Sample records for active site located

  1. Facebook, Twitter Activities Sites, Location and Students' Interest in Learning

    ERIC Educational Resources Information Center

    Igbo, J. N.; Ezenwaji, Ifeyinwa; Ajuziogu, Christiana U.

    2018-01-01

    This study was carried out to ascertain the influence of social networking sites activities (twitter and Facebook) on secondary school students' interest in learning It also considered the impact of these social networking sites activities on location of the students. Two research questions and two null hypotheses guided the study. Mean and…

  2. 10 CFR 40.2a - Coverage of inactive tailings sites.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... materials as defined in this part that are located at a site where milling operations are no longer active... defined in this part that is located at a site where milling operations are no longer active, if such site... 10 Energy 1 2011-01-01 2011-01-01 false Coverage of inactive tailings sites. 40.2a Section 40.2a...

  3. 10 CFR 40.2a - Coverage of inactive tailings sites.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... materials as defined in this part that are located at a site where milling operations are no longer active... defined in this part that is located at a site where milling operations are no longer active, if such site... 10 Energy 1 2012-01-01 2012-01-01 false Coverage of inactive tailings sites. 40.2a Section 40.2a...

  4. 10 CFR 40.2a - Coverage of inactive tailings sites.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... materials as defined in this part that are located at a site where milling operations are no longer active... defined in this part that is located at a site where milling operations are no longer active, if such site... 10 Energy 1 2014-01-01 2014-01-01 false Coverage of inactive tailings sites. 40.2a Section 40.2a...

  5. 10 CFR 40.2a - Coverage of inactive tailings sites.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... materials as defined in this part that are located at a site where milling operations are no longer active... defined in this part that is located at a site where milling operations are no longer active, if such site... 10 Energy 1 2013-01-01 2013-01-01 false Coverage of inactive tailings sites. 40.2a Section 40.2a...

  6. Influence of active site location on catalytic activity in de novo-designed zinc metalloenzymes.

    PubMed

    Zastrow, Melissa L; Pecoraro, Vincent L

    2013-04-17

    While metalloprotein design has now yielded a number of successful metal-bound and even catalytically active constructs, the question of where to put a metal site along a linear, repetitive sequence has not been thoroughly addressed. Often several possibilities in a given sequence may exist that would appear equivalent but may in fact differ for metal affinity, substrate access, or protein dynamics. We present a systematic variation of active site location for a hydrolytically active ZnHis3O site contained within a de novo-designed three-stranded coiled coil. We find that the maximal rate, substrate access, and metal-binding affinity are dependent on the selected position, while catalytic efficiency for p-nitrophenyl acetate hydrolysis can be retained regardless of the location of the active site. This achievement demonstrates how efficient, tailor-made enzymes which control rate, pKa, substrate and solvent access (and selectivity), and metal-binding affinity may be realized. These findings may be applied to the more advanced de novo design of constructs containing secondary interactions, such as hydrogen-bonding channels. We are now confident that changes to location for accommodating such channels can be achieved without location-dependent loss of catalytic efficiency. These findings bring us closer to our ultimate goal of incorporating the secondary interactions we believe will be necessary in order to improve both active site properties and the catalytic efficiency to be competitive with the native enzyme, carbonic anhydrase.

  7. TALE activators regulate gene expression in a position- and strand-dependent manner in mammalian cells.

    PubMed

    Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao

    2014-01-24

    Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. The National Children's Study: Recruitment Outcomes Using an Enhanced Household-Based Approach.

    PubMed

    Blaisdell, Laura L; Zellner, Jennifer A; King, Alison A; Faustman, Elaine; Wilhelm, Mari; Hudak, Mark L; Annett, Robert D

    2016-06-01

    Ten National Children's Study (NCS) study locations with diverse demographic characteristics used an enhanced household-based recruitment (EHBR) approach to enroll preconceptional and pregnant women. Study centers used different types and dosages of community outreach and engagement (COE) activities and supplemental strategies. The goal of the study was to determine whether variability in enumeration and recruitment outcomes correlated with study location characteristics or types and dosages of COE activities (number of COE events, number of advance household mailings, total media expenditures, and total COE expenditures). Each of the sites provided data on COE activities, protocol implementation, supplemental recruitment activities, location demographic characteristics, and enumeration/recruitment outcomes. COE activities varied across sites in breadth and scope. Numerous strategies were used, including media advertising, social media, participation in community-wide events, presentations to stakeholders, and creation of advisory boards. Some sites included supplemental recruitment efforts. EHBR sites enrolled 1404 women at the initial pregnancy screening. No significant relationships were found between study location demographic characteristics or between the types and dosages of COE activities and recruitment outcomes. Probability sampling for a long-term study requires a positive image with stakeholders and within communities; this requirement may be especially true for door-to-door recruitment. EHBR sites successfully recruited a representative sample of preconceptional and pregnant women. Sites reported implementing similar COE activities but with varying dosage and cost; however, analyses did not support a benefit of COE strategies on study recruitment. Copyright © 2016 by the American Academy of Pediatrics.

  9. Locating bomb factories by detecting hydrogen peroxide.

    PubMed

    Romolo, Francesco Saverio; Connell, Samantha; Ferrari, Carlotta; Suarez, Guillaume; Sauvain, Jean-Jacques; Hopf, Nancy B

    2016-11-01

    The analytical capability to detect hydrogen peroxide vapour can play a key role in localizing a site where a H2O2 based Improvised Explosive (IE) is manufactured. In security activities it is very important to obtain information in a short time. For this reason, an analytical method to be used in security activity needs portable devices. The authors have developed the first analytical method based on a portable luminometer, specifically designed and validated to locate IE manufacturing sites using quantitative on-site vapour analysis for H2O2. The method was tested both indoor and outdoor. The results demonstrate that the detection of H2O2 vapours could allow police forces to locate the site, while terrorists are preparing an attack. The collected data are also very important in developing new sensors, able to give an early alarm if located at a proper distance from a site where an H2O2 based IE is prepared. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Enzyme/non-enzyme discrimination and prediction of enzyme active site location using charge-based methods.

    PubMed

    Bate, Paul; Warwicker, Jim

    2004-07-02

    Calculations of charge interactions complement analysis of a characterised active site, rationalising pH-dependence of activity and transition state stabilisation. Prediction of active site location through large DeltapK(a)s or electrostatic strain is relevant for structural genomics. We report a study of ionisable groups in a set of 20 enzymes, finding that false positives obscure predictive potential. In a larger set of 156 enzymes, peaks in solvent-space electrostatic properties are calculated. Both electric field and potential match well to active site location. The best correlation is found with electrostatic potential calculated from uniform charge density over enzyme volume, rather than from assignment of a standard atom-specific charge set. Studying a shell around each molecule, for 77% of enzymes the potential peak is within that 5% of the shell closest to the active site centre, and 86% within 10%. Active site identification by largest cleft, also with projection onto a shell, gives 58% of enzymes for which the centre of the largest cleft lies within 5% of the active site, and 70% within 10%. Dielectric boundary conditions emphasise clefts in the uniform charge density method, which is suited to recognition of binding pockets embedded within larger clefts. The variation of peak potential with distance from active site, and comparison between enzyme and non-enzyme sets, gives an optimal threshold distinguishing enzyme from non-enzyme. We find that 87% of the enzyme set exceeds the threshold as compared to 29% of the non-enzyme set. Enzyme/non-enzyme homologues, "structural genomics" annotated proteins and catalytic/non-catalytic RNAs are studied in this context.

  11. Effects of location and timing of co-activated neurons in the auditory midbrain on cortical activity: implications for a new central auditory prosthesis

    NASA Astrophysics Data System (ADS)

    Straka, Małgorzata M.; McMahon, Melissa; Markovitz, Craig D.; Lim, Hubert H.

    2014-08-01

    Objective. An increasing number of deaf individuals are being implanted with central auditory prostheses, but their performance has generally been poorer than for cochlear implant users. The goal of this study is to investigate stimulation strategies for improving hearing performance with a new auditory midbrain implant (AMI). Previous studies have shown that repeated electrical stimulation of a single site in each isofrequency lamina of the central nucleus of the inferior colliculus (ICC) causes strong suppressive effects in elicited responses within the primary auditory cortex (A1). Here we investigate if improved cortical activity can be achieved by co-activating neurons with different timing and locations across an ICC lamina and if this cortical activity varies across A1. Approach. We electrically stimulated two sites at different locations across an isofrequency ICC lamina using varying delays in ketamine-anesthetized guinea pigs. We recorded and analyzed spike activity and local field potentials across different layers and locations of A1. Results. Co-activating two sites within an isofrequency lamina with short inter-pulse intervals (<5 ms) could elicit cortical activity that is enhanced beyond a linear summation of activity elicited by the individual sites. A significantly greater extent of normalized cortical activity was observed for stimulation of the rostral-lateral region of an ICC lamina compared to the caudal-medial region. We did not identify any location trends across A1, but the most cortical enhancement was observed in supragranular layers, suggesting further integration of the stimuli through the cortical layers. Significance. The topographic organization identified by this study provides further evidence for the presence of functional zones across an ICC lamina with locations consistent with those identified by previous studies. Clinically, these results suggest that co-activating different neural populations in the rostral-lateral ICC rather than the caudal-medial ICC using the AMI may improve or elicit different types of hearing capabilities.

  12. Identification of the Allosteric Site for Phenylalanine in Rat Phenylalanine Hydroxylase*

    PubMed Central

    Zhang, Shengnan; Fitzpatrick, Paul F.

    2016-01-01

    Liver phenylalanine hydroxylase (PheH) is an allosteric enzyme that requires activation by phenylalanine for full activity. The location of the allosteric site for phenylalanine has not been established. NMR spectroscopy of the isolated regulatory domain (RDPheH(25–117) is the regulatory domain of PheH lacking residues 1–24) of the rat enzyme in the presence of phenylalanine is consistent with formation of a side-by-side ACT dimer. Six residues in RDPheH(25–117) were identified as being in the phenylalanine-binding site on the basis of intermolecular NOEs between unlabeled phenylalanine and isotopically labeled protein. The location of these residues is consistent with two allosteric sites per dimer, with each site containing residues from both monomers. Site-specific variants of five of the residues (E44Q, A47G, L48V, L62V, and H64N) decreased the affinity of RDPheH(25–117) for phenylalanine based on the ability to stabilize the dimer. Incorporation of the A47G, L48V, and H64N mutations into the intact protein increased the concentration of phenylalanine required for activation. The results identify the location of the allosteric site as the interface of the regulatory domain dimer formed in activated PheH. PMID:26823465

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aurelio, Mario; Taguibao, Kristine Joy; Vargas, Edmundo

    In the selection of sites for disposal facilities involving low- and intermediate-level radioactive waste (LILW), International Atomic Energy Agency (IAEA) recommendations require that 'the region in which the site is located shall be such that significant tectonic and surface processes are not expected to occur with an intensity that would compromise the required isolation capability of the repository'. Evaluating the appropriateness of a site therefore requires a deep understanding of the geological and tectonic setting of the area. The Philippines sits in a tectonically active region frequented by earthquakes and volcanic activity. Its highly variable morphology coupled with its locationmore » along the typhoon corridor in the west Pacific region subjects the country to surface processes often manifested in the form of landslides. The Philippine LILW near surface repository project site is located on the north eastern sector of the Island of Luzon in northern Philippines. This island is surrounded by active subduction trenches; to the east by the East Luzon Trough and to the west by the Manila Trench. The island is also traversed by several branches of the Philippine Fault System. The Philippine LILW repository project is located more than 100 km away from any of these major active fault systems. In the near field, the project site is located less than 10 km from a minor fault (Dummon River Fault) and more than 40 km away from a volcanic edifice (Mt. Caguas). This paper presents an analysis of the potential hazards that these active tectonic features may pose to the project site. The assessment of such geologic hazards is imperative in the characterization of the site and a crucial input in the design and safety assessment of the repository. (authors)« less

  14. Ngram time series model to predict activity type and energy cost from wrist, hip and ankle accelerometers: implications of age

    PubMed Central

    Strath, Scott J; Kate, Rohit J; Keenan, Kevin G; Welch, Whitney A; Swartz, Ann M

    2016-01-01

    To develop and test time series single site and multi-site placement models, we used wrist, hip and ankle processed accelerometer data to estimate energy cost and type of physical activity in adults. Ninety-nine subjects in three age groups (18–39, 40–64, 65 + years) performed 11 activities while wearing three triaxial accelereometers: one each on the non-dominant wrist, hip, and ankle. During each activity net oxygen cost (METs) was assessed. The time series of accelerometer signals were represented in terms of uniformly discretized values called bins. Support Vector Machine was used for activity classification with bins and every pair of bins used as features. Bagged decision tree regression was used for net metabolic cost prediction. To evaluate model performance we employed the jackknife leave-one-out cross validation method. Single accelerometer and multi-accelerometer site model estimates across and within age group revealed similar accuracy, with a bias range of −0.03 to 0.01 METs, bias percent of −0.8 to 0.3%, and a rMSE range of 0.81–1.04 METs. Multi-site accelerometer location models improved activity type classification over single site location models from a low of 69.3% to a maximum of 92.8% accuracy. For each accelerometer site location model, or combined site location model, percent accuracy classification decreased as a function of age group, or when young age groups models were generalized to older age groups. Specific age group models on average performed better than when all age groups were combined. A time series computation show promising results for predicting energy cost and activity type. Differences in prediction across age group, a lack of generalizability across age groups, and that age group specific models perform better than when all ages are combined needs to be considered as analytic calibration procedures to detect energy cost and type are further developed. PMID:26449155

  15. 10 CFR 960.3-2-2-4 - The environmental assessment.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the site-characterization activities at the site on public health and safety and the environment; a discussion of alternative activities related to site characterization that may be taken to avoid such impact; and an assessment of the regional and local impacts of locating a repository at the site. The draft...

  16. Closure Report for Corrective Action Unit 465: Hydronuclear Nevada National Security Site, Nevada, Revision 0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mark Burmeister and Patrick Matthews

    2012-11-01

    The corrective action sites (CASs) within CAU 465 are located within Areas 6 and 27 of the NNSS. CAU 465 comprises the following CASs: • 00-23-01, Hydronuclear Experiment, located in Area 27 of the NNSS and known as the Charlie site. • 00-23-02, Hydronuclear Experiment, located in Area 27 of the NNSS and known as the Dog site. • 00-23-03, Hydronuclear Experiment, located in Area 27 of the NNSS and known as the Charlie Prime and Anja sites. • 06-99-01, Hydronuclear, located in Area 6 of the NNSS and known as the Trailer 13 site. The purpose of this CRmore » is to provide documentation supporting the completed corrective actions and provide data confirming that the closure objectives for CASs within CAU 465 were met. From September 2011 through July 2012, closure activities were performed as set forth in the Streamlined Approach for Environmental Restoration Plan for CAU 465: Hydronuclear, Nevada National Security Site, Nevada.« less

  17. Assessment of karst activity at highway construction sites using the electrical resistivity method (Greene and Jefferson Counties, Missouri).

    DOT National Transportation Integrated Search

    2006-11-01

    Two-dimensional (2-D) electrical resistivity data were acquired across and in proximity to active sinkholes at two Missouri : Department of Transportation (MoDOT) highway-construction sites. Construction site #1 is located in Greene County, Missouri;...

  18. 3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

    PubMed Central

    Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

    2016-01-01

    Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

  19. From Points to Patterns - Functional Relations between Groundwater Connectivity and Catchment-scale Streamflow Response

    NASA Astrophysics Data System (ADS)

    Rinderer, M.; McGlynn, B. L.; van Meerveld, I. H. J.

    2016-12-01

    Groundwater measurements can help us to improve our understanding of runoff generation at the catchment-scale but typically only provide point-scale data. These measurements, therefore, need to be interpolated or upscaled in order to obtain information about catchment scale groundwater dynamics. Our approach used data from 51 spatially distributed groundwater monitoring sites in a Swiss pre-alpine catchment and time series clustering to define six groundwater response clusters. Each of the clusters was characterized by distinctly different site characteristics (i.e., Topographic Wetness Index and curvature), which allowed us to assign all unmonitored locations to one of these clusters. Time series modeling and the definition of response thresholds (i.e., the depth of more transmissive soil layers) allowed us to derive maps of the spatial distribution of active (i.e., responding) locations across the catchment at 15 min time intervals. Connectivity between all active locations and the stream network was determined using a graph theory approach. The extent of the active and connected areas differed during events and suggests that not all active locations directly contributed to streamflow. Gate keeper sites prevented connectivity of upslope locations to the channel network. Streamflow dynamics at the catchment outlet were correlated to catchment average connectivity dynamics. In a sensitivity analysis we tested six different groundwater levels for a site to be considered "active", which showed that the definition of the threshold did not significantly influence the conclusions drawn from our analysis. This study is the first one to derive patterns of groundwater dynamics based on empirical data (rather than interpolation) and provides insight into the spatio-temporal evolution of the active and connected runoff source areas at the catchment-scale that is critical to understanding the dynamics of water quantity and quality in streams.

  20. GAS HYDRATES AT TWO SITES OF AN ACTIVE CONTINENTAL MARGIN.

    USGS Publications Warehouse

    Kvenvolden, K.A.

    1985-01-01

    Sediment containing gas hydrates from two distant Deep Sea Drilling Project sites (565 and 568), located about 670 km apart on the landward flank of the Middle America Trench, was studied to determine the geochemical conditions that characterize the occurrence of gas hydrates. Site 565 was located in the Pacific Ocean offshore the Nicoya Peninsula of Costa Rica in 3,111 m of water. The depth of the hole at this site was 328 m, and gas hydrates were recovered from 285 and 319 m. Site 568 was located about 670 km to the northwest offshore Guatemala in 2,031 m of water. At this site the hole penetrated to 418 m, and gas hydrates were encountered at 404 m.

  1. A macroinvertebrate assessment of Ozark streams located in lead-zinc mining areas of the Viburnum Trend in southeastern Missouri, USA

    USGS Publications Warehouse

    Poulton, Barry C.; Allert, Ann L.; Besser, John M.; Schmitt, Christopher J.; Brumbaugh, William G.; Fairchild, James F.

    2010-01-01

    The Viburnum Trend lead-zinc mining subdistrict is located in the southeast Missouri portion of the Ozark Plateau. In 2003 and 2004, we assessed the ecological effects of mining in several watersheds in the region. We included macroinvertebrate surveys, habitat assessments, and analysis of metals in sediment, pore water, and aquatic biota. Macroinvertebrates were sampled at 21 sites to determine aquatic life impairment status (full, partial, or nonsupport) and relative biotic condition scores. Macroinvertebrate biotic condition scores were significantly correlated with cadmium, nickel, lead, zinc, and specific conductance in 2003 (r = -0.61 to -0.68) and with cadmium, lead, and pore water toxic units in 2004 (r = -0.55 to -0.57). Reference sites were fully supporting of aquatic life and had the lowest metals concentrations and among the highest biotic condition scores in both years. Sites directly downstream from mining and related activities were partially supporting, with biotic condition scores 10% to 58% lower than reference sites. Sites located greater distances downstream from mining activities had intermediate scores and concentrations of metals. Results indicate that elevated concentrations of metals originating from mining activities were the underlying cause of aquatic life impairment in several of the streams studied. There was general concurrence among the adversely affected sites in how the various indicators responded to mining activities during the overall study.

  2. Borehole dilatometer installation, operation, and maintenance at sites in Hawaii

    USGS Publications Warehouse

    Myren, G.D.; Johnston, M.J.S.; Mueller, R.J.

    2006-01-01

    In response to concerns about the potential hazard of Mauna Loa volcano in Hawaii, the USGS began efforts in 1998 to add four high-resolution borehole sites. Located at these sites are; strainmeters, tiltmeters, seismometers, accelerometers and other instrumentation. These instruments are capable of providing continuous monitoring of the magma movement under Mauna Loa. Each site was planned to provide multi-parameter monitoring of volcanic activity. In June of 2000, a contract was let for the core drilling of three of these four sites. They are located at Hokukano (west side of Mauna Loa) above Captain Cook, Hawaii; at Mauna Loa Observatory (11,737 feet near the summit), and at Mauna Loa Strip Road (east side of Mauna Loa). Another site was chosen near Halema'uma u' and Kilauea's summit, in the Keller deep well. (See maps). The locations of these instruments are shown in Figure 1 with their latitude and longitude in Table 1. The purpose of this network is to monitor crustal deformation associated with volcanic intrusions and earthquakes on Mauna Loa and Kilauea volcanoes. This report describes the methods used to locate sites, install dilatometers, other instrumentation, and telemetry. We also provide a detailed description of the electronics used for signal amplification and telemetry, plus techniques used for instrument maintenance. Instrument sites were selected in regions of hard volcanic rock where the expected signals from magmatic activity were calculated to be a maximum and the probability of earthquakes with magnitude 4 or greater is large. At each location, an attempt was made to separate tectonic and volcanic signals from known noise sources for each instrument type.

  3. Health assessment for Texarkana Wood Preserving Company, Texarkana, Bowie County, Texas, Region 6. CERCLIS No. TXD008056152. Addendum. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The Texarkana Wood Preserving Company (TWPC) is a National Priorities List site located in northeastern Texas, at the southern extremity of the City of Texarkana in Bowie County. The TWPC site has been used for various lumber-related activities since the early 1900s and for creosoting operations since the early 1950s. Contaminated soils, groundwater, surface water, and surface water sediments have been detected on and off of the TWPC site. The primary contaminants of concern are polycyclic aromatic hydrocarbons, pentachlorophenol, chlorinated dibenzodioxins and chlorinated dibenzofurans. The population at greatest risk of exposure to these contaminants are on-site workers engaged in remedialmore » activities. There are currently no residences or businesses located immediately adjacent to the site and no documentation that contaminated groundwater is being used for potable purposes. The Texarkana Wood Preserving Company site has been evaluated by the Agency for Toxic Substances and Disease Registry (ATSDR) Health Activities Recommendation Panel (HARP) for appropriate follow-up with respect to health activities.« less

  4. Field Assessment of Gopher Tortoise Habitat at Camp Shelby, MS. Phase II: Overstory and Combined Assessments

    DTIC Science & Technology

    2010-10-17

    conditions between active, recently active and randomly selected non-burrow locations at this site. Field surveys were completed in three study areas ...at the installation. On average, burrow sites had a much higher overall occurrence of longleaf pine and significantly lower total basal area as...East Area burrow and non-burrow locations, Camp Shelby, MS 2007 .................. 10 2 Mean basal area per acre for pine and hardwood on T-44, Mars

  5. Fiscal Year 2009 Revegetation Assessment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Michael Lewis

    2009-10-01

    This report summarizes the Fiscal Year 2009 Revegetation Assessment by Battelle Energy Alliance, LLC. This assessment was conducted to supplement documentation related to the Storm Water Pollution Prevention Plan for Construction Activities and to ensure that disturbed vegetation and soil at various locations are being restored. This report provides the following information for each site being monitored by the Idaho National Laboratory Environmental Support and Services: • Summary of each site • Assessment of vegetation status and site stabilization at each location • Recommendation(s) for each site.

  6. Fiscal Year 2010 Revegetation Assessment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jenifer Nordstrom; Mike Lewis

    2010-11-01

    This report summarizes the Fiscal Year 2010 Revegetation Assessment by Battelle Energy Alliance, LLC. This assessment was conducted to supplement documentation related to the Storm Water Pollution Prevention Plan for Construction Activities and to ensure that disturbed vegetation and soil at various locations are being restored. This report provides the following information for each site being monitored by the Idaho National Laboratory Environmental Support and Services: • Summary of each site • Assessment of vegetation status and site stabilization at each location • Recommendation(s) for each site.

  7. Is part-night lighting an effective measure to limit the impacts of artificial lighting on bats?

    PubMed

    Azam, Clémentine; Kerbiriou, Christian; Vernet, Arthur; Julien, Jean-François; Bas, Yves; Plichard, Laura; Maratrat, Julie; Le Viol, Isabelle

    2015-12-01

    As light pollution is currently considered to be a major threat to biodiversity, different lighting management options are being explored to mitigate the impact of artificial lighting on wildlife. Although part-night lighting schemes have been adopted by many local authorities across Europe to reduce the carbon footprint and save energy, their effects on biodiversity are unknown. Through a paired, in situ experiment, we compared the activity levels of 8 bat species under unlit, part-night, and full-night lighting treatments in a rural area located 60 km south of Paris, France. We selected 36 study locations composed of 1 lit site and a paired unlit control site; 24 of these sites were located in areas subject to part-night lighting schemes, and 12 sites were in areas under standard, full-night lighting. There was significantly more activity on part-night lighting sites compared to full-night lighting sites for the late-emerging, light-sensitive Plecotus spp., and a similar pattern was observable for Myotis spp., although not significant. In contrast, part-night lighting did not influence the activity of early emerging bat species around streetlights, except for Pipistrellus pipistrellus for which there was significantly less activity on part-night lighting sites than on full-night lighting sites. Overall, no significant difference in activity between part- and full-night lighting sites were observed in 5 of the 8 species studied, suggesting that current part-night lighting schemes fail to encompass the range of activity of most bat species. We recommend that such schemes start earlier at night to effectively mitigate the adverse effects of artificial lighting on light-sensitive species, particularly along ecological corridors that are especially important to the persistence of biodiversity in urban landscapes. © 2015 John Wiley & Sons Ltd.

  8. Foraging location and site fidelity of the Double-crested Cormorant on Oneida Lake, New York

    USGS Publications Warehouse

    Coleman, J.T.H.; Richmond, M.E.; Rudstam, L. G.; Mattison, P.M.

    2005-01-01

    We studied the foraging behavior of the Double-crested Cormorant (Phalacrocorax auritus) on Oneida Lake, New York, by monitoring the activities of 27 radio-tagged birds in July and August of 1999 and 2000. A total of 224 locations were obtained of cormorants actively diving, and presumed foraging, at the time of detection. A geographic information system was used to examine foraging distances from the nesting island, the water depth and type of substrate at preferred foraging sites, and to estimate kernel home ranges for analysis of individual foraging site fidelity. An explanatory model was developed to determine parameters affecting the distance to cormorant foraging sites. The mean distance to foraging locations of tagged cormorants from the colony site was 2,920 m (SE ?? 180 m, max = 14,190 m), and 52% of the locations were within 2,000 m of the nesting island. No cormorant was observed making daily foraging trips to outside water bodies. Mean foraging distance was greater during morning than in the afternoon, and there was a significant effect of the time of day on distance. There was no significant effect of sex date, a seasonal measure on distance to foraging location. Individual cormorants exhibited fidelity to specific foraging sites. Most cormorants foraged in close proximity to the nesting island much of the time, while those detected further from the island tended to return repeatedly to the same locations. Ninety percent of the foraging locations were in water depths ???7.5 m, and most were in water 2.5-5 m deep. Compositional analysis of habitat use revealed a preference for these depths, along with substrates of cobble with rubble, and silt with clay.

  9. Optimization Review, Black Butte Mine Superfund Site, Lane County, Oregon

    EPA Pesticide Factsheets

    The BBM Superfund Site (the site) is located in Lane County, Oregon, approximately 35 miles southeast of Eugene and approximately 10 miles upstream from the Cottage Grove Reservoir (CGR). Mercury mining and processing operations were active at the site...

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohay, Alan C.; Sweeney, Mark D.; Hartshorn, Donald C.

    The Hanford Seismic Assessment Program (HSAP) provides an uninterrupted collection of high-quality raw and processed seismic data from the Hanford Seismic Network for the U.S. Department of Energy and its contractors. The HSAP is responsible for locating and identifying sources of seismic activity and monitoring changes in the historical pattern of seismic activity at the Hanford Site. The data are compiled, archived, and published for use by the Hanford Site for waste management, natural phenomena hazards assessments, and engineering design and construction. In addition, the HSAP works with the Hanford Site Emergency Services Organization to provide assistance in the eventmore » of a significant earthquake on the Hanford Site. The Hanford Seismic Network and the Eastern Washington Regional Network consist of 44 individual sensor sites and 15 radio relay sites maintained by the Hanford Seismic Assessment Team. The Hanford Seismic Network recorded 23 local earthquakes during the third quarter of FY 2010. Sixteen earthquakes were located at shallow depths (less than 4 km), five earthquakes at intermediate depths (between 4 and 9 km), most likely in the pre-basalt sediments, and two earthquakes were located at depths greater than 9 km, within the basement. Geographically, twelve earthquakes were located in known swarm areas, 3 earthquakes occurred near a geologic structure (Saddle Mountain anticline), and eight earthquakes were classified as random events. The highest magnitude event (3.0 Mc) was recorded on May 8, 2010 at depth 3.0 km with epicenter located near the Saddle Mountain anticline. Later in the quarter (May 24 and June 28) two additional earthquakes were also recorded nearly at the same location. These events are not considered unusual in that earthquakes have been previously recorded at this location, for example, in October 2006 (Rohay et al; 2007). Six earthquakes were detected in the vicinity of Wooded Island, located about eight miles north of Richland just west of the Columbia River. The Wooded Island events recorded this quarter were a continuation of the swarm events observed during the 2009 and 2010 fiscal years and reported in previous quarterly and annual reports (Rohay et al; 2009a, 2009b, 2009c, 2010a, and 2010b). All events were considered minor (coda-length magnitude [Mc] less than 1.0) with a maximum depth estimated at 1.7 km. Based upon this quarters activity it is likely that the Wooded Island swarm has subsided. Pacific Northwest National Laboratory (PNNL) will continue to monitor for activity at this location.« less

  11. Normal Modes Expose Active Sites in Enzymes.

    PubMed

    Glantz-Gashai, Yitav; Meirson, Tomer; Samson, Abraham O

    2016-12-01

    Accurate prediction of active sites is an important tool in bioinformatics. Here we present an improved structure based technique to expose active sites that is based on large changes of solvent accessibility accompanying normal mode dynamics. The technique which detects EXPOsure of active SITes through normal modEs is named EXPOSITE. The technique is trained using a small 133 enzyme dataset and tested using a large 845 enzyme dataset, both with known active site residues. EXPOSITE is also tested in a benchmark protein ligand dataset (PLD) comprising 48 proteins with and without bound ligands. EXPOSITE is shown to successfully locate the active site in most instances, and is found to be more accurate than other structure-based techniques. Interestingly, in several instances, the active site does not correspond to the largest pocket. EXPOSITE is advantageous due to its high precision and paves the way for structure based prediction of active site in enzymes.

  12. Normal Modes Expose Active Sites in Enzymes

    PubMed Central

    Glantz-Gashai, Yitav; Samson, Abraham O.

    2016-01-01

    Accurate prediction of active sites is an important tool in bioinformatics. Here we present an improved structure based technique to expose active sites that is based on large changes of solvent accessibility accompanying normal mode dynamics. The technique which detects EXPOsure of active SITes through normal modEs is named EXPOSITE. The technique is trained using a small 133 enzyme dataset and tested using a large 845 enzyme dataset, both with known active site residues. EXPOSITE is also tested in a benchmark protein ligand dataset (PLD) comprising 48 proteins with and without bound ligands. EXPOSITE is shown to successfully locate the active site in most instances, and is found to be more accurate than other structure-based techniques. Interestingly, in several instances, the active site does not correspond to the largest pocket. EXPOSITE is advantageous due to its high precision and paves the way for structure based prediction of active site in enzymes. PMID:28002427

  13. 10 CFR 960.3-2-1 - Site screening for potentially acceptable sites.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... POTENTIAL SITES FOR A NUCLEAR WASTE REPOSITORY Implementation Guidelines § 960.3-2-1 Site screening for... first repository, the process shall begin with site-screening activities that consider large land masses... repositories, the Secretary shall first identify the State within which the site is located in a decision-basis...

  14. Agonist activation of α7 nicotinic acetylcholine receptors via an allosteric transmembrane site

    PubMed Central

    Gill, JasKiran K.; Savolainen, Mari; Young, Gareth T.; Zwart, Ruud; Sher, Emanuele; Millar, Neil S.

    2011-01-01

    Conventional nicotinic acetylcholine receptor (nAChR) agonists, such as acetylcholine, act at an extracellular “orthosteric” binding site located at the interface between two adjacent subunits. Here, we present evidence of potent activation of α7 nAChRs via an allosteric transmembrane site. Previous studies have identified a series of nAChR-positive allosteric modulators (PAMs) that lack agonist activity but are able to potentiate responses to orthosteric agonists, such as acetylcholine. It has been shown, for example, that TQS acts as a conventional α7 nAChR PAM. In contrast, we have found that a compound with close chemical similarity to TQS (4BP-TQS) is a potent allosteric agonist of α7 nAChRs. Whereas the α7 nAChR antagonist metyllycaconitine acts competitively with conventional nicotinic agonists, metyllycaconitine is a noncompetitive antagonist of 4BP-TQS. Mutation of an amino acid (M253L), located in a transmembrane cavity that has been proposed as being the binding site for PAMs, completely blocks agonist activation by 4BP-TQS. In contrast, this mutation had no significant effect on agonist activation by acetylcholine. Conversely, mutation of an amino acid located within the known orthosteric binding site (W148F) has a profound effect on agonist potency of acetylcholine (resulting in a shift of ∼200-fold in the acetylcholine dose-response curve), but had little effect on the agonist dose-response curve for 4BP-TQS. Computer docking studies with an α7 homology model provides evidence that both TQS and 4BP-TQS bind within an intrasubunit transmembrane cavity. Taken together, these findings provide evidence that agonist activation of nAChRs can occur via an allosteric transmembrane site. PMID:21436053

  15. Archaeological Data Recovery in the Abiquiu Reservoir Multiple Resource Area, New Mexico,

    DTIC Science & Technology

    1982-09-01

    location probably does not represent a locus of past human activity. Iso i .... .. 2 *1 . .. . .A LA27006 (AR56) Description: The site is a small...25566 27021 27047 25378 No topo map location for site (n 3) 27001 27002 27037 118 TABLE 10 ESTIMATED AND ACTUAL FREQUENCIES OF ARTIFACT CLASSES AT

  16. Bioremediation in oil-contaminated sites: bacteria and surfactant accelerated remediation

    NASA Astrophysics Data System (ADS)

    Strong-Gunderson, Janet M.; Guzman, Francisco

    1996-11-01

    In Mexico, there are several environmental issues which are being addressed under the current governmental legislation. One important issue is restoring sites belonging to Petroleos Mexicanos (PEMEX). PEMEX is a large government owned oil company that regulates and manages the oil reserves. These sites are primarily contaminated with weathered hydrocarbons which are a consequence of extracting millions of barrels of oil. Within the southern regions of Mexico there are sites which were contaminated by activities and spills that have occurred during the past 30 years. PEMEX has taken the leadership in correcting environmental problems and is very concerned about cleaning up the contaminated sites as quickly as possible. The most significant contaminated sites are located to the north of Veracruz and south of Tabasco. These sites areas are close to refineries or locations of oil exploration. The primary category of contaminants are hydrocarbons, among them asphaltens, aromatic and other contaminants. The concentration of the contaminants varies depending on the location of the sites, but it can reach as high as 500,000 ppm. PEMEX has been searching for appropriate, and cost- effective technologies to clean up these sites. Biologically based remediation activities are of primary interest to PEMEX. However, other treatment technologies such as chemical-physical methods, encapsulation and incineration are also being considered. The present report summarizes preliminary experiments that measured the feasibility of bioremediation for a contaminated site in southern Mexico.

  17. Prediction of allosteric sites and mediating interactions through bond-to-bond propensities

    NASA Astrophysics Data System (ADS)

    Amor, B. R. C.; Schaub, M. T.; Yaliraki, S. N.; Barahona, M.

    2016-08-01

    Allostery is a fundamental mechanism of biological regulation, in which binding of a molecule at a distant location affects the active site of a protein. Allosteric sites provide targets to fine-tune protein activity, yet we lack computational methodologies to predict them. Here we present an efficient graph-theoretical framework to reveal allosteric interactions (atoms and communication pathways strongly coupled to the active site) without a priori information of their location. Using an atomistic graph with energy-weighted covalent and weak bonds, we define a bond-to-bond propensity quantifying the non-local effect of instantaneous bond fluctuations propagating through the protein. Significant interactions are then identified using quantile regression. We exemplify our method with three biologically important proteins: caspase-1, CheY, and h-Ras, correctly predicting key allosteric interactions, whose significance is additionally confirmed against a reference set of 100 proteins. The almost-linear scaling of our method renders it suitable for high-throughput searches for candidate allosteric sites.

  18. Prediction of allosteric sites and mediating interactions through bond-to-bond propensities

    PubMed Central

    Amor, B. R. C.; Schaub, M. T.; Yaliraki, S. N.; Barahona, M.

    2016-01-01

    Allostery is a fundamental mechanism of biological regulation, in which binding of a molecule at a distant location affects the active site of a protein. Allosteric sites provide targets to fine-tune protein activity, yet we lack computational methodologies to predict them. Here we present an efficient graph-theoretical framework to reveal allosteric interactions (atoms and communication pathways strongly coupled to the active site) without a priori information of their location. Using an atomistic graph with energy-weighted covalent and weak bonds, we define a bond-to-bond propensity quantifying the non-local effect of instantaneous bond fluctuations propagating through the protein. Significant interactions are then identified using quantile regression. We exemplify our method with three biologically important proteins: caspase-1, CheY, and h-Ras, correctly predicting key allosteric interactions, whose significance is additionally confirmed against a reference set of 100 proteins. The almost-linear scaling of our method renders it suitable for high-throughput searches for candidate allosteric sites. PMID:27561351

  19. Capacitated location of collection sites in an urban waste management system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghiani, Gianpaolo, E-mail: gianpaolo.ghiani@unisalento.it; Itaca S.r.l., via P. Bucci 41C, 87036 Rende; Lagana, Demetrio, E-mail: dlagana@deis.unical.it

    2012-07-15

    Urban waste management is becoming an increasingly complex task, absorbing a huge amount of resources, and having a major environmental impact. The design of a waste management system consists in various activities, and one of these is related to the location of waste collection sites. In this paper, we propose an integer programming model that helps decision makers in choosing the sites where to locate the unsorted waste collection bins in a residential town, as well as the capacities of the bins to be located at each collection site. This model helps in assessing tactical decisions through constraints that forcemore » each collection area to be capacitated enough to fit the expected waste to be directed to that area, while taking into account Quality of Service constraints from the citizens' point of view. Moreover, we propose an effective constructive heuristic approach whose aim is to provide a good solution quality in an extremely reduced computational time. Computational results on data related to the city of Nardo, in the south of Italy, show that both exact and heuristic approaches provide consistently better solutions than that currently implemented, resulting in a lower number of activated collection sites, and a lower number of bins to be used.« less

  20. Antiarrhythmic properties of atrial pacing.

    PubMed

    Kliś, Magdalena; Sławuta, Agnieszka; Gajek, Jacek

    2017-01-01

    Bradycardia, atrial stretch and dilatation, autonomic nervous system disorders, and the presence of triggers such as atrial premature contractions, are factors which predispose a person to paroxysmal AF. Atrial pacing not only eliminates bradycardia but also prevents atrial premature contractions and dispersion of refractoriness, which are a substrate for atrial fibrillation. As the prolonged duration of atrial activation during pacing, especially from locations changing the physiological pattern of this activation (right atrium lateral wall, right atrium appendage), negatively influences both a mechanical and an electrical function of the atria, the atrial pacing site affects an atrial arrhythmogenesis. A conventional atrial lead location in the right atrium appendage causes non-physiological activation propagation, resulting in a prolongation of the activation time of both atria. This location is optimal according to a passive fixation of the atrial lead but the available contemporary active fixation leads could potentially be located in any area of the atrium. There is growing evidence of the benefit of pacing, imitating the physiological propagation of impulses within the atria. It seems that the Bachmann's bundle pacing is the best pacing site within the atria, not only positively influencing the atrial mechanical function but also best fulfilling the so-called atrial resynchronization function, in particular in patients with interatrial conduction delay. It can be effectively achieved using only one atrial electrode, and the slight shortening of atrioventricular conduction provides an additional benefit of this atrial pacing site.

  1. 40 CFR 270.230 - May I perform remediation waste management activities under a RAP at a location removed from the...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false May I perform remediation waste management activities under a RAP at a location removed from the area where the remediation wastes originated... Plans (RAPs) Obtaining A Rap for An Off-Site Location § 270.230 May I perform remediation waste...

  2. 50 CFR 18.124 - How do I obtain a Letter of Authorization?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... polar bears or Pacific walruses in execution of those activities and you want nonlethal incidental take... operation. (2) A site-specific plan to monitor the effects of the activity on the behavior of polar bears... depending on the activity, the location, and the time of year. (3) A site-specific polar bear and/or walrus...

  3. 50 CFR 18.124 - How do I obtain a Letter of Authorization?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... polar bears or Pacific walruses in execution of those activities and you want nonlethal incidental take... operation. (2) A site-specific plan to monitor the effects of the activity on the behavior of polar bears... depending on the activity, the location, and the time of year. (3) A site-specific polar bear and/or walrus...

  4. 50 CFR 18.124 - How do I obtain a Letter of Authorization?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... polar bears or Pacific walruses in execution of those activities and you want nonlethal incidental take... operation. (2) A site-specific plan to monitor the effects of the activity on the behavior of polar bears... depending on the activity, the location, and the time of year. (3) A site-specific polar bear and/or walrus...

  5. 50 CFR 18.124 - How do I obtain a Letter of Authorization?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... polar bears or Pacific walruses in execution of those activities and you want nonlethal incidental take... operation. (2) A site-specific plan to monitor the effects of the activity on the behavior of polar bears... depending on the activity, the location, and the time of year. (3) A site-specific polar bear and/or walrus...

  6. Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

    PubMed

    Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

    2018-04-01

    In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. 10 CFR 960.4-2-8-2 - Site ownership and control.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...) Qualifying condition. The site shall be located on land for which the DOE can obtain, in accordance with the... required in order that potential surface and subsurface activities as the site will not be likely to lead...

  8. Developing Study Stations on Your School Site.

    ERIC Educational Resources Information Center

    Ohio State Dept. of Natural Resources, Columbus. Office of Information and Education.

    The school site is a convenient location for study stations since it is available for short periods of time and can be used consistently. Special preparations, such as transportation, required for off-site fieldtrips can be eliminated. In addition, on-site activities provide students with concrete experiences necessary to understand difficult…

  9. Post-Closure Challenges of U.S. Department of Energy Sites in Desert Environments of the Southwestern United States - 12095

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gil, April; Steckley, Deborah; Gauthier, Cassie

    2012-07-01

    U.S. Department of Energy (DOE) sites located in harsh desert environments of the Four Corners region of the southwestern United States require diligence and continual maintenance to ensure the remediation systems function as designed to protect human health and the environment. The geology and climate of this area create issues that are unique to these sites. Geologic formations contain naturally occurring constituents that are often the same as the residual contaminants remaining from historical milling activities at the sites. Although annual precipitation is low, when precipitation events occur they can be of extreme intensity, resulting in erosion and flooding thatmore » can quickly destroy infrastructure and rapidly change site conditions. Winds can cause sand storms and sand mounding that effect site features. These challenging environmental conditions, along with the remote locations of the sites, require active management beyond what was originally envisioned for uranium disposal sites to address concerns in a safe and cost-effective manner. The unique environment of the Four Corners region creates many challenges to the LTSM of LM sites in southwestern United States. The remediation efforts and approaches to infrastructure have to be specifically structured to work in this environment. Often, the systems and structures have to be modified based on lessons learned on how to best adapt to these difficult conditions and remote locations. These sites require continual maintenance and additional efforts compared to many other LM sites. (authors)« less

  10. 47 CFR 90.675 - Information exchange.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... business days before a new cell site is activated or an existing cell site is modified: (1) Location; (2... believes a proposed cell will generate unacceptable interference; (2) Permit ESMR or part 22 Cellular... cell is activated. (c) Public safety information exchange. (1) Upon request by an ESMR or part 22...

  11. Interaction Between the Biotin Carboxyl Carrier Domain and the Biotin Carboxylase Domain in Pyruvate Carboxylase from Rhizobium etli†

    PubMed Central

    Lietzan, Adam D.; Menefee, Ann L.; Zeczycki, Tonya N.; Kumar, Sudhanshu; Attwood, Paul V.; Wallace, John C.; Cleland, W. Wallace; Maurice, Martin St.

    2011-01-01

    Pyruvate carboxylase (PC) catalyzes the ATP-dependent carboxylation of pyruvate to oxaloacetate, an important anaplerotic reaction in mammalian tissues. To effect catalysis, the tethered biotin of PC must gain access to active sites in both the biotin carboxylase domain and the carboxyl transferase domain. Previous studies have demonstrated that a mutation of threonine 882 to alanine in PC from Rhizobium etli renders the carboxyl transferase domain inactive and favors the positioning of biotin in the biotin carboxylase domain. We report the 2.4 Å resolution X-ray crystal structure of the Rhizobium etli PC T882A mutant which reveals the first high-resolution description of the domain interaction between the biotin carboxyl carrier protein domain and the biotin carboxylase domain. The overall quaternary arrangement of Rhizobium etli PC remains highly asymmetrical and is independent of the presence of allosteric activator. While biotin is observed in the biotin carboxylase domain, its access to the active site is precluded by the interaction between Arg353 and Glu248, revealing a mechanism for regulating carboxybiotin access to the BC domain active site. The binding location for the biotin carboxyl carrier protein domain demonstrates that tethered biotin cannot bind in the biotin carboxylase domain active site in the same orientation as free biotin, helping to explain the difference in catalysis observed between tethered biotin and free biotin substrates in biotin carboxylase enzymes. Electron density located in the biotin carboxylase domain active site is assigned to phosphonoacetate, offering a probable location for the putative carboxyphosphate intermediate formed during biotin carboxylation. The insights gained from the T882A Rhizobium etli PC crystal structure provide a new series of catalytic snapshots in PC and offer a revised perspective on catalysis in the biotin-dependent enzyme family. PMID:21958016

  12. Relocating the Active-Site Lysine in Rhodopsin: 2. Evolutionary Intermediates.

    PubMed

    Devine, Erin L; Theobald, Douglas L; Oprian, Daniel D

    2016-08-30

    The visual pigment rhodopsin is a G protein-coupled receptor that covalently binds its retinal chromophore via a Schiff base linkage to an active-site Lys residue in the seventh transmembrane helix. Although this residue is strictly conserved among all type II retinylidene proteins, we found previously that the active-site Lys in bovine rhodopsin (Lys296) can be moved to three other locations (G90K, T94K, S186K) while retaining the ability to form a pigment with retinal and to activate transducin in a light-dependent manner [ Devine et al. ( 2013 ) Proc. Natl. Acad. Sci. USA 110 , 13351 - 13355 ]. Because the active-site Lys is not functionally constrained to be in helix seven, it is possible that it could relocate within the protein, most likely via an evolutionary intermediate with two active-site Lys. Therefore, in this study we characterized potential evolutionary intermediates with two Lys in the active site. Four mutant rhodopsins were prepared in which the original Lys296 was left untouched and a second Lys residue was substituted for G90K, T94K, S186K, or F293K. All four constructs covalently bind 11-cis-retinal, form a pigment, and activate transducin in a light-dependent manner. These results demonstrate that rhodopsin can tolerate a second Lys in the retinal binding pocket and suggest that an evolutionary intermediate with two Lys could allow migration of the Schiff base Lys to a position other than the observed, highly conserved location in the seventh TM helix. From sequence-based searches, we identified two groups of natural opsins, insect UV cones and neuropsins, that contain Lys residues at two positions in their active sites and also have intriguing spectral similarities to the mutant rhodopsins studied here.

  13. Spatial patterns of serial murder: an analysis of disposal site location choice.

    PubMed

    Lundrigan, S; Canter, D

    2001-01-01

    Although the murders committed by serial killers may not be considered rational, there is growing evidence that the locations in which they commit their crimes may be guided by an implicit, if limited rationality. The hypothesized logic of disposal site choice of serial killers led to predictions that (a) their criminal domains would be around their home base and relate to familiar travel distances, (b) they would have a size that was characteristic of each offender, (c) the distribution would be biased towards other non-criminal activities, and (d) the size of the domains would increase over time. Examination of the geographical distribution of the sites at which 126 US and 29 UK serial killers disposed of their victims' bodies supported all four hypotheses. It was found that rational choice and routine activity models of criminal behavior could explain the spatial choices of serial murderers. It was concluded that the locations at which serial killers dispose of their victims' bodies reflect the inherent logic of the choices that underlie their predatory activities. Copyright 2001 John Wiley & Sons, Ltd.

  14. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  15. 2016 Annual Inspection and Radiological Survey Results for the Piqua, Ohio, Decommissioned Reactor Site, July 2016

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zimmerman, Brian; Miller, Michele

    This report presents the findings of the annual inspection and radiological survey of the Piqua, Ohio, Decommissioned Reactor Site (site). The decommissioned nuclear power demonstration facility was inspected and surveyed on April 15, 2016. The site, located on the east bank of the Great Miami River in Piqua, Ohio, was in fair physical condition. There is no requirement for a follow-up inspection, partly because City of Piqua (City) personnel participated in a March 2016 meeting to address reoccurring safety concerns. Radiological survey results from 104 locations revealed no removable contamination. One direct beta activity reading in a floor drain onmore » the 56-foot level (1674 disintegrations per minute [dpm]/100 square centimeters [cm2]) exceeded the minimum detectable activity (MDA). Beta activity has been detected in the past at this floor drain. The reading was well below the action level of 5000 dpm/100 cm2.« less

  16. Determination of precursor sites for pitting corrosion of polycrystalline titanium by using different techniques

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garfias-Mesias, L.F.; Alodan, M.; James, P.I.

    1998-06-01

    Scanning electrochemical microscopy (SECM) in ferrocyanide and bromide solutions was used to locate active sites (pitting precursors) on polycrystalline Ti where oxidation of Br{sup {minus}} and Fe(CN){sub 6}{sup 4{minus}} was possible. Analysis of the electrochemically active sites was done by using electron microscopy (SEM), energy dispersive X-ray analysis (EDX), atomic force microscopy (AFM), and in situ confocal laser scanning microscopy (CLSM). In most cases, the active sites were found to be associated with particles (inclusions) which contained mainly Al and Si; however, some other areas not associated with particles were also found to be active. Although the size of themore » inclusions was normally smaller than 20 {micro}m, as revealed by SEM and AFM imaging, in some cases larger particles were also found. Pitting corrosion tests in bromide solution at potentials above 1.5 V{sub SCE} followed by EDX analysis inside the pits and in situ CLSM observation, confirmed that most of the localized attack started in the areas where particles had been located.« less

  17. QSAR and molecular graphics analysis of N2-phenylguanines as inhibitors of herpes simplex virus thymidine kinases.

    PubMed

    Gaudio, A C; Richards, W G; Takahata, Y

    2000-02-01

    A quantitative structure-activity relationship study of N2-(substituted)-phenylguanines (PHG) as inhibitors of herpes simplex virus thymidine kinase (HSV TK) was performed. The activity of a set of PHG derivatives were analyzed against the thymidine kinase of herpes simplex virus types 1 (HSV1 TK) and 2 (HSV2 TK). Classic and calculated physicochemical parameters were included in the analysis. The results showed that there is an important difference in the activity of the meta substituted PHG derivatives against HSV1 TK and HSV2 TK. The activity of the meta derivatives against HSV2 TK is influenced by a steric effect, which is not observed against HSV1 TK. The superposition of the three-dimensional structures of the active sites of HSV1 TK (crystal structure) and HSV2 TK (homology model) revealed that the amino acid Ile97 is located near the meta position in the HSV1 TK active site, whereas the amino acid Leu97 is located near the meta position in the HSV2 TK active site. This single difference in the active sites of both enzymes can explain the source of the steric effect and serves as an indication that our previously proposed binding mode for the PHG derivatives is plausible. However, another observed mutation in the active site region, Ala168 by Ser168, suggests that an alternative binding mode, similar to that of ganciclovir, could be possible.

  18. Optimization Review: French Gulch/Wellington-Oro Mine Site Water Treatment Plant, Breckenridge, Summit County, Colorado

    EPA Pesticide Factsheets

    The French Gulch/Wellington-Oro Mine Site is located near the town of Breckenridge in Summit County, Colorado. Environmental contamination of surface water, groundwater, soil and sediment at the site resulted from mining activities dating to the 1880s.

  19. Substituted Phosphonic Analogues of Phenylglycine as Inhibitors of Phenylalanine Ammonia Lyase from Potatoes.

    PubMed

    Wanat, Weronika; Talma, Michał; Hurek, Józef; Pawełczak, Małgorzata; Kafarski, Paweł

    2018-06-08

    A series of phosphonic acid analogues of phenylglycine variously substituted in phenyl ring have been synthesized and evaluated for their inhibitory activity towards potato L-phenylalanine ammonia lyase. Most of the compounds appeared to act as moderate (micromolar) inhibitors of the enzyme. Analysis of their binding performed using molecular modeling have shown that they might be bound either in active site of the enzyme or in the non-physiologic site. The latter one is located in adjoining deep site nearby the to the entrance channel for substrate into active site. Copyright © 2018. Published by Elsevier B.V.

  20. A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

    PubMed Central

    Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

    2012-01-01

    Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

  1. Fiscal Year 2012 Revegetation Assessment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jenifer Nordstrom

    2012-11-01

    This report summarizes the Fiscal Year 2012 Revegetation Assessment by Battelle Energy Alliance, LLC. This assessment was conducted to supplement documentation related to the Storm Water Pollution Prevention Plan for Construction Activities and to ensure that disturbed vegetation and soil at various locations are being restored. This report provides the following information for each site being monitored by the Idaho National Laboratory Environmental Support and Services: • Summary of each site • Assessment of vegetation status and site stabilization at each location • Actions and Resolutions for each site. Ten disturbed sites were evaluated for this assessment. Six have achievedmore » final stabilization. The remaining four sites not meeting the criteria for final stabilization will be evaluated again in the next fiscal year.« less

  2. United States Air Force 611th Air Support Group/Civil Engineering Squadron, Elmendorf AFB, Alaska. Decision document for no further response action planned Oliktok Point Radar Installation, Alaska. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karmi, S.

    1996-06-03

    This Decision Document discusses the selection of no further action as the recommended action for four sites located at the Oliktok Point radar installation. The United States Air Force (Air Force) completed a Remedial Investigation/Feasibility Study and a Risk Assessment for the eight sites located at the Oliktok Point installation (U.S. Air Force 1996a,b). Based on the findings of these activities, four sites are recommended for no further action.

  3. 7 CFR 3560.58 - Site requirements.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Direct Loan and Grant Origination § 3560.58 Site... will not be located in areas where there are undesirable influences such as high activity railroad... development costs and standards. The cost of site development must be less than or comparable to the cost of...

  4. Distribution and abundance of host-seeking Culex species at three proximate locations with different levels of West Nile virus activity

    USGS Publications Warehouse

    Rochlin, I.; Ginsberg, H.S.; Campbell, S.R.

    2009-01-01

    Culex species were monitored at three proximate sites with historically different West Nile virus (WNV) activities. The site with human WNV transmission (epidemic) had the lowest abundance of the putative bridge vectors, Culex pipiens and Cx. salinarius. The site with horse cases but not human cases (epizootic) had the highest percent composition of Cx. salinarius, whereas the site with WNV-positive birds only (enzootic) had the highest Cx. pipiens abundance and percent composition. A total of 29 WNV-positive Culex pools were collected at the enzootic site, 17 at the epidemic site, and 14 at the epizootic site. Published models of human risk using Cx. pipiens and Cx. salinarius as the primary bridge vectors did not explain WNV activity at our sites. Other variables, such as additional vector species, environmental components, and socioeconomic factors, need to be examined to explain the observed patterns of WNV epidemic activity.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clayton, C.; Gueretta, J.; Tack, J.

    The Manhattan Engineer District (MED) and U.S. Atomic Energy Commission (AEC) contracted for support work through private and academic parties through the early 1960's. The work often involved radioactive materials. Residual radioactive contamination was left at some of more than 600 potentially contaminated (candidate) sites, and worker health and safety concerns remain from the site operations and subsequent remediation activities. The U.S. Department of Energy (DOE) initiated a program to identify and protect records of MED/AEC activities and of remediation work conducted under the Formerly Utilized Sites Remedial Action Program (FUSRAP) to aid in resolving questions about site conditions, liability,more » and worker health and safety and to ensure ongoing protectiveness of human health and the environment. This paper discusses DOE activities undertaken to locate records collections, confirm retention schedules and access requirements, and document information about the collections for use by future stewards. In conclusion: DOE-LM recognizes that records and information management is a critical component of effective LTS and M. Records are needed to answer questions about site conditions and demonstrate to the public in the future that the sites are safe. DOE-LM is working to satisfy present needs and anticipate future uses for FUSRAP records, and compile a collection of site and program information from which future stewards can readily locate and retrieve needed information. (authors)« less

  6. 10 CFR 75.2 - Scope.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... location of a uranium or thorium mine or concentration plant (e.g., in-situ leach mines and activities... holders: (1) A facility, as defined in § 75.4, and the site of the facility; (2) A location performing nuclear fuel cycle-related research and development, as defined in § 75.4; (3) A location manufacturing...

  7. 10 CFR 75.2 - Scope.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... location of a uranium or thorium mine or concentration plant (e.g., in-situ leach mines and activities... holders: (1) A facility, as defined in § 75.4, and the site of the facility; (2) A location performing nuclear fuel cycle-related research and development, as defined in § 75.4; (3) A location manufacturing...

  8. 10 CFR 75.2 - Scope.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... location of a uranium or thorium mine or concentration plant (e.g., in-situ leach mines and activities... holders: (1) A facility, as defined in § 75.4, and the site of the facility; (2) A location performing nuclear fuel cycle-related research and development, as defined in § 75.4; (3) A location manufacturing...

  9. 10 CFR 75.2 - Scope.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... location of a uranium or thorium mine or concentration plant (e.g., in-situ leach mines and activities... holders: (1) A facility, as defined in § 75.4, and the site of the facility; (2) A location performing nuclear fuel cycle-related research and development, as defined in § 75.4; (3) A location manufacturing...

  10. 10 CFR 75.2 - Scope.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... location of a uranium or thorium mine or concentration plant (e.g., in-situ leach mines and activities... holders: (1) A facility, as defined in § 75.4, and the site of the facility; (2) A location performing nuclear fuel cycle-related research and development, as defined in § 75.4; (3) A location manufacturing...

  11. Application of ground-penetrating radar imagery for three-dimensional visualisation of near-surface structures in ice-rich permafrost, Barrow, Alaska

    USGS Publications Warehouse

    Munroe, Jeffrey S.; Doolittle, James A.; Kanevskiy, Mikhail; Hinkel, Kenneth M.; Nelson, Frederick E.; Jones, Benjamin M.; Shur, Yuri; Kimble, John M.

    2007-01-01

    Three-dimensional ground-penetrating radar (3D GPR) was used to investigate the subsurface structure of ice-wedge polygons and other features of the frozen active layer and near-surface permafrost near Barrow, Alaska. Surveys were conducted at three sites located on landscapes of different geomorphic age. At each site, sediment cores were collected and characterised to aid interpretation of GPR data. At two sites, 3D GPR was able to delineate subsurface ice-wedge networks with high fidelity. Three-dimensional GPR data also revealed a fundamental difference in ice-wedge morphology between these two sites that is consistent with differences in landscape age. At a third site, the combination of two-dimensional and 3D GPR revealed the location of an active frost boil with ataxitic cryostructure. When supplemented by analysis of soil cores, 3D GPR offers considerable potential for imaging, interpreting and 3D mapping of near-surface soil and ice structures in permafrost environments.

  12. The availability of hydrogeologic data associated with areas identified by the US Geological Survey as experiencing potentially induced seismicity resulting from subsurface injection

    NASA Astrophysics Data System (ADS)

    Barnes, Caitlin; Halihan, Todd

    2018-05-01

    A critical need exists for site-specific hydrogeologic data in order to determine potential hazards of induced seismicity and to manage risk. By 2015, the United States Geological Survey (USGS) had identified 17 locations in the USA that are experiencing an increase in seismicity, which may be potentially induced through industrial subsurface injection. These locations span across seven states, which vary in geological setting, industrial exposure and seismic history. Comparing the research across the 17 locations revealed patterns for addressing induced seismicity concerns, despite the differences between geographical locations. Most induced seismicity studies evaluate geologic structure and seismic data from areas experiencing changes in seismic activity levels, but the inherent triggering mechanism is the transmission of hydraulic pressure pulses. This research conducted a systematic review of whether data are available in these locations to generate accurate hydrogeologic predictions, which could aid in managing seismicity. After analyzing peer-reviewed research within the 17 locations, this research confirms a lack of site-specific hydrogeologic data availability for at-risk areas. Commonly, formation geology data are available for these sites, but hydraulic parameters for the seismically active injection and basement zones are not available to researchers conducting peer-reviewed research. Obtaining hydrogeologic data would lead to better risk management for injection areas and provide additional scientific evidential support for determining a potentially induced seismic area.

  13. Rac1 GTPase activates the WAVE regulatory complex through two distinct binding sites.

    PubMed

    Chen, Baoyu; Chou, Hui-Ting; Brautigam, Chad A; Xing, Wenmin; Yang, Sheng; Henry, Lisa; Doolittle, Lynda K; Walz, Thomas; Rosen, Michael K

    2017-09-26

    The Rho GTPase Rac1 activates the WAVE regulatory complex (WRC) to drive Arp2/3 complex-mediated actin polymerization, which underpins diverse cellular processes. Here we report the structure of a WRC-Rac1 complex determined by cryo-electron microscopy. Surprisingly, Rac1 is not located at the binding site on the Sra1 subunit of the WRC previously identified by mutagenesis and biochemical data. Rather, it binds to a distinct, conserved site on the opposite end of Sra1. Biophysical and biochemical data on WRC mutants confirm that Rac1 binds to both sites, with the newly identified site having higher affinity and both sites required for WRC activation. Our data reveal that the WRC is activated by simultaneous engagement of two Rac1 molecules, suggesting a mechanism by which cells may sense the density of active Rac1 at membranes to precisely control actin assembly.

  14. Site Assessment of a New State-Wide Seismic Network in Texas (TexNet)

    NASA Astrophysics Data System (ADS)

    Savvaidis, A.; Young, B.; Mukherjee, T.; Hennings, P.; Rathje, E.; Zalachoris, G.; Young, M.; Walter, J. I.; DeShon, H. R.; Frohlich, C.

    2016-12-01

    Earthquake activity has recently increased in the southern mid-continent of the U.S., including Texas. To monitor seismicity activity in the state of Texas, a new seismicity monitoring program known as TexNet, was funded by the Texas State Legislature in 2015. TexNet consists of 22 new permanent broadband (120s post-hole) seismic stations that will complement the 17 stations currently operating in the State. These permanent stations will provide the baseline seismicity of the state. In addition, 36 portable stations (incorporating both a 20s post-hole seismometer and a post-hole accelerometer) will be used to densify the network in specific areas, of the State, depending on measured seismicity level, proximity to infrastructure, or other scientific investigations. One goal for TexNet is to provide authenticated data needed to evaluate the location, and frequency of earthquakes. To minimize the uncertainties in earthquake locations and increase detectability of the network, an extensive site assessment survey was conducted. The initial station positions were chosen based on Earthscope, Transportable Array (TA) site positions, while ensuring that the stations were relatively evenly-spaced across the State. We then analyzed the noise and earthquake data from the TA seismometers, and added new locations based on geology, topography, and absence of nearby human activities. A 30-min noise test was conducted at each site to identify the site amplification using HVSR information. A 24-hr survey then followed, where the noise level during day and night was identified, analyzed using power spectral density and compared to the NHNM and NLNM (Peterson, 1993; USGS Open File Report, 322). Based on these survey results nearby alternative sites were evaluated to improve final site position. Full deployment and data streaming is expected by December 2016, and will be discussed during this presentation.

  15. Site Assessment of a New State-Wide Seismic Network in Texas (TexNet), USA.

    NASA Astrophysics Data System (ADS)

    Savvaidis, Alexandros; Young, Bissett; Hennings, Peter; Rathje, Ellen; Zalachoris, George; Young, Michael H.; Walter, Jacob I.; DeShon, Heather R.; Frohlich, Cliff

    2017-04-01

    Earthquake activity has recently increased in the southern mid-continent of the U.S., including Texas. To monitor seismicity activity in the state of Texas, a new seismicity monitoring program known as TexNet, was funded by the Texas State Legislature in 2015. TexNet consists of 22 new permanent broadband (120s post-hole) seismic stations that will complement the 17 stations currently operating in the State. These permanent stations will provide the baseline seismicity of the state. In addition, 36 portable stations (incorporating both a 20s post-hole seismometer and a post-hole accelerometer) will be used to densify the network in specific areas, of the State, depending on measured seismicity level, proximity to infrastructure, or other scientific investigations. One goal for TexNet is to provide authenticated data needed to evaluate the location, and frequency of earthquakes. To minimize the uncertainties in earthquake locations and increase detectability of the network, an extensive site assessment survey was conducted. The initial station positions were chosen based on Earthscope, Transportable Array (TA) site positions, while ensuring that the stations were relatively evenly-spaced across the State. We then analyzed the noise and earthquake data from the TA seismometers, and added new locations based on geology, topography, and absence of nearby human activities. A 30-min noise test was conducted at each site to identify the site amplification using HVSR information. A 24-hr survey then followed, where the noise level during day and night was identified, analyzed using power spectral density and compared to the NHNM and NLNM (Peterson, 1993; USGS Open File Report, 322). Based on these survey results nearby alternative sites were evaluated to improve final site position. Deployment and data streaming started on September 2016, and will be discussed during this presentation.

  16. AmeriFlux US-ARb ARM Southern Great Plains burn site- Lamont

    DOE Data Explorer

    Torn, Margaret [Lawrence Berkeley National Laboratory

    2016-01-01

    This is the AmeriFlux version of the carbon flux data for the site US-ARb ARM Southern Great Plains burn site- Lamont. Site Description - The ARM SGP Burn site is located in the native tallgrass prairies of the USDA Grazinglands Research Laboratory near El Reno, OK. One of two adjacent 35 ha plots, the US-ARb plot was burned on 2005/03/08. The second plot, US-ARc, was left unburned as the control for experimental purposes. Aside from 2005, the region evaded burning activities for at least 15 years. Current disturbances consist of only light grazing activities.

  17. Hazardous Waste Cleanup: Johnson Matthey Incorporated in Wonslow, New Jersey

    EPA Pesticide Factsheets

    Johnson Matthey Incorporated is located on Piney Hollow Road in Winslow, New Jersey. The Johnson Matthey site began operations in 1971. The site occupies approximately seven acres. Activities included the production of process catalysts, salts manufacture

  18. Fire activity and hydrological dynamics in the past 5700 years reconstructed from Sphagnum peatlands along the oceanic-continental climatic gradient in northern Poland

    NASA Astrophysics Data System (ADS)

    Marcisz, Katarzyna; Gałka, Mariusz; Pietrala, Patryk; Miotk-Szpiganowicz, Grażyna; Obremska, Milena; Tobolski, Kazimierz; Lamentowicz, Mariusz

    2017-12-01

    Fire is a critical component of many ecosystems and, as predicted by various climate models, fire activity may increase significantly in the following years due to climate change. Therefore, knowledge about the past fire activity of various ecosystems is highly important for future nature conservation purposes. We present results of high-resolution investigation of fire activity and hydrological changes in northern Poland. We analyzed microscopic charcoal from three Sphagnum-dominated peatlands located on the south of Baltic, on the oceanic-continental (west-east) climatic gradient, and reconstructed the history of fire in the last 5700 years. We hypothesize that air circulation patterns are highly important for local fire activity, and that fire activity is more intensive in peatlands influenced by continental air masses. We have found out that forest fires have been occurring regularly since the past millennia and were linked to climatic conditions. We show that fire activity (related to climate and fuel availability) was significantly higher in sites dominated by continental climate (northeastern Poland) than in the site located under oceanic conditions (northwestern Poland)-microscopic charcoal influx was 13.3 times higher in the eastern study site of the gradient, compared to the western study site. Recorded fire activity patterns were different between the sites in a long timescale. Moreover, most of the recorded charcoal peaks occurred during high water tables. Rising human pressure has caused droughts and water table instability, and substantial increase in fire activity in the last 400 years.

  19. Methylation of an alpha-foetoprotein gene intragenic site modulates gene activity.

    PubMed Central

    Opdecamp, K; Rivière, M; Molné, M; Szpirer, J; Szpirer, C

    1992-01-01

    By comparing the methylation pattern of Mspl/Hpall sites in the 5' region of the mouse alpha-foetoprotein (AFP) gene of different cells (hepatoma cells, foetal and adult liver, fibroblasts), we found a correlation between gene expression and unmethylation of a site located in the first intron of the gene. Other sites did not show this correlation. In transfection experiments of unmethylated and methylated AFP-CAT chimeric constructions, we then showed that methylation of the intronic site negatively modulates expression of CAT activity. We also found that a DNA segment centered on this site binds nuclear proteins; however methylation did not affect protein binding. Images PMID:1371343

  20. The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 1 of 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beck Colleen M,Edwards Susan R.,King Maureen L.

    2011-09-01

    This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archivalmore » research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.« less

  1. The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 3 of 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beck Colleen M.,Edwards Susan R.,King Maureen L.

    2011-09-01

    This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archivalmore » research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.« less

  2. The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 2 of 3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beck Colleen M.,Edwards Susan R.,King Maureen L.

    2011-09-01

    This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archivalmore » research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.« less

  3. Characteristics, location and origin of flare activity in a complex active region

    NASA Technical Reports Server (NTRS)

    Machado, M. E.; Gary, G. A.; Hagyard, M. J.; Hernandez, A. M.; Rovira, M. G.

    1986-01-01

    The observational characteristics of series of multiple-loop flares from a complex active region are summarized. The location of the highest observed photospheric magnetic shear is found to be the commonly observed site of flare onset, but not, in many cases, the magnetic region where the largest time-integrated energy release is observed. The observations thus reveal a consistent pattern of energy-release processes related to the magnetic-field topology.

  4. United States Air Force 611th Air Support Group/Civil Engineering Squadron Elmendorf AFB, Alaska. Decision document for no further response action planned: Bullen Point Radar Installation, Alaska. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karmi, S.

    1996-05-24

    This Decision Document discusses the selection of no further action as the recommended action for two sites located at the Bullen Point radar installation. The United States Air Force (Air Force) completed a Remedial Investigation/Feasibility Study and a Risk Assessment for the five sites located at the Bullen Point installation (U.S. Air Force 1996a,b). Based on the findings of these activities, two sites are recommended for no further action. Sites at the Bullen Point radar installation recommended for no further action are: Old Landfill/Dump Site East (LF06) and Drum Storage Area (SS10).

  5. Health assessment for Midwest Industrial Waste Disposal Company, Inc. (Midco II) NPL (National Priorities List) Site, 5900 Industrial Highway, Gary, Indiana, Region 5. CERCLIS No. IND980679559. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1989-04-12

    The 7-acre Midco II Site is located at 5900 Industrial Highway, Gary, Indiana. The site is listed on the National Priorities List. Various heavy metals, inorganic, and organic compounds were found in the media on-site. The environmental media of concern at the site are ground water, surface water, and soil. Although access to the Midco II site is restricted, the contaminants detected on-site will continue to migrate and may pose health threats until remedial activities are completed. Therefore, the Midco II site poses a potential health concern until an evaluation of the site is completed and remedial activities are chosen.

  6. United States Air Force 611th Air Support Group/Civil Engineering Squadron Elmendorf AFB, Alaska. Decision document for no further response action planned: Barter Island Radar Installation, Alaska. Final report, December 1995-May 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karmi, S.; Madden, J.; Borsetti, R.

    1996-05-03

    This Decision Document discusses the selection of no further action as the recommended action for nine sites located at the Barter Island radar installation. The United States Air Force (Air Force) completed a Remedial Investigation/Feasibility Study and a Risk Assessment for the 14 sites located at the Barter Island installation (U.S. Air Force 1996a,b). Based on the findings of these activities, nine sites are recommended for no further action.

  7. Regional specialization in human nuclei: visualization of discrete sites of transcription by RNA polymerase III.

    PubMed Central

    Pombo, A; Jackson, D A; Hollinshead, M; Wang, Z; Roeder, R G; Cook, P R

    1999-01-01

    Mammalian nuclei contain three different RNA polymerases defined by their characteristic locations and drug sensitivities; polymerase I is found in nucleoli, and polymerases II and III in the nucleoplasm. As nascent transcripts made by polymerases I and II are concentrated in discrete sites, the locations of those made by polymerase III were investigated. HeLa cells were lysed with saponin in an improved 'physiological' buffer that preserves transcriptional activity and nuclear ultrastructure; then, engaged polymerases were allowed to extend nascent transcripts in Br-UTP, before the resulting Br-RNA was immunolabelled indirectly with fluorochromes or gold particles. Biochemical analysis showed that approximately 10 000 transcripts were being made by polymerase III at the moment of lysis, while confocal and electron microscopy showed that these transcripts were concentrated in only approximately 2000 sites (diameter approximately 40 nm). Therefore, each site contains approximately five active polymerases. These sites contain specific subunits of polymerase III, but not the hyperphosphorylated form of the largest subunit of polymerase II. The results indicate that the active forms of all three nuclear polymerases are concentrated in their own dedicated transcription sites or 'factories', suggesting that different regions of the nucleus specialize in the transcription of different types of gene. PMID:10205177

  8. Inhibition of erythrocytes δ-aminolevulinic acid dehydratase (ALAD) activity in fish from waters affected by lead smelters

    USGS Publications Warehouse

    Schmitt, Christopher J.; Caldwell, Colleen A.; Olsen, Bill; Serdar, Dave; Coffey, Mike

    2002-01-01

    We assessed the effects on fish of lead (Pb) released to streamsby smelters located in Trail, BC (Canada), E. Helena, MT, Herculaneum, MO, and Glover, MO. Fish were collected by electrofishing from sites located downstream of smelters and from reference sites. Blood from each fish was analyzed for δ-aminolevulinic acid dehydratase (ALAD) activity and hemoglobin (Hb), and samples of blood, liver, or carcass were analyzed for Pb, zinc (Zn), or both. Fish collected downstreamof all four smelters sites had elevated Pb concentrations, decreased ALAD activity, or both relative to their respectivereference sites. At E. Helena, fish from the downstream site also had lower Hb concentrations than fish from upstream. Differences among taxa were also apparent. Consistent with previous studies, ALAD activity in catostomids (Pisces: Catostomidae-northern hog sucker,Hypentelium nigricans;river carpsucker, Carpiodes carpio; largescale sucker, Catostomus macrocheilus; and mountain sucker, C. platyrhynchus) seemed more sensitive to Pb-induced ALADinhibition than the salmonids (Pisces: Salmonidae-rainbow trout,Oncorhynchus mykiss; brook trout,Salvelinus fontinalis) or common carp (Cyprinus carpio). Some of these differences may have resulted from differential accumulation of Zn, which was not measured at all sites. We detected noALAD activity in channel catfish (Ictaluruspunctatus) from either site on the Mississippi River at Herculaneum, MO. Our findings confirmed that Pb is releasedto aquatic ecosystems by smelters and accumulated by fish, andwe documented potentially adverse effects of Pb in fish. We recommend that Zn be measured along with Pb when ALAD activityis used as a biomarker and the collection of at least 10 fish ofa species at each site to facilitate statistical analysis.

  9. 42 CFR 485.703 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    .... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

  10. 42 CFR 485.703 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    .... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

  11. 42 CFR 485.703 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    .... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

  12. 42 CFR 485.703 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    .... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

  13. 42 CFR 485.703 - Definitions.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    .... Public health agency. An official agency established by a State or local government, the primary function... the primary site. The extension location is part of the rehabilitation agency. The extension location... function or activity and that— (1) Includes initial direction and periodic observation of the actual...

  14. Electrical latency predicts the optimal left ventricular endocardial pacing site: results from a multicentre international registry.

    PubMed

    Sieniewicz, Benjamin J; Behar, Jonathan M; Sohal, Manav; Gould, Justin; Claridge, Simon; Porter, Bradley; Niederer, Steve; Gamble, James H P; Betts, Tim R; Jais, Pierre; Derval, Nicolas; Spragg, David D; Steendijk, Paul; van Gelder, Berry M; Bracke, Frank A; Rinaldi, Christopher A

    2018-04-23

    The optimal site for biventricular endocardial (BIVENDO) pacing remains undefined. Acute haemodynamic response (AHR) is reproducible marker of left ventricular (LV) contractility, best expressed as the change in the maximum rate of LV pressure (LV-dp/dtmax), from a baseline state. We examined the relationship between factors known to impact LV contractility, whilst delivering BIVENDO pacing at a variety of LV endocardial (LVENDO) locations. We compiled a registry of acute LVENDO pacing studies from five international centres: Johns Hopkins-USA, Bordeaux-France, Eindhoven-The Netherlands, Oxford-United Kingdom, and Guys and St Thomas' NHS Foundation Trust, London-UK. In all, 104 patients incorporating 687 endocardial and 93 epicardial pacing locations were studied. Mean age was 66 ± 11 years, mean left ventricular ejection fraction 24.6 ± 7.7% and mean QRS duration of 163 ± 30 ms. In all, 50% were ischaemic [ischaemic cardiomyopathy (ICM)]. Scarred segments were associated with worse haemodynamics (dp/dtmax; 890 mmHg/s vs. 982 mmHg/s, P < 0.01). Delivering BiVENDO pacing in areas of electrical latency was associated with greater improvements in AHR (P < 0.01). Stimulating late activating tissue (LVLED >50%) achieved greater increases in AHR than non-late activating tissue (LVLED < 50%) (8.6 ± 9.6% vs. 16.1 ± 16.2%, P = 0.002). However, the LVENDO pacing location with the latest Q-LV, was associated with the optimal AHR in just 62% of cases. Identifying viable LVENDO tissue which displays late electrical activation is crucial to identifying the optimal BiVENDO pacing site. Stimulating late activating tissue (LVLED >50%) yields greater improvements in AHR however, the optimal location is frequently not the site of latest activation.

  15. Finding erotic oases: locating the sites of men's same-sex anonymous sexual encounters.

    PubMed

    Tewksbury, Richard

    2008-01-01

    Because anonymous sexual relations between two men are widely considered deviant many men seeking such activities look to erotic oases-natural environments appropriated for covert, often furtive sexual purposes. Previous research on erotic oases has focused on characteristics of involved men and processes of locating, negotiating with, and consummating sexual relations with others. This study draws on one major Web site listing of "cruising places" in the United States to identify common locations for erotic oases. Results show that the most common locations identified as erotic oases by users are public parks, adult bookstores, health clubs, and college campuses. Locations most likely to be listed as believed to be under law enforcement surveillance are outdoor, high traffic locations. Based on these results existing research has only begun to examine the most common locations for this highly stigmatized, deviant behavior and subculture.

  16. Empirical Calibration of Small Explosion Seismic And Acoustic Phenomenology in New England

    DTIC Science & Technology

    2008-10-31

    site was too close to a nearby cell /radio tower and the active quarry wall to detonate our planned 400 lb explosions. Core drilling at an...alternative test site (Figure 52) was conducted further away from the active quarry wall and a nearby cell /radio tower. The alternative site would be far...experiment was returned into the original location (Figure 52). In order to reduce the projected ground vibrations at the cell /radio tower and high

  17. AmeriFlux US-ARc ARM Southern Great Plains control site- Lamont

    DOE Data Explorer

    Torn, Margaret [Lawrence Berkeley National Laboratory

    2016-01-01

    This is the AmeriFlux version of the carbon flux data for the site US-ARc ARM Southern Great Plains control site- Lamont. Site Description - The ARM SGP Control site is located in the native tallgrass prairies of the USDA Grazinglands Research Laboratory near El Reno, OK. One of two adjacent 35 ha plots with identical towers, measurements at the US-ARc unburned plot are used as the experimental control. The second plot, US-Arb, was burned on 2005/03/08. Measurement comparisons between the control and burn plot are used to address questions regarding the effects of burning activities on carbon fluxes. The region evaded burning activities for at least 15 years. Current disturbances consist of only light grazing activities.

  18. Early prediction of eruption site using lightning location data: Estimates of accuracy during past eruptions

    NASA Astrophysics Data System (ADS)

    Nína Petersen, Guðrún; Arason, Þórður; Bjornsson, Halldór

    2013-04-01

    Eruption of subglacial volcanoes may lead to catastrophic floods and therefore early determination of the exact eruption site may be critical to civil protection evacuation plans. Poor visibility due to weather or darkness often inhibit positive identification of exact eruption location for many hours. However, because of the proximity and abundance of water in powerful subglacial volcanic eruptions, they are probably always accompanied by early lightning activity in the volcanic column. Lightning location systems, designed for weather thunderstorm monitoring, based on remote detection of electromagnetic waves from lightning, can provide valuable real-time information on location of eruption site. Important aspect of such remote detection is its independence of weather, apart from thunderstorms close to the volcano. Individual lightning strikes can be 5-10 km in length and are sometimes tilted and to the side of the volcanic column. This adds to the lightning location uncertainty, which is often a few km. Furthermore, the volcanic column may be swayed by the local wind to one side. Therefore, location of a single lightning can be misleading but by calculating average location of many lightning strikes and applying wind correction a more accurate eruption site location can be obtained. In an effort to assess the expected accuracy, the average lightning locations during the past five volcanic eruptions in Iceland (1998-2011) were compared to the exact site of the eruption vent. Simultaneous weather thunderstorms might have complicated this analysis, but there were no signs of ordinary thunderstorms in Iceland during these eruptions. To identify a suitable wind correction, the vector wind at the 500 hPa pressure level (5-6 km altitude) was compared to mean lightning locations during the eruptions. The essential elements of a system, which predicts the eruption site during the first hour(s) of an eruption, will be described.

  19. Hazardous Waste Cleanup: IBM Corporation in Kingston, New York

    EPA Pesticide Factsheets

    This site, approximately 258 acres in size, is located at Neighborhood Road in Kingston, New York. The site was first developed in the 1950s. Activities in the past were the development, manufacture, and testing of computer systems and the manufacture of

  20. 30 CFR 250.906 - What must I do to obtain approval for the proposed site of my platform?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... design and siting of your platform. Your geological survey must assess: (1) Seismic activity at your... seafloor subsidence. (c) Subsurface surveys. Depending upon the design and location of your proposed... the proposed site of my platform? (a) Shallow hazards surveys. You must perform a high-resolution or...

  1. 30 CFR 250.906 - What must I do to obtain approval for the proposed site of my platform?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... design and siting of your platform. Your geological survey must assess: (1) Seismic activity at your... seafloor subsidence. (c) Subsurface surveys. Depending upon the design and location of your proposed... the proposed site of my platform? (a) Shallow hazards surveys. You must perform a high-resolution or...

  2. 30 CFR 250.906 - What must I do to obtain approval for the proposed site of my platform?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... design and siting of your platform. Your geological survey must assess: (1) Seismic activity at your... seafloor subsidence. (c) Subsurface surveys. Depending upon the design and location of your proposed... the proposed site of my platform? (a) Shallow hazards surveys. You must perform a high-resolution or...

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohay, Alan C.; Clayton, Ray E.; Sweeney, Mark D.

    The Hanford Seismic Assessment Program (HSAP) provides an uninterrupted collection of high-quality raw and processed seismic data from the Hanford Seismic Network for the U.S. Department of Energy and its contractors. The HSAP is responsible for locating and identifying sources of seismic activity and monitoring changes in the historical pattern of seismic activity at the Hanford Site. The data are compiled, archived, and published for use by the Hanford Site for waste management, natural phenomena hazards assessments, and engineering design and construction. In addition, the HSAP works with the Hanford Site Emergency Services Organization to provide assistance in the eventmore » of a significant earthquake on the Hanford Site. The Hanford Seismic Network and the Eastern Washington Regional Network consist of 44 individual sensor sites and 15 radio relay sites maintained by the Hanford Seismic Assessment Team. During FY 2010, the Hanford Seismic Network recorded 873 triggers on the seismometer system, which included 259 seismic events in the southeast Washington area and an additional 324 regional and teleseismic events. There were 210 events determined to be local earthquakes relevant to the Hanford Site. One hundred and fifty-five earthquakes were detected in the vicinity of Wooded Island, located about eight miles north of Richland just west of the Columbia River. The Wooded Island events recorded this fiscal year were a continuation of the swarm events observed during fiscal year 2009 and reported in previous quarterly and annual reports (Rohay et al. 2009a, 2009b, 2009c, 2010a, 2010b, and 2010c). Most events were considered minor (coda-length magnitude [Mc] less than 1.0) with the largest event recorded on February 4, 2010 (3.0Mc). The estimated depths of the Wooded Island events are shallow (averaging approximately 1.5 km deep) placing the swarm within the Columbia River Basalt Group. Based upon the last two quarters (Q3 and Q4) data, activity at the Wooded Island area swarm has largely subsided. Pacific Northwest National Laboratory will continue to monitor for activity at this location. The highest-magnitude events (3.0Mc) were recorded on February 4, 2010 within the Wooded Island swarm (depth 2.4 km) and May 8, 2010 on or near the Saddle Mountain anticline (depth 3.0 km). This latter event is not considered unusual in that earthquakes have been previously recorded at this location, for example, in October 2006 (Rohay et al. 2007). With regard to the depth distribution, 173 earthquakes were located at shallow depths (less than 4 km, most likely in the Columbia River basalts), 18 earthquakes were located at intermediate depths (between 4 and 9 km, most likely in the pre-basalt sediments), and 19 earthquakes were located at depths greater than 9 km, within the crystalline basement. Geographically, 178 earthquakes were located in known swarm areas, 4 earthquakes occurred on or near a geologic structure (Saddle Mountain anticline), and 28 earthquakes were classified as random events. The Hanford Strong Motion Accelerometer (SMA) network was triggered several times by the Wooded Island swarm events and the events located on or near the Saddle Mountain anticline. The maximum acceleration value recorded by the SMA network during fiscal year 2010 occurred February 4, 2010 (Wooded Island swarm event), approximately 2 times lower than the reportable action level for Hanford facilities (2% g) with no action required.« less

  4. Information Technology Division’s Technical Paper Abstracts

    DTIC Science & Technology

    1994-07-05

    antenna systems. 86 Title: An Electromagnetic Interference Study of Potential Transmitter Sites for the HF Active Auroral Research Program ( HAARP ...examined a number of potential sites for the location of the proposed High Frequency Active Auroral Research Program ( HAARP ) transmitter facility. The...proposed HAARP facility will consist of a large planar array of antennas excited by phased high power transmitters operating in the lower portion of the

  5. Spatial and temporal patterns of macrozoobenthic community inhabiting sediments under tropical fish farming

    NASA Astrophysics Data System (ADS)

    Aufa, Abdullah; Hadi, Mochamad; Purnomo Putro, Sapto

    2018-05-01

    Macrozoobenthic animals is one of biota that may be used to assess the impact of the activities. They inhabit sediment of water ecosystem and may respond vary at different spatiotemporal scales. The purpose of this study is to study spatial and temporal patterns of macrozoobenthic community under fish farming activities at coastal area of Tembelas Island, Kepulauan Riau Province, Indonesia. The macrozoobenthic assemblages were assessedat three sampling locations, i.e. policulture [IMTA], monoculture and reference sites. Each sampling location consisted of three stations with three replicates for each station. The data obtained were analyzed using PRIMER software V.6.1.5. to compare number of taxa (S), Shanon- Wiener diversity index (H’), and Pielou’s evenness index (e) and K-dominance cumulative curves between sites and times. The results showed that diversity index at fish farming locations (IMTA and monoculture) exhibited lower than those at reference site, between 1.58 – 2.19 and between 1.99-2.84, respectively. However, diversity at all locations were considered moderate diverse ecosystem. Meanwhile, Pielou’s evenness indexbetween locations and sampling time showed no majordifference, ranging between 0.96-0.98. Based on K-dominance curves, P3T2 station curve was positioned on the top among other curves, implying certain taxa has dominated the assemblages, i.e. Nassarius sp. (Gastropod).

  6. Specification of unique Pit-1 activity in the hGH locus control region

    PubMed Central

    Shewchuk, Brian M.; Liebhaber, Stephen A.; Cooke, Nancy E.

    2002-01-01

    The human GH (hGH) gene cluster is regulated by a remote 5′ locus control region (LCR). HSI, an LCR component located 14.5 kb 5′ to the hGH-N promoter, constitutes the primary determinant of high-level hGH-N activation in pituitary somatotropes. HSI encompasses an array of three binding sites for the pituitary-specific POU homeodomain factor Pit-1. In the present report we demonstrate that all three Pit-1 sites in the HSI array contribute to LCR activity in vivo. Furthermore, these three sites as a unit are fully sufficient for position-independent and somatotrope-restricted hGH-N transgene activation. In contrast, the hGH-N transgene is not activated by Pit-1 sites native to either the hGH-N or rat (r)GH gene promoters. These findings suggest that the structures of the Pit-1 binding sites at HSI specify distinct chromatin-dependent activities essential for LCR-mediated activation of hGH in the developing pituitary. PMID:12189206

  7. U.S. Department of Energy Nevada Operations Office Environmental Monitoring Program summary data report, second calendar quarter 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Black, S.C.; Townsend, Y.E.

    1997-02-01

    The Nevada Test Site (NTS), located in southern Nevada, has been the primary location for testing of nuclear explosives in the continental US. Testing began in 1951 and continued until the moratorium in 1992. Waste storage and disposal facilities for defense radioactive and mixed waste are located in Areas 3 and 5. At the Area 5 Radioactive Waste Management Site (RWMS-5), low-level wastes (LLW) from US Department of Energy (DOE) affiliated onsite and offsite generators are disposed of using standard shallow land disposal techniques. Transuranic wastes are retrievably stored at the RWMS-5 in containers on a surface pad, pending shipmentmore » to the Waste Isolation Pilot Plant facility in New Mexico. Nonradioactive hazardous wastes are accumulated at a special site before shipment to a licensed offsite disposal facility. Non-standard packages of LLW are buried in subsidence craters in the Area 3 RWMS. This report describes these activities on and around the NTS and includes a listing of the results obtained from environmental surveillance activities during the second calendar quarter of 1996.« less

  8. Launch Complex 39 Observation Gantry Area (SWMU# 107) Annual Long-Term Monitoring Report (Year 1) Kennedy Space Center, Florida

    NASA Technical Reports Server (NTRS)

    Johnson, Jill W.; Towns, Crystal

    2015-01-01

    This document has been prepared by Geosyntec Consultants, Inc. (Geosyntec) to present and discuss the findings of the 2014 and 2015 Long-Term Monitoring (LTM) activities that were completed at the Launch Complex 39 (LC39) Observation Gantry Area (OGA) located at the John F. Kennedy Space Center (KSC), Florida (Site). The remainder of this report includes: (i) a description of the Site location; (ii) summary of Site background and previous investigations; (iii) description of field activities completed as part of the annual LTM program at the Site; (iv) groundwater flow evaluation; (v) presentation and discussion of field and analytical results; and (vi) conclusions and recommendations. Applicable KSC Remediation Team (KSCRT) Meeting minutes are included in Attachment A. This Annual LTM Letter Report was prepared by Geosyntec Consultants (Geosyntec) for NASA under contract number NNK12CA13B, Delivery Order NNK13CA39T project number PCN ENV2188.

  9. RNase L targets distinct sites in influenza A virus RNAs.

    PubMed

    Cooper, Daphne A; Banerjee, Shuvojit; Chakrabarti, Arindam; García-Sastre, Adolfo; Hesselberth, Jay R; Silverman, Robert H; Barton, David J

    2015-03-01

    Influenza A virus (IAV) infections are influenced by type 1 interferon-mediated antiviral defenses and by viral countermeasures to these defenses. When IAV NS1 protein is disabled, RNase L restricts virus replication; however, the RNAs targeted for cleavage by RNase L under these conditions have not been defined. In this study, we used deep-sequencing methods to identify RNase L cleavage sites within host and viral RNAs from IAV PR8ΔNS1-infected A549 cells. Short hairpin RNA knockdown of RNase L allowed us to distinguish between RNase L-dependent and RNase L-independent cleavage sites. RNase L-dependent cleavage sites were evident at discrete locations in IAV RNA segments (both positive and negative strands). Cleavage in PB2, PB1, and PA genomic RNAs suggests that viral RNPs are susceptible to cleavage by RNase L. Prominent amounts of cleavage mapped to specific regions within IAV RNAs, including some areas of increased synonymous-site conservation. Among cellular RNAs, RNase L-dependent cleavage was most frequent at precise locations in rRNAs. Our data show that RNase L targets specific sites in both host and viral RNAs to restrict influenza virus replication when NS1 protein is disabled. RNase L is a critical component of interferon-regulated and double-stranded-RNA-activated antiviral host responses. We sought to determine how RNase L exerts its antiviral activity during influenza virus infection. We enhanced the antiviral activity of RNase L by disabling a viral protein, NS1, that inhibits the activation of RNase L. Then, using deep-sequencing methods, we identified the host and viral RNAs targeted by RNase L. We found that RNase L cleaved viral RNAs and rRNAs at very precise locations. The direct cleavage of IAV RNAs by RNase L highlights an intimate battle between viral RNAs and an antiviral endonuclease. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. National priorities list sites: North Carolina, 1995

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-05-01

    The fact sheets describe hazardous waste sites on the NPL and their locations, as well as the conditions leading to their listing (Site Description). The summaries list the types of contaminants that have been discovered and related threats to public and ecological health (Threats and Contaminants). Cleanup Approach presents an overview of the cleanup activities completed, underway, or planned. The fact sheets are arranged in alphabetical order by site name.

  11. Technical Basis Document for Internal Dosimetry at Sandia National Laboratories Revision 2.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potter, Charles A.

    2014-09-01

    The RPID Project will be implemented at all SNL facilities for activities involving the processing and/or storing of radioactive materials. This project includes activities at the Tech Area (TA) I, TA II, TA III, TA IV, TA V, Coyote Test Field, and environmental restoration sites at SNL, located in Albuquerque, New Mexico, and the Kauai Test Facility(SNL/KTF). Reference to SNL throughout this document includes facilities and activities at the Albuquerque location and at SNL/KTF.

  12. ARCO's Ambitious Program to Promote Employee Fitness.

    ERIC Educational Resources Information Center

    Sparks, John

    1983-01-01

    The Atlantic Richfield Company provides a well-rounded array of health education and physical activities for its employees. Recreational and health activities for workers on the North Slope (Alaska) oil site and at other locations are described. (PP)

  13. Baseline ecological risk assessment Salmon Site, Lamar County, Mississippi

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-04-01

    The Salmon Site (SS), formerly the Tatum Dome Test Site, located in Mississippi was the site of two nuclear and two gas explosion tests conducted between 1964 and 1970. A consequence of these testing activities is that radionuclides were released into the salt dome, where they are presently contained. During reentry drilling and other site activities, incidental liquid and solid wastes that contained radioactivity were generated, resulting in some soil, ground water and equipment contamination. As part of the remedial investigation effort, a Baseline Ecological Risk Assessment was conducted at the SS. The purpose is to gauge ecological and othermore » environmental impacts attributable to past activities at the former test facility. The results of this facility-specific baseline risk assessment are presented in this document.« less

  14. Using History Museums.

    ERIC Educational Resources Information Center

    Leon, Warren

    1980-01-01

    Discusses and evaluates an interdisciplinary environmental project in which junior high school students pretend that they are members of an interplanetary force which landed on earth. Activities include locating and testing local water supplies, marking hazards at the landing site, and using natural resources found near the landing site to make…

  15. Space Shuttle Familiarization

    NASA Technical Reports Server (NTRS)

    Mellett, Kevin

    2006-01-01

    This slide presentation visualizes the NASA space center and research facility sites, as well as the geography, launching sites, launching pads, rocket launching, pre-flight activities, and space shuttle ground operations located at NASA Kennedy Space Center. Additionally, highlights the international involvement behind the International Space Station and the space station mobile servicing system. Extraterrestrial landings, surface habitats and habitation systems, outposts, extravehicular activity, and spacecraft rendezvous with the Earth return vehicle are also covered.

  16. Quantification of Rock Damage from Small Explosions and Its Effect on Shear-Wave Generation

    DTIC Science & Technology

    2009-06-15

    close to a nearby cell /radio tower and the active quarry wall to detonate our planned 400 lb explosions. Core drilling at an alternative test site...Figure ) was conducted further away from the active quarry wall and a nearby cell /radio tower. The alternative site would be far enough away from...returned into the original location (Figure ). In order to reduce the projected ground vibrations at the cell /radio tower and high wall of the active

  17. Influence of phosphorylation of THR-3, SER-11, and SER-15 on deoxycytidine kinase activity and stability.

    PubMed

    Smal, C; Ntamashimikiro, S; Arts, A; Van Den Neste, E; Bontemps, F

    2010-06-01

    Deoxycytidine kinase (dCK) is a key enzyme in the salvage of deoxyribonucleosides and in the activation of several anticancer and antiviral nucleoside analogues. We have recently shown that dCK is a phosphoprotein. Four in vivo phosphorylation sites were identified: Thr-3, Ser-11, Ser-15, and Ser-74. Site-directed mutagenesis demonstrated that phosphorylation of Ser-74, the major phosphorylated residue, strongly influences dCK activity in eucaryotic cells. Here, we show that phosphorylation of the three other sites, located in the N-terminal extremity of the protein, does not significantly modify dCK activity, but phosphorylation of Thr-3 could promote dCK stability.

  18. Evaluation of Experiential Outdoor Research Locations in Asia for a K-12 school in Hong Kong

    NASA Astrophysics Data System (ADS)

    Ibarra, D. L.; Joyce, S.

    2016-12-01

    A team of faculty and administrators from The Independent Schools Foundation Academy spend the 2015 - 2016 academic year identifying possible locations in Asia for a year-round outdoor education center. ISF Academy currently has over 1500 students its K-12 bilingual school in Hong Kong, China. The outdoor education center is an extension of the built campus in Pokfulam and will provide students opportunities to live in a natural setting, participate in outdoor educational activities and study in an environment significantly different than a classroom. Currently ISF Academy students in grades 4 - 12 are off campus twice during the academic year in an experiential learning environment. These current programs include camping, hiking, kayaking, other adventurous activities and service learning opportunities. The purpose of the dedicated site is to have a "home base" for ISF Academy and the experiential learning programs. This past year we looked specifically at programs and locations that could also be used by students for ecology and earth systems based research in the senior school (grades 9 - 12). We have looked at sites in Hong Kong, Indonesia, Malaysia and Taiwan. The ideal site will have marine, terrestrial and mangrove ecosystems and allow students to set up long-term research sites in any of these ecosystems. Creating opportunities for authentic research that allows students spend an extended time in a research setting will help them to gain both skills and independence needed in the future at the tertiary level. The evaluation of these sites included identifying potential research partners, site preparation, logistics in and out of the locations, and the heath/safety management of students living and working in a remote location. In parallel to the site evaluations, the curriculum is being developed for the students that is age and skill appropriate using the frame work of the existing guided discovery curriculum in the primary school, and the MYP and DP curriculum of the IBO for the secondary school. Delivering a curriculum of this complexity will require participation and input from faculty across all disciplines.

  19. Letter from Yuen-Chang (Didi) Fung, Tetra Tech to Steve Spurlin, EPA Region 4. Concerning Site Activities and Drum Inventory Summary

    EPA Pesticide Factsheets

    This letter summarizes the drum inventory obtained on July 12, 2007 including drum staging area locations, sample locations, physical states, and preliminary waste categories. Region ID: 04 DocID: 10517019, DocDate: 07-19-2007

  20. CLOSURE REPORT FOR CORRECTIVE ACTION UNIT165: AREA 25 AND 26 DRY WELL AND WASH DOWN AREAS, NEVADA TEST SITE, NEVADA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    BECHTEL NEVADA

    This Closure Report (CR) documents the closure activities for Corrective Action Unit (CAU) 165, Area 25 and 26 Dry Well and Washdown Areas, according to the Federal Facility Agreement and Consent Order (FFACO) of 1996. CAU 165 consists of 8 Corrective Action Sites (CASs) located in Areas 25 and 26 of the Nevada Test Site (NTS). The NTS is located approximately 105 kilometers (65 miles) northwest of Las Vegas, nevada. Site closure activities were performed according to the Nevada Division of Environmental Protection (NDEP)-approved Corrective Action Plan (CAP) for CAU 165. CAU 165 consists of the following CASs: (1) CASmore » 25-07-06, Train Decontamination Area; (2) CAS 25-07-07, Vehicle Washdown; (3) CAS 25-20-01, Lab Drain Dry Well; (4) CAS 25-47-01, Reservoir and French Drain; (5) CAS 25-51-02, Drywell; (6) CAS 25-59-01, Septic System; (7) CAS 26-07-01, Vehicle Washdown Station; and (8) CAS 26-59-01, Septic System. CAU 165, Area 25 and 26 Dry Well and Washdown Areas, consists of eight CASs located in Areas 25 and 26 of the NTS. The approved closure alternatives included No Further Action, Clean Closure, and Closure in Place with Administrative Controls.« less

  1. Analysis of the plasticity of location of the Arg244 positive charge within the active site of the TEM-1 β-lactamase

    PubMed Central

    Marciano, David C; Brown, Nicholas G; Palzkill, Timothy

    2009-01-01

    A large number of β-lactamases have emerged that are capable of conferring bacterial resistance to β-lactam antibiotics. Comparison of the structural and functional features of this family has refined understanding of the catalytic properties of these enzymes. An arginine residue present at position 244 in TEM-1 β-lactamase interacts with the carboxyl group common to penicillin and cephalosporin antibiotics and thereby stabilizes both the substrate and transition state complexes. A comparison of class A β-lactamase sequences reveals that arginine at position 244 is not conserved, although a positive charge at this structural location is conserved and is provided by an arginine at positions 220 or 276 for those enzymes lacking arginine at position 244. The plasticity of the location of positive charge in the β-lactamase active site was experimentally investigated by relocating the arginine at position 244 in TEM-1 β-lactamase to positions 220, 272, and 276 by site-directed mutagenesis. Kinetic analysis of the engineered β-lactamases revealed that removal of arginine 244 by alanine mutation reduced catalytic efficiency against all substrates tested and restoration of an arginine at positions 272 or 276 partially suppresses the catalytic defect of the Arg244Ala substitution. These results suggest an evolutionary mechanism for the observed divergence of the position of positive charge in the active site of class A β-lactamases. PMID:19672877

  2. Paducah Site annual report for 1995

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, G.

    1997-01-01

    The Paducah Gaseous Diffusion Plant, located in McCracken County, Kentucky, has been producing enriched uranium since 1952. In July 1993, the US department of Energy (DOE) leased the production areas of the site to the US Enrichment Corporation (USEC). A new subsidiary of Lockheed Martin Corporation, Lockheed Martin Utility Services, manages the leased facilities for USEC. DOE maintains responsibility for the environmental restoration, waste management, and enrichment facilities activities at the plant through its management contractor, Lockheed Martin Energy Systems. The purpose of this document is to summarize calendar year 1995 environmental monitoring activities for DOE activities at the Paducahmore » Site. DOE requires all of its facilities to conduct and document such activities annually. This report does not include USEC environmental activities.« less

  3. Selection and Characterization of Landing Sites for Chandrayaan-2 Lander

    NASA Astrophysics Data System (ADS)

    Gopala Krishna, Barla; Amitabh, Amitabh; Srinivasan, T. P.; Karidhal, Ritu; Nagesh, G.; Manjusha, N.

    2016-07-01

    Indian Space Research Organisation has planned the second mission to moon known as Chandrayaan-2, which consists of an Orbiter, a Lander and a Rover. This will be the first soft landing mission of India on lunar surface. The Orbiter, Lander and Rover individually will carry scientific payloads that enhance the scientific objectives of Chandrayaan-2. The Lander soft lands on the lunar surface and subsequently Lander & Rover will carry on with the payload activities on the moon surface. Landing Site identification based on the scientific and engineering constrains of lander plays an important role in success of a mission. The Lander poses some constraints because of its engineering design for the selection of the landing site and on the other hand the landing site / region imparts some constrain on the Lander. The various constraints that have to be considered for the study of the landing site are Local slope, Sun illumination during mission life, Radio communication with the Earth, Global slope towards equator, Boulders size, Crater density and boulder distribution. This paper describes the characterization activities of the different landing locations which have been studied for Chandrayaan-2 Lander. The sites have been studied both in the South Polar and North Polar regions of the moon on the near side. The Engineering Constraints at the sites due to the Lander, Factors that affect mission life (i.e. illumination at the location), Factors influencing communication to earth (i.e. RF visibility) & Shadow movements have been studied at these locations and zones that are favourable for landing have been short listed. This paper gives methodology of these studies along with the results of the characteristics of all the sites and the recommendations for further action in finalizing the landing area.

  4. Measurement of atmospheric pollutants associated with oil and natural gas exploration and production activity in Pennsylvania's Allegheny National Forest.

    PubMed

    Pekney, Natalie J; Veloski, Garret; Reeder, Matthew; Tamilia, Joseph; Rupp, Erik; Wetzel, Alan

    2014-09-01

    Oil and natural gas exploration and production (E&P) activities generate emissions from diesel engines, compressor stations, condensate tanks, leaks and venting of natural gas, construction of well pads, and well access roads that can negatively impact air quality on both local and regional scales. A mobile, autonomous air quality monitoring laboratory was constructed to collect measurements of ambient concentrations of pollutants associated with oil and natural gas E&P activities. This air-monitoring laboratory was deployed to the Allegheny National Forest (ANF) in northwestern Pennsylvania for a campaign that resulted in the collection of approximately 7 months of data split between three monitoring locations between July 2010 and June 2011. The three monitoring locations were the Kane Experimental Forest (KEF) area in Elk County, which is downwind of the Sackett oilfield; the Bradford Ranger Station (BRS) in McKean County, which is downwind of a large area of historic oil and gas productivity; and the U.S. Forest Service Hearts Content campground (HC) in Warren County, which is in an area relatively unimpacted by oil and gas development and which therefore yielded background pollutant concentrations in the ANF. Concentrations of criteria pollutants ozone and NO2 did not vary significantly from site to site; averages were below National Ambient Air Quality Standards. Concentrations of volatile organic compounds (VOCs) associated with oil and natural gas (ethane, propane, butane, pentane) were highly correlated. Applying the conditional probability function (CPF) to the ethane data yielded most probable directions of the sources that were coincident with known location of existing wells and activity. Differences between the two impacted and one background site were difficult to discern, suggesting the that the monitoring laboratory was a great enough distance downwind of active areas to allow for sufficient dispersion with background air such that the localized plumes were not detected. Implications: Monitoring of pollutants associated with oil and natural gas exploration and production activity at three sites within the Allegheny National Forest (ANF) showed only slight site-to-site differences even with one site far removed from these activities. However, the impact was evident not in detection of localized plumes but in regional elevated ethane concentrations, as ethane can be considered a tracer species for oil and natural gas activity. The data presented serve as baseline conditions for evaluation of impacts from future development of Marcellus or Utica shale gas reserves.

  5. Health assessment for Koppers Company, Inc. , National Priorities List (NPL) Site, Texarkana, Texas, Region 6. CERCLIS No. TXD980623904. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The Koppers Company, Inc. Site located in Texarkana, Texas is on the National Priorities List. The site is the former location of a wood treatment facility. The site is contaminated with numerous chemicals from the former wood treatment operations including polyaromatic hydrocarbons (PAH), phenolic compounds, polychlorinated dibenzofurans (PCDF). Previous remedial activity has included reseeding and the installation of sod in highly contaminated residential areas. The primary environmental pathways of potential concern are surface soils and ground water. Long-term exposures to contaminated soils in the residential area pose a potential health risk for ingestion and dermal absorption of soil contaminants. Groundmore » water beneath the site is contaminated and would pose a potential health risk if used for potable purposes.« less

  6. 50 CFR 216.155 - Requirements for monitoring and reporting.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... place 3 autonomous digital video cameras overlooking chosen haul-out sites located varying distances from the missile launch site. Each video camera will be set to record a focal subgroup within the... presence and activity will be conducted and recorded in a field logbook or recorded on digital video for...

  7. Field Summary Report for Remedial Investigation of Hanford Site Releases to the Columbia River, Hanford Site, Washington

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    L.C. Hulstrom

    2010-09-28

    This report documents field activity associated with the collection, preparation, and shipment of fish samples. The purpose of the report is to describe the sampling locations, identify samples collected, and describe any modifications and additions made to the sampling and analysis plan.

  8. 43 CFR 10005.12 - Policy regarding the scope of measures to be included in the plan.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... the site of the impact typically involves restoration or replacement. Off-site mitigation might involve protection, restoration, or enhancement of a similar resource value at a different location... responsibilities, the Commission sees an obligation to give priority to protection and restoration activities that...

  9. Activation of MMP-9 activity by acrolein in saliva from patients with primary Sjögren's syndrome and its mechanism.

    PubMed

    Uemura, Takeshi; Suzuki, Takehiro; Saiki, Ryotaro; Dohmae, Naoshi; Ito, Satoshi; Takahashi, Hoyu; Toida, Toshihiko; Kashiwagi, Keiko; Igarashi, Kazuei

    2017-07-01

    We have recently reported that the altered recognition patterns of immunoglobulins due to acrolein conjugation are at least partially responsible for autoimmune diseases in patients with primary Sjögren's syndrome (pSS). In the current study, it was found that the specific activity (activity/ng protein) of metalloproteinase-9 (MMP-9) in saliva was elevated about 2.4-fold in pSS patients. Accordingly, it was examined whether MMP-9 is activated by acrolein. It was found that the MMP-9 with 92kDa molecular weight was activated by acrolein. Under the conditions studied, Cys99, located in the propeptide, was conjugated with acrolein together with Cys230, 244, 302, 314, 329, 347, 361, 373, 388 and 516, which are located in fibronectin repeats and glycosyl domains, but not on the active site of MMP-9. In addition, 82 and 68kDa constructs of MMP-9s, lacking the NH 2 -terminal domain that contains Cys99, were not activated by acrolein. The results suggest that acrolein conjugation at Cys99 caused the active site of MMP-9 to be exposed. Activation of MMP-9 by acrolein was inhibited by cysteine, and slightly by lysine, because these amino acids inhibited acrolein conjugation with MMP-9. Conversely, MMP-9 activity in the presence of 50μM acrolein was enhanced by 100μM histidine. This was due to the inhibition of acrolein conjugation with His405 and 411 located at the Zn 2+ binding site of MMP-9. These results suggest that activation of 92kDa MMP-9 by acrolein is involved in tissue damage in pSS patients and is regulated by cysteine and histidine, and slightly by lysine. Activated 82 and 68kDa MMP-9s were not detected in saliva of pSS patients by Western blotting. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Water vapor and aerosol lidar measurements within an atmospheric instrumental super site to study the aerosols and the tropospheric trace gases in rome

    NASA Astrophysics Data System (ADS)

    Dionisi, D.; Iannarelli, A. M.; Scoccione, A.; Liberti, G. L.; Cacciani, M.; Argentini, S.; Baldini, L.; Barnaba, F.; Campanelli, M.; Casasanta, G.; Diémoz, H.; Di Liberto, L.; Gobbi, G. P.; Petenko, I.; Siani, A. M.; Von Bismarck, J.; Casadio, S.

    2018-04-01

    A joint instrumental Super Site, combining observation in urban ("Sapienza" University) and semi-rural (ESA-ESRIN and CNR-ISAC) environment, for atmospheric studies and satellites Cal/Val activities, has been set-up in the Rome area (Italy). Ground based active and passive remote sensing instruments located in both sites are operating in synergy, offering information for a wide range of atmospheric parameters. In this work, a comparison of aerosol and water vapor measurements derived by the Rayleigh-Mie-Raman (RMR) lidars, operating simultaneously in both experimental sites, is presented.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cochran, John R.

    This Environmental Restoration Operations (ER) Consolidated Quarterly Report (ER Quarterly Report) provides the status of ongoing corrective action activities being implemented at Sandia National Laboratories, New Mexico (SNL/NM) during the July, August, and September 2016 quarterly reporting period. The Solid Waste Management Units (SWMUs) and Areas of Concern (AOCs) identified for corrective action at SNL/NM are listed in Table I-1. Sections I.2.1 and I.2.2 summarize the work completed during this quarter. Section I.2.1 summarizes the quarterly activities at sites undergoing corrective action field activities. Field activities are conducted at the three groundwater AOCs (Burn Site Groundwater [BSG AOC], Technical Areamore » [TA]-V Groundwater [TAVG AOC], and Tijeras Arroyo Groundwater [TAG AOC]). Section I.2.2 summarizes quarterly activities at sites where the New Mexico Environment Department (NMED) issued a certificate of completion and the sites are in the corrective action complete (CAC) regulatory process. Currently, SWMUs 8 and 58, 68, 149, 154, and 502 are in the CAC regulatory process. Corrective action activities are deferred at the Long Sled Track (SWMU 83), the Gun Facilities (SWMU 84), and the Short Sled Track (SWMU 240) because these three sites are active mission facilities. These three active sites are located in TA-III.« less

  12. NIMBY, CLAMP, and the location of new nuclear-related facilities: U.S. national and 11 site-specific surveys.

    PubMed

    Greenberg, Michael R

    2009-09-01

    Public and political opposition have made finding locations for new nuclear power plants, waste management, and nuclear research and development facilities a challenge for the U.S. government and the nuclear industry. U.S. government-owned properties that already have nuclear-related activities and commercial nuclear power generating stations are logical locations. Several studies and utility applications to the Nuclear Regulatory Commission suggest that concentrating locations at major plants (CLAMP) has become an implicit siting policy. We surveyed 2,101 people who lived within 50 miles of 11 existing major nuclear sites and 600 who lived elsewhere in the United States. Thirty-four percent favored CLAMP for new nuclear power plants, 52% for waste management facilities, and 50% for new nuclear laboratories. College educated, relatively affluent male whites were the strongest CLAMP supporters. They disproportionately trusted those responsible for the facilities and were not worried about existing nuclear facilities or other local environmental issues. Notably, they were concerned about continuing coal use. Not surprisingly, CLAMP proponents tended to be familiar with their existing local nuclear site. In short, likely CLAMP sites have a large and politically powerful core group to support a CLAMP policy. The challenge to proponents of nuclear technologies will be to sustain this support and expand the base among those who clearly are less connected and receptive to new nearby sites.

  13. In vitro toxicity of particulate matter (PM) collected at different sites in the Netherlands is associated with PM composition, size fraction and oxidative potential - the RAPTES project

    PubMed Central

    2011-01-01

    Background Ambient particulate matter (PM) exposure is associated with respiratory and cardiovascular morbidity and mortality. To what extent such effects are different for PM obtained from different sources or locations is still unclear. This study investigated the in vitro toxicity of ambient PM collected at different sites in the Netherlands in relation to PM composition and oxidative potential. Method PM was sampled at eight sites: three traffic sites, an underground train station, as well as a harbor, farm, steelworks, and urban background location. Coarse (2.5-10 μm), fine (< 2.5 μm) and quasi ultrafine PM (qUF; < 0.18 μm) were sampled at each site. Murine macrophages (RAW 264.7 cells) were exposed to increasing concentrations of PM from these sites (6.25-12.5-25-50-100 μg/ml; corresponding to 3.68-58.8 μg/cm2). Following overnight incubation, MTT-reduction activity (a measure of metabolic activity) and the release of pro-inflammatory markers (Tumor Necrosis Factor-alpha, TNF-α; Interleukin-6, IL-6; Macrophage Inflammatory Protein-2, MIP-2) were measured. The oxidative potential and the endotoxin content of each PM sample were determined in a DTT- and LAL-assay respectively. Multiple linear regression was used to assess the relationship between the cellular responses and PM characteristics: concentration, site, size fraction, oxidative potential and endotoxin content. Results Most PM samples induced a concentration-dependent decrease in MTT-reduction activity and an increase in pro-inflammatory markers with the exception of the urban background and stop & go traffic samples. Fine and qUF samples of traffic locations, characterized by a high concentration of elemental and organic carbon, induced the highest pro-inflammatory activity. The pro-inflammatory response to coarse samples was associated with the endotoxin level, which was found to increase dramatically during a three-day sample concentration procedure in the laboratory. The underground samples, characterized by a high content of transition metals, showed the largest decrease in MTT-reduction activity. PM size fraction was not related to MTT-reduction activity, whereas there was a statistically significant difference in pro-inflammatory activity between Fine and qUF PM. Furthermore, there was a statistically significant negative association between PM oxidative potential and MTT-reduction activity. Conclusion The response of RAW264.7 cells to ambient PM was markedly different using samples collected at various sites in the Netherlands that differed in their local PM emission sources. Our results are in support of other investigations showing that the chemical composition as well as oxidative potential are determinants of PM induced toxicity in vitro. PMID:21888644

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    G. N. Doyle

    Corrective Action Unit (CAU) 254 is located in Area 25 of the Nevada Test Site (NTS), approximately 100 kilometers (km) (62 miles) northwest of Las Vegas, Nevada. The site is located within the Reactor Maintenance, Assembly and Disassembly (R-MAD) compound and consists of Building 3126, two outdoor decontamination pads, and surrounding areas within an existing fenced area measuring approximately 50 x 37 meters (160 x 120 feet). The site was used from the early 1960s to the early 1970s as part of the Nuclear Rocket Development Station program to decontaminate test-car hardware and tooling. The site was reactivated in themore » early 1980s to decontaminate a radiologically contaminated military tank. This Closure Report (CR) describes the closure activities performed to allow un-restricted release of the R-MAD Decontamination Facility.« less

  15. Stream Phosphorus Dynamics Along a Suburbanizing Gradient in Southern Ontario, Canada

    NASA Astrophysics Data System (ADS)

    Duval, T. P.

    2017-12-01

    While it is well known that urban streams are subject to impaired water quality relative to natural analogues, far less research has been directed at stream water quality during the process of (sub-) urbanization. This study determines the role of housing construction activities in Brampton, Canada on the concentration and flux of phosphorus (P) of a headwater stream. Prior to development the stream was engineered with a riffle-pool sequence, riparian plantings, and a floodplain corridor that was lined with sediment fencing. Stream sites were sampled daily over a period of six months at locations representing varying stages of subdivision completion (upper site -active construction; middle site -finished construction and natural vegetation; lower site -finished construction and active construction). A nearby urban stream site developed ten years prior to this study was selected as a reference site. There were no differences in total phosphorus (TP) levels or flux between the suburbanizing and urban streams; however, the forms of P differed between sites. The urban stream TP load was dominated by particulate phosphorus (PP) while suburbanizing stream P was mainly in the dissolved organic phosphorus (DOP) form. The importance of DOP to TP flux increased with the onset of the growing season. TP levels in all stream segments frequently exceeded provincial water quality guidelines during storm events but were generally low during baseflow conditions. During storm events PP and total suspended solid levels in the suburbanizing stream reached levels of the urban stream due to sediment fence failure at several locations along the construction-hillslope interface. Along the suburbanizing gradient, the hydrological connection to a mid-reach zone of no-construction activity / fallow field and native forest resulted in significantly lower P levels than the upper suburbanizing stream site. This suggests that stream channel design features as well as timing of construction activities and the hydrological connection between the stream and construction projects all contribute to downstream export of nutrients and ultimately stream water quality.

  16. Activation of phenylalanine hydroxylase by phenylalanine does not require binding in the active site.

    PubMed

    Roberts, Kenneth M; Khan, Crystal A; Hinck, Cynthia S; Fitzpatrick, Paul F

    2014-12-16

    Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein's regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The k(cat)/K(phe) value is down 10⁴ for the mutant enzyme, and the K(m) value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain.

  17. Activation of Phenylalanine Hydroxylase by Phenylalanine Does Not Require Binding in the Active Site

    PubMed Central

    2015-01-01

    Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein’s regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The kcat/Kphe value is down 104 for the mutant enzyme, and the Km value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain. PMID:25453233

  18. 76 FR 33324 - Agency Information Collection Activities, Proposed Collection; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-08

    ... District of Columbia, the Commonwealth of Puerto Rico, the Virgin Islands, Guam, American Samoa, and the... efficiency and effectiveness. Focus groups with 8-12 consumers that will be conducted on location at each of the 10 PATH locations selected for site visitation. The focus groups will assess clients' knowledge of...

  19. 76 FR 51046 - Agency Information Collection Activities: Submission for OMB Review; Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-17

    ... District of Columbia, the Commonwealth of Puerto Rico, the Virgin Islands, Guam, American Samoa, and the... needs and improving PATH efficiency and effectiveness. Focus groups with 8-12 consumers that will be conducted on location at each of the 10 PATH locations selected for site visitation. The focus groups will...

  20. Barred Owl (Strix varia) nest site characteristics in the boreal forest of Saskatchewan, Canada

    Treesearch

    Kurt M. Mazur; Paul C. James; Shanna D. Frith

    1997-01-01

    Between 1994 and 1996 we located 15 active Barred Owl (Strix varia) nests in the boreal forest of central Saskatchewan, Canada. Eighty-seven percent of Barred Owl nests were located within old mixedwood forest stands. Nest tree species included white spruce (Picea glauca), trembling aspen (Populus tremuloides),...

  1. Hidden Hazards of Radon: Scanning the Country for Problem Locations.

    ERIC Educational Resources Information Center

    Gundersen, Linda C. S.

    1992-01-01

    Describes the geology of the radon problem in the United States and suggests how homeowners can cope with the radio active gas. Vignettes illustrate how and where radon is produced beneath the earth's surface, testing sites and procedures for radon in houses, and locations for potential radon problems across the United States. (MCO)

  2. Control site location and transcriptional regulation in Escherichia coli.

    PubMed Central

    Collado-Vides, J; Magasanik, B; Gralla, J D

    1991-01-01

    The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993

  3. Flexibility and Stability Trade-Off in Active Site of Cold-Adapted Pseudomonas mandelii Esterase EstK.

    PubMed

    Truongvan, Ngoc; Jang, Sei-Heon; Lee, ChangWoo

    2016-06-28

    Cold-adapted enzymes exhibit enhanced conformational flexibility, especially in their active sites, as compared with their warmer-temperature counterparts. However, the mechanism by which cold-adapted enzymes maintain their active site stability is largely unknown. In this study, we investigated the role of conserved D308-Y309 residues located in the same loop as the catalytic H307 residue in the cold-adapted esterase EstK from Pseudomonas mandelii. Mutation of D308 and/or Y309 to Ala or deletion resulted in increased conformational flexibility. Particularly, the D308A or Y309A mutant showed enhanced substrate affinity and catalytic rate, as compared with wild-type EstK, via enlargement of the active site. However, all mutant EstK enzymes exhibited reduced thermal stability. The effect of mutation was greater for D308 than Y309. These results indicate that D308 is not preferable for substrate selection and catalytic activity, whereas hydrogen bond formation involving D308 is critical for active site stabilization. Taken together, conformation of the EstK active site is constrained via flexibility-stability trade-off for enzyme catalysis and thermal stability. Our study provides further insights into active site stabilization of cold-adapted enzymes.

  4. Marte Valles site

    NASA Technical Reports Server (NTRS)

    Rice, Jim W.

    1994-01-01

    This site is located at 16 deg N, 177 deg W on the flood plains of Marte Valles, which is perhaps the youngest channel system on Mars. The young age of this channel warrants investigation because of climatic implications for fluvial activities in recent geologic time. The paucity of craters makes this an excellent site in terms of safety requirements. Some of the objectives stated previously for the Maja Valles region would also apply to this site (grab bag of rock types, etc.).

  5. Data from a thick unsaturated zone underlying Oro Grande and Sheep Creek washes in the western part of the Mojave Desert, near Victorville, San Bernardino County, California

    USGS Publications Warehouse

    Izbicki, John A.; Clark, Dennis A.; Pimental, Maria I.; Land, Michael; Radyk, John C.; Michel, Robert L.

    2000-01-01

    This report presents data on the physical properties of unsaturated alluvial deposits and on the chemical and isotopic composition of soil water and soil gas collected at 12 monitoring sites in the western part of the Mojave Desert, near Victorville, California. Sites were installed using the ODEX air-hammer method. Seven sites were located in the active channels of Oro Grande and Sheep Creek Washes. The remaining five sites were located away from the active washes. Most sites were drilled to a depth of about 100 feet below land surface; two sites were drilled to the water table almost 650 feet below land surface. Drilling procedures, lithologic and geophysical data, and site construction and instrumentation are described. Core material was analyzed for water content, bulk density, water potential, particle size, and water retention. The chemical composition of leachate from almost 1,000 subsamples of cores and cuttings was determined. Water extracted from selected subsamples of cores was analyzed for tritium and the stable isotopes of oxygen and hydrogen. Water from suction-cup lysimeters and soil-gas samples also were analyzed for chemical and isotopic composition. In addition, data on the chemical and isotopic composition of bulk precipitation from five sites and on ground water from two water-table wells are reported.

  6. An integrated approach for identifying priority contaminant in ...

    EPA Pesticide Factsheets

    Environmental assessment of complex mixtures typically requires integration of chemical and biological measurements. This study demonstrates the use of a combination of instrumental chemical analyses, effects-based monitoring, and bio-effects prediction approaches to help identify potential hazards and priority contaminants in two Great Lakes Areas of Concern (AOCs), the Lower Green Bay/Fox River located near Green Bay, WI, USA and the Milwaukee River Estuary, located near Milwaukee, WI, USA. Fathead minnows were caged at four sites within each AOC (eight sites total). Following 4 d of in situ exposure, tissues and biofluids were sampled and used for targeted biological effects analyses. Additionally, 4 d composite water samples were collected concurrently at each caged fish site and analyzed for 134 analytes as well as evaluated for total estrogenic and androgenic activity using cell-based bioassays. Of the analytes examined, 75 were detected in composite samples from at least one site. Based on multiple analyses, one site in the East River and another site near a paper mill discharge from lower Green Bay/Fox River AOC, were prioritized due to their estrogenic and androgenic acitvity, respectively. The water samples from other sites generally did not exhibit significant estrogenic or androgenic activity, nor was there evidence for endocrine disruption in the fish exposed at these sites as indicated the the lack of alterations in ex vivo steroid production, c

  7. Migration, foraging, and residency patterns for Northern Gulf loggerheads: implications of local threats and international movements

    USGS Publications Warehouse

    Hart, Kristen M.; Lamont, Margaret M.; Sartain-Iverson, Autumn R.; Fujisaki, Ikuko

    2014-01-01

    Northern Gulf of Mexico (NGoM) loggerheads (Caretta caretta) make up one of the smallest subpopulations of this threatened species and have declining nest numbers. We used satellite telemetry and a switching state-space model to identify distinct foraging areas used by 59 NGoM loggerheads tagged during 2010–2013. We tagged turtles after nesting at three sites, 1 in Alabama (Gulf Shores; n = 37) and 2 in Florida (St. Joseph Peninsula; n = 20 and Eglin Air Force Base; n = 2). Peak migration time was 22 July to 9 August during which >40% of turtles were in migration mode; the mean post-nesting migration period was 23.0 d (±13.8 d SD). After displacement from nesting beaches, 44 turtles traveled to foraging sites where they remained resident throughout tracking durations. Selected foraging locations were variable distances from tagging sites, and in 5 geographic regions; no turtles selected foraging sites outside the Gulf of Mexico (GoM). Foraging sites delineated using 50% kernel density estimation were located a mean distance of 47.6 km from land and in water with mean depth of −32.5 m; other foraging sites, delineated using minimum convex polygons, were located a mean distance of 43.0 km from land and in water with a mean depth of −24.9 m. Foraging sites overlapped with known trawling activities, oil and gas extraction activities, and the footprint of surface oiling during the 2010 Deepwater Horizon oil spill (n = 10). Our results highlight the year-round use of habitats in the GoM by loggerheads that nest in the NGoM. Our findings indicate that protection of females in this subpopulation requires both international collaborations and management of threats that spatially overlap with distinct foraging habitats.

  8. Migration, foraging, and residency patterns for Northern Gulf loggerheads: implications of local threats and international movements.

    PubMed

    Hart, Kristen M; Lamont, Margaret M; Sartain, Autumn R; Fujisaki, Ikuko

    2014-01-01

    Northern Gulf of Mexico (NGoM) loggerheads (Caretta caretta) make up one of the smallest subpopulations of this threatened species and have declining nest numbers. We used satellite telemetry and a switching state-space model to identify distinct foraging areas used by 59 NGoM loggerheads tagged during 2010-2013. We tagged turtles after nesting at three sites, 1 in Alabama (Gulf Shores; n = 37) and 2 in Florida (St. Joseph Peninsula; n = 20 and Eglin Air Force Base; n = 2). Peak migration time was 22 July to 9 August during which >40% of turtles were in migration mode; the mean post-nesting migration period was 23.0 d (±13.8 d SD). After displacement from nesting beaches, 44 turtles traveled to foraging sites where they remained resident throughout tracking durations. Selected foraging locations were variable distances from tagging sites, and in 5 geographic regions; no turtles selected foraging sites outside the Gulf of Mexico (GoM). Foraging sites delineated using 50% kernel density estimation were located a mean distance of 47.6 km from land and in water with mean depth of -32.5 m; other foraging sites, delineated using minimum convex polygons, were located a mean distance of 43.0 km from land and in water with a mean depth of -24.9 m. Foraging sites overlapped with known trawling activities, oil and gas extraction activities, and the footprint of surface oiling during the 2010 Deepwater Horizon oil spill (n = 10). Our results highlight the year-round use of habitats in the GoM by loggerheads that nest in the NGoM. Our findings indicate that protection of females in this subpopulation requires both international collaborations and management of threats that spatially overlap with distinct foraging habitats.

  9. Site Selection and Deployment Scenarios for Servicing of Deep-Space Observatories

    NASA Technical Reports Server (NTRS)

    Willenberg, Harvey J.; Fruhwirth, Michael A.; Potter, Seth D.; Leete, Stephen J.; Moe, Rud V.

    2001-01-01

    The deep-space environment and relative transportation accessibility of the Weak Stability Boundary (WSB) region connecting the Earth-Moon and Sun-Earth libration points makes the Sun-Earth L2 an attractive operating location for future observatories. A summary is presented of key characteristics of future observatories designed to operate in this region. The ability to service observatories that operate within the region around the Lagrange points may greatly enhance their reliability, lifetime, and scientific return. The range of servicing missions might begin with initial deployment, assembly, test, and checkout. Post-assembly servicing missions might also include maintenance and repair, critical fluids resupply, and instrument upgrades. We define the range of servicing missions that can be performed with extravehicular activity, with teleoperated robots, and with autonomous robots. We then describe deployment scenarios that affect payload design. A trade study is summarized of the benefits and risks of alternative servicing sites, including at the International Space Station, at other low-Earth-orbit locations, at the Earth-Moon L1 location, and on-site at the Sun-Earth L2 location. Required technology trades and development issues for observatory servicing at each site, and with each level of autonomy, are summarized.

  10. Diffusive flux of PAHs across sediment-water and water-air interfaces at urban superfund sites.

    PubMed

    Minick, D James; Anderson, Kim A

    2017-09-01

    Superfund sites may be a source of polycyclic aromatic hydrocarbons (PAHs) to the surrounding environment. These sites can also act as PAH sinks from present-day anthropogenic activities, especially in urban locations. Understanding PAH transport across environmental compartments helps to define the relative contributions of these sources and is therefore important for informing remedial and management decisions. In the present study, paired passive samplers were co-deployed at sediment-water and water-air interfaces within the Portland Harbor Superfund Site and the McCormick and Baxter Superfund Site. These sites, located along the Willamette River (Portland, OR, USA), have PAH contamination from both legacy and modern sources. Diffusive flux calculations indicate that the Willamette River acts predominantly as a sink for low molecular weight PAHs from both the sediment and the air. The sediment was also predominantly a source of 4- and 5-ring PAHs to the river, and the river was a source of these same PAHs to the air, indicating that legacy pollution may be contributing to PAH exposure for residents of the Portland urban center. At the remediated McCormick and Baxter Superfund Site, flux measurements highlight locations within the sand and rock sediment cap where contaminant breakthrough is occurring. Environ Toxicol Chem 2017;36:2281-2289. © 2017 SETAC. © 2017 SETAC.

  11. Evaluation of Final Radiological Conditions at Areas of the Niagara Falls Storage Site Remediated under the Formerly Utilized Sites Remedial Action Program - 12184

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clayton, Christopher; Kothari, Vijendra; Starr, Ken

    2012-07-01

    The U.S. Department of Energy (DOE) methods and protocols allow evaluation of remediation and final site conditions to determine if remediated sites remain protective. Two case studies are presented that involve the Niagara Falls Storage Site (NFSS) and associated vicinity properties (VPs), which are being remediated under the Formerly Utilized Sites Remedial Action Program (FUSRAP). These properties are a part of the former Lake Ontario Ordnance Works (LOOW). In response to stakeholders concerns about whether certain remediated NFSS VPs were putting them at risk, DOE met with stakeholders and agreed to evaluate protectiveness. Documentation in the DOE records collection adequatelymore » described assessed and final radiological conditions at the completed VPs. All FUSRAP wastes at the completed sites were cleaned up to meet DOE guidelines for unrestricted use. DOE compiled the results of the investigation in a report that was released for public comment. In conducting the review of site conditions, DOE found that stakeholders were also concerned about waste from the Separations Process Research Unit (SPRU) at the Knolls Atomic Power Laboratory (KAPL) that was handled at LOOW. DOE agreed to determine if SPRU waste remained at that needed to be remediated. DOE reviewed records of waste characterization, historical handling locations and methods, and assessment and remediation data. DOE concluded that the SPRU waste was remediated on the LOOW to levels that pose no unacceptable risk and allow unrestricted use and unlimited exposure. This work confirms the following points as tenets of an effective long-term surveillance and maintenance (LTS and M) program: - Stakeholder interaction must be open and transparent, and DOE must respond promptly to stakeholder concerns. - DOE, as the long-term custodian, must collect and preserve site records in order to demonstrate that remediated sites pose no unacceptable risk. - DOE must continue to maintain constructive relationships with the U.S. Army Corps of Engineers and state and federal regulators. After review of historical site documentation, DOE reports, and USACE radiological data, DOE concluded the following: - DOE had access to adequate documentation to evaluate site conditions at the former LOOW. This is important to confirm now, while institutional knowledge of early FUSRAP work remains available. - DOE remediated the completed VPs to conditions that are protective for unrestricted residential use. Sample and walkover gamma scan results indicate that no wastes remain that exceed cleanup criteria. - Process knowledge and field observations establish that Cs-137 is the predominant radionuclide in the KAPL waste stream. Cs-137, a strong gamma emitter, was used as an indicator for remediation of KAPL waste. Other radionuclides were present in much lower relative concentrations and were likely also removed during remediation of the VPs. - KAPL contaminants were removed during remedial activities at the former LOOW as either co-located or co-mingled with other radionuclides. - For the active VPs (VP-E, VP-E', and VP-G), results of DOE's cleanup of the accessible portions of these properties indicate that KAPL waste does not remain at concentrations greater than the DOE cleanup limit: - Inaccessible areas were not associated with historic KAPL waste handling. Therefore, it is unlikely that KAPL waste remains on the active VPs. - Because gamma activity was used by DOE during remediation/verification activities for excavation control, additional USACE cleanup of FUSRAP wastes on these properties will likely result in the remediation of any co-located residual KAPL wastes to acceptable levels or identification of KAPL waste that is not co-located. - Although USACE has not established a cleanup level for Cs-137 on the active NFSS VPs, DOE assessment and remediation data indicate that assessed Cs-137 was remediated and significant Cs-137 is unlikely to remain. Because of the low likelihood of encountering significant KAPL waste on the active NFSS VPs, additional remediation is not anticipated at these properties. - USACE assessment soil sampling results on the NFSS proper indicate that KAPL waste does not exceed the DOE cleanup level for Cs-137. USACE has not established a cleanup level for Cs-137 on NFSS proper. The USACE cleanup of FUSRAP wastes on the NFSS proper will likely result in the remediation of any co-located residual KAPL wastes or identification of KAPL waste that is not co-located. DOE is drafting a report of the investigation of KAPL waste at LOOW. The report will be released to the public for comment when the draft is complete. DOE responses to stakeholder inquiries resulted in a common understanding of site conditions and site risk. DOE expects additional interaction with stakeholders at the former LOOW as USACE completes remediation of the active VPs and the NFSS proper, and these relationships will hopefully have built trust between DOE and the stakeholders that DOE will perform its duties in an open and transparent manner that includes stakeholders as stewards for remediated FUSRAP sites. (authors)« less

  12. 22 CFR 1104.2 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...) Archaeological resource means any material remains of human life or activities which are at least 100 years of... providing scientific or humanistic understandings of past human behavior, cultural adaptation, and related... means physical evidence of human habitation, occupation, use, or activity, including the site, location...

  13. 18 CFR 1312.3 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) Archaeological resource means any material remains of human life or activities which are at least 100 years of... providing scientific or humanistic understandings of past human behavior, cultural adaptation, and related... means physical evidence of human habitation, occupation, use, or activity, including the site, location...

  14. 22 CFR 1104.2 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) Archaeological resource means any material remains of human life or activities which are at least 100 years of... providing scientific or humanistic understandings of past human behavior, cultural adaptation, and related... means physical evidence of human habitation, occupation, use, or activity, including the site, location...

  15. 36 CFR 296.3 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...) Archaeological resource means any material remains of human life or activities which are at least 100 years of... providing scientific or humanistic understandings of past human behavior, cultural adaptation, and related... means physical evidence of human habitation, occupation, use, or activity, including the site, location...

  16. Verification of a Schumann Resonance Inversion Method for Global Lightning Activity in Absolute Units

    NASA Astrophysics Data System (ADS)

    Williams, E. R.; Guha, A.; Liu, Y.; Boldi, R. A.; Pracser, E.; Said, R.; Satori, G.; Bozoki, T.; Bor, J.; Atkinson, M.; Beggan, C.; Cummer, S.; Lyu, F.; Fain, B.; Hobara, Y.; Alexander, K.; Kulak, A.; McCraty, R.; Mlynarczyk, J.; Montanya, J.; Moore, R. C.; Neska, M.; Ortega, P.; Price, C. G.; Rawat, R.; Sato, M.; Sinha, A. K.; Yampolski, Y.

    2017-12-01

    The global reach of single, calibrated ELF receivers operating in the Schumann resonance (SR) band (3-50 Hz) has been verified by global maps of energetic Q-burst locations and vertical charge moment change, and by locations of independently verified transient luminous events in a wide variety of locations worldwide. It has also been previously shown that with as few as six ELF receivers in widely separated locations, multi-station, multi-modal SR parameters extracted from the SR "background" signal can be inverted to provide the centroid locations of continental lightning "chimneys" (Asia, Africa, Americas) and their respective lightning activities in absolute units (coul2 km2/sec). This inversion method involves a propagation model for the Earth-ionosphere cavity with day-night asymmetry. The Earth is now populated with more than 30 calibrated ELF receivers making continuous time series observations. This circumstance is exploited in the present study to verify the findings of the ELF inversion method. During the period May 17-20 and 23-24, 2015, two independent sets of nine ELF receivers each, in widely-separated geographical locations (first set: Antarctica (3 sites), Hungary, Japan (2 sites), Poland, Spitzbergen, and USA; second set: Antarctica, Canada, Cape Verde Island, Lithuania, New Zealand, Saudi Arabia, Scotland, Tahiti, and USA), are used to compare the locations and source strengths of lightning chimneys. Detailed comparisons will be shown over Universal Time for selected days.

  17. Site Rehabilitation Completion Report with No Further Action Proposal for the Northeast Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daniel, Joe; Tabor, Charles; Survochak, Scott

    2013-05-01

    The purpose of this Site Rehabilitation Completion Report is to present the post-active-remediation monitoring results for the Northeast Site and to propose No Further Action with Controls. This document includes information required by Chapter 62-780.750(4)(d), 62-780.750(6), and 62-780.600(8)(a)27 Florida Administrative Code (F.A.C.). The Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site (DOE 2009a) describes the approach for post-active-remediation monitoring. The Young - Rainey Science, Technology, and Research Center (STAR Center) is a former U.S. Department of Energy (DOE) facility constructed in the mid-1950s. The 99-acre STAR Center is located in Largo, Florida. The Northeast Site is locatedmore » in the northeast corner of the STAR Center. The Northeast Site meets all the requirements for an RMO II closure—No Further Action with Controls. DOE is nearing completion of a restrictive covenant for the Northeast Site. DOE has completed post-active-remediation monitoring at the Northeast Site as of September 2012. No additional monitoring will be conducted.« less

  18. Statistical activities during 1976 and the design and initial analysis of nuclear site studies. [/sup 241/Am, /sup 137/Cs, /sup 239/Pu, /sup 240/Pu

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilbert, R O; Essington, E H; Brady, D N

    Statistical design and analysis activities for the Nevada Applied Ecology Group (NAEG) during 1976 are briefly outlined. This is followed by a description of soil data collected thus far at nuclear study sites. Radionuclide concentrations in surface soil collected along a transect from ground zero (GZ) along the main fallout pattern are given for Nuclear Site (NS) 201. Concentrations in soil collected at 315 locations on a grid system at 200 foot spacings are also given for this site. The /sup 241/Am to /sup 137/Cs ratios change over NS 201 depending on location relative to GZ. They range from lessmore » than one where /sup 241/Am is at low levels, to more than fifty where /sup 241/Am levels are high (near GZ). The estimated median /sup 239/ /sup 240/Pu to /sup 241/Am ratio is 11 and appears to be relatively constant over the area (the 95 percent lower and upper limits on the true median ratio are about 8 and 14).« less

  19. Active-Site Hydration and Water Diffusion in Cytochrome P450cam: A Highly Dynamic Process

    PubMed Central

    Miao, Yinglong; Baudry, Jerome

    2011-01-01

    Long-timescale molecular dynamics simulations (300 ns) are performed on both the apo- (i.e., camphor-free) and camphor-bound cytochrome P450cam (CYP101). Water diffusion into and out of the protein active site is observed without biased sampling methods. During the course of the molecular dynamics simulation, an average of 6.4 water molecules is observed in the camphor-binding site of the apo form, compared to zero water molecules in the binding site of the substrate-bound form, in agreement with the number of water molecules observed in crystal structures of the same species. However, as many as 12 water molecules can be present at a given time in the camphor-binding region of the active site in the case of apo-P450cam, revealing a highly dynamic process for hydration of the protein active site, with water molecules exchanging rapidly with the bulk solvent. Water molecules are also found to exchange locations frequently inside the active site, preferentially clustering in regions surrounding the water molecules observed in the crystal structure. Potential-of-mean-force calculations identify thermodynamically favored trans-protein pathways for the diffusion of water molecules between the protein active site and the bulk solvent. Binding of camphor in the active site modifies the free-energy landscape of P450cam channels toward favoring the diffusion of water molecules out of the protein active site. PMID:21943431

  20. Dungeness crab survey for the Southwest Ocean Disposal Site off Grays Harbor, Washington, June 1990

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Higgins, B.J.; Pearson, W.H.

    1991-09-01

    As part of the Grays Harbor Navigation Improvement Project, the Seattle District of the US Army Corps of Engineers has begun active use of the Southwest Ocean Disposal Site off Grays Harbor, Washington. This survey was to verify that the location of the area of high crab density observed during site selection surveys has not shifted into the Southeast Ocean Disposal Site. In June 1990, mean densities of juvenile Dungeness crab were 146 crab/ha within the disposal site and 609 crab/ha outside ad north of the disposal site. At nearshore locations outside the disposal site, juvenile crab density was 3275more » crab/ha. Despite the low overall abundance, the spatial distribution of crab was such that the high crab densities in 1990 have remained outside the Southwest Ocean Disposal Site. The survey data have confirmed the appropriateness of the initial selection of the disposal site boundaries and indicated no need to move to the second monitoring tier. 8 refs., 9 figs., 2 tabs.« less

  1. Bait distribution among multiple colonies of Pharaoh ants (hymenoptera: Formicidae).

    PubMed

    Oi, D H; Vail, K M; Williams, D F

    2000-08-01

    Pharaoh ant, Monomorium pharaonis (L.), infestations often consist of several colonies located at different nest sites. To achieve control, it is desirable to suppress or eliminate the populations of a majority of these colonies. We compared the trophallactic distribution and efficacy of two ant baits, with different modes of action, among groups of four colonies of Pharaoh ants. Baits contained either the metabolic-inhibiting active ingredient hydramethylnon or the insect growth regulator (IGR) pyriproxyfen. Within 3 wk, the hydramethylnon bait reduced worker and brood populations by at least 80%, and queen reductions ranged between 73 and 100%, when nests were in proximity (within 132 cm) to the bait source. However, these nest sites were reoccupied by ants from other colonies located further from the bait source. The pyriproxyfen bait was distributed more thoroughly to all nest locations with worker populations gradually declining by 73% at all nest sites after 8 wk. Average queen reductions ranged from 31 to 49% for all nest sites throughout the study. Even though some queens survived, brood reductions were rapid in the pyriproxyfen treatment, with reductions of 95% at all locations by week 3. Unlike the metabolic inhibitor, the IGR did not kill adult worker ants quickly, thus, more surviving worker ants were available to distribute the bait to all colonies located at different nest sites. Thus, from a single bait source, the slow-acting bait toxicant provided gradual, but long-term control, whereas the fast-acting bait toxicant provided rapid, localized control for a shorter duration.

  2. Application of individual foraminifera Mg/Ca and δ18O analyses for paleoceanographic reconstructions in the Bay of Bengal and other active depositional environments

    NASA Astrophysics Data System (ADS)

    Fritz-Endres, T.; Dekens, P.; Fehrenbacher, J. S.; Spero, H. J.; Stine, A.

    2017-12-01

    Paleoceanographic research traditionally focuses on regions where sediment deposition is minimally affected by transport. However, sediment fans near tectonically active regions provide an opportunity to link oceanographic climate to terrestrial processes. Sediment cores recovered during IODP Expedition 354 in the Bay of Bengal include hemipelagic sections that record the history of tectonic uplift and the development of the Indian Monsoon through the last 10 Ma. Although these cores provide a unique opportunity to link marine and terrestrial climate, the complex depositional environment requires that the source of foraminifera is carefully considered before using these proxies to reconstruct oceanographic conditions. Foraminifera in Bengal Fan sediments may have been transported via turbidity currents from the northern Bay of Bengal, where the seasonal variability of SST and SSS is larger compared to the southern Bay of Bengal. We measured single Globigerinoides sacculifer Mg/Ca and δ18O from mudline samples of IODP Site U1454 (8.4°N, 85.5°E, 3721 m water depth) near the modern active channel and Site U1449 (8.4°N, 88.7°E, 3653 m water depth) far from channel activity. We compare these sites to single G. sacculifer from the core-top sample of Site 342KL (20.6°N, 90.1°E, 1256 m water depth) located on the continental shelf. Each foraminifera lives 2-4 weeks and the distribution of 60 to 80 data points reflects the seasonal range of SST and SSS at the location where the foraminifera calcified. Measurements in foraminifera from Site U1449 (away from active channel) are statistically different from the site in the northern Bay of Bengal and more consistent with local conditions. Conversely, foraminifera from the site near the active channel reflect a combined signal of local conditions recorded from the site far from channel activity and those recorded from the continental shelf. This suggests a portion of foraminifera from the active channel site have been transported from the northern Bay of Bengal. Our data show that foraminifera can be used to reconstruct SST and δ18O in this complex depositional environment, but caution must be taken when the down-core lithology indicates turbidites and possible sediment transport

  3. Drilling on the Moon and Mars: Developing the Science Approach for Subsurface Exploration with Human Crews

    NASA Technical Reports Server (NTRS)

    Stoker, C. R.; Zavaleta, J.; Bell, M.; Direto, S.; Foing, B.; Blake, D.; Kim, S.

    2010-01-01

    DOMEX (Drilling on the Moon and Mars in Human Exploration) is using analog missions to develop the approach for using human crews to perform science activities on the Moon and Mars involving exploration and sampling of the subsurface. Subsurface science is an important activity that may be uniquely enabled by human crews. DOMEX provides an opportunity to plan and execute planetary mission science activities without the expense and overhead of a planetary mission. Objectives: The objective of this first in a series of DOMEX missions were to 1) explore the regional area to understand the geologic context and determine stratigraphy and geologic history of various geologic units in the area. 2) Explore for and characterize sites for deploying a deep (10 m depth) drilling system in a subsequent field season. 3) Perform GPR on candidate drill sites. 4) Select sites that represent different geological units deposited in different epochs and collect soil cores using sterile procedures for mineralogical, organic and biological analysis. 5) Operate the MUM in 3 different sites representing different geological units and soil characteristics. 6) Collect rock and soil samples of sites visited and analyze them at the habitat. Results: At mission start the crew performed a regional survey to identify major geologic units that were correlated to recognized stratigraphy and regional geologic maps. Several candidate drill sites were identified. During the rest of the mission, successful GPR surveys were conducted in four locations. Soil cores were collected in 5 locations representing soils from 4 different geologic units, to depths up to 1m. Soil cores from two locations were analyzed with PCR in the laboratory. The remainder were reserved for subsequent analysis. XRD analysis was performed in the habitat and in the field on 39 samples, to assist with sample characterization, conservation, and archiving. MUM was deployed at 3 field locations and 1 test location (outside the habitat) where it operated autonomously for 2-4 hours at each site. Depths achieved ranged from 15 to 70 cm depending on the soil compressive strength and the presence and depth of subsurface indurated layers. Subsurface samples weighing 0.5 to 1 g were collected at the deepest depth encountered at each of the sites using the MUM automated sample collection system, and subsequently analyzed with XRD. Downhole inspection of holes produced by MUM with the Raman spectrometer was acquired on two of the holes and spectral features associated with selenite were identified in specific soil layers. Previously unreported fossilized remains of vertebrate fauna from the Jurassic era were discovered during our mission. Analysis of mineral biomarkers associated with this discovery are underway.

  4. Preparation and preliminary characterization of crystallizing fluorescent derivatives of chicken egg white lysozyme

    NASA Astrophysics Data System (ADS)

    Sumida, John P.; Forsythe, Elizabeth L.; Pusey, Marc L.

    2001-11-01

    Fluorescence is one of the most versatile and powerful tools for the study of macromolecules. While most proteins are intrinsically fluorescent, working at crystallization concentrations require the use of covalently prepared derivatives added as tracers. This approach requires derivatives that do not markedly affect the crystal packing. We have prepared fluorescent derivatives of chicken egg white lysozyme with probes bound to one of two different sites on the protein molecule. Lucifer yellow and 5-(2-aminoethyl)aminonapthalene-1-sulfonic acid (EDANS) have been attached to the side chain carboxyl of Asp 101 using a carbodiimide coupling procedure. Asp 101 lies within the active site cleft, and it is believed that the probes are "buried" within that cleft. Lucifer yellow and EDANS probes with iodoacetamide reactive groups have been bound to His 15, located on the "back side" of the molecule relative to the active site. All the derivatives fluoresce in the solution and the crystalline states. Fluorescence characterization has focused on determination of binding effects on the probe quantum yield, lifetime, absorption and emission spectra, and quenching by added solutes. Quenching studies show that, as postulated, the Asp 101-bound probes are partially sheltered from the bulk solution by their location within the active site cleft. Probes bound to His 15 have quenching constants about equal to those for the free probes, indicating that this site is highly exposed to the bulk solution.

  5. AmeriFlux US-Bkg Brookings

    DOE Data Explorer

    Meyers, Tilden [NOAA/ARL

    2016-01-01

    This is the AmeriFlux version of the carbon flux data for the site US-Bkg Brookings. Site Description - The Brookings site is located in a private pasture, consisting of a mixture of C3 and C4 species actively used for grazing. Belonging to the Northern Great Plains Rangelands, the grassland is representative of many in the north central United States, with seasonal winter conditions and a wet growing season.

  6. Humboldt Open Ocean Disposal Site (HOODS) Survey Work 2014

    EPA Pesticide Factsheets

    The Humboldt Open Ocean Disposal Site (HOODS) is a dredged material disposal site located 3 nautical miles (nm) offshore of Humboldt Bay in Northern California. HOODS was permanently designated by EPA Region 9 in 1995, and has been actively used for dredged material disposal operations since then. The HOODS has received higher volumes of dredged material than predicted since its designation in 1995, mainly from USACE construction and maintenance dredging.

  7. Impact of informal electronic waste recycling on metal concentrations in soils and dusts.

    PubMed

    Ohajinwa, Chimere May; van Bodegom, Peter M; Vijver, Martina G; Peijnenburg, Willie J G M

    2018-07-01

    Electronic and electrical equipment contains over 1000 different substances, including metals. During informal e-waste recycling some of these substances such as metals, are released into the environment causing environmental pollution. This study assessed the impact of different informal e-waste recycling activities (burning, dismantling, and repairing) on metal concentrations in top soils and various dust. A comparative cross-sectional study design was adopted to assess metal concentrations in top soils and in various dust samples from multiple e-waste recycling sites. Metal concentrations at e-waste recycling sites were compared to the concentrations at control sites in three study locations in Nigeria (Lagos, Ibadan, and Aba). In the three study locations, mean metal concentrations at the e-waste recycling sites exceeded the concentrations at the control sites and the Nigerian standard guideline values by 100 s to 1000 s times. Burning sites showed the highest pollution level, followed by dismantling sites, then repair sites. Our findings show serious environmental and public health concerns. The metal concentrations were also higher than levels reported in other studies at the same locations in Nigeria, indicating that the situation is worsening. This study provides scientific evidence for an urgent need to develop effective strategies to strengthen enforcement of existing e-waste regulations in Nigeria. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase.

    PubMed

    Fenwick, Michael K; Mehta, Angad P; Zhang, Yang; Abdelwahed, Sameh H; Begley, Tadhg P; Ealick, Steven E

    2015-03-27

    Radical S-adenosylmethionine (SAM) enzymes use a [4Fe-4S] cluster to generate a 5'-deoxyadenosyl radical. Canonical radical SAM enzymes are characterized by a β-barrel-like fold and SAM anchors to the differentiated iron of the cluster, which is located near the amino terminus and within the β-barrel, through its amino and carboxylate groups. Here we show that ThiC, the thiamin pyrimidine synthase in plants and bacteria, contains a tethered cluster-binding domain at its carboxy terminus that moves in and out of the active site during catalysis. In contrast to canonical radical SAM enzymes, we predict that SAM anchors to an additional active site metal through its amino and carboxylate groups. Superimposition of the catalytic domains of ThiC and glutamate mutase shows that these two enzymes share similar active site architectures, thus providing strong evidence for an evolutionary link between the radical SAM and adenosylcobalamin-dependent enzyme superfamilies.

  9. Fate and groundwater impacts of produced water releases at OSPER "B" site, Osage County, Oklahoma

    USGS Publications Warehouse

    Kharaka, Y.K.; Kakouros, E.; Thordsen, J.J.; Ambats, G.; Abbott, M.M.

    2007-01-01

    For the last 5 a, the authors have been investigating the transport, fate, natural attenuation and ecosystem impacts of inorganic and organic compounds in releases of produced water and associated hydrocarbons at the Osage-Skiatook Petroleum Environmental Research (OSPER) "A" and "B" sites, located in NE Oklahoma. Approximately 1.0 ha of land at OSPER "B", located within the active Branstetter lease, is visibly affected by salt scarring, tree kills, soil salinization, and brine and petroleum contamination. Site "B" includes an active production tank battery and adjacent large brine pit, two injection well sites, one with an adjacent small pit, and an abandoned brine pit and tank battery site. Oil production in this lease started in 1938, and currently there are 10 wells that produce 0.2-0.5 m3/d (1-3 bbl/d) oil, and 8-16 m3/d (50-100 bbl/d) brine. Geochemical data from nearby oil wells show that the produced water source is a Na-Ca-Cl brine (???150,000 mg/L TDS), with high Mg, but low SO4 and dissolved organic concentrations. Groundwater impacts are being investigated by detailed chemical analyses of water from repeated sampling of 41 boreholes, 1-71 m deep. The most important results at OSPER "B" are: (1) significant amounts of produced water from the two active brine pits percolate into the surficial rocks and flow towards the adjacent Skiatook reservoir, but only minor amounts of liquid petroleum leave the brine pits; (2) produced-water brine and minor dissolved organics have penetrated the thick (3-7 m) shale and siltstone units resulting in the formation of three interconnected plumes of high-salinity water (5000-30,000 mg/L TDS) that extend towards the Skiatook reservoir from the two active and one abandoned brine pits; and (3) groundwater from the deep section of only one well, BR-01 located 330 m upslope and west of the site, appear not to be impacted by petroleum operations. ?? 2007.

  10. National Guard Counterdrug Programs

    DTIC Science & Technology

    2001-02-14

    comparisons to locate indoor Marijuana grows, outdoor infrastructure - Monitor activity at known sites - Meth labs, stash houses, marijuana grows - Real...Identifies key signatures of structures for indoor growth of cannabis - Vehiclelvessel surveillance * Video capabilities for evidence e Global Positioning...System Navigational Equipment - Identify marijuana locations for ground recovery Contact Information Voice (703) 607-5665 DSN Voice 327-5665 FAX (703

  11. Rapid Bioassessment Methods for Assessing Stream Macroinvertebrate Community on the Savannah River Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Specht, W.L.

    Macroinvertebrate sampling was performed at 16 locations in the Savannah River Site (SRS) streams using Hester-Dendy multiplate samplers and EPA Rapid Bioassessment Protocols (RBP). Some of the sampling locations were unimpacted, while other locations had been subject to various forms of perturbation by SRS activities. In general, the data from the Hester-Dendy multiplate samplers were more sensitive at detecting impacts than were the RBP data. We developed a Biotic Index for the Hester-Dendy data which incorporated eight community structure, function, and balance parameters. when tested using a data set that was unrelated to the data set that was used inmore » developing the Biotic Index, the index was very successful at detecting impact.« less

  12. Structure of L-Xylulose-5-Phosphate 3-Epimerase (UlaE) from the Anaerobic L-Ascorbate Utilization Pathway of Escherichia coli: Identification of a Novel Phosphate Binding Motif within a TIM Barrel Fold

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Rong; Pineda, Marco; Ajamian, Eunice

    2009-01-15

    Three catabolic enzymes, UlaD, UlaE, and UlaF, are involved in a pathway leading to fermentation of L-ascorbate under anaerobic conditions. UlaD catalyzes a {beta}-keto acid decarboxylation reaction to produce L-xylulose-5-phosphate, which undergoes successive epimerization reactions with UlaE (L-xylulose-5-phosphate 3-epimerase) and UlaF (L-ribulose-5-phosphate 4-epimerase), yielding D-xylulose-5-phosphate, an intermediate in the pentose phosphate pathway. We describe here crystallographic studies of UlaE from Escherichia coli O157:H7 that complete the structural characterization of this pathway. UlaE has a triosephosphate isomerase (TIM) barrel fold and forms dimers. The active site is located at the C-terminal ends of the parallel {beta}-strands. The enzyme binds Zn{sup 2+},more » which is coordinated by Glu155, Asp185, His211, and Glu251. We identified a phosphate-binding site formed by residues from the {beta}1/{alpha}1 loop and {alpha}3' helix in the N-terminal region. This site differs from the well-characterized phosphate-binding motif found in several TIM barrel superfamilies that is located at strands {beta}7 and {beta}8. The intrinsic flexibility of the active site region is reflected by two different conformations of loops forming part of the substrate-binding site. Based on computational docking of the L-xylulose 5-phosphate substrate to UlaE and structural similarities of the active site of this enzyme to the active sites of other epimerases, a metal-dependent epimerization mechanism for UlaE is proposed, and Glu155 and Glu251 are implicated as catalytic residues. Mutation and activity measurements for structurally equivalent residues in related epimerases supported this mechanistic proposal.« less

  13. Final 2014 Remedial Action Report Project Chariot, Cape Thompson, Alaska

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None, None

    2015-03-01

    This report was prepared to document remedial action (RA) work performed at the former Project Chariot site located near Cape Thompson, Alaska during 2014. The work was managed by the U.S. Army Corps of Engineers (USACE) Alaska District for the U.S. Department of Energy (DOE) Office of Legacy Management (LM). Due to the short field season and the tight barge schedule, all field work was conducted at the site July 6 through September 12, 2014. Excavation activities occurred between July 16 and August 26, 2014. A temporary field camp was constructed at the site prior to excavation activities to accommodatemore » the workers at the remote, uninhabited location. A total of 785.6 tons of petroleum, oil, and lubricants (POL)-contaminated soil was excavated from four former drill sites associated with test holes installed circa 1960. Diesel was used in the drilling process during test hole installations and resulted in impacts to surface and subsurface soils at four of the five sites (no contamination was identified at Test Hole Able). Historic information is not definitive as to the usage for Test Hole X-1; it may have actually been a dump site and not a drill site. In addition to the contaminated soil, the steel test hole casings were decommissioned and associated debris was removed as part of the remedial effort.« less

  14. Methanopyrus kandleri topoisomerase V contains three distinct AP lyase active sites in addition to the topoisomerase active site

    PubMed Central

    Rajan, Rakhi; Osterman, Amy; Mondragón, Alfonso

    2016-01-01

    Topoisomerase V (Topo-V) is the only topoisomerase with both topoisomerase and DNA repair activities. The topoisomerase activity is conferred by a small alpha-helical domain, whereas the AP lyase activity is found in a region formed by 12 tandem helix-hairpin-helix ((HhH)2) domains. Although it was known that Topo-V has multiple repair sites, only one had been mapped. Here, we show that Topo-V has three AP lyase sites. The atomic structure and Small Angle X-ray Scattering studies of a 97 kDa fragment spanning the topoisomerase and 10 (HhH)2 domains reveal that the (HhH)2 domains extend away from the topoisomerase domain. A combination of biochemical and structural observations allow the mapping of the second repair site to the junction of the 9th and 10th (HhH)2 domains. The second site is structurally similar to the first one and to the sites found in other AP lyases. The 3rd AP lyase site is located in the 12th (HhH)2 domain. The results show that Topo-V is an unusual protein: it is the only known protein with more than one (HhH)2 domain, the only known topoisomerase with dual activities and is also unique by having three AP lyase repair sites in the same polypeptide. PMID:26908655

  15. Social and nonsocial behaviours of sex- and age-matched enclosed and free-ranging rhesus monkeys (Macaca mulatta).

    PubMed

    Baulu, J; Redmond, D E

    1980-01-01

    The behavioural profiles (time budgeting of social and nonsocial activities) and the frequencies of major social interactions of corral-enclosed rhesus monkeys were compared with sex- and age-matched free-ranging rhesus monkeys on La Cueva Island, Puerto Rico. All animals (n = 32) were provisioned ad libitum at specific feeder sites. The occurrence of 14 behaviours around feeders was compared with their occurrence away from the feeders by noting the location of each monkey relative to the feeder at the time of observation. An analysis of variance between free-ranging versus corral-enclosed groups and within groups by location (around or away from the feeder) revealed significant differences in several behavioural categories, including foraging, lookout, inactive, dominant, submissive, allogrooming, social contact, social initiative, active, and passive behaviours. When the effect of limited food distribution sites was analyzed by comparing data recorded away from the feeding sites, there were remarkably few differences between the groups.

  16. Identification of the Catalytic Ubiquinone-binding Site of Vibrio cholerae Sodium-dependent NADH Dehydrogenase

    PubMed Central

    Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar

    2017-01-01

    The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088

  17. SURFACE GEOPHYSICAL EXPLORATION OF B & BX & BY TANK FARMS AT THE HANFORD SITE RESULTS OF BACKGROUND CHARACTERIZATION WITH MAGNETICS AND ELECTROMAGNETICS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MYERS DA

    This report documents the results of preliminary surface geophysical exploration activities performed between October and December 2006 at the B, BX, and BY tank farms (B Complex). The B Complex is located in the 200 East Area of the U. S. Department of Energy's Hanford Site in Washington State. The objective of the preliminary investigation was to collect background characterization information with magnetic gradiometry and electromagnetic induction to understand the spatial distribution of metallic objects that could potentially interfere with the results from high resolution resistivity survey. Results of the background characterization show there are several areas located around themore » site with large metallic subsurface debris or metallic infrastructure.« less

  18. Conserved tyrosine 182 residue in hyperthermophilic esterase EstE1 plays a critical role in stabilizing the active site.

    PubMed

    Truongvan, Ngoc; Chung, Hye-Shin; Jang, Sei-Heon; Lee, ChangWoo

    2016-03-01

    An aromatic amino acid, Tyr or Trp, located in the esterase active site wall, is highly conserved, with hyperthermophilic esterases showing preference for Tyr and lower temperature esterases showing preference for Trp. In this study, we investigated the role of Tyr(182) in the active site wall of hyperthermophilic esterase EstE1. Mutation of Tyr to Phe or Ala had a moderate effect on EstE1 thermal stability. However, a small-to-large mutation such as Tyr to His or Trp had a devastating effect on thermal stability. All mutant EstE1 enzymes showed reduced catalytic rates and enhanced substrate affinities as compared with wild-type EstE1. Hydrogen bond formation involving Tyr(182) was unimportant for maintaining EstE1 thermal stability, as the EstE1 structure is already adapted to high temperatures via increased intramolecular interactions. However, removal of hydrogen bond from Tyr(182) significantly decreased EstE1 catalytic activity, suggesting its role in stabilization of the active site. These results suggest that Tyr is preferred over a similarly sized Phe residue or bulky His or Trp residue in the active site walls of hyperthermophilic esterases for stabilizing the active site and regulating catalytic activity at high temperatures.

  19. Environmental Restoration (ER) Consolidated Quarterly Report_April to June 2017_ October 2017

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cochran, John R.

    2017-10-01

    This Environmental Restoration Operations (ER) Consolidated Quarterly Report (ER Quarterly Report) provides the status of ongoing corrective action activities being implemented at Sandia National Laboratories, New Mexico (SNL/NM) during the April, May, and June 2017 quarterly reporting period. Table I-1 lists the Solid Waste Management Units (SWMUs) and Areas of Concern (AOCs) identified for corrective action at SNL/NM. Sections I.2.1 and I.2.2 summarize the work completed during this quarter. Section I.2.1 summarizes the quarterly activities at sites undergoing corrective action field activities. Field activities are conducted at the three groundwater AOCs (Burn Site Groundwater [BSG AOC], Technical Area [TA]-V Groundwatermore » [TAVG AOC], and Tijeras Arroyo Groundwater [TAG AOC]). Section I.2.2 summarizes quarterly activities at sites where the New Mexico Environment Department (NMED) Hazardous Waste Bureau (HWB) issued a certificate of completion and the sites are in the corrective action complete (CAC) regulatory process. Currently, SWMUs 8 and 58, 68, 149, 154, and 502 are in the CAC regulatory process. Corrective action activities are deferred at the Long Sled Track (SWMU 83), the Gun Facilities (SWMU 84), and the Short Sled Track (SWMU 240) because these three sites are active mission facilities. These three active mission sites are located in TA-III.« less

  20. Active layer monitoring at CALM-S site near J.G.Mendel Station, James Ross Island, eastern Antarctic Peninsula.

    PubMed

    Hrbáček, Filip; Kňažková, Michaela; Nývlt, Daniel; Láska, Kamil; Mueller, Carsten W; Ondruch, Jakub

    2017-12-01

    The Circumpolar Active Layer Monitoring - South (CALM-S) site was established in February 2014 on James Ross Island as the first CALM-S site in the eastern Antarctic Peninsula region. The site, located near Johann Gregor Mendel Station, is labelled CALM-S JGM. The grid area is gently sloped (<3°) and has an elevation of between 8 and 11ma.s.l. The lithology of the site consists of the muddy sediments of Holocene marine terrace and clayey-sandy Cretaceous sedimentary rocks, which significantly affect the texture, moisture content, and physical parameters of the ground within the grid. Our objective was to study seasonal and interannual variability of the active layer depth and thermal regime at the CALM-S site, and at two ground temperature measurement profiles, AWS-JGM and AWS-CALM, located in the grid. The mean air temperature in the period March 2013 to February 2016 reached -7.2°C. The mean ground temperature decreased with depth from -5.3°C to -5.4°C at 5cm, to -5.5°C to -5.9°C at 200cm. Active layer thickness was significantly higher at AWS-CALM and ranged between 86cm (2014/15) and 87cm (2015/16), while at AWS-JGM it reached only 51cm (2013/14) to 65cm (2015/16). The mean probed active layer depth increased from 66.4cm in 2013/14 to 78.0cm in 2014/15. Large differences were observed when comparing the minimum (51cm to 59cm) and maximum (100cm to 113cm) probed depths. The distribution of the active layer depth and differences in the thermal regime of the uppermost layer of permafrost at CALM-S JGM clearly show the effect of different lithological properties on the two lithologically distinct parts of the grid. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  2. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Geophysical investigation, Salmon Site, Lamar County, Mississippi

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    Geophysical surveys were conducted in 1992 and 1993 on 21 sites at the Salmon Site (SS) located in Lamar County, Mississippi. The studies are part of the Remedial Investigation/Feasibility Study (RI/FS) being conducted by IT Corporation for the U.S. Department of Energy (DOE). During the 1960s, two nuclear devices and two chemical tests were detonated 826 meters (in) (2710 feet [ft]) below the ground surface in the salt dome underlying the SS. These tests were part of the Vela Uniform Program conducted to improve the United States capability to detect, identify, and locate underground nuclear detonations. The RI/FS is beingmore » conducted to determine if any contamination is migrating from the underground shot cavity in the salt dome and if there is any residual contamination in the near surface mud and debris disposal pits used during the testing activities. The objective of the surface geophysical surveys was to locate buried debris, disposal pits, and abandoned mud pits that may be present at the site. This information will then be used to identify the locations for test pits, cone penetrometer tests, and drill hole/monitor well installation. The disposal pits were used during the operation of the test site in the 1960s. Vertical magnetic gradient (magnetic gradient), electromagnetic (EM) conductivity, and ground-penetrating radar (GPR) surveys were used to accomplish these objectives. A description of the equipment used and a theoretical discussion of the geophysical methods are presented Appendix A. Because of the large number of figures relative to the number of pages of text, the geophysical grid-location maps, the contour maps of the magnetic-gradient data, the contour maps of the EM conductivity data, and the GPR traverse location maps are located in Appendix B, Tabs I through 22. In addition, selected GPR records are located in Appendix C.« less

  4. Catalytic efficiency and thermostability improvement of Suc2 invertase through rational site-directed mutagenesis.

    PubMed

    Mohandesi, Nooshin; Haghbeen, Kamahldin; Ranaei, Omid; Arab, Seyed Shahriar; Hassani, Sorour

    2017-01-01

    Engineering of invertases has come to attention because of increasing demand for possible applications of invertases in various industrial processes. Due to the known physicochemical properties, invertases from micro-organisms such as Saccharomyces cerevisiae carrying SUC2 gene are considered as primary models. To improve thermostability and catalytic efficiency of SUC2 invertase (SInv), six influential residues with Relative Solvent Accessibility<5% were selected through multiple-sequence alignments, molecular modelling, structural and computational analyses. Consequently, SInv and 5 mutants including three mutants with single point substitution [Mut1=P152V, Mut2=S85V and Mut3=K153F)], one mutant with two points [Mut4=S305V-N463V] and one mutant with three points [Mut5=S85V-K153F-T271V] were developed via site-directed mutagenesis and produced using Pichia pastoris as the host. Physicochemical studies on these enzymes indicated that the selected amino acids which were located in the active site region mainly influenced catalytic efficiency. The best improvement belonged to Mut1 (54% increase in K cat /K m ) and Mut3 exhibited the worst effect (90% increase in K m ). These results suggest that Pro152 and Lys153 play key role in preparation of the right substrate lodging in the active site of SInv. The best thermostability improvement (16%) was observed for Mut4 in which two hydrophilic residues located on the loops, far from the active site, were replaced by Valines. These results suggest that tactful simultaneous substitution of influential hydrophilic residues in both active site region and peripheral loops with hydrophobic amino acids could result in more thermostable invertases with enhanced catalytic efficiency. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Corrective Action Investigation Plan for Corrective Action Unit 151: Septic Systems and Discharge Area, Nevada Test Site, Nevada, Rev. No.: 0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    David A. Strand

    2004-06-01

    This Corrective Action Investigation Plan (CAIP) contains project-specific information for conducting site investigation activities at Corrective Action Unit (CAU) 151: Septic Systems and Discharge Area, Nevada Test Site, Nevada. Information presented in this CAIP includes facility descriptions, environmental sample collection objectives, and criteria for the selection and evaluation of environmental corrective action alternatives. Corrective Action Unit 151 is located in Areas 2, 12, 18, and 20 of the Nevada Test Site, which is 65 miles northwest of Las Vegas, Nevada. Corrective Action Unit 151 is comprised of the nine Corrective Action Sites (CAS) listed below: (1) 02-05-01, UE-2ce Pond; (2)more » 12-03-01, Sewage Lagoons (6); (3) 12-04-01, Septic Tanks; (4) 12-04-02, Septic Tanks; (5) 12-04-03, Septic Tank; (6) 12-47-01, Wastewater Pond; (7) 18-03-01, Sewage Lagoon; (8) 18-99-09, Sewer Line (Exposed); and (9) 20-19-02, Photochemical Drain. The CASs within CAU 151 are discharge and collection systems. Corrective Action Site 02-05-01 is located in Area 2 and is a well-water collection pond used as a part of the Nash test. Corrective Action Sites 12-03-01, 12-04-01, 12-04-02, 12-04-03, and 12-47-01 are located in Area 12 and are comprised of sewage lagoons, septic tanks, associated piping, and two sumps. The features are a part of the Area 12 Camp housing and administrative septic systems. Corrective Action Sites 18-03-01 and 18-99-09 are located in the Area 17 Camp in Area 18. These sites are sewage lagoons and associated piping. The origin and terminus of CAS 18-99-09 are unknown; however, the type and configuration of the pipe indicates that it may be a part of the septic systems in Area 18. Corrective Action Site 20-19-02 is located in the Area 20 Camp. This site is comprised of a surface discharge of photoprocessing chemicals.« less

  6. Knife River Indian Villages National Historic Site: Teacher's Guide.

    ERIC Educational Resources Information Center

    National Park Service (Dept. of Interior), Washington, DC. National Register of Historic Places.

    This guide provides history and social studies teachers, at all grade levels, with information and activities about the American Indians of the Northern Plains who lived in the area of the Knife River where it enters the Missouri River. Located in what is now North Dakota, this area is the Knife River Indian Villages National Historic Site. The…

  7. Remedial investigation and feasibility study Point Lonely Radar Installation, Alaska. Volume 1. Appendices a - c. Final report, January 1995-April 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1996-04-01

    This report presents the findings of Remedial Investigations and Feasibility Studies at sites located at the Point Lonely radar installation in northern Alaska. The sites were characterized based on sampling and analyses conducted during Remedial Investigation activities performed during August and September 1993.

  8. Enabling Remote Access to Fieldwork: Gaining Insight into the Pedagogic Effectiveness of "Direct" and "Remote" Field Activities

    ERIC Educational Resources Information Center

    Stokes, Alison; Collins, Trevor; Maskall, John; Lea, John; Lunt, Paul; Davies, Sarah

    2012-01-01

    This study considers the pedagogical effectiveness of remote access to fieldwork locations. Forty-one students from across the GEES disciplines (geography, earth and environmental sciences) undertook a fieldwork exercise, supported by two lecturers. Twenty students accessed the field site directly and the remainder accessed the site remotely using…

  9. Historical agriculture alters the effects of fire on understory plant beta diversity.

    PubMed

    Mattingly, W Brett; Orrock, John L; Collins, Cathy D; Brudvig, Lars A; Damschen, Ellen I; Veldman, Joseph W; Walker, Joan L

    2015-02-01

    Land-use legacies are known to shape the diversity and distribution of plant communities, but we lack an understanding of whether historical land use influences community responses to contemporary disturbances. Because human-modified landscapes often bear a history of multiple land-use activities, this contingency can challenge our understanding of land-use impacts on plant diversity. We address this contingency by evaluating how beta diversity (the spatial variability of species composition), an important component of regional biodiversity, is shaped by interactions between historical agriculture and prescribed fire, two prominent disturbances that are often coincident in terrestrial ecosystems. At three study locations spanning 450 km in the southeastern United States, we surveyed longleaf pine woodland understory plant communities across 232 remnant and post-agricultural sites with differing prescribed fire regimes. Our results demonstrate that agricultural legacies are a strong predictor of beta diversity, but the direction of this land-use effect differed among the three study locations. Further, although beta diversity increased with prescribed fire frequency at each study location, this effect was influenced by agricultural land-use history, such that positive fire effects were only documented among sites that lacked a history of agriculture at two of our three study locations. Our study not only highlights the role of historical agriculture in shaping beta diversity in a fire-maintained ecosystem but also illustrates how this effect can be contingent upon fire regime and geographic location. We suggest that interactions among historical and contemporary land-use activities may help to explain dissimilarities in plant communities among sites in human-dominated landscapes.

  10. A fast stimulability screening protocol for neuronal cultures on microelectrode arrays.

    PubMed

    Kapucu, Fikret E; Tanskanen, Jarno M A; Yuan, Yuting; Hyttinen, Jari A K

    2015-01-01

    Microelectrode arrays (MEAs) are used to study the electrical activity in brain slices and neuronal cultures. MEA experiments for the analysis of electrical stimulation responses require the tissue or culture to be prone to stimulation. For brain slices, potential stimulation sites may be directly visible in microscope, in which case the determination of stimulability at those locations is sufficient. In unstructured neuronal cultures, potential stimulation sites may not be known a priori, and spatial stimulability screening should be performed. Considering, e.g., 59 microelectrode sites, each to be stimulated several times, may result in long screening times, unacceptable with a MEA system without an integrated CO2 incubator, or in high stimulation effects on the networks. Here, we describe an implementation of a fast stimulation protocol employing pseudorandom stimulation site switching aiming at alleviating the network effects of the stimulability screening. In this paper, we show the usability of the proposed protocol by first detecting stimulable locations and subsequently apply repeated stimulation on the identified potentially stimulable locations to observe an exemplary neuronal pathway.

  11. The Idaho National Engineering Laboratory Site environmental report for calendar Year 1990

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoff, D.L.; Mitchell, R.G.; Moore, R.

    1991-06-01

    The results of the various monitoring programs for 1990 indicate that most radioactivity from the Idaho National Engineering Laboratory (INEL) operations could not be distinguished from worldwide fallout and natural radioactivity in the region surrounding the INEL Site. Although some radioactive materials were discharged during Site operations, concentrations and doses to the surrounding population were of no health consequence and were far less than State of Idaho and Federal health protection guidelines. The first section of the report summarizes Calendar Year 1990 and January 1 through April 1, 1991, INEL activities related to compliance with environmental regulations and laws. Themore » balance of the report describes the surveillance program, the collection of foodstuffs at the INEL boundary and distant offsite locations, and the collection of air and water samples at onsite locations and offsite boundary and distant locations. The report also compares and evaluates the sample results and discusses implications, if any. Nonradioactive and radioactive effluent monitoring at the Site, and the US Geological Survey (USGS) ground-water monitoring program are also summarized. 33 refs., 18 figs., 29 tabs.« less

  12. Adaption of the Magnetometer Towed Array geophysical system to meet Department of Energy needs for hazardous waste site characterization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cochran, J.R.; McDonald, J.R.; Russell, R.J.

    1995-10-01

    This report documents US Department of Energy (DOE)-funded activities that have adapted the US Navy`s Surface Towed Ordnance Locator System (STOLS) to meet DOE needs for a ``... better, faster, safer and cheaper ...`` system for characterizing inactive hazardous waste sites. These activities were undertaken by Sandia National Laboratories (Sandia), the Naval Research Laboratory, Geo-Centers Inc., New Mexico State University and others under the title of the Magnetometer Towed Array (MTA).

  13. GIS modeling of archaeological site locations: A low-tech approach

    NASA Technical Reports Server (NTRS)

    Futato, Eugene M.

    1991-01-01

    A Geographic Information System (GIS)-type analysis of archaeological site locations using a dBase III plus program and a desk top computer is presented. A previously developed model of site locations in the Sequatchie Valley of northeastern Alabama is tested against known site locations in another large survey area there. The model fails to account for site locations in the test area. A model is developed for the test area and indicates the site locations are indeed different. Whether this is due to differences in site locations on a sub-regional level, or to sample error in the original model is unknown.

  14. Analysis of the Mutations in the Active Site of the RNA-Dependent RNA Polymerase of Human Parainfluenza Virus Type 3 (HPIV3)

    PubMed Central

    Malur, Achut G.; Gupta, Neera K.; De, Bishnu P.; Banerjee, Amiya K.

    2002-01-01

    The large protein (L) of the human parainfluenza virus type 3 (HPIV3) is the functional RNA-dependent RNA polymerase, which possesses highly conserved residues QGDNQ located within motif C of domain III comprising the putative polymerase active site. We have characterized the role of the QGDNQ residues as well as the residues flanking this region in the polymerase activity of the L protein by site-directed mutagenesis and examining the polymerase activity of the wild-type and mutant L proteins by an in vivo minigenome replication assay and an in vitro mRNA transcription assay. All mutations in the QGDNQ residues abolished transcription while mutations in the flanking residues gave rise to variable polymerase activities. These observations support the contention that the QGDNQ sequence is absolutely required for the polymerase activity of the HPIV3 RNA-dependent RNA polymerase. PMID:12064576

  15. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  16. Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    2012-10-24

    This plan incorporates U.S. Department of Energy (DOE) Office of Legacy Management (LM) standard operating procedures (SOPs) into environmental monitoring activities and will be implemented at all sites managed by LM. This document provides detailed procedures for the field sampling teams so that samples are collected in a consistent and technically defensible manner. Site-specific plans (e.g., long-term surveillance and maintenance plans, environmental monitoring plans) document background information and establish the basis for sampling and monitoring activities. Information will be included in site-specific tabbed sections to this plan, which identify sample locations, sample frequencies, types of samples, field measurements, and associatedmore » analytes for each site. Additionally, within each tabbed section, program directives will be included, when developed, to establish additional site-specific requirements to modify or clarify requirements in this plan as they apply to the corresponding site. A flowchart detailing project tasks required to accomplish routine sampling is displayed in Figure 1. LM environmental procedures are contained in the Environmental Procedures Catalog (LMS/PRO/S04325), which incorporates American Society for Testing and Materials (ASTM), DOE, and U.S. Environmental Protection Agency (EPA) guidance. Specific procedures used for groundwater and surface water monitoring are included in Appendix A. If other environmental media are monitored, SOPs used for air, soil/sediment, and biota monitoring can be found in the site-specific tabbed sections in Appendix D or in site-specific documents. The procedures in the Environmental Procedures Catalog are intended as general guidance and require additional detail from planning documents in order to be complete; the following sections fulfill that function and specify additional procedural requirements to form SOPs. Routine revision of this Sampling and Analysis Plan will be conducted annually at the beginning of each fiscal year when attachments in Appendix D, including program directives and sampling location/analytical tables, will be reviewed by project personnel and updated. The sampling location/analytical tables in Appendix D, however, may have interim updates according to project direction that are not reflected in this plan. Deviations from location/analytical tables in Appendix D prior to sampling will be documented in project correspondence (e.g., startup letters). If significant changes to other aspects of this plan are required before the annual update, then the plan will be revised as needed.« less

  17. Radionuclide Concentrations in Terrestrial Vegetation and Soil Samples On and Around the Hanford Site, 1971 Through 2008

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simmons, Mary Ann; Poston, Ted M.; Fritz, Brad G.

    2011-07-29

    Environmental monitoring is conducted on the U.S. Department of Energy (DOE) Hanford Site to comply with DOE Orders and federal and state regulations. Major objectives of the monitoring are to characterize contaminant levels in the environment and to determine site contributions to the contaminant inventory. This report focuses on surface soil and perennial vegetation samples collected between 1971 and 2008 as part of the Pacific Northwest National Laboratory Surface Environmental Surveillance Project performed under contract to DOE. Areas sampled under this program are located on the Hanford Site but outside facility boundaries and on public lands surrounding the Hanford Site.more » Additional samples were collected during the past 8 years under DOE projects that evaluated parcels of land for radiological release. These data were included because the same sampling methodology and analytical laboratory were used for the projects. The spatial and temporal trends of six radionuclides collected over a 38-year period were evaluated. The radionuclides----cobalt-60, cesium-137, strontium-90, plutonium-238, plutonium-239/240, and uranium (reported either as uranium-238 or total uranium)----were selected because they persist in the environment and are still being monitored routinely and reported in Hanford Site environmental reports. All these radionuclides were associated with plutonium production and waste management of activities occurring on the site. Other sources include fallout from atmospheric testing of nuclear weapons, which ended in 1980, and the Chernobyl explosion in 1986. Uranium is also a natural component of the soil. This assessment of soil and vegetation data provides important information on the distribution of radionuclides in areas adjacent to industrial areas, established perimeter locations and buffer areas, and more offsite nearby and distant locations. The concentrations reflect a tendency for detection of some radionuclides close to where they were utilized onsite, but as one moves to unindustrialized areas on the site, surrounding buffer areas and perimeter location into the more distant sites, concentrations of these radionuclides approach background and cannot be distinguished from fallout activity. More importantly, concentrations in soil and vegetation samples did not exceed environmental benchmark concentrations, and associated exposure to human and ecological receptors were well below levels that are demonstratively hazardous to human health and the environment.« less

  18. Corrective Action Investigation Plan for Corrective Action Unit 410: Waste Disposal Trenches, Tonopah Test Range, Nevada, Revision 0 (includes ROTCs 1, 2, and 3)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NNSA /NV

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit (CAU) 410 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 410 is located on the Tonopah Test Range (TTR), which is included in the Nevada Test and Training Range (formerly the Nellis Air Force Range) approximately 140 miles northwest of Las Vegas, Nevada. This CAU is comprised of five Corrective Action Sites (CASs): TA-19-002-TAB2, Debris Mound; TA-21-003-TANL, Disposal Trench; TA-21-002-TAAL,more » Disposal Trench; 09-21-001-TA09, Disposal Trenches; 03-19-001, Waste Disposal Site. This CAU is being investigated because contaminants may be present in concentrations that could potentially pose a threat to human health and/or the environment, and waste may have been disposed of with out appropriate controls. Four out of five of these CASs are the result of weapons testing and disposal activities at the TTR, and they are grouped together for site closure based on the similarity of the sites (waste disposal sites and trenches). The fifth CAS, CAS 03-19-001, is a hydrocarbon spill related to activities in the area. This site is grouped with this CAU because of the location (TTR). Based on historical documentation and process know-ledge, vertical and lateral migration routes are possible for all CASs. Migration of contaminants may have occurred through transport by infiltration of precipitation through surface soil which serves as a driving force for downward migration of contaminants. Land-use scenarios limit future use of these CASs to industrial activities. The suspected contaminants of potential concern which have been identified are volatile organic compounds; semivolatile organic compounds; high explosives; radiological constituents including depleted uranium, beryllium, total petroleum hydrocarbons; and total Resource Conservation and Recovery Act metals. Field activities will consist of geophysical and radiological surveys, and collecting soil samples at biased locations by appropriate methods. A two-step data quality objective strategy will be followed: (1) define the nature of contamination at each CAS location by identifying any contamination above preliminary action levels (PALs); and, (2) determine the extent of contamination identified above PALs. The results of this field investigation will support a defensible evaluation of corrective action alternatives in the corrective action decision document.« less

  19. Seasonal and spatial variation in reactive oxygen species activity of quasi-ultrafine particles (PM0.25) in the Los Angeles metropolitan area and its association with chemical composition

    NASA Astrophysics Data System (ADS)

    Saffari, Arian; Daher, Nancy; Shafer, Martin M.; Schauer, James J.; Sioutas, Constantinos

    2013-11-01

    Seasonal and spatial variation in redox activity of quasi-ultrafine particles (PM0.25) and its association with chemical species was investigated at 9 distinct sampling sites across the Los Angeles metropolitan area. Biologically reactive oxygen species (ROS) assay (generation of ROS in rat alveolar macrophage cells) was employed in order to assess the redox activity of PM0.25 samples. Seasonally, fall and summer displayed higher volume-based ROS activity (i.e. ROS activity per unit volume of air) compared to spring and winter. ROS levels were generally higher at near source and urban background sites compared to rural receptor locations, except for summer when comparable ROS activity was observed at the rural receptor sites. Univariate linear regression analysis indicated association (R > 0.7) between ROS activity and organic carbon (OC), water soluble organic carbon (WSOC) and water soluble transition metals (including Fe, V, Cr, Cd, Ni, Zn, Mn, Pb and Cu). A multivariate regression method was also used to obtain a model to predict the ROS activity of PM0.25, based on its water-soluble components. The most important species associated with ROS were Cu and La at the source site of Long Beach, and Fe and V at urban Los Angeles sites. These metals are tracers of road dust enriched with vehicular emissions (Fe and Cu) and residual oil combustion (V and La). At Riverside, a rural receptor location, WSOC and Ni (tracers of secondary organic aerosol and metal plating, respectively) were the dominant species driving the ROS activity. At Long Beach, the multivariate model was able to reconstruct the ROS activity with a high coefficient of determination (R2 = 0.82). For Los Angeles and Riverside, however, the regression models could only explain 63% and 68% of the ROS activity, respectively. The unexplained portion of the measured ROS activity is likely attributed to the nature of organic species not captured in the organic carbon (OC) measurement as well as non-linear effects, which were not included in our linear model.

  20. Engineering assessment of low-level liquid waste disposal caisson locations at the 618-11 Burial Grounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Phillips, S.J.; Fischer, D.D.; Crawford, R.C.

    1982-06-01

    Rockwell Hanford Operations is currently involved in an extensive effort to perform interim ground surface stabilization activities at retired low-level waste burial grounds located at the Hanford Site, Richland, Washington. The principal objective of these activities is to promote increased occupational and radiological safety at burial grounds. Interim stabilization activities include: (1) load testing (traversing burial ground surfaces with heavy equipment to promote incipient collapse of void spaces within the disposal structure and overburden), (2) barrier placement (placement of a {ge} 0.6 m soil barrier over existing overburden), and (3) revegetation (establishment of shallow rooted vegetation on the barrier tomore » mitigate deep rooted plant growth and to reduce erosion). Low-level waste disposal caissons were used in 300 Area Burial Grounds as internment structures for containerized liquid wastes. These caissons, by virtue of their contents, design and methods of closure, require long-term performance evaluation. As an initial activity to evaluate long-term performance, the accurate location of these structures is required. This topical report summarizes engineering activities used to locate caissons in the subsurface environment at the Burial Ground. Activities were conducted to locate caissons during surface stabilization activities. The surface locations were marked, photographed, and recorded on an as built engineering drawing. The recorded location of these caissons will augment long-term observations of confinement structure and engineered surface barrier performance. In addition, accurate caisson location will minimize occupational risk during monitoring and observation activities periodically conducted at the burial ground.« less

  1. Letter Report to Address Comments on the Closure Report for Corrective Action Unit 224: Decon Pad and Septic Systems, Nevada Test Site, Nevada, Revision 0, March 2008

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NSTec Environmental Restoration

    2008-03-17

    The Closure Report (CR) for Corrective Action Unit (CAU) 224, Decon Pad and Septic Systems, was approved by the Nevada Department of Environmental Protection (NDEP) on November 01, 2007. The approval letter contained the following two comments: Comment 1--For 06-05-01, 06-17-04, 06-23-01 provide evidence that the 6 inch VCP pipe originating from building CP-2 is no longer active and sealed to prevent possible future contamination. Comment 2--For the area that includes 06-03-01, provide evidence that active lines are no longer feeding the North and South lagoons and have been sealed to prevent possible future contamination. To address these comments, closuremore » documentation was reviewed, and site visits were conducted to locate and document the areas of concern. Additional fieldwork was conducted in March 2008 to seal the lines and openings described in the two comments. Photographs were taken of the closed drains and lines to document that the NDEP comments were adequately addressed and potential inadvertent discharge to the environment has been eliminated. Investigation and closure documentation was reviewed to identify the locations of potential drains, lines, and other features that could receive and/or transmit liquid. Based on the investigation findings and subsequent closure activities, no openings, distribution boxes, or other features (excluding known floor drains at CP-2) that could receive liquid were found at the CP-2 location (Figure 1), and potential manholes for the north and south sewage lagoons were identified for Corrective Action Site (CAS) 06-03-01 (Figure 2). The distribution box identified in Figure 1 was not located during the investigation and was assumed to have been previously removed.« less

  2. Retrospective dose assessment for the population living in areas of local fallout from the Semipalatinsk Nuclear Test Site Part II: Internal exposure to thyroid.

    PubMed

    Gordeev, Konstantin; Shinkarev, Sergey; Ilyin, Leonid; Bouville, André; Hoshi, Masaharu; Luckyanov, Nickolas; Simon, Steven L

    2006-02-01

    A methodology to assess internal exposure to thyroid from radioiodines for the residents living in settlements located in the vicinity of the Semipalatinsk Nuclear Test Site is described that is the result of many years of research, primarily at the Moscow Institute of Biophysics. This methodology introduces two important concepts. First, the biologically active fraction, is defined as the fraction of the total activity on fallout particles with diameter less than 50 microns. That fraction is retained by vegetation and will ultimately result in contamination of dairy products. Second, the relative distance is derived as a dimensionless quantity from information on test yield, maximum height of cloud, and average wind velocity and describes how the biologically active fraction is distributed with distance from the site of the explosion. The parameter is derived in such a way that at locations with equal values of relative distance, the biologically active fraction will be the same for any test. The estimates of internal exposure to thyroid for the residents of Dolon and Kanonerka villages, for which the external exposure were assessed and given in a companion paper (Gordeev et al. 2006) in this conference, are presented. The main sources of uncertainty in the estimates are identified.

  3. Monitoring the Presence of 13 Active Compounds in Surface Water Collected from Rural Areas in Northwestern Spain

    PubMed Central

    Iglesias, Alejandra; Nebot, Carolina; Vázquez, Beatriz I.; Coronel-Olivares, Claudia; Franco Abuín, Carlos M.; Cepeda, Alberto

    2014-01-01

    Drug residues are considered environmental contaminants, and their occurrence has recently become a matter of concern. Analytical methods and monitoring systems are therefore required to control the continuous input of these drug residues into the environment. This article presents a suitable HPLC-ESI-MS/MS method for the simultaneous extraction, detection and quantification of residues of 13 drugs (antimicrobials, glucocorticosteroids, anti-inflammatories, anti-hypertensives, anti-cancer drugs and triphenylmethane dyes) in surface water. A monitoring study with 549 water samples was carried out in northwestern Spain to detect the presence of drug residues over two sampling periods during 2010, 2011 and 2012. Samples were collected from rural areas with and without farming activity and from urban areas. The 13 analytes were detected, and 18% of the samples collected showed positive results for the presence of at least one analyte. More collection sites were located in rural areas than in urban areas. However, more positive samples with higher concentrations and a larger number of analytes were detected in samples collected from sites located after the discharge of a WWTP. Results indicated that the WWTPs seems to act as a concentration point. Positive samples were also detected at a site located near a drinking water treatment plant. PMID:24837665

  4. Monitoring the presence of 13 active compounds in surface water collected from rural areas in northwestern Spain.

    PubMed

    Iglesias, Alejandra; Nebot, Carolina; Vázquez, Beatriz I; Coronel-Olivares, Claudia; Abuín, Carlos M Franco; Cepeda, Alberto

    2014-05-15

    Drug residues are considered environmental contaminants, and their occurrence has recently become a matter of concern. Analytical methods and monitoring systems are therefore required to control the continuous input of these drug residues into the environment. This article presents a suitable HPLC-ESI-MS/MS method for the simultaneous extraction, detection and quantification of residues of 13 drugs (antimicrobials, glucocorticosteroids, anti-inflammatories, anti-hypertensives, anti-cancer drugs and triphenylmethane dyes) in surface water. A monitoring study with 549 water samples was carried out in northwestern Spain to detect the presence of drug residues over two sampling periods during 2010, 2011 and 2012. Samples were collected from rural areas with and without farming activity and from urban areas. The 13 analytes were detected, and 18% of the samples collected showed positive results for the presence of at least one analyte. More collection sites were located in rural areas than in urban areas. However, more positive samples with higher concentrations and a larger number of analytes were detected in samples collected from sites located after the discharge of a WWTP. Results indicated that the WWTPs seems to act as a concentration point. Positive samples were also detected at a site located near a drinking water treatment plant.

  5. A remote palm domain residue of RB69 DNA polymerase is critical for enzyme activity and influences the conformation of the active site.

    PubMed

    Jacewicz, Agata; Trzemecka, Anna; Guja, Kip E; Plochocka, Danuta; Yakubovskaya, Elena; Bebenek, Anna; Garcia-Diaz, Miguel

    2013-01-01

    Non-conserved amino acids that are far removed from the active site can sometimes have an unexpected effect on enzyme catalysis. We have investigated the effects of alanine replacement of residues distant from the active site of the replicative RB69 DNA polymerase, and identified a substitution in a weakly conserved palm residue (D714A), that renders the enzyme incapable of sustaining phage replication in vivo. D714, located several angstroms away from the active site, does not contact the DNA or the incoming dNTP, and our apoenzyme and ternary crystal structures of the Pol(D714A) mutant demonstrate that D714A does not affect the overall structure of the protein. The structures reveal a conformational change of several amino acid side chains, which cascade out from the site of the substitution towards the catalytic center, substantially perturbing the geometry of the active site. Consistent with these structural observations, the mutant has a significantly reduced k pol for correct incorporation. We propose that the observed structural changes underlie the severe polymerization defect and thus D714 is a remote, non-catalytic residue that is nevertheless critical for maintaining an optimal active site conformation. This represents a striking example of an action-at-a-distance interaction.

  6. Metastatic site location influences the diagnostic accuracy of ctDNA EGFR- mutation testing in NSCLC patients: a pooled analysis.

    PubMed

    Passiglia, Francesco; Rizzo, Sergio; Rolfo, Christian; Galvano, Antonio; Bronte, Enrico; Incorvaia, Lorena; Listi, Angela; Barraco, Nadia; Castiglia, Marta; Calo, Valentina; Bazan, Viviana; Russo, Antonio

    2018-03-08

    Recent studies evaluated the diagnostic accuracy of circulating tumor DNA (ctDNA) in the detection of epidermal growth factor receptor (EGFR) mutations from plasma of NSCLC patients, overall showing a high concordance as compared to standard tissue genotyping. However it is less clear if the location of metastatic site may influence the ability to identify EGFR mutations in plasma. This pooled analysis aims to evaluate the association between the metastatic site location and the sensitivity of ctDNA analysis in detecting EGFR mutations in NSCLC patients. Data from all published studies, evaluating the sensitivity of plasma-based EGFR-mutation testing, stratified by metastatic site location (extrathoracic (M1b) vs intrathoracic (M1a)) were collected by searching in PubMed, Cochrane Library, American Society of Clinical Oncology, and World Conference of Lung Cancer, meeting proceedings. Pooled Odds ratio (OR) and 95% confidence intervals (95% CIs) were calculated for the ctDNA analysis sensitivity, according to metastatic site location. A total of ten studies, with 1425 patients, were eligible. Pooled analysis showed that the sensitivity of ctDNA-based EGFR-mutation testing is significantly higher in patients with M1b vs M1a disease (OR: 5.09; 95% CIs: 2.93 - 8.84). A significant association was observed for both EGFR-activating (OR: 4.30, 95% CI: 2.35-7.88) and resistant T790M mutations (OR: 11.89, 95% CI: 1.45-97.22), regardless of the use of digital-PCR (OR: 5.85, 95% CI: 3.56-9.60) or non-digital PCR technologies (OR: 2.96, 95% CI: 2.24-3.91). These data suggest that the location of metastatic sites significantly influences the diagnostic accuracy of ctDNA analysis in detecting EGFR mutations in NSCLC patients. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. Atmospheric Science Research at the Whiteface Mountain Adirondack High Peaks Observatory

    NASA Astrophysics Data System (ADS)

    Schwab, J. J.; Brandt, R. E.; Casson, P.; Demerjian, K. L.; Crandall, B. A.

    2014-12-01

    The Atmospheric Sciences Research Center established an atmospheric observatory at Whiteface Mountain in the Adirondacks in 1961. The current mountain top observatory building was built by the University at Albany in 1969-70 and the New York State Department of Environmental Conservation (DEC) began ozone measurements at this summit location in 1973. Those measurements continue to this day and constitute a valuable long term data record for tropospheric ozone in the northeastern U.S. The elevation of the summit is 1483 m above sea level, and is roughly 90 m above the tree line in this location. With a mean cloud base height of less than 1100 m at the summit, it is a prime location for cloud research. The research station headquarters, laboratories, offices, and a second measurement site are located at the Marble Mountain Lodge, perched on a shoulder northeast of the massif at an elevation of 604 m above sea level. Parameters measured at the site include meteorological variables, trace gases, precipitation chemistry, aerosol mass and components, and more. Precipitation and cloud chemistry has a long history at the lodge and summit locations, respectively, and continues to this day. Some data from the 40-year record will be shown in the presentation. In the late 1980's the summit site was outfitted with instrumentation to measure oxides of nitrogen and other ozone precursors. Measurements of many of these same parameters were added at the lodge site and continue to this day. In this poster we will give an overview of the Whiteface Mountain Observatory and its two measurement locations. We will highlight the parameters currently being measured at our sites, and indicate those measured by ASRC, as well as those measured by other organizations. We will also recap some of the historical activities and measurement programs that have taken place at the site, as alluded to above. Also included will be examples of the rich archive of trends data for gas phase species, precipitation chemistry, and particulate matter.

  8. Measuring Air Quality in a Construction Site Biotope Using the AQM-65 Analyser

    NASA Astrophysics Data System (ADS)

    Ioana-Alina, Creţan; Nicoleta, Nemeș

    2017-10-01

    Activities related to the execution of construction works often exert pressure on the quality of environmental factors in adjacent habitat. In various stages of realization of the works if is the opening of the building site and access roads, borrow pits and the storage, or the construction itself, all the related activities will cause harm in various degrees of vegetation on the construction site and its surroundings. Large areas are rendered non-productive and, although they should be restored for use in the same place or elsewhere, sometimes they can lose their natural habitat baseline. The paper is presenting a case study of air quality monitoring using the AQM 65 analyser for a construction site located near Timisoara locality, Timis County, Romania.

  9. A Strategy to Conduct an Analysis of the Long-Term Performance of Low-Activity Waste Glass in a Shallow Subsurface Disposal System at Hanford

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Neeway, James J.; Pierce, Eric M.; Freedman, Vicky L.

    2014-08-04

    The federal facilities located on the Hanford Site in southeastern Washington State have been used extensively by the U.S. government to produce nuclear materials for the U.S. strategic defense arsenal. Currently, the Hanford Site is under the stewardship of the U.S. Department of Energy (DOE) Office of Environmental Management (EM). A large inventory of radioactive and mixed waste resulting from the production of nuclear materials has accumulated, mainly in 177 underground single- and double-shell tanks located in the central plateau of the Hanford Site (Mann et al., 2001). The DOE-EM Office of River Protection (ORP) is proceeding with plans tomore » immobilize and permanently dispose of the low-activity waste (LAW) fraction onsite in a shallow subsurface disposal facility (the Integrated Disposal Facility [IDF]). Pacific Northwest National Laboratory (PNNL) was contracted to provide the technical basis for estimating radionuclide release from the engineered portion of the IDF (the source term) as part of an immobilized low-activity waste (ILAW) glass testing program to support future IDF performance assessments (PAs).« less

  10. Preparation and Preliminary Characterization of Crystallizing Fluorescent Derivatives of Chicken Egg White Lysozyme

    NASA Technical Reports Server (NTRS)

    Sumida, John; Forsythe, Elizabeth L.; Pusey, Marc L.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    Fluorescence is one of the most versatile and powerful tools for the study of macromolecules. While most proteins are intrinsically fluorescent, working at crystallization concentrations require the use of covalently prepared derivatives added as tracers. This approach requires derivatives that do not markedly affect the crystal packing. We have prepared fluorescent derivatives of chicken egg white lysozyme with probes bound to one of two different sites on the protein molecule. Lucifer yellow and 5-(2-aminoethyl)aminonapthalene-1-sulfonic acid (EDANS) have been attached to the side chain carboxyl of Asp(sup 101) using a carbodiimide coupling procedure. Asp(sup 101) lies within the active site cleft, and it is believed that the probes are "buried" within that cleft. Lucifer yellow and MANS probes with iodoacetamide reactive groups have been bound to His(sup 15), located on the "back side" of the molecule relative to the active site. All the derivatives fluoresce in the solution and the crystalline states. Fluorescence characterization has focused on determination of binding effects on the probe quantum yield, lifetime, absorption and emission spectra, and quenching by added solutes. Quenching studies show that, as postulated, the Asp(sup 101)-bound probes are partially sheltered from the bulk solution by their location within the active site cleft. Probes bound to His(sup 15) have quenching constants about equal to those for the free probes, indicating that this site is highly exposed to the bulk solution.

  11. Preparation and Preliminary Characterization of Crystallizing Fluorescent Derivatives of Chicken Egg White Lysozyme

    NASA Technical Reports Server (NTRS)

    Sumida, John P.; Forsythe, Elizabeth L.; Pusey, Marc L.

    2001-01-01

    Fluorescence is one of the most versatile and powerful tools for the study of macromolecules. While most proteins are intrinsically fluorescent, working at crystallization concentrations require the use of covalently prepared derivatives added as tracers. This approach requires derivatives that do not markedly affect the crystal packing. We have prepared fluorescent derivatives of chicken egg white lysozyme with probes bound to one of two different sites on the protein molecule. Lucifer yellow and 5-(2-aminoethyl)aminonapthalene-i-sulfonic acid (EDANS) have been attached to the side chain carboxyl of Asp(sup 101) using a carbodiimide coupling procedure. Asp(sup 101) lies within the active site cleft, and it is believed that the probes are 'buried' within that cleft. Lucifer yellow and MANS probes with iodoacetamide reactive five groups have been bound to His(sup 15), located on the 'back side' of the molecule relative to the active site. All the derivatives fluoresce in the solution and the crystalline states. Fluorescence characterization has focused on determination of binding effects on the probe quantum yield, lifetime, absorption and emission spectra, and quenching by added solutes. Quenching studies show that, as postulated, the Asp(sup 101)-bound probes are partially sheltered from the bulk solution by their location within the active site cleft. Probes bound to His(sup 15) have quenching constants about equal to those for the free probes, indicating that this site is highly exposed to the bulk solution.

  12. Long-range electrostatics-induced two-proton transfer captured by neutron crystallography in an enzyme catalytic site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gerlits, Oksana; Wymore, Troy; Das, Amit

    Neutron crystallography was used to directly locate two protons before and after a pH-induced two-proton transfer between catalytic aspartic acid residues and the hydroxy group of the bound clinical drug darunavir, located in the catalytic site of enzyme HIV-1 protease. The two-proton transfer is triggered by electrostatic effects arising from protonation state changes of surface residues far from the active site. The mechanism and pH effect are supported by quantum mechanics/molecular mechanics (QM/MM) calculations. The low-pH proton configuration in the catalytic site is deemed critical for the catalytic action of this enzyme and may apply more generally to other asparticmore » proteases. Neutrons therefore represent a superb probe to obtain structural details for proton transfer reactions in biological systems at a truly atomic level.« less

  13. Long-range electrostatics-induced two-proton transfer captured by neutron crystallography in an enzyme catalytic site

    DOE PAGES

    Gerlits, Oksana; Wymore, Troy; Das, Amit; ...

    2016-03-09

    Neutron crystallography was used to directly locate two protons before and after a pH-induced two-proton transfer between catalytic aspartic acid residues and the hydroxy group of the bound clinical drug darunavir, located in the catalytic site of enzyme HIV-1 protease. The two-proton transfer is triggered by electrostatic effects arising from protonation state changes of surface residues far from the active site. The mechanism and pH effect are supported by quantum mechanics/molecular mechanics (QM/MM) calculations. The low-pH proton configuration in the catalytic site is deemed critical for the catalytic action of this enzyme and may apply more generally to other asparticmore » proteases. Neutrons therefore represent a superb probe to obtain structural details for proton transfer reactions in biological systems at a truly atomic level.« less

  14. Long-Range Electrostatics-Induced Two-Proton Transfer Captured by Neutron Crystallography in an Enzyme Catalytic Site.

    PubMed

    Gerlits, Oksana; Wymore, Troy; Das, Amit; Shen, Chen-Hsiang; Parks, Jerry M; Smith, Jeremy C; Weiss, Kevin L; Keen, David A; Blakeley, Matthew P; Louis, John M; Langan, Paul; Weber, Irene T; Kovalevsky, Andrey

    2016-04-11

    Neutron crystallography was used to directly locate two protons before and after a pH-induced two-proton transfer between catalytic aspartic acid residues and the hydroxy group of the bound clinical drug darunavir, located in the catalytic site of enzyme HIV-1 protease. The two-proton transfer is triggered by electrostatic effects arising from protonation state changes of surface residues far from the active site. The mechanism and pH effect are supported by quantum mechanics/molecular mechanics (QM/MM) calculations. The low-pH proton configuration in the catalytic site is deemed critical for the catalytic action of this enzyme and may apply more generally to other aspartic proteases. Neutrons therefore represent a superb probe to obtain structural details for proton transfer reactions in biological systems at a truly atomic level. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. The dynamics of camphor in the cytochrome P450 CYP101D2

    PubMed Central

    Vohra, Shabana; Musgaard, Maria; Bell, Stephen G; Wong, Luet-Lok; Zhou, Weihong; Biggin, Philip C

    2013-01-01

    The recent crystal structures of CYP101D2, a cytochrome P450 protein from the oligotrophic bacterium Novosphingobium aromaticivorans DSM12444 revealed that both the native (substrate-free) and camphor-soaked forms have open conformations. Furthermore, two other potential camphor-binding sites were also identified from electron densities in the camphor-soaked structure, one being located in the access channel and the other in a cavity on the surface near the F-helix side of the F-G loop termed the substrate recognition site. These latter sites may be key intermediate positions on the pathway for substrate access to or product egress from the active site. Here, we show via the use of unbiased atomistic molecular dynamics simulations that despite the open conformation of the native and camphor-bound crystal structures, the underlying dynamics of CYP101D2 appear to be very similar to other CYP proteins. Simulations of the native structure demonstrated that the protein is capable of sampling many different conformational substates. At the same time, simulations with the camphor positioned at various locations within the access channel or recognition site show that movement towards the active site or towards bulk solvent can readily occur on a short timescale, thus confirming many previously reported in silico studies using steered molecular dynamics. The simulations also demonstrate how the fluctuations of an aromatic gate appear to control access to the active site. Finally, comparison of camphor-bound simulations with the native simulations suggests that the fluctuations can be of similar level and thus are more representative of the conformational selection model rather than induced fit. PMID:23832606

  16. Urban Environmental Excursions: Designing field trips to demonstrate sustainable connections between natural and engineered systems in urban environments

    NASA Astrophysics Data System (ADS)

    Lemke, L. D.

    2012-12-01

    Field trips are a proven and effective instructional tool to connect students with the world around them. In most communities, opportunities abound to allow students to make connections between concepts introduced in classroom or lab activities and the urban environment that surrounds them. Potential destinations include solid and liquid waste disposal sites, brownfield redevelopment sites, hazardous waste sites, industrial complexes, or sites with ongoing environmental restoration efforts. Each of these locations presents opportunities to explore sustainable aspects of anthropogenic activities in relation to the natural systems that they seek to modify or exploit. Early planning is essential, however, because it can sometimes take several months lead time to arrange for a large group tour of industrial or municipal sites. Several practices may be employed to design effective learning experiences for students when visiting such sites. These include: 1) choose local sites to keep trips relevant and practical; 2) balance sites of environmental concern with those where significant progress is being made in environmental restoration or stewardship; 3) connect sites with a pertinent theme (e.g., air quality, water quality, economic development, environmental justice, etc.); 4) develop a sense of location among student participants by providing a map showing the relationship between campus and the field sites; 5) prepare a guidebook containing one-page descriptions of each stop along with a list of questions to stimulate discussion and promote active engagement among all participants; 6) employ expert guides to maximize students' access to authoritative information; 7) tie each field experience to your curriculum; and 8) model active learning by asking genuine questions and engaging in open discussions with experts and student participants. In this presentation, urban field trip design will be illustrated with examples from trips run in conjunction with freshman-level introductory courses in Physical and Environmental Geology, as well as a junior-level course in Environmental Systems Analysis at Wayne State University in Detroit, Michigan, USA. Ties to environmental systems and sustainability, emphasizing systems boundaries, fluxes, and transformations of systems components, will be described along with logistical tips to help instructors prepare meaningful and memorable field trips.

  17. Fort Devens Feasibility Study (FS) for Group 1A Sites, Final Data Gap Activities Work Plan

    DTIC Science & Technology

    1993-03-01

    3-6 3.1.7 Railroad Roundhouse ......................... 3-7 3.2 COLD SPRING BROOK LANDFILL BACKGROUND AND U CONDITIONS...wells SHL-3 and SHL-7) is the site of a former railroad roundhouse . This roundhouse was used between 1900 and 1935. Because of the age of the... Roundhouse 5 Environmental samples will be collected at four locations at the site of the former railroad roundhouse adjacent to Shepley’s Hill

  18. A sediment mesocosm experiment to determine if the remediation of a shoreline waste disposal site in Antarctica caused further environmental impacts.

    PubMed

    Stark, Jonathan S; Johnstone, Glenn J; Riddle, Martin J

    2014-12-15

    A shoreline waste disposal site at Casey Station, Antarctica was removed because it was causing impacts in the adjacent marine environment (Brown Bay). We conducted a field experiment to determine whether the excavation created further impacts. Trays of clean, defaunated sediment were deployed at two locations within Brown Bay and two control locations, two years prior to remediation. Trays were sampled one year before, 1month before, 1month after and two years after the excavation. An increase in metals was found at Brown Bay two years after the remediation. However there was little evidence of impacts on sediment assemblages. Communities at each location were different, but differences from before to after the remediation were comparable, indicating there were unlikely to have been further impacts. We demonstrate that abandoned waste disposal sites in hydrologically active places in Antarctica can be removed without creating greater adverse impacts to ecosystems downstream. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  19. Superfund Record of Decision (EPA Region 2): Helen Kramer Landfill, Mantua Township, New Jersey, September 1985. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1985-09-27

    The Helen Kramer Landfill is located in Mantua Township, Gloucester County, New Jersey. The site encompasses a 66-acre refuse area and an 11-acre stressed area between the refuse and Edwards Run which is located immediately east of the landfill. The Helen Kramer Landfill site was originally operated as a sand and gravel pit. The site became an operating landfill between 1963 and 1965, during which time landfilling occurred simultaneously with sand excavation. In 1963, large volumes of wastes were deposited just north of the south ravine. Ponds of standing liquid were also located around the north ravine. Between 1963 andmore » 1965, the fill was extended into the south ravine, and the north ravine was filled and graded. Very little is known about the landfill activities between 1965 and 1970. Throughout 1970 to 1981 it was alleged by area residents that sporadic chemical dumping continued.« less

  20. Survey of ecological resources at selected US Department of Energy sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McAllister, C.; Beckert, H.; Abrams, C.

    The U.S. Department of Energy (DOE) owns and manages a wide range of ecological resources. During the next 30 years, DOE Headquarters and Field Offices will make land-use planning decisions and conduct environmental remediation and restoration activities in response to federal and state statutes. This document fulfills, in part, DOE`s need to know what types of ecological resources it currently owns and manages by synthesizing information on the types and locations of ecological resources at 10 DOE sites: Hanford Site, Idaho National Engineering Laboratory, Lawrence Livermore National Laboratory, Sandia National Laboratory, Rocky Flats Plant, Los Alamos National Laboratory, savannah Rivermore » Site, Oak Ridge National Laboratory, Argonne National Laboratory, and Fernald Environmental Management Project. This report summarizes information on ecosystems, habitats, and federally listed threatened, endangered, and candidate species that could be stressed by contaminants or physical activity during the restoration process, or by the natural or anthropogenic transport of contaminants from presently contaminated areas into presently uncontaminated areas. This report also provides summary information on the ecosystems, habitats, and threatened and endangered species that exist on each of the 10 sites. Each site chapter contains a general description of the site, including information on size, location, history, geology, hydrology, and climate. Descriptions of the major vegetation and animal communities and of aquatic resources are also provided, with discussions of the treatened or endangered plant or animal species present. Site-specific ecological issues are also discussed in each site chapter. 106 refs., 11 figs., 1 tab.« less

  1. 77 FR 46376 - Foreign-Trade Zone 43-Battle Creek, MI; Application for Reorganization Under Alternative Site...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-03

    ... ``usage-driven'' FTZ sites for operators/users located within a grantee's ``service area'' in the context of the Board's standard 2,000-acre activation limit for a general-purpose zone project. The application was submitted pursuant to the Foreign-Trade Zones Act, as amended (19 U.S.C. 81a-81u), and the...

  2. 78 FR 33811 - Takes of Marine Mammals Incidental to Specified Activities; Low-Energy Marine Geophysical Survey...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-05

    ... . NMFS is not responsible for email comments sent to addresses other than the one provided here. Comments... (Philippines) during September to October 2013. The SIO plans to use one source vessel, the R/V Roger REVELLE... sites in the tropical western Pacific Ocean in September to October 2013. The study sites are located...

  3. 78 FR 77433 - Takes of Marine Mammals Incidental to Specified Activities; Taking Marine Mammals Incidental to...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-23

    ... in all cases every possible measure will be taken to select a pathway of approach to study sites that... in the study plots or while biologists walk from one location to another. No motorized equipment is... found at any one of PISCO's study sites is variable, and often no California sea lions are observed...

  4. Cultural Resources Review for Closure of the nonradioactive Dangerous Waste Landfill and Solid Waste Landfill in the 600 Area, Hanford Site, Benton County, Washington, HCRC# 2010-600-018R

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gutzeit, Jennifer L.; Kennedy, Ellen P.; Bjornstad, Bruce N.

    2011-02-02

    The U.S. Department of Energy Richland Operations Office is proposing to close the Nonradioactive Dangerous Waste Landfill (NRDWL) and Solid Waste Landfill (SWL) located in the 600 Area of the Hanford Site. The closure of the NRDWL/SWL entails the construction of an evapotranspiration cover over the landfill. This cover would consist of a 3-foot (1-meter) engineered layer of fine-grained soil, modified with 15 percent by weight pea gravel to form an erosion-resistant topsoil that will sustain native vegetation. The area targeted for silt-loam borrow soil sits in Area C, located in the northern central portion of the Fitzner/Eberhardt Arid Landsmore » Ecology (ALE) Reserve Unit. The pea gravel used for the mixture will be obtained from both off-site commercial sources and an active gravel pit (Pit #6) located just west of the 300 Area of the Hanford Site. Materials for the cover will be transported along Army Loop Road, which runs from Beloit Avenue (near the Rattlesnake Barricade) east-northeast to the NRDWL/SWL, ending at State Route 4. Upgrades to Army Loop Road are necessary to facilitate safe bidirectional hauling traffic. This report documents a cultural resources review of the proposed activity, conducted according to Section 106 of the National Historic Preservation Act of 1966.« less

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    The Taylorville Central Illinois Public Service (CIPS) Company site is located on the south end of Taylorville, Christian County, Illinois. Past industrial activities at this site, 60-100 years ago, have resulted in subsurface soil and groundwater contamination by high levels of polynuclear aromatic hydrocarbons (PAHs) and volatile organic compounds (VOCs). Complete pathways at this site include exposure to sediments, surface water, air, and fish in the Seaman Estate Pond. The Illinois Department of Public Health (IDPH) concludes that exposure to site related contaminants to local residents does not pose a health hazard at this time.

  6. Location of Buried Mineshafts and Adits Using Reconnaissance Geophysical Methods

    NASA Astrophysics Data System (ADS)

    Culshaw, Martin; Donnelly, Laurance; McCann, David

    Britain has a long history of mining activity, which stretches back some 3000 years to the excavation of flint in East Anglia. The legacy of this long period of activity is the presence of many buried mineshafts and adits, whose location is often unknown precisely and in many cases not even recorded in historical mining records. As has been shown by Donnelly et al (2003) the discovery of a mineshaft in an area of housing development can have a profound effect on property values in its vicinity. Hence, urgent action must be taken to establish at the site investigation stage of a development to determine whether any mineshafts are present at the site so that remedial action can be taken before construction commences. A study of historical information and the drilling may well enable the developer to locate any suspected mineshafts and adits on his site. However, the use of geophysical reconnaissance methods across the whole site may well provide sufficient information to simplify the drilling programme and reduce its cost to a minimum. In this paper a number of rapid reconnaissance geophysical methods are described and evaluated in terms of their success in the location of buried mineshafts and adits. It has shown that a combination of ground conductivity and magnetic surveys provides a most effective approach on open sites in greenfield and brownfield areas. Ground penetrating radar and micro-gravity surveys have proved to be a valuable approach in urban areas where the use of many geophysical methods is prevented by the presence of various types of cultural noise. On a regional scale the infrared thermography method is being increasingly used but care must be taken to overcome certain environmental difficulties. The practical use of all these geophysical methods in the field is illustrated by a number of appropriate case histories.

  7. Closure Report for CAU No. 430: Buried Depleted Uraniuim Artillery Round No. 1, Tonopah Test Range, Revision 0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    1997-02-25

    1.1 Purpose This Closure Report presents the information obtained from investigative actions performed to justify the decision for clean closure of CAU 430 through "No Further Action." The investigative actions were performed per the Streamlined Approach for Environmental Restoration Plan, CA UNO. 430: Buried Depleted Uranium Artille~ Round No. 1, Tonopah Test Range (DOE/NV, 1996a) (hereafter referred to as the SAFER Plan). The Buried DU Artillery Round No. 1 is located approximately 1.1 kilometers (km) (0.7 mile [mi]) south of Avenue 13 in the test area south of Area 9 (Figure 1-2). The site was thought to consist of amore » potentially unexploded W-79 Joint Test Assembly (JTA) test artillery projectile with high explosives (HE) and DU. The DU was substituted for Special Nuclear Material to prevent a nuclear explosion and yet retain the physical characteristics of uranium for ballistic and other mechanical tests. The projectile was reportedly buried in one pit, approximately 5 to 10 feet (ft) deep (Smith, 1993; Smith, 1996; Quas, 1996). The exact location of the burial pit is unknown; however, three disturbed areas (Sites A, B, and C) were identified through geophysical surveys, site visits, and employee interviews as possible locations of the test projectile (Figure 1-3). Results of the investigation are summarized within this Closure Report. Additional information about the site and investigation activities may be found in the SAFER Plan (DOE/NV, 1996a). 1.2 Scope The objectives of the SAFER Plan (DOE/NV, 1996a) activities were to prepare the site for closure through locating and identi~ing the projectile (Buried DU Artillery Round No. 1), destroying the projectile and any remaining components, collecting soil samples to detect residual contamination resulting from projectile destruction, and finally, remediating residual contamination.« less

  8. Identification of a unique Ca2+-binding site in rat acid-sensing ion channel 3.

    PubMed

    Zuo, Zhicheng; Smith, Rachel N; Chen, Zhenglan; Agharkar, Amruta S; Snell, Heather D; Huang, Renqi; Liu, Jin; Gonzales, Eric B

    2018-05-25

    Acid-sensing ion channels (ASICs) evolved to sense changes in extracellular acidity with the divalent cation calcium (Ca 2+ ) as an allosteric modulator and channel blocker. The channel-blocking activity is most apparent in ASIC3, as removing Ca 2+ results in channel opening, with the site's location remaining unresolved. Here we show that a ring of rat ASIC3 (rASIC3) glutamates (Glu435), located above the channel gate, modulates proton sensitivity and contributes to the formation of the elusive Ca 2+ block site. Mutation of this residue to glycine, the equivalent residue in chicken ASIC1, diminished the rASIC3 Ca 2+ block effect. Atomistic molecular dynamic simulations corroborate the involvement of this acidic residue in forming a high-affinity Ca 2+ site atop the channel pore. Furthermore, the reported observations provide clarity for past controversies regarding ASIC channel gating. Our findings enhance understanding of ASIC gating mechanisms and provide structural and energetic insights into this unique calcium-binding site.

  9. Lessons Learned: Tribal Community Engagement, Remediation and Restoration of a Uranium Mine Tailings Site, Navajo Nation - 12484

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wadsworth, Donald K.; Hicks, Allison H.

    2012-07-01

    In May, 2011 New World Environmental Inc. was awarded a contract by the Navajo Nation Environmental Protection Agency to remediate an illegal radioactive waste disposal site located in the Navajo Nation. The initial scope included the excavation and shipment of an estimated 3,000 cubic yards of Uranium mine tailings and associated industrial waste. In this instance Stakeholders were supportive of the project, remediation and restoration, yet the movement of residual radioactive materials through tribal communities was a controversial issue. Other Stakeholder issues included site security, water sources for remediation activities, local residents' temporary re-location and care of livestock, right ofmore » way permissions and local workforce development. This presentation recaps the technical and non-technical issues encountered in the remediation and restoration the seven acre site and the outreach to surrounding communities. Cultural and equity issues resulting from historical problems associated with this and other sites in the immediate area and education and training. (authors)« less

  10. An Active Site Water Network in the Plasminogen Activator Pla from Yersinia pestis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eren, Elif; Murphy, Megan; Goguen, Jon

    2010-08-13

    The plasminogen activator Pla from Yersinia pestis is an outer membrane protease (omptin) that is important for the virulence of plague. Here, we present the high-resolution crystal structure of wild-type, enzymatically active Pla at 1.9 {angstrom}. The structure shows a water molecule located between active site residues D84 and H208, which likely corresponds to the nucleophilic water. A number of other water molecules are present in the active site, linking residues important for enzymatic activity. The R211 sidechain in loop L4 is close to the nucleophilic water and possibly involved in the stabilization of the oxyanion intermediate. Subtle conformational changesmore » of H208 result from the binding of lipopolysaccharide to the outside of the barrel, explaining the unusual dependence of omptins on lipopolysaccharide for activity. The Pla structure suggests a model for the interaction with plasminogen substrate and provides a more detailed understanding of the catalytic mechanism of omptin proteases.« less

  11. Direct measurement of the protein response to an electrostatic perturbation that mimics the catalytic cycle in ketosteroid isomerase.

    PubMed

    Jha, Santosh Kumar; Ji, Minbiao; Gaffney, Kelly J; Boxer, Steven G

    2011-10-04

    Understanding how electric fields and their fluctuations in the active site of enzymes affect efficient catalysis represents a critical objective of biochemical research. We have directly measured the dynamics of the electric field in the active site of a highly proficient enzyme, Δ(5)-3-ketosteroid isomerase (KSI), in response to a sudden electrostatic perturbation that simulates the charge displacement that occurs along the KSI catalytic reaction coordinate. Photoexcitation of a fluorescent analog (coumarin 183) of the reaction intermediate mimics the change in charge distribution that occurs between the reactant and intermediate state in the steroid substrate of KSI. We measured the electrostatic response and angular dynamics of four probe dipoles in the enzyme active site by monitoring the time-resolved changes in the vibrational absorbance (IR) spectrum of a spectator thiocyanate moiety (a quantitative sensor of changes in electric field) placed at four different locations in and around the active site, using polarization-dependent transient vibrational Stark spectroscopy. The four different dipoles in the active site remain immobile and do not align to the changes in the substrate electric field. These results indicate that the active site of KSI is preorganized with respect to functionally relevant changes in electric fields.

  12. Direct measurement of the protein response to an electrostatic perturbation that mimics the catalytic cycle in ketosteroid isomerase

    PubMed Central

    Jha, Santosh Kumar; Ji, Minbiao; Gaffney, Kelly J.; Boxer, Steven G.

    2011-01-01

    Understanding how electric fields and their fluctuations in the active site of enzymes affect efficient catalysis represents a critical objective of biochemical research. We have directly measured the dynamics of the electric field in the active site of a highly proficient enzyme, Δ5-3-ketosteroid isomerase (KSI), in response to a sudden electrostatic perturbation that simulates the charge displacement that occurs along the KSI catalytic reaction coordinate. Photoexcitation of a fluorescent analog (coumarin 183) of the reaction intermediate mimics the change in charge distribution that occurs between the reactant and intermediate state in the steroid substrate of KSI. We measured the electrostatic response and angular dynamics of four probe dipoles in the enzyme active site by monitoring the time-resolved changes in the vibrational absorbance (IR) spectrum of a spectator thiocyanate moiety (a quantitative sensor of changes in electric field) placed at four different locations in and around the active site, using polarization-dependent transient vibrational Stark spectroscopy. The four different dipoles in the active site remain immobile and do not align to the changes in the substrate electric field. These results indicate that the active site of KSI is preorganized with respect to functionally relevant changes in electric fields. PMID:21949360

  13. Gardening in the desert: a spatial optimization approach to locating gardens in rapidly expanding urban environments.

    PubMed

    Mack, Elizabeth A; Tong, Daoqin; Credit, Kevin

    2017-10-16

    Food access is a global issue, and for this reason, a wealth of studies are dedicated to understanding the location of food deserts and the benefits of urban gardens. However, few studies have linked these two strands of research together to analyze whether urban gardening activity may be a step forward in addressing issues of access for food desert residents. The Phoenix, Arizona metropolitan area is used as a case to demonstrate the utility of spatial optimization models for siting urban gardens near food deserts and on vacant land. The locations of urban gardens are derived from a list obtained from the Maricopa County Cooperative Extension office at the University of Arizona which were geo located and aggregated to Census tracts. Census tracts were then assigned to one of three categories: tracts that contain a garden, tracts that are immediately adjacent to a tract with a garden, and all other non-garden/non-adjacent census tracts. Analysis of variance is first used to ascertain whether there are statistical differences in the demographic, socio-economic, and land use profiles of these three categories of tracts. A maximal covering spatial optimization model is then used to identify potential locations for future gardening activities. A constraint of these models is that gardens be located on vacant land, which is a growing problem in rapidly urbanizing environments worldwide. The spatial analysis of garden locations reveals that they are centrally located in tracts with good food access. Thus, the current distribution of gardens does not provide an alternative food source to occupants of food deserts. The maximal covering spatial optimization model reveals that gardens could be sited in alternative locations to better serve food desert residents. In fact, 53 gardens may be located to cover 96.4% of all food deserts. This is an improvement over the current distribution of gardens where 68 active garden sites provide coverage to a scant 8.4% of food desert residents. People in rapidly urbanizing environments around the globe suffer from poor food access. Rapid rates of urbanization also present an unused vacant land problem in cities around the globe. This paper highlights how spatial optimization models can be used to improve healthy food access for food desert residents, which is a critical first step in ameliorating the health problems associated with lack of healthy food access including heart disease and obesity.

  14. Geochemical Data from Produced Water Contamination Investigations: Osage-Skiatook Petroleum Environmental Research (OSPER) Sites, Osage County, Oklahoma

    USGS Publications Warehouse

    Thordsen, James J.; Kharaka, Yousif K.; Ambats, Gil; Kakouros, Evangelos; Abbott, Marvin M.

    2007-01-01

    We report chemical and isotopic analyses of 345 water samples collected from the Osage-Skiatook Petroleum Environmental Research (OSPER) project. Water samples were collected as part of an ongoing multi-year USGS investigation to study the transport, fate, natural attenuation, and ecosystem impacts of inorganic salts and organic compounds present in produced water releases at two oil and gas production sites from an aging petroleum field located in Osage County, in northeast Oklahoma. The water samples were collected primarily from monitoring wells and surface waters at the two research sites, OSPER A (legacy site) and OSPER B (active site), during the period March, 2001 to February, 2005. The data include produced water samples taken from seven active oil wells, one coal-bed methane well and two domestic groundwater wells in the vicinity of the OSPER sites.

  15. Desert Research and Technology Studies (RATS) Local and Remote Test Sites

    NASA Technical Reports Server (NTRS)

    Janoiko, Barbara; Kosmo, Joseph; Eppler, Dean

    2007-01-01

    Desert RATS (Research and Technology Studies) is a combined group of inter-NASA center scientists and engineers, collaborating with representatives of industry and academia, for the purpose of conducting remote field exercises. These exercises provide the capability to validate experimental hardware and software, to evaluate and develop mission operational techniques, and to identify and establish technical requirements applicable for future planetary exploration. D-RATS completed its ninth year of field testing in September 2006. Dry run test activities prior to testing at designated remote field site locations are initially conducted at the Johnson Space Center (JSC) Remote Field Demonstration Test Site. This is a multi-acre external test site located at JSC and has detailed representative terrain features simulating both Lunar and Mars surface characteristics. The majority of the remote field tests have been subsequently conducted in various high desert areas adjacent to Flagstaff, Arizona. Both the local JSC and remote field test sites have terrain conditions that are representative of both the Moon and Mars, such as strewn rock and volcanic ash fields, meteorite crater ejecta blankets, rolling plains, hills, gullies, slopes, and outcrops. Flagstaff is the preferred remote test site location for many reasons. First, there are nine potential test sites with representative terrain features within a 75-mile radius. Second, Flagstaff is the location of the United States Geologic Survey (USGS)/Astrogeology Branch, which historically supported Apollo astronaut geologic training and currently supports and provides host accommodations to the D-RATS team. Finally, in considering the importance of logistics in regard to providing the necessary level of support capabilities, the Flagstaff area provides substantial logistics support and lodging accommodations to take care of team members during long hours of field operations.

  16. Continuous multi-component geophysical experiment on LUSI mud edifice: What can we learn from it?

    NASA Astrophysics Data System (ADS)

    Mauri, Guillaume; Husein, Alwi; Karyono, Karyono; Hadi, Soffian; Mazzini, Adriano; Collignon, Marine; Faubert, Maïté; Miller, Stephen A.; Lupi, Matteo

    2016-04-01

    The Lusi eruption is located in East Java, Indonesia, and is ongoing since May 29th, 2006. In the framework of joined international projects, several joint geophysical studies focussing on seismic monitoring, spatial investigation over the mud edifice and its surroundings are being conducted. Here we present freshly acquired data from a test site to investigate: (1) potential change in the natural electrical self-potential generation over time (2) potential change in gravity field associated to change in mass or volume, (3) if the geysering activity generates disruption on either the electrical or gravity field. We selected a location ˜200m to the NE of the active Lusi crater. The experiment site covers an area of 60m x 80m, crossing the boundaries between the soft and the solid walkable mud. The western edge of the study area was less than 100m away from the rim of the crater site. A self-potential array made of 6 Pb-PbCl2 electrodes was deployed over the site. The electrodes were positioned inside active seeps, on dry unaltered zones and close to the mud stream that flushes the water erupted from the crater site. All the electrodes were connected to a single Pb-PbCl2 electrode reference. A second array of 7 thermometers was installed positioning 5 of them next to SP electrodes, one to measure atmospheric temperature and another P/T probe to monitor the stream water. In addition a seismometer coupled with a HD video camera, a thermal camera and a gravimeter recorded on site for several days monitoring visual and seismic activity of the crater. The collected data allows us to 1) monitor and define the different geysering activities ongoing at the crater, 2) define the delay existing between the recorded seismicity and the visual observations, 3) verify if the crater activity triggers perturbations that are transmitted to e.g. the thousands of satellite seeps distributed in the 7 square kilometers zone inside the embankment; 4) how significant is the delay between the crater activity and the water streamed out.

  17. Oxidative stress enzyme and histopathological lesions in Colossoma macropomum (pisces, ariidae) for environmental impact assessment

    NASA Astrophysics Data System (ADS)

    Andrade, Ticianne de Sousa de Oliveira Mota; Sousa, Debora Batista Pinheiro; Dantas, Janaina Gomes; Castro, Jonatas da Silva; Neta, Raimunda Nonata Fortes Carvalho

    2015-12-01

    This study used oxidative stress enzyme (Glutathione S-Transferase and Catalase), histopathological lesions (Branchial lesions) and biometric data in the freshwater fish tambaqui, Colossoma macropomum, to assess environmental impacts in an Environmental Protection Area at São Luis, Brazil. Fish were sampled from two locations (A1 = contaminated area and A2 = reference site) within the protected area on four occasions. The activity of catalase (CAT) and glutathione S-transferase (GST) in C. macropomum was compared with biometric data and histopathological lesions. Results have shown that biometric data decreased significantly in fish (p<0.05) at the contaminated site. The activity of CAT was higher in fish specifically caught in A1. A significant difference was observed in the GST activity in the liver of C. macropomum when comparing fish from the contaminated site and those from the reference site (p<0.05).

  18. Increasing Stability and Activity of Core-Shell Catalysts by Preferential Segregation of Oxide on Edges and Vertexes: Oxygen Reduction on Ti-Au@Pt/C

    DOE PAGES

    Hu, J.; Wu, L.; Kuttiyiel, K.; ...

    2016-06-30

    We describe a new class of core-shell nanoparticle catalysts having edges and vertexes covered by refractory metal oxide that preferentially segregates onto these catalyst sites. The monolayer shell is deposited on the oxidefree core atoms. The oxide on edges and vertexes induces high catalyst’s stability and activity. The catalyst and synthesis are exemplified by fabrication of Au nanoparticles doped by Ti atoms that segregate as oxide onto low–coordination sites of edges and vertexes. Pt monolayer shell deposited on Au sites has the mass and specific activities for the oxygen reduction reaction about 13 and 5 times higher than those ofmore » commercial Pt/C catalysts. The durability tests show no activity loss after 10000 potential cycles from 0.6 to 1.0V. The superior activity and durability of the Ti-Au@Pt catalyst originate from protective Ti oxide located at the most dissolution-prone edge and vertex sites, and Au-supported active and stable Pt shell.« less

  19. Concentration of (137)Cs in soil across Nebraska.

    PubMed

    Weesner, Alexandra Palensky; Fairchild, Robert W

    2008-06-01

    Atmospheric nuclear weapons testing from 1945 through 1980 produced radioactive fallout that was transported by stratospheric winds and deposited unevenly around the world. The accident at Chernobyl in 1986 also contributed to the fallout in some locations. The (137)Cs activity concentration from fallout has been measured as a function of depth in soil samples from five different locations across Nebraska. Soil samples 2-cm thick down to a depth of 30 cm were collected in Brown, Dawes, Lancaster, Red Willow, and Thurston Counties. Samples taken from each of the sites were dried, sieved, and counted using an HPGe gamma spectroscopy system to measure the activity concentration of (137)Cs at each depth in the soil. Activity concentrations as high as 216 Bq kg(-1) were measured in the samples. Dry soil bulk densities were calculated for each site based on soil type and used to calculate the area density of deposition. Area deposition densities up to 13,100 Bq m(-2) were measured, consistent with published estimates.

  20. Oil persistence on beaches in Prince William Sound - a review of SCAT surveys conducted from 1989 to 2002.

    PubMed

    Taylor, Elliott; Reimer, Doug

    2008-03-01

    In 2002, 13 years after the Exxon Valdez oil spill (EVOS), 39 selected sites in Prince William Sound (PWS) were re-surveyed following established shoreline cleanup assessment team (SCAT) field observation procedures to document surface and sub-surface oiling conditions in shoreline sediments and to compare results with those from previous Shoreline Cleanup Assessment Team (SCAT) surveys and other surveys in PWS. The selected sites are locations where EVOS oil persisted in 1992, at the time the Federal and State On-Scene Coordinators determined that the cleanup was complete and that further cleanup activities would provide no net environmental benefit. These sites had been included in a 2001 NOAA survey of shoreline oiling conditions and account for 88% of the sub-surface oil residues (SSO) oil documented by that study. The 2002 field survey found isolated occurrences of residual EVOS surface oil residues (SO) in the form of weathered asphalt pavement at 15 of the 39 sites. This residual SO typically consisted of asphalt in mixed sand/gravel substrate, located within a wave shadow effect created by boulders or bedrock in the upper intertidal to supratidal zone. Residual SO, expressed as a continuous oil cover, was less than 200 m(2) within the approximately 111,120 m(2) surveyed. A total of 1182 pits were dug at locations where SSO residues were present in 1992. Six of the 39 sites and 815 (68%) of the pits contained no residual SSO. Eighty-three percent of pits with SSO residues were found primarily in middle to upper intertidal locations. SSO residues commonly occurred in a discontinuous approximately 3 cm thick band 5-10 cm below the boulder/cobble or pebble/gravel veneer. The SO and SSO occurrences in the 2002 survey closely match the locations where they were found in 1992 and earlier surveys; however, in 2002 residual SSO patches are more discontinuous and thinner than they were in the earlier surveys. These sites are biased toward SSO persistence; those that have SSO residues represent less than 0.5% of the originally oiled shorelines in PWS. Despite evidence of continued oil weathering, both at the surface and in the sub-surface, it is clear that the natural cleaning processes at these particular locations are slow. The slow weathering rates are a consequence of the oil residue being incorporated in finer sediments (fine sand, silt, mix) and isolated from active weathering processes as boulders and outcrops, shallow bedrock asperities, or boulder-armoring create wave shadows and limit effective physical action on shorelines.

  1. Migration, Foraging, and Residency Patterns for Northern Gulf Loggerheads: Implications of Local Threats and International Movements

    PubMed Central

    Hart, Kristen M.; Lamont, Margaret M.; Sartain, Autumn R.; Fujisaki, Ikuko

    2014-01-01

    Northern Gulf of Mexico (NGoM) loggerheads (Caretta caretta) make up one of the smallest subpopulations of this threatened species and have declining nest numbers. We used satellite telemetry and a switching state-space model to identify distinct foraging areas used by 59 NGoM loggerheads tagged during 2010–2013. We tagged turtles after nesting at three sites, 1 in Alabama (Gulf Shores; n = 37) and 2 in Florida (St. Joseph Peninsula; n = 20 and Eglin Air Force Base; n = 2). Peak migration time was 22 July to 9 August during which >40% of turtles were in migration mode; the mean post-nesting migration period was 23.0 d (±13.8 d SD). After displacement from nesting beaches, 44 turtles traveled to foraging sites where they remained resident throughout tracking durations. Selected foraging locations were variable distances from tagging sites, and in 5 geographic regions; no turtles selected foraging sites outside the Gulf of Mexico (GoM). Foraging sites delineated using 50% kernel density estimation were located a mean distance of 47.6 km from land and in water with mean depth of −32.5 m; other foraging sites, delineated using minimum convex polygons, were located a mean distance of 43.0 km from land and in water with a mean depth of −24.9 m. Foraging sites overlapped with known trawling activities, oil and gas extraction activities, and the footprint of surface oiling during the 2010 Deepwater Horizon oil spill (n = 10). Our results highlight the year-round use of habitats in the GoM by loggerheads that nest in the NGoM. Our findings indicate that protection of females in this subpopulation requires both international collaborations and management of threats that spatially overlap with distinct foraging habitats. PMID:25076053

  2. Ventifact Formation in the Mojave Desert: Field Analogs for Martian Processes

    NASA Technical Reports Server (NTRS)

    Laity, J. E.; Bridges, N. T.; Boyle, T. K.

    2001-01-01

    Two field studies in the Mojave Desert, California, shed light on processes of ventifact formation. The field sites are located on a ridge at Little Cowhole Mountain, which lies approximately 12 km south of Baker, and on an unnamed ridge situated along the northern boundary of the Mojave River Sink (Rasor Road site). The rocks at Little Cowhole Mountain are a blue-grey marble/dolomite, whereas those at Rasor Road are Miocene volcanic rocks (basalt). At both sites the abrasive agent is a fine-grained aeolian sand which was probably derived largely from the Mojave River. There are minimal modem inputs of sand to either site: abrasion occurs as a result of unique climatic and topographic conditions which allow pre-existing sand to be recycled from one aspect of the ridge to the other. Climatic conditions are well suited for ventifact formation. Owing, to the dry climate (marked by low average relative humidity, infrequent dew, and low annual rainfall), rates of chemical weathering are low. Where resurfacing of the rocks by sand abrasion proceeds at a rate greater than weathering, the ventifacts are considered "active." Active ventifacts are found atop and straddling the ridge crests, in the zone of maximum wind velocity and sediment supply. Inactive ventifacts occur where modem weathering Processes exceed abrasion rates; principally on the basal two-thirds of the hillslope, where wind velocity and sediment supply are lower. At intermediate locations between the slope base and crest, ventifacts are either active or inactive, depending on local conditions. The presence of relict ventifacts at the study sites, as well as elsewhere in the eastern Mojave Desert, suggests that the conditions for venti fact formation must have been more intense and extensive in the past. Together, the studies illustrate that the processes that interact to form ventifacts are highly complex, and must be studied at many scales. Small-scale effects, such as local topography, plant cover, or even the spatial distribution of boulders, strongly influence the formation of each individual ventifact. Mesoscale effects (hillslope form, total availability of sediment, seasonality of winds, etc.) determine the distribution of overall erosional energy and the location of active and relict forms.

  3. Neighborhood Environments and Objectively Measured Physical Activity in 11 Countries

    PubMed Central

    Cerin, Ester; Cain, Kelli L; Conway, Terry L; Dyck, Delfien Van; Hinckson, Erica; Schipperijn, Jasper; Bourdeaudhuij, Ilse De; Owen, Neville; Davey, Rachel C; Hino, Adriano Akira Ferreira; Mitáš, Josef; Orzanco-Garralda, Rosario; Salvo, Deborah; Sarmiento, Olga L; Christiansen, Lars B; Macfarlane, Duncan J; Schofield, Grant; Sallis, James F

    2014-01-01

    Purpose Environmental changes are potentially effective population-level physical activity (PA) promotion strategies. However, robust multi-site evidence to guide international action for developing activity-supportive environments is lacking. We estimated pooled associations of perceived environmental attributes with objectively-measured PA outcomes; between-site differences in such associations; and, the extent to which perceived environmental attributes explain between-site differences in PA. Methods This was a cross-sectional study conducted in 16 cities located in Belgium, Brazil, Colombia, Czech Republic, Denmark, China, Mexico, New Zealand, Spain, United Kingdom, and USA. Participants were 6,968 adults residing in administrative units stratified by socio-economic status and transport-related walkability. Predictors were 10 perceived neighborhood environmental attributes. Outcome measures were accelerometry-assessed weekly minutes of moderate-to-vigorous PA (MVPA) and meeting the PA guidelines for cancer/weight gain prevention (420 min/week of MVPA). Results Most perceived neighborhood attributes were positively associated with the PA outcomes in the pooled, site-adjusted, single-predictor models. Associations were generalizable across geographical locations. Aesthetics and land use mix – access were significant predictors of both PA outcomes in the fully-adjusted models. Environmental attributes accounted for within-site variability in MVPA corresponding to a 3 min/d or 21 min/week standard deviation. Large between-site differences in PA outcomes were observed: 15.9% to 16.8% of these differences were explained by perceived environmental attributes. All neighborhood attributes were associated with between-site differences in the total effects of the perceived environment on PA outcomes. Conclusions Residents’ perceptions of neighborhood attributes that facilitate walking were positively associated with objectively-measured MVPA and meeting the guidelines for cancer/weight gain prevention at the within- and between-site levels. Associations were similar across study sites, lending support for international recommendations for designing PA-friendly built environments. PMID:24781892

  4. Dynamic conformational switching in the chemokine ligand is essential for G-protein-coupled receptor activation

    PubMed Central

    Joseph, Prem Raj B.; Sawant, Kirti V.; Isley, Angela; Pedroza, Mesias; Garofalo, Roberto P.; Richardson, Ricardo M.; Rajarathnam, Krishna

    2014-01-01

    Chemokines mediate diverse functions from organogenesis to mobilizing leucocytes, and are unusual agonists for class-A GPCRs (G-protein-coupled receptors) because of their large size and multi-domain structure. The current model for receptor activation, which involves interactions between chemokine N-loop and receptor N-terminal residues (Site-I) and between chemokine N-terminal and receptor extracellular loop/transmembrane residues (Site-II), fails to describe differences in ligand/receptor selectivity and the activation of multiple signalling pathways. In the present study, we show in neutrophil-activating chemokine CXCL8 that the highly conserved GP (glycine-proline) motif located distal to both N-terminal and N-loop residues couples Site-I and Site-II interactions. Mutations in the GP motif caused various differences from native-like function to complete loss of activity that could not be correlated with the specific mutation, receptor affinity or subtype, or a specific signalling pathway. NMR studies indicated that the GP motif does not influence Site-I interactions, but molecular dynamics simulations suggested that this motif dictates substates of the CXCL8 conformational ensemble. We conclude that the GP motif enables diverse receptor functions by controlling cross-talk between Site-I and Site-II, and further propose that the repertoire of chemokine functions is best described by a conformational ensemble model in which a network of long-range coupled indirect interactions mediate receptor activity. PMID:24032673

  5. Human Health and Ecological Risk Assessment for the Operation of the Explosives Waste Treatment Facility at Site 300 of the Lawrence Livermore National Laboratory Volume 1: Report of Results

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gallegos, G; Daniels, J; Wegrecki, A

    2006-04-24

    This document contains the human health and ecological risk assessment for the Resource Recovery and Conservation Act (RCRA) permit renewal for the Explosives Waste Treatment Facility (EWTF). Volume 1 is the text of the risk assessment, and Volume 2 (provided on a compact disc) is the supporting modeling data. The EWTF is operated by the Lawrence Livermore National Laboratory (LLNL) at Site 300, which is located in the foothills between the cities of Livermore and Tracy, approximately 17 miles east of Livermore and 8 miles southwest of Tracy. Figure 1 is a map of the San Francisco Bay Area, showingmore » the location of Site 300 and other points of reference. One of the principal activities of Site 300 is to test what are known as ''high explosives'' for nuclear weapons. These are the highly energetic materials that provide the force to drive fissionable material to criticality. LLNL scientists develop and test the explosives and the integrated non-nuclear components in support of the United States nuclear stockpile stewardship program as well as in support of conventional weapons and the aircraft, mining, oil exploration, and construction industries. Many Site 300 facilities are used in support of high explosives research. Some facilities are used in the chemical formulation of explosives; others are locations where explosive charges are mechanically pressed; others are locations where the materials are inspected radiographically for such defects as cracks and voids. Finally, some facilities are locations where the machined charges are assembled before they are sent to the on-site test firing facilities, and additional facilities are locations where materials are stored. Wastes generated from high-explosives research are treated by open burning (OB) and open detonation (OD). OB and OD treatments are necessary because they are the safest methods for treating explosives wastes generated at these facilities, and they eliminate the requirement for further handling and transportation that would be required if the wastes were treated off site.« less

  6. Effects of Zinc on Particulate Methane Monooxygenase Activity and Structure*

    PubMed Central

    Sirajuddin, Sarah; Barupala, Dulmini; Helling, Stefan; Marcus, Katrin; Stemmler, Timothy L.; Rosenzweig, Amy C.

    2014-01-01

    Particulate methane monooxygenase (pMMO) is a membrane-bound metalloenzyme that oxidizes methane to methanol in methanotrophic bacteria. Zinc is a known inhibitor of pMMO, but the details of zinc binding and the mechanism of inhibition are not understood. Metal binding and activity assays on membrane-bound pMMO from Methylococcus capsulatus (Bath) reveal that zinc inhibits pMMO at two sites that are distinct from the copper active site. The 2.6 Å resolution crystal structure of Methylocystis species strain Rockwell pMMO reveals two previously undetected bound lipids, and metal soaking experiments identify likely locations for the two zinc inhibition sites. The first is the crystallographic zinc site in the pmoC subunit, and zinc binding here leads to the ordering of 10 previously unobserved residues. A second zinc site is present on the cytoplasmic side of the pmoC subunit. Parallels between these results and zinc inhibition studies of several respiratory complexes suggest that zinc might inhibit proton transfer in pMMO. PMID:24942740

  7. 77 FR 36997 - Foreign-Trade Zone 7-Mayaguez, PR; Notification of Proposed Production Activity; Baxter...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-20

    ...; Notification of Proposed Production Activity; Baxter Healthcare of Puerto Rico; (Pharmaceutical and Nutritional Intravenous Bags and Administration Sets); Aibonito and Jayuya, PR The Puerto Rico Industrial Development... Healthcare of Puerto Rico (Baxter), at two sites within FTZ 7, located in Aibonito and Jayuya, Puerto Rico...

  8. Facebook, Crowdsourcing and the Transition to College

    ERIC Educational Resources Information Center

    Nehls, Kimberly; Livengood, Jake

    2018-01-01

    The purpose of this study is to enhance our understanding of how college students connect online prior to their first year. Before students ever set foot on a college campus, they are making friends, joining clubs, locating activities, finding roommates and discussing future student activities all through the social network site, Facebook.…

  9. Scaling and calibration of a core validation site for the soil moisture active passive mission

    USDA-ARS?s Scientific Manuscript database

    The calibration and validation of soil moisture remote sensing products is complicated due to the logistics of installing a long term soil moisture monitoring network in an active landscape. It is more efficient to locate these stations along agricultural field boundaries, but unfortunately this oft...

  10. Dual Active Site in the Endolytic Transglycosylase gp144 of Bacteriophage phiKZ.

    PubMed

    Chertkov, O V; Armeev, G A; Uporov, I V; Legotsky, S A; Sykilinda, N N; Shaytan, A K; Klyachko, N L; Miroshnikov, K A

    2017-01-01

    Lytic transglycosylases are abundant peptidoglycan lysing enzymes that degrade the heteropolymers of bacterial cell walls in metabolic processes or in the course of a bacteriophage infection. The conventional catalytic mechanism of transglycosylases involves only the Glu or Asp residue. Endolysin gp144 of Pseudomonas aeruginosa bacteriophage phiKZ belongs to the family of Gram-negative transglycosylases with a modular composition and C -terminal location of the catalytic domain. Glu115 of gp144 performs the predicted role of a catalytic residue. However, replacement of this residue does not completely eliminate the activity of the mutant protein. Site-directed mutagenesis has revealed the participation of Tyr197 in the catalytic mechanism, as well as the presence of a second active site involving Glu178 and Tyr147. The existence of the dual active site was supported by computer modeling and monitoring of the molecular dynamics of the changes in the conformation and surface charge distribution as a consequence of point mutations.

  11. Electrostatic channeling in P. falciparum DHFR-TS: Brownian dynamics and Smoluchowski modeling.

    PubMed

    Metzger, Vincent T; Eun, Changsun; Kekenes-Huskey, Peter M; Huber, Gary; McCammon, J Andrew

    2014-11-18

    We perform Brownian dynamics simulations and Smoluchowski continuum modeling of the bifunctional Plasmodium falciparum dihydrofolate reductase-thymidylate synthase (P. falciparum DHFR-TS) with the objective of understanding the electrostatic channeling of dihydrofolate generated at the TS active site to the DHFR active site. The results of Brownian dynamics simulations and Smoluchowski continuum modeling suggest that compared to Leishmania major DHFR-TS, P. falciparum DHFR-TS has a lower but significant electrostatic-mediated channeling efficiency (?15-25%) at physiological pH (7.0) and ionic strength (150 mM). We also find that removing the electric charges from key basic residues located between the DHFR and TS active sites significantly reduces the channeling efficiency of P. falciparum DHFR-TS. Although several protozoan DHFR-TS enzymes are known to have similar tertiary and quaternary structure, subtle differences in structure, active-site geometry, and charge distribution appear to influence both electrostatic-mediated and proximity-based substrate channeling.

  12. First hydrothermal discoveries on the Australian-Antarctic Ridge: Discharge sites, plume chemistry, and vent organisms

    NASA Astrophysics Data System (ADS)

    Hahm, Doshik; Baker, Edward T.; Siek Rhee, Tae; Won, Yong-Jin; Resing, Joseph A.; Lupton, John E.; Lee, Won-Kyung; Kim, Minjeong; Park, Sung-Hyun

    2015-09-01

    The Australian-Antarctic Ridge (AAR) is one of the largest unexplored regions of the global mid-ocean ridge system. Here, we report a multiyear effort to locate and characterize hydrothermal activity on two first-order segments of the AAR: KR1 and KR2. To locate vent sites on each segment, we used profiles collected by Miniature Autonomous Plume Recorders on rock corers during R/V Araon cruises in March and December of 2011. Optical and oxidation-reduction-potential anomalies indicate multiple active sites on both segments. Seven profiles on KR2 found 3 sites, each separated by ˜25 km. Forty profiles on KR1 identified 17 sites, some within a few kilometer of each other. The spatial density of hydrothermal activity along KR1 and KR2 (plume incidence of 0.34) is consistent with the global trend for a spreading rate of ˜70 mm/yr. The densest area of hydrothermal activity, named "Mujin," occurred along the 20 km-long inflated section near the segment center of KR1. Continuous plume surveys conducted in January-February of 2013 on R/V Araon found CH4/3He (1 - 15 × 106) and CH4/Mn (0.01-0.5) ratios in the plume samples, consistent with a basaltic-hosted system and typical of ridges with intermediate spreading rates. Additionally, some of the plume samples exhibited slightly higher ratios of H2/3He and Fe/Mn than others, suggesting that those plumes are supported by a younger hydrothermal system that may have experienced a recent eruption. The Mujin-field was populated by Kiwa crabs and seven-armed Paulasterias starfish previously recorded on the East Scotia Ridge, raising the possibility of circum-Antarctic biogeographic connections of vent fauna.

  13. Accurate means of detecting and characterizing abnormal patterns of ventricular activation by phase image analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Botvinick, E.H.; Frais, M.A.; Shosa, D.W.

    1982-08-01

    The ability of scintigraphic phase image analysis to characterize patterns of abnormal ventricular activation was investigated. The pattern of phase distribution and sequential phase changes over both right and left ventricular regions of interest were evaluated in 16 patients with normal electrical activation and wall motion and compared with those in 8 patients with an artificial pacemaker and 4 patients with sinus rhythm with the Wolff-Parkinson-White syndrome and delta waves. Normally, the site of earliest phase angle was seen at the base of the interventricular septum, with sequential change affecting the body of the septum and the cardiac apex andmore » then spreading laterally to involve the body of both ventricles. The site of earliest phase angle was located at the apex of the right ventricle in seven patients with a right ventricular endocardial pacemaker and on the lateral left ventricular wall in one patient with a left ventricular epicardial pacemaker. In each case the site corresponded exactly to the position of the pacing electrode as seen on posteroanterior and left lateral chest X-ray films, and sequential phase changes spread from the initial focus to affect both ventricles. In each of the patients with the Wolff-Parkinson-White syndrome, the site of earliest ventricular phase angle was located, and it corresponded exactly to the site of the bypass tract as determined by endocardial mapping. In this way, four bypass pathways, two posterior left paraseptal, one left lateral and one right lateral, were correctly localized scintigraphically. On the basis of the sequence of mechanical contraction, phase image analysis provides an accurate noninvasive method of detecting abnormal foci of ventricular activation.« less

  14. The peregrine falcon in Arizona: Habitat utilization and management recommendations

    USGS Publications Warehouse

    Ellis, D.H.

    1982-01-01

    The peregrine falcon once bred in significant numbers in Arizona. Good documentation is available for specific breeding sites and an additional 20 general locations. This report, based on the published literature, an extensive personal contact survey, an aerial habitat inventory (over 124 hours air time), and ground visits to over 300 locations, provides information on habitat preferences and management practices which can contribute to the bird's survival. In seeking to identify the habitat preferences of the falcon, many site description factors were examined. Those traits which appeared common to most recent Arizona sites (and therefore most useful in evaluating habitat) were: elevation less than 9,000 feet, cliffs tall or very tall, cliffs extensive, topographic relief high, and surface water readily available. All recent sites are in extensive canyon systems or in extensive mountain ranges. Using a habitat evaluation key derived from the traits common to known breeding sites, all cliff regions in Arizona and the Navajo Indian Reservation were flown and evaluated for suitability. Nineteen falcon eyries located in subsequent ground visits were all in areas previously ranked acceptable or better. Many management alternatives are discussed: management of information on breeding sites, habitat preservation, controlling disruptive human activities, and enhancing productivity through the creation of suitable breeding ledges, providing pesticide free prey, or direct reintroductions. Given their privacy (and an increasingly pesticide free environment) the peregrine falcon will likely exist indefinitely in suitable areas across Arizona.

  15. Bed-material characteristics of the Sacramento–San Joaquin Delta, California, 2010–13

    USGS Publications Warehouse

    Marineau, Mathieu D.; Wright, Scott A.

    2017-02-10

    The characteristics of bed material at selected sites within the Sacramento–San Joaquin Delta, California, during 2010–13 are described in a study conducted by the U.S. Geological Survey in cooperation with the Bureau of Reclamation. During 2010‒13, six complete sets of samples were collected. Samples were initially collected at 30 sites; however, starting in 2012, samples were collected at 7 additional sites. These sites are generally collocated with an active streamgage. At all but one site, a separate bed-material sample was collected at three locations within the channel (left, right, and center). Bed-material samples were collected using either a US BMH–60 or a US BM–54 (for sites with higher stream velocity) cable-suspended, scoop sampler. Samples from each location were oven-dried and sieved. Bed material finer than 2 millimeters was subsampled using a sieving riffler and processed using a Beckman Coulter LS 13–320 laser diffraction particle-size analyzer. To determine the organic content of the bed material, the loss on ignition method was used for one subsample from each location. Particle-size distributions are presented as cumulative percent finer than a given size. Median and 90th-percentile particle size, and the percentage of subsample mass lost using the loss on ignition method for each sample are also presented in this report.

  16. Mars Surface System Common Capabilities and Challenges for Human Missions

    NASA Technical Reports Server (NTRS)

    Hoffman, Stephen J.; Toups, Larry

    2016-01-01

    NASA has begun a process to identify and evaluate candidate locations where humans could land, live and work on the martian surface. These locations are referred to as Exploration Zones (EZs). Given current mission concepts, an EZ is a collection of Regions of Interest (ROIs) that are located within approximately 100 kilometers of a centralized landing site. ROIs are areas that are relevant for scientific investigation and/or development/maturation of capabilities and resources necessary for a sustainable human presence. The EZ also contains a landing site and a habitation site that will be used by multiple human crews during missions to explore and utilize the ROIs within the EZ. In parallel with this process, NASA continues to make progress on the Evolvable Mars Campaign examining alternatives that can pioneer an extended human presence on Mars that is Earth independent. This involves ongoing assessments of surface systems and operations to enable a permanent, sustainable human presence. Because of the difficulty in getting equipment and supplies to the surface of Mars, part of these assessments involve identifying those systems and processes that can perform in multiple, sometimes completely unrelated, situations. These assessments have been performed in a very generic surface mission carried out at a very generic surface location. As specific candidate EZs are identified it becomes important to evaluate the current suite of surface systems and operations as they are likely to perform for the specific locations and for the types of operations - both scientific and development - that are proposed for these EZs. It is also important to evaluate the proposed EZs for their suitability to be explored or developed given the range of capabilities and constraints for the types of surface systems and operations being considered within the EMC. This means looking at setting up and operating a field station at a central location within the EZ as well as traversing to and exploring the scientific ROIs within the boundaries of the EZ. The proposed paper will describe the current status of common systems and operations as they can be applied to actual EZ locations on Mars. Initially these EZs will be the four locations identified MEPAG's Human Exploration of Mars Science Analysis Group (HEM-SAG) that will be used as representative of the EZs that will emerge from the process that NASA has initiated. An example process that could be commonly applied is an approach for developing a field station site plan that would be demonstrated by applying this process to each of the four HEM-SAG sites. Examples of common systems include (a) mobility systems that can be used to off-load and move payloads to specific locations at the central field station location that could also be used to traverse long distances to reach some of the more remote ROIs or (b) robotic systems that can support various activities (such as system set up and maintenance) at the field station that could also be used to explore scientific ROIs and used to support site-specific ISRU production activities.

  17. United States Air Force 611th Air Support Group/Civil Engineering Squadron, Elmendorf AFB, Alaska. Remedial investigation and feasibility study: Oliktok Point Radar Installation, Alaska. Volume 1. (Includes appendices a - b)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1996-04-15

    This report presents the findings of Remedial Investigations and Feasibility Studies at sites located at the Oliktok Point radar installation in northern Alaska. The sites were characterized based on sampling and analyses conducted during Remedial Investigation activities performed during August and September 1993.

  18. Floating sample-collection platform with stage-activated automatic water sampler for streams with large variation in stage

    USGS Publications Warehouse

    Tarte, Stephen R.; Schmidt, A.R.; Sullivan, Daniel J.

    1992-01-01

    A floating sample-collection platform is described for stream sites where the vertical or horizontal distance between the stream-sampling point and a safe location for the sampler exceed the suction head of the sampler. The platform allows continuous water sampling over the entire storm-runoff hydrogrpah. The platform was developed for a site in southern Illinois.

  19. Public-health assessment for Westinghouse (Sunnyvale Plant), Sunnyvale, Santa Clara County, California, Region 9, CERCLIS No. CAD001864081. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1992-09-28

    Located in Sunnyvale, California, the Westinghouse Electric Corporation Sunnyvale Plant is an active manufacturing facility currently manufacturing steam generators, marine propulsion systems, and missle launching systems for the Department of Defense. Between the mid-1950's and 1964, Westinghouse manufactured and tested electrical transformers in a building located at the southeastern part of the site near a water reservoir tank. The transformers contained mineral oil and Inerteen, which consisted principally of polychlorinated biphenyls (PCBs) and trichlorobenzene (TCB), as thermal insulating fluids. Handling and storage of Inerteen primarily led to soil and shallow groundwater contamination. In 1984 and 1985, Westinghouse removed contaminated soilsmore » along fencelines and railroad spurs. The remaining contamination exists principally in the southeastern part of the site near a water reservoir tank where the Inerteen storage tank and the associated pipelines were located. Based on information reviewed, the Agency for Toxic Substances Disease Registry (ATSDR) and the California Department of Health Services (CDHS) consider this site to be a public health hazard due to the past exposure to PCBs that nearby residences and on-site workers may have experienced.« less

  20. Action of insecticidal N-alkylamides at site 2 of the voltage-sensitive sodium channel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ottea, J.A.; Payne, G.T.; Soderlund, D.M.

    1990-08-01

    Nine synthetic N-alkylamides were examined as inhibitors of the specific binding of ({sup 3}H)batrachotoxinin A 20{alpha}-benzoate (({sup 3}H)BTX-B) to sodium channels and as activators of sodium uptake in mouse brain synaptoneurosomes. In the presence of scorpion (Leiurus quinquestriatus) venom, the six insecticidal analogues were active as both inhibitors of ({sup 3}H)BTX-B binding and stimulators of sodium uptake. These findings are consistent with an action of these compounds at the alkaloid activator recognition site (site 2) of the voltage-sensitive sodium channel. The three noninsecticidal N-alkylamides also inhibited ({sup 3}H)BTX-B binding but were ineffective as activators of sodium uptake. Concentration-response studies revealedmore » that some of the insecticidal amides also enhanced sodium uptake through a second, high-affinity interaction that does not involve site 2, but this secondary effect does not appear to be correlated with insecticidal activity. The activities of N-alkylamides as sodium channel activators were influenced by the length of the alkenyl chain and the location of unsaturation within the molecule. These results further define the actions of N-alkylamides on sodium channels and illustrate the significance of the multiple binding domains of the sodium channel as target sites for insect control agents.« less

  1. Area 3 Support Buildings (A3SB) H5-0992, H5-0996 PRL 218 Confirmatory Sampling Report

    NASA Technical Reports Server (NTRS)

    Mrdjenovich, Timothy

    2015-01-01

    The Area 3 Support Buildings site (A3SB) consists of two separate areas located on the north side of Beach Road in the northern portion of Kennedy Space Center, Florida (KSC), outside the secured perimeter of KSC. The A3SB areas are approximately 0.6 miles apart, and were developed as Shiffler's Grocery Store and Service Station (west site) and as a residence (east site) prior to acquisition by the National Aeronautics and Space Administration (NASA) in 1963. Both areas were used by the Bendix Company in support of NASA as chemical laboratories from 1963 through 1969. Both of the buildings were demolished by 1987. The west portion of the site was used by the US Fish & Wildlife Service (F&W) in support of the Merritt Island National Wildlife Refuge (MINWR) for parking at the entrance to the Hammock Trails from 1969 to the present. The east portion of the site was used for intermittent suspect materials staging in the early 1990s and is still used as an apiary location, but is otherwise no longer active. In support of the NASA HSWA permit requirements, this site was identified as Potential Release Location (PRL) 218 and a Solid Waste Management Unit (SWMU) Assessment (SA) was conducted in 2013. Confirmatory Sampling (CS) was recommended and approved by the KSC Remediation Team (KSCRT). Three locations of concern (LOCs) were identified and sampled at the site. The LOCs include two former chemical labs and a former suspect staging area. The CS was conducted in March of 2015 at three locations by means of Direct Push Technology (DPT) groundwater sampling and at one location for soil sampling. The samples were collected and analyzed in accordance with the approved CS Work Plan. There were no exceedances of criteria detected in any of the samples from the three LOCs. The results of this investigation indicate that past and/or present operations have not negatively impacted environmental media at the A3SB. Based upon no confirmed groundwater detections above GCTLs and no soil impacts above applicable screening criteria no further investigation is warranted at the A3SB. A No Further Action (NFA) status for all locations was approved by the KSCRT at the June 2015 meeting.

  2. Radioactive liquid wastes discharged to ground in the 200 Areas during 1976

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mirabella, J.E.

    An overall summary is presented giving the radioactive liquid wastes discharged to ground during 1976 and since startup (for both total and decayed depositions) within the Production and Waste Management Division control zone (200 Area plateau). Overall summaries are also presented for 200 East Area and for 200 West Area. The data contain an estimate of the radioactivity discharged to individual ponds, cribs and specific retention sites within the Production and Waste Management Division during 1976 and from startup through December 31, 1976; an estimate of the decayed activities from startup through 1976; the location and reference drawings of eachmore » disposal site; and the usage dates of each disposal site. The estimates for the radioactivity discharged and for decayed activities dicharged from startup through December 31, 1976 are based upon Item 4 of the Bibliography. The volume of liquid discharged to the ponds also includes major nonradioactive streams. The wastes discharged during 1976 to each active disposal site are detailed on a month-to-month basis, along with the monthly maximum concentration and average concentration data. An estimate of the radioactivity discharged to each active site along with the remaining decayed activities is given.« less

  3. The Target: H2O on the Moon

    NASA Technical Reports Server (NTRS)

    Green, J.; Wys, J. Negusde; Zuppero, A.

    1992-01-01

    The importance of H2O on the lunar surface has long been identified as a high priority for the existence of a human colony for mining activities and, more recently, for space fuel. Using the Earth as an analog, volcanic activity would suggest the generation of water during lunar history. Evidence of volcanism is found not only in present lunar morphology, but in over 400 locations of lunar transient events cataloged by Middlehurst and Kuiper in the 1960's. These events consisted of sightings since early history of vapor emissions and bright spots or flares. Later infrared scanning by Saari and Shorthill showed 'hot spots', many of which coincided with transient event sites. Many of the locations of Middlehurst and Kuiper were the sites of repeat events, leading to the conclusion that these were possibly volcanic in nature. The detection and use of H2O from the lunar surface is discussed.

  4. AIRSAR South American deployment: Operation plan, version 3.0

    NASA Technical Reports Server (NTRS)

    Kobrick, M.

    1993-01-01

    The United States National Aeronautics and Space Administration (NASA) and the Brazilian Commission for Space Activities (COBAE) are undertaking a joint experiment involving NASA's DC-8 research aircraft and the Airborne Synthetic Aperture Radar (AIRSAR) system during late May and June 1993. The research areas motivating these activities are: (1) fundamental research in the role of soils, vegetation, and hydrology in the global carbon cycle; and (2) in cooperation with South American scientists, airborne remote sensing research for the upcoming NASA Spaceborne Imaging Radar (SIR)-C/X-SAR flights on the Space Shuttle. A flight schedule and plans for the deployment that were developed are included. Maps of the site locations and schematic indications of flight routes and dates, plots showing swath locations derived from the flight requests and generated by flight planning software, and, most importantly, a calendar showing which sites will be imaged each day are included.

  5. Second Quarter Hanford Seismic Report for Fiscal Year 2010

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohay, Alan C.; Sweeney, Mark D.; Hartshorn, Donald C.

    2010-06-30

    The Hanford Seismic Assessment Program (HSAP) provides an uninterrupted collection of high-quality raw and processed seismic data from the Hanford Seismic Network for the U.S. Department of Energy and its contractors. The HSAP is responsible for locating and identifying sources of seismic activity and monitoring changes in the historical pattern of seismic activity at the Hanford Site. The data are compiled, archived, and published for use by the Hanford Site for waste management, natural phenomena hazards assessments, and engineering design and construction. In addition, the HSAP works with the Hanford Site Emergency Services Organization to provide assistance in the eventmore » of a significant earthquake on the Hanford Site. The Hanford Seismic Network and the Eastern Washington Regional Network consist of 44 individual sensor sites and 15 radio relay sites maintained by the Hanford Seismic Assessment Team. The Hanford Seismic Network recorded 90 local earthquakes during the second quarter of FY 2010. Eighty-one of these earthquakes were detected in the vicinity of Wooded Island, located about eight miles north of Richland just west of the Columbia River. The Wooded Island events recorded this quarter were a continuation of the swarm events observed during the 2009 and 2010 fiscal years and reported in previous quarterly and annual reports (Rohay et al; 2009a, 2009b, 2009c, and 2010). Most of the events were considered minor (coda-length magnitude [Mc] less than 1.0) with only 1 event in the 2.0-3.0 range; the maximum magnitude event (3.0 Mc) occurred February 4, 2010 at depth 2.4 km. The average depth of the Wooded Island events during the quarter was 1.6 km with a maximum depth estimated at 3.5 km. This placed the Wooded Island events within the Columbia River Basalt Group (CRBG). The low magnitude of the Wooded Island events has made them undetectable to all but local area residents. The Hanford Strong Motion Accelerometer (SMA) network was triggered several times by these events and the SMA recordings are discussed in section 6.0. During the last year some Hanford employees working within a few miles of the swarm area and individuals living directly across the Columbia River from the swarm center have reported feeling many of the larger magnitude events. Similar earthquake swarms have been recorded near this same location in 1970, 1975 and 1988 but not with SMA readings or satellite imagery. Prior to the 1970s, earthquake swarms may have occurred at this location or elsewhere in the Columbia Basin, but equipment was not in place to record those events. The Wooded Island swarm, due its location and the limited magnitude of the events, does not appear to pose any significant risk to Hanford waste storage facilities. Since swarms of the past did not intensify in magnitude, seismologists do not expect that these events will persist or increase in intensity. However, Pacific Northwest National Laboratory (PNNL) will continue to monitor the activity. Outside of the Wooded Island swarm, nine earthquakes were recorded, seven minor events plus two events with magnitude less than 2.0 Mc. Two earthquakes were located at shallow depths (less than 4 km), three earthquakes at intermediate depths (between 4 and 9 km), most likely in the pre-basalt sediments, and four earthquakes were located at depths greater than 9 km, within the basement. Geographically, six earthquakes were located in known swarm areas and three earthquakes were classified as random events.« less

  6. Integrating NASA Dryden Research Endeavors into the Teaching-Learning of Mathematics in the K-12 Classroom via the WWW

    NASA Technical Reports Server (NTRS)

    Ward, Robin A.

    2002-01-01

    The primary goal of this project was to continue populating the currently existing web site developed in 1998 in conjunction with the NASA Dryden Flight Research Center and California Polytechnic State University, with more mathematics lesson plans and activities that K-12 teachers, students, home-schoolers, and parents could access. All of the activities, while demonstrating some mathematical topic, also showcase the research endeavors of the NASA Dryden Flight Research Center. The website is located at: http://daniel.calpoly.edu/dfrc/Robin. The secondary goal of this project was to share the web-based activities with educators at various conferences and workshops. To address the primary goal of this project, over the past year, several new activities were posted on the web site and some of the existing activities were enhanced to contain more video clips, photos, and materials for teachers. To address the project's secondary goal, the web-based activities were showcased at several conferences and workshops. Additionally, in order to measure and assess the outreach impact of the web site, a link to the web site hitbox.com was established in April 2001, which allowed for the collection of traffic statistics against the web site (such as the domains of visitors, the frequency of visitors to this web site, etc.) Provided is a description of some of the newly created activities posted on the web site during the project period of 2001-2002, followed by a description of the conferences and workshops at which some of the web-based activities were showcased. Next is a brief summary of the web site's traffic statistics demonstrating its worldwide educational impact, followed by a listing of some of the awards and accolades the web site has received.

  7. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    PubMed

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  8. X-ray crystal structure of divalent metal-activated ß-xyloisdase, RS223BX

    USDA-ARS?s Scientific Manuscript database

    We report the first X-ray structure of a glycoside hydrolase family 43 ß-xylosidase, RS223BX, which is strongly activated by the addition of divalent metal cations. The 2.69 Å structure reveals that the Ca2+ cation is located at the back of the active site pocket. The Ca2+ coordinates to H274 to sta...

  9. A description of the index of active Florida water data collection stations and a user's guide for station or site information retrieval using computer program Findex H578

    USGS Publications Warehouse

    Merritt, M.L.

    1977-01-01

    A computerized index of water-data collection activities and retrieval software to generate publication list of this information was developed for Florida. This system serves a vital need in the administration of the many and diverse water-data collection activities. Previously, needed data was very difficult to assemble for use in program planning or project implementation. Largely descriptive, the report tells how a file of computer card images has been established which contains entries for all sites in Florida at which there is currently a water-data-collection activity. Entries include information such as identification number, station name, location, type of site, county, information about data collection, funding, and other pertinent details. The computer program FINDEX selectively retrieves entries and lists them in a format suitable for publication. Updating the index is done routinely. (Woodard-USGS)

  10. Biochemical indicators of contaminant exposure in birds and turtles of the Great Lakes-St. Lawrence River

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bishop, C.; Trudeau, S.; Kennedy, S.

    1995-12-31

    Pre-fledgling chicks of tree swallows, double-crested cormorants, herring gulls, common terns and hatchling snapping turtles were collected from contaminated Areas of Concern and reference sites in the Great Lakes and St. Lawrence River to determine the geographic and species variation in biomarker responses. EROD activity in colonial waterbirds was generally an order of magnitude above EROD activity in tree swallows and snapping turtles. Notably, EROD activity in colonial waterbirds did not correlate with organochlorine contamination in livers at one industrialized site suggesting that exposure to other contaminants, possibly PAHs, may be an important factor. Retinol concentrations in cormorants were non-detectablemore » and retinyl palmitate concentrations were equal or greater than those in herring gulls. In tree swallows, there was a significant negative correlation between vitamin A concentration in liver and kidney and EROD activity. In snapping turtles, there was a significant induction in EROD activity and significantly higher cytochrome P450 IAI level in livers from the Great Lakes site relative to a clean inland location. There were no significant differences in porphyrin concentrations between sites.« less

  11. Coupling of ionosphere and troposphere during the occurrence of isolated tornadoes on November 20, 1973

    NASA Technical Reports Server (NTRS)

    Hung, R. J.; Phan, T.; Smith, R. E.

    1979-01-01

    The paper examines the coupling between the ionosphere and the troposphere during time periods with isolated tornadoes on the stormy day of November 20, 1973. Observations are made with a high-frequency CW Doppler array system, in which radio receivers located at a central site monitored signals transmitted from three independent remote sites on three sets of frequencies (4.0125, 4.759, 5.734 MHz) and reflected off the ionosphere approximately halfway between the transmitter and receiver sites. It is shown that the sources of the gravity waves associated with tornadoes are always on the squall lines and near the tornado touchdown locations, and that analyses of ionospheric Doppler sounder observations of medium-scale gravity waves can contribute to the understanding of the coupling between the ionosphere and the troposphere during periods of severe storm activity.

  12. The Willard L. Eccles Observatory: Commissioning and Development of Remote Operation Capabilities

    NASA Astrophysics Data System (ADS)

    Springer, Wayne; Dawson, Kyle; Gondolo, Paolo; Ricketts, Paul; Ramsrud, Nicolas; Samarasingha, Upul

    2011-03-01

    The University of Utah completed construction of the Willard L. Eccles Observatory located on Frisco Peak near Milford, UT in October 2009. The observatory site is located on a prominent peak at an altitude of approximately 9600 feet in a region with minimal light pollution. The Frisco Peak site was chosen after careful consideration of many factors including climate, light pollution and available infrastructure. The facility houses a 32" telescope manufactured by DFM Engineering of Longmont, CO. Further development of remote operation capabilities is currently being undertaken. Monitoring of the weather and seeing conditions are being performed and confirm the excellent nature of the site for astronomical observations. The observatory facilities will be used for educational and public outreach activities as well as research projects. A description of the facility and its planned use will be provided.

  13. Renewable Molecular Flasks with NADH Models: Combination of Light-Driven Proton Reduction and Biomimetic Hydrogenation of Benzoxazinones.

    PubMed

    Zhao, Liang; Wei, Jianwei; Lu, Junhua; He, Cheng; Duan, Chunying

    2017-07-17

    Using small molecules with defined pockets to catalyze chemical transformations resulted in attractive catalytic syntheses that echo the remarkable properties of enzymes. By modulating the active site of a nicotinamide adenine dinucleotide (NADH) model in a redox-active molecular flask, we combined biomimetic hydrogenation with in situ regeneration of the active site in a one-pot transformation using light as a clean energy source. This molecular flask facilitates the encapsulation of benzoxazinones for biomimetic hydrogenation of the substrates within the inner space of the flask using the active sites of the NADH models. The redox-active metal centers provide an active hydrogen source by light-driven proton reduction outside the pocket, allowing the in situ regeneration of the NADH models under irradiation. This new synthetic platform, which offers control over the location of the redox events, provides a regenerating system that exhibits high selectivity and efficiency and is extendable to benzoxazinone and quinoxalinone systems. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Rock slope stability analysis along the North Carolina section of the Blue Ridge Parkway: Using a geographic information system (GIS) to integrate site data and digital geologic maps

    USGS Publications Warehouse

    Latham, R.S.; Wooten, R.M.; Cattanach, B.L.; Merschat, C.E.; Bozdog, G.N.

    2009-01-01

    In 2008, the North Carolina Geological Survey (NCGS) completed a five-year geologic and geohazards inventory of the 406-km long North Carolina segment of the Blue Ridge Parkway (BRP). The ArcGIS??? format deliverables for rock slopes include a slope movement and slope movement deposit database and maps and site-specific rock slope stability assessments at 158 locations. Database entries for known and potential rock slope failures include: location data, failure modes and dimensions, activity dates and levels, structural and lithologic data, the occurrence of sulfide minerals and acid-producing potential test results. Rock slope stability assessments include photographs of the rock cuts and show locations and orientations of rock data, seepage zones, and kinematic stability analyses. Assigned preliminary geologic hazard ratings of low, moderate and high indicate the generalized relative probability of rock fall and/or rock slide activity at a given location. Statistics compiled based on the database indicate some general patterns within the data. This information provides the National Park Service with tools that can aid in emergency preparedness, and in budgeting mitigation, maintenance and repair measures. Copyright 2009 ARMA, American Rock Mechanics Association.

  15. Local and systemic tumor immune dynamics

    NASA Astrophysics Data System (ADS)

    Enderling, Heiko

    Tumor-associated antigens, stress proteins, and danger-associated molecular patterns are endogenous immune adjuvants that can both initiate and continually stimulate an immune response against a tumor. In retaliation, tumors can hijack intrinsic immune regulatory programs that are intended to prevent autoimmune disease, thereby facilitating continued growth despite the activated antitumor immune response. In metastatic disease, this ongoing tumor-immune battle occurs at each site. Adding an additional layer of complexity, T cells activated at one tumor site can cycle through the blood circulation system and extravasate in a different anatomic location to surveil a distant metastasis. We propose a mathematical modeling framework that incorporates the trafficking of activated T cells between metastatic sites. We extend an ordinary differential equation model of tumor-immune system interactions to multiple metastatic sites. Immune cells are activated in response to tumor burden and tumor cell death, and are recruited from tumor sites elsewhere in the body. A model of T cell trafficking throughout the circulatory system can inform the tumor-immune interaction model about the systemic distribution and arrival of T cells at specific tumor sites. Model simulations suggest that metastases not only contribute to immune surveillance, but also that this contribution varies between metastatic sites. Such information may ultimately help harness the synergy of focal therapy with the immune system to control metastatic disease.

  16. Corrective Action Investigation Plan for Corrective Action Unit 541: Small Boy Nevada National Security Site and Nevada Test and Training Range, Nevada with ROTC 1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matthews, Patrick

    Corrective Action Unit (CAU) 541 is co-located on the boundary of Area 5 of the Nevada National Security Site and Range 65C of the Nevada Test and Training Range, approximately 65 miles northwest of Las Vegas, Nevada. CAU 541 is a grouping of sites where there has been a suspected release of contamination associated with nuclear testing. This document describes the planned investigation of CAU 541, which comprises the following corrective action sites (CASs): 05-23-04, Atmospheric Tests (6) - BFa Site; 05-45-03, Atmospheric Test Site - Small Boy. These sites are being investigated because existing information on the nature andmore » extent of potential contamination is insufficient to evaluate and recommend corrective action alternatives (CAAs). Additional information will be obtained by conducting a corrective action investigation before evaluating CAAs and selecting the appropriate corrective action for each CAS. The results of the field investigation will support a defensible evaluation of viable CAAs that will be presented in the investigation report. The sites will be investigated based on the data quality objectives (DQOs) developed on April 1, 2014, by representatives of the Nevada Division of Environmental Protection; U.S. Air Force; and the U.S. Department of Energy (DOE), National Nuclear Security Administration Nevada Field Office. The DQO process was used to identify and define the type, amount, and quality of data needed to develop and evaluate appropriate corrective actions for CAU 541. The site investigation process also will be conducted in accordance with the Soils Activity Quality Assurance Plan, which establishes requirements, technical planning, and general quality practices to be applied to this activity. The potential contamination sources associated with CASs 05-23-04 and 05-45-03 are from nuclear testing activities conducted at the Atmospheric Tests (6) - BFa Site and Atmospheric Test Site - Small Boy sites. The presence and nature of contamination at CAU 541 will be evaluated based on information collected from field investigations. Radiological contamination will be evaluated based on a comparison of the total effective dose at sample locations to the dose-based final action level. The total effective dose will be calculated as the total of separate estimates of internal and external dose. Results from the analysis of soil samples will be used to calculate internal radiological dose. Thermoluminescent dosimeters placed at the center of each sample location will be used to measure external radiological dose. Appendix A provides a detailed discussion of the DQO methodology and the DQOs specific to each CAS.« less

  17. Fragile Sites of ‘Valencia’ Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA

    PubMed Central

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in ‘Valencia’ C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of ‘Valencia’ C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid ‘Valencia’ C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in ‘Valencia’ sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in ‘Valencia’ sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  18. Fragile Sites of 'Valencia' Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA.

    PubMed

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in 'Valencia' C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of 'Valencia' C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid 'Valencia' C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in 'Valencia' sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in 'Valencia' sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites.

  19. Movement, home range, and site fidelity of bluegills in a Great Plains Lake

    USGS Publications Warehouse

    Paukert, C.P.; Willis, D.W.; Bouchard, M.A.

    2004-01-01

    Little is known about the distribution, movement, and home ranges of bluegills Lepomis macrochirus in lentic environments. Therefore, the objectives of this study were to evaluate the seasonal and diel differences in movement rates, site fidelity, and home range of bluegills in a shallow, natural Great Plains lake. A total of 78 bluegills (200-273 mm total length) were implanted with radio transmitters in March and May 2000. Of these fish, 10 males and 10 females were randomly selected and located every 2 h during one 24-h period each month from April to September 2000. Bluegill movement peaked during midsummer: however, there was little difference in diel movements, suggesting relatively consistent movement throughout the 24-h period. Home range estimates (which included the 24-h tracking plus an additional six locations from the same fish located once per day for six consecutive days each month) ranged up to 172 ha, probably because only about half of the bluegills exhibited site fidelity during any month sampled. Bluegill movement did not appear to be strongly linked with water temperature, barometric pressure, or wind speed. These results suggest that bluegills move considerable distances and that many roam throughout this 332-ha shallow lake. However, diel patterns were not evident. Sampling bluegills in Great Plains lakes using passive gears (e.g., trap nets) may be most effective during the summer months, when fish are most active. Active sampling (e.g., electrofishing) may be more effective than the use of passive gears in spring and fall, when bluegills are less active.

  20. Contamination of potentially toxic elements in streams and water sediments in the area of abandoned Pb-Zn-Cu deposits (Hrubý Jesenník, Czech Republic)

    NASA Astrophysics Data System (ADS)

    Lichnovský, J.; Kupka, J.; Štěrbová, V.; Andráš, P.; Midula, P.

    2017-10-01

    The deposits, located in Nová Ves and Zlaté Hory were well known and important sources of metal ore in Jesenniky region in the past. Especially the one in Nová Ves, which is recently the most important hydrothermal deposit of venous type in the whole area. The mining activity, aimed on lead and zinc minerals was practically permanent here from the middle-age to 1959. On the other hand, the site in Zlaté Hory is the most important ore deposit in Czech Silesia. The non-venous types of polymetallic, copper and gold deposits, evolved in the complex of metamorphic devon rocks are located on south and south-west directions of the area. Long and permanent mining industry caused remarkable changes in the local environment, creating mine heaps and depressions. The probability, that dump material contains potentially toxic substances that could be possibly leaked into surrounded environment is high. This contribution presents the part of complex study results, aimed on evaluating of potential environmental impacts in above mentioned locations. It aims on contamination, caused by potentially toxic heavy metals (Pb, Zn, Cu, Ni, Fe, Mn, Co, Cd, Cr and As) at the sites, exposed to mining activity in the past. The study focus on the contamination of these sites and evaluate them as potential risk for surrounded environment.

  1. Annual Hanford Seismic Report for Fiscal Year 2009

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohay, Alan C.; Sweeney, Mark D.; Hartshorn, Donald C.

    2009-12-31

    The Hanford Seismic Assessment Program (HSAP) provides an uninterrupted collection of high-quality raw and processed seismic data from the Hanford Seismic Network for the U.S. Department of Energy and its contractors. The HSAP is responsible for locating and identifying sources of seismic activity and monitoring changes in the historical pattern of seismic activity at the Hanford Site. The data are compiled, archived, and published for use by the Hanford Site for waste management, natural phenomena hazards assessments, and engineering design and construction. In addition, the HSAP works with the Hanford Site Emergency Services Organization to provide assistance in the eventmore » of a significant earthquake on the Hanford Site. The Hanford Seismic Network and the Eastern Washington Regional Network consist of 44 individual sensor sites and 15 radio relay sites maintained by the Hanford Seismic Assessment Team. During FY 2009, the Hanford Seismic Network recorded nearly 3000 triggers on the seismometer system, which included over 1700 seismic events in the southeast Washington area and an additional 370 regional and teleseismic events. There were 1648 events determined to be local earthquakes relevant to the Hanford Site. Nearly all of these earthquakes were detected in the vicinity of Wooded Island, located about eight miles north of Richland just west of the Columbia River. Recording of the Wooded Island events began in January with over 250 events per month through June 2009. The frequency of events decreased starting in July 2009 to approximately 10-15 events per month through September 2009. Most of the events were considered minor (coda-length magnitude [Mc] less than 1.0) with 47 events in the 2.0-3.0 range. The estimated depths of the Wooded Island events are shallow (averaging less than 1.0 km deep) with a maximum depth estimated at 2.3 km. This places the Wooded Island events within the Columbia River Basalt Group (CRBG). The highest-magnitude event (3.0Mc) occurred on May 13, 2009 within the Wooded Island swarm at depth 1.8 km. With regard to the depth distribution, 1613 earthquakes were located at shallow depths (less than 4 km, most likely in the Columbia River basalts), 18 earthquakes were located at intermediate depths (between 4 and 9 km, most likely in the pre-basalt sediments), and 17 earthquakes were located at depths greater than 9 km, within the crystalline basement. Geographically, 1630 earthquakes were located in swarm areas and 18 earthquakes were classified as random events. The low magnitude of the Wooded Island events has made them undetectable to all but local area residents. However, some Hanford employees working within a few miles of the area of highest activity and individuals living in homes directly across the Columbia River from the swarm center have reported feeling many of the larger magnitude events. The Hanford Strong Motion Accelerometer (SMA) network was triggered numerous times by the Wooded Island swarm events. The maximum acceleration value recorded by the SMA network was approximately 3 times lower than the reportable action level for Hanford facilities (2% g) and no action was required. The swarming is likely due to pressure that has built up, cracking the brittle basalt layers within the Columbia River Basalt Formation (CRBG). Similar earthquake “swarms” have been recorded near this same location in 1970, 1975 and 1988. Prior to the 1970s, swarming may have occurred, but equipment was not in place to record those events. Quakes of this limited magnitude do not pose a risk to Hanford cleanup efforts or waste storage facilities. Since swarms of the past did not intensify in magnitude, seismologists do not expect that these events will increase in intensity. However, Pacific Northwest National Laboratory (PNNL) will continue to monitor the activity.« less

  2. Determination of the location of positive charges in gas-phase polypeptide polycations by tandem mass spectrometry

    NASA Astrophysics Data System (ADS)

    Kjeldsen, Frank; Savitski, Mikhail M.; Adams, Christopher M.; Zubarev, Roman A.

    2006-06-01

    Location of protonated sites in electrospray-ionized gas-phase peptides and proteins was performed with tandem mass spectrometry using ion activation by both electron capture dissociation (ECD) and collisional activation dissociation (CAD). Charge-carrying sites were assigned based on the increment in the charge state of fragment ions compared to that of the previous fragment in the same series. The property of ECD to neutralize preferentially the least basic site was confirmed by the analysis of three thousand ECD mass spectra of doubly charged tryptic peptides. Multiply charged cations of bradykinin, neurotensin and melittin were studied in detail. For n+ precursors, ECD revealed the positions of (n - 1) most basic sites, while CAD could in principle locate alln charges. However, ECD introduced minimal proton mobilization and produced more conclusive data than CAD, for which N- and C-terminal data often disagreed. Consistent with the dominance of one charge conformer and its preservation in ECD, the average charge states of complementary fragments of n+ ions almost always added up to (n - 1)+, while the similar figure in CAD often deviated from n+, indicating extensive charge isomerization under collisional excitation. For bradykinin and neurotensin, the charge assignments were largely in agreement with the intrinsic gas-phase basicity of the respective amino acid residues. For melittin ions in higher charge states, ECD revealed the charging at both intrinsically basic as well as at less basic residues, which was attributed to charge sharing with other groups due to the presence of secondary and higher order structures in this larger polypeptide.

  3. Pinellas County, Florida Site Environmental Restoration Project Semiannual Progress Report for the 4.5 Acre Site June through November 2016 January 2017

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Survochak, Scott; Daniel, Joe

    This Pinellas County, Florida, Site Environmental Restoration Project Semiannual Progress Report for the 4.5 Acre Site describes environmental restoration activities for the 4.5 Acre Site located in Pinellas County, Largo, Florida (Figure 1). The former U.S. Department of Energy (DOE) Pinellas Plant facility consisted of the 4.5 Acre Site and what is now the STAR Center (Young - Rainey Science, Technology, and Research Center). Both the 4.5 Acre Site and the STAR Center are part of the overall Pinellas County, Florida, Site (Figure 2). The 4.5 Acre Site is located immediately northwest of the STAR Center, in the northeast quartermore » of Section 13, Township 30 South, Range 15 East. DOE owned this parcel from 1957 to 1972, at which time it was sold to a private landowner. During the period of DOE ownership, the property was used for the disposal of drums of waste resins and solvents. As a result of this practice, the surficial aquifer was impacted by volatile organic compounds (VOCs)—trichloroethene (TCE), cis-1,2-dichloroethene (cDCE), trans-1,2-dichloroethene (tDCE), vinyl chloride (VC), and benzene. Detailed background information for the site is contained in the Long-Term Surveillance and Maintenance Plan for the Pinellas Site (DOE 2016). That document and other site-related documents can be accessed at this website: http://www.lm.doe.gov/Pinellas/Sites.aspx. Recent remediation activities consist of the injection of emulsified soybean oil and the microorganism Dehalococcoides mccartyi (formerly known as Dehalococcoides ethenogenes) into the subsurface in February 2010 and again in July 2013 to enhance contaminant biodegradation (hereafter described as bioinjection). Monitoring the performance of these actions, in the form of monitoring well sampling, is ongoing.« less

  4. Nevada National Security Site Environmental Report Summary 2016

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wills, Cathy

    This document is a summary of the full 2016 Nevada National Security Site Environmental Report (NNSSER) prepared by the U.S. Department of Energy, National Nuclear Security Administration Nevada Field Office (NNSA/ NFO). This summary provides an abbreviated and more readable version of the full NNSSER. NNSA/NFO prepares the NNSSER to provide the public an understanding of the environmental monitoring and compliance activities that are conducted on the Nevada National Security Site (NNSS) to protect the public and the environment from radiation hazards and from potential nonradiological impacts. It is a comprehensive report of environmental activities performed at the NNSS andmore » offsite facilities over the previous calendar year. The NNSS is currently the nation’s unique site for ongoing national security–related missions and high-risk operations. The NNSS is located about 65 miles northwest of Las Vegas. The approximately 1,360-square-mile site is one of the largest restricted access areas in the United States. It is surrounded by federal installations with strictly controlled access as well as by lands that are open to public entry. In 2016, National Security Technologies, LLC (NSTec), was the NNSS Management and Operations Contractor accountable for ensuring work was performed in compliance with environmental regulations. NNSS activities in 2016 continued to be diverse, with the primary goal to ensure that the existing U.S. stockpile of nuclear weapons remains safe and reliable. Other activities included weapons of mass destruction first responder training; the controlled release of hazardous material at the Nonproliferation Test and Evaluation Complex (NPTEC); remediation of legacy contamination sites; characterization of waste destined for the Waste Isolation Pilot Plant in Carlsbad, New Mexico, or the Idaho National Laboratory in Idaho Falls, Idaho; disposal of low-level and mixed low-level radioactive waste; and environmental research. Facilities and centers that support the National Security/Defense mission include the U1a Facility, Big Explosives Experimental Facility (BEEF), Device Assembly Facility (DAF), National Criticality Experiments Research Center (NCERC) located in the DAF, Joint Actinide Shock Physics Experimental Research (JASPER) Facility, Dense Plasma Focus (DPF) Facility located in the Los Alamos Technical Facility (LATF), and the Radiological/ Nuclear Countermeasures Test and Evaluation Complex (RNCTEC). Facilities that support the Environmental Management mission include the Area 5 Radioactive Waste Management Complex (RWMC) and the Area 3 Radioactive Waste Management Site (RWMS), which has been in cold standby since 2006.« less

  5. Selected Water- and Sediment-Quality, Aquatic Biology, and Mine-Waste Data from the Ely Copper Mine Superfund Site, Vershire, VT, 1998-2007

    USGS Publications Warehouse

    Argue, Denise M.; Kiah, Richard G.; Piatak, Nadine M.; Seal, Robert R.; Hammarstrom, Jane M.; Hathaway, Edward; Coles, James F.

    2008-01-01

    The data contained in this report are a compilation of selected water- and sediment-quality, aquatic biology, and mine-waste data collected at the Ely Copper Mine Superfund site in Vershire, VT, from August 1998 through May 2007. The Ely Copper Mine Superfund site is in eastern, central Vermont (fig. 1) within the Vermont Copper Belt (Hammarstrom and others, 2001). The Ely Copper Mine site was placed on the U.S. Environmental Protection Agency (USEPA) National Priorities List in 2001. Previous investigations conducted at the site documented that the mine is contributing metals and highly acidic waters to local streams (Hammarstrom and others, 2001; Holmes and others, 2002; Piatak and others, 2003, 2004, and 2006). The U.S. Geological Survey (USGS), in cooperation with the USEPA, compiled selected data from previous investigations into uniform datasets that will be used to help characterize the extent of contamination at the mine. The data may be used to determine the magnitude of biological impacts from the contamination and in the development of remediation activities. This report contains analytical data for samples collected from 98 stream locations, 6 pond locations, 21 surface-water seeps, and 29 mine-waste locations. The 98 stream locations are within 3 streams and their tributaries. Ely Brook flows directly through the Ely Copper Mine then into Schoolhouse Brook (fig. 2), which joins the Ompompanoosuc River (fig. 1). The six pond locations are along Ely Brook Tributary 2 (fig. 2). The surface-water seeps and mine-waste locations are near the headwaters of Ely Brook (fig. 2 and fig. 3). The datasets 'Site_Directory' and 'Coordinates' contain specific information about each of the sample locations including stream name, number of meters from the mouth of stream, geographic coordinates, types of samples collected (matrix of sample), and the figure on which the sample location is depicted. Data have been collected at the Ely Copper Mine Superfund site by the USEPA, the Vermont Department of Environmental Conservation (VTDEC), and the USGS. Data also have been collected on behalf of USEPA by the following agencies: Arthur D. Little Incorporated (ADL), U.S. Army Cold Region Research and Engineering Laboratory (CRREL), URS Corporation (URS), USEPA, and USGS. These data provide information about the aquatic communities and their habitats, including chemical analyses of surface water, pore water, sediments, and fish tissue; assessments of macroinvertebrate and fish assemblages; physical characteristics of sediments; and chemical analyses of soil and soil leachate collected in and around the piles of mine waste.

  6. Transcriptional Profiling Identifies Functional Interactions of TGFβ and PPARβ/δ Signaling

    PubMed Central

    Kaddatz, Kerstin; Adhikary, Till; Finkernagel, Florian; Meissner, Wolfgang; Müller-Brüsselbach, Sabine; Müller, Rolf

    2010-01-01

    Peroxisome proliferator-activated receptors (PPARs) not only play a key role in regulating metabolic pathways but also modulate inflammatory processes, pointing to a functional interaction between PPAR and cytokine signaling pathways. In this study, we show by genome-wide transcriptional profiling that PPARβ/δ and transforming growth factor-β (TGFβ) pathways functionally interact in human myofibroblasts and that a subset of these genes is cooperatively activated by TGFβ and PPARβ/δ. Using the angiopoietin-like 4 (ANGPTL4) gene as a model, we demonstrate that two enhancer regions cooperate to mediate the observed synergistic response. A TGFβ-responsive enhancer located ∼8 kb upstream of the transcriptional start site is regulated by a mechanism involving SMAD3, ETS1, RUNX, and AP-1 transcription factors that interact with multiple contiguous binding sites. A second enhancer (PPAR-E) consisting of three juxtaposed PPAR response elements is located in the third intron ∼3.5 kb downstream of the transcriptional start site. The PPAR-E is strongly activated by all three PPAR subtypes, with a novel type of PPAR response element motif playing a central role. Although the PPAR-E is not regulated by TGFβ, it interacts with SMAD3, ETS1, RUNX2, and AP-1 in vivo, providing a possible mechanistic explanation for the observed synergism. PMID:20595396

  7. An evaluation of water quality in private drinking water wells near natural gas extraction sites in the Barnett Shale formation.

    PubMed

    Fontenot, Brian E; Hunt, Laura R; Hildenbrand, Zacariah L; Carlton, Doug D; Oka, Hyppolite; Walton, Jayme L; Hopkins, Dan; Osorio, Alexandra; Bjorndal, Bryan; Hu, Qinhong H; Schug, Kevin A

    2013-09-03

    Natural gas has become a leading source of alternative energy with the advent of techniques to economically extract gas reserves from deep shale formations. Here, we present an assessment of private well water quality in aquifers overlying the Barnett Shale formation of North Texas. We evaluated samples from 100 private drinking water wells using analytical chemistry techniques. Analyses revealed that arsenic, selenium, strontium and total dissolved solids (TDS) exceeded the Environmental Protection Agency's Drinking Water Maximum Contaminant Limit (MCL) in some samples from private water wells located within 3 km of active natural gas wells. Lower levels of arsenic, selenium, strontium, and barium were detected at reference sites outside the Barnett Shale region as well as sites within the Barnett Shale region located more than 3 km from active natural gas wells. Methanol and ethanol were also detected in 29% of samples. Samples exceeding MCL levels were randomly distributed within areas of active natural gas extraction, and the spatial patterns in our data suggest that elevated constituent levels could be due to a variety of factors including mobilization of natural constituents, hydrogeochemical changes from lowering of the water table, or industrial accidents such as faulty gas well casings.

  8. Hazardous Waste Cleanup: Chemtura Corporation in Perth Amboy, New Jersey

    EPA Pesticide Factsheets

    The Chemtura Corporation (formerly Crompton Corp.) is located at 10 Convery Boulevard in Perth Amboy, New Jersey. The site encompasses approximately 25 acres, and is an active facility that manufactures chemicals and chemical intermediates for a variety

  9. 77 FR 65360 - Foreign-Trade Zone 168-Dallas/Ft. Worth, TX; Notification of Proposed Production Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-26

    ... (Eyewear Assembly/Kitting), Grand Prairie, TX The Metroplex International Trade Development Corporation... facility is located within Site 4 of FTZ 168. The facility is used for the assembly/kitting of eyewear...

  10. 78 FR 57653 - Agency Information Collection Activities: Comment Request for the Comprehensive Test Ban Treaty...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-19

    ... Secretariat with geographic locations of sites where chemical explosions of 300 tons of TNT-equivalent, or... response. Estimated Reporting and Recordkeeping ``Non-Hour Cost'' Burden: We have not identified any ``non...

  11. FIELD-DRIVEN APPROACHES TO SUBSURFACE CONTAMINANT TRANSPORT MODELING.

    EPA Science Inventory

    Observations from field sites provide a means for prioritizing research activities. In the case of petroleum releases, observations may include spiking of concentration distributions that may be related to water table fluctuation, co-location of contaminant plumes with geochemi...

  12. BCLDP site environmental report for calendar year 1997 on radiological and nonradiological parameters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fry, J.

    1998-09-30

    Battelle Memorial Institute currently maintains its retired nuclear research facilities in a surveillance and maintenance (S and M) mode and continues decontamination and decommissioning (D and D) activities. The activities are referred to as the Battelle Columbus Laboratories Decommissioning Project (BCLDP). Operations reference in this report are performed in support of S and M and D and D activities. The majority of this report is devoted to discussion of the West Jefferson facility, because the source term at this facility is larger than the source term at Battelle`s King Avenue site. The contamination found at the King Avenue site consistsmore » of small amounts of residual radioactive material in solid form, which has become embedded or captured in nearby surfaces such as walls, floors, ceilings, drains, laboratory equipment, and soils. By the end of calendar year (CY) 1997, most remediation activities were completed at the King Avenue site. The contamination found at the West Jefferson site is the result of research and development activities with irradiated materials. During CY 1997, multiple tests at the West Jefferson Nuclear Sciences Area found no isotopes present above the minimum detectable activity (MDA) for air releases or for liquid discharges to Big Darby Creek. Data obtained from downstream sampling locations were statistically indistinguishable from background levels.« less

  13. A Great Lakes atmospheric mercury monitoring network: evaluation and design

    USGS Publications Warehouse

    Risch, Martin R.; Kenski, Donna M.; ,; David, A.

    2014-01-01

    As many as 51 mercury (Hg) wet-deposition-monitoring sites from 4 networks were operated in 8 USA states and Ontario, Canada in the North American Great Lakes Region from 1996 to 2010. By 2013, 20 of those sites were no longer in operation and approximately half the geographic area of the Region was represented by a single Hg-monitoring site. In response, a Great Lakes Atmospheric Mercury Monitoring (GLAMM) network is needed as a framework for regional collaboration in Hg-deposition monitoring. The purpose of the GLAMM network is to detect changes in regional atmospheric Hg deposition related to changes in Hg emissions. An optimized design for the network was determined to be a minimum of 21 sites in a representative and approximately uniform geographic distribution. A majority of the active and historic Hg-monitoring sites in the Great Lakes Region are part of the National Atmospheric Deposition Program (NADP) Mercury Deposition Network (MDN) in North America and the GLAMM network is planned to be part of the MDN. To determine an optimized network design, active and historic Hg-monitoring sites in the Great Lakes Region were evaluated with a rating system of 21 factors that included characteristics of the monitoring locations and interpretations of Hg data. Monitoring sites were rated according to the number of Hg emissions sources and annual Hg emissions in a geographic polygon centered on each site. Hg-monitoring data from the sites were analyzed for long-term averages in weekly Hg concentrations in precipitation and weekly Hg-wet deposition, and on significant temporal trends in Hg concentrations and Hg deposition. A cluster analysis method was used to group sites with similar variability in their Hg data in order to identify sites that were unique for explaining Hg data variability in the Region. The network design included locations in protected natural areas, urban areas, Great Lakes watersheds, and in proximity to areas with a high density of annual Hg emissions and areas with high average weekly Hg wet deposition. In a statistical analysis, relatively strong, positive correlations in the wet deposition of Hg and sulfate were shown for co-located NADP Hg-monitoring and acid-rain monitoring sites in the Region. This finding indicated that efficiency in regional Hg monitoring can be improved by adding new Hg monitoring to existing NADP acid-rain monitoring sites. Implementation of the GLAMM network design will require Hg-wet-deposition monitoring to be: (a) continued at 12 MDN sites active in 2013 and (b) restarted or added at 9 NADP sites where it is absent in 2013. Ongoing discussions between the states in the Great Lakes Region, the Lake Michigan Air Directors Consortium (a regional planning entity), the NADP, the U.S. Environmental Protection Agency, and the U.S. Geological Survey are needed for coordinating the GLAMM network.

  14. LUNAR SITE MAP (APOLLO XV) - MSC

    NASA Image and Video Library

    1971-07-16

    S71-40085 (July 1971) --- An enlarged Lunar Orbiter photograph of the Apollo 15 landing area in the Hadley-Apennine region on the nearside of the moon. The overlay indicates the location of the numerous informally-named surface features. These names will facilitate understanding the verbal descriptions from the astronauts during their lunar surface extravehicular activity (EVA). This is an August 1967, Lunar Orbiter V photograph of Site 26.1.

  15. Characterizing of a Mid-Latitude Ice-Rich Landing Site on Mars to Enable in Situ Habitability Studies

    NASA Technical Reports Server (NTRS)

    Heldmann, J.; Schurmeier, L. R.; Wilhelm, M.; Stoker, C.; McKay, C.; Davila, A.; Marinova, M.; Karcz, J.; Smith, H.

    2012-01-01

    We suggest an ice-rich landing site at 188.5E 46.16N within Amazonis Planitia as a candidate location to support a Mars lander mission equipped to study past habitability and regions capable of preserving the physical and chemical signs of life and organic matter. Studies of the ice-rich subsurface on Mars are critical for several reasons. The subsurface environment provides protection from radiation to shield organic and biologic compounds from destruction. The ice-rich substrate is also ideal for preserving organic and biologic molecules and provides a source of H2O for biologic activity. Examination of martian ground ice can test several hypotheses such as: 1) whether ground ice supports habitable conditions, 2) that ground ice can preserve and accumulate organic compounds, and 3) that ice contains biomolecules evident of past or present biological activity on Mars. This Amazonis site, located near the successful Viking Lander 2, shows indirect evidence of subsurface ice (ubiquitous defined polygonal ground, gamma ray spectrometer hydrogen signature, and numerical modeling of ice stability) and direct evidence of exposed subsurface ice. This site also provides surface conditions favorable to a safe landing including no boulders, low rock density, minimal rough topography, and few craters.

  16. In silico modeling and experimental evidence of coagulant protein interaction with precursors for nanoparticle functionalization.

    PubMed

    Okoli, Chuka; Sengottaiyan, Selvaraj; Arul Murugan, N; Pavankumar, Asalapuram R; Agren, Hans; Kuttuva Rajarao, Gunaratna

    2013-10-01

    The design of novel protein-nanoparticle hybrid systems has applications in many fields of science ranging from biomedicine, catalysis, water treatment, etc. The main barrier in devising such tool is lack of adequate information or poor understanding of protein-ligand chemistry. Here, we establish a new strategy based on computational modeling for protein and precursor linkers that can decorate the nanoparticles. Moringa oleifera (MO2.1) seed protein that has coagulation and antimicrobial properties was used. Superparamagnetic nanoparticles (SPION) with precursor ligands were used for the protein-ligand interaction studies. The molecular docking studies reveal that there are two binding sites, one is located at the core binding site; tetraethoxysilane (TEOS) or 3-aminopropyl trimethoxysilane (APTES) binds to this site while the other one is located at the side chain residues where trisodium citrate (TSC) or Si60 binds to this site. The protein-ligand distance profile analysis explains the differences in functional activity of the decorated SPION. Experimentally, TSC-coated nanoparticles showed higher coagulation activity as compared to TEOS- and APTES-coated SPION. To our knowledge, this is the first report on in vitro experimental data, which endorses the computational modeling studies as a powerful tool to design novel precursors for functionalization of nanomaterials; and develop interface hybrid systems for various applications.

  17. Fine-Tuning the Activity of Metal–Organic Framework Supported Cobalt Catalysts for the Oxidative Dehydrogenation of Propane

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Zhanyong; Peters, Aaron W.; Platero-Prats, Ana E.

    Few-atom cobalt-oxide clusters, when dispersed on a Zr-based metal–organic framework (MOF) NU-1000, have previously been shown to be active for the oxidative dehydrogenation (ODH) of propane at low temperatures (< 230 °C), affording a selective and stable propene production catalyst. In our current work, a series of promoter ions with varying Lewis acidity, including Ni(II), Zn(II), Al(III), Ti(IV) and Mo(VI), are anchored as metal-oxide,hydroxide clusters to NU-1000 via SIM (solvothermal deposition within MOFs–specifically the nodes) followed by incorporation of Co(II) ions via vapor-phase AIM (atomic layer deposition (ALD) in MOFs). This process yields a series of NU-1000-supported bimetallic-oxo,hydroxo,aqua clusters. Usingmore » difference envelope density (DED) analyses, the spatial locations of the promoter ions and catalytic cobalt ions are determined. For all samples the SIM-anchored promoter ions are sited between pairs of Zr 6 nodes along the MOF c-axis (channel-aligned axis) whereas the location of the AIM-anchored cobalt ions varies depending on the identity of promoter metal ion. With Ni(II)-, Al(III)-, or Ti(IV)-containing clusters as promoters, the oxy-cobalt species are sited atop the promoter sites; with Mo(VI) they grow exclusively on the MOF nodes sites (hexa-Zr(IV)- oxo,hydroxo,aqua units); with Zn(II) they grow on both the node and promoter. The NU-1000- supported bimetallic-oxide clusters are active for propane ODH after thermal activation under O 2 to open a cobalt coordination site and to oxidize Co(II) to Co(III), as evidenced by operando Xray absorption spectroscopy at the Co K-edge. The cobalt component is exclusively responsible for the observed catalysis. In accord with the decreasing Lewis acidity of the promoter ion, catalytic activity increases in the order: Mo(VI)« less

  18. Fine-Tuning the Activity of Metal–Organic Framework Supported Cobalt Catalysts for the Oxidative Dehydrogenation of Propane

    DOE PAGES

    Li, Zhanyong; Peters, Aaron W.; Platero-Prats, Ana E.; ...

    2017-10-04

    Few-atom cobalt-oxide clusters, when dispersed on a Zr-based metal–organic framework (MOF) NU-1000, have previously been shown to be active for the oxidative dehydrogenation (ODH) of propane at low temperatures (< 230 °C), affording a selective and stable propene production catalyst. In our current work, a series of promoter ions with varying Lewis acidity, including Ni(II), Zn(II), Al(III), Ti(IV) and Mo(VI), are anchored as metal-oxide,hydroxide clusters to NU-1000 via SIM (solvothermal deposition within MOFs–specifically the nodes) followed by incorporation of Co(II) ions via vapor-phase AIM (atomic layer deposition (ALD) in MOFs). This process yields a series of NU-1000-supported bimetallic-oxo,hydroxo,aqua clusters. Usingmore » difference envelope density (DED) analyses, the spatial locations of the promoter ions and catalytic cobalt ions are determined. For all samples the SIM-anchored promoter ions are sited between pairs of Zr 6 nodes along the MOF c-axis (channel-aligned axis) whereas the location of the AIM-anchored cobalt ions varies depending on the identity of promoter metal ion. With Ni(II)-, Al(III)-, or Ti(IV)-containing clusters as promoters, the oxy-cobalt species are sited atop the promoter sites; with Mo(VI) they grow exclusively on the MOF nodes sites (hexa-Zr(IV)- oxo,hydroxo,aqua units); with Zn(II) they grow on both the node and promoter. The NU-1000- supported bimetallic-oxide clusters are active for propane ODH after thermal activation under O 2 to open a cobalt coordination site and to oxidize Co(II) to Co(III), as evidenced by operando Xray absorption spectroscopy at the Co K-edge. The cobalt component is exclusively responsible for the observed catalysis. In accord with the decreasing Lewis acidity of the promoter ion, catalytic activity increases in the order: Mo(VI)« less

  19. Executive summary: Weldon Spring Site Environmental Report for calendar year 1992. Weldon Spring Site Remedial Action Project, Weldon Spring, Missouri

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1993-06-01

    This report has been prepared to provide information about the public safety and environmental protection programs conducted by the Weldon Spring Site Remedial Action Project. The Weldon Spring site is located in southern St. Charles County, Missouri, approximately 48 km (30 mi) west of St. Louis. The site consists of two main areas, the Weldon Spring Chemical Plant and raffinate pits and the Weldon Spring Quarry. The objectives of the Site Environmental Report are to present a summary of data from the environmental monitoring program, to characterize trends and environmental conditions at the site, and to confirm compliance with environmentalmore » and health protection standards and requirements. The report also presents the status of remedial activities and the results of monitoring these activities to assess their impacts on the public and environment. The scope of the environmental monitoring program at the Weldon Spring site has changed since it was initiated. Previously, the program focused on investigations of the extent and level of contaminants in the groundwater, surface waters, buildings, and air at the site. In 1992, the level of remedial activities required monitoring for potential impacts of those activities, particularly on surface water runoff and airborne effluents. This report includes monitoring data from routine radiological and nonradiological sampling activities. These data include estimates of dose to the public from the Weldon Spring site; estimates of effluent releases; and trends in groundwater contaminant levels. Also, applicable compliance requirements, quality assurance programs, and special studies conducted in 1992 to support environmental protection programs are reviewed.« less

  20. Instrumenting the Conifers: A Look at Daily Tree Growth and Locally Observed Environmental Conditions Across Four Mountain Sites in the Central Great Basin, USA

    NASA Astrophysics Data System (ADS)

    Strachan, S.; Biondi, F.; Johnson, B. G.

    2012-12-01

    Tree growth is often used as a proxy for past environmental conditions or as an indicator of developing trends. Reconstructions of drought, precipitation, temperature, and other phenomena derived from tree-growth indices abound in scientific literature aimed at informing policy makers. Observations of tree recruitment or death in treeline populations are frequently tied to climatic fluctuation in cause-effect hypotheses. Very often these hypotheses are based on statistical relationships between annual-to-seasonal tree growth measurements and some environmental parameter measured or modeled off-site. Observation of daily tree growth in conjunction with in-situ environmental measurements at similar timescales takes us one step closer to quantifying the uncertainty in reconstruction or predictive studies. In four separate sites in two different mountain ranges in the central Great Basin, co-located observations of conifer growth activity and local atmospheric and soils conditions have been initiated. Species include Pinus longaeva (Great Basin bristlecone pine), Pinus flexilis (limber pine), Picea engelmannii (Engelmann spruce), Pinus monophylla (singleleaf pinyon pine), Pinus ponderosa (ponderosa pine), Abies concolor (white fir), and Pseudotsuga menziesii (Douglas-fir). Measurements of sub-hourly tree radial length change and sap flow activity are compared with a suite of in-situ observations including air temperature, precipitation, photosynthetically-active radiation (PAR), relative humidity, soil temperature, and soil moisture/water content. Subalpine study site located at 3360 m elevation in the Snake Range, Nevada

  1. Sequence requirement of the ade6-4095 meiotic recombination hotspot in Schizosaccharomyces pombe.

    PubMed

    Foulis, Steven J; Fowler, Kyle R; Steiner, Walter W

    2018-02-01

    Homologous recombination occurs at a greatly elevated frequency in meiosis compared to mitosis and is initiated by programmed double-strand DNA breaks (DSBs). DSBs do not occur at uniform frequency throughout the genome in most organisms, but occur preferentially at a limited number of sites referred to as hotspots. The location of hotspots have been determined at nucleotide-level resolution in both the budding and fission yeasts, and while several patterns have emerged regarding preferred locations for DSB hotspots, it remains unclear why particular sites experience DSBs at much higher frequency than other sites with seemingly similar properties. Short sequence motifs, which are often sites for binding of transcription factors, are known to be responsible for a number of hotspots. In this study we identified the minimum sequence required for activity of one of such motif identified in a screen of random sequences capable of producing recombination hotspots. The experimentally determined sequence, GGTCTRGACC, closely matches the previously inferred sequence. Full hotspot activity requires an effective sequence length of 9.5 bp, whereas moderate activity requires an effective sequence length of approximately 8.2 bp and shows significant association with DSB hotspots. In combination with our previous work, this result is consistent with a large number of different sequence motifs capable of producing recombination hotspots, and supports a model in which hotspots can be rapidly regenerated by mutation as they are lost through recombination.

  2. Human Health and Ecological Risk Assessment for the Operation of the Explosives Waste Treatment Facility at Site 300 of the Lawrence Livermore National Laboratory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gallegos, G; Daniels, J; Wegrecki, A

    2007-10-01

    This document contains the human health and ecological risk assessment for the Resource Recovery and Conservation Act (RCRA) permit renewal for the Explosives Waste Treatment Facility (EWTF). Volume 1 is the text of the risk assessment, and Volume 2 (provided on a compact disc) is the supporting modeling data. The EWTF is operated by the Lawrence Livermore National Laboratory (LLNL) at Site 300, which is located in the foothills between the cities of Livermore and Tracy, approximately 17 miles east of Livermore and 8 miles southwest of Tracy. Figure 1 is a map of the San Francisco Bay Area, showingmore » the location of Site 300 and other points of reference. One of the principal activities of Site 300 is to test what are known as 'high explosives' for nuclear weapons. These are the highly energetic materials that provide the force to drive fissionable material to criticality. LLNL scientists develop and test the explosives and the integrated non-nuclear components in support of the United States nuclear stockpile stewardship program as well as in support of conventional weapons and the aircraft, mining, oil exploration, and construction industries. Many Site 300 facilities are used in support of high explosives research. Some facilities are used in the chemical formulation of explosives; others are locations where explosive charges are mechanically pressed; others are locations where the materials are inspected radiographically for such defects as cracks and voids. Finally, some facilities are locations where the machined charges are assembled before they are sent to the onsite test firing facilities, and additional facilities are locations where materials are stored. Wastes generated from high-explosives research are treated by open burning (OB) and open detonation (OD). OB and OD treatments are necessary because they are the safest methods for treating explosives wastes generated at these facilities, and they eliminate the requirement for further handling and transportation that would be required if the wastes were treated off site.« less

  3. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  4. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  5. User's Manual for the New England Water-Use Data System (NEWUDS)

    USGS Publications Warehouse

    Horn, Marilee A.

    2003-01-01

    Water is used in a variety of ways that need to be understood for effective management of water resources. Water-use activities need to be categorized and included in a database management system to understand current water uses and to provide information to water-resource management policy decisionmakers. The New England Water-Use Data System (NEWUDS) is a complex database developed to store water-use information that allows water to be tracked from a point of water-use activity (called a 'Site'), such as withdrawal from a resource (reservoir or aquifer), to a second Site, such as distribution to a user (business or irrigator). NEWUDS conceptual model consists of 10 core entities: system, owner, address, location, site, data source, resource, conveyance, transaction/rate, and alias, with tables available to store user-defined details. Three components--site (with both a From Site and a To Site), a conveyance that connects them, and a transaction/rate associated with the movement of water over a specific time interval form the core of the basic NEWUDS network model. The most important step in correctly translating real-world water-use activities into a storable format in NEWUDS depends on choosing the appropriate sites and linking them correctly in a network to model the flow of water from the initial From Site to the final To Site. Ten water-use networks representing real-world activities are described--three withdrawal networks, three return networks, two user networks, two complex community-system networks. Ten case studies of water use, one for each network, also are included in this manual to illustrate how to compile, store, and retrieve the appropriate data. The sequence of data entry into tables is critical because there are many foreign keys. The recommended core entity sequence is (1) system, (2) owner, (3) address, (4) location, (5) site, (6) data source, (7) resource, (8) conveyance, (9) transaction, and (10) rate; with (11) alias and (12) user-defined detail subject areas populated as needed. After each step in data entry, quality-assurance queries should be run to ensure the data are correctly entered so that it can be retrieved accurately. The point of data storage is retrieval. Several retrieval queries that focus on retrieving only relevant data to specific questions are presented in this manual as examples for the NEWUDS user.

  6. 2010 Ecological Survey of the Pacific Northwest National Laboratory Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chamness, Michele A.; Perry, Christopher; Downs, Janelle L.

    The U.S. Department of Energy (DOE) Pacific Northwest Site Office (PNSO) oversees and manages the DOE contract for the Pacific Northwest National Laboratory (PNNL), a DOE Office of Science multi-program laboratory located in Richland, Washington. PNSO is responsible for ensuring that all activities conducted on the PNNL Site comply with applicable laws, policies, and DOE orders. The DOE Pacific Northwest Site Office Cultural and Biological Resources Management Plan (DOE/PNSO 2008) addresses the requirement for annual surveys and monitoring for species of concern and to identify and map invasive species. In addition to the requirement for an annual survey, proposed projectmore » activities must be reviewed to assess any potential environmental consequences of conducting the project. The assessment process requires a thorough understanding of the resources present, the potential impacts of a proposed action to those resources, and the ultimate consequences of those actions. The PNNL Site is situated on the southeastern corner of the DOE Hanford Site, located at the north end of the city of Richland in south-central Washington. The site is bordered on the east by the Columbia River, on the west by Stevens Drive, and on the north by the Hanford Site 300 Area (Figure 1). The environmental setting of the PNNL Site is described in Larson and Downs (2009). There are currently two facilities on the PNNL Site: the William R. Wiley Environmental Molecular Sciences Laboratory (EMSL), and the recently completed Physical Sciences Facility (PSF). This report describes the results of the annual survey of the biological resources found on the undeveloped portions of the PNNL Site in 2010. A brief description of the methods PNNL ecologists used to conduct the surveys and the results of the surveys are presented. Actions taken to fully delineate noxious weed populations discovered in 2009 and efforts in 2010 to control those weeds also are described. Appendix A provides a list of plant and animal species identified on the PNNL Site.« less

  7. XET Activity is Found Near Sites of Growth and Cell Elongation in Bryophytes and Some Green Algae: New Insights into the Evolution of Primary Cell Wall Elongation

    PubMed Central

    Van Sandt, Vicky S. T.; Stieperaere, Herman; Guisez, Yves; Verbelen, Jean-Pierre; Vissenberg, Kris

    2007-01-01

    Background and Aims In angiosperms xyloglucan endotransglucosylase (XET)/hydrolase (XTH) is involved in reorganization of the cell wall during growth and development. The location of oligo-xyloglucan transglucosylation activity and the presence of XTH expressed sequence tags (ESTs) in the earliest diverging extant plants, i.e. in bryophytes and algae, down to the Phaeophyta was examined. The results provide information on the presence of an XET growth mechanism in bryophytes and algae and contribute to the understanding of the evolution of cell wall elongation in general. Methods Representatives of the different plant lineages were pressed onto an XET test paper and assayed. XET or XET-related activity was visualized as the incorporation of fluorescent signal. The Physcomitrella genome database was screened for the presence of XTHs. In addition, using the 3′ RACE technique searches were made for the presence of possible XTH ESTs in the Charophyta. Key Results XET activity was found in the three major divisions of bryophytes at sites corresponding to growing regions. In the Physcomitrella genome two putative XTH-encoding cDNA sequences were identified that contain all domains crucial for XET activity. Furthermore, XET activity was located at the sites of growth in Chara (Charophyta) and Ulva (Chlorophyta) and a putative XTH ancestral enzyme in Chara was identified. No XET activity was identified in the Rhodophyta or Phaeophyta. Conclusions XET activity was shown to be present in all major groups of green plants. These data suggest that an XET-related growth mechanism originated before the evolutionary divergence of the Chlorobionta and open new insights in the evolution of the mechanisms of primary cell wall expansion. PMID:17098750

  8. Sedimentary Controls on Foraminifera Deposition in the Bay of Bengal: Implications from Single Shell Mg/Ca and δ18O

    NASA Astrophysics Data System (ADS)

    Fritz-Endres, T.; Dekens, P.; Spero, H. J.; Fehrenbacher, J. S.; Spiess, V.; France-Lanord, C.

    2016-12-01

    Sediment cores from the Bay of Bengal present an opportunity to improve our understanding of the links between terrestrial and oceanographic climate variability. Foraminifera archive key proxies for reconstructing oceanographic conditions, but in Bengal fan sediments, fossils may have been transported via turbidity currents. Given the difference in SST and SSS variability in the southern (29.0±0.8°C; 33.9 ±0.3‰) and the northern Bay of Bengal (28.0±1.4°C; 31.6±0.8‰), it is important to determine the source of foraminifera to the sediment cores before attempting paleoceanographic reconstructions. We present paired Mg/Ca and δ18O data from single Globigerinoides sacculifer in mudline samples from three locations with differing oceanographic conditions. Two sites are from IODP Expedition 354 and one site is from the continental shelf. IODP Site U1454 (8.4°N, 85.5°E, 3721 m water depth) is near the modern active channel and more likely to be influenced by transport, while IODP site U1449 (8.4°N, 88.7°E, 3653 m water depth) is 200 km from channel activity and site 342KL (20.6°N, 90°E, 1256 m water depth) is on the continental shelf. The distribution of 70 to 80 Mg/Ca and δ18O data-points reflects the seasonal signal at the location foraminifera calcified. Mg/Ca and δ18O data from site U1449 (far from channel activity) have a distribution that most closely reflects the seasonal oceanographic conditions of the overlying water column. However, the distribution of G. sacculifer Mg/Ca and δ18O from site U1454 (near the active channel) has similarities to the distribution of the G. sacculifer Mg/Ca and δ18O data from the continental shelf. Our data suggest that foraminifera near the active channel are a mixture of shells from the overlying water column and shells transported from the northern Bay of Bengal. We suggest foraminifera can be used to reconstruct SST and δ18O in this complex depositional environment, but caution must be taken when the down-core lithology indicates regional turbidite activity and other evidence of sediment redeposition.

  9. Health assessment for Tansitor Electronics, Inc. Site, Bennington County, Vermont, Region 1. CERCLIS No. VTD000509174. Preliminary report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1991-03-26

    The Tansitor Electronics, Inc. site, located in Bennington, Bennington County, Vermont, has been proposed by the Environmental Protection Agency for inclusion onto the National Priorities List (NPL). Most of the investigations into site contamination have been coordinated by the Vermont Department of Environmental Conservation. Tansitor Electronics, Inc. operates an electronic capacitor manufacturing facility on a 36-acre parcel located along Route 9 and about 3 miles west of downtown Bennington, Bennington County, Vermont. The site is of potential public health concern because of the risk to human health resulting from possible exposure to hazardous substances at concentrations that may result inmore » adverse health effects. There are no monitoring data or information indicating that appreciable human exposure to site-related contaminants is currently occurring. However, additional monitoring data or information is needed to evaluate the on-site and off-site ground water (shallow aquifer and bedrock aquifer), ambient air, sediment, surface soil, and surface water. The monitoring data or information may form the basis of future ATSDR evaluation of the undefined human exposure pathways and public health implications associated with these pathways. The site is not recommended for follow-up health activities at this time.« less

  10. Permafrost and active layer monitoring in the maritime Antarctic: Preliminary results from CALM sites on Livingston and Deception Islands

    USGS Publications Warehouse

    Ramos, M.; Vieira, G.; Blanco, J.J.; Hauck, C.; Hidalgo, M.A.; Tome, D.; Nevers, M.; Trindade, A.

    2007-01-01

    This paper describes results obtained from scientific work and experiments performed on Livingston and Deception Islands. Located in the South Shetland Archipelago, these islands have been some of the most sensitive regions over the last 50 years with respect to climate change with a Mean Annual Air Temperature (MAAT) close to -2 ºC. Three Circumpolar Active Layer Monitoring (CALM) sites were installed to record the thermal regime and the behaviour of the active layer in different places with similar climate, but with different soil composition, porosity, and water content. The study’s ultimate aim is to document the influence of climate change on permafrost degradation. Preliminary results, obtained in 2006, on maximum active-layer thickness (around 40 cm in the CALM of Deception Island), active layer temperature evolution, snow thickness, and air temperatures permit early characterization of energy exchange mechanisms between the ground and the atmosphere in the CALM-S sites.

  11. Archaeology: site studies, activation analysis, preservation, and remote sensing. 1978-November 1979 (citations from the NTIS Data Base). Report for 1978-November 1979

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1981-01-01

    This bibliography contains general studies as well as chemical analysis of archaeological specimens. The chemical analysis is mainly activation analysis of articles such as metals, pottery, coins, paintings, soils, glass and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies include results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 237 citations, none of which are new entries to the previous edition.)

  12. Site-Directed Synthesis of Cobalt Oxide Clusters in a Metal–Organic Framework

    DOE PAGES

    Peters, Aaron W.; Otake, Kenichi; Platero-Prats, Ana E.; ...

    2018-04-19

    Here, direct control over structure and location of catalytic species deposited on amorphous supports represents a formidable challenge in heterogeneous catalysis. In contrast, a structurally well-defined, crystalline metal–organic framework (MOF) can be rationally designed using post-synthetic techniques to allow for desired structural or locational changes of deposited metal ions. Herein, naphthalene dicarboxylate linkers are incorporated in the MOF, NU-1000, to block the small cavities where few-atom clusters of cobalt oxide preferentially grow, inducing catalyst deposition towards hither-to ill-favored grafting sites orientated toward NU-1000’s mesoporous channels. Despite the different cobalt oxide location, the resulting material is still an active propane oxidativemore » dehydrogenation catalyst at low temperature, reaching a turnover frequency of 0.68 ± 0.05 h –1 at 230 °C and confirming the utility of MOFs as crystalline supports to guide rational design of catalysts.« less

  13. Hydrogeochemical and stream sediment special reconnaissance report for the Deep Creek Mountains, Nevada and Utah

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qualheim, B.

    1979-04-01

    This report represents the results of the reconnaissance sampling of the Deep Creek Mountains of western Utah. The Deep Creek range is located in the northwest corner of the Delta NTMS 1:250,000 and the southwestern corner of the Tooele NTMS 1:250,000 sheets and covers an area of 1750 km/sup 2/. Samples collected in this study include dry and wet stream sediments and water from available streams, wells, and springs. The samples were analyzed for uranium, as well as 15 to 20 trace elements, using neutron activation techniques. In addition, field and laboratory measurements were made on the water samples. Analyticalmore » data and field measurements are presented in tabular hard copy and fiche format. Water-sample site locations, water-sample uranium concentrations, sediment-sample site locations, and sediment-sample uranium concentrations are shown on separate overlays.« less

  14. Site-Directed Synthesis of Cobalt Oxide Clusters in a Metal–Organic Framework

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peters, Aaron W.; Otake, Kenichi; Platero-Prats, Ana E.

    Here, direct control over structure and location of catalytic species deposited on amorphous supports represents a formidable challenge in heterogeneous catalysis. In contrast, a structurally well-defined, crystalline metal–organic framework (MOF) can be rationally designed using post-synthetic techniques to allow for desired structural or locational changes of deposited metal ions. Herein, naphthalene dicarboxylate linkers are incorporated in the MOF, NU-1000, to block the small cavities where few-atom clusters of cobalt oxide preferentially grow, inducing catalyst deposition towards hither-to ill-favored grafting sites orientated toward NU-1000’s mesoporous channels. Despite the different cobalt oxide location, the resulting material is still an active propane oxidativemore » dehydrogenation catalyst at low temperature, reaching a turnover frequency of 0.68 ± 0.05 h –1 at 230 °C and confirming the utility of MOFs as crystalline supports to guide rational design of catalysts.« less

  15. Assessment of karst activity at Springfield Route 60 study site

    DOT National Transportation Integrated Search

    2008-02-01

    MST proposes to acquire electrical resistivity data within a roadway ROW. These geophysical data will be processed, analyzed and interpreted with the objective of locating and mapping any subsurface voids that might compromise the integrity of the pi...

  16. Human Mars Mission Overview and Dust Storm Impacts on Site Selection

    NASA Astrophysics Data System (ADS)

    Hoffman, S. J.

    2017-06-01

    This presentation briefly reviews NASA's current approach to human exploration of Mars and key features placed on locations (referred to as Exploration Zones) for these activities. Impacts of dust and dust storms on selecting an EZ are discussed.

  17. Incorporating ToxCast and Tox21 datasets to rank biological activity of chemicals at Superfund sites in North Carolina.

    PubMed

    Tilley, Sloane K; Reif, David M; Fry, Rebecca C

    2017-04-01

    The Superfund program of the Environmental Protection Agency (EPA) was established in 1980 to address public health concerns posed by toxic substances released into the environment in the United States. Forty-two of the 1328 hazardous waste sites that remain on the Superfund National Priority List are located in the state of North Carolina. We set out to develop a database that contained information on both the prevalence and biological activity of chemicals present at Superfund sites in North Carolina. A chemical characterization tool, the Toxicological Priority Index (ToxPi), was used to rank the biological activity of these chemicals based on their predicted bioavailability, documented associations with biological pathways, and activity in in vitro assays of the ToxCast and Tox21 programs. The ten most prevalent chemicals found at North Carolina Superfund sites were chromium, trichloroethene, lead, tetrachloroethene, arsenic, benzene, manganese, 1,2-dichloroethane, nickel, and barium. For all chemicals found at North Carolina Superfund sites, ToxPi analysis was used to rank their biological activity. Through this data integration, residual pesticides and organic solvents were identified to be some of the most highly-ranking predicted bioactive chemicals. This study provides a novel methodology for creating state or regional databases of biological activity of contaminants at Superfund sites. These data represent a novel integrated profile of the most prevalent chemicals at North Carolina Superfund sites. This information, and the associated methodology, is useful to toxicologists, risk assessors, and the communities living in close proximity to these sites. Copyright © 2016. Published by Elsevier Ltd.

  18. A Single Base Difference between Pit-1 Binding Sites at the hGH Promoter and Locus Control Region Specifies Distinct Pit-1 Conformations and Functions

    PubMed Central

    Shewchuk, Brian M.; Ho, Yugong; Liebhaber, Stephen A.; Cooke, Nancy E.

    2006-01-01

    Activation of the human growth hormone (hGH-N) gene in pituitary somatotropes is mediated by a locus control region (LCR). This LCR is composed of DNase I-hypersensitive sites (HS) located −14.5 kb to −32 kb relative to the hGH-N promoter. HSI, at −14.5 kb, is the dominant determinant of hGH-N expression and is essential for establishment of a 32-kb domain of histone acetylation that encompasses the active hGH locus. This activity is conferred by three binding sites for the POU domain transcription factor Pit-1. These Pit-1 elements are sufficient to activate hGH-N expression in the mouse pituitary. In contrast, Pit-1 sites at the hGH-N promoter are consistently unable to mediate similar activity. In the present study, we demonstrate that the functional difference between the promoter-proximal and the HSI Pit-1 binding sites can be attributed in part to a single base difference. This base affects the conformation of the Pit-1/DNA complex, and reciprocal exchange of the divergent bases between the two sets of Pit-1 elements results in a partial reversal of their transgenic activities. These data support a model in which the Pit-1 binding sites in the hGH LCR allosterically program the bound Pit-1 complex for chromatin activating functions. PMID:16914737

  19. Evidence for wing molt and breeding site fidelity in King Eiders

    USGS Publications Warehouse

    Phillips, Laura M.; Powell, A.N.

    2006-01-01

    Fidelity of King Eiders (Somateria spectabilis) to breeding and wing molt sites was examined using satellite telemetry data obtained opportunistically when battery life of transmitters provided locations in a second year. Consecutive breeding locations were obtained for eleven female and 23 male King Eiders. All females exhibited breeding site fidelity by returning to sites within 15 km of first year breeding areas on the North Slope of Alaska. Breeding locations of males in a subsequent year were located on average >1000 km from their prior breeding sites and were primarily outside Alaska, on the coasts of Russia and Canada. Second-year wing molt locations were obtained for two female and six male King Eiders. Wing molt sites of males were located 6.2 ?? 3.1 km apart on average in successive years, while female wing molt locations averaged almost 50 km apart. Our results demonstrate site fidelity of female King Eiders to a breeding area on the North Slope of Alaska, document the dispersal of male King Eiders between breeding seasons, and present the first evidence for wing molt site fidelity in males.

  20. United States Air Force 611th Air Support Group Civil Engineering Squadron, Elmendorf AFB, Alaska. Remedial investigation and feasibility study Point Lay Radar Installation, Alaska. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karmi, S.

    1996-03-04

    The United States Air Force (Air Force) has prepared this Remedial Investigation/Feasibility Study (RI/FS) report to present the results of RI/FS activities at four sites located at the Point Lay radar installation. The remedial investigation (RI) field activities were conducted at the Point Lay radar installation during the summer of 1993. The four sites at Point Lay were investigated because they were suspected of being contaminated with hazardous substances. RI activities were conducted using methods and procedures specified in the RI/FS Work Plan, Sampling and Analysis Plan (SAP), and Health and Safety Plan.

  1. Stereochemical requirements for central and peripheral muscarinic and antimuscarinic activity of some acetylenic compounds related to oxotremorine.

    PubMed Central

    Dahlbom, R.; Jenden, D. J.; Resul, B.; Ringdahl, B.

    1982-01-01

    1 The enantiomers of some analogues of the central muscarinic agent, oxotremorine, were prepared and investigated for tremorogenic and tremorolytic activity in intact mice and for muscarinic and antimuscarinic activity on the isolated ileum of the guinea-pig. 2 The R-isomers were more potent than the S-isomers both in vivo and in vitro regardless of whether the compounds are agonists, partial agonists or competitive antagonists. 3 It is suggested that in the oxotremorine series, agonists and antagonists interact with a common receptor site, in contrast to classical muscarinic antagonists which are believed to bind also to accessory receptor areas, located close to the agonist binding site. PMID:7093587

  2. Different properties of skin of different body sites: The root of keloid formation?

    PubMed

    Butzelaar, Liselotte; Niessen, Frank B; Talhout, Wendy; Schooneman, Dennis P M; Ulrich, Magda M; Beelen, Robert H J; Mink van der Molen, Aebele B

    2017-09-01

    The purpose of this study was to examine extracellular matrix composition, vascularization, and immune cell population of skin sites prone to keloid formation. Keloids remain a complex problem, posing esthetical as well as functional difficulties for those affected. These scars tend to develop at anatomic sites of preference. Mechanical properties of skin vary with anatomic location and depend largely on extracellular matrix composition. These differences in extracellular matrix composition, but also vascularization and resident immune cell populations might play a role in the mechanism of keloid formation. To examine this hypothesis, skin samples of several anatomic locations were taken from 24 human donors within zero to 36 hours after they had deceased. Collagen content and cross-links were determined through high-performance liquid chromatography. The expression of several genes, involved in extracellular matrix production and degradation, was measured by means of real-time PCR. (Immuno)histochemistry was performed to detect fibroblasts, collagen, elastin, blood vessels, Langerhans cells, and macrophages. Properties of skin of keloid predilections sites were compared to properties of skin from other locations (nonpredilection sites [NPS]). The results indicated that there are site specific variations in extracellular matrix properties (collagen and cross-links) as well as macrophage numbers. Moreover, predilection sites (PS) for keloid formation contain larger amounts of collagen compared to NPS, but decreased numbers of macrophages, in particular classically activated CD40 positive macrophages. In conclusion, the altered (histological, protein, and genetic) properties of skin of keloid PS may cause a predisposition for and contribute to keloid formation. © 2017 by the Wound Healing Society.

  3. High-resolution physical and functional mapping of the template adjacent DNA binding site in catalytically active telomerase.

    PubMed

    Romi, Erez; Baran, Nava; Gantman, Marina; Shmoish, Michael; Min, Bosun; Collins, Kathleen; Manor, Haim

    2007-05-22

    Telomerase is a cellular reverse transcriptase, which utilizes an integral RNA template to extend single-stranded telomeric DNA. We used site-specific photocrosslinking to map interactions between DNA primers and the catalytic protein subunit (tTERT) of Tetrahymena thermophila telomerase in functional enzyme complexes. Our assays reveal contact of the single-stranded DNA adjacent to the primer-template hybrid and tTERT residue W187 at the periphery of the N-terminal domain. This contact was detected in complexes with three different registers of template in the active site, suggesting that it is maintained throughout synthesis of a complete telomeric repeat. Substitution of nearby residue Q168, but not W187, alters the K(m) for primer elongation, implying that it plays a role in the DNA recognition. These findings are the first to directly demonstrate the physical location of TERT-DNA contacts in catalytically active telomerase and to identify amino acid determinants of DNA binding affinity. Our data also suggest a movement of the TERT active site relative to the template-adjacent single-stranded DNA binding site within a cycle of repeat synthesis.

  4. SABER: A computational method for identifying active sites for new reactions

    PubMed Central

    Nosrati, Geoffrey R; Houk, K N

    2012-01-01

    A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644–1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were l-Ala d/l-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. PMID:22492397

  5. Second Quarter Hanford Seismic Report for Fiscal Year 2009

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohay, Alan C.; Sweeney, Mark D.; Hartshorn, Donald C.

    2009-07-31

    The Hanford Seismic Assessment Program (HSAP) provides an uninterrupted collection of high-quality raw and processed seismic data from the Hanford Seismic Network for the U.S. Department of Energy and its contractors. The HSAP is responsible for locating and identifying sources of seismic activity and monitoring changes in the historical pattern of seismic activity at the Hanford Site. The data are compiled, archived, and published for use by the Hanford Site for waste management, natural phenomena hazards assessments, and engineering design and construction. In addition, the HSAP works with the Hanford Site Emergency Services Organization to provide assistance in the eventmore » of a significant earthquake on the Hanford Site. The Hanford Seismic Network and the Eastern Washington Regional Network consist of 44 individual sensor sites and 15 radio relay sites maintained by the Hanford Seismic Assessment Team. The Hanford Seismic Network recorded over 800 local earthquakes during the second quarter of FY 2009. Nearly all of these earthquakes were detected in the vicinity of Wooded Island, located about eight miles north of Richland just west of the Columbia River. Most of the events were considered minor (magnitude (Mc) less than 1.0) with 19 events in the 2.0-2.9 range. The estimated depths of the Wooded Island events are shallow (averaging less than 1.0 km deep) with a maximum depth estimated at 1.9 km. This places the Wooded Island events within the Columbia River Basalt Group (CRBG). The low magnitude and the shallowness of the Wooded Island events have made them undetectable to most area residents. However, some Hanford employees working within a few miles of the area of highest activity, and individuals living in homes directly across the Columbia River from the swarm center, have reported feeling some movement. The Hanford SMA network was triggered numerous times by the Wooded Island swarm events. The maximum acceleration values recorded by the SMA network were approximately 2-3 times lower than the reportable action level for Hanford facilities (2% g) and no action was required. The swarming is likely due to pressures that have built up, cracking the brittle basalt layers within the Columbia River Basalt Formation (CRBG). Similar earthquake “swarms” have been recorded near this same location in 1970, 1975 and 1988. Prior to the 1970s, swarming may have occurred, but equipment was not in place to record those events. Quakes of this limited magnitude do not pose a risk to Hanford cleanup efforts or waste storage facilities. Since swarms of the past did not intensify in magnitude, seismologists do not expect that these events will increase in intensity. However, PNNL will continue to monitor the activity continuously. Outside of the Wooded Island swarm, four earthquakes were recorded. Three earthquakes were classified as minor and one event registered 2.3 Mc. One earthquake was located at intermediate depth (between 4 and 9 km, most likely in the pre-basalt sediments) and three earthquakes at depths greater than 9 km, within the basement. Geographically, two earthquakes were located in known swarm areas and two earthquakes were classified as random events.« less

  6. Surface ozone and NOx trends observed over Kannur, a South Indian coastal location of weak industrial activities

    NASA Astrophysics Data System (ADS)

    Kumar, Satheesh Mk; T, Nishanth; M, Praseeed K.

    South India is a peninsular region surrounded by the three belts of Arabian Sea, Bay of Bengal and Indian Ocean. Usually, coastal regions experience relatively high air quality compared to that of the interior land masses owing to the abundance of OH over ocean surface which acts as detergent in the atmosphere. Kannur (11.9 N, 75.4E, 5 m AMSL) is a coastal location along the Arabian Sea which is located in the northern district of Kerala State with fairly low industrial activities. A continuous observation of surface ozone (O3), NOx and OX (NO2+ O3) which has been initiated at this coastal site since 2009 reveals the enhancement in the concentrations of these trace species quite significantly. It is observed that surface O3 mixing ratio is increased at a rate of 1.51 ± 0.5 ppbv/year during the four year period from 2009 at Kannur. The enhancement rate in the mixing ratios of NOx is 1.01 ± 0.4 ppbv/year and OX is 1.49±0.42 ppbv/year respectively. The increase of O3 may be attributed due to the increase in methane and non-methane organic emissions from the wet lands and vehicles may enhance O3 production and fairly low rate of change of NO concentration at this site. This paper describes the rate of changes of O3, NOx and OX during the period of observation in detail. Likewise, the increase in nighttime concentrations of O3 and PM10 observed during the festival occasions in the summer month of April in all years is explained. Being a weak industrialized location, the main source of pollution is by vehicular emissions and the increase in these trace gases in the context of rapid enhancement in the number of vehicles is well correlated. These results may be helpful for improving government policies to control the photochemical formation of secondary air pollutants in the rural coastal sites that has a significant influence on the onset of monsoon and the outcome of this study have significant relevance for gradual transformation of pristine locations into polluted sites.

  7. Substrate tunnels in enzymes: structure-function relationships and computational methodology.

    PubMed

    Kingsley, Laura J; Lill, Markus A

    2015-04-01

    In enzymes, the active site is the location where incoming substrates are chemically converted to products. In some enzymes, this site is deeply buried within the core of the protein, and, in order to access the active site, substrates must pass through the body of the protein via a tunnel. In many systems, these tunnels act as filters and have been found to influence both substrate specificity and catalytic mechanism. Identifying and understanding how these tunnels exert such control has been of growing interest over the past several years because of implications in fields such as protein engineering and drug design. This growing interest has spurred the development of several computational methods to identify and analyze tunnels and how ligands migrate through these tunnels. The goal of this review is to outline how tunnels influence substrate specificity and catalytic efficiency in enzymes with buried active sites and to provide a brief summary of the computational tools used to identify and evaluate these tunnels. © 2015 Wiley Periodicals, Inc.

  8. A Feasibility Study to Evaluate Wind Energy Potential on the Navajo Nation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Terry Battiest

    2012-11-30

    The project, A Feasibility Study to Evaluate Wind Energy Potential on the Navajo Nation, is funded under a solicitation issued by the U.S. Department of Energy Tribal Energy Program. Funding provided by the grant allowed the Navajo Nation to measure wind potential at two sites, one located within the boundaries of the Navajo Nation and the other off-reservation during the project period (September 5, 2005 - September 30, 2009). The recipient for the grant award is the Navajo Tribal Utility Authority (NTUA). The grant allowed the Navajo Nation and NTUA manage the wind feasibility from initial site selection through themore » decision-making process to commit to a site for wind generation development. The grant activities help to develop human capacity at NTUA and help NTUA to engage in renewable energy generation activities, including not only wind but also solar and biomass. The final report also includes information about development activities regarding the sited included in the grant-funded feasibility study.« less

  9. BOREAS TE-23 Map Plot Data

    NASA Technical Reports Server (NTRS)

    Rich, Paul M.; Fournier, Robert; Hall, Forrest G. (Editor); Papagno, Andrea (Editor)

    2000-01-01

    The Boreal Ecosystem-Atmospheric Study (BOREAS) TE-23 (Terrestrial Ecology) team collected map plot data in support of its efforts to characterize and interpret information on canopy architecture and understory cover at the BOREAS tower flux sites and selected auxiliary sites from May to August 1994. Mapped plots (typical dimensions 50 m x 60 m) were set up and characterized at all BOREAS forested tower flux and selected auxiliary sites. Detailed measurement of the mapped plots included: (1) stand characteristics (location, density, basal area); (2) map locations diameter at breast height (DBH) of all trees; (3) detailed geometric measures of a subset of trees (height, crown dimensions); and (4) understory cover maps. The data are stored in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  10. Carbene footprinting accurately maps binding sites in protein-ligand and protein-protein interactions

    NASA Astrophysics Data System (ADS)

    Manzi, Lucio; Barrow, Andrew S.; Scott, Daniel; Layfield, Robert; Wright, Timothy G.; Moses, John E.; Oldham, Neil J.

    2016-11-01

    Specific interactions between proteins and their binding partners are fundamental to life processes. The ability to detect protein complexes, and map their sites of binding, is crucial to understanding basic biology at the molecular level. Methods that employ sensitive analytical techniques such as mass spectrometry have the potential to provide valuable insights with very little material and on short time scales. Here we present a differential protein footprinting technique employing an efficient photo-activated probe for use with mass spectrometry. Using this methodology the location of a carbohydrate substrate was accurately mapped to the binding cleft of lysozyme, and in a more complex example, the interactions between a 100 kDa, multi-domain deubiquitinating enzyme, USP5 and a diubiquitin substrate were located to different functional domains. The much improved properties of this probe make carbene footprinting a viable method for rapid and accurate identification of protein binding sites utilizing benign, near-UV photoactivation.

  11. A benthic-macroinvertebrate index of biotic integrity and assessment of conditions in selected streams in Chester County, Pennsylvania, 1998-2009

    USGS Publications Warehouse

    Reif, Andrew G.

    2012-01-01

    The Stream Conditions of Chester County Biological Monitoring Network (Network) was established by the U.S. Geological Survey and the Chester County Water Resources Authority in 1969. Chester County encompasses 760 square miles in southeastern Pennsylvania and has a rapidly expanding population. Land-use change has occurred in response to this continual growth, as open space, agricultural lands, and wooded lands have been converted to residential and commercial lands. In 1998, the Network was modified to include 18 fixed-location sites and 9 flexible-location sites. Sites were sampled annually in the fall (October-November) during base-flow conditions for water chemistry, instream habitat, and benthic macroinvertebrates. A new set of 9 flexible-location sites was selected each year. From 1998 to 2009, 213 samples were collected from the 18 fixed-location sites and 107 samples were collected from the 84 flexible-location sites. Eighteen flexible-location sites were sampled more than once over the 12-year period; 66 sites were sampled only once. Benthic-macroinvertebrate data from samples collected during 1998-2009 were used to establish the Chester County Index of Biotic Integrity (CC-IBI). The CC-IBI was based on the methods and metrics outlined in the Pennsylvania Department of Environmental Protection's "A Benthic Index of Biotic Integrity for Wadeable Freestone Streams in Pennsylvania." The resulting CC-IBI consists of scores for benthic-macroinvertebrate samples collected from sites in the Network that related to reference conditions in Chester County. Mean CC-IBI scores for 18 fixed-location sites ranged from 37.21 to 88.92. Thirty-nine percent of the 213 samples collected at the 18 fixed-location sites had a CC-IBI score less than 50; 33 percent, 50 to 70; 28 percent, greater than 70. CC-IBI scores from the 107 flexible-location samples ranged from 23.48 to 99.96. Twenty-five percent of the 107 samples collected at the flexible-location sites had a CC-IBI score less than 50; 33 percent, 50 to 70; and 42 percent, greater than 70. Factors that were found to affect CC-IBI scores are nutrient concentrations, habitat conditions, and percent of wooded and urban land use. A positive relation was determined between mean CC-IBI scores and mean total habitat scores for the 18 fixed-location sites. CC-IBI scores were most strongly affected by stream bank vegetative protection, embeddedness, riparian zone width, and sediment deposition. The highest CC-IBI scores were associated with sites that had greater than 28 percent wooded-wetland-water land use, less than 5 percent urban land use, and no municipal wastewater discharges within 10 miles upstream from the sampling site. The lowest CC-IBI scores were associated with sites where urban land use was greater than 15 percent or a municipal wastewater discharge was within 10 miles upstream from the sampling reach. The Mann Kendall test for trends was used to determine trends in CC-IBI scores and concentrations of nitrate, orthophosphate, and chloride for the 18 fixed-location sites. A positive trend in CC-IBI was determined for six sites, and a negative trend was determined for one site. Positive trends in nitrate concentrations were determined for 4 of the 18 fixed-location sites, and a negative trend in orthophosphate concentrations was determined for 1 of the 18 fixed-location sites. Positive trends in chloride concentrations were determined for 16 of the 18 fixed-location sites.

  12. Crystal structure of the glycosidase family 73 peptidoglycan hydrolase FlgJ

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hashimoto, Wataru; Ochiai, Akihito; Momma, Keiko

    Glycoside hydrolase (GH) categorized into family 73 plays an important role in degrading bacterial cell wall peptidoglycan. The flagellar protein FlgJ contains N- and C-terminal domains responsible for flagellar rod assembly and peptidoglycan hydrolysis, respectively. A member of family GH-73, the C-terminal domain (SPH1045-C) of FlgJ from Sphingomonas sp. strain A1 was expressed in Escherichia coli, purified, and characterized. SPH1045-C exhibited bacterial cell lytic activity most efficiently at pH 6.0 and 37 deg. C. The X-ray crystallographic structure of SPH1045-C was determined at 1.74 A resolution by single-wavelength anomalous diffraction. The enzyme consists of two lobes, {alpha} and {beta}. Amore » deep cleft located between the two lobes can accommodate polymer molecules, suggesting that the active site is located in the cleft. Although SPH1045-C shows a structural homology with family GH-22 and GH-23 lysozymes, the arrangement of the nucleophile/base residue in the active site is specific to each peptidoglycan hydrolase.« less

  13. Bimetallic Effect of Single Nanocatalysts Visualized by Super-Resolution Catalysis Imaging

    DOE PAGES

    Chen, Guanqun; Zou, Ningmu; Chen, Bo; ...

    2017-11-01

    Compared with their monometallic counterparts, bimetallic nanoparticles often show enhanced catalytic activity associated with the bimetallic interface. Direct quantitation of catalytic activity at the bimetallic interface is important for understanding the enhancement mechanism, but challenging experimentally. Here using single-molecule super-resolution catalysis imaging in correlation with electron microscopy, we report the first quantitative visualization of enhanced bimetallic activity within single bimetallic nanoparticles. We focus on heteronuclear bimetallic PdAu nanoparticles that present a well-defined Pd–Au bimetallic interface in catalyzing a photodriven fluorogenic disproportionation reaction. Our approach also enables a direct comparison between the bimetallic and monometallic regions within the same nanoparticle. Theoreticalmore » calculations further provide insights into the electronic nature of N–O bond activation of the reactant (resazurin) adsorbed on bimetallic sites. Subparticle activity correlation between bimetallic enhancement and monometallic activity suggests that the favorable locations to construct bimetallic sites are those monometallic sites with higher activity, leading to a strategy for making effective bimetallic nanocatalysts. Furthermore, the results highlight the power of super-resolution catalysis imaging in gaining insights that could help improve nanocatalysts.« less

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Guanqun; Zou, Ningmu; Chen, Bo

    Compared with their monometallic counterparts, bimetallic nanoparticles often show enhanced catalytic activity associated with the bimetallic interface. Direct quantitation of catalytic activity at the bimetallic interface is important for understanding the enhancement mechanism, but challenging experimentally. Here using single-molecule super-resolution catalysis imaging in correlation with electron microscopy, we report the first quantitative visualization of enhanced bimetallic activity within single bimetallic nanoparticles. We focus on heteronuclear bimetallic PdAu nanoparticles that present a well-defined Pd–Au bimetallic interface in catalyzing a photodriven fluorogenic disproportionation reaction. Our approach also enables a direct comparison between the bimetallic and monometallic regions within the same nanoparticle. Theoreticalmore » calculations further provide insights into the electronic nature of N–O bond activation of the reactant (resazurin) adsorbed on bimetallic sites. Subparticle activity correlation between bimetallic enhancement and monometallic activity suggests that the favorable locations to construct bimetallic sites are those monometallic sites with higher activity, leading to a strategy for making effective bimetallic nanocatalysts. Furthermore, the results highlight the power of super-resolution catalysis imaging in gaining insights that could help improve nanocatalysts.« less

  15. Effects of Dimerization of Serratia marcescens Endonuclease on Water Dynamics.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Chuanying; Beck, Brian W.; Krause, Kurt

    2007-02-15

    The research described in this product was performed in part in the Environmental Molecular Sciences Laboratory, a national scientific user facility sponsored by the Department of Energy's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory. The dynamics and structure of Serratia marcescens endonuclease and its neighboring solvent are investigated by molecular dynamics (MD). Comparisons are made with structural and biochemical experiments. The dimer form is physiologic and functions more processively than the monomer. We previously found a channel formed by connected clusters of waters from the active site to the dimer interface. Here, we showmore » that dimerization clearly changes correlations in the water structure and dynamics in the active site not seen in the monomer. Our results indicate that water at the active sites of the dimer is less affected compared with bulk solvent than in the monomer where it has much slower characteristic relaxation times. Given that water is a required participant in the reaction, this gives a clear advantage to dimerization in the absence of an apparent ability to use both active sites simultaneously.« less

  16. 1998 Tier two emergency and hazardous chemical inventory - emergency planning and community right-to-know act section 312

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    ZALOUDEK, D.E.

    The Hanford Site covers approximately 1,450 square kilometers (560 square miles) of land that is owned by the U.S, Government and managed by the U.S. Department of Energy, Richland Operations Office (DOE-RL). The Hanford Site is located northwest of the city of Richland, Washington. The city of Richland adjoins the southeastern portion of the Hanford Site boundary and is the nearest population center. Activities on the Hanford Site are centralized in numerically designated areas. The 100 Areas, located along the Columbia River, contain deactivated reactors. The processing units are in the 200 Areas, which are on a plateau approximately 11more » kilometers (7 miles) from the Columbia River. The 300 Area, located adjacent to and north of Richland, contains research and development laboratories. The 400 Area, 8 kilometers (5 miles) northwest of the 300 Area, contains the Fast Flux Test Facility previously used for testing liquid metal reactor systems. Adjacent to the north of Richland, the 1100 Area contains offices associated with administration, maintenance, transportation, and materials procurement and distribution. The 600 Area covers all locations not specifically given an area designation. This Tier Two Emergency and Hazardous Chemical Inventory report contains information pertaining to hazardous chemicals managed by DOE-RL and its contractors on the Hanford Site. It does not include chemicals maintained in support of activities conducted by others on lands covered by leases, use permits, easements, and other agreements whereby land is used by parties other than DOE-RL. For example, this report does not include chemicals stored on state owned or leased lands (including the burial ground operated by US Ecology, Inc.), lands owned or used by the Bonneville Power Administration (including the Midway Substation and the Ashe Substation), lands used by the National Science Foundation (the Laser Interferometer Gravitational-Wave Observatory), lands leased to the Washington Public Power Supply System, Johnson Controls, Inc. (boilers operated for steam production), and R. H. Smith Company (gas stations), or similarly leased lands not under the management of DOE-RL.« less

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meyers, Tilden

    This is the AmeriFlux version of the carbon flux data for the site US-Goo Goodwin Creek. Site Description - The Goodwin Creek site is located in the Bluff Hills, just east of the Mississippi River valley. In addition to being a core AmeriFlux site, Goodwin Creek is also affiliated with a multitude of other projects including SURFRAD, BSRN, and one of the twelve watersheds in the USDA Conservation Reserve Program. Natural disturbances are of minimal influence to the site. The immediate region is primarily used for grazing while infrequent logging activities occur in nearby forests. The grass surrounding the basemore » of the tower is mowed periodically to maintain a height consistent with the regional grasslands.« less

  18. Site environmental report for Calendar Year 1994 on radiological and nonradiological parameters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-06-30

    Battelle Memorial Institute`s nuclear research facilities are currently being maintained in a surveillance and maintenance (S&M) mode with continual decontamination and decommissioning (D&D) activities being conducted under Department of Energy (DOE) Contract W-7405-ENG-92. These activities are referred to under the Contract as the Battelle Columbus Laboratories Decommissioning Project (BCLDP). Operations referenced in this report are performed in support of S&M and D&D activities. Battelle`s King Avenue facility is not considered in this report to the extent that the West Jefferson facility is. The source term at the King Avenue site is a small fraction of the source term at themore » West Jefferson site. Off site levels of radionuclides that could be attributed to the west Jefferson and King Avenue nuclear operations wereindistinguishable from background levels at specific locations where air, water, and direct radiation measurements were performed. Environmental monitoring continued to demonstrate compliance by Battelle with federal, state and local regulations. Routine, nonradiological activities performed include monitoring liquid effluents and monitoring the ground water system for the West Jefferson North site. Samples of various environmental media including air, water, grass, fish, field and garden crops, sediment and soil were collected from the region surrounding the two sites and analyzed.« less

  19. Effects of anthropogenic activities on chemical contamination within the Grand Canal, China.

    PubMed

    Wang, Xiaolong; Han, Jingyi; Xu, Ligang; Gao, Junfeng; Zhang, Qi

    2011-06-01

    Contamination of nutrients and heavy metals within aquatic system is of great concern due to its potential impact on human and animal health. The Grand Canal of China, the largest artificial river in the world, is of great importance in supplying water resource, transporting cargo, and recreating resident, as well as great historical heritage. This study assessed and examined the impact of human activities on characters of contamination distribution within the section of the Canal in Taihu watershed. Physicochemical parameters of surface water quality were determined monthly from the year 2004 to 2006 at 11 sites that were influenced by different anthropogenic activities along the Canal. Moreover, contaminations at surface sediments (20 cm) at the same locations were also analyzed in September 2006. Results showed that the Canal had been seriously polluted, which was characterized with high spatial variations in contaminations distribution. The sites influenced mainly by industry and urbanization showed higher contents of nutrients and lower levels of dissolve oxygen than other sites. Concentrations of nitrogen at all studied sites exceeded the worst level of surface water quality according to the National Criterion of Surface Water Quality, China, with the average values varying from 2.27 to 10.34 mg/L. Furthermore, the site influenced mainly by industry (i.e., Site 4) presented the highest contents of cadmium (3.453 mg/kg), chromium (196.87 mg/kg), nickel (87.12 mg/kg), zinc (381.8 mg/kg), and copper (357.32 mg/kg). While sites in vicinity to cities had presented relatively higher contents of metals, especially for the site located downstream of Changzhou City (Site 3) had presented the highest contents of mercury (1.64 mg/kg) and lead (197.62 mg/kg). Copper at Sites 2 to 6, Nickel at Sites 2 to 9 except for Site 7, chromium, lead, and zinc at Sites 3 to 6 had exceeded New York State Department of Environmental Conservation (NYSDEC) Severe Effect Level (SEL). By multivariate statistical, nutrient variables, companied with V-phen, had contributed the most variation of water quality, while nutrient and metals had explained the most part of total variance of contaminations in sediment. This study indicated that the canal had been polluted severely and urgently need to control.

  20. Continuous Snow Depth, Intensive Site 1, Barrow, Alaska

    DOE Data Explorer

    Bob Busey; Larry Hinzman; Vladimir Romanovsky; William Cable

    2014-11-06

    Continuous Snow depth data are being collected at several points within four intensive study areas in Barrow, Alaska. These data are being collected to better understand the energy dynamics above the active layer and permafrost. They complement in-situ snow and soil measurements at this location. The data could also be used as supporting measurements for other research and modeling activities.

  1. Mars Surface Systems Common Capabilities and Challenges for Human Missions

    NASA Technical Reports Server (NTRS)

    Toups, Larry; Hoffman, Stephen J.

    2016-01-01

    This paper describes the current status of common systems and operations as they are applied to actual locations on Mars that are representative of Exploration Zones (EZ) - NASA's term for candidate locations where humans could land, live and work on the Martian surface. Given NASA's current concepts for human missions to Mars, an EZ is a collection of Regions of Interest (ROIs) located within approximately 100 kilometers of a centralized landing site. ROIs are areas that are relevant for scientific investigation and/or development/maturation of capabilities and resources necessary for a sustainable human presence. An EZ also contains a habitation site that will be used by multiple human crews during missions to explore and utilize the ROIs within the EZ. The Evolvable Mars Campaign (EMC), a description of NASA's current approach to these human Mars missions, assumes that a single EZ will be identified within which NASA will establish a substantial and durable surface infrastructure that will be used by multiple human crews. The process of identifying and eventually selecting this single EZ will likely take many years to finalized. Because of this extended EZ selection process it becomes important to evaluate the current suite of surface systems and operations being evaluated for the EMC as they are likely to perform at a variety of proposed EZ locations and for the types of operations - both scientific and development - that are proposed for these candidate EZs. It is also important to evaluate proposed EZs for their suitability to be explored or developed given the range of capabilities and constraints for the types of surface systems and operations being considered within the EMC. Four locations identified in the Mars Exploration Program Analysis Group (MEPAG)'s Human Exploration of Mars Science Analysis Group (HEM-SAG) report are used in this paper as representative of candidate EZs that will emerge from the selection process that NASA has initiated. A field station site plan is developed for each of these four HEM-SAG sites. Because of the difficulty in getting equipment and supplies to the surface of Mars, specific assessments have been conducted to identify those systems and processes that can perform in multiple, sometimes completely unrelated, situations. Examples of common systems that are assessed at all of these sites include: (a) habitation and associated logistics storage systems, (b) a centralized power plant capable of supplying power to a geographically distributed (but within the central habitation zone) set of systems, (c) mobility systems that can be used to off-load and move payloads to specific locations at the central field station location that could also be used to traverse long distances to reach some of the more remote ROIs and (d) robotic systems that can support various activities (such as system set up and maintenance) at the field station that could also be used to explore scientific ROIs and used to support site-specific ISRU (In Situ Resource Utilization) production activities.

  2. Vehicle Dynamics Monitoring and Tracking System (VDMTS): Monitoring Mission Impacts in Support of Installation Land Management

    DTIC Science & Technology

    2012-05-01

    Hawaii (U.S. Army Environmental Command, 2008). The installation is located in the saddle between Mauna Loa and Mauna Kea volcanoes. PTA is located...17 5.2 SITE LOCATION, HISTORY , AND SITE CHARACTERISTICS...allowed the system to be tested and validated under different conditions and on different vehicle types. 5.2 SITE LOCATION, HISTORY , AND SITE

  3. Energetic Particles: From Sun to Heliosphere - and vice versa

    NASA Astrophysics Data System (ADS)

    Wimmer-Schweingruber, R. F.; Rodriguez-Pacheco, J.; Boden, S.; Boettcher, S. I.; Cernuda, I.; Dresing, N.; Drews, C.; Droege, W.; Elftmann, R.; Espinosa Lara, F.; Gomez-Herrero, R.; Heber, B.; Ho, G. C.; Klassen, A.; Kulkarni, S. R.; Mann, G. J.; Martin-Garcia, C.; Mason, G. M.; Panitzsch, L.; Prieto, M.; Sanchez, S.; Steinhagen, J.; Tammen, J.; Terasa, C.; Yu, J.

    2016-12-01

    Energetic particles in the heliosphere can be measured at their elevated energetic status after three processes: injection, acceleration, and transport. Suprathermal seed particles have speeds well above the fast magnetosonic speed in the solar wind frame of reference and can vary from location to location and within the solar activity cycle. Acceleration sites include reconnecting current sheets in solar flares or magnetspheric boundaries, shocks in the solar corona, heliosphere and a planetary obstacles, as well as planetary magnetospheres. Once accelerated, particles are transported from the acceleration site into and through the heliosphere. Thus, by investigating properties of energetic particles such as their composition, energy spectra, pitch-angle distribution, etc. one can attempt to distinguish their origin or injection and acceleration site. This in turn allows us to better understand transport effects whose underlying microphysics is also a key ingredient in the acceleration of particles. In this presentation we will present some clear examples which link energetic particles from their observing site to their source locations. These include Jupiter electrons, singly-charged He ions from CIRs, and 3He from solar flares. We will compare these examples with the measurement capabilities of the Energetic Particle Detector (EPD) on Solar Orbiter and consider implications for the key science goal of Solar Orbiter and Solar Proble Plus - How the Sun creates and controls the heliosphere.

  4. Energetic Particles: From Sun to Heliosphere - and vice versa

    NASA Astrophysics Data System (ADS)

    Wimmer-Schweingruber, R. F.; Rodriguez-Pacheco, J.; Boden, S.; Boettcher, S. I.; Cernuda, I.; Dresing, N.; Drews, C.; Droege, W.; Espinosa Lara, F.; Gomez-Herrero, R.; Heber, B.; Ho, G. C.; Klassen, A.; Kulkarni, S. R.; Mann, G. J.; Martin-Garcia, C.; Mason, G. M.; Panitzsch, L.; Prieto, M.; Sanchez, S.; Terasa, C.; Eldrum, S.

    2017-12-01

    Energetic particles in the heliosphere can be measured at their elevated energetic status after three processes: injection, acceleration, and transport. Suprathermal seed particles have speeds well above the fast magnetosonic speed in the solar wind frame of reference and can vary from location to location and within the solar activity cycle. Acceleration sites include reconnecting current sheets in solar flares or magnetspheric boundaries, shocks in the solar corona, heliosphere and a planetary obstacles, as well as planetary magnetospheres. Once accelerated, particles are transported from the acceleration site into and through the heliosphere. Thus, by investigating properties of energetic particles such as their composition, energy spectra, pitch-angle distribution, etc. one can attempt to distinguish their origin or injection and acceleration site. This in turn allows us to better understand transport effects whose underlying microphysics is also a key ingredient in the acceleration of particles. In this presentation we will present some clear examples which link energetic particles from their observing site to their source locations. These include Jupiter electrons, singly-charged He ions from CIRs, and 3He from solar flares. We will compare these examples with the measurement capabilities of the Energetic Particle Detector (EPD) on Solar Orbiter and consider implications for the key science goal of Solar Orbiter and Solar Proble Plus - How the Sun creates and controls the heliosphere.

  5. Locating the Binding Sites of Pb(II) Ion with Human and Bovine Serum Albumins

    PubMed Central

    Belatik, Ahmed; Hotchandani, Surat; Carpentier, Robert; Tajmir-Riahi, Heidar-Ali

    2012-01-01

    Lead is a potent environmental toxin that has accumulated above its natural level as a result of human activity. Pb cation shows major affinity towards protein complexation and it has been used as modulator of protein-membrane interactions. We located the binding sites of Pb(II) with human serum (HSA) and bovine serum albumins (BSA) at physiological conditions, using constant protein concentration and various Pb contents. FTIR, UV-visible, CD, fluorescence and X-ray photoelectron spectroscopic (XPS) methods were used to analyse Pb binding sites, the binding constant and the effect of metal ion complexation on HSA and BSA stability and conformations. Structural analysis showed that Pb binds strongly to HSA and BSA via hydrophilic contacts with overall binding constants of KPb-HSA = 8.2 (±0.8)×104 M−1 and KPb-BSA = 7.5 (±0.7)×104 M−1. The number of bound Pb cation per protein is 0.7 per HSA and BSA complexes. XPS located the binding sites of Pb cation with protein N and O atoms. Pb complexation alters protein conformation by a major reduction of α-helix from 57% (free HSA) to 48% (metal-complex) and 63% (free BSA) to 52% (metal-complex) inducing a partial protein destabilization. PMID:22574219

  6. United States Air Force 611th Air Support Group/Civil Engineering Squadron Elmendorf AFB, Alaska. Remedial investigation and feasibility study. Barter Island Radar Installation, Alaska. Volume 1 (includes appendices a through c). Revision 1. Final report, January 1995-January 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karmi, S.; Madden, J.; Borsetti, R.

    1996-01-05

    This report presents the findings of Remedial Investigations and Feasibility Studies at sites located at the Barter Island radar installation in northern Alaska. The sites were characterized based on sampling and analyses conducted during Remedial Investigation activities performed during August and September 1993.

  7. From the utilization point of view, the two approaches seem to United States Air Force 611th Air Support Group/Civil Engineering Squadron, Elmendorf AFB, Alaska. Remedial investigation and feasibility study Point Barrow Radar Installation, Alaska. Final report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karmi, S.

    1996-02-19

    This report presents the findings of Remedial Investigations and Feasibility Studies at sites located at the Point Barrow radar installation in northern Alaska. The sites were characterized based on sampling and analyses conducted during Remedial Investigation activities performed during August and September 1993.

  8. Quarterly Performance/Technical Report of the National Marrow Donor Program

    DTIC Science & Technology

    2010-11-05

    care. IIBA. Task 1: Period 8 Activity: Expand Network Co=unications Extended the Business to Business ( B2B ) Services to support the new alleles...exterior glass. • Site visit was conducted at the NMDP operated donor center in Philadelphia (August 12,2010) 0 At these site visits the Business ...Continuity Planner reviews the Business Continuity Action Guide with staff to better prepare each location for responding to incidents that interrupt

  9. Selecting optimal monitoring site locations for peak ambient particulate material concentrations using the MM5-CAMx4 numerical modelling system.

    PubMed

    Sturman, Andrew; Titov, Mikhail; Zawar-Reza, Peyman

    2011-01-15

    Installation of temporary or long term monitoring sites is expensive, so it is important to rationally identify potential locations that will achieve the requirements of regional air quality management strategies. A simple, but effective, numerical approach to selecting ambient particulate matter (PM) monitoring site locations has therefore been developed using the MM5-CAMx4 air pollution dispersion modelling system. A new method, 'site efficiency,' was developed to assess the ability of any monitoring site to provide peak ambient air pollution concentrations that are representative of the urban area. 'Site efficiency' varies from 0 to 100%, with the latter representing the most representative site location for monitoring peak PM concentrations. Four heavy pollution episodes in Christchurch (New Zealand) during winter 2005, representing 4 different aerosol dispersion patterns, were used to develop and test this site assessment technique. Evaluation of the efficiency of monitoring sites was undertaken for night and morning aerosol peaks for 4 different particulate material (PM) spatial patterns. The results demonstrate that the existing long term monitoring site at Coles Place is quite well located, with a site efficiency value of 57.8%. A temporary ambient PM monitoring site (operating during winter 2006) showed a lower ability to capture night and morning peak aerosol concentrations. Evaluation of multiple site locations used during an extensive field campaign in Christchurch (New Zealand) in 2000 indicated that the maximum efficiency achieved by any site in the city would be 60-65%, while the efficiency of a virtual background site is calculated to be about 7%. This method of assessing the appropriateness of any potential monitoring site can be used to optimize monitoring site locations for any air pollution measurement programme. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Earthquake disaster mitigation of Lembang Fault West Java with electromagnetic method

    NASA Astrophysics Data System (ADS)

    Widodo

    2015-04-01

    The Lembang fault is located around eight kilometers from Bandung City, West Java, Indonesia. The existence of this fault runs through densely populated settlement and tourism area. It is an active fault structure with increasing seismic activity where the 28 August 2011 earthquake occurred. The seismic response at the site is strongly influenced by local geological conditions. The ambient noise measurements from the western part of this fault give strong implication for a complex 3-D tectonic setting. Hence, near surface Electromagnetic (EM) measurements are carried out to understand the location of the local active fault of the research area. Hence, near surface EM measurements are carried out to understand the location of the local active fault and the top of the basement structure of the research area. The Transientelectromagnetic (TEM) measurements are carried out along three profiles, which include 35 TEM soundings. The results indicate that TEM data give detailed conductivity distribution of fault structure in the study area.

  11. Earthquake disaster mitigation of Lembang Fault West Java with electromagnetic method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Widodo, E-mail: widodo@gf.itb.ac.id

    The Lembang fault is located around eight kilometers from Bandung City, West Java, Indonesia. The existence of this fault runs through densely populated settlement and tourism area. It is an active fault structure with increasing seismic activity where the 28 August 2011 earthquake occurred. The seismic response at the site is strongly influenced by local geological conditions. The ambient noise measurements from the western part of this fault give strong implication for a complex 3-D tectonic setting. Hence, near surface Electromagnetic (EM) measurements are carried out to understand the location of the local active fault of the research area. Hence,more » near surface EM measurements are carried out to understand the location of the local active fault and the top of the basement structure of the research area. The Transientelectromagnetic (TEM) measurements are carried out along three profiles, which include 35 TEM soundings. The results indicate that TEM data give detailed conductivity distribution of fault structure in the study area.« less

  12. An analysis of the potential for Glen Canyon Dam releases to inundate archaeological sites in the Grand Canyon, Arizona

    USGS Publications Warehouse

    Sondossi, Hoda A.; Fairley, Helen C.

    2014-01-01

    The development of a one-dimensional flow-routing model for the Colorado River between Lees Ferry and Diamond Creek, Arizona in 2008 provided a potentially useful tool for assessing the degree to which varying discharges from Glen Canyon Dam may inundate terrestrial environments and potentially affect resources located within the zone of inundation. Using outputs from the model, a geographic information system analysis was completed to evaluate the degree to which flows from Glen Canyon Dam might inundate archaeological sites located along the Colorado River in the Grand Canyon. The analysis indicates that between 4 and 19 sites could be partially inundated by flows released from Glen Canyon Dam under current (2014) operating guidelines, and as many as 82 archaeological sites may have been inundated to varying degrees by uncontrolled high flows released in June 1983. Additionally, the analysis indicates that more of the sites currently (2014) proposed for active management by the National Park Service are located at low elevations and, therefore, tend to be more susceptible to potential inundation effects than sites not currently (2014) targeted for management actions, although the potential for inundation occurs in both groups of sites. Because of several potential sources of error and uncertainty associated with the model and with limitations of the archaeological data used in this analysis, the results are not unequivocal. These caveats, along with the fact that dam-related impacts can involve more than surface-inundation effects, suggest that the results of this analysis should be used with caution to infer potential effects of Glen Canyon Dam on archaeological sites in the Grand Canyon.

  13. Diurnal time-activity budgets of redheads (Aythya americana) wintering in seagrass beds and coastal ponds in Louisiana and Texas

    USGS Publications Warehouse

    Michot, T.C.; Woodin, M.C.; Adair, S.E.; Moser, E.B.

    2006-01-01

    Diurnal time-activity budgets were determined for wintering redheads (Aythya americana) from estuarine seagrass beds in Louisiana (Chandeleur Sound) and Texas (Laguna Madre) and from ponds adjacent to the Laguna Madre. Activities differed (p<0.0001) by location, month, and diurnal time period. Resting and feeding were the most frequent activities of redheads at the two estuarine sites, whereas drinking was almost nonexistent. Birds on ponds in Texas engaged most frequently in resting and drinking, but feeding was very infrequent. Redheads from the Louisiana estuarine site rested less than birds in Texas at either the Laguna Madre or freshwater ponds. Redheads in Louisiana fed more than birds in Texas; this was partially because of weather differences (colder temperatures in Louisiana), but the location effect was still significant even when we adjusted the model for weather effects. Redheads in Louisiana showed increased resting and decreased feeding as winter progressed, but redheads in Texas did not exhibit a seasonal pattern in either resting or feeding. In Louisiana, birds maintained a high level of feeding activity during the early morning throughout the winter, whereas afternoon feeding tapered off in mid- to late-winter. Texas birds showed a shift from morning feeding in early winter to afternoon feeding in late winter. Males and females at both Chandeleur Sound and Laguna Madre showed differences in their activities, but because the absolute difference seldom exceeded 2%, biological significance is questionable. Diurnal time-activity budgets of redheads on the wintering grounds are influenced by water salinities and the use of dietary fresh water, as well as by weather conditions, tides, and perhaps vegetation differences between sites. The opportunity to osmoregulate via dietary freshwater, vs. via nasal salt glands, may have a significant effect on behavioral allocations. ?? Springer 2006.

  14. Noninvasive Localization of Accessory Pathways in Wolff-Parkinson-White Syndrome by Three-Dimensional Speckle Tracking Echocardiography.

    PubMed

    Ishizu, Tomoko; Seo, Yoshihiro; Igarashi, Miyako; Sekiguchi, Yukio; Machino-Ohtsuka, Tomoko; Ogawa, Kojiro; Kuroki, Kenji; Yamamoto, Masahiro; Nogami, Akihiko; Kawakami, Yasushi; Aonuma, Kazutaka

    2016-06-01

    We have developed a noninvasive isochrone activation imaging (AI) system with 3-dimensional (3D) speckle tracking echocardiography (STE), which allows visualization of the wavefront image of mechanical propagation of the accessory pathway (ACP) in Wolff-Parkinson-White syndrome. Patients with manifest Wolff-Parkinson-White syndrome were imaged in 3D-STE AI mode, which quantified the time from QRS onset to regional endocardial deformation. In 2 patients with left- and right-side ACP, we confirmed that intraoperative contact endocardial electric mapping and the 3D-STE AI system showed comparable images pre- and postablation. In normal heart assessment by 3D-echo AI, the earliest activation sites were found at the attachment of the papillary muscles in the left ventricle and midseptum in the right ventricle, and none showed earliest activation at the peri-atrioventricular valve annuli. An analyzer who was unaware of the clinical information assessed 39 ACP locations in 38 Wolff-Parkinson-White syndrome patients using 3D-STE. All showed abnormal perimitral or tricuspid annular activations, and the location of 34 ACP (87%) showed agreement with the successful ablation sites within a 2-o'clock range. Especially for left free wall ACP, 17/18 (94%) showed consistency with the ablation site within a 2 o'clock range. Among 15 ACP at the ventricular septum, 9 (60%) showed early local activation in both right and left sides of the septum. Isochrone AI with 3D-STE may be a promising noninvasive imaging tool to assess cardiac synchronized activation in normal hearts and detect abnormal breakthrough of mechanical activation from both atrioventricular annuli in Wolff-Parkinson-White syndrome. © 2016 American Heart Association, Inc.

  15. HYFLUX: Satellite Exploration of Natural Hydrocarbon Seeps and Discovery of a Methane Hydrate Mound at GC600

    NASA Astrophysics Data System (ADS)

    Garcia-Pineda, O. G.; MacDonald, I. R.; Shedd, W.; Zimmer, B.

    2009-12-01

    Analysis of natural hydrocarbon seeps is important to improve our understanding of methane flux from deeper sediments to the water column. In order to quantify natural hydrocarbon seep formations in the Northern Gulf of Mexico, a set of 686 Synthetic Aperture Radar (SAR) images was analyzed using the Texture Classifying Neural Network Algorithm (TCNNA), which processes SAR data to delineate oil slicks. This analysis resulted in a characterization of 396 natural seep sites distributed in the northern GOM. Within these sites, a maximum of 1248 individual vents where identified. Oil reaching the sea-surface is deflected from its source during transit through the water column. This presentation describes a method for estimating locations of active oil vents based on repeated slick detection in SAR. One of the most active seep formations was detected in MMS lease block GC600. A total of 82 SAR scenes (collected by RADARSAT-1 from 1995 to 2007) was processed covering this region. Using TCNNA the area covered by each slick was computed and Oil Slicks Origins (OSO) were selected as single points within detected oil slicks. At this site, oil slick signatures had lengths up to 74 km and up to 27 km^2 of area. Using SAR and TCNNA, four active vents were identified in this seep formation. The geostatistical mean centroid among all detections indicated a location along a ridge-line at ~1200m. Sea truth observations with an ROV, confirmed that the estimated location of vents had a maximum offset of ~30 m from their actual locations on the seafloor. At the largest vent, a 3-m high, 12-m long mound of oil-saturated gas hydrate was observed. The outcrop contained thousands of ice worms and numerous semi-rigid chimneys from where oily bubbles were escaping in a continuous stream. Three additional vents were found along the ridge; these had lower apparent flow, but were also plugged with gas hydrate mounds. These results support use of SAR data for precise delineation of active seep formation and shallow gas hydrate deposits.

  16. 78 FR 9667 - Foreign-Trade Zone 50-Long Beach, California; Notification of Proposed Production Activity...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-11

    ... Consumer Electronics); Anaheim, CA The Board of Harbor Commissioners of the Port of Long Beach, grantee of... located within Site 31 of FTZ 50. The facility is used for the kitting of consumer electronics parts into...

  17. Source-term characterisation and solid speciation of plutonium at the Semipalatinsk NTS, Kazakhstan.

    PubMed

    Nápoles, H Jiménez; León Vintró, L; Mitchell, P I; Omarova, A; Burkitbayev, M; Priest, N D; Artemyev, O; Lukashenko, S

    2004-01-01

    New data on the concentrations of key fission/activation products and transuranium nuclides in samples of soil and water from the Semipalatinsk Nuclear Test Site are presented and interpreted. Sampling was carried out at Ground Zero, Lake Balapan, the Tel'kem craters and reference locations within the test site boundary well removed from localised sources. Radionuclide ratios have been used to characterise the source term(s) at each of these sites. The geochemical partitioning of plutonium has also been examined and it is shown that the bulk of the plutonium contamination at most of the sites examined is in a highly refractory, non-labile form.

  18. A report on the medieval mining and ore processing complex: Zilan valley, Van, Turkey.

    NASA Astrophysics Data System (ADS)

    Ateş, Yusuf; Kılıη, Sinan

    Literature has records of the use of obsidian that shows the existence of a knowledge base on raw material resources around Lake Van extending to very ancient times. Against this background, very little information can be obtained from literature about accurate location of historical mining activities in the region today. An ancient mining and processing complex, located northwest of the city of Van (Turkey) has been discovered by chance in 2007. The purpose of this article is to describe this historical mining area. The site contains mining structures such as shafts and galleries, and heaves of stone chips indicating some ore enrichment activities taking place there. The XRD and chemical analyses show the samples taken from the ore vein are rich in Manganese (Mn) and Barium (Ba), and it is concluded that the Zilan Valley Mining and Processing Complex was for Pyrolusite (MnO2), Barium or both. The site is being described for the first time in the literature and offers an opportunity to fulfill the gap in literature regarding mining history. The discovery and the description of the site would also have implications in a wide multidisciplinary scientific community, including metallurgy, archeology, and world heritage.

  19. Position-specific binding of FUS to nascent RNA regulates mRNA length

    PubMed Central

    Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen

    2015-01-01

    More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189

  20. Electrical Resistivity Imaging of Tidal Fluctuations in the Water Table at Inwood Hill Park, Manhattan

    NASA Astrophysics Data System (ADS)

    Kenyon, P. M.; Kassem, D.; Olin, A.; Nunez, J.; Smalling, A.

    2005-05-01

    Inwood Hill Park is located on the northern tip of Manhattan and has been extensively modified over the years by human activities. In its current form, it has a backbone of exposed or lightly covered bedrock along the Hudson River, adjacent to a flat area with two tidal inlets along the northern shore of Manhattan. The tidal motions in the inlets are expected to drive corresponding fluctuations in the water table along the borders of the inlets. In the Fall of 2002, a group of students from the Department of Earth and Atmospheric Sciences at the City College of New York studied these fluctuations. Electrical resistivity cross sections were obtained with a Syscal Kid Switch 24 resistivity meter during the course of a tidal cycle at three locations surrounding the westernmost inlet in the park. No change was seen over a tidal cycle at Site 1, possibly due to the effect of concrete erosion barriers which were located between the land and the water surrounding this site. Measurements at Site 2 revealed a small, regular change in the water table elevation of approximately 5 cm over the course of a tidal cycle. This site is inferred to rest on alluvial sediments deposited by a small creek. The cross sections taken at different times during a tidal cycle at Site 3 were the most interesting. They show a very heterogeneous subsurface, with water spurting between blocks of high resistivity materials during the rising portion of the cycle. A small sinkhole was observed on the surface of the ground directly above an obvious plume of water in the cross section. Park personnel confirmed that this sinkhole, like others scattered around this site, is natural and not due to recent construction activity. They also indicated that debris from the construction of the New York City subways may have been dumped in the area in the past. Our conclusion is that the tidal fluctuations at Site 3 are being channeled by solid blocks in the construction debris, and that the sinkholes currently present result from removal of sediments from below, as a result of the tidal fluctuations.

  1. Localization of PKA Phosphorylation Site, Serine-2030, in the Three-Dimensional Structure of Cardiac Ryanodine Receptor

    PubMed Central

    Jones, Peter P.; Meng, Xing; Xiao, Bailong; Cai, Shitian; Bolstad, Jeff; Wagenknecht, Terence; Liu, Zheng; Chen, S. R. Wayne

    2009-01-01

    Protein kinase A (PKA)-dependent phosphorylation of the cardiac Ca2+ release channel/ryanodine receptor (RyR2) is believed to directly dissociate FKBP12.6 from the channel, causing abnormal channel activation and Ca2+ release. To gain insight into the structural basis of the regulation of RyR2 by PKA, we determined the three-dimensional location of the PKA site S2030. Green fluorescent protein (GFP) was inserted into the wild type (wt) RyR2 and RyR2 mutant, A4860G, after T2023. The resultant GFP-RyR2 fusion proteins, RyR2T2023-GFP and RyR2(A4860G)T2023-GFP, were expressed in HEK293 cells and functionally characterized. Ca2+ release assays revealed that both GFP-RyR2 fusion proteins formed caffeine- and ryanodine-sensitive Ca2+ release channels. Further analyses using [3H]ryanodine binding demonstrated that the insertion of GFP into RyR2 wt after T2023 reduced the sensitivity of the channel to activation by Ca2+ or caffeine. RyR2(A4860G)T2023-GFP was found to be structurally more stable than RyR2T2023-GFP and was subsequently used as a basis for three-dimensional reconstruction. Cryo-electron microscopy and single particle image processing of the purified RyR2(A4860G)T2023-GFP protein revealed the location of the inserted GFP, and hence the S2030 PKA site in domain 4, a region that may be involved in signal transduction between the transmembrane and cytoplasmic domains. Like the S2808 PKA site reported previously, the S2030 site is not located close to the FKBP12.6 binding site mapped previously, indicating that neither of these PKA sites is directly involved in FKBP12.6 binding. Based on the three-dimensional localizations of a number of residues or regions, a model for the subunit organization in the structure of RyR2 is proposed. PMID:17967164

  2. Computation-Facilitated Assignment of Function in the Enolase Superfamily: A Regiochemically Distinct Galactarate Dehydratase from Oceanobacillus iheyensis†

    PubMed Central

    Rakus, John F.; Kalyanaraman, Chakrapani; Fedorov, Alexander A.; Fedorov, Elena V.; Mills-Groninger, Fiona P.; Toro, Rafael; Bonanno, Jeffrey; Bain, Kevin; Sauder, J. Michael; Burley, Stephen K.; Almo, Steven C.; Jacobson, Matthew P.; Gerlt, John A.

    2009-01-01

    The structure of an uncharacterized member of the enolase superfamily from Oceanobacillus iheyensis (GI: 23100298; IMG locus tag Ob2843; PDB Code 2OQY) was determined by the New York SGX Research Center for Structural Genomics (NYSGXRC). The structure contained two Mg2+ ions located 10.4 Å from one another, with one located in the canonical position in the (β/α)7β-barrel domain (although the ligand at the end of the fifth β-strand is His, unprecedented in structurally characterized members of the superfamily); the second is located in a novel site within the capping domain. In silico docking of a library of mono- and diacid sugars to the active site predicted a diacid sugar as a likely substrate. Activity screening of a physical library of acid sugars identified galactarate as the substrate (kcat = 6.8 s−1, KM = 620 μM; kcat/KM = 1.1 × 104 M−1 s−1), allowing functional assignment of Ob2843 as galactarate dehydratase (GalrD-II) The structure of a complex of the catalytically impaired Y90F mutant with Mg2+ and galactarate allowed identification of a Tyr 164-Arg 162 dyad as the base that initiates the reaction by abstraction of the α-proton and Tyr 90 as the acid that facilitates departure of the β-OH leaving group. The enzyme product is 2-keto-3-deoxy-D-threo-4,5-dihydroxyadipate, the enantiomer of the product obtained in the GalrD reaction catalyzed by a previously characterized bifunctional L-talarate/galactarate dehydratase (TalrD/GalrD). On the basis of the different active site structures and different regiochemistries, we recognize that these functions represent an example of apparent, not actual, convergent evolution of function. The structure of GalrD-II and its active site architecture allow identification of the seventh functionally and structurally characterized subgroup in the enolase superfamily. This study provides an additional example that an integrated sequence/structure-based strategy employing computational approaches is a viable approach for directing functional assignment of unknown enzymes discovered in genome projects. PMID:19883118

  3. 14 CFR 420.27 - Launch site location review-information requirements.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Launch site location review-information... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION LICENSING LICENSE TO OPERATE A LAUNCH SITE Criteria and Information Requirements for Obtaining a License § 420.27 Launch site location review—information requirements. An...

  4. A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

    PubMed Central

    Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

    2000-01-01

    Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

  5. Environmental Restoration Operations: Consolidated Quarterly Report January -March 2017

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cochran, John R.

    This Environmental Restoration Operations (ER) Consolidated Quarterly Report (ER Quarterly Report) provides the status of ongoing corrective action activities being implemented at Sandia National Laboratories, New Mexico (SNL/NM) during the January, February, and March 2017 quarterly reporting period. Table I-1 lists the Solid Waste Management Units (SWMUs) and Areas of Concern (AOCs) identified for corrective action at SNL/NM. Sections I.2.1 and I.2.2 summarize the work completed during this quarter. Section I.2.1 summarizes the quarterly activities at sites undergoing corrective action field activities. Field activities are conducted at the three groundwater AOCs (Burn Site Groundwater [BSG AOC], Technical Area [TA]-V Groundwatermore » [TAVG AOC], and Tijeras Arroyo Groundwater [TAG AOC]). Section I.2.2 summarizes quarterly activities at sites where the New Mexico Environment Department (NMED) Hazardous Waste Bureau (HWB) issued a certificate of completion and the sites are in the corrective action complete (CAC) regulatory process. Currently, SWMUs 8 and 58, 68, 149, 154, and 502 are in the CAC regulatory process. Corrective action activities are deferred at the Long Sled Track (SWMU 83), the Gun Facilities (SWMU 84), and the Short Sled Track (SWMU 240) because these three sites are active mission facilities. These three active mission sites are located in TA-III. This Sandia National Laboratories, New Mexico Environmental Restoration Operations (ER) Consolidated Quarterly Report (ER Quarterly Report) fulfills all quarterly reporting requirements set forth in the Resource Conservation and Recovery Act Facility Operating Permit and the Compliance Order on Consent.« less

  6. Amino acid sequence of human cholinesterase. Annual report, 30 September 1984-30 September 1985

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lockridge, O.

    1985-10-01

    The active-site serine residue is located 198 amino acids from the N-terminal. The active-site peptide was isolated from three different genetic types of human serum cholinesterase: from usual, atypical, and atypical-silent genotypes. It was found that the amino acid sequence of the active-site peptide was identical in all three genotypes. Comparison of the complete sequences of cholinesterase from human serum and acetylcholinesterase from the electric organ of Torpedo californica shows an identity of 53%. Cholinesterase is of interest to the Department of Defense because cholinesterase protects against organophosphate poisons of the type used in chemical warfare. The structural results presentedmore » here will serve as the basis for cloning the gene for cholinesterase. The potential uses of large amounts of cholinesterase would be for cleaning up spills of organophosphates and possibly for detoxifying exposed personnel.« less

  7. Beach erosion and nest site selection by the leatherback sea turtle Dermochelys coriacea (Testudines: Dermochelyidae) and implications for management practices at Playa Gandoca, Costa Rica.

    PubMed

    Spanier, Matthew J

    2010-12-01

    Leatherback sea turtles (Dermochelys coriacea) nest on dynamic, erosion-prone beaches. Erosive processes and resulting nest loss have long been presumed to be a hindrance to clutch survival. In order to better understand how leatherbacks cope with unstable nesting beaches, I investigated the role of beach erosion in leatherback nest site selection at Playa Gandoca, Costa Rica. I also examined the potential effect of nest relocation, a conservation strategy in place at Playa Gandoca to prevent nest loss to erosion, on the temperature of incubating clutches. I monitored changes in beach structure as a result of erosion at natural nest sites during the time the nest was laid, as well as in subsequent weeks. To investigate slope as a cue for nest site selection, I measured the slope of the beach where turtles ascended from the sea to nest, as well as the slopes at other random locations on the beach for comparison. I examined temperature differences between natural and relocated nest sites with thermocouples placed in the sand at depths typical of leatherback nests. Nests were distributed non-randomly in a clumped distribution along the length of the beach and laid at locations that were not undergoing erosion. The slope at nest sites was significantly different than at randomly chosen locations on the beach. The sand temperature at nest depths was significantly warmer at natural nest sites than at locations of relocated nests. The findings of this study suggest leatherbacks actively select nest sites that are not undergoing erosive processes, with slope potentially being used as a cue for site selection. The relocation of nests appears to be inadvertently cooling the nest environment. Due to the fact that leatherback clutches undergo temperature-dependent sex determination, the relocation of nests may be producing an unnatural male biasing of hatchlings. The results of this study suggest that the necessity of relocation practices, largely in place to protect nests from erosion, should be reevaluated to ensure the proper conservation of this critically endangered species.

  8. Bathymetry (Part I), sedimentary regimes (Part II), and abyssal waste-disposal potential near the conterminous United States

    NASA Astrophysics Data System (ADS)

    Bowles, Frederick A.; Vogt, Peter R.; Jung, Woo-Yeol

    1998-05-01

    Placing waste on the seafloor, with the intention that it remain in place and isolated from mankind, requires a knowledge of the environmental factors that may be applicable to a specific seafloor area. DBDB5 (Digital Bathymetric Database gridded at 5' latitude by 5' longitude cell dimension) is used here for regional assessments of seafloor depth, slope, and relief at five surrogate abyssal waste sites; two each in the western Atlantic and eastern Pacific, and one in the Gulf of Mexico. Only Pacific-1 exhibits a `high' slope (2°) by DBDB5 standards, whereas the remaining sites are located on almost level seafloor. Detailed examination of the sites using multibeam-based contour sheets show the area around Atlantic-1 to be a featureless plain. Atlantic-2 and both Pacific sites are surrounded by abyssal hill topography, with local slopes ranging from greater than 6° at all sites to above 15° at Pacific-2. Neither Pacific site features a seafloor as `flat' as at Atlantic-1 or at the Gulf of Mexico site. Locating waste sites on sedimented slopes could have serious consequences due to catastrophic slope failure and downslope displacement of waste by mass sediment-transport processes. Neither slumping nor sliding are perceived as critical processes affecting the surrogate sites because of their locations on negligibly sloping seafloors. However, debris flows and turbidity currents are capable of transporting large volumes of sediment for long distances over low gradients and, in the case of turbidity currents, at great speed. Dispersal of loose waste material by these processes is virtually assured, but less likely if the waste is bagged. The turbidity current problem is alleviated (but not eliminated) by locating waste sites on distal portions of abyssal plains. Both Pacific sites are surrounded by abyssal hills and, in the case of Pacific-2, far beyond the reach of land-derived turbidity currents. Thin sediment cover and low rates of sedimentation have also resulted in highly stable slope (abyssal hill) deposits. Hence, the probability of locally derived, small-volume flows is low at these sites. Existing high sea levels have also resulted in a worldwide decrease in turbidity current activity relative to glacial times when sea levels were much lower.

  9. Characterization of Fe(II) oxidizing bacterial activities and communities at two acidic Appalachian coalmine drainage-impacted sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Senko, John M.; Wanjugi, Pauline; Lucas, Melanie

    2008-06-12

    We characterized the microbiologically mediated oxidative precipitation of Fe(II) from coalminederived acidic mine drainage (AMD) along flow-paths at two sites in northern Pennsylvania. At the Gum Boot site, dissolved Fe(II) was efficiently removed from AMD whereas minimal Fe(II) removal occurred at the Fridays-2 site. Neither site received human intervention to treat the AMD. Culturable Fe(II) oxidizing bacteria were most abundant at sampling locations along the AMD flow path corresponding to greatest Fe(II) removal and where overlying water contained abundant dissolved O2. Rates of Fe(II) oxidation determined in laboratory-based sediment incubations were also greatest at these sampling locations. Ribosomal RNA intergenicmore » spacer analysis and sequencing of partial 16S rRNA genes recovered from sediment bacterial communities revealed similarities among populations at points receiving regular inputs of Fe(II)-rich AMD and provided evidence for the presence of bacterial lineages capable of Fe(II) oxidation. A notable difference between bacterial communities at the two sites was the abundance of Chloroflexi-affiliated 16S rRNA gene sequences in clone libraries derived from the Gum Boot sediments. Our results suggest that inexpensive and reliable AMD treatment strategies can be implemented by mimicking the conditions present at the Gum Boot field site.« less

  10. Usefulness of ventricular endocardial electric reconstruction from body surface potential maps to noninvasively localize ventricular ectopic activity in patients

    NASA Astrophysics Data System (ADS)

    Lai, Dakun; Sun, Jian; Li, Yigang; He, Bin

    2013-06-01

    As radio frequency (RF) catheter ablation becomes increasingly prevalent in the management of ventricular arrhythmia in patients, an accurate and rapid determination of the arrhythmogenic site is of important clinical interest. The aim of this study was to test the hypothesis that the inversely reconstructed ventricular endocardial current density distribution from body surface potential maps (BSPMs) can localize the regions critical for maintenance of a ventricular ectopic activity. Patients with isolated and monomorphic premature ventricular contractions (PVCs) were investigated by noninvasive BSPMs and subsequent invasive catheter mapping and ablation. Equivalent current density (CD) reconstruction (CDR) during symptomatic PVCs was obtained on the endocardial ventricular surface in six patients (four men, two women, years 23-77), and the origin of the spontaneous ectopic activity was localized at the location of the maximum CD value. Compared with the last (successful) ablation site (LAS), the mean and standard deviation of localization error of the CDR approach were 13.8 and 1.3 mm, respectively. In comparison, the distance between the LASs and the estimated locations of an equivalent single moving dipole in the heart was 25.5 ± 5.5 mm. The obtained CD distribution of activated sources extending from the catheter ablation site also showed a high consistency with the invasively recorded electroanatomical maps. The noninvasively reconstructed endocardial CD distribution is suitable to predict a region of interest containing or close to arrhythmia source, which may have the potential to guide RF catheter ablation.

  11. Revised description of index of Florida water data collection active stations and a user's guide for station or site information retrieval computer program FINDEX H578

    USGS Publications Warehouse

    Geiger, Linda H.

    1983-01-01

    The report is an update of U.S. Geological Survey Open-File Report 77-703, which described a retrieval program for administrative index of active data-collection sites in Florida. Extensive changes to the Findex system have been made since 1977 , making the previous report obsolete. A description of the data base and computer programs that are available in the Findex system are documented in this report. This system serves a vital need in the administration of the many and diverse water-data collection activities. District offices with extensive data-collection activities will benefit from the documentation of the system. Largely descriptive, the report tells how a file of computer card images has been established which contains entries for all sites in Florida at which there is currently a water-data collection activity. Entries include information such as identification number, station name, location, type of site, county, frequency of data collection, funding, and other pertinent details. The computer program FINDEX selectively retrieves entries and lists them in a format suitable for publication. The index is updated routinely. (USGS)

  12. Climate effect on soil enzyme activities and dissolved organic carbon in mountain calcareous soils: a soil-transplant experiment

    NASA Astrophysics Data System (ADS)

    Puissant, Jérémy; Cécillon, Lauric; Mills, Robert T. E.; Gavazov, Konstantin; Robroek, Bjorn J. M.; Spiegelberger, Thomas; Buttler, Alexandre; Brun, Jean-Jacques

    2013-04-01

    Mountain soils store huge amounts of carbon as soil organic matter (SOM) which may be highly vulnerable to the strong climate changes that mountain areas currently experience worldwide. Climate modifications are expected to impact microbial activity which could change the rate of SOM decomposition/accumulation, thereby questioning the net C source/sink character of mountain soils. To simulate future climate change expected in the 21st century in the calcareous pre-Alps, 15 blocks (30 cm deep) of undisturbed soil were taken from a mountain pasture located at 1400 m a.s.l. (Marchairuz, Jura, Switzerland) and transplanted into lysimeters at the same site (control) and at two other sites located at 1000 m a.s.l. and 600 m a.s.l. (5 replicates per site). This transplantation experiment which started in 2009 simulates a climate warming with a temperature increase of 4° C and a decreased humidity of 40 % at the lowest site. In this study, we used soil extracellular enzyme activities (EEA) as functional indicators of SOM decomposition to evaluate the effect of climate change on microbial activity and SOM dynamics along the seasons. Dissolved organic carbon (DOC) was also measured to quantify the assimilable carbon for microorganism. In autumn 2012, a first sampling step out of four (winter, spring and summer 2013) has been realized. We extracted 15 cm deep soil cores from each transplant (x15) and measured (i) DOC and (ii) the activities of nine different enzymes. Enzymes were chosen to represent the degradation of the most common classes of biogeochemical compounds in SOM. β-glucosidase, β-D-cellubiosidase, β-Xylosidase, N-acetyl-β-glucosaminidase, leucine aminopeptidase, lipase, phenoloxidase respectively represented the degradation of sugar, cellulose, hemicellulose, chitin, protein, lipid and lignin. Moreover, the fluorescein diacetate (FDA) hydrolysis was used to provide an estimate of global microbial activity and phosphatase was used to estimate phosphorus mineralization. The autumn results showed no differences for global microbial activity along the climate gradient (0.37 nKatal g-1 dry soil), no differences and a very low activity for leucine aminopeptidase and β-glucosidase and β-Xylosidase (about 0.09 nKatal g-1 dry soil) and no differences for cellulose, chitin and phosphorus mineralization. Conversely, we measured a greater activity at the highest elevation site for lipase and phenoloxydase (ANOVA test, p

  13. Thermal regime of active layer at two lithologically contrasting sites on James Ross Island, Antarctic Peninsula.

    NASA Astrophysics Data System (ADS)

    Hrbáček, Filip; Nývlt, Daniel; Láska, Kamil

    2016-04-01

    Antarctic Peninsula region (AP) represents one of the most rapidly warming parts of our planet in the last 50 years. Despite increasing research activities along both western and eastern sides of AP in last decades, there is still a lot of gaps in our knowledge relating to permafrost, active layer and its thermal and physical properties. This study brings new results of active layer monitoring on James Ross Island, which is the largest island in northern AP. Its northern part, Ulu Peninsula, is the largest ice-free area (more than 200 km2) in the region. Due its large area, we focused this study on sites located in different lithologies, which would affect local thermal regime of active layer. Study site (1) at Abernethy Flats area (41 m a.s.l.) lies ~7 km from northern coast. Lithologically is formed by disintegrated Cretaceous calcareous sandstones and siltstones of the Santa Marta Formation. Study site (2) is located at the northern slopes of Berry Hill (56 m a.s.l.), about 0.4 km from northern coastline. Lithology is composed of muddy to intermediate diamictites, tuffaceous siltstones to fine grained sandstones of the Mendel Formation. Data of air temperature at 2 meters above ground and the active layer temperatures at 75 cm deep profiles were obtained from both sites in period 1 January 2012 to 31 December 2014. Small differences were found when comparing mean air temperatures and active temperatures at 5 and 75 cm depth in the period 2012-2014. While the mean air temperatures varied between -7.7 °C and -7.0 °C, the mean ground temperatures fluctuated between -6.6 °C and -6.1 °C at 5 cm and -6.9 °C and -6.0 °C at 75 cm at Abernethy Flats and Berry Hill slopes respectively. Even though ground temperature differences along the profiles weren't pronounced during thawing seasons, the maximum active layer thickness was significantly larger at Berry Hill slopes (80 to 82 cm) than at Abernethy Flats (52 to 64 cm). We assume this differences are affected by local lithology, especially by the higher proportion of fine particles and more thermally conductive minerals, together with higher water saturation are fundamental for higher maximum active layer thickness found at Berry Hill slopes.

  14. Effects of land use on water quality and transport of selected constituents in streams in Mecklenburg County, North Carolina, 1994–98

    USGS Publications Warehouse

    Ferrell, Gloria M.

    2001-01-01

    Transport rates for total solids, total nitrogen, total phosphorus, biochemical oxygen demand, chromium, copper, lead, nickel, and zinc during 1994–98 were computed for six stormwater-monitoring sites in Mecklenburg County, North Carolina. These six stormwater-monitoring sites were operated by the Mecklenburg County Department of Environmental Protection, in cooperation with the City of Charlotte, and are located near the mouths of major streams. Constituent transport at the six study sites generally was dominated by nonpoint sources, except for nitrogen and phosphorus at two sites located downstream from the outfalls of major municipal wastewater-treatment plants.To relate land use to constituent transport, regression equations to predict constituent yield were developed by using water-quality data from a previous study of nine stormwater-monitoring sites on small streams in Mecklenburg County. The drainage basins of these nine stormwater sites have relatively homogeneous land-use characteristics compared to the six study sites. Mean annual construction activity, based on building permit files, was estimated for all stormwater-monitoring sites and included as an explanatory variable in the regression equations. These regression equations were used to predict constituent yield for the six study sites. Predicted yields generally were in agreement with computed yields. In addition, yields were predicted by using regression equations derived from a national urban water-quality database. Yields predicted from the regional regression equations generally were about an order of magnitude lower than computed yields.Regression analysis indicated that construction activity was a major contributor to transport of the constituents evaluated in this study except for total nitrogen and biochemical oxygen demand. Transport of total nitrogen and biochemical oxygen demand was dominated by point-source contributions. The two study basins that had the largest amounts of construction activity also had the highest total solids yields (1,300 and 1,500 tons per square mile per year). The highest total phosphorus yields (3.2 and 1.7 tons per square mile per year) attributable to nonpoint sources also occurred in these basins. Concentrations of chromium, copper, lead, nickel, and zinc were positively correlated with total solids concentrations at most of the study sites (Pearson product-moment correlation >0.50). The site having the highest median concentrations of chromium, copper, and nickel also was the site having the highest computed yield for total solids.

  15. Remote Acoustic Monitoring of North Atlantic Right Whales (Eubalaena glacialis) Reveals Seasonal and Diel Variations in Acoustic Behavior

    PubMed Central

    Matthews, Leanna P.; McCordic, Jessica A.; Parks, Susan E.

    2014-01-01

    Remote acoustic monitoring is a non-invasive tool that can be used to study the distribution, behavior, and habitat use of sound-producing species. The North Atlantic right whale (Eubalaena glacialis) is an endangered baleen whale species that produces a variety of stereotyped acoustic signals. One of these signals, the “gunshot” sound, has only been recorded from adult male North Atlantic right whales and is thought to function for reproduction, either as reproductive advertisement for females or as an agonistic signal toward other males. This study uses remote acoustic monitoring to analyze the presence of gunshots over a two-year period at two sites on the Scotian Shelf to determine if there is evidence that North Atlantic right whales may use these locations for breeding activities. Seasonal analyses at both locations indicate that gunshot sound production is highly seasonal, with an increase in the autumn. One site, Roseway West, had significantly more gunshot sounds overall and exhibited a clear diel trend in production of these signals at night. The other site, Emerald South, also showed a seasonal increase in gunshot production during the autumn, but did not show any significant diel trend. This difference in gunshot signal production at the two sites indicates variation either in the number or the behavior of whales at each location. The timing of the observed seasonal increase in gunshot sound production is consistent with the current understanding of the right whale breeding season, and our results demonstrate that detection of gunshots with remote acoustic monitoring can be a reliable way to track shifts in distribution and changes in acoustic behavior including possible mating activities. PMID:24646524

  16. Remote acoustic monitoring of North Atlantic right whales (Eubalaena glacialis) reveals seasonal and diel variations in acoustic behavior.

    PubMed

    Matthews, Leanna P; McCordic, Jessica A; Parks, Susan E

    2014-01-01

    Remote acoustic monitoring is a non-invasive tool that can be used to study the distribution, behavior, and habitat use of sound-producing species. The North Atlantic right whale (Eubalaena glacialis) is an endangered baleen whale species that produces a variety of stereotyped acoustic signals. One of these signals, the "gunshot" sound, has only been recorded from adult male North Atlantic right whales and is thought to function for reproduction, either as reproductive advertisement for females or as an agonistic signal toward other males. This study uses remote acoustic monitoring to analyze the presence of gunshots over a two-year period at two sites on the Scotian Shelf to determine if there is evidence that North Atlantic right whales may use these locations for breeding activities. Seasonal analyses at both locations indicate that gunshot sound production is highly seasonal, with an increase in the autumn. One site, Roseway West, had significantly more gunshot sounds overall and exhibited a clear diel trend in production of these signals at night. The other site, Emerald South, also showed a seasonal increase in gunshot production during the autumn, but did not show any significant diel trend. This difference in gunshot signal production at the two sites indicates variation either in the number or the behavior of whales at each location. The timing of the observed seasonal increase in gunshot sound production is consistent with the current understanding of the right whale breeding season, and our results demonstrate that detection of gunshots with remote acoustic monitoring can be a reliable way to track shifts in distribution and changes in acoustic behavior including possible mating activities.

  17. Multiple active site residues are important for photochemical efficiency in the light-activated enzyme protochlorophyllide oxidoreductase (POR).

    PubMed

    Menon, Binuraj R K; Hardman, Samantha J O; Scrutton, Nigel S; Heyes, Derren J

    2016-08-01

    Protochlorophyllide oxidoreductase (POR) catalyzes the light-driven reduction of protochlorophyllide (Pchlide), an essential, regulatory step in chlorophyll biosynthesis. The unique requirement of the enzyme for light has provided the opportunity to investigate how light energy can be harnessed to power biological catalysis and enzyme dynamics. Excited state interactions between the Pchlide molecule and the protein are known to drive the subsequent reaction chemistry. However, the structural features of POR and active site residues that are important for photochemistry and catalysis are currently unknown, because there is no crystal structure for POR. Here, we have used static and time-resolved spectroscopic measurements of a number of active site variants to study the role of a number of residues, which are located in the proposed NADPH/Pchlide binding site based on previous homology models, in the reaction mechanism of POR. Our findings, which are interpreted in the context of a new improved structural model, have identified several residues that are predicted to interact with the coenzyme or substrate. Several of the POR variants have a profound effect on the photochemistry, suggesting that multiple residues are important in stabilizing the excited state required for catalysis. Our work offers insight into how the POR active site geometry is finely tuned by multiple active site residues to support enzyme-mediated photochemistry and reduction of Pchlide, both of which are crucial to the existence of life on Earth. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Photovoltaic receivers for laser beamed power in space

    NASA Technical Reports Server (NTRS)

    Landis, Geoffrey A.

    1991-01-01

    There has recently been a resurgence of interest in the use of beamed power to support space exploration activities. One of the most promising beamed power concepts uses a laser beam to transmit power to a remote photovoltaic array. Large lasers can be located on cloud-free sites at one or more ground locations and illuminate solar arrays to a level sufficient to provide operating power. Issues involved in providing photovoltaic receivers for such applications are discussed.

  19. Desert Research and Technology Studies (RATS) 2007 Field Campaign Objectives and Results

    NASA Technical Reports Server (NTRS)

    Kosmo, Joseph; Romig, Barbara

    2008-01-01

    Desert "RATS" (Research and Technology Studies) is a combined, multi-discipline group of inter-NASA center scientists and engineers, net-working and collaborating with representatives of industry and academia, for the purpose of conducting planetary surface exploration-focused remote field exercises. These integrated testing exercises conducted under representative analog Lunar and Mars surface terrain conditions, provide NASA the capability to validate experimental prototype hardware and software systems as well as to evaluate and develop mission operational techniques in order to identify and establish technical requirements and identify potential technology "gaps" applicable for future planetary human exploration. The 2007 D-RATS field campaign test activities were initiated based on the major themes and objectives of a notional 5-year plan developed for conducting relative analog test activities in support of the engineering evaluation and assessment of various system architectural requirements, conceptual prototype support equipment and selected technologies necessary for the establishment of a lunar outpost. Specifically, the major objectives included measuring task efficiency during robot, human, and human-robot interactive tasks associated with lunar outpost site surveying and reconnaissance activities and deployment of a representative solar panel power and distribution system. In addition, technology demonstrations were conducted with a new Lithium-ion battery and autonomous software to coordinate multiple robot activities. Secondary objectives were evaluating airlock concept mockups and prototype removable space suit over-garment elements for dust mitigation, and upgrades to the prototype extravehicular activities (EVA) communication and information system. Dry run test activities, prior to testing at a designated remote field site location, were initially conducted at the Johnson Space Center (JSC) Remote Field Demonstration Test Site. This is a multi-acre external test site located at JSC and has detailed representative terrain features simulating both Lunar and Mars surface characteristics. Both the local JSC and remote field test sites have terrain conditions that are representative and characteristic of both the Moon and Mars, such as strewn rock and volcanic ash fields, craters, rolling plains, hills, gullies, slopes, and outcrops. The D-RATS 2007 field campaign, representing the completion of its tenth year of analog testing, was conducted at the large Cinder Lake volcanic ash bed area adjacent to Flagstaff, Arizona.

  20. On-site or off-site treatment of medical waste: a challenge

    PubMed Central

    2014-01-01

    Treating hazardous-infectious medical waste can be carried out on-site or off-site of health-care establishments. Nevertheless, the selection between on-site and off-site locations for treating medical waste sometimes is a controversial subject. Currently in Iran, due to policies of Health Ministry, the hospitals have selected on-site-treating method as the preferred treatment. The objectives of this study were to assess the current condition of on-site medical waste treatment facilities, compare on-site medical waste treatment facilities with off-site systems and find the best location of medical waste treatment. To assess the current on-site facilities, four provinces (and 40 active hospitals) were selected to participate in the survey. For comparison of on-site and off-site facilities (due to non availability of an installed off-site facility) Analytical Hierarchy Process (AHP) was employed. The result indicated that most on-site medical waste treating systems have problems in financing, planning, determining capacity of installations, operation and maintenance. AHP synthesis (with inconsistency ratio of 0.01 < 0.1) revealed that, in total, the off-site treatment of medical waste was in much higher priority than the on-site treatment (64.1% versus 35.9%). According to the results of study it was concluded that the off-site central treatment can be considered as an alternative. An amendment could be made to Iran’s current medical waste regulations to have infectious-hazardous waste sent to a central off-site installation for treatment. To begin and test this plan and also receive the official approval, a central off-site can be put into practice, at least as a pilot in one province. Next, if it was practically successful, it could be expanded to other provinces and cities. PMID:24739145

  1. Assessment of seismic hazards along the northern Gulf of Aqaba

    NASA Astrophysics Data System (ADS)

    Abueladas, Abdel-Rahman Aqel

    Aqaba and Elat are very important port and recreation cities for the Hashemite Kingdom of Jordan and Israel, respectively. The two cities are the most susceptible to damage from a destructive future earthquake because they are located over the tectonically active Dead Sea transform fault (DST) that is the source of most of the major historical earthquakes in the region. The largest twentieth century earthquake on the DST, the magnitude Mw 7.2 Nuweiba earthquake of November 22, 1995, caused damage to structures in both cities. The integration of geological, geophysical, and earthquake engineering studies will help to assess the seismic hazards by determining the location and slip potential of active faults and by mapping areas of high liquefaction susceptibility. Ground Penetrating Radar (GPR) as a high resolution shallow geophysical tool was used to map the shallow active faults in Aqaba, Taba Sabkha area, and Elat. The GPR data revealed the onshore continuation of the Evrona, West Aqaba, Aqaba fault zones, and several transverse faults. The integration of offshore and onshore data confirm the extension of these faults along both sides of the Gulf of Aqaba. A 3D model of GPR data at one site in Aqaba indicates that the NW-trending transverse faults right laterally offset older than NE-trending faults. The most hazardous fault is the Evrona fault which extends north to the Tabs Sabkha. A geographic information system (GIS) database of the seismic hazard was created in order to facilitate the analyzing, manipulation, and updating of the input parameters. Liquefaction potential maps were created for the region based on analysis of borehole data. The liquefaction map shows high and moderate liquefaction susceptibility zones along the northern coast of the Gulf of Aqaba. In Aqaba several hotels are located within a high and moderate liquefaction zones. The Yacht Club, Aqaba, Ayla archaeological site, and a part of commercial area are also situated in a risk area. A part of residential site of the Saraya Development and the southern part of Ayla Oasis Development project area are located within a high susceptibility zone In Elat, the seaport and most hotels are located within a high susceptibility zone. Fortunately most residence areas, schools, and hospitals in both cities are located within zones not susceptible to liquefaction. A setback, or no build zone, is delineated around active faults to allow a suitable level of conservatism or factor of safety, residential, hotels, commercial buildings, schools, and other facilities are located inside this buffer in Aqaba area. These data will help planners, engineer instructions within the rapidly developing the northern Gulf of Aqaba.

  2. Refining the Subseafloor Circulation Model of the Middle Valley Hydrothermal System Using Fluid Geochemistry

    NASA Astrophysics Data System (ADS)

    Inderbitzen, K. E.; Wheat, C. G.; Baker, P. A.; Fisher, A. T.

    2014-12-01

    Currently, fluid circulation patterns and the evolution of rock/fluid compositions as circulation occurs in subseafloor hydrothermal systems are poorly constrained. Sedimented spreading centers provide a unique opportunity to study subsurface flow because sediment acts as an insulating blanket that traps heat from the cooling magma body and limits: (a) potential flow paths for seawater to recharge the aquifer in permeable upper basaltic basement and (b) points of altered fluid egress. This also allows for a range of thermal and geochemical gradients to exist near the sediment-water interface. Models of fluid circulation patterns in this type of hydrologic setting have been generated (eg. Stein and Fisher, 2001); however fluid chemistry datasets have not previously been used to test the model's viability. We address this issue by integrating the existing circulation model with fluid compositional data collected from sediment pore waters and high temperature hydrothermal vents located in Middle Valley on the Juan de Fuca Ridge. Middle Valley hosts a variety of hydrologic regimes: including areas of fluid recharge (Site 855), active venting (Site 858/1036; Dead Dog vent field), recent venting (Site 856/1035; Bent Hill Massive Sulfide deposit) and a section of heavily sedimented basement located between recharge and discharge sites (Site 857). We will present new results based on thermal and geochemical data from the area of active venting (Sites 858 and 1036), that was collected during Ocean Drilling Program Legs 139 and 169 and a subsequent heat flow/gravity coring effort. These results illuminate fine scale controls on secondary recharge and fluid flow within the sediment section at Site 858/1036. The current status of high temperature vents in this area (based on observations made in July, 2014) will also be outlined.

  3. IMPACT OF CRITICAL ANION SOIL SOLUTION CONCENTRATION ON ALUMINUM ACTIVITY IN ALPINE TUNDRA SOIL Andrew Evans, Jr.1 , Michael B. Jacobs2, and Jason R. Janke1, (1) Metropolitan State University of Denver, Dept. of Earth and Atmospheric Sciences, (2) Dept. of Chemistry, Denver, CO, United States.

    NASA Astrophysics Data System (ADS)

    Evans, A.

    2015-12-01

    Soil solution anionic composition can impact both plant and microbial activity in alpine tundra soils by altering biochemical cycling within the soil, either through base cation leaching, or shifts in aluminum controlling solid phases. Although anions play a critical role in the aqueous speciation of metals, relatively few high altitude field studies have examined their impact on aluminum controlling solid phases and aluminum speciation in soil water. For this study, thirty sampling sites were selected on Trail Ridge Road in Rocky Mountain National Park, Estes Park, CO, and sampled during July, the middle of the growing season. Sampling elevations ranged from approximately 3560 - 3710 m. Soil samples were collected to a depth of 15.24 cm, and the anions were extracted using a 2:1 D.I. water to soil ratio. Filtered extracts were analyzed using IC and ICP-MS. Soil solution NO3- concentrations were significantly higher for sampling locations east of Iceberg Pass (EIBP) (mean = 86.94 ± 119.8 mg/L) compared to locations west of Iceberg Pass (WIBP) (mean 1.481 ± 2.444 mg/L). Both F- and PO43- soil solution concentrations, 0.533 and 0.440 mg/L, respectively, were substantially lower, for sampling sites located EIBP, while locations WIBP averaged 0.773 and 0.829 mg/L respectively, for F- and PO43-. Sulfate concentration averaged 3.869 ± 3.059 mg/L for locations EIBP, and 3.891 ± 3.1970 for locations WIBP. Geochemical modeling of Al3+ in the soil solution indicated that a suite of aluminum hydroxyl sulfate minerals controlled Al3+ activity in the alpine tundra soil, with shifts between controlling solid phases occurring in the presence of elevated F- concentrations.

  4. Closure Report for Corrective Action Unit 408: Bomblet Target Area Tonopah Test Range (TTR), Nevada, Revision 0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mark Krauss

    2010-09-01

    This Closure Report (CR) presents information supporting the closure of Corrective Action Unit (CAU) 408: Bomblet Target Area (TTR), Tonopah Test Range, Nevada. This CR complies with the requirements of the Federal Facility Agreement and Consent Order that was agreed to by the State of Nevada; U.S. Department of Energy (DOE), Environmental Management; U.S. Department of Defense; and DOE, Legacy Management. Corrective Action Unit 408 is located at the Tonopah Test Range, Nevada, and consists of Corrective Action Site (CAS) TA-55-002-TAB2, Bomblet Target Areas. This CAS includes the following seven target areas: • Mid Target • Flightline Bomblet Location •more » Strategic Air Command (SAC) Target Location 1 • SAC Target Location 2 • South Antelope Lake • Tomahawk Location 1 • Tomahawk Location 2 The purpose of this CR is to provide documentation supporting the completed corrective actions and data confirming that the closure objectives for the CAS within CAU 408 were met. To achieve this, the following actions were performed: • Review the current site conditions, including the concentration and extent of contamination. • Implement any corrective actions necessary to protect human health and the environment. • Properly dispose of corrective action and investigation wastes. • Document Notice of Completion and closure of CAU 408 issued by the Nevada Division of Environmental Protection. From July 2009 through August 2010, closure activities were performed as set forth in the Streamlined Approach for Environmental Restoration Plan for CAU 408: Bomblet Target Area, Tonopah Test Range (TTR), Nevada. The purposes of the activities as defined during the data quality objectives process were as follows: • Identify and remove munitions of explosive concern (MEC) associated with DOE activities. • Investigate potential disposal pit locations. • Remove depleted uranium-contaminated fragments and soil. • Determine whether contaminants of concern (COCs) are present. • If COCs are present, determine their nature and extent, implement appropriate corrective actions, and properly dispose of wastes. Analytes detected during the closure activities were evaluated against final action levels to determine COCs for CAU 408. Assessment of the data indicated COCs are not present at CAS TA-55-002-TAB2; therefore, no corrective action is necessary. No use restrictions are required to be placed on this CAU because the investigation showed no evidence of remaining soil contamination or remaining debris/waste upon completion of all investigation activities. The MEC was successfully removed and dispositioned as planned using current best available technologies. As MEC guidance and general MEC standards acknowledge that MEC response actions cannot determine with 100 percent certainty that all MEC and unexploded ordnance (UXO) are removed, the clean closure of CAU 408 will implement a best management practice of posting UXO hazard warning signs near the seven target areas. The signs will warn future land users of the potential for encountering residual UXO hazards. The DOE, National Nuclear Security Administration Nevada Site Office, provides the following recommendations: • A Notice of Completion to the DOE, National Nuclear Security Administration Nevada Site Office, is requested from the Nevada Division of Environmental Protection for closure of CAU 408. • Corrective Action Unit 408 should be moved from Appendix III to Appendix IV of the Federal Facility Agreement and Consent Order.« less

  5. On the placement of active members in adaptive truss structures for vibration control

    NASA Technical Reports Server (NTRS)

    Lu, L.-Y.; Utku, S.; Wada, B. K.

    1992-01-01

    The problem of optimal placement of active members which are used for vibration control in adaptive truss structures is investigated. The control scheme is based on the method of eigenvalue assignment as a means of shaping the transient response of the controlled adaptive structures, and the minimization of required control action is considered as the optimization criterion. To this end, a performance index which measures the control strokes of active members is formulated in an efficient way. In order to reduce the computation burden, particularly for the case where the locations of active members have to be selected from a large set of available sites, several heuristic searching schemes are proposed for obtaining the near-optimal locations. The proposed schemes significantly reduce the computational complexity of placing multiple active members to the order of that when a single active member is placed.

  6. Summary of Environmental Monitoring and Assessment Program (EMAP) activities in South Dakota, 2000-2004

    USGS Publications Warehouse

    Heakin, Allen J.; Neitzert, Kathleen M.; Shearer, Jeffrey S.

    2006-01-01

    The U.S. Environmental Protection Agency (USEPA) initiated data-collection activities for the Environmental Monitoring and Assessment Program-West (EMAP-West) in South Dakota during 2000. The objectives of the study were to develop the monitoring tools necessary to produce unbiased estimates of the ecological condition of surface waters across a large geographic area of the western United States, and to demonstrate the effectiveness of those tools in a large-scale assessment. In 2001, the U.S. Geological Survey (USGS) and the South Dakota Department of Game, Fish and Parks (GF&P) established a cooperative agreement and assumed responsibility for completing the remaining assessments for the perennial, wadable streams of the EMAP-West in the State. Stream assessment sites were divided into two broad categories-the first category of sites was randomly selected and assigned by the USEPA for South Dakota. The second category consisted of sites that were specifically selected because they appeared to have reasonable potential for representing the best available physical, chemical, and biological conditions in the State. These sites comprise the second category of assessment sites and were called 'reference' sites and were selected following a detailed evaluation process. Candidate reference site data will serve as a standard or benchmark for assessing the overall ecological condition of the randomly selected sites. During 2000, the USEPA completed 22 statewide stream assessments in South Dakota. During 2001-2003, the USGS and GF&P completed another 42 stream assessments bringing the total of randomly selected stream assessments within South Dakota to 64. In addition, 18 repeat assessments designed to meet established quality-assurance/quality-control requirements were completed at 12 of these 64 sites. During 2002-2004, the USGS in cooperation with GF&P completed stream assessments at 45 candidate reference sites. Thus, 109 sites had stream assessments completed in South Dakota for EMAP-West (2000-2004). Relatively early in the EMAP-West stream-assessment process, it became apparent that for some streams in south-central South Dakota, in-stream conditions varied considerably over relatively short distances of only a few miles. These changes appeared to be a result of geomorphic changes associated with changes in the underlying geology. For these streams, moving stream assessment sites short distances upstream or downstream had the potential to provide substantially different bioassessment data. In order to obtain a better understanding of how geology influences stream conditions, two streams located in south-central South Dakota were chosen for multiple stream sampling at sites located along their longitudinal profile at points where notable changes in geomorphology were observed. Subsequently, three sites on Bear-in-the-Lodge Creek and three sites on Black Pipe Creek were selected for multiple stream sampling using EMAP-West protocols so that more could be learned about geologic influences on stream conditions. Values for dissolved oxygen and specific conductance generally increased from upstream to downstream locations on Bear-in-the-Lodge Creek. Values for pH and water temperature generally decreased from upstream to downstream locations. Decreasing water temperature could be indicative of ground-water inflows. Values for dissolved oxygen, pH, and water temperature generally increased from upstream to downstream locations on Black Pipe Creek. The increase in temperature at the lower sites is a result of less dense riparian cover, and the warmer water also could account for the lower concentrations of dissolved oxygen found in the lower reaches of Black Pipe Creek. Values for specific conductance were more than three times greater at the lower site (1,342 microsiemens per centimeter (?S/cm)) than at the upper site (434 ?S/cm). The increase probably occurs when the stream transitions from contacting the underlying Ar

  7. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    PubMed

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  8. Site Environmental Report for 2011, Volumes 1& 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baskin, David; Bauters, Tim; Borglin, Ned

    2012-09-12

    The Site Environmental Report for 2011 summarizes Berkeley Lab’s environmental management performance, presents environmental monitoring results, and describes significant programs for calendar year (CY) 2011. Throughout this report, “Berkeley Lab” or “LBNL” refers both to (1) the multiprogram scientific facility the UC manages and operates on the 202-acre university-owned site located in the hills above the UC Berkeley campus, and the site itself, and (2) the UC as managing and operating contractor for Ernest Orlando Lawrence Berkeley National Laboratory. The report is separated into two volumes. Volume I is organized into an executive summary followed by six chapters that includemore » an overview of LBNL, a discussion of its Environmental Management System (EMS), the status of environmental programs, summarized results from surveillance and monitoring activities, and quality assurance (QA) measures. Volume II contains individual data results from surveillance and monitoring activities.« less

  9. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  10. Automated extraction of temporal motor activity signals from video recordings of neonatal seizures based on adaptive block matching.

    PubMed

    Karayiannis, Nicolaos B; Sami, Abdul; Frost, James D; Wise, Merrill S; Mizrahi, Eli M

    2005-04-01

    This paper presents an automated procedure developed to extract quantitative information from video recordings of neonatal seizures in the form of motor activity signals. This procedure relies on optical flow computation to select anatomical sites located on the infants' body parts. Motor activity signals are extracted by tracking selected anatomical sites during the seizure using adaptive block matching. A block of pixels is tracked throughout a sequence of frames by searching for the most similar block of pixels in subsequent frames; this search is facilitated by employing various update strategies to account for the changing appearance of the block. The proposed procedure is used to extract temporal motor activity signals from video recordings of neonatal seizures and other events not associated with seizures.

  11. Incorporating ToxCast and Tox21 Datasets to Rank Biological Activity of Chemicals at Superfund Sites in North Carolina

    PubMed Central

    Tilley, Sloane K.; Reif, David M.; Fry, Rebecca C.

    2017-01-01

    Background The Superfund program of the Environmental Protection Agency (EPA) was established in 1980 to address public health concerns posed by toxic substances released into the environment in the United States. Forty-two of the 1328 hazardous waste sites that remain on the Superfund National Priority List are located in the state of North Carolina. Methods We set out to develop a database that contained information on both the prevalence and biological activity of chemicals present at Superfund sites in North Carolina. A chemical characterization tool, the Toxicological Priority Index (ToxPi), was used to rank the biological activity of these chemicals based on their predicted bioavailability, documented associations with biological pathways, and activity in in vitro assays of the ToxCast and Tox21 programs. Results The ten most prevalent chemicals found at North Carolina Superfund sites were chromium, trichloroethene, lead, tetrachloroethene, arsenic, benzene, manganese, 1,2-dichloroethane, nickel, and barium. For all chemicals found at North Carolina Superfund sites, ToxPi analysis was used to rank their biological activity. Through this data integration, residual pesticides and organic solvents were identified to be some of the most highly-ranking predicted bioactive chemicals. This study provides a novel methodology for creating state or regional databases of Superfund sites. Conclusions These data represent a novel integrated profile of the most prevalent chemicals at North Carolina Superfund sites. This information, and the associated methodology, is useful to toxicologists, risk assessors, and the communities living in close proximity to these sites. PMID:28153528

  12. 5000 yr of paleoseismicity along the southern Dead Sea fault

    NASA Astrophysics Data System (ADS)

    Klinger, Y.; Le Béon, M.; Al-Qaryouti, M.

    2015-07-01

    The 1000-km-long left-lateral Dead Sea fault is a major tectonic structure of the oriental Mediterranean basin, bounding the Arabian Plate to the west. The fault is located in a region with an exceptionally long and rich historical record, allowing to document historical seismicity catalogues with unprecedented level of details. However, if the earthquake time series is well documented, location and lateral extent of past earthquakes remain often difficult to establish, if only based on historical testimonies. We excavated a palaeoseismic trench in a site located in a kilometre-size extensional jog, south of the Dead Sea, in the Wadi Araba. Based on the stratigraphy exposed in the trench, we present evidence for nine earthquakes that produced surface ruptures during a time period spanning 5000 yr. Abundance of datable material allows us to tie the five most recent events to historical earthquakes with little ambiguities, and to constrain the possible location of these historical earthquakes. The events identified at our site are the 1458 C.E., 1212 C.E., 1068 C.E., one event during the 8th century crisis, and the 363 C.E. earthquake. Four other events are also identified, which correlation with historical events remains more speculative. The magnitude of earthquakes is difficult to assess based on evidence at one site only. The deformation observed in the excavation, however, allows discriminating between two classes of events that produced vertical deformation with one order of amplitude difference, suggesting that we could distinguish earthquakes that started/stopped at our site from earthquakes that potentially ruptured most of the Wadi Araba fault. The time distribution of earthquakes during the past 5000 yr is uneven. The early period shows little activity with return interval of ˜500 yr or longer. It is followed by a ˜1500-yr-long period with more frequent events, about every 200 yr. Then, for the past ˜550 yr, the fault has switched back to a quieter mode with no significant earthquake along the entire southern part of the Dead Sea fault, between the Dead Sea and the Gulf of Aqaba. We computed the Coefficient of Variation for our site and three other sites along the Dead Sea fault, south of Lebanon, to compare time distribution of earthquakes at different locations along the fault. With one exception at a site located next to Lake Tiberias, the three other sites are consistent to show some temporal clustering at the scale of few thousands years.

  13. Nevada National Security Site Environmental Report 2011 Attachment A: Site Description

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cathy Wills, ed.

    2012-09-12

    This attachment expands on the general description of the Nevada National Security Site (NNSS) presented in the Introduction to the Nevada National Security Site Environmental Report 2011. Included are subsections that summarize the site's geological, hydrological, climatological, and ecological setting and the cultural resources of the NNSS. The subsections are meant to aid the reader in understanding the complex physical and biological environment of the NNSS. An adequate knowledge of the site's environment is necessary to assess the environmental impacts of new projects, design and implement environmental monitoring activities for current site operations, and assess the impacts of site operationsmore » on the public residing in the vicinity of the NNSS. The NNSS environment contributes to several key features of the site that afford protection to the inhabitants of adjacent areas from potential exposure to radioactivity or other contaminants resulting from NNSS operations. These key features include the general remote location of the NNSS, restricted access, extended wind transport times, the great depths to slow-moving groundwater, little or no surface water, and low population density. This attachment complements the annual summary of monitoring program activities and dose assessments presented in the main body of this report.« less

  14. Web Sitings.

    ERIC Educational Resources Information Center

    Lo, Erika

    2001-01-01

    Presents seven mathematics games, located on the World Wide Web, for elementary students, including: Absurd Math: Pre-Algebra from Another Dimension; The Little Animals Activity Centre; MathDork Game Room (classic video games focusing on algebra); Lemonade Stand (students practice math and business skills); Math Cats (teaches the artistic beauty…

  15. 75 FR 39612 - IJC Will Review Bi-National Management of the Lake of the Woods and Rainy River Basin

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-09

    ...-jurisdictional coordination and collaboration on science and management activities to enhance and restore water... matter at dates and locations to be announced in the local news media and on the IJC's Web site. In...

  16. Ventral medullary neurones excited from the hypothalamic and mid-brain defence areas.

    PubMed

    Hilton, S M; Smith, P R

    1984-07-01

    In cats anaesthetised with chloralose, the ventral medulla was explored in and around the strip previously identified as the location of the efferent pathway from the hypothalamic and mid-brain defence areas to the spinal cord, in a search for neurones excited by electrical stimulation of the defence areas. Such units were found mostly in the caudal part of this strip, at a depth of not more than 500 microns from the surface. Nearly all were located in the ventral part of nucleus paragigantocellularis lateralis (PGL) at the level of the rostral pole of the inferior olive. There was evidence of temporal and spatial facilitation, indicating a convergent excitatory input from the defence areas onto neurones in PGL. This is consistent with earlier evidence of a synaptic relay in the efferent pathway at this site. When the pathway is blocked at this site, arterial blood pressure falls profoundly, so activity in these neurones may be essential for the normal level of sympathetic nerve activity.

  17. Magnetic surveys for locating abandoned wells

    USGS Publications Warehouse

    ,

    1995-01-01

    Abandoned and unrecorded wells may act as conduits for the contamination of groundwater supplies by oil field brines and other pollutants. The casings of abandoned wells eventually develop leaks, which, if not properly plugged, can allow pollutants to reach freshwater aquifers that supply drinking water. Sources of pollutants include brine ponds, landfill sites, agricultural activities, industrial activities, illegal disposal sites, or accidental spills. The problem is particularly acute in regions where there are old petroleum fields or where water wells have been extensively used for agricultural irrigation. Even urban areas can contain wells that were abandoned and concealed during development. Carefully designed ground magnetic or aeromagnetic surveys can be used to locate abandoned wells by mapping the magnetic disturbances or "anomalies" produced by their steel well casings. The U.S. Geological Survey (USGS) can, at the request of other Federal, State, or local agencies, conduct, process, and interpret such surveys, or it can aid in the design and monitoring of contracts for such surveys.

  18. Snapping turtles (Chelydra serpentina) as biomonitors of lead contamination of the Big River in Missouri`s Old Lead Belt

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Overmann, S.R.; Krajicek, J.J.

    1995-04-01

    The usefulness of common snapping turtles (Chelydra serpentina) as biomonitors of lead (Pb) contamination of aquatic ecosystems was assessed. Thirty-seven snapping turtles were collected from three sites on the Big River, an Ozarkian stream contaminated with Pb mine tailings. Morphometric measurements, tissue Pb concentrations (muscle, blood, bone, carapace, brain, and liver), {delta}-aminolevulinic acid dehydratase ({delta}-ALAD) activity, hematocrit, hemoglobin, plasma glucose, osmolality, and chloride ion content were measured. The data showed no effects of Pb contamination on capture success or morphological measurements. Tissue Pb concentrations were related to capture location. Hematocrit, plasma osmolality, plasma glucose, and plasma chloride ion content weremore » not significantly different with respect to capture location. The {delta}-ALAD activity levels were decreased in turtles taken from contaminated sites. Lead levels in the Big River do not appear to be adversely affecting the snapping turtles of the river. Chelydra serpentina is a useful species for biomonitoring of Pb-contaminated aquatic environments.« less

  19. Reconstitution and structure of a bacterial Pnkp1RnlHen1 RNA repair complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Pei; Selvadurai, Kiruthika; Huang, Raven H.

    Ribotoxins cleave essential RNAs for cell killing, and RNA repair neutralizes the damage inflicted by ribotoxins for cell survival. We report a new bacterial RNA repair complex that performs RNA repair linked to immunity. This new RNA repair complex is a 270-kDa heterohexamer composed of three proteins—Pnkp1, Rnl and Hen1—that are required to repair ribotoxin-cleaved RNA in vitro. The crystal structure of the complex reveals the molecular architecture of the heterohexamer as two rhomboid-shaped ring structures of Pnkp1–Rnl–Hen1 heterotrimer fused at the Pnkp1 dimer interface. The four active sites required for RNA repair are located on the inner rim ofmore » each ring. Furthermore, the architecture and the locations of the active sites of the Pnkp1–Rnl–Hen1 heterohexamer suggest an ordered series of repair reactions at the broken RNA ends that confer immunity to recurrent damage.« less

  20. Non-canonical active site architecture of the radical SAM thiamin pyrimidine synthase

    DOE PAGES

    Fenwick, Michael K.; Mehta, Angad P.; Zhang, Yang; ...

    2015-03-27

    Radical S-adenosylmethionine (SAM) enzymes use a [4Fe-4S] cluster to generate a 5'-deoxyadenosyl radical. Canonical radical SAM enzymes are characterized by a β-barrel-like fold and SAM anchors to the differentiated iron of the cluster, which is located near the amino terminus and within the β-barrel, through its amino and carboxylate groups. Here we show that ThiC, the thiamin pyrimidine synthase in plants and bacteria, contains a tethered cluster-binding domain at its carboxy terminus that moves in and out of the active site during catalysis. In contrast to canonical radical SAM enzymes, we predict that SAM anchors to an additional active sitemore » metal through its amino and carboxylate groups. Superimposition of the catalytic domains of ThiC and glutamate mutase shows that these two enzymes share similar active site architectures, thus providing strong evidence for an evolutionary link between the radical SAM and adenosylcobalamin-dependent enzyme superfamilies.« less

  1. Timber Mountain Precipitation Monitoring Station

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lyles, Brad; McCurdy, Greg; Chapman, Jenny

    2012-01-01

    A precipitation monitoring station was placed on the west flank of Timber Mountain during the year 2010. It is located in an isolated highland area near the western border of the Nevada National Security Site (NNSS), south of Pahute Mesa. The cost of the equipment, permitting, and installation was provided by the Environmental Monitoring Systems Initiative (EMSI) project. Data collection, analysis, and maintenance of the station during fiscal year 2011 was funded by the U.S. Department of Energy, National Nuclear Security Administration, Nevada Site Office Environmental Restoration, Soils Activity. The station is located near the western headwaters of Forty Milemore » Wash on the Nevada Test and Training Range (NTTR). Overland flows from precipitation events that occur in the Timber Mountain high elevation area cross several of the contaminated Soils project CAU (Corrective Action Unit) sites located in the Forty Mile Wash watershed. Rain-on-snow events in the early winter and spring around Timber Mountain have contributed to several significant flow events in Forty Mile Wash. The data from the new precipitation gauge at Timber Mountain will provide important information for determining runoff response to precipitation events in this area of the NNSS. Timber Mountain is also a groundwater recharge area, and estimation of recharge from precipitation was important for the EMSI project in determining groundwater flowpaths and designing effective groundwater monitoring for Yucca Mountain. Recharge estimation additionally provides benefit to the Underground Test Area Sub-project analysis of groundwater flow direction and velocity from nuclear test areas on Pahute Mesa. Additionally, this site provides data that has been used during wild fire events and provided a singular monitoring location of the extreme precipitation events during December 2010 (see data section for more details). This letter report provides a summary of the site location, equipment, and data collected in fiscal year 2011.« less

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Findlay, Rick

    The Gnome-Coach, New Mexico, Site was the location of a 3-kiloton-yield underground nuclear test in 1961 and a groundwater tracer test in 1963. The U.S. Geological Survey conducted the groundwater tracer test using four dissolved radionuclides--tritium, iodine-131, strontium-90, and cesium-137--as tracers. Site reclamation and remediation began after the underground testing, and was conducted in several phases at the site. The New Mexico Environment Department (NMED) issued a Conditional Certificate of Completion in September 2014, which documents that surface remediation activities have been successfully completed in accordance with the Voluntary Remediation Program. Subsurface activities have included annual sampling and monitoring ofmore » wells at and near the site since 1972. These annual monitoring activities were enhanced in 2008 to include monitoring hydraulic head and collecting samples from the onsite wells USGS-4, USGS-8, and LRL-7 using the low-flow sampling method. In 2010, the annual monitoring was focused to the monitoring wells within the site boundary. A site inspection and annual sampling were conducted on January 27-28, 2015. A second site visit was conducted on April 21, 2015, to install warning/notification signs to fulfill a requirement of the Conditional Certificate of Completion that was issued by the NMED for the surface.« less

  3. Soil gas screening for chlorinated solvents at three contaminated karst sites in Tennessee

    USGS Publications Warehouse

    Wolfe, W.J.; Williams, S.D.

    2002-01-01

    Soil gas was sampled using active sampling techniques and passive collectors at three sites in Tennessee to evaluate the effectiveness of these techniques for locating chlorinated solvent sources and flowpaths in karst aquifers. Actively collected soil gas samples were analyzed in the field with a portable gas chromatograph, and the passive soil gas collectors were analyzed in the lab with gas chromatography/mass spectrometry. Results of the sampling indicate that the effectiveness of both techniques is highly dependent on the distribution of the contaminants in the subsurface, the geomorphic and hydrogeologic characteristics of the site, and, in one case, on seasonal conditions. Both active and passive techniques identified areas of elevated subsurface chlorinated solvent concentrations at a landfill site where contamination remains concentrated in the regolith. Neither technique detected chlorinated solvents known to be moving in the bedrock at a manufacturing site characterized by thick regolith and an absence of surficial karst features. Passive soil gas sampling had varied success detecting flowpaths for chloroform in the bedrock at a train derailment site characterized by shallow regolith and abundant surficial karst features. At the train derailment site, delineation of the contaminant flowpath through passive soil gas sampling was stronger and more detailed under Winter conditions than summer.

  4. Analysis of Binding Site Hot Spots on the Surface of Ras GTPase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buhrman, Greg; O; #8242

    2012-09-17

    We have recently discovered an allosteric switch in Ras, bringing an additional level of complexity to this GTPase whose mutants are involved in nearly 30% of cancers. Upon activation of the allosteric switch, there is a shift in helix 3/loop 7 associated with a disorder to order transition in the active site. Here, we use a combination of multiple solvent crystal structures and computational solvent mapping (FTMap) to determine binding site hot spots in the 'off' and 'on' allosteric states of the GTP-bound form of H-Ras. Thirteen sites are revealed, expanding possible target sites for ligand binding well beyond themore » active site. Comparison of FTMaps for the H and K isoforms reveals essentially identical hot spots. Furthermore, using NMR measurements of spin relaxation, we determined that K-Ras exhibits global conformational dynamics very similar to those we previously reported for H-Ras. We thus hypothesize that the global conformational rearrangement serves as a mechanism for allosteric coupling between the effector interface and remote hot spots in all Ras isoforms. At least with respect to the binding sites involving the G domain, H-Ras is an excellent model for K-Ras and probably N-Ras as well. Ras has so far been elusive as a target for drug design. The present work identifies various unexplored hot spots throughout the entire surface of Ras, extending the focus from the disordered active site to well-ordered locations that should be easier to target.« less

  5. Language-dependent changes in pitch-relevant neural activity in the auditory cortex reflect differential weighting of temporal attributes of pitch contours

    PubMed Central

    Krishnan, Ananthanarayan; Gandour, Jackson T.; Xu, Yi; Suresh, Chandan H.

    2016-01-01

    There remains a gap in our knowledge base about neural representation of pitch attributes that occur between onset and offset of dynamic, curvilinear pitch contours. The aim is to evaluate how language experience shapes processing of pitch contours as reflected in the amplitude of cortical pitch-specific response components. Responses were elicited from three nonspeech, bidirectional (falling-rising) pitch contours representative of Mandarin Tone 2 varying in location of the turning point with fixed onset and offset. At the frontocentral Fz electrode site, Na–Pb and Pb–Nb amplitude of the Chinese group was larger than the English group for pitch contours exhibiting later location of the turning point relative to the one with the earliest location. Chinese listeners’ amplitude was also greater than that of English in response to those same pitch contours with later turning points. At lateral temporal sites (T7/T8), Na–Pb amplitude was larger in Chinese listeners relative to English over the right temporal site. In addition, Pb–Nb amplitude of the Chinese group showed a rightward asymmetry. The pitch contour with its turning point located about halfway of total duration evoked a rightward asymmetry regardless of group. These findings suggest that neural mechanisms processing pitch in the right auditory cortex reflect experience-dependent modulation of sensitivity to weighted integration of changes in acceleration rates of rising and falling sections and the location of the turning point. PMID:28713201

  6. Matriptase shedding is closely coupled with matriptase zymogen activation and requires de novo proteolytic cleavage likely involving its own activity

    PubMed Central

    Barndt, Robert; Gu, Yayun; Chen, Chien-Yu; Tseng, I-Chu; Su, Sheng-Fang; Wang, Jehng-Kang; Johnson, Michael D.

    2017-01-01

    The type 2 transmembrane serine protease matriptase is involved in many pathophysiological processes probably via its enzymatic activity, which depends on the dynamic relationship between zymogen activation and protease inhibition. Matriptase shedding can prolong the life of enzymatically active matriptase and increase accessibility to substrates. We show here that matriptase shedding occurs via a de novo proteolytic cleavage at sites located between the SEA domain and the CUB domain. Point or combined mutations at the four positively charged amino acid residues in the region following the SEA domain allowed Arg-186 to be identified as the primary cleavage site responsible for matriptase shedding. Kinetic studies further demonstrate that matriptase shedding is temporally coupled with matriptase zymogen activation. The onset of matriptase shedding lags one minute behind matriptase zymogen activation. Studies with active site triad Ser-805 point mutated matriptase, which no longer undergoes zymogen activation or shedding, further suggests that matriptase shedding depends on matriptase zymogen activation, and that matriptase proteolytic activity may be involved in its own shedding. Our studies uncover an autonomous mechanism coupling matriptase zymogen activation, proteolytic activity, and shedding such that a proportion of newly generated active matriptase escapes HAI-1-mediated rapid inhibition by shedding into the extracellular milieu. PMID:28829816

  7. Bacillus cereus strain MCN as a debriding agent

    NASA Technical Reports Server (NTRS)

    Dalton, H. P.; Haynes, B. W.; Stone, L. L.

    1978-01-01

    Biologically active means are effective for rapidly removing scar tissue caused by burns or corrosive agents. Specially selected strain of bacteria applied to injury site releases enzymes which are active against eschar. These bacteria tend to locate between eschar and unburned tissue, thus providing optimal cell surface area arrangement for enzyme dispersal. Procedure may prove especially useful in treatment of disaster casualties under relatively primitive conditions.

  8. Thule AB, Greenland, Mosquito Survey and Arbovirus Surveillance, 2012

    DTIC Science & Technology

    2013-11-21

    July 2012. One species of mosquitoes, Aedes impiger, was collected and more than 3000 were processed for virus testing. Active mosquito breeding...of mosquitoes, Aedes impiger, was collected and more than 3000 were processed for virus testing. Active mosquito breeding sites were located...were characterized by DNA sequencing. 4. FINDINGS: a. One species of mosquito, Aedes impiger, was found throughout the Thule area

  9. An Archaeological Survey of Certain Lands Adjacent to the Galisteo Dam, New Mexico.

    DTIC Science & Technology

    1976-03-12

    of the basal- tic rock. A good candidate for the source of the cherts and petrified wood is the Cretaceous(?)- Oligocene Galisteo Formation, which is...5,500- -57- The character of the site suggests that it functioned as a farmstead, and its north exposure is additionally suggestive of primary warm ...agricultural activities. The north-exposed, south-protected locations of the more important sites would seem to indicate warm -weather occu- pation in the main

  10. Government Activities to Detect, Deter and Disrupt Threats Enumerating from the Dark Web

    DTIC Science & Technology

    2017-06-09

    the surface selling web website, the Silk Road site offered a variety of illegal goods and served as a grant for the customer transaction. The...order to degrade human prosperity. Tor network, besides offering legal anonymity, services is an infrastructure for illicit online services which are... customer ordered illegal goods from the website located on the dark web and paid in Bitcoins. The money stays on the site wallet until the customer

  11. Installation Restoration Program. Preliminary Assessment: 183rd Tactical Fighter Group, Illinois Air National Guard, Capital Airport, Springfield, Illinois

    DTIC Science & Technology

    1990-05-01

    11140 Rockville Pike Rockville, Maryland 20852 Contract No. DLA 900-82-C-4426 Completed by Science & Technology, Inc. 704 South Illinois Avenue Suite C... Environments . .......... 111-19 IV. SITE EVALUATION...................v-i *A. Activity Review ................. v-i B. Disposal/Spill Site Identification...approximately 120 feet north of a small pond and creek located on the south side of the airport on airport property. The Base conducted operations at

  12. NV/YMP radiological control manual, Revision 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gile, A.L.

    The Nevada Test Site (NTS) and the adjacent Yucca Mountain Project (YMP) are located in Nye County, Nevada. The NTS has been the primary location for testing nuclear explosives in the continental US since 1951. Current activities include operating low-level radioactive and mixed waste disposal facilities for US defense-generated waste, assembly/disassembly of special experiments, surface cleanup and site characterization of contaminated land areas, and non-nuclear test operations such as controlled spills of hazardous materials at the hazardous Materials (HAZMAT) Spill Center (HSC). Currently, the major potential for occupational radiation exposure is associated with the burial of low-level nuclear waste andmore » the handling of radioactive sources. Planned future remediation of contaminated land areas may also result in radiological exposures. The NV/YMP Radiological Control Manual, Revision 2, represents DOE-accepted guidelines and best practices for implementing Nevada Test Site and Yucca Mountain Project Radiation Protection Programs in accordance with the requirements of Title 10 Code of Federal Regulations Part 835, Occupational Radiation Protection. These programs provide protection for approximately 3,000 employees and visitors annually and include coverage for the on-site activities for both personnel and the environment. The personnel protection effort includes a DOE Laboratory Accreditation Program accredited dosimetry and personnel bioassay programs including in-vivo counting, routine workplace air sampling, personnel monitoring, and programmatic and job-specific As Low as Reasonably Achievable considerations.« less

  13. Honey Bee Location- and Time-Linked Memory Use in Novel Foraging Situations: Floral Color Dependency

    PubMed Central

    Amaya-Márquez, Marisol; Hill, Peggy S. M.; Abramson, Charles I.; Wells, Harrington

    2014-01-01

    Learning facilitates behavioral plasticity, leading to higher success rates when foraging. However, memory is of decreasing value with changes brought about by moving to novel resource locations or activity at different times of the day. These premises suggest a foraging model with location- and time-linked memory. Thus, each problem is novel, and selection should favor a maximum likelihood approach to achieve energy maximization results. Alternatively, information is potentially always applicable. This premise suggests a different foraging model, one where initial decisions should be based on previous learning regardless of the foraging site or time. Under this second model, no problem is considered novel, and selection should favor a Bayesian or pseudo-Bayesian approach to achieve energy maximization results. We tested these two models by offering honey bees a learning situation at one location in the morning, where nectar rewards differed between flower colors, and examined their behavior at a second location in the afternoon where rewards did not differ between flower colors. Both blue-yellow and blue-white dimorphic flower patches were used. Information learned in the morning was clearly used in the afternoon at a new foraging site. Memory was not location-time restricted in terms of use when visiting either flower color dimorphism. PMID:26462587

  14. Suitability of oyster restoration sites along the Louisiana coast: Examining site and stock × site interaction

    USGS Publications Warehouse

    Schwarting Miller, Lindsay; La Peyre, Jerome F.; LaPeyre, Megan K.

    2017-01-01

    Recognition of the global loss of subtidal oyster reefs has led to a rise in reef restoration efforts, including in the Gulf of Mexico. Created reef success depends entirely on selecting a location that supports long-term oyster growth and survival, including the recruitment and survival of on-reef oysters. Significant changes in estuarine salinity through management of freshwater inflows and through changed precipitation patterns may significantly impact the locations of optimal oyster restoration sites. These rapid shifts in conditions necessitate a need to better understand both impacts to on-reef oyster growth and population development, and variation in oyster stock performance. Oyster growth, mortality, condition, and disease prevalence were examined in three different stocks of oysters located in protected cages, as well as oyster recruitment and mortality on experimental reef units in three different locations representing a salinity gradient, along the Louisiana Gulf coast in 2011 and 2012. Over a 2-y period, the high-salinity site had highest oyster growth rate in protected cages but demonstrated the least likelihood for reef development based on on-reef oyster population failure, likely because of predation-related mortality (high recruitment and 100% mortality). In contrast, the midsalinity site with moderate oyster growth and on-reef recruitment and low mortality demonstrated a higher likelihood for reef development. The lowest salinity site exhibited extreme variability in all oyster responses between years because of extreme variation in environmental conditions during the study, indicating a low likelihood of long-term reef development. Whereas limited differences in stock performance between sites were found, the range of site environmental conditions tested was ultimately much lower than expected and may not have provided a wide enough range of conditions. In areas with limited, low recruitment, or rapidly changing environmental conditions, seeding with stocks selected for best growth and survival under expected future environmental conditions could better ensure reef development by using oyster populations best suited to the predicted conditions. With rapidly changing estuarine conditions from anthropogenic activities and climate change, siting of oyster reef restoration incorporating both oyster population dynamics and in situ biotic and abiotic interactions is critical in better directing site selection for reef restoration efforts.

  15. A progress report on the ARRA-funded geotechnical site characterization project

    NASA Astrophysics Data System (ADS)

    Martin, A. J.; Yong, A.; Stokoe, K.; Di Matteo, A.; Diehl, J.; Jack, S.

    2011-12-01

    For the past 18 months, the 2009 American Recovery and Reinvestment Act (ARRA) has funded geotechnical site characterizations at 189 seismographic station sites in California and the central U.S. This ongoing effort applies methods involving surface-wave techniques, which include the horizontal-to-vertical spectral ratio (HVSR) technique and one or more of the following: spectral analysis of surface wave (SASW), active and passive multi-channel analysis of surface wave (MASW) and passive array microtremor techniques. From this multi-method approach, shear-wave velocity profiles (VS) and the time-averaged shear-wave velocity of the upper 30 meters (VS30) are estimated for each site. To accommodate the variability in local conditions (e.g., rural and urban soil locales, as well as weathered and competent rock sites), conventional field procedures are often modified ad-hoc to fit the unanticipated complexity at each location. For the majority of sites (>80%), fundamental-mode Rayleigh wave dispersion-based techniques are deployed and where complex geology is encountered, multiple test locations are made. Due to the presence of high velocity layers, about five percent of the locations require multi-mode inversion of Rayleigh wave (MASW-based) data or 3-D array-based inversion of SASW dispersion data, in combination with shallow P-wave seismic refraction and/or HVSR results. Where a strong impedance contrast (i.e. soil over rock) exists at shallow depth (about 10% of sites), dominant higher modes limit the use of Rayleigh wave dispersion techniques. Here, use of the Love wave dispersion technique, along with seismic refraction and/or HVSR data, is required to model the presence of shallow bedrock. At a small percentage of the sites, surface wave techniques are found not suitable for stand-alone deployment and site characterization is limited to the use of the seismic refraction technique. A USGS Open File Report-describing the surface geology, VS profile and the calculated VS30 for each site-will be prepared after the completion of the project in November 2011.

  16. Environmental and individual PAH exposures near rural natural gas extraction.

    PubMed

    Paulik, L Blair; Hobbie, Kevin A; Rohlman, Diana; Smith, Brian W; Scott, Richard P; Kincl, Laurel; Haynes, Erin N; Anderson, Kim A

    2018-05-29

    Natural gas extraction (NGE) has expanded rapidly in the United States in recent years. Despite concerns, there is little information about the effects of NGE on air quality or personal exposures of people living or working nearby. Recent research suggests NGE emits polycyclic aromatic hydrocarbons (PAHs) into air. This study used low-density polyethylene passive samplers to measure concentrations of PAHs in air near active (n = 3) and proposed (n = 2) NGE sites. At each site, two concentric rings of air samplers were placed around the active or proposed well pad location. Silicone wristbands were used to assess personal PAH exposures of participants (n = 19) living or working near the sampling sites. All samples were analyzed for 62 PAHs using GC-MS/MS, and point sources were estimated using the fluoranthene/pyrene isomer ratio. ∑PAH was significantly higher in air at active NGE sites (Wilcoxon rank sum test, p < 0.01). PAHs in air were also more petrogenic (petroleum-derived) at active NGE sites. This suggests that PAH mixtures at active NGE sites may have been affected by direct emissions from petroleum sources at these sites. ∑PAH was also significantly higher in wristbands from participants who had active NGE wells on their properties than from participants who did not (Wilcoxon rank sum test, p < 0.005). There was a significant positive correlation between ∑PAH in participants' wristbands and ∑PAH in air measured closest to participants' homes or workplaces (simple linear regression, p < 0.0001). These findings suggest that living or working near an active NGE well may increase personal PAH exposure. This work also supports the utility of the silicone wristband to assess personal PAH exposure. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Active and regulatory sites of cytosolic 5'-nucleotidase.

    PubMed

    Pesi, Rossana; Allegrini, Simone; Careddu, Maria Giovanna; Filoni, Daniela Nicole; Camici, Marcella; Tozzi, Maria Grazia

    2010-12-01

    Cytosolic 5'-nucleotidase (cN-II), which acts preferentially on 6-hydroxypurine nucleotides, is essential for the survival of several cell types. cN-II catalyses both the hydrolysis of nucleotides and transfer of their phosphate moiety to a nucleoside acceptor through formation of a covalent phospho-intermediate. Both activities are regulated by a number of phosphorylated compounds, such as diadenosine tetraphosphate (Ap₄A), ADP, ATP, 2,3-bisphosphoglycerate (BPG) and phosphate. On the basis of a partial crystal structure of cN-II, we mutated two residues located in the active site, Y55 and T56. We ascertained that the ability to catalyse the transfer of phosphate depends on the presence of a bulky residue in the active site very close to the aspartate residue that forms the covalent phospho-intermediate. The molecular model indicates two possible sites at which adenylic compounds may interact. We mutated three residues that mediate interaction in the first activation site (R144, N154, I152) and three in the second (F127, M436 and H428), and found that Ap₄A and ADP interact with the same site, but the sites for ATP and BPG remain uncertain. The structural model indicates that cN-II is a homotetrameric protein that results from interaction through a specific interface B of two identical dimers that have arisen from interaction of two identical subunits through interface A. Point mutations in the two interfaces and gel-filtration experiments indicated that the dimer is the smallest active oligomerization state. Finally, gel-filtration and light-scattering experiments demonstrated that the native enzyme exists as a tetramer, and no further oligomerization is required for enzyme activation. © 2010 The Authors Journal compilation © 2010 FEBS.

  18. SABER: a computational method for identifying active sites for new reactions.

    PubMed

    Nosrati, Geoffrey R; Houk, K N

    2012-05-01

    A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644-1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were L-Ala D/L-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. Copyright © 2012 The Protein Society.

  19. Archaeology: site studies, activation analysis, preservation, and remote sensing. Volume 3. 1978-November 1979 (a bibliography with abstracts). Report for 1978-November 79

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cavagnaro, D.

    1979-12-01

    These citations of federally-funded research are divided into two parts; namely, a chemical analysis of archaeological specimens, and general studies. The chemical analysis section deals primarily with activation analysis. Articles examined include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies section cites other archaeological research, including results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 237 abstracts, 149 of which are new entries to the previous edition.)

  20. Archaeology: site studies, activation analysis, preservation, and remote sensing. December 1979-December 1980 (citations from the NTIS Data Base). Report for December 1970-December 1980

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1981-01-01

    These citations of federally-funded research contains the chemical analysis of archaeological specimens, as well as general studies. The chemical analysis deals primarily with activation analysis. Articles examined include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies cites other archaeological research, including results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 133 citations, all of which are new entries to the previous edition.)

  1. Archaeology: site studies, activation analysis, preservation, and remote sensing. Volume 2. 1977 (a bibliography with abstracts). Report for 1977

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cavagnaro, D.

    1979-12-01

    The cited reports of Federally-funded research are divided into two parts: namely, a chemical analysis of archaeological specimens, and general studies. The chemical analysis section deals primarily with activation analysis. Artifacts examined include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies section discusses other archaeological research, including results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 128 abstracts, none of which are new entries to the previous edition.)

  2. Archaeology: site studies, activation analysis, preservation, and remote sensing. volume 2. 1977-november, 1978 (a bibliography with abstracts). Report for 1977-Nov 78

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cavagnaro, D.M.

    1978-11-01

    These citations of Federally-funded research are divided into two parts; namely, a chemical analysis of archaeological specimens, and general studies. The chemical analysis section deals primarily with activation analysis. Articles examined include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan and prehistoric times. The general studies section cites other archaeological research, including results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 209 abstracts, 141 of which are new entries to the previous edition.)

  3. PIT-tagged particle study of bed mobility in a Maine salmon river impacted by logging activities

    NASA Astrophysics Data System (ADS)

    Thompson, D. M.; Fixler, S. A.; Roberts, K. E.; McKenna, M.; Marshall, A. E.; Koenig, S.

    2017-12-01

    Presenting an interim report on a study on the Narraguagus River in Maine, which utilizes laser total stations cross-sectional surveys and tracking of passive integrated transponder (PIT) tags embedded in glass spheres to document changes in channel-bed characteristics associated with large wood (LW) additions and natural spawning activities. In 2016, work was initiated to monitor changes in bed elevation and sediment mobility with the addition of LW to the Narraguagus River as part of a restoration effort. Ten cross-sections, spaced 5-m apart, were established and surveyed with a laser total station in each of three different study reaches. The study sites include a control reach, a section with anticipated spawning activities and a site with ongoing LW placement. A grid of 200 glass spheres embedded with PIT tags, with twenty alternating 25-mm and 40-mm size particles equally spaced along each of the ten transects, were placed to serve as point sensors to detect sediment mobilization within each reach. In 2017, the site was revisited to determine if differences in PIT-tagged tracer particle mobilization reflect locations were LW was added and places where Atlantic salmon (Salmo salar) and sea lamprey (Petromyzon marinus) construct spawning redds. The positions of PIT-tagged tracer particles was recorded, but particles were not disturbed or uncovered to permit study of potential reworking of buried tracer particles the following year. Full tracer particle recovery will be determined in 2018 to determine if depths of tracer burial and changes in bed elevation vary among places near redds, LW and main channel locations. The data will be used to determine if salmon redds are preferentially located in either places with greater evidence of sediment reworking or alternatively in stable areas? The study will help determine the degree of bed disruption associated with spawning activities and whether LW placement encourages similar sediment mobilization processes.

  4. Usefulness of C-Reactive Protein as a Disease Activity Marker in Crohn’s Disease according to the Location of Disease

    PubMed Central

    Yang, Dong-Hoon; Yang, Suk-Kyun; Park, Sang Hyoung; Lee, Ho-Su; Boo, Sun-Jin; Park, Jae-Ho; Na, Soo Young; Jung, Kee Wook; Kim, Kyung-Jo; Ye, Byong Duk; Byeon, Jeong-Sik; Myung, Seung-Jae; Kim, Jin-Ho

    2015-01-01

    Background/Aims C-reactive protein (CRP) is a serologic activity marker in Crohn’s disease (CD), but it may be less useful in evaluating CD activity in ileal CD patients. We aimed to investigate the usefulness of CRP as a disease activity marker in CD according to disease location. Methods Korean CD patients in a single hospital were evaluated. Factors associated with elevated CRP concentration at the time of diagnosis of CD and the association between the physician’s prediction regarding upcoming surgery and the sites of the lesions directly related to surgery were analyzed. Results Of 435 CD patients, 25.7%, 6.9%, and 67.4% had ileal, colonic, and ileocolonic CD, respectively. Multivariate analysis revealed that an elevated erythrocyte sedimentation rate, reduced serum albumin, CD activity index (CDAI) >220, and ileocolonic/colonic location were associated with an elevated CRP level and that the CRP level was significantly correlated with the CDAI in all CD patients (γ=0.466, p<0.01). However, the correlation coefficient was dependent on the location, with values of 0.395, 0.456, and 0.527 in patients with an ileal, ileocolonic, and colonic disease location, respectively. Surgery for ileal lesions was less predictable than surgery for ileocolonic or colonic lesions during follow-up. Conclusions CRP is less useful as a disease activity marker in patients with ileal CD than those with ileocolonic or colonic CD. PMID:25170056

  5. Whooping crane stopover site use intensity within the Great Plains

    USGS Publications Warehouse

    Pearse, Aaron T.; Brandt, David A.; Harrell, Wade C.; Metzger, Kristine L.; Baasch, David M.; Hefley, Trevor J.

    2015-09-23

    Whooping cranes (Grus americana) of the Aransas-Wood Buffalo population migrate twice each year through the Great Plains in North America. Recovery activities for this endangered species include providing adequate places to stop and rest during migration, which are generally referred to as stopover sites. To assist in recovery efforts, initial estimates of stopover site use intensity are presented, which provide opportunity to identify areas across the migration range used more intensively by whooping cranes. We used location data acquired from 58 unique individuals fitted with platform transmitting terminals that collected global position system locations. Radio-tagged birds provided 2,158 stopover sites over 10 migrations and 5 years (2010–14). Using a grid-based approach, we identified 1,095 20-square-kilometer grid cells that contained stopover sites. We categorized occupied grid cells based on density of stopover sites and the amount of time cranes spent in the area. This assessment resulted in four categories of stopover site use: unoccupied, low intensity, core intensity, and extended-use core intensity. Although provisional, this evaluation of stopover site use intensity offers the U.S. Fish and Wildlife Service and partners a tool to identify landscapes that may be of greater conservation significance to migrating whooping cranes. Initially, the tool will be used by the U.S. Fish and Wildlife Service and other interested parties in evaluating the Great Plains Wind Energy Habitat Conservation Plan.

  6. Mapping General Anesthetic Sites in Heteromeric γ-Aminobutyric Acid Type A Receptors Reveals a Potential For Targeting Receptor Subtypes.

    PubMed

    Forman, Stuart A; Miller, Keith W

    2016-11-01

    IV general anesthetics, including propofol, etomidate, alphaxalone, and barbiturates, produce important actions by enhancing γ-aminobutyric acid type A (GABAA) receptor activation. In this article, we review scientific studies that have located and mapped IV anesthetic sites using photoaffinity labeling and substituted cysteine modification protection. These anesthetics bind in transmembrane pockets between subunits of typical synaptic GABAA receptors, and drugs that display stereoselectivity also show remarkably selective interactions with distinct interfacial sites. These results suggest strategies for developing new drugs that selectively modulate distinct GABAA receptor subtypes.

  7. LSA field test

    NASA Technical Reports Server (NTRS)

    Jaffe, P.

    1979-01-01

    Degradation tests indicate that electrical degradation is not a slow monotonically increasing phenomenon as originally thought but occurs abruptly as the result of some traumatic event. This finding has led to a change in the test philosophy. A discussion of this change is presented along with a summary of degradation and failure data from all the sites and results from a variety of special tests. New instrumentation for in-field measurements are described. Field testing activity was expanded by the addition of twelve remote sites located as far away as Alaska and the Canal Zone. Descriptions of the new sites are included.

  8. Effects on the immune system associated with living near a pesticide dump site.

    PubMed Central

    Vine, M F; Stein, L; Weigle, K; Schroeder, J; Degnan, D; Tse, C K; Hanchette, C; Backer, L

    2000-01-01

    In this paper, we report results of the second phase of a larger study designed to evaluate the effects on the immune system of living near a Superfund site containing organochlorine pesticides, volatile organic compounds, and metals. Phase II was conducted to determine whether living near the site, consisting of six locations in Aberdeen, North Carolina, is associated with higher plasma organochlorine levels, immune suppression, or DNA damage. Each of 302 residents of Aberdeen and neighboring communities provided a blood specimen, underwent a skin test, and answered a questionnaire. Blood specimens were analyzed for organochlorine pesticides, immune markers, and micronuclei. Of 20 organochlorines tested, only DDE was detected in the blood of participants (except for one individual). Age-adjusted mean plasma DDE levels were 4.05 ppb for Aberdeen residents and 2.95 ppb (p = 0.01) for residents of neighboring communities. Residents of 40-59 years of age who lived within a mile of any site, but particularly the Farm Chemicals site, had higher plasma DDE levels than residents who lived farther away. Residents who lived near the Farm Chemicals site before versus after 1985 also had higher plasma DDE levels. Overall, there were few differences in immune markers between residents of Aberdeen and the neighboring communities. However, residents who lived closer to the dump sites had statistically significantly lower mitogen-induced lymphoproliferative activity than residents who lived farther away (p < 0.05). Residential location was not consistently associated with frequency of micronuclei or skin test responses. Although some statistically significant differences in immune markers were noted in association with residential location, the magnitude of effects are of uncertain clinical importance. PMID:11133390

  9. Den-site characteristics of black bears in Rocky Mountain National Park, Colorado

    USGS Publications Warehouse

    Baldwin, R.A.; Bender, L.C.

    2008-01-01

    We compared historic (1985-1992) and contemporary (2003-2006) black bear (Ursus americanus) den locations in Rocky Mountain National Park (RMNP), Colorado, USA, for habitat and physiographic attributes of den sites and used maximum entropy modeling to determine which factors were most influential in predicting den-site locations. We observed variability in the relationship between den locations and distance to trails and elevation over rime. Locations of historic den sites were most associated with slope, elevation, and covertype, whereas contemporary sites were associated with slope, distance to roads, aspect, and canopy height. Although relationships to covariates differed between historic and contemporary periods, preferred den-site characteristics consistently included steep slopes and factors associated with greater snow depth. Distribution of den locations shifted toward areas closer to human developments, indicating little negative influence of this factor on den-site selection by black bears in RMNP.

  10. Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

    PubMed Central

    Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

    1998-01-01

    Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

  11. Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

    PubMed

    Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

    2016-01-01

    Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

  12. Tryptophanase from Proteus vulgaris: the conformational rearrangement in the active site, induced by the mutation of Tyrosine 72 to phenylalanine, and its mechanistic consequences.

    PubMed

    Kulikova, Vitalia V; Zakomirdina, Ludmila N; Dementieva, Irene S; Phillips, Robert S; Gollnick, Paul D; Demidkina, Tatyana V; Faleev, Nicolai G

    2006-04-01

    Tyr72 is located at the active site of tryptophanase (Trpase) from Proteus vulgaris. For the wild-type Trpase Tyr72 might be considered as the general acid catalyst at the stage of elimination of the leaving groups. The replacement of Tyr72 by Phe leads to a decrease in activity for L-tryptophan by 50,000-fold and to a considerable rearrangement of the active site of Trpase. This rearrangement leads to an increase of room around the alpha-C atom of any bound amino acid, such that covalent binding of alpha-methyl-substituted amino acids becomes possible (which cannot be realized in wild-type Trpase). The changes in reactivities of S-alkyl-L-cysteines provide evidence for an increase of congestion in the proximity of their side groups in the mutant enzyme as compared to wild-type enzyme. The observed alteration of catalytic properties in a large degree originates from a conformational change in the active site. The Y72F Trpase retains significant activity for L-serine, which allowed us to conclude that in the mutant enzyme, some functional group is present which fulfills the role of the general acid catalyst in reactions associated with elimination of small leaving groups.

  13. Structural and functional determination of homologs of the Mycobacterium tuberculosisN-acetylglucosamine-6-phosphate deacetylase (NagA).

    PubMed

    Ahangar, Mohd Syed; Furze, Christopher M; Guy, Collette S; Cooper, Charlotte; Maskew, Kathryn S; Graham, Ben; Cameron, Alexander D; Fullam, Elizabeth

    2018-05-04

    The Mycobacterium tuberculosis (Mtb) pathogen encodes an N -acetylglucosamine-6-phosphate deacetylase enzyme, NagA (Rv3332), that belongs to the amidohydrolase superfamily. NagA enzymes catalyze the deacetylation of N -acetylglucosamine-6-phosphate (GlcNAc6P) to glucosamine-6-phosphate (GlcN6P). NagA is a potential anti-tubercular drug target because it represents the key enzymatic step in the generation of essential amino-sugar precursors required for Mtb cell wall biosynthesis and also influences recycling of cell wall peptidoglycan fragments. Here, we report the structural and functional characterization of NagA from Mycobacterium smegmatis (MSNagA) and Mycobacterium marinum (MMNagA), close relatives of Mtb Using a combination of X-ray crystallography, site-directed mutagenesis, and biochemical and biophysical assays, we show that these mycobacterial NagA enzymes are selective for GlcNAc6P. Site-directed mutagenesis studies revealed crucial roles of conserved residues in the active site that underpin stereo-selective recognition, binding, and catalysis of substrates. Moreover, we report the crystal structure of MSNagA in both ligand-free form and in complex with the GlcNAc6P substrate at 2.6 Å and 2.0 Å resolutions, respectively. The GlcNAc6P-complex structure disclosed the precise mode of GlcNAc6P binding and the structural framework of the active site, including two divalent metals located in the α/β binuclear site. Furthermore, we observed a cysteine residue located on a flexible loop region that occludes the active site. This cysteine is unique to mycobacteria and may represent a unique subsite for targeting mycobacterial NagA enzymes. Our results provide critical insights into the structural and mechanistic properties of mycobacterial NagA enzymes having an essential role in amino-sugar and nucleotide metabolism in mycobacteria. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  15. Phase I Archaeological Investigation Cultural Resources Survey, Hawaii Geothermal Project, Makawao and Hana Districts, South Shore of Maui, Hawaii (DRAFT )

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Erkelens, Conrad

    1994-03-01

    This report details the archaeological investigation of a 200 foot wide sample corridor extending approximately 9 miles along the southern portion of Maui within the present districts of Hana and Makawao. A total of 51 archaeological sites encompassing 233 surface features were documented. A GPS receiver was used to accurately and precisely plot locations for each of the documented sites. Analysis of the locational information suggests that archaeological sites are abundant throughout the region and only become scarce where vegetation has been bulldozed for ranching activities. At the sea-land transition points for the underwater transmission cable, both Ahihi Bay andmore » Huakini Bay are subjected to seasonal erosion and redeposition of their boulder shorelines. The corridor at the Ahihi Bay transition point runs through the Moanakala Village Complex which is an archaeological site on the State Register of Historic Places within a State Natural Area Reserve. Numerous other potentially significant archaeological sites lie within the project corridor. It is likely that rerouting of the corridor in an attempt to avoid known sites would result in other undocumented sites located outside the sample corridor being impacted. Given the distribution of archaeological sites, there is no alternative route that can be suggested that is likely to avoid encountering sites. A total of twelve charcoal samples were obtained for potential taxon identification and radiocarbon analysis. Four of these samples were subsequently submitted for dating and species identification. Bird bone from various locations within a lava tube were collected for identification. Sediment samples for subsequent pollen analysis were obtained from within two lava tubes. With these three sources of information it is hoped that paleoenvironmental data can be recovered that will enable a better understanding of the setting for Hawaiian habitation of the area. A small test unit was excavated at one habitation site. Charcoal, molluscan and fish remains, basalt tools, and other artifacts were recovered. This material, while providing an extremely small sample, will greatly enhance our understanding of the use of the area. Recommendations regarding the need for further investigation and the preservation of sites within the project corridor are suggested. All sites within the project corridor must be considered potentially significant at this juncture. Further archaeological investigation consisting of a full inventory survey will be required prior to a final assessment of significance for each site and the development of a mitigation plan for sites likely to be impacted by the Hawaii Geothermal Project.« less

  16. 32 CFR 767.7 - Conditions of permits.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... GUIDELINES FOR ARCHEOLOGICAL RESEARCH PERMITS ON SHIP AND AIRCRAFT WRECKS UNDER THE JURISDICATION OF THE... to submit to NHC a working and diving log listing days spent in field research, activities pursued... protect all sensitive information regarding the location and character of the wreck site that could...

  17. Characterization of a Wide Array of Fluorinated Organic Compounds in Contaminated Soils

    EPA Science Inventory

    Herein we report the results of analyses on the concentrations of perfluorinated compounds (PFCs) and fluorotelomer alcohols (FTOHs) in soils from a site that has been impacted by human activities. Soil samples were collected from several locations that had been impacted and one...

  18. Siting process for disposal site of low level radiactive waste in Thailand

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamkate, P.; Sriyotha, P.; Thiengtrongjit, S.

    The radioactive waste in Thailand is composed of low level waste from the application of radioisotopes in medical treatment and industry, the operation of the 2 MW TRIGA Mark III Research Reactor and the production of radioisotopes at OAEP. In addition, the high activity of sealed radiation sources i.e. Cs-137 Co-60 and Ra-226 are also accumulated. Since the volume of treated waste has been gradually increased, the general needs for a repository become apparent. The near surface disposal method has been chosen for this aspect. The feasibility study on the underground disposal site has been done since 1982. The sitemore » selection criteria have been established, consisting of the rejection criteria, the technical performance criteria and the economic criteria. About 50 locations have been picked for consideration and 5 candidate sites have been selected and subsequent investigated. After thoroughly investigation, a definite location in Ratchburi Province, about 180 kilometers southwest of Bangkok, has been selected as the most suitable place for the near surface disposal of radioactive waste in Thailand.« less

  19. Remedy performance monitoring at contaminated sediment sites using profiling solid phase microextraction (SPME) polydimethylsiloxane (PDMS) fibers.

    PubMed

    Thomas, Courtney; Lampert, David; Reible, Danny

    2014-03-01

    Passive sampling using polydimethylsiloxane (PDMS) profilers was evaluated as a tool to assess the performance of in situ sediment remedies at three locations, Chattanooga Creek (Chattanooga, TN), Eagle Harbor (Bainbridge Island, WA) and Hunter's Point (San Francisco, CA). The remedy at the first two locations was capping over PAH contaminated sediments while at Hunter's Point, the assessment was part of an in situ treatment demonstration led by R. G. Luthy (Stanford University) using activated carbon mixed into PCB contaminated sediments. The implementation and results at these contaminated sediment sites were used to illustrate the utility and usefulness of the passive sampling approach. Two different approaches were employed to evaluate kinetics of uptake onto the sorbent fibers. At the capping sites, the passive sampling approach was employed to measure intermixing during cap placement, contamination migration into the cap post-placement and recontamination over time. At the in situ treatment demonstration site, reductions in porewater concentrations in treated versus untreated sediments were compared to measurements of bioaccumulation of PCBs in Neanthes arenaceodentata.

  20. Miscellaneous chemical basin expedited site characterization report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riha, B.D.; Pemberton, B.E.; Rossabi, J.

    1996-12-01

    A total of twenty nine cone penetrometer test (CPT) pushes in three weeks were conducted for vadose zone characterization of the Miscellaneous Chemical Basin (MCB) waste unit at the Savannah River Site. The shallow, unlined basin received liquid chemical wastes over an 18 year period beginning in 1956. This characterization was initiated to determine the vertical and lateral extent of contamination in the vadose zone and to install vadose zone wells for remediation by barometric pumping or active vapor extraction to help prevent further contamination of groundwater. The CPT locations within the waste site were selected based on results frommore » previous shallow soil gas surveys, groundwater contamination data, and the suspected basin center. Geophysical data and soil gas samples were collected at twenty five locations and twenty five vadose zone wells were installed. The wells were screened to target the clay zones and areas of higher soil gas concentrations. The well construction diagrams are provided in Appendix B. Baro-Ball{trademark} valves for enhanced barometric pumping were installed on each well upon completion to immediately begin the remediation treatability study at the site.« less

  1. Superfund Site Information

    EPA Pesticide Factsheets

    This asset includes a number of individual data sets related to site-specific information for Superfund, which is governed under the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) of 1980, which was amended by the Superfund Amendments and Reauthorization Act (SARA) in 1986. The Superfund Enterprise Management System (SEMS) contains basic site description, location, schedule of activities, enforcement and settlement data, contaminants and selected remedy and much more, as well as the records that clearly document site decisions. This asset also includes sampling data and lab results (CLPSS, EDDs), redevelopment and technical assistance case studies, site reuse and land revitalization information, EPAOSC.net information, Superfund Technical Assistance Grants information, site management information records (RODs, Remediation plans, cleanup directives), contract management information, and more.Superfund site management information can also be found in agency wide systems such as EAS and COMPASS.

  2. Site safety plan for Lawrence Livermore National Laboratory CERCLA investigations at site 300. Revision 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kilmer, J.

    Various Department of Energy Orders incorporate by reference, health and safety regulations promulgated by the Occupational Safety and Health Administration (OSHA). One of the OSHA regulations, 29 CFR 1910.120, Hazardous Waste Operations and Emergency Response, requires that site safety plans are written for activities such as those covered by work plans for Site 300 environmental investigations. Based upon available data, this Site Safety Plan (Plan) for environmental restoration has been prepared specifically for the Lawrence Livermore National Laboratory Site 300, located approximately 15 miles east of Livermore, California. As additional facts, monitoring data, or analytical data on hazards are provided,more » this Plan may need to be modified. It is the responsibility of the Environmental Restoration Program and Division (ERD) Site Safety Officer (SSO), with the assistance of Hazards Control, to evaluate data which may impact health and safety during these activities and to modify the Plan as appropriate. This Plan is not `cast-in-concrete.` The SSO shall have the authority, with the concurrence of Hazards Control, to institute any change to maintain health and safety protection for workers at Site 300.« less

  3. statement of significance, location map, site plan, landscape plan, site ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    statement of significance, location map, site plan, landscape plan, site sections, evolution of cemetery landscape. - San Francisco National Cemetery, 1 Lincoln Boulevard, San Francisco, San Francisco County, CA

  4. Experimental and model-based analysis of differences in perception of cutaneous electrical stimulation across the sole of the foot.

    PubMed

    Frahm, Ken Steffen; Mørch, Carsten Dahl; Grill, Warren M; Andersen, Ole Kæseler

    2013-09-01

    During electrocutaneous stimulations, variation in skin properties across locations can lead to differences in neural activation. However, little focus has been given to the effect of different skin thicknesses on neural activation. Electrical stimulation was applied to six sites across the sole of the foot. The intensities used were two and four times perception threshold. The subjects (n = 8) rated the perception quality and intensity using the McGill Pain Questionnaire and a visual analog scale (VAS). A finite element model was developed and combined with the activation function (AF) to estimate neural activation. Electrical stimulation was perceived as significantly less sharp at the heel compared to all other sites, except one site in the forefoot (logistic regression, p < 0.05). The VAS scores were significantly higher in the arch than at the heel (RM ANOVA, p < 0.05). The model showed that the AF was between 91 and 231 % higher at the five other sites than at the heel. The differences in perception across the sole of the foot indicated that the CNS received different inputs depending on the stimulus site. The lower AF at the heel indicated that the skin thicknesses could contribute to the perceived differences.

  5. An integrated approach for identifying priority contaminant in the Great Lakes Basin - Investigations in the Lower Green Bay/Fox River and Milwaukee Estuary areas of concern.

    PubMed

    Li, Shibin; Villeneuve, Daniel L; Berninger, Jason P; Blackwell, Brett R; Cavallin, Jenna E; Hughes, Megan N; Jensen, Kathleen M; Jorgenson, Zachary; Kahl, Michael D; Schroeder, Anthony L; Stevens, Kyle E; Thomas, Linnea M; Weberg, Matthew A; Ankley, Gerald T

    2017-02-01

    Environmental assessment of complex mixtures typically requires integration of chemical and biological measurements. This study demonstrates the use of a combination of instrumental chemical analyses, effects-based monitoring, and bio-effects prediction approaches to help identify potential hazards and priority contaminants in two Great Lakes Areas of Concern (AOCs), the Lower Green Bay/Fox River located near Green Bay, WI, USA and the Milwaukee Estuary, located near Milwaukee, WI, USA. Fathead minnows were caged at four sites within each AOC (eight sites total). Following 4d of in situ exposure, tissues and biofluids were sampled and used for targeted biological effects analyses. Additionally, 4d composite water samples were collected concurrently at each caged fish site and analyzed for 132 analytes as well as evaluated for total estrogenic and androgenic activity using cell-based bioassays. Of the analytes examined, 75 were detected in composite samples from at least one site. Based on multiple analyses, one site in the East River and another site near a paper mill discharge in the Lower Green Bay/Fox River AOC, were prioritized due to their estrogenic and androgenic activity, respectively. The water samples from other sites generally did not exhibit significant estrogenic or androgenic activity, nor was there evidence for endocrine disruption in the fish exposed at these sites as indicated by the lack of alterations in ex vivo steroid production, circulating steroid concentrations, or vitellogenin mRNA expression in males. Induction of hepatic cyp1a mRNA expression was detected at several sites, suggesting the presence of chemicals that activate the aryl hydrocarbon receptor. To expand the scope beyond targeted investigation of endpoints selected a priori, several bio-effects prediction approaches were employed to identify other potentially disturbed biological pathways and related chemical constituents that may warrant future monitoring at these sites. For example, several chemicals such as diethylphthalate and naphthalene, and genes and related pathways, such as cholinergic receptor muscarinic 3 (CHRM3), estrogen receptor alpha1 (esr1), chemokine ligand 10 protein (CXCL10), tumor protein p53 (p53), and monoamine oxidase B (Maob), were identified as candidates for future assessments at these AOCs. Overall, this study demonstrates that a better prioritization of contaminants and associated hazards can be achieved through integrated evaluation of multiple lines of evidence. Such prioritization can guide more comprehensive follow-up risk assessment efforts. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Electrical Advantages of Dendritic Spines

    PubMed Central

    Gulledge, Allan T.; Carnevale, Nicholas T.; Stuart, Greg J.

    2012-01-01

    Many neurons receive excitatory glutamatergic input almost exclusively onto dendritic spines. In the absence of spines, the amplitudes and kinetics of excitatory postsynaptic potentials (EPSPs) at the site of synaptic input are highly variable and depend on dendritic location. We hypothesized that dendritic spines standardize the local geometry at the site of synaptic input, thereby reducing location-dependent variability of local EPSP properties. We tested this hypothesis using computational models of simplified and morphologically realistic spiny neurons that allow direct comparison of EPSPs generated on spine heads with EPSPs generated on dendritic shafts at the same dendritic locations. In all morphologies tested, spines greatly reduced location-dependent variability of local EPSP amplitude and kinetics, while having minimal impact on EPSPs measured at the soma. Spine-dependent standardization of local EPSP properties persisted across a range of physiologically relevant spine neck resistances, and in models with variable neck resistances. By reducing the variability of local EPSPs, spines standardized synaptic activation of NMDA receptors and voltage-gated calcium channels. Furthermore, spines enhanced activation of NMDA receptors and facilitated the generation of NMDA spikes and axonal action potentials in response to synaptic input. Finally, we show that dynamic regulation of spine neck geometry can preserve local EPSP properties following plasticity-driven changes in synaptic strength, but is inefficient in modifying the amplitude of EPSPs in other cellular compartments. These observations suggest that one function of dendritic spines is to standardize local EPSP properties throughout the dendritic tree, thereby allowing neurons to use similar voltage-sensitive postsynaptic mechanisms at all dendritic locations. PMID:22532875

  7. Explicit treatment of active-site waters enhances quantum mechanical/implicit solvent scoring: Inhibition of CDK2 by new pyrazolo[1,5-a]pyrimidines.

    PubMed

    Hylsová, Michaela; Carbain, Benoit; Fanfrlík, Jindřich; Musilová, Lenka; Haldar, Susanta; Köprülüoğlu, Cemal; Ajani, Haresh; Brahmkshatriya, Pathik S; Jorda, Radek; Kryštof, Vladimír; Hobza, Pavel; Echalier, Aude; Paruch, Kamil; Lepšík, Martin

    2017-01-27

    We present comprehensive testing of solvent representation in quantum mechanics (QM)-based scoring of protein-ligand affinities. To this aim, we prepared 21 new inhibitors of cyclin-dependent kinase 2 (CDK2) with the pyrazolo[1,5-a]pyrimidine core, whose activities spanned three orders of magnitude. The crystal structure of a potent inhibitor bound to the active CDK2/cyclin A complex revealed that the biphenyl substituent at position 5 of the pyrazolo[1,5-a]pyrimidine scaffold was located in a previously unexplored pocket and that six water molecules resided in the active site. Using molecular dynamics, protein-ligand interactions and active-site water H-bond networks as well as thermodynamics were probed. Thereafter, all the inhibitors were scored by the QM approach utilizing the COSMO implicit solvent model. Such a standard treatment failed to produce a correlation with the experiment (R 2  = 0.49). However, the addition of the active-site waters resulted in significant improvement (R 2  = 0.68). The activities of the compounds could thus be interpreted by taking into account their specific noncovalent interactions with CDK2 and the active-site waters. In summary, using a combination of several experimental and theoretical approaches we demonstrate that the inclusion of explicit solvent effects enhance QM/COSMO scoring to produce a reliable structure-activity relationship with physical insights. More generally, this approach is envisioned to contribute to increased accuracy of the computational design of novel inhibitors. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  9. Distribution of Unlinked Transpositions of a Ds Element from a T-DNA Locus on Tomato Chromosome 4

    PubMed Central

    Briza, J.; Carroll, B. J.; Klimyuk, V. I.; Thomas, C. M.; Jones, D. A.; Jones, JDG.

    1995-01-01

    In maize, receptor sites for unlinked transpositions of Activator (Ac) elements are not distributed randomly. To test whether the same is true in tomato, the receptor sites for a Dissociation (Ds) element derived from Ac, were mapped for 26 transpositions unlinked to a donor T-DNA locus on chromosome 4. Four independent transposed Dss mapped to sites on chromosome 4 genetically unlinked to the donor T-DNA, consistent with a preference for transposition to unlinked sites on the same chromosome as opposed to sites on other chromosomes. There was little preference among the nondonor chromosomes, except perhaps for chromosome 2, which carried seven transposed Dss, but these could not be proven to be independent. However, these data, when combined with those from other studies in tomato examining the distribution of transposed Acs or Dss among nondonor chromosomes, suggest there may be absolute preferences for transposition irrespective of the chromosomal location of the donor site. If true, transposition to nondonor chromosomes in tomato would differ from that in maize, where the preference seems to be determined by the spatial arrangement of chromosomes in the interphase nucleus. The tomato lines carrying Ds elements at known locations are available for targeted transposon tagging experiments. PMID:8536985

  10. Closure Report for Corrective Action Unit 539: Areas 25 and 26 Railroad Tracks Nevada National Security Site, Nevada with ROTC-1, Revision 0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mark Kauss

    2011-06-01

    This Closure Report (CR) presents information supporting the closure of Corrective Action Unit (CAU) 539: Areas 25 and 26 Railroad Tracks, Nevada National Security Site, Nevada. This CR complies with the requirements of the Federal Facility Agreement and Consent Order (FFACO) that was agreed to by the State of Nevada; U.S. Department of Energy (DOE), Environmental Management; U.S. Department of Defense; and DOE, Legacy Management. The corrective action sites (CASs) within CAU 539 are located within Areas 25 and 26 of the Nevada National Security Site. Corrective Action Unit 539 comprises the following CASs: • 25-99-21, Area 25 Railroad Tracksmore » • 26-99-05, Area 26 Railroad Tracks The purpose of this CR is to provide documentation supporting the completed corrective actions and provide data confirming that the closure objectives for CASs within CAU 539 were met. To achieve this, the following actions were performed: • Reviewed documentation on historical and current site conditions, including the concentration and extent of contamination. • Conducted radiological walkover surveys of railroad tracks in both Areas 25 and 26. • Collected ballast and soil samples and calculated internal dose estimates for radiological releases. • Collected in situ thermoluminescent dosimeter measurements and calculated external dose estimates for radiological releases. • Removed lead bricks as potential source material (PSM) and collected verification samples. • Implemented corrective actions as necessary to protect human health and the environment. • Properly disposed of corrective action and investigation wastes. • Implemented an FFACO use restriction (UR) for radiological contamination at CAS 25-99-21. The approved UR form and map are provided in Appendix F and will be filed in the DOE, National Nuclear Security Administration Nevada Site Office (NNSA/NSO), Facility Information Management System; the FFACO database; and the NNSA/NSO CAU/CAS files. From November 29, 2010, through May 2, 2011, closure activities were performed as set forth in the Streamlined Approach for Environmental Restoration (SAFER) Plan for Corrective Action Unit 539: Areas 25 and 26 Railroad Tracks, Nevada Test Site, Nevada. The purposes of the activities as defined during the data quality objectives process were as follows: • Determine whether contaminants of concern (COCs) are present. • If COCs are present, determine their nature and extent, implement appropriate corrective actions, and properly dispose of wastes. Analytes detected during the closure activities were evaluated against final action levels (FALs) to determine COCs for CAU 539. Assessment of the data generated from closure activities revealed the following: • At CAS 26-99-05, the total effective dose for radiological releases did not exceed the FAL of 25 millirem per Industrial Area year. Potential source material in the form of lead bricks was found at three locations. A corrective action of clean closure was implemented at these locations, and verification samples indicated that no further action is necessary. • At CAS 25-99-21, the total effective dose for radiological releases exceeds the FAL of 25 millirem per Industrial Area year. Potential source material in the form of lead bricks was found at eight locations. A corrective action was implemented by removing the lead bricks and soil above FALs at these locations, and verification samples indicated that no further action is necessary. Pieces of debris with high radioactivity were identified as PSM and remain within the CAS boundary. A corrective action of closure in place with a UR was implemented at this CAS because closure activities showed evidence of remaining soil contamination and radioactive PSM. Future land use will be restricted from surface and intrusive activities. Closure activities generated waste streams consisting of industrial solid waste, recyclable materials, low-level radioactive waste, and mixed low-level radioactive waste. Wastes were disposed of in the appropriate onsite landfills. The NNSA/NSO provides the following recommendations: • Clean closure is required at CAS 26-99-05. • Closure in place is required at CAS 25-99-21. • A UR is required at CAS 25-99-21. • A Notice of Completion to the NNSA/NSO is requested from the Nevada Division of Environmental Protection for closure of CAU 539. • Corrective Action Unit 539 should be moved from Appendix III to Appendix IV of the FFACO.« less

  11. Individual and cumulative effects of agriculture, forestry and metal mining activities on the metal and phosphorus content of fluvial fine-grained sediment; Quesnel River Basin, British Columbia, Canada.

    PubMed

    Smith, Tyler B; Owens, Philip N

    2014-10-15

    The impact of agriculture, forestry and metal mining on the quality of fine-grained sediment (<63 μm) was investigated in the Quesnel River Basin (QRB) (~11,500 km(2)) in British Columbia, Canada. Samples of fine-grained sediment were collected monthly during the snow-free season in 2008 using time-integrated samplers at replicate sites representative of agriculture, forestry and mining activities in the basin (i.e. "impacted" sites). Samples were also collected from replicate reference sites and also from the main stem of the Quesnel River at the downstream confluence with the Fraser River. Generally, metal(loid) and phosphorus (P) concentrations for "impacted" sites were greater than for reference sites. Furthermore, concentrations of copper (forestry and mining sites), manganese (agriculture and forestry sites) and selenium (agriculture, forestry and mining sites) exceeded upper sediment quality guideline (SQG) thresholds. These results suggest that agriculture, forestry and metal mining activities are having an influence on the concentrations of sediment-associated metal(loid)s and P in the Quesnel basin. Metal(loid) and P concentrations of sediment collected from the downstream site were not significantly greater than values for the reference sites, and were typically lower than the values for the impacted sites. This suggests that the cumulative effects of agriculture, forestry and mining activities in the QRB are presently not having a measureable effect at the river basin-scale. The lack of a cumulative effect at the basin-scale is thought to reflect: (i) the relatively recent occurrence of land use disturbances in this basin; (ii) the dominance of sediment contributions from natural forest and agriculture; and (iii) the potential for storage of contaminants on floodplains and other storage elements between the locations of disturbance activities and the downstream sampling site, which may be attenuating the disturbance signal. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. 75 FR 19368 - Foreign-Trade Zone 126-Reno, NV; Site Renumbering Notice

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-14

    ... at 728 Spice Island Drive, Sparks; Site 2 (9 acres)--located at 450-475 Lillard Drive, Sparks; Site 3..., 700 South Rock Boulevard, Reno; Site 14 (0.4 acres)--located at 1095 Spice Island Drive, Sparks; Site...

  13. Molecular dynamics simulation study of the "stay or leave" problem for two magnesium ions in gene transcription.

    PubMed

    Wu, Shaogui

    2017-06-01

    Two magnesium ions play important roles in nucleotide addition cycle (NAC) of gene transcription. However, at the end of each NAC, why does one ion stay in the active site while the other ion leaves with product pyrophosphate (PP i )? This problem still remains obscure. In this work, we studied the problem using all-atom molecular dynamics simulation combined with steered molecular dynamics and umbrella sampling simulation methods. Our simulations reveal that although both ions are located in the active site after chemistry, their detailed positions are not symmetrical, leading to their different forces from surrounding groups. One ion makes weaker contacts with PP i than the whole protein. Hence, PP i release is less likely to take it away. The other one forms tighter contacts with PP i relative to the protein. The formed (Mg 2+ -PP i ) 2- complex is found to break the contacts with surrounding protein residues one by one so as to dissociate from the active site. This effectively avoids the coexistence of two ions in the active site after PP i release and guarantees a reasonable Mg 2+ ion number in the active site for the next NAC. The observations from this work can provide valuable information for comprehensively understanding the molecular mechanism of transcription. Proteins 2017; 85:1002-1007. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  14. Geospatial analytics to evaluate point-of-dispensing sites for mass immunizations in Allegheny County, Pennsylvania.

    PubMed

    Everett, Kibri H; Potter, Margaret A; Wheaton, William D; Gleason, Sherrianne M; Brown, Shawn T; Lee, Bruce Y

    2013-01-01

    Public health agencies use mass immunization locations to quickly administer vaccines to protect a population against an epidemic. The selection of such locations is frequently determined by available staffing levels and in some places, not all potential sites can be opened, often because of a lack of resources. Public health agencies need assistance in determining which n sites are the prime ones to open given available staff to minimize travel time and travel distance for those in the population who need to get to a site to receive treatment. Employ geospatial analytical methods to identify the prime n locations from a predetermined set of potential locations (eg, schools) and determine which locations may not be able to achieve the throughput necessary to reach the herd immunity threshold based on varying R0 values. Spatial location-allocation algorithms were used to select the ideal n mass vaccination locations. Allegheny County, Pennsylvania, served as the study area. The most favorable sites were selected and the number of individuals required to be vaccinated to achieve the herd immunity threshold for a given R0, ranging from 1.5 to 7, was determined. Locations that did not meet the Centers for Disease Control and Prevention throughput recommendation for smallpox were identified. At R0 = 1.5, all mass immunization locations met the required throughput to achieve the herd immunity threshold within 5 days. As R0s increased from 2 to 7, an increasing number of sites were inadequate to meet throughput requirements. Identifying the top n sites and categorizing those with throughput challenges allows health departments to adjust staffing, shift length, or the number of sites. This method has the potential to be expanded to select immunization locations under a number of additional scenarios.

  15. Probing Conformational Changes and Interfacial Recognition Site of Lipases With Surfactants and Inhibitors.

    PubMed

    Mateos-Diaz, E; Amara, S; Roussel, A; Longhi, S; Cambillau, C; Carrière, F

    2017-01-01

    Structural studies on lipases by X-ray crystallography have revealed conformational changes occurring in the presence of surfactants/inhibitors and the pivotal role played by a molecular "lid" of variable size and structure depending on the enzyme. Besides controlling the access to the enzyme active site, the lid is involved in lipase activation, formation of the interfacial recognition site (IRS), and substrate docking within the active site. The combined use of surfactants and inhibitors has been critical for a better understanding of lipase structure-function relationships. An overview of crystal structures of lipases in complex with surfactants and inhibitors reveals common structural features and shows how surfactants monomers interact with the lid in its open conformation. The location of surfactants, inhibitors, and hydrophobic residues exposed upon lid opening provides insights into the IRS of lipases. The mechanism by which surfactants promote the lid opening can be further investigated in solution by site-directed spin labeling of lipase coupled to electron paramagnetic resonance spectroscopy. These experimental approaches are illustrated here by results obtained with mammalian digestive lipases, fungal lipases, and cutinases. © 2017 Elsevier Inc. All rights reserved.

  16. Linde FUSRAP Site Remediation: Engineering Challenges and Solutions of Remedial Activities on an Active Industrial Facility - 13506

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beres, Christopher M.; Fort, E. Joseph; Boyle, James D.

    2013-07-01

    The Linde FUSRAP Site (Linde) is located in Tonawanda, New York at a major research and development facility for Praxair, Inc. (Praxair). Successful remediation activities at Linde combines meeting cleanup objectives of radiological contamination while minimizing impacts to Praxair business operations. The unique use of Praxair's property coupled with an array of active and abandoned utilities poses many engineering and operational challenges; each of which has been overcome during the remedial action at Linde. The U.S. Army Corps of Engineers - Buffalo District (USACE) and CABRERA SERVICES, INC. (CABRERA) have successfully faced engineering challenges such as relocation of an abovegroundmore » structure, structural protection of an active water line, and installation of active mechanical, electrical, and communication utilities to perform remediation. As remediation nears completion, continued success of engineering challenges is critical as remaining activities exist in the vicinity of infrastructure essential to business operations; an electrical substation and duct bank providing power throughout the Praxair facility. Emphasis on engineering and operations through final remediation and into site restoration will allow for the safe and successful completion of the project. (authors)« less

  17. Daily and seasonal activity patterns in the eastern gray squirrel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bland, M.E.

    1977-03-01

    The daily and seasonal activity patterns of the eastern gray squirrel were investigated between July 1, 1971 and September 16, 1972. Seasonal variations existed in the amount of time per day squirrels were active, the time of onset and cessation of activity, and the size of home range. Squirrels were most active in the fall and spring and least active in the winter. Two peaks in activity (morning and evening) with a mid-day resting period were characteristic of the summer activity pattern. During the winter one brief period of activity occurred during the warm mid-day hours. In the fall themore » time of onset of activity was consistent and occurred 20 to 30 minutes before sunrise. Cessation of activity was also regular and took place 20 to 30 minutes after sunset. Times of onset and cessation of activity were irregular during the winter and summer with onset usually occurring after sunrise and cessation before sunset. Home range size was smallest in winter and largest in late spring and late summer. Male and female range sizes were similar in fall and winter but in the spring and summer ranges of males exceeded those of females. During winter one night nest location was used per given two week period and daytime activity was restricted to the area around the den site. In spring, summer, and fall each squirrel used between two and three nest locations per two week period and squirrels traveled considerable distance from the den site. Hardwood and cedar forests were heavily utilized by the squirrels with approximately 53 percent of the locations occurring in hardwood forests and 38 percent in cedar forests. Correlations between the amount of time per day squirrels were active and various abiotic and biotic factors were made. Snow cover and/or extremely cold temperatures during the winter and early spring curtailed movement, and rainy weather in summer decreased activity. The availability of acorns in the autumn and the appearance of food in the spring increased movement.« less

  18. Selection of actuator locations for static shape control of large space structures by heuristic integer programing

    NASA Technical Reports Server (NTRS)

    Haftka, R. T.; Adelman, H. M.

    1984-01-01

    Orbiting spacecraft such as large space antennas have to maintain a highly accurate space to operate satisfactorily. Such structures require active and passive controls to mantain an accurate shape under a variety of disturbances. Methods for the optimum placement of control actuators for correcting static deformations are described. In particular, attention is focused on the case were control locations have to be selected from a large set of available sites, so that integer programing methods are called for. The effectiveness of three heuristic techniques for obtaining a near-optimal site selection is compared. In addition, efficient reanalysis techniques for the rapid assessment of control effectiveness are presented. Two examples are used to demonstrate the methods: a simple beam structure and a 55m space-truss-parabolic antenna.

  19. Stack Flow Rate Changes and the ANSI/N13.1-1999 Qualification Criteria: Application to the Hanford Canister Storage Building Stack

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Flaherty, Julia E.; Glissmeyer, John A.

    2016-02-29

    The Canister Storage Building (CSB), located in the 200-East Area of the Hanford Site, is a 42,000 square foot facility used to store spent nuclear fuel from past activities at the Hanford Site. Because the facility has the potential to emit radionuclides into the environment, its ventilation exhaust stack has been equipped with an air monitoring system. Subpart H of the National Emissions Standards for Hazardous Air Pollutants requires that a sampling probe be located in the exhaust stack in accordance with criteria established by the American National Standards Institute/Health Physics Society Standard N13.1-1999, Sampling and Monitoring Releases of Airbornemore » Radioactive Substances from the Stack and Ducts of Nuclear Facilities.« less

  20. Crystal Structure of Phosphatidylglycerophosphatase (PGPase), a Putative Membrane-Bound Lipid Phosphatase, Reveals a Novel Binuclear Metal Binding Site and Two Proton Wires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumaran,D.; Bonnano, J.; Burley, S.

    2006-01-01

    Phosphatidylglycerophosphatase (PGPase), an enzyme involved in lipid metabolism, catalyzes formation of phosphatidylglycerol from phosphatidylglycerophosphate. Phosphatidylglycerol is a multifunctional phospholipid, found in the biological membranes of many organisms. Here, we report the crystal structure of Listeria monocytogenes PGPase at 1.8 Angstroms resolution. PGPase, an all-helical molecule, forms a homotetramer. Each protomer contains an independent active site with two metal ions, Ca{sup 2+} and Mg{sup 2+}, forming a hetero-binuclear center located in a hydrophilic cavity near the surface of the molecule. The binuclear center, conserved ligands, metal-bound water molecules, and an Asp-His dyad form the active site. The catalytic mechanism of thismore » enzyme is likely to proceed via binuclear metal activated nucleophilic water. The binuclear metal-binding active-site environment of this structure should provide insights into substrate binding and metal-dependent catalysis. A long channel with inter-linked linear water chains, termed 'proton wires', is observed at the tetramer interface. Comparison of similar water chain structures in photosynthetic reaction centers (RCs), Cytochrome f, gramicidin, and bacteriorhodopsin, suggests that PGPase may conduct protons via proton wires.« less

  1. Integrated geophysical investigations in a fault zone located on southwestern part of İzmir city, Western Anatolia, Turkey

    NASA Astrophysics Data System (ADS)

    Drahor, Mahmut G.; Berge, Meriç A.

    2017-01-01

    Integrated geophysical investigations consisting of joint application of various geophysical techniques have become a major tool of active tectonic investigations. The choice of integrated techniques depends on geological features, tectonic and fault characteristics of the study area, required resolution and penetration depth of used techniques and also financial supports. Therefore, fault geometry and offsets, sediment thickness and properties, features of folded strata and tectonic characteristics of near-surface sections of the subsurface could be thoroughly determined using integrated geophysical approaches. Although Ground Penetrating Radar (GPR), Electrical Resistivity Tomography (ERT) and Seismic Refraction Tomography (SRT) methods are commonly used in active tectonic investigations, other geophysical techniques will also contribute in obtaining of different properties in the complex geological environments of tectonically active sites. In this study, six different geophysical methods used to define faulting locations and characterizations around the study area. These are GPR, ERT, SRT, Very Low Frequency electromagnetic (VLF), magnetics and self-potential (SP). Overall integrated geophysical approaches used in this study gave us commonly important results about the near surface geological properties and faulting characteristics in the investigation area. After integrated interpretations of geophysical surveys, we determined an optimal trench location for paleoseismological studies. The main geological properties associated with faulting process obtained after trenching studies. In addition, geophysical results pointed out some indications concerning the active faulting mechanism in the area investigated. Consequently, the trenching studies indicate that the integrated approach of geophysical techniques applied on the fault problem reveals very useful and interpretative results in description of various properties of faulting zone in the investigation site.

  2. Analysis of terrestrial conditions and dynamics

    NASA Technical Reports Server (NTRS)

    Goward, S. N. (Principal Investigator)

    1984-01-01

    Land spectral reflectance properties for selected locations, including the Goddard Space Flight Center, the Wallops Flight Facility, a MLA test site in Cambridge, Maryland, and an acid test site in Burlington, Vermont, were measured. Methods to simulate the bidirectional reflectance properties of vegetated landscapes and a data base for spatial resolution were developed. North American vegetation patterns observed with the Advanced Very High Resolution Radiometer were assessed. Data and methods needed to model large-scale vegetation activity with remotely sensed observations and climate data were compiled.

  3. Study of a metallurgical site in Tuscany (Italy) by radiocarbon dating

    NASA Astrophysics Data System (ADS)

    Cartocci, A.; Fedi, M. E.; Taccetti, F.; Benvenuti, M.; Chiarantini, L.; Guideri, S.

    2007-06-01

    Tuscany represents one of the most important ancient mining districts of Italy. Metalworking activities have been present in the area since ancient times and several mining centres have been active in the region since the Etruscan period. Two of the more notable mining locations are the island of Elba and the towns of Populonia and Massa Marittima. In order to reconstruct the development of metallurgical techniques in the past, a multi-disciplinary approach is required, involving both archaeological study and archaeometric analysis of the sites of interest. One of the most complex problems is establishing the chronological history of metallurgical exploitation in ancient sites: archaeological remains are sometimes incomplete and the stratigraphy of archaeological horizons might have been deeply altered. Thus, direct dating of metallurgical slags and other remains of mining and metalworking activities using radiocarbon measurements is particularly useful for developing site chronologies. Charcoal samples from a recent excavation in Populonia were dated by AMS radiocarbon in order to reconstruct the chronological evolution of ancient metallurgical production; results reported here are consistent with archaeological observations.

  4. A contribution to the development of an economic atlas of the Houston Area Test Site

    NASA Technical Reports Server (NTRS)

    1972-01-01

    An outine description of the Houston Area Test Site was prepared, in the form of an atlas-catalog of Universal Transverse Mercator grid coordinate locations, building on the manufacturing sector and expanding along agreed lines as far as possible. It was concluded that (1) the effort expended in securing and verifying the locations of larger manufacturing plants yielded 5,000-plus usable entries, in addition to certain valuable conclusions about the general feasibility of obtaining ground information by economic sector; (2) on the basis of the number and the quality of the usable entries obtained, the resources expended on nonmanufacturing sectors and on historical data cannot be wholly justified; and (3) even without the 5,000-odd locations of completely satisfactory quality, the relatively modest cost of this pilot study secured enough data to provide a sound basis for obtaining feasibly and systematically some appropriate ground information on almost any economic or social activity, together with some indication of their relative areal and economic significance.

  5. Hazardous Waste Cleanup: Sunoco Incorporated - R&M Eagle Point Refinery in Westville, New Jersey

    EPA Pesticide Factsheets

    Sunoco, Inc. - R&M Eagle Point Refinery is located on Route 295 & 130 in Westville, West Deptford Township, New Jersey. The site is a 1,000-acre oil refinery on the Delaware River, 550 acres of which is an active production area.

  6. Digging into Archaeology Projects.

    ERIC Educational Resources Information Center

    Grambo, Greg

    1996-01-01

    Suggestions are offered for a classroom project of planning and conducting an archaeological dig on or near school property. Principles of archaeological practice such as making drawings of the site and using a grid frame to record locations are explained. Also suggested is a simulation activity in which students pick imbedded "findings" out of…

  7. 50 CFR 217.55 - Requirements for monitoring and reporting.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... MAMMALS INCIDENTAL TO SPECIFIED ACTIVITIES Taking of Marine Mammals Incidental To Target and Missile... the following monitoring measures: (1) Visual land-based monitoring. (i) Prior to each missile launch... located varying distances from the missile launch site. Each video camera will be set to record a focal...

  8. "This Is Still a Work in Progress": Common Ground, Littleton, New Hampshire.

    ERIC Educational Resources Information Center

    Hall, Mair; Walker, Pam

    This site-visit report describes Common Ground, a program located in New Hampshire that supports 52 people with developmental disabilities, including some with severe and multiple impairments, in a broad range of individualized, integrated daytime activities, including supported and competitive employment, self-employment, volunteer work, and the…

  9. Hazardous Waste Cleanup: Bristol-Myers Squibb Company Worldwide Medicines in Brunswick, New Jersey

    EPA Pesticide Factsheets

    The Bristol-Myers Squibb Company (BMS) is located at 1 Squibb Drive in New Brunswick, New Jersey. The site has been an active pharmaceutical manufacturing and research and development facility since it began operation by E.R. Squibb and Sons, Inc. in 1907.

  10. Effects of Permafrost and Seasonally Frozen Ground on the Seismic Responses of Transportation Infrastructure Sites

    DOT National Transportation Integrated Search

    2010-02-01

    The state of Alaska is located in one of the most seismically active zones in the world. Several large magnitude earthquakes (the Prince William Sound Earthquake, March 1964 and the Denali Earthquake, November 2002) have occurred in the state and cau...

  11. Microbial Activity In The Peerless Jenny King Sulfate Reducing Bioreactor System (Presentation)

    EPA Science Inventory

    The Peerless Jenny King treatment system is a series of four sulfate reducing bioreactor cells installed to treat acid mine drainage in the Upper Tenmile Creek Superfund Site located in the Rimini Mining District, near Helena MT. The system consists of a wetland pretreatment fol...

  12. Microbial Activity In The Peerless Jenny King Sulfate Reducing Bioreactors System

    EPA Science Inventory

    The Peerless Jenny King treatment system is a series of four sulfate reducing bioreactor cells installed to treat acid mine drainage in the Upper Tenmile Creek Superfund Site located in the Rimini Mining District, near Helena, MT. The system consists of a wetland pretreatment fo...

  13. Literary Maps for Young Adult Literature.

    ERIC Educational Resources Information Center

    Snodgrass, Mary Ellen

    The activities presented in this handbook are designed to help students envision the locations and landmarks of sites along journeys described in popular young adult literature (e.g., "The Adventures of Huckleberry Finn,""Born Free,""The Call of the Wild,""Catcher in the Rye,""I Know Why the Caged Bird…

  14. Watershed inventory, Ravenna Training and Logistics Site, Ohio

    USGS Publications Warehouse

    Ostheimer, Chad J.; Tertuliani, John S.

    2003-01-01

    The Ohio Army National Guard (OHARNG) conducts training activities on the lands it manages to fulfill its primary mission of maintaining combat readiness. One of the training areas OHARNG manages is the Ravenna Training and Logistics Site (RTLS). This facility is co-located with the Ravenna Army Ammunition Plant (RVAAP) in Portage and Trumbull Counties, Ohio. Training activities can subject watersheds to various effects. Although environmental effects from training activities cannot be completely avoided, OHARNG is actively seeking for ways to minimize such effects in accordance with Federal, State, and local laws and regulations. This report presents the results of a study by the U.S. Geological Survey (USGS), in cooperation with the OHARNG, to inventory current conditions of the watersheds that drain the RTLS/RVAAP facility. As part of the inventory, a digital geographic database was developed.

  15. Corrective Action Plan for Corrective Action Unit 262: Area 25 Septic Systems and Underground Discharge Point, Nevada Test Site, Nevada

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    K. B. Campbell

    This Corrective Action Plan (CAP) provides selected corrective action alternatives and proposes the closure methodology for Corrective Action Unit (CAU) 262, Area 25 Septic Systems and Underground Discharge Point. CAU 262 is identified in the Federal Facility Agreement and Consent Order (FFACO) of 1996. Remediation of CAU 262 is required under the FFACO. CAU 262 is located in Area 25 of the Nevada Test Site (NTS), approximately 100 kilometers (km) (62 miles [mi]) northwest of Las Vegas, Nevada. The nine Corrective Action Sites (CASs) within CAU 262 are located in the Nuclear Rocket Development Station complex. Individual CASs are locatedmore » in the vicinity of the Reactor Maintenance, Assembly, and Disassembly (R-MAD); Engine Maintenance, Assembly, and Disassembly (E-MAD); and Test Cell C compounds. CAU 262 includes the following CASs as provided in the FFACO (1996); CAS 25-02-06, Underground Storage Tank; CAS 25-04-06, Septic Systems A and B; CAS 25-04-07, Septic System; CAS 25-05-03, Leachfield; CAS 25-05-05, Leachfield; CAS 25-05-06, Leachfield; CAS 25-05-08, Radioactive Leachfield; CAS 25-05-12, Leachfield; and CAS 25-51-01, Dry Well. Figures 2, 3, and 4 show the locations of the R-MAD, the E-MAD, and the Test Cell C CASs, respectively. The facilities within CAU 262 supported nuclear rocket reactor engine testing. Activities associated with the program were performed between 1958 and 1973. However, several other projects used the facilities after 1973. A significant quantity of radioactive and sanitary waste was produced during routine operations. Most of the radioactive waste was managed by disposal in the posted leachfields. Sanitary wastes were disposed in sanitary leachfields. Septic tanks, present at sanitary leachfields (i.e., CAS 25-02-06,2504-06 [Septic Systems A and B], 25-04-07, 25-05-05,25-05-12) allowed solids to settle out of suspension prior to entering the leachfield. Posted leachfields do not contain septic tanks. All CASs located in CAU 262 are inactive or abandoned. However, some leachfields may still receive liquids from runoff during storm events. Results from the 2000-2001 site characterization activities conducted by International Technology (IT) Corporation, Las Vegas Office are documented in the Corrective Action Investigation Report for Corrective Action Unit 262: Area 25 Septic Systems and Underground Discharge Point, Nevada Test Site, Nevada. This document is located in Appendix A of the Corrective Action Decision Document for CAU 262. Area 25 Septic Systems and Underground Discharge Point, Nevada Test Site, Nevada. (DOE/NV, 2001).« less

  16. Mechanosensitive ion channel Piezo1 is expressed in antral G cells of murine stomach.

    PubMed

    Lang, Kerstin; Breer, Heinz; Frick, Claudia

    2018-02-01

    G cells in the antrum region of the murine stomach produce gastrin, the central hormone for controlling gastric activities. Secretion of gastrin is induced mainly by protein breakdown products but also by distensions of the stomach wall. Although G cells respond to protein fragments via distinct chemosensory receptor types, the mechanism underlying G cell activation upon distention is entirely ambiguous. Mechanosensitive ion channels are considered as potential candidates for such a task. Therefore, we explore the possibility of whether Piezo1, a polymodal sensor for diverse mechanical forces, is expressed in antral G cells. The experimental analyses revealed that the vast majority of G cells indeed expressed Piezo1. Within flask-like G cells at the base of the antral invaginations, the Piezo1 protein was primarily located at the basolateral portion, which is thought to be the release site for the exocytic secretion of gastrin. In the spindle-like G cells, which are oriented parallel to the invaginations, Piezo1 protein was restricted to the cell body where the hormone was also located, whereas the long processes appeared to be devoid of Piezo1 protein. Our results suggest that mechanosensitive channels such as Piezo1, located in close proximity to hormone-release sites, enable G cells to respond directly to antrum distensions with gastrin secretion.

  17. Locating active-site hydrogen atoms in d-xylose isomerase: Time-of-flight neutron diffraction

    PubMed Central

    Katz, Amy K.; Li, Xinmin; Carrell, H. L.; Hanson, B. Leif; Langan, Paul; Coates, Leighton; Schoenborn, Benno P.; Glusker, Jenny P.; Bunick, Gerard J.

    2006-01-01

    Time-of-flight neutron diffraction has been used to locate hydrogen atoms that define the ionization states of amino acids in crystals of d-xylose isomerase. This enzyme, from Streptomyces rubiginosus, is one of the largest enzymes studied to date at high resolution (1.8 Å) by this method. We have determined the position and orientation of a metal ion-bound water molecule that is located in the active site of the enzyme; this water has been thought to be involved in the isomerization step in which d-xylose is converted to d-xylulose or d-glucose to d-fructose. It is shown to be water (rather than a hydroxyl group) under the conditions of measurement (pH 8.0). Our analyses also reveal that one lysine probably has an −NH2-terminal group (rather than NH3+). The ionization state of each histidine residue also was determined. High-resolution x-ray studies (at 0.94 Å) indicate disorder in some side chains when a truncated substrate is bound and suggest how some side chains might move during catalysis. This combination of time-of-flight neutron diffraction and x-ray diffraction can contribute greatly to the elucidation of enzyme mechanisms. PMID:16707576

  18. Installation Restoration Program. Remedial Investigation Report. Minnesota Air National Guard Base Duluth International Airport, Duluth, Minnesota. Volume 5

    DTIC Science & Technology

    1990-01-01

    1-20 1-6 Sites Defined and Ranked During IRP Phase I Study. 1-29 1-7 Aerial Photograph of Site 2, April 1988. 1-32 1-8 Site 2 Sampling Locations...Utilized During Phase II Investigations. 1-35 1-9 Aerial Photograph of Site 3, April 1988. 1-38 1-10 Site 3 Sampling Locations Utilized During Phase II...Investigations. 1-47 1-11 Aerial Photograph of Site 4, April 1988. 1-54 1-12 Site 4 Sampling Locations Utilized During Phase II Investigations. 1-57 1-13

  19. Thermal Imaging of the Waccasassa Bay Preserve: Image Acquisition and Processing

    USGS Publications Warehouse

    Raabe, Ellen A.; Bialkowska-Jelinska, Elzbieta

    2010-01-01

    Thermal infrared (TIR) imagery was acquired along coastal Levy County, Florida, in March 2009 with the goal of identifying groundwater-discharge locations in Waccasassa Bay Preserve State Park (WBPSP). Groundwater discharge is thermally distinct in winter when Floridan aquifer temperature, 71-72 degrees F, contrasts with the surrounding cold surface waters. Calibrated imagery was analyzed to assess temperature anomalies and related thermal traces. The influence of warm Gulf water and image artifacts on small features was successfully constrained by image evaluation in three separate zones: Creeks, Bay, and Gulf. Four levels of significant water-temperature anomalies were identified, and 488 sites of interest were mapped. Among the sites identified, at least 80 were determined to be associated with image artifacts and human activity, such as excavation pits and the Florida Barge Canal. Sites of interest were evaluated for geographic concentration and isolation. High site densities, indicating interconnectivity and prevailing flow, were located at Corrigan Reef, No. 4 Channel, Winzy Creek, Cow Creek, Withlacoochee River, and at excavation sites. In other areas, low to moderate site density indicates the presence of independent vents and unique flow paths. A directional distribution assessment of natural seep features produced a northwest trend closely matching the strike direction of regional faults. Naturally occurring seeps were located in karst ponds and tidal creeks, and several submerged sites were detected in Waccasassa River and Bay, representing the first documentation of submarine vents in the Waccasassa region. Drought conditions throughout the region placed constraints on positive feature identification. Low discharge or displacement by landward movement of saltwater may have reduced or reversed flow during this season. Approximately two-thirds of seep locations in the overlap between 2009 and 2005 TIR night imagery were positively re-identified in 2009. These results indicate a 33 percent chance of feature omission in the 2009 imagery. This assessment of seep location and distribution contributes to an understanding of the underlying geology, the role of fault and fracture patterns, and the presence of both interconnected and constrained flow paths in the region. The maps and evaluations will enhance Park management efforts, interpretation of Park resources, and increase understanding of the combined effects of land and water use on the coastal lowlands, estuarine habitats, and natural resources of WBPSP.

  20. Mechanistic differences between methanol and dimethyl ether carbonylation in side pockets and large channels of mordenite.

    PubMed

    Boronat, Mercedes; Martínez, Cristina; Corma, Avelino

    2011-02-21

    The activity and selectivity towards carbonylation presented by Brønsted acid sites located inside the 8MR pockets or in the main 12MR channels of mordenite is studied by means of quantum-chemical calculations, and the mechanistic differences between methanol and DME carbonylation are investigated. The selectivity towards carbonylation is higher inside the 8MR pockets, where the competitive formation of DME and hydrocarbons that finally leads to catalyst deactivation is sterically impeded. Moreover, inclusion of dispersion interactions in the calculations leads to agreement between the calculated activation barriers for the rate determining step and the experimentally observed higher reactivity of methoxy groups located inside the 8MR channels.

  1. Corrective action investigation plan for CAU Number 453: Area 9 Landfill, Tonopah Test Range

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    This Corrective Action Investigation Plan (CAIP) contains the environmental sample collection objectives and criteria for conducting site investigation activities at the Area 9 Landfill, Corrective Action Unit (CAU) 453/Corrective Action (CAS) 09-55-001-0952, which is located at the Tonopah Test Range (TTR). The TTR, included in the Nellis Air Force Range, is approximately 255 kilometers (140 miles) northwest of Las Vegas, Nevada. The Area 9 Landfill is located northwest of Area 9 on the TTR. The landfill cells associated with CAU 453 were excavated to receive waste generated from the daily operations conducted at Area 9 and from range cleanup whichmore » occurred after test activities.« less

  2. Environmental risk assessment in five rivers of Parana River basin, Southern Brazil, through biomarkers in Astyanax spp.

    PubMed

    Barros, Ivaldete Tijolin; Ceccon, Juliana Parolin; Glinski, Andressa; Liebel, Samuel; Grötzner, Sonia Regina; Randi, Marco Antonio Ferreira; Benedito, Evanilde; Ortolani-Machado, Claudia Feijó; Filipak Neto, Francisco; de Oliveira Ribeiro, Ciro Alberto

    2017-07-01

    In the current study, water quality of five river sites in Parana River basin (Brazil), utilized for public water supply, was assessed through a set of biomarkers in fish Astyanax spp. Population growth and inadequate use of land are challenges to the preservation of biodiversity and resources such as water. Some physicochemical parameters as well as somatic indexes, gills and liver histopathology, genotoxicity, and biochemical biomarkers were evaluated. The highest gonadosomatic index (GSI) and antioxidant parameters (catalase and glutathione S-transferase activities, non-protein thiols), as well as the lowest damage to biomolecules (lipid peroxidation, protein carbonylation, DNA damage) were observed in site 0 (Piava River), which is located at an environmental protected area. Site 1, located in the same river, but downstream site 0 and outside the protection area, presents some level of impact. Fish from site 2 (Antas River), which lack of riparian forest and suffer from silting, presented the highest micronucleus incidence and no melanomacrophages. Differently, individuals from site 3 (Xambrê River) and site 4 (Pinhalzinho River) which receive surface runoff from Umuarama city, urban and industrial sewage, have the highest incidences of liver and gill histopathological alterations, including neoplasia, which indicated the worst health conditions of all sites. In particular, site 4 had high levels of total nitrogen and ammonia, high turbidity, and very low oxygen levels, which indicate important chemical impact. Comparison of the biomarkers in fish allowed classification of the five sites in terms of environmental impact and revealed that sites 3 and 4 had particular poor water quality.

  3. Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

    PubMed Central

    Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

    2001-01-01

    A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

  4. Commisioning and ``First-Light'' of the Willard L. Eccles Observatory at Frisco Peak

    NASA Astrophysics Data System (ADS)

    Springer, Wayne; Dawson, Kyle; Ricketts, Paul; Ramsrud, Nicolas; Samarasingha, Upul

    2010-10-01

    The University of Utah completed construction of the Willard L. Eccles Observatory located on Frisco Peak near Milford, Utah in October 2009. The observatory site is located on a prominent peak at an altitude of approximately 9600 feet in a region with minimal light pollution. The Frisco Peak site was chosen after careful consideration of many factors including climate, light pollution and available infrastructure. The facility houses a 32'' Schmidt-Cassegrain telescope manufactured by DFM Engineering of Longmont, CO. Commissioning and development of remote operation capabilities is currently being undertaken. Monitoring of the weather and seeing conditions are being performed and confirm the excellent nature of the site for astronomical observations. The observatory facilities will be used for educational and public outreach activities as well as research projects. A description of the facility and its planned use will be provided. Measurements of the ``seeing'' and night sky background from images obtained with the telescope will also be presented.

  5. 78 FR 66746 - Medical Device User Fee and Modernization Act; Notice to Public of Web Site Location of Fiscal...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-06

    ...] Medical Device User Fee and Modernization Act; Notice to Public of Web Site Location of Fiscal Year 2014... and Drug Administration (FDA or the Agency) is announcing the Web site location where the Agency will... documents, FDA has committed to updating its Web site in a timely manner to reflect the Agency's review of...

  6. The role of human outdoor recreation in shaping patterns of grizzly bear-black bear co-occurrence

    PubMed Central

    Steenweg, Robin; Shepherd, Brenda; Boyce, Mark S.

    2018-01-01

    Species’ distributions are influenced by a combination of landscape variables and biotic interactions with other species, including people. Grizzly bears and black bears are sympatric, competing omnivores that also share habitats with human recreationists. By adapting models for multi-species occupancy analysis, we analyzed trail camera data from 192 trail camera locations in and around Jasper National Park, Canada to estimate grizzly bear and black bear occurrence and intensity of trail use. We documented (a) occurrence of grizzly bears and black bears relative to habitat variables (b) occurrence and intensity of use relative to competing bear species and motorised and non-motorised recreational activity, and (c) temporal overlap in activity patterns among the two bear species and recreationists. Grizzly bears were spatially separated from black bears, selecting higher elevations and locations farther from roads. Both species co-occurred with motorised and non-motorised recreation, however, grizzly bears reduced their intensity of use of sites with motorised recreation present. Black bears showed higher temporal activity overlap with recreational activity than grizzly bears, however differences in bear daily activity patterns between sites with and without motorised and non-motorised recreation were not significant. Reduced intensity of use by grizzly bears of sites where motorised recreation was present is a concern given off-road recreation is becoming increasingly popular in North America, and can negatively influence grizzly bear recovery by reducing foraging opportunities near or on trails. Camera traps and multi-species occurrence models offer non-invasive methods for identifying how habitat use by animals changes relative to sympatric species, including humans. These conclusions emphasise the need for integrated land-use planning, access management, and grizzly bear conservation efforts to consider the implications of continued access for motorised recreation in areas occupied by grizzly bears. PMID:29389939

  7. The role of human outdoor recreation in shaping patterns of grizzly bear-black bear co-occurrence.

    PubMed

    Ladle, Andrew; Steenweg, Robin; Shepherd, Brenda; Boyce, Mark S

    2018-01-01

    Species' distributions are influenced by a combination of landscape variables and biotic interactions with other species, including people. Grizzly bears and black bears are sympatric, competing omnivores that also share habitats with human recreationists. By adapting models for multi-species occupancy analysis, we analyzed trail camera data from 192 trail camera locations in and around Jasper National Park, Canada to estimate grizzly bear and black bear occurrence and intensity of trail use. We documented (a) occurrence of grizzly bears and black bears relative to habitat variables (b) occurrence and intensity of use relative to competing bear species and motorised and non-motorised recreational activity, and (c) temporal overlap in activity patterns among the two bear species and recreationists. Grizzly bears were spatially separated from black bears, selecting higher elevations and locations farther from roads. Both species co-occurred with motorised and non-motorised recreation, however, grizzly bears reduced their intensity of use of sites with motorised recreation present. Black bears showed higher temporal activity overlap with recreational activity than grizzly bears, however differences in bear daily activity patterns between sites with and without motorised and non-motorised recreation were not significant. Reduced intensity of use by grizzly bears of sites where motorised recreation was present is a concern given off-road recreation is becoming increasingly popular in North America, and can negatively influence grizzly bear recovery by reducing foraging opportunities near or on trails. Camera traps and multi-species occurrence models offer non-invasive methods for identifying how habitat use by animals changes relative to sympatric species, including humans. These conclusions emphasise the need for integrated land-use planning, access management, and grizzly bear conservation efforts to consider the implications of continued access for motorised recreation in areas occupied by grizzly bears.

  8. Install active/passive neutron examination and assay (APNEA)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1996-04-01

    This document describes activities pertinent to the installation of the prototype Active/Passive Neutron Examination and Assay (APNEA) system built in Area 336 into its specially designed trailer. It also documents the basic theory of operation, design and protective features, basic personnel training, and the proposed characterization site location at Lockheed Martin Specialty Components, Inc., (Specialty Components) with the estimated 10 mrem/year boundary. Additionally, the document includes the Preventive Change Analysis (PCA) form, and a checklist of items for verification prior to unrestricted system use.

  9. Conserved Loop Cysteines of Vitamin K Epoxide Reductase Complex Subunit 1-like 1 (VKORC1L1) Are Involved in Its Active Site Regeneration*

    PubMed Central

    Tie, Jian-Ke; Jin, Da-Yun; Stafford, Darrel W.

    2014-01-01

    Vitamin K epoxide reductase complex subunit 1 (VKORC1) reduces vitamin K epoxide in the vitamin K cycle for post-translational modification of proteins that are involved in a variety of biological functions. However, the physiological function of VKORC1-like 1 (VKORC1L1), a paralogous enzyme sharing about 50% protein identity with VKORC1, is unknown. Here we determined the structural and functional differences of these two enzymes using fluorescence protease protection (FPP) assay and an in vivo cell-based activity assay. We show that in vivo VKORC1L1 reduces vitamin K epoxide to support vitamin K-dependent carboxylation as efficiently as does VKORC1. However, FPP assays show that unlike VKORC1, VKORC1L1 is a four-transmembrane domain protein with both its termini located in the cytoplasm. Moreover, the conserved loop cysteines, which are not required for VKORC1 activity, are essential for VKORC1L1's active site regeneration. Results from domain exchanges between VKORC1L1 and VKORC1 suggest that it is VKORC1L1's overall structure that uniquely allows for active site regeneration by the conserved loop cysteines. Intermediate disulfide trapping results confirmed an intra-molecular electron transfer pathway for VKORC1L1's active site reduction. Our results allow us to propose a concerted action of the four conserved cysteines of VKORC1L1 for active site regeneration; the second loop cysteine, Cys-58, attacks the active site disulfide, forming an intermediate disulfide with Cys-139; the first loop cysteine, Cys-50, attacks the intermediate disulfide resulting in active site reduction. The different membrane topologies and reaction mechanisms between VKORC1L1 and VKORC1 suggest that these two proteins might have different physiological functions. PMID:24532791

  10. Conserved loop cysteines of vitamin K epoxide reductase complex subunit 1-like 1 (VKORC1L1) are involved in its active site regeneration.

    PubMed

    Tie, Jian-Ke; Jin, Da-Yun; Stafford, Darrel W

    2014-03-28

    Vitamin K epoxide reductase complex subunit 1 (VKORC1) reduces vitamin K epoxide in the vitamin K cycle for post-translational modification of proteins that are involved in a variety of biological functions. However, the physiological function of VKORC1-like 1 (VKORC1L1), a paralogous enzyme sharing about 50% protein identity with VKORC1, is unknown. Here we determined the structural and functional differences of these two enzymes using fluorescence protease protection (FPP) assay and an in vivo cell-based activity assay. We show that in vivo VKORC1L1 reduces vitamin K epoxide to support vitamin K-dependent carboxylation as efficiently as does VKORC1. However, FPP assays show that unlike VKORC1, VKORC1L1 is a four-transmembrane domain protein with both its termini located in the cytoplasm. Moreover, the conserved loop cysteines, which are not required for VKORC1 activity, are essential for VKORC1L1's active site regeneration. Results from domain exchanges between VKORC1L1 and VKORC1 suggest that it is VKORC1L1's overall structure that uniquely allows for active site regeneration by the conserved loop cysteines. Intermediate disulfide trapping results confirmed an intra-molecular electron transfer pathway for VKORC1L1's active site reduction. Our results allow us to propose a concerted action of the four conserved cysteines of VKORC1L1 for active site regeneration; the second loop cysteine, Cys-58, attacks the active site disulfide, forming an intermediate disulfide with Cys-139; the first loop cysteine, Cys-50, attacks the intermediate disulfide resulting in active site reduction. The different membrane topologies and reaction mechanisms between VKORC1L1 and VKORC1 suggest that these two proteins might have different physiological functions.

  11. The 3'-5' exonuclease of DNA polymerase I of Escherichia coli: contribution of each amino acid at the active site to the reaction.

    PubMed Central

    Derbyshire, V; Grindley, N D; Joyce, C M

    1991-01-01

    We have used site-directed mutagenesis to change amino acid side chains that have been shown crystallographically to be in close proximity to a DNA 3' terminus bound at the 3'-5' exonuclease active site of Klenow fragment. Exonuclease assays of the resulting mutant proteins indicate that the largest effects on exonuclease activity result from mutations in a group of carboxylate side chains (Asp355, Asp424 and Asp501) anchoring two divalent metal ions that are essential for exonuclease activity. Another carboxylate (Glu357) within this cluster seems to be less important as a metal ligand, but may play a separate role in catalysis of the exonuclease reaction. A second group of residues (Leu361, Phe473 and Tyr497), located around the terminal base and ribose positions, plays a secondary role, ensuring correct positioning of the substrate in the active site and perhaps also facilitating melting of a duplex DNA substrate by interacting with the frayed 3' terminus. The pH-dependence of the 3'-5' exonuclease reaction is consistent with a mechanism in which nucleophilic attack on the terminal phosphodiester bond is initiated by a hydroxide ion coordinated to one of the enzyme-bound metal ions. PMID:1989882

  12. Riparian vegetation structure and the hunting behavior of adult estuarine crocodiles.

    PubMed

    Evans, Luke J; Davies, Andrew B; Goossens, Benoit; Asner, Gregory P

    2017-01-01

    Riparian ecosystems are amongst the most biodiverse tropical habitats. They are important, and essential, ecological corridors, linking remnant forest fragments. In this study, we hypothesised that crocodile's actively select nocturnal resting locations based on increased macaque predation potential. We examined the importance of riparian vegetation structure in the maintenance of crocodile hunting behaviours. Using airborne Light Detection and Ranging (LiDAR) and GPS telemetry on animal movement, we identified the repeated use of nocturnal resting sites by adult estuarine crocodiles (Crocodylus porosus) throughout the fragmented Lower Kinabatangan Wildlife Sanctuary in Sabah, Malaysia. Crocodile resting locations were found to resemble, in terms of habitat characteristics, the sleeping sites of long-tailed macaque; positioned in an attempt to avoid predation by terrestrial predators. We found individual crocodiles were actively selecting overhanging vegetation and that the protrusion of trees from the tree line was key to site selection by crocodiles, as well as influencing both the presence and group size of sleeping macaques. Although these findings are correlational, they have broad management implications, with the suggestion that riparian corridor maintenance and quality can have implications beyond that of terrestrial fauna. We further place our findings in the context of the wider ecosystem and the maintenance of trophic interactions, and discuss how future habitat management has the potential to mitigate human-wildlife conflict.

  13. From Tornadoes to Earthquakes: Forecast Verification for Binary Events Applied to the 1999 Chi-Chi, Taiwan, Earthquake

    NASA Astrophysics Data System (ADS)

    Chen, C.; Rundle, J. B.; Holliday, J. R.; Nanjo, K.; Turcotte, D. L.; Li, S.; Tiampo, K. F.

    2005-12-01

    Forecast verification procedures for statistical events with binary outcomes typically rely on the use of contingency tables and Relative Operating Characteristic (ROC) diagrams. Originally developed for the statistical evaluation of tornado forecasts on a county-by-county basis, these methods can be adapted to the evaluation of competing earthquake forecasts. Here we apply these methods retrospectively to two forecasts for the m = 7.3 1999 Chi-Chi, Taiwan, earthquake. These forecasts are based on a method, Pattern Informatics (PI), that locates likely sites for future large earthquakes based on large change in activity of the smallest earthquakes. A competing null hypothesis, Relative Intensity (RI), is based on the idea that future large earthquake locations are correlated with sites having the greatest frequency of small earthquakes. We show that for Taiwan, the PI forecast method is superior to the RI forecast null hypothesis. Inspection of the two maps indicates that their forecast locations are indeed quite different. Our results confirm an earlier result suggesting that the earthquake preparation process for events such as the Chi-Chi earthquake involves anomalous changes in activation or quiescence, and that signatures of these processes can be detected in precursory seismicity data. Furthermore, we find that our methods can accurately forecast the locations of aftershocks from precursory seismicity changes alone, implying that the main shock together with its aftershocks represent a single manifestation of the formation of a high-stress region nucleating prior to the main shock.

  14. Trench logs, terrestrial lidar system imagery, and radiocarbon data from the kilometer-62 site on the Greenville Fault, southeastern Alameda County, California, 2014

    USGS Publications Warehouse

    Lienkaemper, James J.; DeLong, Stephen B.; Avdievitch, Nikita N.; Pickering, Alexandra J; Guilderson, Thomas P.

    2015-01-01

    In 2014, we investigated an abrupt 8.5-meter (m), right-laterally deflected stream channel located near the Greenville Fault in southeastern Alameda County, California (-121.56224° E, 37.53430° N) that we discovered using 0.5-m resolution, 2011 aerial lidar imagery flown along the active fault trace. Prior to trenching we surveyed the site using a terrestrial lidar system (TLS) to document the exact geomorphic expression of this deflected stream channel before excavating a trench adjacent to it. We trenched perpendicular to the fault hoping to document the prehistoric history of earthquake ruptures along the fault. However, the alluvial stratigraphy that we document in these trench logs shows conclusively that this trench did not expose any active fault trace. Using other local geomorphic evidence for the fault location, a straight fault scarp immediately north of this stream projects slightly upslope of the west end of our trench and may be the actual location of the active fault trace. Five radiocarbon samples establish age control for the alluvial sequence documented in the trench, which may in the future be useful in constraining the long-term slip rate of the Greenville Fault. The deflection had been caused by an abrupt nontectonic termination of unit u30, a relatively thick (0.15–0.35 m) silt that is more erosion resistant than the adjacent cohesionless sand and gravel. 

  15. Ground-penetrating radar investigation of active faults along the Dead Sea Transform and implications for seismic hazards within the city of Aqaba, Jordan

    NASA Astrophysics Data System (ADS)

    Slater, Lee; Niemi, Tina M.

    2003-06-01

    Ground-penetrating radar (GPR) was used in an effort to locate a major active fault that traverses Aqaba City, Jordan. Measurements over an exposed (trenched) cross fault outside of the city identify a radar signature consisting of linear events and horizontal offset/flexured reflectors both showing a geometric correlation with two known faults at a control site. The asymmetric linear events are consistent with dipping planar reflectors matching the known direction of dip of the faults. However, other observations regarding this radar signature render the mechanism generating these events more complex and uncertain. GPR measurements in Aqaba City were limited to vacant lots. Seven GPR profiles were conducted approximately perpendicular to the assumed strike of the fault zone, based on regional geological evidence. A radar response very similar to that obtained over the cross fault was observed on five of the profiles in Aqaba City, although the response is weaker than that obtained at the control site. The positions of the identified responses form a near straight line with a strike of 45°. Although subsurface verification of the fault by trenching within the city is needed, the geophysical evidence for fault zone location is strong. The location of the interpreted fault zone relative to emergency services, military bases, commercial properties, and residential areas is defined to within a few meters. This study has significant implications for seismic hazard analysis in this tectonically active and heavily populated region.

  16. Evaluation of radioisotope tracer and activation analysis techniques for contamination monitoring in space environment simulation chambers

    NASA Technical Reports Server (NTRS)

    Smathers, J. B.; Kuykendall, W. E., Jr.; Wright, R. E., Jr.; Marshall, J. R.

    1973-01-01

    Radioisotope measurement techniques and neutron activation analysis are evaluated for use in identifying and locating contamination sources in space environment simulation chambers. The alpha range method allows the determination of total contaminant concentration in vapor state and condensate state. A Cf-252 neutron activation analysis system for detecting oils and greases tagged with stable elements is described. While neutron activation analysis of tagged contaminants offers specificity, an on-site system is extremely costly to implement and provides only marginal detection sensitivity under even the most favorable conditions.

  17. Risk based requirements for long term stewardship: A proof-of-principle analysis of an analytic method tested on selected Hanford locations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jarvis, T.T.; Andrews, W.B.; Buck, J.W.

    1998-03-01

    Since 1989, the Department of Energy`s (DOE) Environmental Management (EM) Program has managed the environmental legacy of US nuclear weapons production, research and testing at 137 facilities in 31 states and one US territory. The EM program has conducted several studies on the public risks posed by contaminated sites at these facilities. In Risks and the Risk Debate [DOE, 1995a], the Department analyzed the risks at sites before, during, and after remediation work by the EM program. The results indicated that aside from a few urgent risks, most hazards present little inherent risk because physical and active site management controlsmore » limit both the releases of site contaminants, and public access to these hazards. Without these controls, these sites would pose greater risks to the public. Past risk reports, however, provided little information about post-cleanup risk, primarily because of uncertainty about future site uses and site characteristics at the end of planned cleanup activities. This is of concern because in many cases current cleanup technologies, and remedies, will last a shorter period of time than the waste itself and the resulting contamination will remain hazardous.« less

  18. Site investigation for 125th fighter interceptor group Florida Air National Guard

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-03-01

    A two-step Site Investigation (SI) was conducted to evaluate the nature and extent of environmental contamination that might have resulted from past activities at eight disposal/spill sites at the 125th Fighter Interceptor Group, Florida Air National Guard (FANG) in Jacksonville, Florida. The sites included in the SI are shown on the location map in Figure ES-i and briefly described below: Oil/water separator (OWS) inlets along the aircraft parking apron; Subsurface of aircraft parking apron; Fire training areas, separated for clarity into Site 3E for the east area and Site 3W for the west area; OWS at the Hush House; OWSmore » at the Vehicle Maintenance Building; Area outside the Munitions Building; Trim pad for aircraft run-up; OWS at the Wash Rack.« less

  19. Structural evidence for a copper-bound carbonate intermediate in the peroxidase and dismutase activities of superoxide dismutase.

    PubMed

    Strange, Richard W; Hough, Michael A; Antonyuk, Svetlana V; Hasnain, S Samar

    2012-01-01

    Copper-zinc superoxide dismutase (SOD) is of fundamental importance to our understanding of oxidative damage. Its primary function is catalysing the dismutation of superoxide to O(2) and H(2)O(2). SOD also reacts with H(2)O(2), leading to the formation of a strong copper-bound oxidant species that can either inactivate the enzyme or oxidise other substrates. In the presence of bicarbonate (or CO(2)) and H(2)O(2), this peroxidase activity is enhanced and produces the carbonate radical. This freely diffusible reactive oxygen species is proposed as the agent for oxidation of large substrates that are too bulky to enter the active site. Here, we provide direct structural evidence, from a 2.15 Å resolution crystal structure, of (bi)carbonate captured at the active site of reduced SOD, consistent with the view that a bound carbonate intermediate could be formed, producing a diffusible carbonate radical upon reoxidation of copper. The bound carbonate blocks direct access of substrates to Cu(I), suggesting that an adjunct to the accepted mechanism of SOD catalysed dismutation of superoxide operates, with Cu(I) oxidation by superoxide being driven via a proton-coupled electron transfer mechanism involving the bound carbonate rather than the solvent. Carbonate is captured in a different site when SOD is oxidised, being located in the active site channel adjacent to the catalytically important Arg143. This is the probable route of diffusion from the active site following reoxidation of the copper. In this position, the carbonate is poised for re-entry into the active site and binding to the reduced copper.

  20. Structural Evidence for a Copper-Bound Carbonate Intermediate in the Peroxidase and Dismutase Activities of Superoxide Dismutase

    PubMed Central

    Strange, Richard W.; Hough, Michael A.; Antonyuk, Svetlana V.; Hasnain, S. Samar

    2012-01-01

    Copper-zinc superoxide dismutase (SOD) is of fundamental importance to our understanding of oxidative damage. Its primary function is catalysing the dismutation of superoxide to O2 and H2O2. SOD also reacts with H2O2, leading to the formation of a strong copper-bound oxidant species that can either inactivate the enzyme or oxidise other substrates. In the presence of bicarbonate (or CO2) and H2O2, this peroxidase activity is enhanced and produces the carbonate radical. This freely diffusible reactive oxygen species is proposed as the agent for oxidation of large substrates that are too bulky to enter the active site. Here, we provide direct structural evidence, from a 2.15 Å resolution crystal structure, of (bi)carbonate captured at the active site of reduced SOD, consistent with the view that a bound carbonate intermediate could be formed, producing a diffusible carbonate radical upon reoxidation of copper. The bound carbonate blocks direct access of substrates to Cu(I), suggesting that an adjunct to the accepted mechanism of SOD catalysed dismutation of superoxide operates, with Cu(I) oxidation by superoxide being driven via a proton-coupled electron transfer mechanism involving the bound carbonate rather than the solvent. Carbonate is captured in a different site when SOD is oxidised, being located in the active site channel adjacent to the catalytically important Arg143. This is the probable route of diffusion from the active site following reoxidation of the copper. In this position, the carbonate is poised for re-entry into the active site and binding to the reduced copper. PMID:22984565

Top