tsujikawa, Kenji; Kuwayama, Kenji; Miyaguchi, Hajime; Kanamori, Tatsuyuki; Iwata, Yuko T; Yoshida, Takemi; Inoue, Hiroyuki

2008-02-04

We tried to develop a library search system using a portable, attenuated total reflection Fourier transform infrared (ATR-FT-IR) spectrometer for on-site identification of 3,4-methylenedioxymethamphetamine (MDMA) and 3,4-methylenedioxyamphetamine (MDA) tablets. The library consisted of the spectra from mixtures of controlled drugs (e.g. MDMA and ketamine), adulterants (e.g. caffeine), and diluents (e.g. lactose). In the seven library search algorithms, the derivative correlation coefficient showed the best discriminant capability. This was enhanced by segmentation of the search area. The optimized search algorithm was validated by the positive (n=154, e.g. the standard mixtures containing the controlled drug, and the MDMA/MDA tablets confiscated) and negative samples (n=56, e.g. medicinal tablets). All validation samples except for four were judged truly. Final criteria for positive identification were decided on the basis of the results of the validation. In conclusion, a portable ATR-FT-IR spectrometer with our library search system would be a useful tool for on-site identification of amphetamine-type stimulant tablets.

CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

PubMed

Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

2018-05-10

CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

Large microplastic particles in sediments of tributaries of the River Thames, UK - Abundance, sources and methods for effective quantification.

PubMed

Horton, Alice A; Svendsen, Claus; Williams, Richard J; Spurgeon, David J; Lahive, Elma

2017-01-15

Sewage effluent input and population were chosen as predictors of microplastic presence in sediments at four sites in the River Thames basin (UK). Large microplastic particles (1mm-4mm) were extracted using a stepwise approach to include visual extraction, flotation and identification using Raman spectroscopy. Microplastics were found at all four sites. One site had significantly higher numbers of microplastics than other sites, average 66 particles 100g -1 , 91% of which were fragments. This site was downstream of a storm drain outfall receiving urban runoff; many of the fragments at this site were determined to be derived of thermoplastic road-surface marking paints. At the remaining three sites, fibres were the dominant particle type. The most common polymers identified included polypropylene, polyester and polyarylsulphone. This study describes two major new findings: presence of microplastic particles in a UK freshwater system and identification of road marking paints as a source of microplastics. This study is the first to quantify microplastics of any size in river sediments in the UK and links their presence to terrestrial sources including sewage and road marking paints. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

Identification of novel antibody-reactive detection sites for comprehensive gluten monitoring.

PubMed

Röckendorf, Niels; Meckelein, Barbara; Scherf, Katharina A; Schalk, Kathrin; Koehler, Peter; Frey, Andreas

2017-01-01

Certain cereals like wheat, rye or barley contain gluten, a protein mixture that can trigger celiac disease (CD). To make gluten-free diets available for affected individuals the gluten content of foodstuff must be monitored. For this purpose, antibody-based assays exist which rely on the recognition of certain linear gluten sequence motifs. Yet, not all CD-active gluten constituents and fragments formed during food processing/fermentation may be covered by those tests. In this study, we therefore assayed the coverage of reportedly CD-active gluten components by currently available detection antibodies and determined the antibody-inducing capacity of wheat gluten constituents in order to provide novel diagnostic targets for comprehensive gluten quantitation. Immunizations of outbred mice with purified gliadins and glutenins were conducted and the linear target recognition profile of the sera was recorded using synthetic peptide arrays that covered the sequence space of gluten constituents present in those preparations. The resulting murine immunorecognition profile of gluten demonstrated that further linear binding sites beyond those recognized by the monoclonal antibodies α20, R5 and G12 exist and may be exploitable as diagnostic targets. We conclude that the safety of foodstuffs for CD patients can be further improved by complementing current tests with antibodies directed against additional CD-active gluten components. Currently unrepresented linear gluten detection sites in glutenins and α-gliadins suggest sequences QQQYPS, PQQSFP, QPGQGQQG and QQPPFS as novel targets for antibody generation.

Identification of novel antibody-reactive detection sites for comprehensive gluten monitoring

PubMed Central

Röckendorf, Niels; Meckelein, Barbara; Scherf, Katharina A.; Schalk, Kathrin; Koehler, Peter

2017-01-01

Certain cereals like wheat, rye or barley contain gluten, a protein mixture that can trigger celiac disease (CD). To make gluten-free diets available for affected individuals the gluten content of foodstuff must be monitored. For this purpose, antibody-based assays exist which rely on the recognition of certain linear gluten sequence motifs. Yet, not all CD-active gluten constituents and fragments formed during food processing/fermentation may be covered by those tests. In this study, we therefore assayed the coverage of reportedly CD-active gluten components by currently available detection antibodies and determined the antibody-inducing capacity of wheat gluten constituents in order to provide novel diagnostic targets for comprehensive gluten quantitation. Immunizations of outbred mice with purified gliadins and glutenins were conducted and the linear target recognition profile of the sera was recorded using synthetic peptide arrays that covered the sequence space of gluten constituents present in those preparations. The resulting murine immunorecognition profile of gluten demonstrated that further linear binding sites beyond those recognized by the monoclonal antibodies α20, R5 and G12 exist and may be exploitable as diagnostic targets. We conclude that the safety of foodstuffs for CD patients can be further improved by complementing current tests with antibodies directed against additional CD-active gluten components. Currently unrepresented linear gluten detection sites in glutenins and α-gliadins suggest sequences QQQYPS, PQQSFP, QPGQGQQG and QQPPFS as novel targets for antibody generation. PMID:28759621

The 1.25 Å resolution structure of phosphoribosyl-ATP pyrophosphohydrolase from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Javid-Majd, Farah; Yang, Dong; Ioerger, Thomas R.

2008-06-23

Phosphoribosyl-ATP pyrophosphohydrolase is the second enzyme in the histidine-biosynthetic pathway, irreversibly hydrolyzing phosphoribosyl-ATP to phosphoribosyl-AMP and pyrophosphate. It is encoded by the hisE gene, which is present as a separate gene in many bacteria and archaea but is fused to hisI in other bacteria, fungi and plants. Because of its essentiality for growth in vitro, HisE is a potential drug target for tuberculosis. The crystal structures of two native (uncomplexed) forms of HisE from Mycobacterium tuberculosis have been determined to resolutions of 1.25 and 1.79 {angstrom}. The structure of the apoenzyme reveals that the protein is composed of five -helicesmore » with connecting loops and is a member of the {alpha}-helical nucleoside-triphosphate pyrophosphatase superfamily. The biological unit of the protein is a homodimer, with an active site on each subunit composed of residues exclusively from that subunit. A comparison with the Campylobacter jejuni dUTPase active site allowed the identification of putative metal- and substrate-binding sites in HisE, including four conserved glutamate and glutamine residues in the sequence that are consistent with a motif for pyrophosphohydrolase activity. However, significant differences between family members are observed in the loop region between {alpha}-helices H1 and H3. The crystal structure of M. tuberculosis HisE provides insights into possible mechanisms of substrate binding and the diversity of the nucleoside-triphosphate pyrophosphatase superfamily.« less

Quantitative in vivo Analyses Reveal Calcium-dependent Phosphorylation Sites and Identifies a Novel Component of the Toxoplasma Invasion Motor Complex

PubMed Central

Nebl, Thomas; Prieto, Judith Helena; Kapp, Eugene; Smith, Brian J.; Williams, Melanie J.; Yates, John R.; Cowman, Alan F.; Tonkin, Christopher J.

2011-01-01

Apicomplexan parasites depend on the invasion of host cells for survival and proliferation. Calcium-dependent signaling pathways appear to be essential for micronemal release and gliding motility, yet the target of activated kinases remains largely unknown. We have characterized calcium-dependent phosphorylation events during Toxoplasma host cell invasion. Stimulation of live tachyzoites with Ca2+-mobilizing drugs leads to phosphorylation of numerous parasite proteins, as shown by differential 2-DE display of 32[P]-labeled protein extracts. Multi-dimensional Protein Identification Technology (MudPIT) identified ∼546 phosphorylation sites on over 300 Toxoplasma proteins, including 10 sites on the actomyosin invasion motor. Using a Stable Isotope of Amino Acids in Culture (SILAC)-based quantitative LC-MS/MS analyses we monitored changes in the abundance and phosphorylation of the invasion motor complex and defined Ca2+-dependent phosphorylation patterns on three of its components - GAP45, MLC1 and MyoA. Furthermore, calcium-dependent phosphorylation of six residues across GAP45, MLC1 and MyoA is correlated with invasion motor activity. By analyzing proteins that appear to associate more strongly with the invasion motor upon calcium stimulation we have also identified a novel 15-kDa Calmodulin-like protein that likely represents the MyoA Essential Light Chain of the Toxoplasma invasion motor. This suggests that invasion motor activity could be regulated not only by phosphorylation but also by the direct binding of calcium ions to this new component. PMID:21980283

Identification of the regulatory autophosphorylation site of autophosphorylation-dependent protein kinase (auto-kinase). Evidence that auto-kinase belongs to a member of the p21-activated kinase family.

PubMed

Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D

1998-08-15

Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both autophosphorylation/activation and protein phosphatase-mediated dephosphorylation/inactivation processes. Taken together, our results identify Thr402 as the regulatory autophosphorylation site of auto-kinase, which is a C-terminal catalytic fragment of PAK2.

Identification of the regulatory autophosphorylation site of autophosphorylation-dependent protein kinase (auto-kinase). Evidence that auto-kinase belongs to a member of the p21-activated kinase family.

PubMed Central

Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D

1998-01-01

Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both autophosphorylation/activation and protein phosphatase-mediated dephosphorylation/inactivation processes. Taken together, our results identify Thr402 as the regulatory autophosphorylation site of auto-kinase, which is a C-terminal catalytic fragment of PAK2. PMID:9693111

77 FR 54576 - Proposed RCRA Prospective Purchaser Agreement, Order on Consent and Covenant Not To Sue for a...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-05

... contaminated soils; planting of trees and other native vegetation; installing walkways; installing new... N. Chevrolet Avenue, Flint, Michigan (Site). The EPA identification number for the Site is MID 005...

Savannah River Site Experiences in In Situ Field Measurements of Radioactive Materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moore, F.S.

1999-10-07

This paper discusses some of the field gamma-ray measurements made at the Savannah River Site, the equipment used for the measurements, and lessons learned during in situ identification and characterization of radioactive materials.