Sample records for active site position

  1. Distribution and abundance of host-seeking Culex species at three proximate locations with different levels of West Nile virus activity

    USGS Publications Warehouse

    Rochlin, I.; Ginsberg, H.S.; Campbell, S.R.

    2009-01-01

    Culex species were monitored at three proximate sites with historically different West Nile virus (WNV) activities. The site with human WNV transmission (epidemic) had the lowest abundance of the putative bridge vectors, Culex pipiens and Cx. salinarius. The site with horse cases but not human cases (epizootic) had the highest percent composition of Cx. salinarius, whereas the site with WNV-positive birds only (enzootic) had the highest Cx. pipiens abundance and percent composition. A total of 29 WNV-positive Culex pools were collected at the enzootic site, 17 at the epidemic site, and 14 at the epizootic site. Published models of human risk using Cx. pipiens and Cx. salinarius as the primary bridge vectors did not explain WNV activity at our sites. Other variables, such as additional vector species, environmental components, and socioeconomic factors, need to be examined to explain the observed patterns of WNV epidemic activity.

  2. A Variable Active Site Residue Influences the Kinetics of Response Regulator Phosphorylation and Dephosphorylation.

    PubMed

    Immormino, Robert M; Silversmith, Ruth E; Bourret, Robert B

    2016-10-04

    Two-component regulatory systems, minimally composed of a sensor kinase and a response regulator protein, are common mediators of signal transduction in microorganisms. All response regulators contain a receiver domain with conserved active site residues that catalyze the signal activating and deactivating phosphorylation and dephosphorylation reactions. We explored the impact of variable active site position T+1 (one residue C-terminal to the conserved Thr/Ser) on reaction kinetics and signaling fidelity, using wild type and mutant Escherichia coli CheY, CheB, and NarL to represent the three major sequence classes observed across response regulators: Ala/Gly, Ser/Thr, and Val/Ile/Met, respectively, at T+1. Biochemical and structural data together suggested that different amino acids at T+1 impacted reaction kinetics by altering access to the active site while not perturbing overall protein structure. A given amino acid at position T+1 had similar effects on autodephosphorylation in each protein background tested, likely by modulating access of the attacking water molecule to the active site. Similarly, rate constants for CheY autophosphorylation with three different small molecule phosphodonors were consistent with the steric constraints on access to the phosphorylation site arising from combination of specific phosphodonors with particular amino acids at T+1. Because other variable active site residues also influence response regulator phosphorylation biochemistry, we began to explore how context (here, the amino acid at T+2) affected the influence of position T+1 on CheY autocatalytic reactions. Finally, position T+1 affected the fidelity and kinetics of phosphotransfer between sensor kinases and response regulators but was not a primary determinant of their interaction.

  3. Effects of protonation state of Asp181 and position of active site water molecules on the conformation of PTP1B.

    PubMed

    Ozcan, Ahmet; Olmez, Elif Ozkirimli; Alakent, Burak

    2013-05-01

    In protein tyrosine phosphatase 1B (PTP1B), the flexible WPD loop adopts a closed conformation (WPDclosed ) in the active state of PTP1B, bringing the catalytic Asp181 close to the active site pocket, while WPD loop is in an open conformation (WPDopen ) in the inactive state. Previous studies showed that Asp181 may be protonated at physiological pH, and ordered water molecules exist in the active site. In the current study, molecular dynamics simulations are employed at different Asp181 protonation states and initial positions of active site water molecules, and compared with the existing crystallographic data of PTP1B. In WPDclosed conformation, the active site is found to maintain its conformation only in the protonated state of Asp181 in both free and liganded states, while Asp181 is likely to be deprotonated in WPDopen conformation. When the active site water molecule network that is a part of the free WPDclosed crystal structure is disrupted, intermediate WPD loop conformations, similar to that in the PTPRR crystal structure, are sampled in the MD simulations. In liganded PTP1B, one active site water molecule is found to be important for facilitating the orientation of Cys215 and the phosphate ion, thus may play a role in the reaction. In conclusion, conformational stability of WPD loop, and possibly catalytic activity of PTP1B, is significantly affected by the protonation state of Asp181 and position of active site water molecules, showing that these aspects should be taken into consideration both in MD simulations and inhibitor design. Copyright © 2013 Wiley Periodicals, Inc.

  4. Crystallographic Analysis of Active Site Contributions to Regiospecificity in the Diiron Enzyme Toluene 4-Monooxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bailey, Lucas J.; Acheson, Justin F.; McCoy, Jason G.

    Crystal structures of toluene 4-monooxygenase hydroxylase in complex with reaction products and effector protein reveal active site interactions leading to regiospecificity. Complexes with phenolic products yield an asymmetric {mu}-phenoxo-bridged diiron center and a shift of diiron ligand E231 into a hydrogen bonding position with conserved T201. In contrast, complexes with inhibitors p-NH{sub 2}-benzoate and p-Br-benzoate showed a {mu}-1,1 coordination of carboxylate oxygen between the iron atoms and only a partial shift in the position of E231. Among active site residues, F176 trapped the aromatic ring of products against a surface of the active site cavity formed by G103, E104 andmore » A107, while F196 positioned the aromatic ring against this surface via a {pi}-stacking interaction. The proximity of G103 and F176 to the para substituent of the substrate aromatic ring and the structure of G103L T4moHD suggest how changes in regiospecificity arise from mutations at G103. Although effector protein binding produced significant shifts in the positions of residues along the outer portion of the active site (T201, N202, and Q228) and in some iron ligands (E231 and E197), surprisingly minor shifts (<1 {angstrom}) were produced in F176, F196, and other interior residues of the active site. Likewise, products bound to the diiron center in either the presence or absence of effector protein did not significantly shift the position of the interior residues, suggesting that positioning of the cognate substrates will not be strongly influenced by effector protein binding. Thus, changes in product distributions in the absence of the effector protein are proposed to arise from differences in rates of chemical steps of the reaction relative to motion of substrates within the active site channel of the uncomplexed, less efficient enzyme, while structural changes in diiron ligand geometry associated with cycling between diferrous and diferric states are discussed for their potential contribution to product release.« less

  5. TALE activators regulate gene expression in a position- and strand-dependent manner in mammalian cells.

    PubMed

    Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao

    2014-01-24

    Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Water molecules in the nucleotide binding cleft of actin: effects on subunit conformation and implications for ATP hydrolysis.

    PubMed

    Saunders, Marissa G; Voth, Gregory A

    2011-10-14

    In the monomeric actin crystal structure, the positions of a highly organized network of waters are clearly visible within the active site. However, the recently proposed models of filamentous actin (F-actin) did not extend to including these waters. Since the water network is important for ATP hydrolysis, information about water position is critical to understanding the increased rate of catalysis upon filament formation. Here, we show that waters in the active site are essential for intersubdomain rotational flexibility and that they organize the active-site structure. Including the crystal structure waters during simulation setup allows us to observe distinct changes in the active-site structure upon the flattening of the actin subunit, as proposed in the Oda model for F-actin. We identify changes in both protein position and water position relative to the phosphate tail that suggest a mechanism for accelerating the rate of nucleotide hydrolysis in F-actin by stabilizing charge on the β-phosphate and by facilitating deprotonation of catalytic water. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Analysis of the plasticity of location of the Arg244 positive charge within the active site of the TEM-1 β-lactamase

    PubMed Central

    Marciano, David C; Brown, Nicholas G; Palzkill, Timothy

    2009-01-01

    A large number of β-lactamases have emerged that are capable of conferring bacterial resistance to β-lactam antibiotics. Comparison of the structural and functional features of this family has refined understanding of the catalytic properties of these enzymes. An arginine residue present at position 244 in TEM-1 β-lactamase interacts with the carboxyl group common to penicillin and cephalosporin antibiotics and thereby stabilizes both the substrate and transition state complexes. A comparison of class A β-lactamase sequences reveals that arginine at position 244 is not conserved, although a positive charge at this structural location is conserved and is provided by an arginine at positions 220 or 276 for those enzymes lacking arginine at position 244. The plasticity of the location of positive charge in the β-lactamase active site was experimentally investigated by relocating the arginine at position 244 in TEM-1 β-lactamase to positions 220, 272, and 276 by site-directed mutagenesis. Kinetic analysis of the engineered β-lactamases revealed that removal of arginine 244 by alanine mutation reduced catalytic efficiency against all substrates tested and restoration of an arginine at positions 272 or 276 partially suppresses the catalytic defect of the Arg244Ala substitution. These results suggest an evolutionary mechanism for the observed divergence of the position of positive charge in the active site of class A β-lactamases. PMID:19672877

  8. Virtual screening of selective inhibitors of phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis

    NASA Astrophysics Data System (ADS)

    Podshivalov, D. D.; Timofeev, V. I.; Sidorov-Biryukov, D. D.; Kuranova, I. P.

    2017-05-01

    Bacterial phosphopantetheine adenylyltransferase from Mycobacterium tuberculosis (PPAT Mt) is a convenient target protein for the directed search for selective inhibitors as potent antituberculosis drugs. Four compounds suitable for the detailed investigation of their interactions with PPAT Mt were found by virtual screening. The active-site region of the enzyme was chosen as the ligand-binding site. The positions of the ligands found by the docking were refined by molecular dynamics simulation. The nearest environment of the ligands, the positions of which in the active site of the enzyme were found in a computational experiment, was analyzed. The compounds under consideration were shown to directly interact with functionally important active-site amino-acid residues and block access of substrates to the active site. Therefore, these compounds can be used for the design of selective inhibitors of PPAT Mt as potent antituberculosis drugs.

  9. Structure of a Berberine Bridge Enzyme-Like Enzyme with an Active Site Specific to the Plant Family Brassicaceae.

    PubMed

    Daniel, Bastian; Wallner, Silvia; Steiner, Barbara; Oberdorfer, Gustav; Kumar, Prashant; van der Graaff, Eric; Roitsch, Thomas; Sensen, Christoph W; Gruber, Karl; Macheroux, Peter

    2016-01-01

    Berberine bridge enzyme-like (BBE-like) proteins form a multigene family (pfam 08031), which is present in plants, fungi and bacteria. They adopt the vanillyl alcohol-oxidase fold and predominantly show bi-covalent tethering of the FAD cofactor to a cysteine and histidine residue, respectively. The Arabidopsis thaliana genome was recently shown to contain genes coding for 28 BBE-like proteins, while featuring four distinct active site compositions. We determined the structure of a member of the AtBBE-like protein family (termed AtBBE-like 28), which has an active site composition that has not been structurally and biochemically characterized thus far. The most salient and distinguishing features of the active site found in AtBBE-like 28 are a mono-covalent linkage of a histidine to the 8α-position of the flavin-isoalloxazine ring and the lack of a second covalent linkage to the 6-position, owing to the replacement of a cysteine with a histidine. In addition, the structure reveals the interaction of a glutamic acid (Glu426) with an aspartic acid (Asp369) at the active site, which appear to share a proton. This arrangement leads to the delocalization of a negative charge at the active site that may be exploited for catalysis. The structure also indicates a shift of the position of the isoalloxazine ring in comparison to other members of the BBE-like family. The dioxygen surrogate chloride was found near the C(4a) position of the isoalloxazine ring in the oxygen pocket, pointing to a rapid reoxidation of reduced enzyme by dioxygen. A T-DNA insertional mutant line for AtBBE-like 28 results in a phenotype, that is characterized by reduced biomass and lower salt stress tolerance. Multiple sequence analysis showed that the active site composition found in AtBBE-like 28 is only present in the Brassicaceae, suggesting that it plays a specific role in the metabolism of this plant family.

  10. Control site location and transcriptional regulation in Escherichia coli.

    PubMed Central

    Collado-Vides, J; Magasanik, B; Gralla, J D

    1991-01-01

    The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993

  11. Deep Sequencing of Random Mutant Libraries Reveals the Active Site of the Narrow Specificity CphA Metallo-β-Lactamase is Fragile to Mutations.

    PubMed

    Sun, Zhizeng; Mehta, Shrenik C; Adamski, Carolyn J; Gibbs, Richard A; Palzkill, Timothy

    2016-09-12

    CphA is a Zn(2+)-dependent metallo-β-lactamase that efficiently hydrolyzes only carbapenem antibiotics. To understand the sequence requirements for CphA function, single codon random mutant libraries were constructed for residues in and near the active site and mutants were selected for E. coli growth on increasing concentrations of imipenem, a carbapenem antibiotic. At high concentrations of imipenem that select for phenotypically wild-type mutants, the active-site residues exhibit stringent sequence requirements in that nearly all residues in positions that contact zinc, the substrate, or the catalytic water do not tolerate amino acid substitutions. In addition, at high imipenem concentrations a number of residues that do not directly contact zinc or substrate are also essential and do not tolerate substitutions. Biochemical analysis confirmed that amino acid substitutions at essential positions decreased the stability or catalytic activity of the CphA enzyme. Therefore, the CphA active - site is fragile to substitutions, suggesting active-site residues are optimized for imipenem hydrolysis. These results also suggest that resistance to inhibitors targeted to the CphA active site would be slow to develop because of the strong sequence constraints on function.

  12. Active Site Hydrophobicity and the Convergent Evolution of Paraoxonase Activity in Structurally Divergent Enzymes: The Case of Serum Paraoxonase 1

    PubMed Central

    2016-01-01

    Serum paraoxonase 1 (PON1) is a native lactonase capable of promiscuously hydrolyzing a broad range of substrates, including organophosphates, esters, and carbonates. Structurally, PON1 is a six-bladed β-propeller with a flexible loop (residues 70–81) covering the active site. This loop contains a functionally critical Tyr at position 71. We have performed detailed experimental and computational analyses of the role of selected Y71 variants in the active site stability and catalytic activity in order to probe the role of Y71 in PON1’s lactonase and organophosphatase activities. We demonstrate that the impact of Y71 substitutions on PON1’s lactonase activity is minimal, whereas the kcat for the paraoxonase activity is negatively perturbed by up to 100-fold, suggesting greater mutational robustness of the native activity. Additionally, while these substitutions modulate PON1’s active site shape, volume, and loop flexibility, their largest effect is in altering the solvent accessibility of the active site by expanding the active site volume, allowing additional water molecules to enter. This effect is markedly more pronounced in the organophosphatase activity than the lactonase activity. Finally, a detailed comparison of PON1 to other organophosphatases demonstrates that either a similar “gating loop” or a highly buried solvent-excluding active site is a common feature of these enzymes. We therefore posit that modulating the active site hydrophobicity is a key element in facilitating the evolution of organophosphatase activity. This provides a concrete feature that can be utilized in the rational design of next-generation organophosphate hydrolases that are capable of selecting a specific reaction from a pool of viable substrates. PMID:28026940

  13. Active Site Hydrophobicity and the Convergent Evolution of Paraoxonase Activity in Structurally Divergent Enzymes: The Case of Serum Paraoxonase 1.

    PubMed

    Blaha-Nelson, David; Krüger, Dennis M; Szeler, Klaudia; Ben-David, Moshe; Kamerlin, Shina Caroline Lynn

    2017-01-25

    Serum paraoxonase 1 (PON1) is a native lactonase capable of promiscuously hydrolyzing a broad range of substrates, including organophosphates, esters, and carbonates. Structurally, PON1 is a six-bladed β-propeller with a flexible loop (residues 70-81) covering the active site. This loop contains a functionally critical Tyr at position 71. We have performed detailed experimental and computational analyses of the role of selected Y71 variants in the active site stability and catalytic activity in order to probe the role of Y71 in PON1's lactonase and organophosphatase activities. We demonstrate that the impact of Y71 substitutions on PON1's lactonase activity is minimal, whereas the k cat for the paraoxonase activity is negatively perturbed by up to 100-fold, suggesting greater mutational robustness of the native activity. Additionally, while these substitutions modulate PON1's active site shape, volume, and loop flexibility, their largest effect is in altering the solvent accessibility of the active site by expanding the active site volume, allowing additional water molecules to enter. This effect is markedly more pronounced in the organophosphatase activity than the lactonase activity. Finally, a detailed comparison of PON1 to other organophosphatases demonstrates that either a similar "gating loop" or a highly buried solvent-excluding active site is a common feature of these enzymes. We therefore posit that modulating the active site hydrophobicity is a key element in facilitating the evolution of organophosphatase activity. This provides a concrete feature that can be utilized in the rational design of next-generation organophosphate hydrolases that are capable of selecting a specific reaction from a pool of viable substrates.

  14. The role of an active site Mg(2+) in HDV ribozyme self-cleavage: insights from QM/MM calculations.

    PubMed

    Mlýnský, Vojtěch; Walter, Nils G; Šponer, Jiří; Otyepka, Michal; Banáš, Pavel

    2015-01-07

    The hepatitis delta virus (HDV) ribozyme is a catalytic RNA motif embedded in the human pathogenic HDV RNA. It catalyzes self-cleavage of its sugar-phosphate backbone with direct participation of the active site cytosine C75. Biochemical and structural data support a general acid role of C75. Here, we used hybrid quantum mechanical/molecular mechanical (QM/MM) calculations to probe the reaction mechanism and changes in Gibbs energy along the ribozyme's reaction pathway with an N3-protonated C75H(+) in the active site, which acts as the general acid, and a partially hydrated Mg(2+) ion with one deprotonated, inner-shell coordinated water molecule that acts as the general base. We followed eight reaction paths with a distinct position and coordination of the catalytically important active site Mg(2+) ion. For six of them, we observed feasible activation barriers ranging from 14.2 to 21.9 kcal mol(-1), indicating that the specific position of the Mg(2+) ion in the active site is predicted to strongly affect the kinetics of self-cleavage. The deprotonation of the U-1(2'-OH) nucleophile and the nucleophilic attack of the resulting U-1(2'-O(-)) on the scissile phosphodiester are found to be separate steps, as deprotonation precedes the nucleophilic attack. This sequential mechanism of the HDV ribozyme differs from the concerted nucleophilic activation and attack suggested for the hairpin ribozyme. We estimate the pKa of the U-1(2'-OH) group to range from 8.8 to 11.2, suggesting that it is lowered by several units from that of a free ribose, comparable to and most likely smaller than the pKa of the solvated active site Mg(2+) ion. Our results thus support the notion that the structure of the HDV ribozyme, and particularly the positioning of the active site Mg(2+) ion, facilitate deprotonation and activation of the 2'-OH nucleophile.

  15. Roles of s3 site residues of nattokinase on its activity and substrate specificity.

    PubMed

    Wu, Shuming; Feng, Chi; Zhong, Jin; Huan, Liandong

    2007-09-01

    Nattokinase (Subtilisin NAT, NK) is a bacterial serine protease with high fibrinolytic activity. To probe their roles on protease activity and substrate specificity, three residues of S3 site (Gly(100), Ser(101) and Leu(126)) were mutated by site-directed mutagenesis. Kinetics parameters of 20 mutants were measured using tetrapeptides as substrates, and their fibrinolytic activities were determined by fibrin plate method. Results of mutation analysis showed that Gly(100) and Ser(101) had reverse steric and electrostatic effects. Residues with bulky or positively charged side chains at position 100 decreased the substrate binding and catalytic activity drastically, while residues with the same characters at position 101 could obviously enhance protease and fibrinolytic activity of NK. Mutation of Leu(126) might impair the structure of the active cleft and drastically decreased the activity of NK. Kinetics studies of the mutants showed that S3 residues were crucial to keep protease activity while they moderately affected substrate specificity of NK. The present study provided some original insight into the P3-S3 interaction in NK and other subtilisins, as well as showed successful protein engineering cases to improve NK as a potential therapeutic agent.

  16. Determination of the protease cleavage site repertoire—The RNase H but not the RT domain is essential for foamy viral protease activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spannaus, Ralf; Bodem, Jochen, E-mail: Jochen.Bodem@vim.uni-wuerzburg.de

    2014-04-15

    In contrast to orthoretroviruses, the foamy virus protease is only active as a protease-reverse transcriptase fusion protein and requires viral RNA for activation. Maturation of foamy viral proteins seems to be restricted to a single cleavage site in Gag and Pol. We provide evidence that unprocessed Gag is required for optimal infectivity, which is unique among retroviruses. Analyses of the cleavage site sequences of the Gag and Pol cleavage sites revealed a high similarity compared to those of Lentiviruses. We show that positions P2' and P2 are invariant and that Gag and Pol cleavage sites are processed with similar efficiencies.more » The RNase H domain is essential for protease activity, but can functionally be substituted by RNase H domains of other retroviruses. Thus, the RNase H domain might be involved in the stabilization of the protease dimer, while the RT domain is essential for RNA dependent protease activation. - Highlights: • Unprocessed Gag is required for optimal infectivity of foamy viruses. • Positions P2 and P2' are invariant in the foamy viral cleavage sites. • The RNaseH domain is essential for protease activity. • The RNaseH domains of other retroviruses support foamy viral protease activity.« less

  17. The Structure-Activity Relationship of the 3-Oxy Site in the Anticonvulsant (R)-N-Benzyl 2-Acetamido-3-methoxypropionamide

    PubMed Central

    Morieux, Pierre; Salomé, Christophe; Park, Ki Duk; Stables, James P.; Kohn, Harold

    2010-01-01

    Lacosamide ((R)-N-benzyl 2-acetamido-3-methoxypropionamide, (R)-1) is a low molecular weight anticonvulsant recently introduced in the United States and Europe for adjuvant treatment of partial-onset seizures in adults. In this study, we define the structure-activity relationship (SAR) for the compound's 3-oxy site. Placement of small non-polar, non-bulky substituents at the 3-oxy site provided compounds with pronounced seizure protection in the maximal electroshock (MES) seizure test with activities similar to (R)-1. The anticonvulsant activity loss that accompanied introduction of larger moieties at the 3-oxy site in (R)-1 was offset, in part, by including unsaturated groups at this position. Our findings were similar to a recently reported SAR study of the 4′-benzylamide site in (R)-1 (J. Med. Chem.2010, 53, 1288–1305). Together, these results indicate that both the 3-oxy and 4′-benzylamide positions in (R)-1 can accommodate non-bulky, hydrophobic groups and still retain pronounced anticonvulsant activities in rodents in the MES seizure model. PMID:20614888

  18. [Adenylate cyclase from rabbit heart: substrate binding site].

    PubMed

    Perfil'eva, E A; Khropov, Iu V; Khachatrian, L; Bulargina, T V; Baranova, L A

    1981-08-01

    The effects of 17 ATP analogs on the solubilized rabbit heart adenylate cyclase were studied. The triphosphate chain, position 8 of the adenine base and the ribose residue of the ATP molecule were modified. Despite the presence of the alkylating groups in two former types of the analogs tested, no covalent blocking of the active site of the enzyme was observed. Most of the compounds appeared to be competitive reversible inhibitors. The kinetic data confirmed the importance of the triphosphate chain for substrate binding in the active site of adenylate cyclase. (Formula: See Text) The inhibitors with different substituents in position 8 of the adenine base had a low affinity for the enzyme. The possible orientation of the triphosphate chain and the advantages of anti-conformation of the ATP molecule for their binding in the active site of adenylate cyclase are discussed.

  19. Crystallographic snapshots of active site metal shift in E. coli fructose 1,6-bisphosphate aldolase.

    PubMed

    Tran, Huyen-Thi; Lee, Seon-Hwa; Ho, Thien-Hoang; Hong, Seung-Hye; Huynh, Kim-Hung; Ahn, Yeh-Jin; Oh, Deok-Kun; Kang, Lin-Woo

    2016-12-01

    Fructose 1,6-bisphosphate aldolase (FBA) is important for both glycolysis and gluconeogenesis in life. Class II (zinc dependent) FBA is an attractive target for the development of antibiotics against protozoa, bacteria, and fungi, and is also widely used to produce various high-value stereoisomers in the chemical and pharmaceutical industry. In this study, the crystal structures of class II Escherichia coli FBA (EcFBA) were determined from four different crystals, with resolutions between 1.8 Å and 2.0 Å. Native EcFBA structures showed two separate sites of Zn1 (interior position) and Zn2 (active site surface position) for Zn2+ ion. Citrate and TRIS bound EcFBA structures showed Zn2+ position exclusively at Zn2. Crystallographic snapshots of EcFBA structures with and without ligand binding proposed the rationale of metal shift at the active site, which might be a hidden mechanism to keep the trace metal cofactor Zn2+ within EcFBA without losing it. [BMB Reports 2016; 49(12): 681-686].

  20. Foldit Biology

    DTIC Science & Technology

    2015-07-31

    vicinity of the enzyme , searching for the active site; (iii) find the active site and position the substrate at it, triggering the catalysis . As the...visualization options. The Lysozyme example is used to introduce the concepts of how enzymes work, and use a view option to visualize the surface of the... enzyme , its active site and its substrate. It is also in this example that we introduce the Foldit Biology notion of a ‘protein state’. Each protein

  1. Structural Analysis of Charge Discrimination in the Binding of Inhibitors to Human Carbonic Anhydrases I and II

    PubMed Central

    Srivastava, D. K.; Jude, Kevin M.; Banerjee, Abir L.; Haldar, Manas; Manokaran, Sumathra; Kooren, Joel; Mallik, Sanku; Christianson, David W.

    2008-01-01

    Despite the similarity in the active site pockets of carbonic anhydrase (CA) isozymes I and II, the binding affinities of benzenesulfonamide inhibitors are invariably higher with CA II as compared to CA I. To explore the structural basis of this molecular recognition phenomenon, we have designed and synthesized simple benzenesulfonamide inhibitors substituted at the para position with positively-charged, negatively-charged, and neutral functional groups, and we have determined the affinities and X-ray crystal structures of their enzyme complexes. The para-substituents are designed to bind in the midsection of the 15 Å deep active site cleft, where interactions with enzyme residues and solvent molecules are possible. We find that a para-substituted positively-charged amino group is more poorly tolerated in the active site of CA I compared with CA II. In contrast, a para-substituted negatively-charged carboxylate substituent is tolerated equally well in the active sites of both CA isozymes. Notably, enzyme-inhibitor affinity increases upon neutralization of inhibitor charged groups by amidation or esterification. These results inform the design of short molecular linkers connecting the benzenesulfonamide group and a para-substituted tail group in “two-prong” CA inhibitors: an optimal linker segment will be electronically neutral, yet capable of engaging in at least some hydrogen bond interactions with protein residues and/or solvent. Microcalorimetric data reveal that inhibitor binding to CA I is enthalpically less favorable and entropically more favorable than inhibitor binding to CA II. This contrasting behavior may arise in part from differences in active site desolvation and the conformational entropy of inhibitor binding to each isozyme active site. PMID:17407288

  2. Probing the origins of catalytic discrimination between phosphate and sulfate monoester hydrolysis: comparative analysis of alkaline phosphatase and protein tyrosine phosphatases.

    PubMed

    Andrews, Logan D; Zalatan, Jesse G; Herschlag, Daniel

    2014-11-04

    Catalytic promiscuity, the ability of enzymes to catalyze multiple reactions, provides an opportunity to gain a deeper understanding of the origins of catalysis and substrate specificity. Alkaline phosphatase (AP) catalyzes both phosphate and sulfate monoester hydrolysis reactions with a ∼10(10)-fold preference for phosphate monoester hydrolysis, despite the similarity between these reactions. The preponderance of formal positive charge in the AP active site, particularly from three divalent metal ions, was proposed to be responsible for this preference by providing stronger electrostatic interactions with the more negatively charged phosphoryl group versus the sulfuryl group. To test whether positively charged metal ions are required to achieve a high preference for the phosphate monoester hydrolysis reaction, the catalytic preference of three protein tyrosine phosphatases (PTPs), which do not contain metal ions, were measured. Their preferences ranged from 5 × 10(6) to 7 × 10(7), lower than that for AP but still substantial, indicating that metal ions and a high preponderance of formal positive charge within the active site are not required to achieve a strong catalytic preference for phosphate monoester over sulfate monoester hydrolysis. The observed ionic strength dependences of kcat/KM values for phosphate and sulfate monoester hydrolysis are steeper for the more highly charged phosphate ester with both AP and the PTP Stp1, following the dependence expected based on the charge difference of these two substrates. However, the dependences for AP were not greater than those of Stp1 and were rather shallow for both enzymes. These results suggest that overall electrostatics from formal positive charge within the active site is not the major driving force in distinguishing between these reactions and that substantial discrimination can be attained without metal ions. Thus, local properties of the active site, presumably including multiple positioned dipolar hydrogen bond donors within the active site, dominate in defining this reaction specificity.

  3. Curiosity Rover Self Portrait at John Klein Drilling Site

    NASA Image and Video Library

    2013-02-07

    The rover is positioned at a patch of flat outcrop called John Klein, which was selected as the site for the first rock-drilling activities by NASA Curiosity. This self-portrait was acquired to document the drilling site.

  4. STABLE NITROGEN ISOTOPES AS INDICATORS OF ANTHOPOGENIC ACTIVITIES IN SMALL FRESHWATER SYSTEMS

    EPA Science Inventory

    Stable nitrogen isotope ratios ( 15N) were measured in fish, mussel, and sediment samples taken from 17 small freshwater sites to examine food chain length and trophic position across sites affected by differing levels of anthropogenic activity. Both shoreline development and fis...

  5. The activation of the [NiFe]-hydrogenase from Allochromatium vinosum. An infrared spectro-electrochemical study.

    PubMed

    Bleijlevens, Boris; van Broekhuizen, Fleur A; De Lacey, Antonio L; Roseboom, Winfried; Fernandez, Victor M; Albracht, Simon P J

    2004-09-01

    The membrane-bound [NiFe]-hydrogenase from Allochromatium vinosum can occur in several inactive or active states. This study presents the first systematic infrared characterisation of the A. vinosum enzyme, with emphasis on the spectro-electrochemical properties of the inactive/active transition. This transition involves an energy barrier, which can be overcome at elevated temperatures. The reduced Ready enzyme can exist in two different inactive states, which are in an apparent acid-base equilibrium. It is proposed that a hydroxyl ligand in a bridging position in the Ni-Fe site is protonated and that the formed water molecule is subsequently removed. This enables the active site to bind hydrogen in a bridging position, allowing the formation of the fully active state of the enzyme. It is further shown that the active site in enzyme reduced by 1 bar H(2) can occur in three different electron paramagnetic resonance (EPR)-silent states with a different degree of protonation.

  6. Relocating the Active-Site Lysine in Rhodopsin: 2. Evolutionary Intermediates.

    PubMed

    Devine, Erin L; Theobald, Douglas L; Oprian, Daniel D

    2016-08-30

    The visual pigment rhodopsin is a G protein-coupled receptor that covalently binds its retinal chromophore via a Schiff base linkage to an active-site Lys residue in the seventh transmembrane helix. Although this residue is strictly conserved among all type II retinylidene proteins, we found previously that the active-site Lys in bovine rhodopsin (Lys296) can be moved to three other locations (G90K, T94K, S186K) while retaining the ability to form a pigment with retinal and to activate transducin in a light-dependent manner [ Devine et al. ( 2013 ) Proc. Natl. Acad. Sci. USA 110 , 13351 - 13355 ]. Because the active-site Lys is not functionally constrained to be in helix seven, it is possible that it could relocate within the protein, most likely via an evolutionary intermediate with two active-site Lys. Therefore, in this study we characterized potential evolutionary intermediates with two Lys in the active site. Four mutant rhodopsins were prepared in which the original Lys296 was left untouched and a second Lys residue was substituted for G90K, T94K, S186K, or F293K. All four constructs covalently bind 11-cis-retinal, form a pigment, and activate transducin in a light-dependent manner. These results demonstrate that rhodopsin can tolerate a second Lys in the retinal binding pocket and suggest that an evolutionary intermediate with two Lys could allow migration of the Schiff base Lys to a position other than the observed, highly conserved location in the seventh TM helix. From sequence-based searches, we identified two groups of natural opsins, insect UV cones and neuropsins, that contain Lys residues at two positions in their active sites and also have intriguing spectral similarities to the mutant rhodopsins studied here.

  7. Revealing the role of the product metal in DNA polymerase β catalysis

    PubMed Central

    Freudenthal, Bret D.; Beard, William A.; Pedersen, Lee G.; Wilson, Samuel H.

    2017-01-01

    Abstract DNA polymerases catalyze a metal-dependent nucleotidyl transferase reaction during extension of a DNA strand using the complementary strand as a template. The reaction has long been considered to require two magnesium ions. Recently, a third active site magnesium ion was identified in some DNA polymerase product crystallographic structures, but its role is not known. Using quantum mechanical/ molecular mechanical calculations of polymerase β, we find that a third magnesium ion positioned near the newly identified product metal site does not alter the activation barrier for the chemical reaction indicating that it does not have a role in the forward reaction. This is consistent with time-lapse crystallographic structures following insertion of Sp-dCTPαS. Although sulfur substitution deters product metal binding, this has only a minimal effect on the rate of the forward reaction. Surprisingly, monovalent sodium or ammonium ions, positioned in the product metal site, lowered the activation barrier. These calculations highlight the impact that an active site water network can have on the energetics of the forward reaction and how metals or enzyme side chains may interact with the network to modulate the reaction barrier. These results also are discussed in the context of earlier findings indicating that magnesium at the product metal position blocks the reverse pyrophosphorolysis reaction. PMID:28108654

  8. Multiple nucleotide preferences determine cleavage-site recognition by the HIV-1 and M-MuLV RNases H.

    PubMed

    Schultz, Sharon J; Zhang, Miaohua; Champoux, James J

    2010-03-19

    The RNase H activity of reverse transcriptase is required during retroviral replication and represents a potential target in antiviral drug therapies. Sequence features flanking a cleavage site influence the three types of retroviral RNase H activity: internal, DNA 3'-end-directed, and RNA 5'-end-directed. Using the reverse transcriptases of HIV-1 (human immunodeficiency virus type 1) and Moloney murine leukemia virus (M-MuLV), we evaluated how individual base preferences at a cleavage site direct retroviral RNase H specificity. Strong test cleavage sites (designated as between nucleotide positions -1 and +1) for the HIV-1 and M-MuLV enzymes were introduced into model hybrid substrates designed to assay internal or DNA 3'-end-directed cleavage, and base substitutions were tested at specific nucleotide positions. For internal cleavage, positions +1, -2, -4, -5, -10, and -14 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV significantly affected RNase H cleavage efficiency, while positions -7 and -12 for HIV-1 and positions -4, -9, and -11 for M-MuLV had more modest effects. DNA 3'-end-directed cleavage was influenced substantially by positions +1, -2, -4, and -5 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV. Cleavage-site distance from the recessed end did not affect sequence preferences for M-MuLV reverse transcriptase. Based on the identified sequence preferences, a cleavage site recognized by both HIV-1 and M-MuLV enzymes was introduced into a sequence that was otherwise resistant to RNase H. The isolated RNase H domain of M-MuLV reverse transcriptase retained sequence preferences at positions +1 and -2 despite prolific cleavage in the absence of the polymerase domain. The sequence preferences of retroviral RNase H likely reflect structural features in the substrate that favor cleavage and represent a novel specificity determinant to consider in drug design. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  9. QSAR and molecular graphics analysis of N2-phenylguanines as inhibitors of herpes simplex virus thymidine kinases.

    PubMed

    Gaudio, A C; Richards, W G; Takahata, Y

    2000-02-01

    A quantitative structure-activity relationship study of N2-(substituted)-phenylguanines (PHG) as inhibitors of herpes simplex virus thymidine kinase (HSV TK) was performed. The activity of a set of PHG derivatives were analyzed against the thymidine kinase of herpes simplex virus types 1 (HSV1 TK) and 2 (HSV2 TK). Classic and calculated physicochemical parameters were included in the analysis. The results showed that there is an important difference in the activity of the meta substituted PHG derivatives against HSV1 TK and HSV2 TK. The activity of the meta derivatives against HSV2 TK is influenced by a steric effect, which is not observed against HSV1 TK. The superposition of the three-dimensional structures of the active sites of HSV1 TK (crystal structure) and HSV2 TK (homology model) revealed that the amino acid Ile97 is located near the meta position in the HSV1 TK active site, whereas the amino acid Leu97 is located near the meta position in the HSV2 TK active site. This single difference in the active sites of both enzymes can explain the source of the steric effect and serves as an indication that our previously proposed binding mode for the PHG derivatives is plausible. However, another observed mutation in the active site region, Ala168 by Ser168, suggests that an alternative binding mode, similar to that of ganciclovir, could be possible.

  10. Prediction of active sites of enzymes by maximum relevance minimum redundancy (mRMR) feature selection.

    PubMed

    Gao, Yu-Fei; Li, Bi-Qing; Cai, Yu-Dong; Feng, Kai-Yan; Li, Zhan-Dong; Jiang, Yang

    2013-01-27

    Identification of catalytic residues plays a key role in understanding how enzymes work. Although numerous computational methods have been developed to predict catalytic residues and active sites, the prediction accuracy remains relatively low with high false positives. In this work, we developed a novel predictor based on the Random Forest algorithm (RF) aided by the maximum relevance minimum redundancy (mRMR) method and incremental feature selection (IFS). We incorporated features of physicochemical/biochemical properties, sequence conservation, residual disorder, secondary structure and solvent accessibility to predict active sites of enzymes and achieved an overall accuracy of 0.885687 and MCC of 0.689226 on an independent test dataset. Feature analysis showed that every category of the features except disorder contributed to the identification of active sites. It was also shown via the site-specific feature analysis that the features derived from the active site itself contributed most to the active site determination. Our prediction method may become a useful tool for identifying the active sites and the key features identified by the paper may provide valuable insights into the mechanism of catalysis.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Daniel P.; Tymińska, Nina; Zurek, Eva, E-mail: ezurek@buffalo.edu

    Dispersion corrected Density Functional Theory calculations were employed to study the adsorption of benzenes derivatized with functional groups encompassing a large region of the activated/deactivated spectrum to the Ag(111) surface. Benzenes substituted with weak activating or deactivating groups, such as methyl and fluoro, do not have a strong preference for adsorbing to a particular site on the substrate, with the corrugations in the potential energy surface being similar to those of benzene. Strong activating (N(CH{sub 3}){sub 2}) and deactivating (NO{sub 2}) groups, on the other hand, possess a distinct site preference. The nitrogen in the former prefers to lie abovemore » a silver atom (top site), but in the latter a hollow hexagonal-closed-packed (H{sub hcp}) site of the Ag(111) surface is favored instead. Benzenes derivatized with classic activating groups donate electron density from their highest occupied molecular orbital to the surface, and those functionalized with deactivating groups withdraw electron density from the surface into orbitals that are unoccupied in the gas phase. For benzenes functionalized with two substituents, the groups that are strongly activating or deactivating control the site preference and the other groups assume sites that are, to a large degree, dictated by their positions on the benzene ring. The relative stabilities of the ortho, meta, and para positional isomers of disubstituted benzenes can, in some cases, be modified by adsorption to the surface.« less

  12. Evaluating the Substrate Selectivity of Alkyladenine DNA Glycosylase: The Synergistic Interplay of Active Site Flexibility and Water Reorganization.

    PubMed

    Lenz, Stefan A P; Wetmore, Stacey D

    2016-02-09

    Human alkyladenine DNA glycosylase (AAG) functions as part of the base excision repair (BER) pathway by cleaving the N-glycosidic bond that connects nucleobases to the sugar-phosphate backbone in DNA. AAG targets a range of structurally diverse purine lesions using nonspecific DNA-protein π-π interactions. Nevertheless, the enzyme discriminates against the natural purines and is inhibited by pyrimidine lesions. This study uses molecular dynamics simulations and seven different neutral or charged substrates, inhibitors, or canonical purines to probe how the bound nucleotide affects the conformation of the AAG active site, and the role of active site residues in dictating substrate selectivity. The neutral substrates form a common DNA-protein hydrogen bond, which results in a consistent active site conformation that maximizes π-π interactions between the aromatic residues and the nucleobase required for catalysis. Nevertheless, subtle differences in DNA-enzyme contacts for different neutral substrates explain observed differential catalytic efficiencies. In contrast, the exocyclic amino groups of the natural purines clash with active site residues, which leads to catalytically incompetent DNA-enzyme complexes due to significant reorganization of active site water. Specifically, water resides between the A nucleobase and the active site aromatic amino acids required for catalysis, while a shift in the position of the general base (E125) repositions (potentially nucleophilic) water away from G. Despite sharing common amino groups, the methyl substituents in cationic purine lesions (3MeA and 7MeG) exhibit repulsion with active site residues, which repositions the damaged bases in the active site in a manner that promotes their excision. Overall, we provide a structural explanation for the diverse yet discriminatory substrate selectivity of AAG and rationalize key kinetic data available for the enzyme. Specifically, our results highlight the complex interplay of many different DNA-protein interactions used by AAG to facilitate BER, as well as the crucial role of the general base and water (nucleophile) positioning. The insights gained from our work will aid the understanding of the function of other enzymes that use flexible active sites to exhibit diverse substrate specificity.

  13. Language Mapping with Navigated Repetitive TMS: Proof of Technique and Validation

    PubMed Central

    Tarapore, Phiroz E.; Findlay, Anne M.; Honma, Susanne M.; Mizuiri, Danielle; Houde, John F.; Berger, Mitchel S.; Nagarajan, Srikantan S.

    2013-01-01

    Objective Lesion-based mapping of speech pathways has been possible only during invasive neurosurgical procedures using direct cortical stimulation (DCS). However, navigated transcranial magnetic stimulation (nTMS) may allow for lesion-based interrogation of language pathways noninvasively. Although not lesion-based, magnetoencephalographic imaging (MEGI) is another noninvasive modality for language mapping. In this study, we compare the accuracy of nTMS and MEGI with DCS. Methods Subjects with lesions around cortical language areas underwent preoperative nTMS and MEGI for language mapping. nTMS maps were generated using a repetitive TMS protocol to deliver trains of stimulations during a picture naming task. MEGI activation maps were derived from adaptive spatial filtering of beta-band power decreases prior to overt speech during picture naming and verb generation tasks. The subjects subsequently underwent awake language mapping via intraoperative DCS. The language maps obtained from each of the 3 modalities were recorded and compared. Results nTMS and MEGI were performed on 12 subjects. nTMS yielded 21 positive language disruption sites (11 speech arrest, 5 anomia, and 5 other) while DCS yielded 10 positive sites (2 speech arrest, 5 anomia, and 3 other). MEGI isolated 32 sites of peak activation with language tasks. Positive language sites were most commonly found in the pars opercularis for all three modalities. In 9 instances the positive DCS site corresponded to a positive nTMS site, while in 1 instance it did not. In 4 instances, a positive nTMS site corresponded to a negative DCS site, while 169 instances of negative nTMS and DCS were recorded. The sensitivity of nTMS was therefore 90%, specificity was 98%, the positive predictive value was 69% and the negative predictive value was 99% as compared with intraoperative DCS. MEGI language sites for verb generation and object naming correlated with nTMS sites in 5 subjects, and with DCS sites in 2 subjects. Conclusion Maps of language function generated with nTMS correlate well with those generated by DCS. Negative nTMS mapping also correlates with negative DCS mapping. In our study, MEGI lacks the same level of correlation with intraoperative mapping; nevertheless it provides useful adjunct information in some cases. nTMS may offer a lesion-based method for noninvasively interrogating language pathways and be valuable in managing patients with peri-eloquent lesions. PMID:23702420

  14. Identity, Postmodernity, and an Ethics of Activism.

    ERIC Educational Resources Information Center

    Chaput, Catherine

    2000-01-01

    Argues that Marxism is as much an ethical position that resists the foreclosure of identity as it is a political position. Claims a Marxist standpoint could facilitate the political and ethical accountability that the current politicized composition pedagogies seek while also constructing the classroom as a site for active participation in the…

  15. Conservative Tryptophan Mutants of the Protein Tyrosine Phosphatase YopH Exhibit Impaired WPD-Loop Function and Crystallize with Divanadate Esters in Their Active Sites

    PubMed Central

    Moise, Gwendolyn; Gallup, Nathan M.; Alexandrova, Anastassia N.; Hengge, Alvan C.; Johnson, Sean J.

    2016-01-01

    Catalysis in protein tyrosine phosphatases (PTPs) involves movement of a protein loop called the WPD loop that brings a conserved aspartic acid into the active site to function as a general acid. Mutation of the tryptophan in the WPD loop of the PTP YopH to any other residue with a planar, aromatic side chain (phenylalanine, tyrosine, or histidine) disables general acid catalysis. Crystal structures reveal these conservative mutations leave this critical loop in a catalytically unproductive, quasi-open position. Although the loop positions in crystal structures are similar for all three conservative mutants, the reasons inhibiting normal loop closure differ for each mutant. In the W354F and W354Y mutants, steric clashes result from six-membered rings occupying the position of the five-membered ring of the native indole side chain. The histidine mutant dysfunction results from new hydrogen bonds stabilizing the unproductive position. The results demonstrate how even modest modifications can disrupt catalytically important protein dynamics. Crystallization of all the catalytically compromised mutants in the presence of vanadate gave rise to vanadate dimers at the active site. In W354Y and W354H, a divanadate ester with glycerol is observed. Such species have precedence in solution and are known from the small molecule crystal database. Such species have not been observed in the active site of a phosphatase, as a functional phosphatase would rapidly catalyze their decomposition. The compromised functionality of the mutants allows the trapping of species that undoubtedly form in solution and are capable of binding at the active sites of PTPs, and, presumably, other phosphatases. In addition to monomeric vanadate, such higher-order vanadium-based molecules are likely involved in the interaction of vanadate with PTPs in solution. PMID:26445170

  16. Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection

    PubMed Central

    Fedrigo, Olivier; Babbitt, Courtney C.; Wortham, Matthew; Tewari, Alok K.; London, Darin; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Parker, Stephen C. J.; Margulies, Elliott H.; Wray, Gregory A.; Furey, Terrence S.; Crawford, Gregory E.

    2012-01-01

    Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS) sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species. PMID:22761590

  17. Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carra,J.; McHugh, C.; Mulligan, S.

    2007-01-01

    We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding tomore » a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.« less

  18. Mechanism of Intramembrane Cleavage of Alcadeins by γ-Secretase

    PubMed Central

    Piao, Yi; Kimura, Ayano; Urano, Satomi; Saito, Yuhki; Taru, Hidenori; Yamamoto, Tohru; Hata, Saori; Suzuki, Toshiharu

    2013-01-01

    Background Alcadein proteins (Alcs; Alcα, Alcβand Alcγ) are predominantly expressed in neurons, as is Alzheimer's β-amyloid (Aβ) precursor protein (APP). Both Alcs and APP are cleaved by primary α- or β-secretase to generate membrane-associated C-terminal fragments (CTFs). Alc CTFs are further cleaved by γ-secretase to secrete p3-Alc peptide along with the release of intracellular domain fragment (Alc ICD) from the membrane. In the case of APP, APP CTFβ is initially cleaved at the ε-site to release the intracellular domain fragment (AICD) and consequently the γ-site is determined, by which Aβ generates. The initial ε-site is thought to define the final γ-site position, which determines whether Aβ40/43 or Aβ42 is generated. However, initial intracellular ε-cleavage sites of Alc CTF to generate Alc ICD and the molecular mechanism that final γ-site position is determined remains unclear in Alcs. Methodology Using HEK293 cells expressing Alcs plus presenilin 1 (PS1, a catalytic unit of γ-secretase) and the membrane fractions of these cells, the generation of p3-Alc possessing C-terminal γ-cleavage site and Alc ICD possessing N-terminal ε-cleavage site were analysed with MALDI-TOF/MS. We determined the initial ε-site position of all Alcα, Alcβ and Alcγ, and analyzed the relationship between the initially determined ε-site position and the final γ-cleavage position. Conclusions The initial ε-site position does not always determine the final γ-cleavage position in Alcs, which differed from APP. No additional γ-cleavage sites are generated from artificial/non-physiological positions of ε-cleavage for Alcs, while the artificial ε-cleavage positions can influence in selection of physiological γ-site positions. Because alteration of γ-secretase activity is thought to be a pathogenesis of sporadic Alzheimer's disease, Alcs are useful and sensitive substrate to detect the altered cleavage of substrates by γ-secretase, which may be induced by malfunction of γ-secretase itself or changes of membrane environment for enzymatic reaction. PMID:23658629

  19. Drosophila mini-white model system: new insights into positive position effects and the role of transcriptional terminators and gypsy insulator in transgene shielding

    PubMed Central

    Silicheva, Margarita; Golovnin, Anton; Pomerantseva, Ekaterina; Parshikov, Aleksander; Georgiev, Pavel; Maksimenko, Oksana

    2010-01-01

    The white gene, which is responsible for eye pigmentation, is widely used to study position effects in Drosophila. As a result of insertion of P-element vectors containing mini-white without enhancers into random chromosomal sites, flies with different eye color phenotypes appear, which is usually explained by the influence of positive/negative regulatory elements located around the insertion site. We found that, in more than 70% of cases when mini-white expression was subject to positive position effects, deletion of the white promoter had no effect on eye pigmentation; in these cases, the transposon was inserted into the transcribed regions of genes. Therefore, transcription through the mini-white gene could be responsible for high levels of its expression in most of chromosomal sites. Consistently with this conclusion, transcriptional terminators proved to be efficient in protecting mini-white expression from positive position effects. On the other hand, the best characterized Drosophila gypsy insulator was poorly effective in terminating transcription and, as a consequence, only partially protected mini-white expression from these effects. Thus, to ensure maximum protection of a transgene from position effects, a perfect boundary/insulator element should combine three activities: to block enhancers, to provide a barrier between active and repressed chromatin, and to terminate transcription. PMID:19854952

  20. Oxygen activation in flavoprotein oxidases: the importance of being positive.

    PubMed

    Gadda, Giovanni

    2012-04-03

    The oxidation of flavin hydroquinones by O(2) in solution is slow, with second-order rate constants of ~250 M(-1) s(-1). This is due to the obligatory, single-electron transfer that initiates the reaction being thermodynamically unfavored and poorly catalyzed. Notwithstanding considerations of O(2) accessibility to the reaction site, its desolvation and geometry and other factors that can also contribute to further rate acceleration, flavoprotein oxidases must activate O(2) for reaction with flavin hydroquinones to be able to achieve the 100-1000-fold rate enhancements typically observed. Protein positive charges have been identified in glucose oxidase, monomeric sarcosine oxidase, N-methyltryptophan oxidase and fructosamine oxidase that electrostatically stabilize the transition state for the initial single electron transfer that generates the O(2)(-•)/flavin semiquinone radical pair. In choline oxidase despite the presence of three histidines in the active site, the trimethylammonium group of the reaction product provides such an electrostatic stabilization. A nonpolar site proximal to the flavin C(4a) atom in choline oxidase has also been identified, which contributes to the geometry and desolvation of the O(2) reaction site. The relevance of O(2) activation by product charges to other flavoprotein oxidases, such as for example those catalyzing amine oxidations, is discussed in this review. A nonpolar site close to the flavin C(4a) atom and a positive charge is identified through structural analysis in several flavoprotein oxidases. Mutagenesis has disclosed nonpolar sites in O(2)-reducing enzymes that utilize copper/TPQ or iron. It is predicted that classes of O(2)-reducing enzymes utilizing other cofactors also contain a similar catalytic motif.

  1. Tunable allosteric library of caspase-3 identifies coupling between conserved water molecules and conformational selection

    PubMed Central

    Maciag, Joseph J.; Mackenzie, Sarah H.; Tucker, Matthew B.; Schipper, Joshua L.; Swartz, Paul; Clark, A. Clay

    2016-01-01

    The native ensemble of caspases is described globally by a complex energy landscape where the binding of substrate selects for the active conformation, whereas targeting an allosteric site in the dimer interface selects an inactive conformation that contains disordered active-site loops. Mutations and posttranslational modifications stabilize high-energy inactive conformations, with mostly formed, but distorted, active sites. To examine the interconversion of active and inactive states in the ensemble, we used detection of related solvent positions to analyze 4,995 waters in 15 high-resolution (<2.0 Å) structures of wild-type caspase-3, resulting in 450 clusters with the most highly conserved set containing 145 water molecules. The data show that regions of the protein that contact the conserved waters also correspond to sites of posttranslational modifications, suggesting that the conserved waters are an integral part of allosteric mechanisms. To test this hypothesis, we created a library of 19 caspase-3 variants through saturation mutagenesis in a single position of the allosteric site of the dimer interface, and we show that the enzyme activity varies by more than four orders of magnitude. Altogether, our database consists of 37 high-resolution structures of caspase-3 variants, and we demonstrate that the decrease in activity correlates with a loss of conserved water molecules. The data show that the activity of caspase-3 can be fine-tuned through globally desolvating the active conformation within the native ensemble, providing a mechanism for cells to repartition the ensemble and thus fine-tune activity through conformational selection. PMID:27681633

  2. Tunable allosteric library of caspase-3 identifies coupling between conserved water molecules and conformational selection.

    PubMed

    Maciag, Joseph J; Mackenzie, Sarah H; Tucker, Matthew B; Schipper, Joshua L; Swartz, Paul; Clark, A Clay

    2016-10-11

    The native ensemble of caspases is described globally by a complex energy landscape where the binding of substrate selects for the active conformation, whereas targeting an allosteric site in the dimer interface selects an inactive conformation that contains disordered active-site loops. Mutations and posttranslational modifications stabilize high-energy inactive conformations, with mostly formed, but distorted, active sites. To examine the interconversion of active and inactive states in the ensemble, we used detection of related solvent positions to analyze 4,995 waters in 15 high-resolution (<2.0 Å) structures of wild-type caspase-3, resulting in 450 clusters with the most highly conserved set containing 145 water molecules. The data show that regions of the protein that contact the conserved waters also correspond to sites of posttranslational modifications, suggesting that the conserved waters are an integral part of allosteric mechanisms. To test this hypothesis, we created a library of 19 caspase-3 variants through saturation mutagenesis in a single position of the allosteric site of the dimer interface, and we show that the enzyme activity varies by more than four orders of magnitude. Altogether, our database consists of 37 high-resolution structures of caspase-3 variants, and we demonstrate that the decrease in activity correlates with a loss of conserved water molecules. The data show that the activity of caspase-3 can be fine-tuned through globally desolvating the active conformation within the native ensemble, providing a mechanism for cells to repartition the ensemble and thus fine-tune activity through conformational selection.

  3. Experimental Civilian Personnel Office Project (EXPO): Final Report for Nonappropriated Fund Sites

    DTIC Science & Technology

    1991-07-01

    existing data bases; budgetary data; and other documents provided by the test sites. The results indicate that EXPO initiatives had a positive impact on...EXPO has had a positive impact on NAF operations and profitability of revenue-generating activities has remained stable. Important findings include...appropriate education and training resources are available. v viii VllI CONTENTS INTRO DU CTIO N

  4. ATP hydrolysis in Eg5 kinesin involves a catalytic two-water mechanism.

    PubMed

    Parke, Courtney L; Wojcik, Edward J; Kim, Sunyoung; Worthylake, David K

    2010-02-19

    Motor proteins couple steps in ATP binding and hydrolysis to conformational switching both in and remote from the active site. In our kinesin.AMPPPNP crystal structure, closure of the active site results in structural transformations appropriate for microtubule binding and organizes an orthosteric two-water cluster. We conclude that a proton is shared between the lytic water, positioned for gamma-phosphate attack, and a second water that serves as a general base. To our knowledge, this is the first experimental detection of the catalytic base for any ATPase. Deprotonation of the second water by switch residues likely triggers subsequent large scale structural rearrangements. Therefore, the catalytic base is responsible for initiating nucleophilic attack of ATP and for relaying the positive charge over long distances to initiate mechanotransduction. Coordination of switch movements via sequential proton transfer along paired water clusters may be universal for nucleotide triphosphatases with conserved active sites, such as myosins and G-proteins.

  5. Activity of N-coordinated multi-metal-atom active site structures for Pt-free oxygen reduction reaction catalysis: Role of *OH ligands

    DOE PAGES

    Holby, Edward F.; Taylor, Christopher D.

    2015-03-19

    We report calculated oxygen reduction reaction energy pathways on multi-metal-atom structures that have previously been shown to be thermodynamically favorable. We predict that such sites have the ability to spontaneously cleave the O₂ bond and then will proceed to over-bind reaction intermediates. In particular, the *OH bound state has lower energy than the final 2 H₂O state at positive potentials. Contrary to traditional surface catalysts, this *OH binding does not poison the multi-metal-atom site but acts as a modifying ligand that will spontaneously form in aqueous environments leading to new active sites that have higher catalytic activities. These *OH boundmore » structures have the highest calculated activity to date.« less

  6. Retrotransposon Tf1 is targeted to pol II promoters by transcription activators

    PubMed Central

    Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.

    2008-01-01

    SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330

  7. Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.

    PubMed

    Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L

    2008-04-11

    The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.

  8. Baseline asynchrony, assessed circumferentially using temporal uniformity of strain, besides coincidence between site of latest mechanical activation and presumed left ventricular lead position, predicts favourable prognosis after resynchronization therapy.

    PubMed

    Cavallino, Chiara; Rondano, Elisa; Magnani, Andrea; Leva, Lucia; Inglese, Eugenio; Dell'era, Gabriele; Occhetta, Eraldo; Bortnik, Miriam; Marino, Paolo N

    2012-06-01

    Traditional indexes of LV dyssynchrony (DYS) in pts to be resynchronized are sensitive to noise, while the concordance between LV lead position and site of latest mechanical activation is suggested to be, in these patients, clinically relevant. Both aspects, asynchrony and lead position have been addressed separately but unclear is their potential synergistic role in the clinical evolution of CRT patients. We assessed clinical and echocardiographic outcome, as well as mid-term prognosis, in a population of CHF patients submitted to CRT, stratified according to a novel asynchrony quantitation (temporal uniformity of strain: TUS) method and concordance or not between presumed LV lead position and site of latest mechanical activation. TUS was computed in 85 pts (QRS > 120 ms, EF < 0.35) in whom we measured circumferential and longitudinal strains using speckle-tracking 2D-echocardiography before and 3-6 months after CRT, together with triplane apical LV volumes. Optimal LV lead position in short axis view was defined as concordance of the segment with latest systolic circumferential strain prior-CRT and segment with assumed LV lead position. Assumed LV lead position was defined from a chest X-ray obtained 1 day after implantation and scored as anterior, lateral, posterior or inferior using 2 orthogonal views (antero-posterior and lateral). Following CRT, LV volume decreased (diastolic -8 ± 20%) and EF improved (+6 ± 9%, P < 0.001 for both). Two-way ANOVA revealed TUS improvement post-CRT (+22 ± 68%, P = 0.025), with a clear evidence for more marked asynchrony detectable at circumferential (from 0.53 ± 0.20 to 0.55 ± 0.19) as compared with longitudinal level (from 0.56 ± 0.14 to 0.62 ± 0.14) (P = 0.017). Multivariate analysis revealed that greater baseline asynchrony, as assessed circumferentially (P = 0.079), together with concordance between LV lead position and site of activation (P = 0.012), besides younger age (P = 0.051), longer QRS duration (P = 0.021) and higher baseline EF (P = 0.04),), but not longitudinal TUS (P = 0.231) did predict death from any cause or new episodes of pulmonary or systemic congestion requiring i.v. diuretics during a 529 ± 357 days clinical follow-up. We conclude that DYS indexed by circumferential TUS yields CRT benefits, supporting the idea of targeting TUS-measured DYS as the informative asynchrony quantitative measurement in CRT pts. Significant predictability in medium-term clinical follow-up of patients to be resynchronized is also associated with concordance between site of latest mechanical activation and presumed LV lead position in the present study.

  9. Mercury behaviour and C, N, and P biogeochemical cycles during ecological restoration processes of old mining sites in French Guiana.

    PubMed

    Couic, Ewan; Grimaldi, Michel; Alphonse, Vanessa; Balland-Bolou-Bi, Clarisse; Livet, Alexandre; Giusti-Miller, Stéphanie; Sarrazin, Max; Bousserrhine, Noureddine

    2018-04-25

    Several decades of gold mining extraction activities in the Amazonian rainforest have caused deforestation and pollution. While ecological rehabilitation is essential for restoring biodiversity and decreasing erosion on deforested lands, few studies note the behaviour or toxicity of trace elements during the rehabilitation process. Our original study focused on the potential use of microbial activity and Hg speciation and compared them with As, Cu, Zn and Cr speciation in assessing the chemical and biological quality of ecological restoration efforts. We sampled two sites in French Guyana 17 years after rehabilitation efforts began. The former site was actively regenerated (R) with the leguminous species Clitoria racemosa and Acacia mangium, and the second site was passively regenerated with spontaneous vegetation (Sv). We also sampled soil from a control site without a history of gold mining (F). We performed microcosm soil experiments for 30 days, where trace element speciation and enzyme activities (i.e., FDA, dehydrogenase, β-glucosidase, urease, alkaline and acid phosphatase) were estimated to characterise the behaviour of trace elements and the soil microbial activity. As bioindicators, the use of soil microbial carbon biomass and soil enzyme activities related to the carbon and phosphorus cycles seems to be relevant for assessing soil quality in rehabilitated and regenerated old mining sites. Our results showed that restoration with leguminous species had a positive effect on soil chemical quality and on soil microbial bioindicators, with activities that tended toward natural non-degraded soil (F). Active restoration processes also had a positive effect on Hg speciation by reducing its mobility. While in Sv we found more exchangeable and soluble mercury, in regenerated sites, Hg was mostly bound to organic matter. These results also suggested that enzyme activities and mercury cycles are sensitive to land restoration and must be considered when evaluating the efficiency of restoration processes.

  10. Specificity determinants for autoproteolysis of LexA, a key regulator of bacterial SOS mutagenesis.

    PubMed

    Mo, Charlie Y; Birdwell, L Dillon; Kohli, Rahul M

    2014-05-20

    Bacteria utilize the tightly regulated stress response (SOS) pathway to respond to a variety of genotoxic agents, including antimicrobials. Activation of the SOS response is regulated by a key repressor-protease, LexA, which undergoes autoproteolysis in the setting of stress, resulting in derepression of SOS genes. Remarkably, genetic inactivation of LexA's self-cleavage activity significantly decreases acquired antibiotic resistance in infection models and renders bacteria hypersensitive to traditional antibiotics, suggesting that a mechanistic study of LexA could help inform its viability as a novel target for combating acquired drug resistance. Despite structural insights into LexA, a detailed knowledge of the enzyme's protease specificity is lacking. Here, we employ saturation and positional scanning mutagenesis on LexA's internal cleavage region to analyze >140 mutants and generate a comprehensive specificity profile of LexA from the human pathogen Pseudomonas aeruginosa (LexAPa). We find that the LexAPa active site possesses a unique mode of substrate recognition. Positions P1-P3 prefer small hydrophobic residues that suggest specific contacts with the active site, while positions P5 and P1' show a preference for flexible glycine residues that may facilitate the conformational change that permits autoproteolysis. We further show that stabilizing the β-turn within the cleavage region enhances LexA autoproteolytic activity. Finally, we identify permissive positions flanking the scissile bond (P4 and P2') that are tolerant to extensive mutagenesis. Our studies shed light on the active site architecture of the LexA autoprotease and provide insights that may inform the design of probes of the SOS pathway.

  11. Specification of unique Pit-1 activity in the hGH locus control region

    PubMed Central

    Shewchuk, Brian M.; Liebhaber, Stephen A.; Cooke, Nancy E.

    2002-01-01

    The human GH (hGH) gene cluster is regulated by a remote 5′ locus control region (LCR). HSI, an LCR component located 14.5 kb 5′ to the hGH-N promoter, constitutes the primary determinant of high-level hGH-N activation in pituitary somatotropes. HSI encompasses an array of three binding sites for the pituitary-specific POU homeodomain factor Pit-1. In the present report we demonstrate that all three Pit-1 sites in the HSI array contribute to LCR activity in vivo. Furthermore, these three sites as a unit are fully sufficient for position-independent and somatotrope-restricted hGH-N transgene activation. In contrast, the hGH-N transgene is not activated by Pit-1 sites native to either the hGH-N or rat (r)GH gene promoters. These findings suggest that the structures of the Pit-1 binding sites at HSI specify distinct chromatin-dependent activities essential for LCR-mediated activation of hGH in the developing pituitary. PMID:12189206

  12. Site Assessment of a New State-Wide Seismic Network in Texas (TexNet)

    NASA Astrophysics Data System (ADS)

    Savvaidis, A.; Young, B.; Mukherjee, T.; Hennings, P.; Rathje, E.; Zalachoris, G.; Young, M.; Walter, J. I.; DeShon, H. R.; Frohlich, C.

    2016-12-01

    Earthquake activity has recently increased in the southern mid-continent of the U.S., including Texas. To monitor seismicity activity in the state of Texas, a new seismicity monitoring program known as TexNet, was funded by the Texas State Legislature in 2015. TexNet consists of 22 new permanent broadband (120s post-hole) seismic stations that will complement the 17 stations currently operating in the State. These permanent stations will provide the baseline seismicity of the state. In addition, 36 portable stations (incorporating both a 20s post-hole seismometer and a post-hole accelerometer) will be used to densify the network in specific areas, of the State, depending on measured seismicity level, proximity to infrastructure, or other scientific investigations. One goal for TexNet is to provide authenticated data needed to evaluate the location, and frequency of earthquakes. To minimize the uncertainties in earthquake locations and increase detectability of the network, an extensive site assessment survey was conducted. The initial station positions were chosen based on Earthscope, Transportable Array (TA) site positions, while ensuring that the stations were relatively evenly-spaced across the State. We then analyzed the noise and earthquake data from the TA seismometers, and added new locations based on geology, topography, and absence of nearby human activities. A 30-min noise test was conducted at each site to identify the site amplification using HVSR information. A 24-hr survey then followed, where the noise level during day and night was identified, analyzed using power spectral density and compared to the NHNM and NLNM (Peterson, 1993; USGS Open File Report, 322). Based on these survey results nearby alternative sites were evaluated to improve final site position. Full deployment and data streaming is expected by December 2016, and will be discussed during this presentation.

  13. Site Assessment of a New State-Wide Seismic Network in Texas (TexNet), USA.

    NASA Astrophysics Data System (ADS)

    Savvaidis, Alexandros; Young, Bissett; Hennings, Peter; Rathje, Ellen; Zalachoris, George; Young, Michael H.; Walter, Jacob I.; DeShon, Heather R.; Frohlich, Cliff

    2017-04-01

    Earthquake activity has recently increased in the southern mid-continent of the U.S., including Texas. To monitor seismicity activity in the state of Texas, a new seismicity monitoring program known as TexNet, was funded by the Texas State Legislature in 2015. TexNet consists of 22 new permanent broadband (120s post-hole) seismic stations that will complement the 17 stations currently operating in the State. These permanent stations will provide the baseline seismicity of the state. In addition, 36 portable stations (incorporating both a 20s post-hole seismometer and a post-hole accelerometer) will be used to densify the network in specific areas, of the State, depending on measured seismicity level, proximity to infrastructure, or other scientific investigations. One goal for TexNet is to provide authenticated data needed to evaluate the location, and frequency of earthquakes. To minimize the uncertainties in earthquake locations and increase detectability of the network, an extensive site assessment survey was conducted. The initial station positions were chosen based on Earthscope, Transportable Array (TA) site positions, while ensuring that the stations were relatively evenly-spaced across the State. We then analyzed the noise and earthquake data from the TA seismometers, and added new locations based on geology, topography, and absence of nearby human activities. A 30-min noise test was conducted at each site to identify the site amplification using HVSR information. A 24-hr survey then followed, where the noise level during day and night was identified, analyzed using power spectral density and compared to the NHNM and NLNM (Peterson, 1993; USGS Open File Report, 322). Based on these survey results nearby alternative sites were evaluated to improve final site position. Deployment and data streaming started on September 2016, and will be discussed during this presentation.

  14. Site-Specific 64Cu Labeling of the Serine Protease, Active Site Inhibited Factor Seven Azide (FVIIai-N3), Using Copper Free Click Chemistry.

    PubMed

    Jeppesen, Troels E; Kristensen, Lotte K; Nielsen, Carsten H; Petersen, Lars C; Kristensen, Jesper B; Behrens, Carsten; Madsen, Jacob; Kjaer, Andreas

    2018-01-17

    A method for site-specific radiolabeling of the serine protease active site inhibited factor seven (FVIIai) with 64 Cu has been applied using a biorthogonal click reaction. FVIIai binds to tissue factor (TF), a trans-membrane protein involved in hemostasis, angiogenesis, proliferation, cell migration, and survival of cancer cells. First a single azide moiety was introduced in the active site of this 50 kDa protease. Then a NOTA moiety was introduced via a strain promoted azide-alkyne reaction and the corresponding conjugate was labeled with 64 Cu. Binding to TF and the stability was evaluated in vitro. TF targeting capability of the radiolabeled conjugate was tested in vivo by positron emission tomography (PET) imaging in pancreatic human xenograft cancer mouse models with various TF expressions. The conjugate showed good stability (>91% at 16 h), an immunoreactivity of 93.5%, and a mean tumor uptake of 2.1 ± 0.2%ID/g at 15 h post injection. In conclusion, FVIIai was radiolabeled with 64 Cu in single well-defined position of the protein. This method can be utilized to prepare conjugates from serine proteases with the label at a specific position.

  15. Role of active site rigidity in activity: MD simulation and fluorescence study on a lipase mutant.

    PubMed

    Kamal, Md Zahid; Mohammad, Tabrez Anwar Shamim; Krishnamoorthy, G; Rao, Nalam Madhusudhana

    2012-01-01

    Relationship between stability and activity of enzymes is maintained by underlying conformational flexibility. In thermophilic enzymes, a decrease in flexibility causes low enzyme activity while in less stable proteins such as mesophiles and psychrophiles, an increase in flexibility is associated with enhanced enzyme activity. Recently, we identified a mutant of a lipase whose stability and activity were enhanced simultaneously. In this work, we probed the conformational dynamics of the mutant and the wild type lipase, particularly flexibility of their active site using molecular dynamic simulations and time-resolved fluorescence techniques. In contrast to the earlier observations, our data show that active site of the mutant is more rigid than wild type enzyme. Further investigation suggests that this lipase needs minimal reorganization/flexibility of active site residues during its catalytic cycle. Molecular dynamic simulations suggest that catalytically competent active site geometry of the mutant is relatively more preserved than wild type lipase, which might have led to its higher enzyme activity. Our study implies that widely accepted positive correlation between conformation flexibility and enzyme activity need not be stringent and draws attention to the possibility that high enzyme activity can still be accomplished in a rigid active site and stable protein structures. This finding has a significant implication towards better understanding of involvement of dynamic motions in enzyme catalysis and enzyme engineering through mutations in active site.

  16. The 3'-5' exonuclease of DNA polymerase I of Escherichia coli: contribution of each amino acid at the active site to the reaction.

    PubMed Central

    Derbyshire, V; Grindley, N D; Joyce, C M

    1991-01-01

    We have used site-directed mutagenesis to change amino acid side chains that have been shown crystallographically to be in close proximity to a DNA 3' terminus bound at the 3'-5' exonuclease active site of Klenow fragment. Exonuclease assays of the resulting mutant proteins indicate that the largest effects on exonuclease activity result from mutations in a group of carboxylate side chains (Asp355, Asp424 and Asp501) anchoring two divalent metal ions that are essential for exonuclease activity. Another carboxylate (Glu357) within this cluster seems to be less important as a metal ligand, but may play a separate role in catalysis of the exonuclease reaction. A second group of residues (Leu361, Phe473 and Tyr497), located around the terminal base and ribose positions, plays a secondary role, ensuring correct positioning of the substrate in the active site and perhaps also facilitating melting of a duplex DNA substrate by interacting with the frayed 3' terminus. The pH-dependence of the 3'-5' exonuclease reaction is consistent with a mechanism in which nucleophilic attack on the terminal phosphodiester bond is initiated by a hydroxide ion coordinated to one of the enzyme-bound metal ions. PMID:1989882

  17. Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

    PubMed

    Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

    1999-10-28

    We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.

  18. [Social media, children and pediatricians].

    PubMed

    Le Heuzey, M-F

    2012-01-01

    Using social media web sites is a common activity for children, and any site that allows social interaction (social network, games, virtual worlds...) is a social media site. Pediatricians are in a position to help families understand the benefits and the risks of these sites, and to diagnose problems in children and adolescents as cyberbullying, depression, and post traumatic disorder. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  19. Catalysis-dependent selenium incorporation and migration in the nitrogenase active site iron-molybdenum cofactor.

    PubMed

    Spatzal, Thomas; Perez, Kathryn A; Howard, James B; Rees, Douglas C

    2015-12-16

    Dinitrogen reduction in the biological nitrogen cycle is catalyzed by nitrogenase, a two-component metalloenzyme. Understanding of the transformation of the inert resting state of the active site FeMo-cofactor into an activated state capable of reducing dinitrogen remains elusive. Here we report the catalysis dependent, site-selective incorporation of selenium into the FeMo-cofactor from selenocyanate as a newly identified substrate and inhibitor. The 1.60 Å resolution structure reveals selenium occupying the S2B site of FeMo-cofactor in the Azotobacter vinelandii MoFe-protein, a position that was recently identified as the CO-binding site. The Se2B-labeled enzyme retains substrate reduction activity and marks the starting point for a crystallographic pulse-chase experiment of the active site during turnover. Through a series of crystal structures obtained at resolutions of 1.32-1.66 Å, including the CO-inhibited form of Av1-Se2B, the exchangeability of all three belt-sulfur sites is demonstrated, providing direct insights into unforeseen rearrangements of the metal center during catalysis.

  20. Long-range electrostatic complementarity governs substrate recognition by human chymotrypsin C, a key regulator of digestive enzyme activation.

    PubMed

    Batra, Jyotica; Szabó, András; Caulfield, Thomas R; Soares, Alexei S; Sahin-Tóth, Miklós; Radisky, Evette S

    2013-04-05

    Human chymotrypsin C (CTRC) is a pancreatic serine protease that regulates activation and degradation of trypsinogens and procarboxypeptidases by targeting specific cleavage sites within their zymogen precursors. In cleaving these regulatory sites, which are characterized by multiple flanking acidic residues, CTRC shows substrate specificity that is distinct from that of other isoforms of chymotrypsin and elastase. Here, we report the first crystal structure of active CTRC, determined at 1.9-Å resolution, revealing the structural basis for binding specificity. The structure shows human CTRC bound to the small protein protease inhibitor eglin c, which binds in a substrate-like manner filling the S6-S5' subsites of the substrate binding cleft. Significant binding affinity derives from burial of preferred hydrophobic residues at the P1, P4, and P2' positions of CTRC, although acidic P2' residues can also be accommodated by formation of an interfacial salt bridge. Acidic residues may also be specifically accommodated in the P6 position. The most unique structural feature of CTRC is a ring of intense positive electrostatic surface potential surrounding the primarily hydrophobic substrate binding site. Our results indicate that long-range electrostatic attraction toward substrates of concentrated negative charge governs substrate discrimination, which explains CTRC selectivity in regulating active digestive enzyme levels.

  1. Converting Transaldolase into Aldolase through Swapping of the Multifunctional Acid-Base Catalyst: Common and Divergent Catalytic Principles in F6P Aldolase and Transaldolase.

    PubMed

    Sautner, Viktor; Friedrich, Mascha Miriam; Lehwess-Litzmann, Anja; Tittmann, Kai

    2015-07-28

    Transaldolase (TAL) and fructose-6-phosphate aldolase (FSA) both belong to the class I aldolase family and share a high degree of structural similarity and sequence identity. The molecular basis of the different reaction specificities (transferase vs aldolase) has remained enigmatic. A notable difference between the active sites is the presence of either a TAL-specific Glu (Gln in FSA) or a FSA-specific Tyr (Phe in TAL). Both residues seem to have analoguous multifunctional catalytic roles but are positioned at different faces of the substrate locale. We have engineered a TAL double variant (Glu to Gln and Phe to Tyr) with an active site resembling that of FSA. This variant indeed exhibits aldolase activity as its main activity with a catalytic efficiency even larger than that of authentic FSA, while TAL activity is greatly impaired. Structural analysis of this variant in complex with the dihydroxyacetone Schiff base formed upon substrate cleavage identifies the introduced Tyr (genuine in FSA) to catalyze protonation of the central carbanion-enamine intermediate as a key determinant of the aldolase reaction. Our studies pinpoint that the Glu in TAL and the Tyr in FSA, although located at different positions at the active site, similarly act as bona fide acid-base catalysts in numerous catalytic steps, including substrate binding, dehydration of the carbinolamine, and substrate cleavage. We propose that the different spatial positions of the multifunctional Glu in TAL and of the corresponding multifunctional Tyr in FSA relative to the substrate locale are critically controlling reaction specificity through either unfavorable (TAL) or favorable (FSA) geometry of proton transfer onto the common carbanion-enamine intermediate. The presence of both potential acid-base residues, Glu and Tyr, in the active site of TAL has deleterious effects on substrate binding and cleavage, most likely resulting from a differently organized H-bonding network. Large-scale motions of the protein associated with opening and closing of the active site that seem to bear relevance for catalysis are observed as covalent intermediates are exclusively observed in the "closed" conformation of the active site. Pre-steady-state kinetics are used to monitor catalytic processes and structural transitions and to refine the kinetic framework of TAL catalysis.

  2. Patterns of Positive Selection of the Myogenic Regulatory Factor Gene Family in Vertebrates

    PubMed Central

    Zhao, Xiao; Yu, Qi; Huang, Ling; Liu, Qing-Xin

    2014-01-01

    The functional divergence of transcriptional factors is critical in the evolution of transcriptional regulation. However, the mechanism of functional divergence among these factors remains unclear. Here, we performed an evolutionary analysis for positive selection in members of the myogenic regulatory factor (MRF) gene family of vertebrates. We selected 153 complete vertebrate MRF nucleotide sequences from our analyses, which revealed substantial evidence of positive selection. Here, we show that sites under positive selection were more frequently detected and identified from the genes encoding the myogenic differentiation factors (MyoG and Myf6) than the genes encoding myogenic determination factors (Myf5 and MyoD). Additionally, the functional divergence within the myogenic determination factors or differentiation factors was also under positive selection pressure. The positive selection sites were more frequently detected from MyoG and MyoD than Myf6 and Myf5, respectively. Amino acid residues under positive selection were identified mainly in their transcription activation domains and on the surface of protein three-dimensional structures. These data suggest that the functional gain and divergence of myogenic regulatory factors were driven by distinct positive selection of their transcription activation domains, whereas the function of the DNA binding domains was conserved in evolution. Our study evaluated the mechanism of functional divergence of the transcriptional regulation factors within a family, whereby the functions of their transcription activation domains diverged under positive selection during evolution. PMID:24651579

  3. A Checklist for Designing and Evaluating Physical Education Program Web Sites

    ERIC Educational Resources Information Center

    Tucker, Michael; Hill, Grant

    2009-01-01

    Creating a physical education department web site is an excellent way to promote a positive image of the program, because students and parents are able to find important information and improve the lines of communication. A well-designed physical education web site can even encourage students to increase their physical activity levels. Improved…

  4. Extending enzyme molecular recognition with an expanded amino acid alphabet

    PubMed Central

    Windle, Claire L.; Simmons, Katie J.; Ault, James R.; Trinh, Chi H.; Nelson, Adam

    2017-01-01

    Natural enzymes are constructed from the 20 proteogenic amino acids, which may then require posttranslational modification or the recruitment of coenzymes or metal ions to achieve catalytic function. Here, we demonstrate that expansion of the alphabet of amino acids can also enable the properties of enzymes to be extended. A chemical mutagenesis strategy allowed a wide range of noncanonical amino acids to be systematically incorporated throughout an active site to alter enzymic substrate specificity. Specifically, 13 different noncanonical side chains were incorporated at 12 different positions within the active site of N-acetylneuraminic acid lyase (NAL), and the resulting chemically modified enzymes were screened for activity with a range of aldehyde substrates. A modified enzyme containing a 2,3-dihydroxypropyl cysteine at position 190 was identified that had significantly increased activity for the aldol reaction of erythrose with pyruvate compared with the wild-type enzyme. Kinetic investigation of a saturation library of the canonical amino acids at the same position showed that this increased activity was not achievable with any of the 20 proteogenic amino acids. Structural and modeling studies revealed that the unique shape and functionality of the noncanonical side chain enabled the active site to be remodeled to enable more efficient stabilization of the transition state of the reaction. The ability to exploit an expanded amino acid alphabet can thus heighten the ambitions of protein engineers wishing to develop enzymes with new catalytic properties. PMID:28196894

  5. Regulatory elements involved in constitutive and phorbol ester-inducible expression of the plasminogen activator inhibitor type 2 gene promoter.

    PubMed Central

    Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K

    1991-01-01

    Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454

  6. Volcanic Surface Deformation in Dominica From GPS Geodesy: Results From the 2007 NSF- REU Site

    NASA Astrophysics Data System (ADS)

    Murphy, R.; James, S.; Styron, R. H.; Turner, H. L.; Ashlock, A.; Cavness, C.; Collier, X.; Fauria, K.; Feinstein, R.; Staisch, L.; Williams, B.; Mattioli, G. S.; Jansma, P. E.; Cothren, J.

    2007-12-01

    GPS measurements have been collected on the island of Dominica in the Lesser Antilles between 2001 and 2007, with five month-long campaigns completed in June of each year supported in part by a NSF REU Site award for the past two years. All GPS data were collected using dual-frequency, code-phase receivers and geodetic-quality antenna, primarily choke rings. Three consecutive 24 hr observation days were normally obtained for each site. Precise station positions were estimated with GIPSY-OASISII using an absolute point positioning strategy and final, precise orbits, clocks, earth orientation parameters, and x-files. All position estimates were updated to ITRF05 and a revised Caribbean Euler pole was used to place our observations in a CAR-fixed frame. Time series were created to determine the velocity of each station. Forward and inverse elastic half-space models with planar (i.e. dike) and Mogi (i.e. point) sources were investigated. Inverse modeling was completed using a downhill simplex method of function minimization. Selected site velocities were used to create appropriate models for specific regions of Dominica, which correspond to known centers of pre-historic volcanic or recent shallow, seismic activity. Because of the current distribution of GPS sites with robust velocity estimates, we limit our models to possible magmatic activity in the northern, proximal to the volcanic centers of Morne Diablotins and Morne aux Diables, and southern, proximal to volcanic centers of Soufriere and Morne Plat Pays, regions of the island. Surface deformation data from the northernmost sites may be fit with the development of a several km-long dike trending approximately northeast- southwest. Activity in the southern volcanic centers is best modeled by an expanding point source at approximately 1 km depth.

  7. The High-Resolution Structure of Activated Opsin Reveals a Conserved Solvent Network in the Transmembrane Region Essential for Activation.

    PubMed

    Blankenship, Elise; Vahedi-Faridi, Ardeschir; Lodowski, David T

    2015-12-01

    Rhodopsin, a light-activated G protein coupled receptor (GPCR), has been the subject of numerous biochemical and structural investigations, serving as a model receptor for GPCRs and their activation. We present the 2.3-Å resolution structure of native source rhodopsin stabilized in a conformation competent for G protein binding. An extensive water-mediated hydrogen bond network linking the chromophore binding site to the site of G protein binding is observed, providing connections to conserved motifs essential for GPCR activation. Comparison of this extensive solvent-mediated hydrogen-bonding network with the positions of ordered solvent in earlier crystallographic structures of rhodopsin photointermediates reveals both static structural and dynamic functional water-protein interactions present during the activation process. When considered along with observations that solvent occupies similar positions in the structures of other GPCRs, these analyses strongly support an integral role for this dynamic ordered water network in both rhodopsin and GPCR activation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. A Conserved Surface Loop in Type I Dehydroquinate Dehydratases Positions an Active Site Arginine and Functions in Substrate Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Light, Samuel H.; Minasov, George; Shuvalova, Ludmilla

    2012-04-18

    Dehydroquinate dehydratase (DHQD) catalyzes the third step in the biosynthetic shikimate pathway. We present three crystal structures of the Salmonella enterica type I DHQD that address the functionality of a surface loop that is observed to close over the active site following substrate binding. Two wild-type structures with differing loop conformations and kinetic and structural studies of a mutant provide evidence of both direct and indirect mechanisms of involvement of the loop in substrate binding. In addition to allowing amino acid side chains to establish a direct interaction with the substrate, closure of the loop necessitates a conformational change ofmore » a key active site arginine, which in turn positions the substrate productively. The absence of DHQD in humans and its essentiality in many pathogenic bacteria make the enzyme a target for the development of nontoxic antimicrobials. The structures and ligand binding insights presented here may inform the design of novel type I DHQD inhibiting molecules.« less

  9. T-state inhibitors of E. coli aspartate transcarbamoylase that prevent the allosteric transition.

    PubMed

    Heng, Sabrina; Stieglitz, Kimberly A; Eldo, Joby; Xia, Jiarong; Cardia, James P; Kantrowitz, Evan R

    2006-08-22

    Escherichia coli aspartate transcarbamoylase (ATCase) catalyzes the committed step in pyrimidine nucleotide biosynthesis, the reaction between carbamoyl phosphate (CP) and l-aspartate to form N-carbamoyl-l-aspartate and inorganic phosphate. The enzyme exhibits homotropic cooperativity and is allosterically regulated. Upon binding l-aspartate in the presence of a saturating concentration of CP, the enzyme is converted from the low-activity low-affinity T state to the high-activity high-affinity R state. The potent inhibitor N-phosphonacetyl-l-aspartate (PALA), which combines the binding features of Asp and CP into one molecule, has been shown to induce the allosteric transition to the R state. In the presence of only CP, the enzyme is the T structure with the active site primed for the binding of aspartate. In a structure of the enzyme-CP complex (T(CP)), two CP molecules were observed in the active site approximately 7A apart, one with high occupancy and one with low occupancy. The high occupancy site corresponds to the position for CP observed in the structure of the enzyme with CP and the aspartate analogue succinate bound. The position of the second CP is in a unique site and does not overlap with the aspartate binding site. As a means to generate a new class of inhibitors for ATCase, the domain-open T state of the enzyme was targeted. We designed, synthesized, and characterized three inhibitors that were composed of two phosphonacetamide groups linked together. These two phosphonacetamide groups mimic the positions of the two CP molecules in the T(CP) structure. X-ray crystal structures of ATCase-inhibitor complexes revealed that each of these inhibitors bind to the T state of the enzyme and occupy the active site area. As opposed to the binding of Asp in the presence of CP or PALA, these inhibitors are unable to initiate the global T to R conformational change. Although the best of these T-state inhibitors only has a K(i) value in the micromolar range, the structural information with respect to their mode of binding provides important information for the design of second generation inhibitors that will have even higher affinity for the active site of the T state of the enzyme.

  10. IFN-γ Release Assay Result Is Associated with Disease Site and Death in Active Tuberculosis.

    PubMed

    Auld, Sara C; Lee, Scott H; Click, Eleanor S; Miramontes, Roque; Day, Cheryl L; Gandhi, Neel R; Heilig, Charles M

    2016-12-01

    The IFN-γ release assays and tuberculin skin tests are used to support the diagnosis of both latent and active tuberculosis. However, we previously demonstrated that a negative tuberculin test in active tuberculosis is associated with disseminated disease and death. It is unknown whether the same associations exist for IFN-γ release assays. To determine the association between these tests and site of tuberculosis and death among persons with active tuberculosis. We analyzed IFN-γ release assays and tuberculin test results for all persons with culture-confirmed tuberculosis reported to the U.S. National Tuberculosis Surveillance System from 2010 to 2014. We used logistic regression to calculate the association between these tests and site of disease and death. A total of 24,803 persons with culture-confirmed tuberculosis had either of these test results available for analysis. Persons with a positive tuberculin test had lower odds of disseminated disease (i.e., miliary or combined pulmonary and extrapulmonary disease), but there was no difference in the odds of disseminated disease with a positive IFN-γ release assay. However, persons who were positive to either of these tests had lower odds of death. An indeterminate IFN-γ release assay result was associated with greater odds of both disseminated disease and death. Despite perceived equivalence in clinical practice, IFN-γ release assays and tuberculin test results have different associations with tuberculosis site, yet similar associations with the risk of death. Furthermore, an indeterminate IFN-γ release assay result in a person with active tuberculosis is not unimportant, and rather carries greater odds of disseminated disease and death. Prospective study may improve our understanding of the underlying mechanisms by which these tests are associated with disease localization and death.

  11. Surface Sites for Engineering Allosteric Control in Proteins

    PubMed Central

    Lee, Jeeyeon; Natarajan, Madhusudan; Nashine, Vishal C.; Socolich, Michael; Vo, Tina; Russ, William P.; Benkovic, Stephen J.; Ranganathan, Rama

    2010-01-01

    Statistical analyses of protein families reveal networks of coevolving amino acids that functionally link distantly positioned functional surfaces. Such linkages suggest a concept for engineering allosteric control into proteins: The intramolecular networks of two proteins could be joined across their surface sites such that the activity of one protein might control the activity of the other. We tested this idea by creating PAS-DHFR, a designed chimeric protein that connects a light-sensing signaling domain from a plant member of the Per/Arnt/Sim (PAS) family of proteins with Escherichia coli dihydrofolate reductase (DHFR). With no optimization, PAS-DHFR exhibited light-dependent catalytic activity that depended on the site of connection and on known signaling mechanisms in both proteins. PAS-DHFR serves as a proof of concept for engineering regulatory activities into proteins through interface design at conserved allosteric sites. PMID:18927392

  12. Strategies to regulate transcription factor-mediated gene positioning and interchromosomal clustering at the nuclear periphery.

    PubMed

    Randise-Hinchliff, Carlo; Coukos, Robert; Sood, Varun; Sumner, Michael Chas; Zdraljevic, Stefan; Meldi Sholl, Lauren; Garvey Brickner, Donna; Ahmed, Sara; Watchmaker, Lauren; Brickner, Jason H

    2016-03-14

    In budding yeast, targeting of active genes to the nuclear pore complex (NPC) and interchromosomal clustering is mediated by transcription factor (TF) binding sites in the gene promoters. For example, the binding sites for the TFs Put3, Ste12, and Gcn4 are necessary and sufficient to promote positioning at the nuclear periphery and interchromosomal clustering. However, in all three cases, gene positioning and interchromosomal clustering are regulated. Under uninducing conditions, local recruitment of the Rpd3(L) histone deacetylase by transcriptional repressors blocks Put3 DNA binding. This is a general function of yeast repressors: 16 of 21 repressors blocked Put3-mediated subnuclear positioning; 11 of these required Rpd3. In contrast, Ste12-mediated gene positioning is regulated independently of DNA binding by mitogen-activated protein kinase phosphorylation of the Dig2 inhibitor, and Gcn4-dependent targeting is up-regulated by increasing Gcn4 protein levels. These different regulatory strategies provide either qualitative switch-like control or quantitative control of gene positioning over different time scales. © 2016 Randise-Hinchliff et al.

  13. Loop engineering reveals the importance of active-site-decorating loops and gating residue in substrate affinity modulation of arginine deiminase (an anti-tumor enzyme).

    PubMed

    Cheng, Feng; Yang, Jianhua; Bocola, Marco; Schwaneberg, Ulrich; Zhu, Leilei

    2018-05-05

    Protein engineering of enzyme loop regions is an effective strategy to improve enzymatic properties. Previous studies that aimed to boost the activity of PpADI (an arginine deiminase from Pseudomonas plecoglossicida) under physiological conditions yielded several significantly improved variants that harbor substitutions predominantly located in active-site-decorating loops. A multi-site saturation mutagenesis at four positions in loop 1 (37, 38, 42, and 43) and three positions in loop 4 (402, 403, and 404) was performed to elucidate the importance of these loops in modulating the substrate affinity of PpADI. The identified "best" variant (M6-L1-4) showed a decreased S 0.5 ('K M ') of 0.48 mM compared with the parent M6 (0.81 mM). Subsequently, a rational design to recombine beneficial substitutions within loops 1 and 4 yielded variant L6 with a substantially decreased S 0.5 value (0.17 mM). A comprehensive simulation analysis resulted in a conclusion that high loop flexibility (especially the gating residue Arg400) is beneficial for substrate affinity due to less efficient blocking of the active site. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Designing small molecules to target cryptic pockets yields both positive and negative allosteric modulators

    PubMed Central

    Moeder, Katelyn E.; Ho, Chris M. W.; Zimmerman, Maxwell I.; Frederick, Thomas E.; Bowman, Gregory R.

    2017-01-01

    Allosteric drugs, which bind to proteins in regions other than their main ligand-binding or active sites, make it possible to target proteins considered “undruggable” and to develop new therapies that circumvent existing resistance. Despite growing interest in allosteric drug discovery, rational design is limited by a lack of sufficient structural information about alternative binding sites in proteins. Previously, we used Markov State Models (MSMs) to identify such “cryptic pockets,” and here we describe a method for identifying compounds that bind in these cryptic pockets and modulate enzyme activity. Experimental tests validate our approach by revealing both an inhibitor and two activators of TEM β-lactamase (TEM). To identify hits, a library of compounds is first virtually screened against either the crystal structure of a known cryptic pocket or an ensemble of structures containing the same cryptic pocket that is extracted from an MSM. Hit compounds are then screened experimentally and characterized kinetically in individual assays. We identify three hits, one inhibitor and two activators, demonstrating that screening for binding to allosteric sites can result in both positive and negative modulation. The hit compounds have modest effects on TEM activity, but all have higher affinities than previously identified inhibitors, which bind the same cryptic pocket but were found, by chance, via a computational screen targeting the active site. Site-directed mutagenesis of key contact residues predicted by the docking models is used to confirm that the compounds bind in the cryptic pocket as intended. Because hit compounds are identified from docking against both the crystal structure and structures from the MSM, this platform should prove suitable for many proteins, particularly targets whose crystal structures lack obvious druggable pockets, and for identifying both inhibitory and activating small-molecule modulators. PMID:28570708

  15. Multidimensional scaling of ideological landscape on social network sites

    NASA Astrophysics Data System (ADS)

    Lee, Deokjae; Hahn, Kyu S.; Park, Juyong

    2012-02-01

    Social network sites (SNSs) are valuable source of information on various subjects in network science. Recently, political activity of SNSs users has increasing attention and is an interesting interdisciplinary subject of physical and social science. In this work, we measure ideological positions of the legislators of U.S. and South Korea (S.K.) evaluated by Twitter users, using the information employed in the bipartite network structure of the legislators and their Twitter followers. We compare the result with ideological positions constructed from roll call record of the legislators. This shows there is a discrepancy between the ideological positions evaluated by Twitter users and actual positions estimated from roll call votes in S.K. We also asses the ideological positions of the Twitter users themselves and analyze the distribution of the positions.

  16. Telomere formation on macronuclear chromosomes of Oxytricha trifallax and O. fallax: alternatively processed regions have multiple telomere addition sites

    PubMed Central

    Williams, Kevin R; Doak, Thomas G; Herrick, Glenn

    2002-01-01

    Background Ciliates employ massive chromatid breakage and de novo telomere formation during generation of the somatic macronucleus. Positions flanking the 81-MAC locus are reproducibly cut. But those flanking the Common Region are proposed to often escape cutting, generating three nested macronuclear chromosomes, two retaining "arms" still appended to the Common Region. Arm-distal positions must differ (in cis) from the Common Region flanks. Results The Common-Region-flanking positions also differ from the arm-distal positions in that they are "multi-TAS" regions: anchored PCR shows heterogeneous patterns of telomere addition sites, but arm-distal sites do not. The multi-TAS patterns are reproducible, but are sensitive to the sequence of the allele being processed. Thus, random degradation following chromatid cutting does not create this heterogeneity; these telomere addition sites also must be dictated by cis-acting sequences. Conclusions Most ciliates show such micro-heterogeneity in the precise positions of telomere addition sites. Telomerase is believed to be tightly associated with, and act in concert with, the chromatid-cutting nuclease: heterogeneity must be the result of intervening erosion activity. Our "weak-sites" hypothesis explains the correlation between alternative chromatid cutting at the Common Region boundaries and their multi-TAS character: when the chromatid-breakage machine encounters either a weak binding site or a weak cut site at these regions, then telomerase dissociates prematurely, leaving the new end subject to erosion by an exonuclease, which pauses at cis-acting sequences; telomerase eventually heals these resected termini. Finally, we observe TAS positioning influenced by trans-allelic interactions, reminiscent of transvection. PMID:12199911

  17. Reengineered glucose oxidase for amperometric glucose determination in diabetes analytics.

    PubMed

    Arango Gutierrez, Erik; Mundhada, Hemanshu; Meier, Thomas; Duefel, Hartmut; Bocola, Marco; Schwaneberg, Ulrich

    2013-12-15

    Glucose oxidase is an oxidoreductase exhibiting a high β-D-glucose specificity and high stability which renders glucose oxidase well-suited for applications in diabetes care. Nevertheless, GOx activity is highly oxygen dependent which can lead to inaccuracies in amperometric β-D-glucose determinations. Therefore a directed evolution campaign with two rounds of random mutagenesis (SeSaM followed by epPCR), site saturation mutagenesis studies on individual positions, and one simultaneous site saturation library (OmniChange; 4 positions) was performed. A diabetes care well suited mediator (quinone diimine) was selected and the GOx variant (T30V I94V) served as starting point. For directed GOx evolution a microtiter plate detection system based on the quinone diimine mediator was developed and the well-known ABTS-assay was applied in microtiter plate format to validate oxygen independency of improved GOx variants. Two iterative rounds of random diversity generation and screening yielded to two subsets of amino acid positions which mainly improved activity (A173, A332) and oxygen independency (F414, V560). Simultaneous site saturation of all four positions with a reduced subset of amino acids using the OmniChange method yielded finally variant V7 with a 37-fold decreased oxygen dependency (mediator activity: 7.4 U/mg WT, 47.5 U/mg V7; oxygen activity: 172.3 U/mg WT, 30.1 U/mg V7). V7 is still highly β-D-glucose specific, highly active with the quinone diimine mediator and thermal resistance is retained (prerequisite for GOx coating of diabetes test stripes). The latter properties and V7's oxygen insensitivity make V7 a very promising candidate to replace standard GOx in diabetes care applications. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

    2004-08-06

    The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

  19. Long-range Electrostatic Complementarity Governs Substrate Recognition by Human Chymotrypsin C, a Key Regulator of Digestive Enzyme Activation*

    PubMed Central

    Batra, Jyotica; Szabó, András; Caulfield, Thomas R.; Soares, Alexei S.; Sahin-Tóth, Miklós; Radisky, Evette S.

    2013-01-01

    Human chymotrypsin C (CTRC) is a pancreatic serine protease that regulates activation and degradation of trypsinogens and procarboxypeptidases by targeting specific cleavage sites within their zymogen precursors. In cleaving these regulatory sites, which are characterized by multiple flanking acidic residues, CTRC shows substrate specificity that is distinct from that of other isoforms of chymotrypsin and elastase. Here, we report the first crystal structure of active CTRC, determined at 1.9-Å resolution, revealing the structural basis for binding specificity. The structure shows human CTRC bound to the small protein protease inhibitor eglin c, which binds in a substrate-like manner filling the S6-S5′ subsites of the substrate binding cleft. Significant binding affinity derives from burial of preferred hydrophobic residues at the P1, P4, and P2′ positions of CTRC, although acidic P2′ residues can also be accommodated by formation of an interfacial salt bridge. Acidic residues may also be specifically accommodated in the P6 position. The most unique structural feature of CTRC is a ring of intense positive electrostatic surface potential surrounding the primarily hydrophobic substrate binding site. Our results indicate that long-range electrostatic attraction toward substrates of concentrated negative charge governs substrate discrimination, which explains CTRC selectivity in regulating active digestive enzyme levels. PMID:23430245

  20. Enhancing Cooperativity in Bifunctional Acid–Pd Catalysts with Carboxylic Acid-Functionalized Organic Monolayers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coan, Patrick D.; Ellis, Lucas D.; Griffin, Michael B.

    Here, cooperative catalysts containing a combination of noble metal hydrogenation sites and Bronsted acid sites are critical for many reactions, including the deoxygenation (DO) of biomass-derived oxygenates in the upgrading of pyrolysis oil. One route toward the design of cooperative catalysts is to tether two different catalytically active functions so that they are in close proximity while avoiding undesirable interactions that can block active sites. Here, we deposited carboxylic acid (CA)-functionalized organophosphonate monolayers onto Al 2O 3-supported Pd nanoparticle catalysts to prepare bifunctional catalysts containing both Bronsted acid and metal sites. Modification with phosphonic acids (PAs) improved activity and selectivitymore » for gas-phase DO reactions, but the degree of improvement was highly sensitive to both the presence and positioning of the CA group, suggesting a significant contribution from both the PA and CA sites. Short spacer lengths of 1-2 methylene groups between the phosphonate head and CA tail were found to yield the best DO rates and selectivities, whereas longer chains performed similarly to self-assembled monolayers having alkyl tails. Results from a combination of density functional theory and Fourier transform infrared spectroscopy suggested that the enhanced catalyst performance on the optimally positioned CAs was due to the generation of strong acid sites on the Al 2O 3 support adjacent to the metal. Furthermore, the high activity of these sites was found to result from a hydrogen-bonded cyclic structure involving cooperativity between the phosphonate head group and CA tail function. More broadly, these results indicate that functional groups tethered to supports via organic ligands can influence catalytic chemistry on metal nanoparticles.« less

  1. Enhancing Cooperativity in Bifunctional Acid–Pd Catalysts with Carboxylic Acid-Functionalized Organic Monolayers

    DOE PAGES

    Coan, Patrick D.; Ellis, Lucas D.; Griffin, Michael B.; ...

    2018-03-05

    Here, cooperative catalysts containing a combination of noble metal hydrogenation sites and Bronsted acid sites are critical for many reactions, including the deoxygenation (DO) of biomass-derived oxygenates in the upgrading of pyrolysis oil. One route toward the design of cooperative catalysts is to tether two different catalytically active functions so that they are in close proximity while avoiding undesirable interactions that can block active sites. Here, we deposited carboxylic acid (CA)-functionalized organophosphonate monolayers onto Al 2O 3-supported Pd nanoparticle catalysts to prepare bifunctional catalysts containing both Bronsted acid and metal sites. Modification with phosphonic acids (PAs) improved activity and selectivitymore » for gas-phase DO reactions, but the degree of improvement was highly sensitive to both the presence and positioning of the CA group, suggesting a significant contribution from both the PA and CA sites. Short spacer lengths of 1-2 methylene groups between the phosphonate head and CA tail were found to yield the best DO rates and selectivities, whereas longer chains performed similarly to self-assembled monolayers having alkyl tails. Results from a combination of density functional theory and Fourier transform infrared spectroscopy suggested that the enhanced catalyst performance on the optimally positioned CAs was due to the generation of strong acid sites on the Al 2O 3 support adjacent to the metal. Furthermore, the high activity of these sites was found to result from a hydrogen-bonded cyclic structure involving cooperativity between the phosphonate head group and CA tail function. More broadly, these results indicate that functional groups tethered to supports via organic ligands can influence catalytic chemistry on metal nanoparticles.« less

  2. Impact of heavy metal on activity of some microbial enzymes in the riverbed sediments: Ecotoxicological implications in the Ganga River (India).

    PubMed

    Jaiswal, Deepa; Pandey, Jitendra

    2018-04-15

    We studied the extracellular enzyme activity (EEA) in the riverbed sediment along a 518km gradient of the Ganga River receiving carbon and nutrient load from varied human sources. Also, we tested, together with substrate-driven stimulation, if the heavy metal accumulated in the sediment inhibits enzyme activities. Because pristine values are not available, we considered Dev Prayag, a least polluted site located 624km upstream to main study stretch, as a reference site. There were distinct increases in enzyme activities in the sediment along the study gradient from Dev Prayag, however, between-site differences were in concordance with sediment carbon(C), nitrogen (N) and phosphorus (P). Fluorescein diacetate hydrolysis (FDAase), β-glucosidase (Glu) and protease activities showed positive correlation with C, N and P while alkaline phosphatase was found negatively correlated with P. Enzyme activities were found negatively correlated with heavy metal, although ecological risk index (E R i ) varied with site and metal species. Dynamic fit curves showed significant positive correlation between heavy metal and microbial metabolic quotient (qCO 2 ) indicating a decrease in microbial activity in response to increasing heavy metal concentrations. This study forms the first report linking microbial enzyme activities to regional scale sediment heavy metal accumulation in the Ganga River, suggests that the microbial enzyme activities in the riverbed sediment were well associated with the proportion of C, N and P and appeared to be a sensitive indicator of C, N and P accumulation in the river. Heavy metal accumulated in the sediment inhibits enzyme activities, although C rich sediment showed relatively low toxicity due probably to reduced bioavailability of the metal. The study has relevance from ecotoxicological as well as from biomonitoring perspectives. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Mapping the Substrate Binding Site of Phenylacetone Monooxygenase from Thermobifida fusca by Mutational Analysis▿†

    PubMed Central

    Dudek, Hanna M.; de Gonzalo, Gonzalo; Torres Pazmiño, Daniel E.; Stępniak, Piotr; Wyrwicz, Lucjan S.; Rychlewski, Leszek; Fraaije, Marco W.

    2011-01-01

    Baeyer-Villiger monooxygenases catalyze oxidations that are of interest for biocatalytic applications. Among these enzymes, phenylacetone monooxygenase (PAMO) from Thermobifida fusca is the only protein showing remarkable stability. While related enzymes often present a broad substrate scope, PAMO accepts only a limited number of substrates. Due to the absence of a substrate in the elucidated crystal structure of PAMO, the substrate binding site of this protein has not yet been defined. In this study, a structural model of cyclopentanone monooxygenase, which acts on a broad range of compounds, has been prepared and compared with the structure of PAMO. This revealed 15 amino acid positions in the active site of PAMO that may account for its relatively narrow substrate specificity. We designed and analyzed 30 single and multiple mutants in order to verify the role of these positions. Extensive substrate screening revealed several mutants that displayed increased activity and altered regio- or enantioselectivity in Baeyer-Villiger reactions and sulfoxidations. Further substrate profiling resulted in the identification of mutants with improved catalytic properties toward synthetically attractive compounds. Moreover, the thermostability of the mutants was not compromised in comparison to that of the wild-type enzyme. Our data demonstrate that the positions identified within the active site of PAMO, namely, V54, I67, Q152, and A435, contribute to the substrate specificity of this enzyme. These findings will aid in more dedicated and effective redesign of PAMO and related monooxygenases toward an expanded substrate scope. PMID:21724896

  4. Structure-based design of bacterial nitric oxide synthase inhibitors

    DOE PAGES

    Holden, Jeffrey K.; Kang, Soosung; Hollingsworth, Scott A.; ...

    2014-12-18

    Inhibition of bacterial nitric oxide synthase (bNOS) has the potential to improve the efficacy of antimicrobials used to treat infections by Gram-positive pathogens Staphylococcus aureus and Bacillus anthracis. However, inhibitor specificity toward bNOS over the mammalian NOS (mNOS) isoforms remains a challenge because of the near identical NOS active sites. One key structural difference between the NOS isoforms is the amino acid composition of the pterin cofactor binding site that is adjacent to the NOS active site. Previously, we demonstrated that a NOS inhibitor targeting both the active and pterin sites was potent and functioned as an antimicrobial. Here wemore » present additional crystal structures, binding analyses, and bacterial killing studies of inhibitors that target both the active and pterin sites of a bNOS and function as antimicrobials. Lastly, these data provide a framework for continued development of bNOS inhibitors, as each molecule represents an excellent chemical scaffold for the design of isoform selective bNOS inhibitors.« less

  5. Biomarkers of metals exposure in fish from lead-zinc mining areas of Southeastern Missouri, USA

    USGS Publications Warehouse

    Schmitt, C.J.; Whyte, J.J.; Roberts, A.P.; Annis, M.L.; May, T.W.; Tillitt, D.E.

    2007-01-01

    The potential effects of proposed lead-zinc mining in an ecologically sensitive area were assessed by studying a nearby mining district that has been exploited for about 30 y under contemporary environmental regulations and with modern technology. Blood and liver samples representing fish of three species (largescale stoneroller, Campostoma oligolepis, n=91; longear sunfish, Lepomis megalotis, n=105; and northern hog sucker, Hypentelium nigricans, n=20) from 16 sites representing a range of conditions relative to mining activities were collected. Samples were analyzed for metals (also reported in a companion paper) and for biomarkers of metals exposure [erythrocyte ??-aminolevulinic acid dehydratase (ALA-D) activity; concentrations of zinc protoporphyrin (ZPP), iron, and hemoglobin (Hb) in blood; and hepatic metallothionein (MT) gene expression and lipid peroxidation]. Blood lead concentrations were significantly higher and ALA-D activity significantly lower in all species at sites nearest to active lead-zinc mines and in a stream contaminated by historical mining than at reference or downstream sites. ALA-D activity was also negatively correlated with blood lead concentrations in all three species but not with other metals. Iron and Hb concentrations were positively correlated in all three species, but were not correlated with any other metals in blood or liver in any species. MT gene expression was positively correlated with liver zinc concentrations, but neither MT nor lipid peroxidase differences among fish grouped according to lead concentrations were statistically significant. ZPP was not detected by hematofluorometry in most fish, but fish with detectable ZPP were from sites affected by mining. Collectively, these results confirm that metals are released to streams from active lead-zinc mining sites and are accumulated by fish. ?? 2007 Elsevier Inc. All rights reserved.

  6. Active site dynamics of ribonuclease.

    PubMed Central

    Brünger, A T; Brooks, C L; Karplus, M

    1985-01-01

    The stochastic boundary molecular dynamics method is used to study the structure, dynamics, and energetics of the solvated active site of bovine pancreatic ribonuclease A. Simulations of the native enzyme and of the enzyme complexed with the dinucleotide substrate CpA and the transition-state analog uridine vanadate are compared. Structural features and dynamical couplings for ribonuclease residues found in the simulation are consistent with experimental data. Water molecules, most of which are not observed in crystallographic studies, are shown to play an important role in the active site. Hydrogen bonding of residues with water molecules in the free enzyme is found to mimic the substrate-enzyme interactions of residues involved in binding. Networks of water stabilize the cluster of positively charged active site residues. Correlated fluctuations between the uridine vanadate complex and the distant lysine residues are mediated through water and may indicate a possible role for these residues in stabilizing the transition state. Images PMID:3866234

  7. Hydroisomerization of n-Hexane Using Acidified Metal-Organic Framework and Platinum Nanoparticles.

    PubMed

    Sabyrov, Kairat; Jiang, Juncong; Yaghi, Omar M; Somorjai, Gabor A

    2017-09-13

    Exceptionally high surface area and ordered nanopores of a metal-organic framework (MOF) are exploited to encapsulate and homogeneously disperse a considerable amount of phosphotungstic acid (PTA). When combined with platinum nanoparticles positioned on the external surface of the MOF, the construct shows a high catalytic activity for hydroisomerization of n-hexane, a reaction requiring hydrogenation/dehydrogenation and moderate to strong Brønsted acid sites. Characterization of the catalytic activity and acidic sites as a function of PTA loading demonstrates that both the concentration and strength of acidic sites are highest for the catalyst with the largest amount of PTA. The MOF construct containing 60% PTA by weight produces isoalkanes with 100% selectivity and 9-fold increased mass activity as compared to a more traditional aluminosilicate catalyst, further demonstrating the capacity of the MOF to contain a high concentration of active sites necessary for the isomerization reaction.

  8. Increasing the Thermostable Sugar-1-Phosphate Nucleotidylyltransferase Activities of the Archaeal ST0452 Protein through Site Saturation Mutagenesis of the 97th Amino Acid Position.

    PubMed

    Honda, Yuki; Zang, Qian; Shimizu, Yasuhiro; Dadashipour, Mohammad; Zhang, Zilian; Kawarabayasi, Yutaka

    2017-02-01

    The ST0452 protein is a bifunctional protein exhibiting sugar-1-phosphate nucleotidylyltransferase (sugar-1-P NTase) and amino-sugar-1-phosphate acetyltransferase activities and was isolated from the thermophilic archaeon Sulfolobus tokodaii Based on the previous observation that five single mutations increased ST0452 sugar-1-P NTase activity, nine double-mutant ST0452 proteins were generated with the intent of obtaining enzymes exhibiting a further increase in catalysis, but all showed less than 15% of the wild-type N-acetyl-d-glucosamine-1-phosphate uridyltransferase (GlcNAc-1-P UTase) activity. The Y97A mutant exhibited the highest activity of the single-mutant proteins, and thus site saturation mutagenesis of the 97th position (Tyr) was conducted. Six mutants showed both increased GlcNAc-1-P UTase and glucose-1-phosphate uridyltransferase activities, eight mutants showed only enhanced GlcNAc-1-P UTase activity, and six exhibited higher GlcNAc-1-P UTase activity than that of the Y97A mutant. Kinetic analyses of three typical mutants indicated that the increase in sugar-1-P NTase activity was mainly due to an increase in the apparent k cat value. We hypothesized that changing the 97th position (Tyr) to a smaller amino acid with similar electronic properties would increase activity, and thus the Tyr at the corresponding 103rd position of the Escherichia coli GlmU (EcGlmU) enzyme was replaced with the same residues. The Y103N mutant EcGlmU showed increased GlcNAc-1-P UTase activity, revealing that the Tyr at the 97th position of the ST0452 protein (103rd position in EcGlmU) plays an important role in catalysis. The present results provide useful information regarding how to improve the activity of natural enzymes and how to generate powerful enzymes for the industrial production of sugar nucleotides. It is typically difficult to increase enzymatic activity by introducing substitutions into a natural enzyme. However, it was previously found that the ST0452 protein, a thermostable enzyme from the thermophilic archaeon Sulfolobus tokodaii, exhibited increased activity following single amino acid substitutions of Ala. In this study, ST0452 proteins exhibiting a further increase in activity were created using a site saturation mutagenesis strategy at the 97th position. Kinetic analyses showed that the increased activities of the mutant proteins were principally due to increased apparent k cat values. These mutant proteins might suggest clues regarding the mechanism underlying the reaction process and provide very important information for the design of synthetic improved enzymes, and they can be used as powerful biocatalysts for the production of sugar nucleotide molecules. Moreover, this work generated useful proteins for three-dimensional structural analysis clarifying the processes underlying the regulation and mechanism of enzymatic activity. Copyright © 2017 American Society for Microbiology.

  9. Stabilization of bacterially expressed erythropoietin by single site-specific introduction of short branched PEG chains at naturally occurring glycosylation sites.

    PubMed

    Hoffmann, E; Streichert, K; Nischan, N; Seitz, C; Brunner, T; Schwagerus, S; Hackenberger, C P R; Rubini, M

    2016-05-24

    The covalent attachment of polyethylene glycol (PEG) to therapeutic proteins can improve their physicochemical properties. In this work we utilized the non-natural amino acid p-azidophenylalanine (pAzF) in combination with the chemoselective Staudinger-phosphite reaction to install branched PEG chains to recombinant unglycosylated erythropoietin (EPO) at each single naturally occurring glycosylation site. PEGylation with two short 750 or 2000 Da PEG units at positions 24, 38, or 83 significantly decreased unspecific aggregation and proteolytic degradation while biological activity in vitro was preserved or even increased in comparison to full-glycosylated EPO. This site-specific bioconjugation approach permits to analyse the impact of PEGylation at single positions. These results represent an important step towards the engineering of site-specifically modified EPO variants from bacterial expression with increased therapeutic efficacy.

  10. Generation of 3D templates of active sites of proteins with rigid prosthetic groups.

    PubMed

    Nebel, Jean-Christophe

    2006-05-15

    With the increasing availability of protein structures, the generation of biologically meaningful 3D patterns from the simultaneous alignment of several protein structures is an exciting prospect: active sites could be better understood, protein functions and protein 3D structures could be predicted more accurately. Although patterns can already be generated at the fold and topological levels, no system produces high-resolution 3D patterns including atom and cavity positions. To address this challenge, our research focuses on generating patterns from proteins with rigid prosthetic groups. Since these groups are key elements of protein active sites, the generated 3D patterns are expected to be biologically meaningful. In this paper, we present a new approach which allows the generation of 3D patterns from proteins with rigid prosthetic groups. Using 237 protein chains representing proteins containing porphyrin rings, our method was validated by comparing 3D templates generated from homologues with the 3D structure of the proteins they model. Atom positions were predicted reliably: 93% of them had an accuracy of 1.00 A or less. Moreover, similar results were obtained regarding chemical group and cavity positions. Results also suggested our system could contribute to the validation of 3D protein models. Finally, a 3D template was generated for the active site of human cytochrome P450 CYP17, the 3D structure of which is unknown. Its analysis showed that it is biologically meaningful: our method detected the main patterns of the cytochrome P450 superfamily and the motifs linked to catalytic reactions. The 3D template also suggested the position of a residue, which could be involved in a hydrogen bond with CYP17 substrates and the shape and location of a cavity. Comparisons with independently generated 3D models comforted these hypotheses. Alignment software (Nestor3D) is available at http://www.kingston.ac.uk/~ku33185/Nestor3D.html

  11. Use of an Improved Matching Algorithm to Select Scaffolds for Enzyme Design Based on a Complex Active Site Model.

    PubMed

    Huang, Xiaoqiang; Xue, Jing; Lin, Min; Zhu, Yushan

    2016-01-01

    Active site preorganization helps native enzymes electrostatically stabilize the transition state better than the ground state for their primary substrates and achieve significant rate enhancement. In this report, we hypothesize that a complex active site model for active site preorganization modeling should help to create preorganized active site design and afford higher starting activities towards target reactions. Our matching algorithm ProdaMatch was improved by invoking effective pruning strategies and the native active sites for ten scaffolds in a benchmark test set were reproduced. The root-mean squared deviations between the matched transition states and those in the crystal structures were < 1.0 Å for the ten scaffolds, and the repacking calculation results showed that 91% of the hydrogen bonds within the active sites are recovered, indicating that the active sites can be preorganized based on the predicted positions of transition states. The application of the complex active site model for de novo enzyme design was evaluated by scaffold selection using a classic catalytic triad motif for the hydrolysis of p-nitrophenyl acetate. Eighty scaffolds were identified from a scaffold library with 1,491 proteins and four scaffolds were native esterase. Furthermore, enzyme design for complicated substrates was investigated for the hydrolysis of cephalexin using scaffold selection based on two different catalytic motifs. Only three scaffolds were identified from the scaffold library by virtue of the classic catalytic triad-based motif. In contrast, 40 scaffolds were identified using a more flexible, but still preorganized catalytic motif, where one scaffold corresponded to the α-amino acid ester hydrolase that catalyzes the hydrolysis and synthesis of cephalexin. Thus, the complex active site modeling approach for de novo enzyme design with the aid of the improved ProdaMatch program is a promising approach for the creation of active sites with high catalytic efficiencies towards target reactions.

  12. Use of an Improved Matching Algorithm to Select Scaffolds for Enzyme Design Based on a Complex Active Site Model

    PubMed Central

    Huang, Xiaoqiang; Xue, Jing; Lin, Min; Zhu, Yushan

    2016-01-01

    Active site preorganization helps native enzymes electrostatically stabilize the transition state better than the ground state for their primary substrates and achieve significant rate enhancement. In this report, we hypothesize that a complex active site model for active site preorganization modeling should help to create preorganized active site design and afford higher starting activities towards target reactions. Our matching algorithm ProdaMatch was improved by invoking effective pruning strategies and the native active sites for ten scaffolds in a benchmark test set were reproduced. The root-mean squared deviations between the matched transition states and those in the crystal structures were < 1.0 Å for the ten scaffolds, and the repacking calculation results showed that 91% of the hydrogen bonds within the active sites are recovered, indicating that the active sites can be preorganized based on the predicted positions of transition states. The application of the complex active site model for de novo enzyme design was evaluated by scaffold selection using a classic catalytic triad motif for the hydrolysis of p-nitrophenyl acetate. Eighty scaffolds were identified from a scaffold library with 1,491 proteins and four scaffolds were native esterase. Furthermore, enzyme design for complicated substrates was investigated for the hydrolysis of cephalexin using scaffold selection based on two different catalytic motifs. Only three scaffolds were identified from the scaffold library by virtue of the classic catalytic triad-based motif. In contrast, 40 scaffolds were identified using a more flexible, but still preorganized catalytic motif, where one scaffold corresponded to the α-amino acid ester hydrolase that catalyzes the hydrolysis and synthesis of cephalexin. Thus, the complex active site modeling approach for de novo enzyme design with the aid of the improved ProdaMatch program is a promising approach for the creation of active sites with high catalytic efficiencies towards target reactions. PMID:27243223

  13. Role of allosteric switch residue histidine 195 in maintaining active-site asymmetry in presynaptic filaments of bacteriophage T4 UvsX recombinase.

    PubMed

    Farb, Joshua N; Morrical, Scott W

    2009-01-16

    Recombinases of the highly conserved RecA/Rad51 family play central roles in homologous recombination and DNA double-stranded break repair. RecA/Rad51 enzymes form presynaptic filaments on single-stranded DNA (ssDNA) that are allosterically activated to catalyze ATPase and DNA strand-exchange reactions. Information is conveyed between DNA- and ATP-binding sites, in part, by a highly conserved glutamine residue (Gln194 in Escherichia coli RecA) that acts as an allosteric switch. The T4 UvsX protein is a divergent RecA ortholog and contains histidine (His195) in place of glutamine at the allosteric switch position. UvsX and RecA catalyze similar strand-exchange reactions, but differ in other properties. UvsX produces both ADP and AMP as products of its ssDNA-dependent ATPase activity--a property that is unique among characterized recombinases. Details of the kinetics of ssDNA-dependent ATP hydrolysis reactions indicate that UvsX-ssDNA presynaptic filaments are asymmetric and contain two classes of ATPase active sites: one that generates ADP, and another that generates AMP. Active-site asymmetry is reduced by mutations at the His195 position, since UvsX-H195Q and UvsX-H195A mutants both exhibit stronger ssDNA-dependent ATPase activity, with lower cooperativity and markedly higher ADP/AMP product ratios, than wild-type UvsX. Reduced active-site asymmetry correlates strongly with reduced ssDNA-binding affinity and DNA strand-exchange activity in both H195Q and H195A mutants. These and other results support a model in which allosteric switch residue His195 controls the formation of an asymmetric conformation of UvsX-ssDNA filaments that is active in DNA strand exchange. The implications of our findings for UvsX recombination functions, and for RecA functions in general, are discussed.

  14. Molecular basis of Kar9-Bim1 complex function during mating and spindle positioning

    PubMed Central

    Manatschal, Cristina; Farcas, Ana-Maria; Degen, Miriam Steiner; Bayer, Mathias; Kumar, Anil; Landgraf, Christiane; Volkmer, Rudolf; Barral, Yves; Steinmetz, Michel O.

    2016-01-01

    The Kar9 pathway promotes nuclear fusion during mating and spindle alignment during metaphase in budding yeast. How Kar9 supports the different outcome of these two divergent processes is an open question. Here, we show that three sites in the C-terminal disordered domain of Kar9 mediate tight Kar9 interaction with the C-terminal dimerization domain of Bim1 (EB1 orthologue). Site1 and Site2 contain SxIP motifs; however, Site3 defines a novel type of EB1-binding site. Whereas Site2 and Site3 mediate Kar9 recruitment to microtubule tips, nuclear movement, and karyogamy, only Site2 functions in spindle positioning during metaphase. Site1 in turn plays an inhibitory role during mating. Additionally, the Kar9-Bim1 complex is involved in microtubule-independent activities during mating. Together, our data reveal how multiple and partially redundant EB1-binding sites provide a microtubule-associated protein with the means to modulate its biochemical properties to promote different molecular processes during cell proliferation and differentiation. PMID:27682587

  15. Key amino acid residues involved in multi-point binding interactions between brazzein, a sweet protein, and the T1R2-T1R3 human sweet receptor

    PubMed Central

    Assadi-Porter, Fariba M.; Maillet, Emeline L.; Radek, James T.; Quijada, Jeniffer; Markley, John L.; Max, Marianna

    2010-01-01

    The sweet protein brazzein activates the human sweet receptor, a heterodimeric G-protein coupled receptor (GPCR) composed of subunits T1R2 and T1R3. In order to elucidate the key amino acid(s) responsible for this interaction, we mutated residues in brazzein and each of the two subunits of the receptor. The effects of brazzein mutations were assayed by a human taste panel and by an in vitro assay involving receptor subunits expressed recombinantly in human embryonic kidney cells; the effects of the receptor mutations were assayed by the in vitro assay. We mutated surface residues of brazzein at three putative interaction sites: Site 1 (Loop43), Site 2 (N- and C-terminus and adjacent Glu36, Loop33), and Site 3 (Loop9–19). Basic residues in Site 1 and acidic residues in Site 2 were essential for positive responses from each assay. Mutation of Y39A (Site 1) greatly reduced positive responses. A bulky side chain at position 54 (Site 2), rather than a side chain with hydrogen bonding potential, was required for positive responses as was the presence of the native disulfide bond in Loop 9–19 (Site 3). Results from mutagenesis and chimeras of the receptor indicated that brazzein interacts with both T1R2 and T1R3 and that the Venus fly trap module of T1R2 is important for brazzein agonism. With one exception, all mutations of receptor residues at putative interaction sites predicted by wedge models failed to yield the expected decrease in the brazzein response. The exception, hT1R2:R217A-hT1R3, which contained a substitution in lobe 2 at the interface between the two subunits, exhibited a small selective decrease in brazzein activity. However, because the mutation was found to increase the positive cooperativity of binding by multiple ligands proposed to bind both T1R subunits (brazzein, monellin, and sucralose) but not those that bind to a single subunit (neotame and cyclamate), we suggest that this site in involved in subunit-subunit interaction rather than direct brazzein binding. Results from this study support a multipoint interaction between brazzein and the sweet receptor by some mechanism other than the proposed wedge models. PMID:20302879

  16. Site-directed mutagenesis of α-L-rhamnosidase from Alternaria sp. L1 to enhance synthesis yield of reverse hydrolysis based on rational design.

    PubMed

    Xu, Li; Liu, Xiaohong; Yin, Zhenhao; Liu, Qian; Lu, Lili; Xiao, Min

    2016-12-01

    The α-L-rhamnosidase catalyzes the hydrolytic release of rhamnose from polysaccharides and glycosides and is widely used due to its applications in a variety of industrial processes. Our previous work reported that a wild-type α-L-rhamnosidase (RhaL1) from Alternaria sp. L1 could synthesize rhamnose-containing chemicals (RCCs) though reverse hydrolysis reaction with inexpensive rhamnose as glycosyl donor. To enhance the yield of reverse hydrolysis reaction and to determine the amino acid residues essential for the catalytic activity of RhaL1, site-directed mutagenesis of 11 residues was performed in this study. Through rationally designed mutations, the critical amino acid residues which may form direct or solvent-mediated hydrogen bonds with donor rhamnose (Asp 252 , Asp 257 , Asp 264 , Glu 530 , Arg 548 , His 553 , and Trp 555 ) and may form the hydrophobic pocket in stabilizing donor (Trp 261 , Tyr 302 , Tyr 316 , and Trp 369 ) in active-site of RhaL1 were analyzed, and three positive mutants (W261Y, Y302F, and Y316F) with improved product yield stood out. From the three positive variants, mutant W261Y accelerated the reverse hydrolysis with a prominent increase (43.7 %) in relative yield compared to the wild-type enzyme. Based on the 3D structural modeling, we supposed that the improved yield of mutant W261Y is due to the adjustment of the spatial position of the putative catalytic acid residue Asp 257 . Mutant W261Y also exhibited a shift in the pH-activity profile in hydrolysis reaction, indicating that introducing of a polar residue in the active site cavity may affect the catalysis behavior of the enzyme.

  17. Hormone activation induces nucleosome positioning in vivo

    PubMed Central

    Belikov, Sergey; Gelius, Birgitta; Almouzni, Geneviève; Wrange, Örjan

    2000-01-01

    The mouse mammary tumor virus (MMTV) promoter is induced by glucocorticoid hormone. A robust hormone- and receptor-dependent activation could be reproduced in Xenopus laevis oocytes. The homogeneous response in this system allowed a detailed analysis of the transition in chromatin structure following hormone activation. This revealed two novel findings: hormone activation led to the establishment of specific translational positioning of nucleosomes despite the lack of significant positioning in the inactive state; and, in the active promoter, a subnucleosomal particle encompassing the glucocorticoid receptor (GR)-binding region was detected. The presence of only a single GR-binding site was sufficient for the structural transition to occur. Both basal promoter elements and ongoing transcription were dispensable. These data reveal a stepwise process in the transcriptional activation by glucocorticoid hormone. PMID:10698943

  18. Novel donepezil-based inhibitors of acetyl- and butyrylcholinesterase and acetylcholinesterase-induced beta-amyloid aggregation.

    PubMed

    Camps, Pelayo; Formosa, Xavier; Galdeano, Carles; Gómez, Tània; Muñoz-Torrero, Diego; Scarpellini, Michele; Viayna, Elisabet; Badia, Albert; Clos, M Victòria; Camins, Antoni; Pallàs, Mercè; Bartolini, Manuela; Mancini, Francesca; Andrisano, Vincenza; Estelrich, Joan; Lizondo, Mònica; Bidon-Chanal, Axel; Luque, F Javier

    2008-06-26

    A novel series of donepezil-tacrine hybrids designed to simultaneously interact with the active, peripheral and midgorge binding sites of acetylcholinesterase (AChE) have been synthesized and tested for their ability to inhibit AChE, butyrylcholinesterase (BChE), and AChE-induced A beta aggregation. These compounds consist of a unit of tacrine or 6-chlorotacrine, which occupies the same position as tacrine at the AChE active site, and the 5,6-dimethoxy-2-[(4-piperidinyl)methyl]-1-indanone moiety of donepezil (or the indane derivative thereof), whose position along the enzyme gorge and the peripheral site can be modulated by a suitable tether that connects tacrine and donepezil fragments. All of the new compounds are highly potent inhibitors of bovine and human AChE and BChE, exhibiting IC50 values in the subnanomolar or low nanomolar range in most cases. Moreover, six out of the eight hybrids of the series, particularly those bearing an indane moiety, exhibit a significant A beta antiaggregating activity, which makes them promising anti-Alzheimer drug candidates.

  19. Probing the role of highly conserved residues in triosephosphate isomerase--analysis of site specific mutants at positions 64 and 75 in the Plasmodial enzyme.

    PubMed

    Bandyopadhyay, Debarati; Murthy, Mathur R N; Balaram, Hemalatha; Balaram, Padmanabhan

    2015-10-01

    Highly conserved residues in enzymes are often found to be clustered close to active sites, suggesting that functional constraints dictate the nature of amino acid residues accommodated at these sites. Using the Plasmodium falciparum triosephosphate isomerase (PfTIM) enzyme (EC 5.3.1.1) as a template, we have examined the effects of mutations at positions 64 and 75, which are not directly involved in the proton transfer cycle. Thr (T) occurring at position 75 is completely conserved, whereas only Gln (Q) and Glu (E) are accommodated at position 64. Biophysical and kinetic data are reported for four T75 (T75S/V/C/N) and two Q64 (Q64N/E) mutants. The dimeric structure is weakened in the Q64E and Q64N mutants, whereas dimer integrity is unimpaired in all four T75 mutants. Measurement of the concentration dependence of enzyme activity permits an estimate of Kd values for dimer dissociation (Q64N = 73.7 ± 9.2 nm and Q64E = 44.6 ± 8.4 nm). The T75S/V/C mutants have activities comparable to the wild-type enzyme, whereas a fourfold drop is observed for T75N. All four T75 mutants show a dramatic fall in activity between 35 °C and 45 °C. Crystal structure determination of the T75S/V/N mutants provides insights into the variations in local interactions, with the T75N mutant showing the largest changes. Hydrogen-bond interactions determine dimer stability restricting the choice of residues at position 64 to Gln (Q) and Glu (E). At position 75, the overwhelming preference for Thr (T) may be dictated by the imperative of maintaining temperature stability of enzyme activity. Structural data have been deposited in the Protein Data Bank under accession numbers 4ZZ9, 5BMW, 5BMX, 5BNK and 5BRB. © 2015 FEBS.

  20. Hydrothermal activity lowers trophic diversity in Antarctic hydrothermal sediments

    NASA Astrophysics Data System (ADS)

    Bell, James B.; Reid, William D. K.; Pearce, David A.; Glover, Adrian G.; Sweeting, Christopher J.; Newton, Jason; Woulds, Clare

    2017-12-01

    Hydrothermal sediments are those in which hydrothermal fluid is discharged through sediments and are one of the least studied deep-sea ecosystems. We present a combination of microbial and biochemical data to assess trophodynamics between and within hydrothermal and background areas of the Bransfield Strait (1050-1647 m of depth). Microbial composition, biomass, and fatty acid signatures varied widely between and within hydrothermally active and background sites, providing evidence of diverse metabolic activity. Several species had different feeding strategies and trophic positions between hydrothermally active and inactive areas, and the stable isotope values of consumers were not consistent with feeding morphology. Niche area and the diversity of microbial fatty acids was lowest at the most hydrothermally active site, reflecting trends in species diversity. Faunal uptake of chemosynthetically produced organics was relatively limited but was detected at both hydrothermal and non-hydrothermal sites, potentially suggesting that hydrothermal activity can affect trophodynamics over a much wider area than previously thought.

  1. Regulation of hepatitis B virus ENI enhancer activity by hepatocyte-enriched transcription factor HNF3.

    PubMed

    Chen, M; Hieng, S; Qian, X; Costa, R; Ou, J H

    1994-11-15

    Hepatitis B virus (HBV) ENI enhancer can activate the expression of HBV and non-HBV genes in a liver-specific manner. By performing the electrophoretic mobility-shift assays, we demonstrated that the three related, liver-enriched, transcription factors, HNF3 alpha, HNF3 beta, and HNF3 gamma could all bind to the 2c site of HBV ENI enhancer. Mutations introduced in the 2c site to abolish the binding by HNF3 reduced the enhancer activity approximately 15-fold. Moreover, expression of HNF3 antisense sequences to suppress the expression of HNF3 in Huh-7 hepatoma cells led to reduction of the ENI enhancer activity. These results indicate that HNF3 positively regulates the ENI enhancer activity and this regulation is most likely mediated through the 2c site. The requirement of HNF3 for the ENI enhancer activity could explain the liver specificity of this enhancer element.

  2. The Crystal Structure Analysis of Group B Streptococcus Sortase C1: A Model for the ;Lid; Movement upon Substrate Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khare, Baldeep; Fu, Zheng-Qing; Huang, I-Hsiu

    2012-02-07

    A unique feature of the class-C-type sortases, enzymes essential for Gram-positive pilus biogenesis, is the presence of a flexible 'lid' anchored in the active site. However, the mechanistic details of the 'lid' displacement, suggested to be a critical prelude for enzyme catalysis, are not yet known. This is partly due to the absence of enzyme-substrate and enzyme-inhibitor complex crystal structures. We have recently described the crystal structures of the Streptococcus agalactiae SAG2603 V/R sortase SrtC1 in two space groups (type II and type III) and that of its 'lid' mutant and proposed a role of the 'lid' as a protectormore » of the active-site hydrophobic environment. Here, we report the crystal structures of SAG2603 V/R sortase C1 in a different space group (type I) and that of its complex with a small-molecule cysteine protease inhibitor. We observe that the catalytic Cys residue is covalently linked to the small-molecule inhibitor without lid displacement. However, the type I structure provides a view of the sortase SrtC1 lid displacement while having structural elements similar to a substrate sorting motif suitably positioned in the active site. We propose that these major conformational changes seen in the presence of a substrate mimic in the active site may represent universal features of class C sortase substrate recognition and enzyme activation.« less

  3. Bioavailability of Pb and Zn from mine tailings as indicated by erythrocyte aminolevulinic acid dehydratase (ALA-D) activity in suckers (Pisces: catostomidae)

    USGS Publications Warehouse

    Schmitt, Christopher J.; Dwyer, F. James; Finger, Susan E.

    1984-01-01

    The activity of the erythrocyte enzyme δ-aminolevulinic acid dehydratase (ALA-D) was measured in 35 catostomids (black redhorse, Moxostoma duquesnei; golden redhorse, M. erythrurum; northern hogsucker, Hypentelium nigricans) collected from three sites on a stream contaminated with Pb-, Cd-, and Zn-rich mine tailings and from an uncontaminated site upstream. Enzyme activity was expressed in terms of hemoglobin (Hb), DNA, and protein concentrations; these variables can be determined in the laboratory on once-frozen blood samples. Concentrations of Pb and Zn in blood and of Pb in edible tissues were significantly higher, and ALA-D activity was significantly lower, at all three contaminated sites than upstream. At the most contaminated site, ALA-D activity was 62–67% lower than upstream. Lead concentrations in the edible tissues and in blood were positively correlated (r = 0.80), whereas ALA-D activity was negatively correlated with Pb in blood (r = −0.70) and in edible tissues (r = −0.59). Five statistically significant relations between Pb and Zn in blood and ALA-D activity were determined. The two models that explained the highest percentage (> 74%) of the total variance also included factors related to Hb concentration. All five significant models included negative coefficients for variables that represented Pb in blood and positive coefficients for Zn in blood. The ALA-D assay with results standardized to Hb concentration represents an expedient alternative to the more traditional hematocrit standardization, and the measurement of ALA-D activity by this method can be used to document exposure of fish to environmental Pb.

  4. Simulation analysis of formycin 5?-monophosphate analog substrates in the ricin A-chain active site

    NASA Astrophysics Data System (ADS)

    Olson, Mark A.; Scovill, John P.; Hack, Dallas C.

    1995-06-01

    Ricin is an RNA N-glycosidase that hydrolyzes a single adenine base from a conserved loop of 28S ribosomal RNA, thus inactivating protein synthesis. Molecular-dynamics simulation methods are used to analyze the structural interactions and thermodynamics that govern the binding of formycin 5'-monophosphate (FMP) and several of its analogs to the active site of ricin A-chain. Simulations are carried out initiated from the X-ray crystal structure of the ricin-FMP complex with the ligand modeled as a dianion, monoanion and zwitterion. Relative changes in binding free energies are estimated for FMP analogs constructed from amino substitutions at the 2- and 2'-positions, and from hydroxyl substitution at the 2'-position.

  5. Simulation analysis of formycin 5'-monophosphate analog substrates in the ricin A-chain active site.

    PubMed

    Olson, M A; Scovill, J P; Hack, D C

    1995-06-01

    Ricin is an RNA N-glycosidase that hydrolyzes a single adenine base from a conserved loop of 28S ribosomal RNA, thus inactivating protein synthesis. Molecular-dynamics simulation methods are used to analyze the structural interactions and thermodynamics that govern the binding of formycin 5'-monophosphate (FMP) and several of its analogs to the active site of ricin A-chain. Simulations are carried out initiated from the X-ray crystal structure of the ricin-FMP complex with the ligand modeled as a dianion, monoanion and zwitterion. Relative changes in binding free energies are estimated for FMP analogs constructed from amino substitutions at the 2- and 2'-positions, and from hydroxyl substitution at the 2'-position.

  6. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

    2004-08-06

    Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

  7. Non-active site mutation (Q123A) in New Delhi metallo-β-lactamase (NDM-1) enhanced its enzyme activity.

    PubMed

    Ali, Abid; Azam, Mohd W; Khan, Asad U

    2018-06-01

    New Delhi metallo β-lactamase-1 is one of the carbapenemases, causing hydrolysis of almost all β-lactamase antibiotics. Seventeen different NDM variants have been reported so far, they varied in their sequences either by single or multiple amino acid substitutions. Hence, it is important to understand its structural and functional relation. In the earlier studies role of active site residues has been studied but non-active site residues has not studied in detail. Therefore, we have initiated to further comprehend its structure and function relation by mutating some of its non-active site residues. A laboratory mutant of NDM-1 was generated by PCR-based site-directed mutagenesis, replacing Q to A at 123 position. The MICs of imipenem and meropenem for NDM-1 Q123A were found increased by 2 fold as compare to wild type and so the hydrolytic activity was enhanced (Kcat/Km) as compared to NDM-1 wild type. GOLD fitness scores were also found in favour of kinetics data. Secondary structure for α-helical content was determined by Far-UV circular dichroism (CD), which showed significant conformational changes. We conclude a noteworthy role of non-active-site amino acid residues in the catalytic activity of NDM-1. This study also provides an insight of emergence of new variants through natural evolution. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Computational and Biochemical Docking of the Irreversible Cocaine Analog RTI 82 Directly Demonstrates Ligand Positioning in the Dopamine Transporter Central Substrate-binding Site*

    PubMed Central

    Dahal, Rejwi Acharya; Pramod, Akula Bala; Sharma, Babita; Krout, Danielle; Foster, James D.; Cha, Joo Hwan; Cao, Jianjing; Newman, Amy Hauck; Lever, John R.; Vaughan, Roxanne A.; Henry, L. Keith

    2014-01-01

    The dopamine transporter (DAT) functions as a key regulator of dopaminergic neurotransmission via re-uptake of synaptic dopamine (DA). Cocaine binding to DAT blocks this activity and elevates extracellular DA, leading to psychomotor stimulation and addiction, but the mechanisms by which cocaine interacts with DAT and inhibits transport remain incompletely understood. Here, we addressed these questions using computational and biochemical methodologies to localize the binding and adduction sites of the photoactivatable irreversible cocaine analog 3β-(p-chlorophenyl)tropane-2β-carboxylic acid, 4′-azido-3′-iodophenylethyl ester ([125I]RTI 82). Comparative modeling and small molecule docking indicated that the tropane pharmacophore of RTI 82 was positioned in the central DA active site with an orientation that juxtaposed the aryliodoazide group for cross-linking to rat DAT Phe-319. This prediction was verified by focused methionine substitution of residues flanking this site followed by cyanogen bromide mapping of the [125I]RTI 82-labeled mutants and by the substituted cysteine accessibility method protection analyses. These findings provide positive functional evidence linking tropane pharmacophore interaction with the core substrate-binding site and support a competitive mechanism for transport inhibition. This synergistic application of computational and biochemical methodologies overcomes many uncertainties inherent in other approaches and furnishes a schematic framework for elucidating the ligand-protein interactions of other classes of DA transport inhibitors. PMID:25179220

  9. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  10. The structure of the TsaB/TsaD/TsaE complex reveals an unexpected mechanism for the bacterial t6A tRNA-modification.

    PubMed

    Missoury, Sophia; Plancqueel, Stéphane; Li de la Sierra-Gallay, Ines; Zhang, Wenhua; Liger, Dominique; Durand, Dominique; Dammak, Raoudha; Collinet, Bruno; van Tilbeurgh, Herman

    2018-05-08

    The universal N6-threonylcarbamoyladenosine (t6A) modification at position A37 of ANN-decoding tRNAs is essential for translational fidelity. In bacteria the TsaC enzyme first synthesizes an l-threonylcarbamoyladenylate (TC-AMP) intermediate. In cooperation with TsaB and TsaE, TsaD then transfers the l-threonylcarbamoyl-moiety from TC-AMP onto tRNA. We determined the crystal structure of the TsaB-TsaE-TsaD (TsaBDE) complex of Thermotoga maritima in presence of a non-hydrolysable AMPCPP. TsaE is positioned at the entrance of the active site pocket of TsaD, contacting both the TsaB and TsaD subunits and prohibiting simultaneous tRNA binding. AMPCPP occupies the ATP binding site of TsaE and is sandwiched between TsaE and TsaD. Unexpectedly, the binding of TsaE partially denatures the active site of TsaD causing loss of its essential metal binding sites. TsaE interferes in a pre- or post-catalytic step and its binding to TsaBD is regulated by ATP hydrolysis. This novel binding mode and activation mechanism of TsaE offers good opportunities for antimicrobial drug development.

  11. Automating ATLAS Computing Operations using the Site Status Board

    NASA Astrophysics Data System (ADS)

    J, Andreeva; Iglesias C, Borrego; S, Campana; Girolamo A, Di; I, Dzhunov; Curull X, Espinal; S, Gayazov; E, Magradze; M, Nowotka M.; L, Rinaldi; P, Saiz; J, Schovancova; A, Stewart G.; M, Wright

    2012-12-01

    The automation of operations is essential to reduce manpower costs and improve the reliability of the system. The Site Status Board (SSB) is a framework which allows Virtual Organizations to monitor their computing activities at distributed sites and to evaluate site performance. The ATLAS experiment intensively uses the SSB for the distributed computing shifts, for estimating data processing and data transfer efficiencies at a particular site, and for implementing automatic exclusion of sites from computing activities, in case of potential problems. The ATLAS SSB provides a real-time aggregated monitoring view and keeps the history of the monitoring metrics. Based on this history, usability of a site from the perspective of ATLAS is calculated. The paper will describe how the SSB is integrated in the ATLAS operations and computing infrastructure and will cover implementation details of the ATLAS SSB sensors and alarm system, based on the information in the SSB. It will demonstrate the positive impact of the use of the SSB on the overall performance of ATLAS computing activities and will overview future plans.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yanli; Sheng, Gang; Juranek, Stefan

    The slicer activity of the RNA-induced silencing complex is associated with argonaute, the RNase H-like PIWI domain of which catalyses guide-strand-mediated sequence-specific cleavage of target messenger RNA. Here we report on the crystal structure of Thermus thermophilus argonaute bound to a 5'-phosphorylated 21-base DNA guide strand, thereby identifying the nucleic-acid-binding channel positioned between the PAZ- and PIWI-containing lobes, as well as the pivot-like conformational changes associated with complex formation. The bound guide strand is anchored at both of its ends, with the solvent-exposed Watson-Crick edges of stacked bases 2 to 6 positioned for nucleation with the mRNA target, whereas twomore » critically positioned arginines lock bases 10 and 11 at the cleavage site into an unanticipated orthogonal alignment. Biochemical studies indicate that key amino acid residues at the active site and those lining the 5'-phosphate-binding pocket made up of the Mid domain are critical for cleavage activity, whereas alterations of residues lining the 2-nucleotide 3'-end-binding pocket made up of the PAZ domain show little effect.« less

  13. Phosphoproteomics Profiling of Tobacco Mature Pollen and Pollen Activated in vitro *

    PubMed Central

    Fíla, Jan; Radau, Sonja; Matros, Andrea; Hartmann, Anja; Scholz, Uwe; Feciková, Jana; Mock, Hans-Peter; Čapková, Věra; Zahedi, René Peiman; Honys, David

    2016-01-01

    Tobacco mature pollen has extremely desiccated cytoplasm, and is metabolically quiescent. Upon re-hydration it becomes metabolically active and that results in later emergence of rapidly growing pollen tube. These changes in cytoplasm hydration and metabolic activity are accompanied by protein phosphorylation. In this study, we subjected mature pollen, 5-min-activated pollen, and 30-min-activated pollen to TCA/acetone protein extraction, trypsin digestion and phosphopeptide enrichment by titanium dioxide. The enriched fraction was subjected to nLC-MS/MS. We identified 471 phosphopeptides that carried 432 phosphorylation sites, position of which was exactly matched by mass spectrometry. These 471 phosphopeptides were assigned to 301 phosphoproteins, because some proteins carried more phosphorylation sites. Of the 13 functional groups, the majority of proteins were put into these categories: transcription, protein synthesis, protein destination and storage, and signal transduction. Many proteins were of unknown function, reflecting the fact that male gametophyte contains many specific proteins that have not been fully functionally annotated. The quantitative data highlighted the dynamics of protein phosphorylation during pollen activation; the identified phosphopeptides were divided into seven groups based on the regulatory trends. The major group comprised mature pollen-specific phosphopeptides that were dephosphorylated during pollen activation. Several phosphopeptides representing the same phosphoprotein had different regulation, which pinpointed the complexity of protein phosphorylation and its clear functional context. Collectively, we showed the first phosphoproteomics data on activated pollen where the position of phosphorylation sites was clearly demonstrated and regulatory kinetics was resolved. PMID:26792808

  14. Influence of a Confined Methanol Solvent on the Reactivity of Active Sites in UiO-66.

    PubMed

    Caratelli, Chiara; Hajek, Julianna; Rogge, Sven M J; Vandenbrande, Steven; Meijer, Evert Jan; Waroquier, Michel; Van Speybroeck, Veronique

    2018-02-19

    UiO-66, composed of Zr-oxide bricks and terephthalate linkers, is currently one of the most studied metal-organic frameworks due to its exceptional stability. Defects can be introduced in the structure, creating undercoordinated Zr atoms which are Lewis acid sites. Here, additional Brønsted sites can be generated by coordinated protic species from the solvent. In this Article, a multilevel modeling approach was applied to unravel the effect of a confined methanol solvent on the active sites in UiO-66. First, active sites were explored with static periodic density functional theory calculations to investigate adsorption of water and methanol. Solvent was then introduced in the pores with grand canonical Monte Carlo simulations, followed by a series of molecular dynamics simulations at operating conditions. A hydrogen-bonded network of methanol molecules is formed, allowing the protons to shuttle between solvent methanol, adsorbed water, and the inorganic brick. Upon deprotonation of an active site, the methanol solvent aids the transfer of protons and stabilizes charged configurations via hydrogen bonding, which could be crucial in stabilizing reactive intermediates. The multilevel modeling approach adopted here sheds light on the important role of a confined solvent on the active sites in the UiO-66 material, introducing dynamic acidity in the system at finite temperatures by which protons may be easily shuttled from various positions at the active sites. © 2018 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  15. Uncovering the determinants of a highly perturbed tyrosine pKa in the active site of ketosteroid isomerase.

    PubMed

    Schwans, Jason P; Sunden, Fanny; Gonzalez, Ana; Tsai, Yingssu; Herschlag, Daniel

    2013-11-05

    Within the idiosyncratic enzyme active-site environment, side chain and ligand pKa values can be profoundly perturbed relative to their values in aqueous solution. Whereas structural inspection of systems has often attributed perturbed pKa values to dominant contributions from placement near charged groups or within hydrophobic pockets, Tyr57 of a Pseudomonas putida ketosteroid isomerase (KSI) mutant, suggested to have a pKa perturbed by nearly 4 units to 6.3, is situated within a solvent-exposed active site devoid of cationic side chains, metal ions, or cofactors. Extensive comparisons among 45 variants with mutations in and around the KSI active site, along with protein semisynthesis, (13)C NMR spectroscopy, absorbance spectroscopy, and X-ray crystallography, was used to unravel the basis for this perturbed Tyr pKa. The results suggest that the origin of large energetic perturbations are more complex than suggested by visual inspection. For example, the introduction of positively charged residues near Tyr57 raises its pKa rather than lowers it; this effect, and part of the increase in the Tyr pKa from the introduction of nearby anionic groups, arises from accompanying active-site structural rearrangements. Other mutations with large effects also cause structural perturbations or appear to displace a structured water molecule that is part of a stabilizing hydrogen-bond network. Our results lead to a model in which three hydrogen bonds are donated to the stabilized ionized Tyr, with these hydrogen-bond donors, two Tyr side chains, and a water molecule positioned by other side chains and by a water-mediated hydrogen-bond network. These results support the notion that large energetic effects are often the consequence of multiple stabilizing interactions rather than a single dominant interaction. Most generally, this work provides a case study for how extensive and comprehensive comparisons via site-directed mutagenesis in a tight feedback loop with structural analysis can greatly facilitate our understanding of enzyme active-site energetics. The extensive data set provided may also be a valuable resource for those wishing to extensively test computational approaches for determining enzymatic pKa values and energetic effects.

  16. Uncovering the Determinants of a Highly Perturbed Tyrosine pKa in the Active Site of Ketosteroid Isomerase†

    PubMed Central

    Schwans, Jason P.; Sunden, Fanny; Gonzalez, Ana; Tsai, Yingssu; Herschlag, Daniel

    2013-01-01

    Within the idiosyncratic enzyme active site environment, side chain and ligand pKa values can be profoundly perturbed relative to their values in aqueous solution. Whereas structural inspection of systems has often attributed perturbed pKa values to dominant contributions from placement near to charged groups or within hydrophobic pockets, Tyr57 of a P. putida ketosteroid isomerase (KSI) mutant, suggested to have a pKa perturbed by nearly 4 units to 6.3, is situated within a solvent-exposed active site devoid of cationic side chains, metal ions, or cofactors. Extensive comparisons among 45 variants with mutations in and around the KSI active site, along with protein semi-synthesis, 13C NMR spectroscopy, absorbance spectroscopy, and x-ray crystallography, was used to unravel the basis for this perturbed Tyr pKa. The results suggest that the origin of large energetic perturbations are more complex than suggested by visual inspection. For example, the introduction of positively charged residues near Tyr57 raises its pKa rather than lowers it; this effect, and part of the increase in the Tyr pKa from introduction of nearby anionic groups arise from accompanying active site structural rearrangements. Other mutations with large effects also cause structural perturbations or appear to displace a structured water molecule that is part of a stabilizing hydrogen bond network. Our results lead to a model in which three hydrogen bonds are donated to the stabilized ionized Tyr, with these hydrogen bond donors, two Tyr side chains and a water molecule, positioned by other side chains and by a water-mediated hydrogen bond network. These results support the notion that large energetic effects are often the consequence of multiple stabilizing interactions, rather than a single dominant interaction. Most generally, this work provides a case study for how extensive and comprehensive comparisons via site-directed mutagenesis in a tight feedback loop with structural analysis can greatly facilitate our understanding of enzyme active site energetics. The extensive dataset provided may also be a valuable resource for those wishing to extensively test computational approaches for determining enzymatic pKa values and energetic effects. PMID:24151972

  17. Integration of High-Risk Human Papillomavirus into Cellular Cancer-Related Genes in Head and Neck Cancer Cell Lines

    PubMed Central

    Walline, Heather M; Komarck, Christine M; McHugh, Jonathan B; Tang, Alice L; Owen, John H; Teh, Bin T; McKean, Erin; Glover, Thomas; Graham, Martin P; Prince, Mark E; Chepeha, Douglas B; Chinn, Steven B; Ferris, Robert L; Gollin, Susanne M; Hoffmann, Thomas K; Bier, Henning; Brakenhoff, Ruud; Bradford, Carol R; Carey, Thomas E

    2017-01-01

    Background HPV-positive oropharyngeal cancer is generally associated with excellent response to therapy, but some HPV-positive tumors progress despite aggressive therapy. This study evaluates viral oncogene expression and viral integration sites in HPV16 and HPV18-positive squamous carcinoma cell lines. Methods E6-E7 alternate transcripts were assessed by RT-PCR. Detection of integrated papillomavirus sequences (DIPS-PCR) and sequencing identified viral insertion sites and affected host genes. Cellular gene expression was assessed across viral integration sites. Results All HPV-positive cell lines expressed alternate HPVE6/E7 splicing indicative of active viral oncogenesis. HPV integration occurred within cancer-related genes TP63, DCC, JAK1, TERT, ATR, ETV6, PGR, PTPRN2, and TMEM237 in 8 HNSCC lines but UM-SCC-105 and UM-GCC-1 had only intergenic integration. Conclusions HPV integration into cancer-related genes occurred in 7/9 HPV-positive cell lines and of these six were from tumors that progressed. HPV integration into cancer-related genes may be a secondary carcinogenic driver in HPV-driven tumors. PMID:28236344

  18. The "Janus face" of the thrombin binding aptamer: Investigating the anticoagulant and antiproliferative properties through straightforward chemical modifications.

    PubMed

    Esposito, Veronica; Russo, Annapina; Amato, Teresa; Vellecco, Valentina; Bucci, Mariarosaria; Mayol, Luciano; Russo, Giulia; Virgilio, Antonella; Galeone, Aldo

    2018-02-01

    The thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative activities. Its chemico-physical and/or biological properties can be tuned by the site-specific replacement of selected residues. Four oligodeoxynucleotides (ODNs) based on the TBA sequence (5'-GGTTGGTGTGGTTGG-3') and containing 2'-deoxyuridine (U) or 5-bromo-2'-deoxyuridine (B) residues at positions 4 or 13 have been investigated by NMR and CD techniques. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay) have been tested and compared with two further ODNs containing 5-hydroxymethyl-2'-deoxyuridine (H) residues in the same positions, previously investigated. The CD and NMR data suggest that all the investigated ODNs are able to form G-quadruplexes strictly resembling that of TBA. The introduction of B residues in positions 4 or 13 increases the melting temperature of the modified aptamers by 7 °C. The replacement of thymidines with U in the same positions results in an enhanced anticoagulant activity compared to TBA, also at low ODN concentration. Although all ODNs show antiproliferative properties, only TBA derivatives containing H in the positions 4 and 13 lose the anticoagulant activity and remarkably preserve the antiproliferative one. All ODNs have shown antiproliferative activities against two cancer cell lines but only those with U and B are endowed with anticoagulant activities similar or improved compared to TBA. The appropriate site-specific replacement of the residues in the TT loops of TBA with commercially available thymine analogues is a useful strategy either to improve the anticoagulant activity or to preserve the antiproliferative properties by quenching the anticoagulant ones. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Enzyme/non-enzyme discrimination and prediction of enzyme active site location using charge-based methods.

    PubMed

    Bate, Paul; Warwicker, Jim

    2004-07-02

    Calculations of charge interactions complement analysis of a characterised active site, rationalising pH-dependence of activity and transition state stabilisation. Prediction of active site location through large DeltapK(a)s or electrostatic strain is relevant for structural genomics. We report a study of ionisable groups in a set of 20 enzymes, finding that false positives obscure predictive potential. In a larger set of 156 enzymes, peaks in solvent-space electrostatic properties are calculated. Both electric field and potential match well to active site location. The best correlation is found with electrostatic potential calculated from uniform charge density over enzyme volume, rather than from assignment of a standard atom-specific charge set. Studying a shell around each molecule, for 77% of enzymes the potential peak is within that 5% of the shell closest to the active site centre, and 86% within 10%. Active site identification by largest cleft, also with projection onto a shell, gives 58% of enzymes for which the centre of the largest cleft lies within 5% of the active site, and 70% within 10%. Dielectric boundary conditions emphasise clefts in the uniform charge density method, which is suited to recognition of binding pockets embedded within larger clefts. The variation of peak potential with distance from active site, and comparison between enzyme and non-enzyme sets, gives an optimal threshold distinguishing enzyme from non-enzyme. We find that 87% of the enzyme set exceeds the threshold as compared to 29% of the non-enzyme set. Enzyme/non-enzyme homologues, "structural genomics" annotated proteins and catalytic/non-catalytic RNAs are studied in this context.

  20. Mechanistic Insights into Glucan Phosphatase Activity against Polyglucan Substrates*

    PubMed Central

    Meekins, David A.; Raththagala, Madushi; Auger, Kyle D.; Turner, Benjamin D.; Santelia, Diana; Kötting, Oliver; Gentry, Matthew S.; Vander Kooi, Craig W.

    2015-01-01

    Glucan phosphatases are central to the regulation of starch and glycogen metabolism. Plants contain two known glucan phosphatases, Starch EXcess4 (SEX4) and Like Sex Four2 (LSF2), which dephosphorylate starch. Starch is water-insoluble and reversible phosphorylation solubilizes its outer surface allowing processive degradation. Vertebrates contain a single known glucan phosphatase, laforin, that dephosphorylates glycogen. In the absence of laforin, water-soluble glycogen becomes insoluble, leading to the neurodegenerative disorder Lafora Disease. Because of their essential role in starch and glycogen metabolism glucan phosphatases are of significant interest, yet a comparative analysis of their activities against diverse glucan substrates has not been established. We identify active site residues required for specific glucan dephosphorylation, defining a glucan phosphatase signature motif (CζAGΨGR) in the active site loop. We further explore the basis for phosphate position-specific activity of these enzymes and determine that their diverse phosphate position-specific activity is governed by the phosphatase domain. In addition, we find key differences in glucan phosphatase activity toward soluble and insoluble polyglucan substrates, resulting from the participation of ancillary glucan-binding domains. Together, these data provide fundamental insights into the specific activity of glucan phosphatases against diverse polyglucan substrates. PMID:26231210

  1. The dynamics of camphor in the cytochrome P450 CYP101D2

    PubMed Central

    Vohra, Shabana; Musgaard, Maria; Bell, Stephen G; Wong, Luet-Lok; Zhou, Weihong; Biggin, Philip C

    2013-01-01

    The recent crystal structures of CYP101D2, a cytochrome P450 protein from the oligotrophic bacterium Novosphingobium aromaticivorans DSM12444 revealed that both the native (substrate-free) and camphor-soaked forms have open conformations. Furthermore, two other potential camphor-binding sites were also identified from electron densities in the camphor-soaked structure, one being located in the access channel and the other in a cavity on the surface near the F-helix side of the F-G loop termed the substrate recognition site. These latter sites may be key intermediate positions on the pathway for substrate access to or product egress from the active site. Here, we show via the use of unbiased atomistic molecular dynamics simulations that despite the open conformation of the native and camphor-bound crystal structures, the underlying dynamics of CYP101D2 appear to be very similar to other CYP proteins. Simulations of the native structure demonstrated that the protein is capable of sampling many different conformational substates. At the same time, simulations with the camphor positioned at various locations within the access channel or recognition site show that movement towards the active site or towards bulk solvent can readily occur on a short timescale, thus confirming many previously reported in silico studies using steered molecular dynamics. The simulations also demonstrate how the fluctuations of an aromatic gate appear to control access to the active site. Finally, comparison of camphor-bound simulations with the native simulations suggests that the fluctuations can be of similar level and thus are more representative of the conformational selection model rather than induced fit. PMID:23832606

  2. Pattern similarity study of functional sites in protein sequences: lysozymes and cystatins

    PubMed Central

    Nakai, Shuryo; Li-Chan, Eunice CY; Dou, Jinglie

    2005-01-01

    Background Although it is generally agreed that topography is more conserved than sequences, proteins sharing the same fold can have different functions, while there are protein families with low sequence similarity. An alternative method for profile analysis of characteristic conserved positions of the motifs within the 3D structures may be needed for functional annotation of protein sequences. Using the approach of quantitative structure-activity relationships (QSAR), we have proposed a new algorithm for postulating functional mechanisms on the basis of pattern similarity and average of property values of side-chains in segments within sequences. This approach was used to search for functional sites of proteins belonging to the lysozyme and cystatin families. Results Hydrophobicity and β-turn propensity of reference segments with 3–7 residues were used for the homology similarity search (HSS) for active sites. Hydrogen bonding was used as the side-chain property for searching the binding sites of lysozymes. The profiles of similarity constants and average values of these parameters as functions of their positions in the sequences could identify both active and substrate binding sites of the lysozyme of Streptomyces coelicolor, which has been reported as a new fold enzyme (Cellosyl). The same approach was successfully applied to cystatins, especially for postulating the mechanisms of amyloidosis of human cystatin C as well as human lysozyme. Conclusion Pattern similarity and average index values of structure-related properties of side chains in short segments of three residues or longer were, for the first time, successfully applied for predicting functional sites in sequences. This new approach may be applicable to studying functional sites in un-annotated proteins, for which complete 3D structures are not yet available. PMID:15904486

  3. Crystallographic comparison of manganese- and iron-dependent homoprotocatechuate 2,3-dioxygenases.

    PubMed

    Vetting, Matthew W; Wackett, Lawrence P; Que, Lawrence; Lipscomb, John D; Ohlendorf, Douglas H

    2004-04-01

    The X-ray crystal structures of homoprotocatechuate 2,3-dioxygenases isolated from Arthrobacter globiformis and Brevibacterium fuscum have been determined to high resolution. These enzymes exhibit 83% sequence identity, yet their activities depend on different transition metals, Mn2+ and Fe2+, respectively. The structures allow the origins of metal ion selectivity and aspects of the molecular mechanism to be examined in detail. The homotetrameric enzymes belong to the type I family of extradiol dioxygenases (vicinal oxygen chelate superfamily); each monomer has four betaalphabetabetabeta modules forming two structurally homologous N-terminal and C-terminal barrel-shaped domains. The active-site metal is located in the C-terminal barrel and is ligated by two equatorial ligands, H214NE1 and E267OE1; one axial ligand, H155NE1; and two to three water molecules. The first and second coordination spheres of these enzymes are virtually identical (root mean square difference over all atoms, 0.19 A), suggesting that the metal selectivity must be due to changes at a significant distance from the metal and/or changes that occur during folding. The substrate (2,3-dihydroxyphenylacetate [HPCA]) chelates the metal asymmetrically at sites trans to the two imidazole ligands and interacts with a unique, mobile C-terminal loop. The loop closes over the bound substrate, presumably to seal the active site as the oxygen activation process commences. An "open" coordination site trans to E267 is the likely binding site for O2. The geometry of the enzyme-substrate complexes suggests that if a transiently formed metal-superoxide complex attacks the substrate without dissociation from the metal, it must do so at the C-3 position. Second-sphere active-site residues that are positioned to interact with the HPCA and/or bound O2 during catalysis are identified and discussed in the context of current mechanistic hypotheses.

  4. Continuous multi-component geophysical experiment on LUSI mud edifice: What can we learn from it?

    NASA Astrophysics Data System (ADS)

    Mauri, Guillaume; Husein, Alwi; Karyono, Karyono; Hadi, Soffian; Mazzini, Adriano; Collignon, Marine; Faubert, Maïté; Miller, Stephen A.; Lupi, Matteo

    2016-04-01

    The Lusi eruption is located in East Java, Indonesia, and is ongoing since May 29th, 2006. In the framework of joined international projects, several joint geophysical studies focussing on seismic monitoring, spatial investigation over the mud edifice and its surroundings are being conducted. Here we present freshly acquired data from a test site to investigate: (1) potential change in the natural electrical self-potential generation over time (2) potential change in gravity field associated to change in mass or volume, (3) if the geysering activity generates disruption on either the electrical or gravity field. We selected a location ˜200m to the NE of the active Lusi crater. The experiment site covers an area of 60m x 80m, crossing the boundaries between the soft and the solid walkable mud. The western edge of the study area was less than 100m away from the rim of the crater site. A self-potential array made of 6 Pb-PbCl2 electrodes was deployed over the site. The electrodes were positioned inside active seeps, on dry unaltered zones and close to the mud stream that flushes the water erupted from the crater site. All the electrodes were connected to a single Pb-PbCl2 electrode reference. A second array of 7 thermometers was installed positioning 5 of them next to SP electrodes, one to measure atmospheric temperature and another P/T probe to monitor the stream water. In addition a seismometer coupled with a HD video camera, a thermal camera and a gravimeter recorded on site for several days monitoring visual and seismic activity of the crater. The collected data allows us to 1) monitor and define the different geysering activities ongoing at the crater, 2) define the delay existing between the recorded seismicity and the visual observations, 3) verify if the crater activity triggers perturbations that are transmitted to e.g. the thousands of satellite seeps distributed in the 7 square kilometers zone inside the embankment; 4) how significant is the delay between the crater activity and the water streamed out.

  5. Electrophysiological Indices of Brain Activity to Content and Function Words in Discourse

    ERIC Educational Resources Information Center

    Neumann, Yael; Epstein, Baila; Shafer, Valerie L.

    2016-01-01

    Background: An increase in positivity of event-related potentials (ERPs) at the lateral anterior sites has been hypothesized to be an index of semantic and discourse processing, with the right lateral anterior positivity (LAP) showing particular sensitivity to discourse factors. However, the research investigating the LAP is limited; it is unclear…

  6. Evolution of CCL11: genetic characterization in lagomorphs and evidence of positive and purifying selection in mammals.

    PubMed

    Neves, Fabiana; Abrantes, Joana; Esteves, Pedro J

    2016-07-01

    The interactions between chemokines and their receptors are crucial for differentiation and activation of inflammatory cells. CC chemokine ligand 11 (CCL11) binds to CCR3 and to CCR5 that in leporids underwent gene conversion with CCR2. Here, we genetically characterized CCL11 in lagomorphs (leporids and pikas). All lagomorphs have a potentially functional CCL11, and the Pygmy rabbit has a mutation in the stop codon that leads to a longer protein. Other mammals also have mutations at the stop codon that result in proteins with different lengths. By employing maximum likelihood methods, we observed that, in mammals, CCL11 exhibits both signatures of purifying and positive selection. Signatures of purifying selection were detected in sites important for receptor binding and activation. Of the three sites detected as under positive selection, two were located close to the stop codon. Our results suggest that CCL11 is functional in all lagomorphs, and that the signatures of purifying and positive selection in mammalian CCL11 probably reflect the protein's biological roles. © The Author(s) 2016.

  7. Pacing from the right ventricular septum: is there a danger to the coronary arteries?

    PubMed

    Teh, Andrew W; Medi, Caroline; Rosso, Raphael; Lee, Geoffrey; Gurvitch, Ronen; Mond, Harry G

    2009-07-01

    Pacing from right ventricular (RV) septal sites has been suggested as an alternative to RV apical pacing in an attempt to avoid long-term adverse consequences on left ventricular function. Concern has been raised as to the relationship of the left anterior descending coronary artery (LAD) to pacing leads in these positions. We retrospectively analyzed three cases in which patients with RV active-fixation leads in situ also had coronary angiography. Multiple fluoroscopic views were used to determine the relationship of the lead tip at various pacing sites to the coronary arteries. A lead placed on the anterior wall was in close proximity to the LAD, whereas septal and free wall positioning was not. Placement of RV active-fixation leads on the septum avoids potential coronary artery compromise.

  8. Relevance of Local Flexibility Near the Active Site for Enzymatic Catalysis: Biochemical Characterization and Engineering of Cellulase Cel5A From Bacillus agaradherans.

    PubMed

    Saavedra, Juan M; Azócar, Mauricio A; Rodríguez, Vida; Ramírez-Sarmiento, César A; Andrews, Barbara A; Asenjo, Juan A; Parra, Loreto P

    2018-03-25

    Detailed molecular mechanisms underpinning enzymatic reactions are still a central problem in biochemistry. The need for active site flexibility to sustain catalytic activity constitutes a notion of wide acceptance, although its direct influence remains to be fully understood. With the aim of studying the relationship between structural dynamics and enzyme catalysis, the cellulase Cel5A from Bacillus agaradherans is used as a model for in silico comparative analysis with mesophilic and psychrophilic counterparts. Structural features that determine flexibility are related to kinetic and thermodynamic parameters of catalysis. As a result, three specific positions in the vicinity of the active site of Cel5A are selected for protein engineering via site-directed mutagenesis. Three Cel5A variants are generated, N141L, A137Y and I102A/A137Y, showing a concomitant increase in the catalytic activity at low temperatures and a decrease in activation energy and activation enthalpy, similar to cold-active enzymes. These results are interpreted in structural terms by molecular dynamics simulations, showing that disrupting a hydrogen bond network in the vicinity of the active site increases local flexibility. These results provide a structural framework for explaining the changes in thermodynamic parameters observed between homologous enzymes with varying temperature adaptations. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. C-tactile afferent stimulating touch carries a positive affective value.

    PubMed

    Pawling, Ralph; Cannon, Peter R; McGlone, Francis P; Walker, Susannah C

    2017-01-01

    The rewarding sensation of touch in affiliative interactions is hypothesized to be underpinned by a specialized system of nerve fibers called C-Tactile afferents (CTs), which respond optimally to slowly moving, gentle touch, typical of a caress. However, empirical evidence to support the theory that CTs encode socially relevant, rewarding tactile information in humans is currently limited. While in healthy participants, touch applied at CT optimal velocities (1-10cm/sec) is reliably rated as subjectively pleasant, neuronopathy patients lacking large myelinated afferents, but with intact C-fibres, report that the conscious sensation elicited by stimulation of CTs is rather vague. Given this weak perceptual impact the value of self-report measures for assessing the specific affective value of CT activating touch appears limited. Therefore, we combined subjective ratings of touch pleasantness with implicit measures of affective state (facial electromyography) and autonomic arousal (heart rate) to determine whether CT activation carries a positive affective value. We recorded the activity of two key emotion-relevant facial muscle sites (zygomaticus major-smile muscle, positive affect & corrugator supercilii-frown muscle, negative affect) while participants evaluated the pleasantness of experimenter administered stroking touch, delivered using a soft brush, at two velocities (CT optimal 3cm/sec & CT non-optimal 30cm/sec), on two skin sites (CT innervated forearm & non-CT innervated palm). On both sites, 3cm/sec stroking touch was rated as more pleasant and produced greater heart rate deceleration than 30cm/sec stimulation. However, neither self-report ratings nor heart rate responses discriminated stimulation on the CT innervated arm from stroking of the non-CT innervated palm. In contrast, significantly greater activation of the zygomaticus major (smiling muscle) was seen specifically to CT optimal, 3cm/sec, stroking on the forearm in comparison to all other stimuli. These results offer the first empirical evidence in humans that tactile stimulation that optimally activates CTs carries a positive affective valence that can be measured implicitly.

  10. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  11. Probing the effect of the non-active-site mutation Y229W in New Delhi metallo-β-lactamase-1 by site-directed mutagenesis, kinetic studies, and molecular dynamics simulations.

    PubMed

    Chen, Jiao; Chen, Hui; Shi, Yun; Hu, Feng; Lao, Xingzhen; Gao, Xiangdong; Zheng, Heng; Yao, Wenbing

    2013-01-01

    New Delhi metallo-β-lactamase-1 (NDM-1) has attracted extensive attention for its high catalytic activities of hydrolyzing almost all β-lactam antibiotics. NDM-1 shows relatively higher similarity to subclass B1 metallo-β-lactamases (MβLs), but its residue at position 229 is identical to that of B2/B3 MβLs, which is a Tyr instead of a B1-MβL-conserved Trp. To elucidate the possible role of Y229 in the bioactivity of NDM-1, we performed mutagenesis study and molecular dynamics (MD) simulations. Although residue Y229 is spatially distant from the active site and not contacting directly with the substrate or zinc ions, the Y229W mutant was found to have higher kcat and Km values than those of wild-type NDM-1, resulting in 1 ∼ 7 fold increases in k(cat) /K(m) values against tested antibiotics. In addition, our MD simulations illustrated the enhanced flexibility of Loop 2 upon Y229W mutation, which could increase the kinetics of both substrate entrance (kon) and product egress (koff). The enhanced flexibility of Loop 2 might allow the enzyme to adjust the geometry of its active site to accommodate substrates with different structures, broadening its substrate spectrum. This study indicated the possible role of the residue at position 229 in the evolution of NDM-1.

  12. A Native Threonine Coordinates Ordered Water to Tune Light-Oxygen-Voltage (LOV) Domain Photocycle Kinetics and Osmotic Stress Signaling in Trichoderma reesei ENVOY.

    PubMed

    Lokhandwala, Jameela; Silverman Y de la Vega, Rafael I; Hopkins, Hilary C; Britton, Collin W; Rodriguez-Iglesias, Aroa; Bogomolni, Roberto; Schmoll, Monika; Zoltowski, Brian D

    2016-07-08

    Light-oxygen-voltage (LOV) domain-containing proteins function as small light-activated modules capable of imparting blue light control of biological processes. Their small modular nature has made them model proteins for allosteric signal transduction and optogenetic devices. Despite intense research, key aspects of their signal transduction mechanisms and photochemistry remain poorly understood. In particular, ordered water has been identified as a possible key mediator of photocycle kinetics, despite the lack of ordered water in the LOV active site. Herein, we use recent crystal structures of a fungal LOV protein ENVOY to interrogate the role of Thr(101) in recruiting water to the flavin active site where it can function as an intrinsic base to accelerate photocycle kinetics. Kinetic and molecular dynamic simulations confirm a role in solvent recruitment to the active site and identify structural changes that correlate with solvent recruitment. In vivo analysis of T101I indicates a direct role of the Thr(101) position in mediating adaptation to osmotic stress, thereby verifying biological relevance of ordered water in LOV signaling. The combined studies identify position 101 as a mediator of both allostery and photocycle catalysis that can impact organism physiology. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Physical activity, but not sedentary time, influences bone strength in late adolescence.

    PubMed

    Tan, Vina Ps; Macdonald, Heather M; Gabel, Leigh; McKay, Heather A

    2018-03-20

    Physical activity is essential for optimal bone strength accrual, but we know little about interactions between physical activity, sedentary time, and bone outcomes in older adolescents. Physical activity (by accelerometer and self-report) positively predicted bone strength and the distal and midshaft tibia in 15-year-old boys and girls. Lean body mass mediated the relationship between physical activity and bone strength in adolescents. To examine the influence of physical activity (PA) and sedentary time on bone strength, structure, and density in older adolescents. We used peripheral quantitative computed tomography to estimate bone strength at the distal tibia (8% site; bone strength index, BSI) and tibial midshaft (50% site; polar strength strain index, SSI p ) in adolescent boys (n = 86; 15.3 ± 0.4 years) and girls (n = 106; 15.3 ± 0.4 years). Using accelerometers (GT1M, Actigraph), we measured moderate-to-vigorous PA (MVPA Accel ), vigorous PA (VPA Accel ), and sedentary time in addition to self-reported MVPA (MVPA PAQ-A ) and impact PA (ImpactPA PAQ-A ). We examined relations between PA and sedentary time and bone outcomes, adjusting for ethnicity, maturity, tibial length, and total body lean mass. At the distal tibia, MVPA Accel and VPA Accel positively predicted BSI (explained 6-7% of the variance, p < 0.05). After adjusting for lean mass, only VPA Accel explained residual variance in BSI. At the tibial midshaft, MVPA Accel , but not VPA Accel , positively predicted SSI p (explained 3% of the variance, p = 0.01). Lean mass attenuated this association. MVPA PAQ-A and ImpactPA PAQ-A also positively predicted BSI and SSI p (explained 2-4% of the variance, p < 0.05), but only ImpactPA PAQ-A explained residual variance in BSI after accounting for lean mass. Sedentary time did not independently predict bone strength at either site. Greater tibial bone strength in active adolescents is mediated, in part, by lean mass. Despite spending most of their day in sedentary pursuits, adolescents' bone strength was not negatively influenced by sedentary time.

  14. Neighborhood Environments and Objectively Measured Physical Activity in 11 Countries

    PubMed Central

    Cerin, Ester; Cain, Kelli L; Conway, Terry L; Dyck, Delfien Van; Hinckson, Erica; Schipperijn, Jasper; Bourdeaudhuij, Ilse De; Owen, Neville; Davey, Rachel C; Hino, Adriano Akira Ferreira; Mitáš, Josef; Orzanco-Garralda, Rosario; Salvo, Deborah; Sarmiento, Olga L; Christiansen, Lars B; Macfarlane, Duncan J; Schofield, Grant; Sallis, James F

    2014-01-01

    Purpose Environmental changes are potentially effective population-level physical activity (PA) promotion strategies. However, robust multi-site evidence to guide international action for developing activity-supportive environments is lacking. We estimated pooled associations of perceived environmental attributes with objectively-measured PA outcomes; between-site differences in such associations; and, the extent to which perceived environmental attributes explain between-site differences in PA. Methods This was a cross-sectional study conducted in 16 cities located in Belgium, Brazil, Colombia, Czech Republic, Denmark, China, Mexico, New Zealand, Spain, United Kingdom, and USA. Participants were 6,968 adults residing in administrative units stratified by socio-economic status and transport-related walkability. Predictors were 10 perceived neighborhood environmental attributes. Outcome measures were accelerometry-assessed weekly minutes of moderate-to-vigorous PA (MVPA) and meeting the PA guidelines for cancer/weight gain prevention (420 min/week of MVPA). Results Most perceived neighborhood attributes were positively associated with the PA outcomes in the pooled, site-adjusted, single-predictor models. Associations were generalizable across geographical locations. Aesthetics and land use mix – access were significant predictors of both PA outcomes in the fully-adjusted models. Environmental attributes accounted for within-site variability in MVPA corresponding to a 3 min/d or 21 min/week standard deviation. Large between-site differences in PA outcomes were observed: 15.9% to 16.8% of these differences were explained by perceived environmental attributes. All neighborhood attributes were associated with between-site differences in the total effects of the perceived environment on PA outcomes. Conclusions Residents’ perceptions of neighborhood attributes that facilitate walking were positively associated with objectively-measured MVPA and meeting the guidelines for cancer/weight gain prevention at the within- and between-site levels. Associations were similar across study sites, lending support for international recommendations for designing PA-friendly built environments. PMID:24781892

  15. Functional sites of the Ada regulatory protein of Escherichia coli. Analysis by amino acid substitutions.

    PubMed

    Takano, K; Nakabeppu, Y; Sekiguchi, M

    1988-05-20

    Specific cysteine residues at possible methyl acceptor sites of the Ada protein of Escherichia coli were converted to other amino acids by site-directed mutagenesis of the cloned ada gene of E. coli. Ada protein with the cysteine residue at 321 replaced by alanine was capable of accepting the methyl group from the methylphosphotriester but not from O6-methylguanine or O4-methylthymine of alkylated DNA, whereas the protein with alanine at position 69 accepted the methyl group from the methylated bases but not from the methylphosphotriester. These two mutants were used to elucidate the biological significance of repair of the two types of alkylation lesions. Introduction of the ada gene with the Ala69 mutation into an ada- cell rendered the cell more resistant to alkylating agents with respect to both killing and induction of mutations, but the gene with the Ala321 mutation exhibited no such activity. Replacement of the cysteine residue at position 69, but not at position 321, abolished the ability of Ada protein to promote transcription of both ada and alkA genes in vitro. These results are compatible with the idea that methylation of the cysteine residue at position 69 renders Ada protein active as a transcriptional regulator, whilst the cysteine residue at position 321 is responsible for repair of pre-mutagenic and lethal lesions in DNA. The actions of mutant Ada proteins on the ada and alkA promoters in vivo were investigated using an artificially composed gene expression system. When the ada gene with the Ala69 mutation was introduced into the cell, there was little induction of expression of either the ada or the alkA genes, even after treatment with an alkylating agent, in agreement with the data obtained from studies in vitro. With the Ala321 mutation, however, a considerable degree of ada gene expression occurred without adaptive treatment. The latter finding suggests that the cysteine residue at position 321, which is located near the C terminus of the Ada protein, is involved in regulating activity, as the transcriptional activator.

  16. A hybrid QM/MM simulation study of intramolecular proton transfer in the pyridoxal 5'-phosphate in the active site of transaminase: influence of active site interaction on proton transfer.

    PubMed

    Dutta Banik, Sindrila; Chandra, Amalendu

    2014-09-25

    Pyridoxal 5'-phosphate (PLP) Schiff base, a versatile cofactor, exhibits a tautomeric equilibrium that involves an intramolecular proton transfer between the N-protonated zwitterionic ketoenamine tautomer and the O-protonated covalent enolimine tautomer. It has been postulated that for the catalytic activity, the PLP has to be in the zwitterionic ketoenamine tautomeric form. However, the exact position of the tautomeric equilibrium of Schiff base in the active site of PLP-dependent enzyme is not known yet. In the present work, we investigated the tautomeric equilibrium for the external aldimine state of PLP aspartate (PLP-Asp) Schiff base in the active site of aspartate aminotransferase (AspAT) using combined quantum mechanical and molecular mechanical simulations. The main focus of the present study is to analyze the factors that control the tautomeric equilibrium in the active sites of various PLP-dependent enzymes. The results show that the ketoenamine tautomer is more preferred than the enolimine tautomer both in the gas and aqueous phases as well as in the active site of AspAT. Current simulations show that the active site of AspAT is more suitable for the ketoenamine tautomer compared to the enolimine tautomer. Interestingly, the Tyr225 acts as a proton donor to the phenolic oxygen in the ketoenamine tautomer, while in the covalent enolimine tautomer, it acts as a proton acceptor to the phenolic oxygen. Finally, the metadynamics study confirms this result. The calculated free energy barrier is about 7.5 kcal/mol. A comparative analysis of the microenvironment created by the active site residues of three different PLP-dependent enzymes (aspartate aminotransferase, Dopa decarboxylase, and Ala-racemase) has been carried out to understand the controlling factor(s) of the tautomeric equilibrium. The analysis shows that the intermolecular hydrogen bonding between active site residues and the phenolic oxygen of PLP shifts the tautomeric equilibrium toward the N-protonated ketoenamine tautomeric form.

  17. Chromatin insulation by a transcriptional activator

    PubMed Central

    Sutter, Nathan B.; Scalzo, David; Fiering, Steven; Groudine, Mark; Martin, David I. K.

    2003-01-01

    In eukaryotic genomes, transcriptionally active regions are interspersed with silent chromatin that may repress genes in its vicinity. Chromatin insulators are elements that can shield a locus from repressive effects of flanking chromatin. Few such elements have been characterized in higher eukaryotes, but transcriptional activating elements are an invariant feature of active loci and have been shown to suppress transgene silencing. Hence, we have assessed the ability of a transcriptional activator to cause chromatin insulation, i.e., to relieve position effects at transgene integration sites in cultured cells. The transgene contained a series of binding sites for the metal-inducible transcriptional activator MTF, linked to a GFP reporter. Clones carrying single integrated transgenes were derived without selection for expression, and in most clones the transgene was silent. Induction of MTF resulted in transition of the transgene from the silent to the active state, prolongation of the active state, and a marked narrowing of the range of expression levels at different genomic sites. At one genomic site, prolonged induction of MTF resulted in suppression of transgene silencing that persisted after withdrawal of the induction stimulus. These results are consistent with MTF acting as a chromatin insulator and imply that transcriptional activating elements can insulate active loci against chromatin repression. PMID:12547916

  18. Viral replication. Structural basis for RNA replication by the hepatitis C virus polymerase.

    PubMed

    Appleby, Todd C; Perry, Jason K; Murakami, Eisuke; Barauskas, Ona; Feng, Joy; Cho, Aesop; Fox, David; Wetmore, Diana R; McGrath, Mary E; Ray, Adrian S; Sofia, Michael J; Swaminathan, S; Edwards, Thomas E

    2015-02-13

    Nucleotide analog inhibitors have shown clinical success in the treatment of hepatitis C virus (HCV) infection, despite an incomplete mechanistic understanding of NS5B, the viral RNA-dependent RNA polymerase. Here we study the details of HCV RNA replication by determining crystal structures of stalled polymerase ternary complexes with enzymes, RNA templates, RNA primers, incoming nucleotides, and catalytic metal ions during both primed initiation and elongation of RNA synthesis. Our analysis revealed that highly conserved active-site residues in NS5B position the primer for in-line attack on the incoming nucleotide. A β loop and a C-terminal membrane-anchoring linker occlude the active-site cavity in the apo state, retract in the primed initiation assembly to enforce replication of the HCV genome from the 3' terminus, and vacate the active-site cavity during elongation. We investigated the incorporation of nucleotide analog inhibitors, including the clinically active metabolite formed by sofosbuvir, to elucidate key molecular interactions in the active site. Copyright © 2015, American Association for the Advancement of Science.

  19. Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

    PubMed Central

    Been, M D; Perrotta, A T

    1995-01-01

    A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

  20. A mechanism underlying position-specific regulation of alternative splicing

    PubMed Central

    Hamid, Fursham M.

    2017-01-01

    Abstract Many RNA-binding proteins including a master regulator of splicing in developing brain and muscle, polypyrimidine tract-binding protein 1 (PTBP1), can either activate or repress alternative exons depending on the pre-mRNA recruitment position. When bound upstream or within regulated exons PTBP1 tends to promote their skipping, whereas binding to downstream sites often stimulates inclusion. How this switch is orchestrated at the molecular level is poorly understood. Using bioinformatics and biochemical approaches we show that interaction of PTBP1 with downstream intronic sequences can activate natural cassette exons by promoting productive docking of the spliceosomal U1 snRNP to a suboptimal 5′ splice site. Strikingly, introducing upstream PTBP1 sites to this circuitry leads to a potent splicing repression accompanied by the assembly of an exonic ribonucleoprotein complex with a tightly bound U1 but not U2 snRNP. Our data suggest a molecular mechanism underlying the transition between a better-known repressive function of PTBP1 and its role as a bona fide splicing activator. More generally, we argue that the functional outcome of individual RNA contacts made by an RNA-binding protein is subject to extensive context-specific modulation.

  1. Employees on the Move!

    ERIC Educational Resources Information Center

    Levin, Sarah

    This paper describes a method for designing, implementing, and evaluating a work-site physical activity campaign aimed at employees who are currently sedentary in their leisure time. Inactivity is a major but modifiable risk factor for coronary heart disease. Increasing the activity levels of underactive adults would have a positive impact on…

  2. An approach to functionally relevant clustering of the protein universe: Active site profile‐based clustering of protein structures and sequences

    PubMed Central

    Knutson, Stacy T.; Westwood, Brian M.; Leuthaeuser, Janelle B.; Turner, Brandon E.; Nguyendac, Don; Shea, Gabrielle; Kumar, Kiran; Hayden, Julia D.; Harper, Angela F.; Brown, Shoshana D.; Morris, John H.; Ferrin, Thomas E.; Babbitt, Patricia C.

    2017-01-01

    Abstract Protein function identification remains a significant problem. Solving this problem at the molecular functional level would allow mechanistic determinant identification—amino acids that distinguish details between functional families within a superfamily. Active site profiling was developed to identify mechanistic determinants. DASP and DASP2 were developed as tools to search sequence databases using active site profiling. Here, TuLIP (Two‐Level Iterative clustering Process) is introduced as an iterative, divisive clustering process that utilizes active site profiling to separate structurally characterized superfamily members into functionally relevant clusters. Underlying TuLIP is the observation that functionally relevant families (curated by Structure‐Function Linkage Database, SFLD) self‐identify in DASP2 searches; clusters containing multiple functional families do not. Each TuLIP iteration produces candidate clusters, each evaluated to determine if it self‐identifies using DASP2. If so, it is deemed a functionally relevant group. Divisive clustering continues until each structure is either a functionally relevant group member or a singlet. TuLIP is validated on enolase and glutathione transferase structures, superfamilies well‐curated by SFLD. Correlation is strong; small numbers of structures prevent statistically significant analysis. TuLIP‐identified enolase clusters are used in DASP2 GenBank searches to identify sequences sharing functional site features. Analysis shows a true positive rate of 96%, false negative rate of 4%, and maximum false positive rate of 4%. F‐measure and performance analysis on the enolase search results and comparison to GEMMA and SCI‐PHY demonstrate that TuLIP avoids the over‐division problem of these methods. Mechanistic determinants for enolase families are evaluated and shown to correlate well with literature results. PMID:28054422

  3. An approach to functionally relevant clustering of the protein universe: Active site profile-based clustering of protein structures and sequences.

    PubMed

    Knutson, Stacy T; Westwood, Brian M; Leuthaeuser, Janelle B; Turner, Brandon E; Nguyendac, Don; Shea, Gabrielle; Kumar, Kiran; Hayden, Julia D; Harper, Angela F; Brown, Shoshana D; Morris, John H; Ferrin, Thomas E; Babbitt, Patricia C; Fetrow, Jacquelyn S

    2017-04-01

    Protein function identification remains a significant problem. Solving this problem at the molecular functional level would allow mechanistic determinant identification-amino acids that distinguish details between functional families within a superfamily. Active site profiling was developed to identify mechanistic determinants. DASP and DASP2 were developed as tools to search sequence databases using active site profiling. Here, TuLIP (Two-Level Iterative clustering Process) is introduced as an iterative, divisive clustering process that utilizes active site profiling to separate structurally characterized superfamily members into functionally relevant clusters. Underlying TuLIP is the observation that functionally relevant families (curated by Structure-Function Linkage Database, SFLD) self-identify in DASP2 searches; clusters containing multiple functional families do not. Each TuLIP iteration produces candidate clusters, each evaluated to determine if it self-identifies using DASP2. If so, it is deemed a functionally relevant group. Divisive clustering continues until each structure is either a functionally relevant group member or a singlet. TuLIP is validated on enolase and glutathione transferase structures, superfamilies well-curated by SFLD. Correlation is strong; small numbers of structures prevent statistically significant analysis. TuLIP-identified enolase clusters are used in DASP2 GenBank searches to identify sequences sharing functional site features. Analysis shows a true positive rate of 96%, false negative rate of 4%, and maximum false positive rate of 4%. F-measure and performance analysis on the enolase search results and comparison to GEMMA and SCI-PHY demonstrate that TuLIP avoids the over-division problem of these methods. Mechanistic determinants for enolase families are evaluated and shown to correlate well with literature results. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

  4. Tryptophan 80 and leucine 143 are critical for the hydride transfer step of thymidylate synthase by controlling active site access.

    PubMed

    Fritz, Timothy A; Liu, Lu; Finer-Moore, Janet S; Stroud, Robert M

    2002-06-04

    Mutant forms of thymidylate synthase (TS) with substitutions at the conserved active site residue, Trp 80, are deficient in the hydride transfer step of the TS reaction. These mutants produce a beta-mercaptoethanol (beta-ME) adduct of the 2'-deoxyuridine-5'-monophosphate (dUMP) exocyclic methylene intermediate. Trp 80 has been proposed to assist hydride transfer by stabilizing a 5,6,7,8-tetrahydrofolate (THF) radical cation intermediate [Barrett, J. E., Lucero, C. M., and Schultz, P. G. (1999) J. Am. Chem. Soc. 121, 7965-7966.] formed after THF changes its binding from the cofactor pocket to a putative alternate site. To understand the molecular basis of hydride transfer deficiency in a mutant in which Trp 80 was changed to Gly, we determined the X-ray structures of this mutant Escherichia coli TS complexed with dUMP and the folate analogue 10-propargyl-5,8-dideazafolate (CB3717) and of the wild-type enzyme complexed with dUMP and THF. The mutant enzyme has a cavity in the active site continuous with bulk solvent. This cavity, sealed from bulk solvent in wild-type TS by Leu 143, would allow nucleophilic attack of beta-ME on the dUMP C5 exocyclic methylene. The structure of the wild-type enzyme/dUMP/THF complex shows that THF is bound in the cofactor binding pocket and is well positioned to transfer hydride to the dUMP exocyclic methylene. Together, these results suggest that THF does not reorient during hydride transfer and indicate that the role of Trp 80 may be to orient Leu 143 to shield the active site from bulk solvent and to optimally position the cofactor for hydride transfer.

  5. Synthesis and anticholinesterase activity of coumarin-3-carboxamides bearing tryptamine moiety.

    PubMed

    Ghanei-Nasab, Samaneh; Khoobi, Mehdi; Hadizadeh, Farzin; Marjani, Azam; Moradi, Alireza; Nadri, Hamid; Emami, Saeed; Foroumadi, Alireza; Shafiee, Abbas

    2016-10-04

    A number of N-(2-(1H-indol-3-yl)ethyl)-2-oxo-2H-chromene-3-carboxamides were synthesized and tested against AChE and BuChE. The in vitro assessment of the synthesized compounds 4a-o revealed that most of them had significant activity toward AChE. The SAR study demonstrated that the introduction of benzyloxy moiety on the 7-position of coumarin scaffold can improve the anti-AChE activity. The best result was obtained with 7-(4-fluorobenzyl)oxy moiety in the case of compound 4o, displaying IC50 value of 0.16 μM. Based on the docking study of AChE, the prototype compound 4o was laid across the active site and occupied both peripheral anionic site (PAS) and catalytic anionic site (CAS). Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  6. Active Site Detection by Spatial Conformity and Electrostatic Analysis—Unravelling a Proteolytic Function in Shrimp Alkaline Phosphatase

    PubMed Central

    Chakraborty, Sandeep; Minda, Renu; Salaye, Lipika; Bhattacharjee, Swapan K.; Rao, Basuthkar J.

    2011-01-01

    Computational methods are increasingly gaining importance as an aid in identifying active sites. Mostly these methods tend to have structural information that supplement sequence conservation based analyses. Development of tools that compute electrostatic potentials has further improved our ability to better characterize the active site residues in proteins. We have described a computational methodology for detecting active sites based on structural and electrostatic conformity - C ata L ytic A ctive S ite P rediction (CLASP). In our pipelined model, physical 3D signature of any particular enzymatic function as defined by its active sites is used to obtain spatially congruent matches. While previous work has revealed that catalytic residues have large pKa deviations from standard values, we show that for a given enzymatic activity, electrostatic potential difference (PD) between analogous residue pairs in an active site taken from different proteins of the same family are similar. False positives in spatially congruent matches are further pruned by PD analysis where cognate pairs with large deviations are rejected. We first present the results of active site prediction by CLASP for two enzymatic activities - β-lactamases and serine proteases, two of the most extensively investigated enzymes. The results of CLASP analysis on motifs extracted from Catalytic Site Atlas (CSA) are also presented in order to demonstrate its ability to accurately classify any protein, putative or otherwise, with known structure. The source code and database is made available at www.sanchak.com/clasp/. Subsequently, we probed alkaline phosphatases (AP), one of the well known promiscuous enzymes, for additional activities. Such a search has led us to predict a hitherto unknown function of shrimp alkaline phosphatase (SAP), where the protein acts as a protease. Finally, we present experimental evidence of the prediction by CLASP by showing that SAP indeed has protease activity in vitro. PMID:22174814

  7. Prognostic benefit of optimum left ventricular lead position in cardiac resynchronization therapy: follow-up of the TARGET Study Cohort (Targeted Left Ventricular Lead Placement to guide Cardiac Resynchronization Therapy).

    PubMed

    Kydd, Anna C; Khan, Fakhar Z; Watson, William D; Pugh, Peter J; Virdee, Munmohan S; Dutka, David P

    2014-06-01

    This study was conducted to assess the impact of left ventricular (LV) lead position on longer-term survival after cardiac resynchronization therapy (CRT). An optimal LV lead position in CRT is associated with improved clinical outcome. A strategy of speckle-tracking echocardiography can be used to guide the implanter to the site of latest activation and away from segments of low strain amplitude (scar). Long-term, prospective survival data according to LV lead position in CRT are limited. Data from a follow-up registry of 250 consecutive patients receiving CRT between June 2008 and July 2010 were studied. The study population comprised patients recruited to the derivation group and the subsequent TARGET (Targeted Left Ventricular Lead Placement to guide Cardiac Resynchronization Therapy) randomized, controlled trial. Final LV lead position was described, in relation to the pacing site determined by pre-procedure speckle-tracking echocardiography, as optimal (concordant/adjacent) or suboptimal (remote). All-cause mortality was recorded at follow-up. An optimal LV lead position (n = 202) conferred LV remodeling response superior to that of a suboptimal lead position (change in LV end-systolic volume: -24 ± 15% vs. -12 ± 17% [p < 0.001]; change in ejection fraction: +7 ± 8% vs. +4 ± 7% [p = 0.02]). During long-term follow-up (median: 39 months; range: <1 to 61 months), an optimal LV lead position was associated with improved survival (log-rank p = 0.003). A suboptimal LV lead placement independently predicted all-cause mortality (hazard ratio: 1.8; p = 0.024). An optimal LV lead position at the site of latest mechanical activation, avoiding low strain amplitude (scar), was associated with superior CRT response and improved survival that persisted during follow-up. Copyright © 2014 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  8. Influence of active site location on catalytic activity in de novo-designed zinc metalloenzymes.

    PubMed

    Zastrow, Melissa L; Pecoraro, Vincent L

    2013-04-17

    While metalloprotein design has now yielded a number of successful metal-bound and even catalytically active constructs, the question of where to put a metal site along a linear, repetitive sequence has not been thoroughly addressed. Often several possibilities in a given sequence may exist that would appear equivalent but may in fact differ for metal affinity, substrate access, or protein dynamics. We present a systematic variation of active site location for a hydrolytically active ZnHis3O site contained within a de novo-designed three-stranded coiled coil. We find that the maximal rate, substrate access, and metal-binding affinity are dependent on the selected position, while catalytic efficiency for p-nitrophenyl acetate hydrolysis can be retained regardless of the location of the active site. This achievement demonstrates how efficient, tailor-made enzymes which control rate, pKa, substrate and solvent access (and selectivity), and metal-binding affinity may be realized. These findings may be applied to the more advanced de novo design of constructs containing secondary interactions, such as hydrogen-bonding channels. We are now confident that changes to location for accommodating such channels can be achieved without location-dependent loss of catalytic efficiency. These findings bring us closer to our ultimate goal of incorporating the secondary interactions we believe will be necessary in order to improve both active site properties and the catalytic efficiency to be competitive with the native enzyme, carbonic anhydrase.

  9. The National Children's Study: Recruitment Outcomes Using an Enhanced Household-Based Approach.

    PubMed

    Blaisdell, Laura L; Zellner, Jennifer A; King, Alison A; Faustman, Elaine; Wilhelm, Mari; Hudak, Mark L; Annett, Robert D

    2016-06-01

    Ten National Children's Study (NCS) study locations with diverse demographic characteristics used an enhanced household-based recruitment (EHBR) approach to enroll preconceptional and pregnant women. Study centers used different types and dosages of community outreach and engagement (COE) activities and supplemental strategies. The goal of the study was to determine whether variability in enumeration and recruitment outcomes correlated with study location characteristics or types and dosages of COE activities (number of COE events, number of advance household mailings, total media expenditures, and total COE expenditures). Each of the sites provided data on COE activities, protocol implementation, supplemental recruitment activities, location demographic characteristics, and enumeration/recruitment outcomes. COE activities varied across sites in breadth and scope. Numerous strategies were used, including media advertising, social media, participation in community-wide events, presentations to stakeholders, and creation of advisory boards. Some sites included supplemental recruitment efforts. EHBR sites enrolled 1404 women at the initial pregnancy screening. No significant relationships were found between study location demographic characteristics or between the types and dosages of COE activities and recruitment outcomes. Probability sampling for a long-term study requires a positive image with stakeholders and within communities; this requirement may be especially true for door-to-door recruitment. EHBR sites successfully recruited a representative sample of preconceptional and pregnant women. Sites reported implementing similar COE activities but with varying dosage and cost; however, analyses did not support a benefit of COE strategies on study recruitment. Copyright © 2016 by the American Academy of Pediatrics.

  10. The biologically active zone in upland habitats at the Hanford Site, Washington, USA: Focus on plant rooting depth and biomobilization.

    PubMed

    Lovtang, Sara; Delistraty, Damon; Rochette, Elizabeth

    2018-07-01

    We challenge the suggestion by Sample et al. (2015) that a depth of 305 cm (10 ft) exceeds the depth of biological activity in soils at the Hanford Site, Washington, USA, or similar sites. Instead, we support the standard point of compliance, identified in the Model Toxics Control Act in the state of Washington, which specifies a depth of 457 cm (15 ft) for the protection of both human and ecological receptors at the Hanford Site. Our position is based on additional information considered in our expanded review of the literature, the influence of a changing environment over time, plant community dynamics at the Hanford Site, and inherent uncertainty in the Sample et al. (2015) analysis. Integr Environ Assess Manag 2018;14:442-446. © 2018 SETAC. © 2018 SETAC.

  11. Synthesis and anticonvulsant activities of N-benzyl (2R)-2-acetamido-3-oxysubstituted propionamide derivatives

    PubMed Central

    Morieux, Pierre; Stables, James P.; Kohn, Harold

    2009-01-01

    Lacosamide has been submitted for regulatory approval in the United States and Europe for the treatment of epilepsy. Previous synthetic methods did not permit the elaboration of the structure–activity relationship (SAR) for the 3-oxy site in lacosamide. We report an expedient five-step stereospecific synthesis for N-benzyl (2R)-2-acetamido-3-oxysubstituted propionamide analogs beginning with d-serine methyl ester. The procedure incorporated alkyl (e.g. methyl, primary, secondary, and tertiary) and aryl groups at this position. The SAR for the 3-oxy site showed maximal activity in animal seizure models for small 3-alkoxy substituents. PMID:18789868

  12. Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

    PubMed

    Landini, P; Volkert, M R

    1995-04-07

    The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

  13. INVESTIGATIONS ON THE ANTIGENICITY OF SNAKE VENOMS

    DTIC Science & Technology

    The chemical composition of viperotoxin, the neurotoxic protein isolated from the venom of Vipera palestinae has been determined. Viperotoxin is...carboxy-terminal position of the viperotoxin chain. Vipera palestinae hemorrhagin has been purified and isolated. Further tests have established that...active sites, or selective blocking of a part of one active center having two distinct biological activities. Purified neurotoxin of V. palestinae

  14. Structure-Activity Relationship and Molecular Mechanics Reveal the Importance of Ring Entropy in the Biosynthesis and Activity of a Natural Product.

    PubMed

    Tran, Hai L; Lexa, Katrina W; Julien, Olivier; Young, Travis S; Walsh, Christopher T; Jacobson, Matthew P; Wells, James A

    2017-02-22

    Macrocycles are appealing drug candidates due to their high affinity, specificity, and favorable pharmacological properties. In this study, we explored the effects of chemical modifications to a natural product macrocycle upon its activity, 3D geometry, and conformational entropy. We chose thiocillin as a model system, a thiopeptide in the ribosomally encoded family of natural products that exhibits potent antimicrobial effects against Gram-positive bacteria. Since thiocillin is derived from a genetically encoded peptide scaffold, site-directed mutagenesis allows for rapid generation of analogues. To understand thiocillin's structure-activity relationship, we generated a site-saturation mutagenesis library covering each position along thiocillin's macrocyclic ring. We report the identification of eight unique compounds more potent than wild-type thiocillin, the best having an 8-fold improvement in potency. Computational modeling of thiocillin's macrocyclic structure revealed a striking requirement for a low-entropy macrocycle for activity. The populated ensembles of the active mutants showed a rigid structure with few adoptable conformations while inactive mutants showed a more flexible macrocycle which is unfavorable for binding. This finding highlights the importance of macrocyclization in combination with rigidifying post-translational modifications to achieve high-potency binding.

  15. Lateralisation effect in comprehension of emotional facial expression: a comparison between EEG alpha band power and behavioural inhibition (BIS) and activation (BAS) systems.

    PubMed

    Balconi, Michela; Mazza, Guido

    2010-05-01

    Asymmetry in comprehension of facial expression of emotions was explored in the present study by analysing alpha band variation within the right and left cortical sides. Second, the behavioural activation system (BAS) and behavioural inhibition system (BIS) were considered as an explicative factor to verify the effect of a motivational/emotional variable on alpha activity. A total of 19 participants looked at an ample range of facial expressions of emotions (anger, fear, surprise, disgust, happiness, sadness, and neutral) in random order. The results demonstrated that anterior frontal sites were more active than central and parietal sites in response to facial stimuli. Moreover, right and left side responses varied as a function of emotional types, with an increased right frontal activity for negative, aversive emotions vs an increased left response for positive emotion. Finally, whereas higher BIS participants generated more right hemisphere activation for some negative emotions (such as fear, anger, surprise, and disgust), BAS participants were more responsive to positive emotion (happiness) within the left hemisphere. Motivational significance of facial expressions was considered to elucidate cortical differences in participants' responses to emotional types.

  16. In vitro activation of NAD-dependent alcohol dehydrogenases by Nudix hydrolases is more widespread than assumed.

    PubMed

    Ochsner, Andrea M; Müller, Jonas E N; Mora, Carlos A; Vorholt, Julia A

    2014-08-25

    In the Gram-positive methylotroph Bacillus methanolicus, methanol oxidation is catalyzed by an NAD-dependent methanol dehydrogenase (Mdh) that belongs to the type III alcohol dehydrogenase (Adh) family. It was previously shown that the in vitro activity of B. methanolicus Mdh is increased by the endogenous activator protein Act, a Nudix hydrolase. Here we show that this feature is not unique, but more widespread among type III Adhs in combination with Act or other Act-like Nudix hydrolases. In addition, we studied the effect of site directed mutations in the predicted active site of Mdh and two other type III Adhs with regard to activity and activation by Act. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  17. Intraoperative mapping during repeat awake craniotomy reveals the functional plasticity of adult cortex.

    PubMed

    Southwell, Derek G; Hervey-Jumper, Shawn L; Perry, David W; Berger, Mitchel S

    2016-05-01

    OBJECT To avoid iatrogenic injury during the removal of intrinsic cerebral neoplasms such as gliomas, direct electrical stimulation (DES) is used to identify cortical and subcortical white matter pathways critical for language, motor, and sensory function. When a patient undergoes more than 1 brain tumor resection as in the case of tumor recurrence, the use of DES provides an unusual opportunity to examine brain plasticity in the setting of neurological disease. METHODS The authors examined 561 consecutive cases in which patients underwent DES mapping during surgery forglioma resection. "Positive" and "negative" sites-discrete cortical regions where electrical stimulation did (positive) or did not (negative) produce transient sensory, motor, or language disturbance-were identified prior to tumor resection and documented by intraoperative photography for categorization into functional maps. In this group of 561 patients, 18 were identified who underwent repeat surgery in which 1 or more stimulation sites overlapped with those tested during the initial surgery. The authors compared intraoperative sensory, motor, or language mapping results between initial and repeat surgeries, and evaluated the clinical outcomes for these patients. RESULTS A total of 117 sites were tested for sensory (7 sites, 6.0%), motor (9 sites, 7.7%), or language (101 sites, 86.3%) function during both initial and repeat surgeries. The mean interval between surgical procedures was 4.1 years. During initial surgeries, 95 (81.2%) of 117 sites were found to be negative and 22 (18.8%) of 117 sites were found to be positive. During repeat surgeries, 103 (88.0%) of 117 sites were negative and 14 (12.0%) of 117 were positive. Of the 95 sites that were negative at the initial surgery, 94 (98.9%) were also negative at the repeat surgery, while 1 (1.1%) site was found to be positive. Of the 22 sites that were initially positive, 13 (59.1%) remained positive at repeat surgery, while 9 (40.9%) had become negative for function. Overall, 6 (33.3%) of 18 patients exhibited loss of function at 1 or more motor or language sites between surgeries. Loss of function at these sites was not associated with neurological impairment at the time of repeat surgery, suggesting that neurological function was preserved through neural circuit reorganization or activation of latent functional pathways. CONCLUSIONS The adult central nervous system reorganizes motor and language areas in patients with glioma. Ultimately, adult neural plasticity may help to preserve motor and language function in the presence of evolving structural lesions. The insight gained from this subset of patients has implications for our understanding of brain plasticity in clinical settings.

  18. Noninvasive evaluation of active lower gastrointestinal bleeding: comparison between contrast-enhanced MDCT and 99mTc-labeled RBC scintigraphy.

    PubMed

    Zink, Stephen I; Ohki, Stephen K; Stein, Barry; Zambuto, Domenic A; Rosenberg, Ronald J; Choi, Jenny J; Tubbs, Daniel S

    2008-10-01

    The purpose of our study was to compare contrast-enhanced MDCT and (99m)Tc-labeled RBC scanning for the evaluation of active lower gastrointestinal bleeding. Over 17 months, 55 patients (32 men, 23 women; age range, 21-92 years) were evaluated prospectively with contrast-enhanced MDCT using 100 mL of iopromide 300 mg I/mL. Technetium-99m-labeled RBC scans were obtained on 41 of 55 patients and select patients underwent angiography for attempted embolization. Each imaging technique was reviewed in a blinded fashion for sensitivity for detection of active bleeding as well as the active lower gastrointestinal bleeding location. Findings were positive on both examinations in eight patients and negative on both examinations in 20 patients. Findings were positive on contrast-enhanced MDCT and negative on (99m)Tc-labeled RBC in two patients; findings were negative on contrast-enhanced MDCT and positive on (99m)Tc-labeled RBC in 11 patients. Statistics showed significant disagreement, with simple agreement = 68.3%, kappa = 0.341, and p = 0.014. Sixteen of 60 (26.7%) contrast-enhanced MDCT scans were positive prospectively, with all accurately localizing the site of bleeding and identification of the underlying lesion in eight of 16 (50%). Nineteen of 41 (46.3%) (99m)Tc-labeled RBC scans were positive. Eighteen of 41 matched patients went on to angiography. In four of these 18 (22.2%) patients, the site of bleeding was confirmed by angiography, but in 14 of 18 (77.8%), the findings were negative. Contrast-enhanced MDCT and (99m)Tc-labeled RBC scanning show significant disagreement for evaluation of active lower gastrointestinal bleeding. Contrast-enhanced MDCT appears effective for detection and localization in cases of active lower gastrointestinal bleeding in which hemorrhage is active at the time of CT.

  19. Analysis of ILRS Site Ties

    NASA Astrophysics Data System (ADS)

    Husson, V. S.; Long, J. L.; Pearlman, M.

    2001-12-01

    By the end of 2000, 94% of ILRS stations had completed station and site information forms (i.e. site logs). These forms contain six types of information. These six categories include site identifiers, contact information, approximate coordinates, system configuration history, system ranging capabilities, and local survey ties. The ILRS Central Bureau, in conjunction with the ILRS Networks and Engineering Working Group, has developed procedures to quality control site log contents. Part of this verification entails data integrity checks of local site ties and is the primary focus of this paper. Local survey ties are critical to the combination of space geodetic network coordinate solutions (i.e. GPS, SLR, VLBI, DORIS) of the International Terrestrial Reference Frame (ITRF). Approximately 90% of active SLR sites are collocated with at least one other space geodetic technique. The process used to verify these SLR ties, at collocated sites, is identical to the approach used in ITRF2000. Local vectors (X, Y, Z) from each ILRS site log are differenced from its corresponding ITRF2000 position vectors (i.e. no transformations). These X, Y, and Z deltas are converted into North, East, and Up. Any deltas, in any component, larger than 5 millimeter is flagged for investigation. In the absence of ITRF2000 SLR positions, CSR positions were used. To further enhance this comparison and to fill gaps in information, local ties contained in site logs from the other space geodetic services (i.e. IGS, IVS, IDS) were used in addition to ITRF2000 ties. Case studies of two collocated sites (McDonald/Ft. Davis and Hartebeeshtoek) will be explored in-depth. Recommendations on how local site surveys should be conducted and how this information should be managed will also be presented.

  20. Association of car ownership and physical activity across the spectrum of human development: Modeling the Epidemiologic Transition Study (METS).

    PubMed

    Shoham, David A; Dugas, Lara R; Bovet, Pascal; Forrester, Terrence E; Lambert, Estelle V; Plange-Rhule, Jacob; Schoeller, Dale A; Brage, Soren; Ekelund, Ulf; Durazo-Arvizu, Ramon A; Cooper, Richard S; Luke, Amy

    2015-02-21

    Variations in physical activity (PA) across nations may be driven by socioeconomic position. As national incomes increase, car ownership becomes within reach of more individuals. This report characterizes associations between car ownership and PA in African-origin populations across 5 sites at different levels of economic development and with different transportation infrastructures: US, Seychelles, Jamaica, South Africa, and Ghana. Twenty-five hundred adults, ages 25-45, were enrolled in the study. A total of 2,101 subjects had valid accelerometer-based PA measures (reported as average daily duration of moderate to vigorous PA, MVPA) and complete socioeconomic information. Our primary exposure of interest was whether the household owned a car. We adjusted for socioeconomic position using household income and ownership of common goods. Overall, PA levels did not vary largely between sites, with highest levels in South Africa, lowest in the US. Across all sites, greater PA was consistently associated with male gender, fewer years of education, manual occupations, lower income, and owning fewer material goods. We found heterogeneity across sites in car ownership: after adjustment for confounders, car owners in the US had 24.3 fewer minutes of MVPA compared to non-car owners in the US (20.7 vs. 45.1 minutes/day of MVPA); in the non-US sites, car-owners had an average of 9.7 fewer minutes of MVPA than non-car owners (24.9 vs. 34.6 minutes/day of MVPA). PA levels are similar across all study sites except Jamaica, despite very different levels of socioeconomic development. Not owning a car in the US is associated with especially high levels of MVPA. As car ownership becomes prevalent in the developing world, strategies to promote alternative forms of active transit may become important.

  1. Ionospheric plasma deterioration in the area of enhanced seismic activity as compared to antipodal sites far from seismicity

    NASA Astrophysics Data System (ADS)

    Gulyaeva, Tamara; Arikan, Feza; Poustovalova, Ljubov; Stanislawska, Iwona

    2016-07-01

    The early magnetogram records from two nearly antipodal sites at Greenwich and Melbourne corresponding to the activity level at the invariant magnetic latitude of 50 deg give a long series of geomagnetic aa indices since 1868. The aa index derived from magnetic perturbation values at only two observatories (as distinct from the planetary ap index) experiences larger extreme values if either input site is well situated to the overhead ionospheric and/or field aligned current systems producing the magnetic storm effects. Analysis of the earthquakes catalogues since 1914 has shown the area of the peak global earthquake occurrence in the Pacific Ocean southwards from the magnetic equator, and, in particular, at Australia. In the present study the ionospheric critical frequency, foF2, is analyzed from the ionosonde measurements at the nearby observatories, Canberra and Slough (Chilton), and Moscow (control site) since 1944 to 2015. The daily-hourly-annual percentage occurrence of positive ionospheric W index (pW+) and negative index (pW-) is determined. It is found that the ionospheric plasma depletion pW- of the instant foF2 as compared to the monthly median is well correlated to the aa index at all three sites but the positive storm signatures show drastic difference at Canberra (no correlation of pW+ with aa index) as compared to two other sites where the high correlation is found of the ionospheric plasma density enhancement with the geomagnetic activity. A possible suppression of the enhanced ionospheric variability over the region of intense seismicity is discussed in the paper. This study is supported by TUBITAK EEEAG 115E915.

  2. Amino Acid Residues That Contribute to Substrate Specificity of Class A β-Lactamase SME-1

    PubMed Central

    Majiduddin, Fahd K.; Palzkill, Timothy

    2005-01-01

    Carbapenem antibiotics are used as antibiotics of last resort because they possess a broad spectrum of antimicrobial activity and are not easily hydrolyzed by β-lactamases. Recently, class A enzymes, such as the SME-1, NMC-A, and IMI-1 β-lactamases, have been identified with the capacity to hydrolyze carbapenem antibiotics. Traditional class A β-lactamases, such as TEM-1 and SHV-1, are unable to hydrolyze carbapenem antibiotics and exhibit some differences in sequence from those that are able to hydrolyze carbapenem antibiotics. The positions that differ may contribute to the unique substrate specificity of the class A carbapenemase SME-1. Codons in the SME-1 gene representing residues 104, 105, 132, 167, 237, and 241 were randomized by site-directed mutagenesis, and functional mutants were selected for the ability to hydrolyze imipenem, ampicillin, or cefotaxime. Although several positions are important for hydrolysis of β-lactam antibiotics, no single position was found to uniquely contribute to carbapenem hydrolysis. The results of this study support a model whereby the carbapenemase activity of SME-1 is due to a highly distributed set of interactions that subtly alter the structure of the active-site pocket. PMID:16048956

  3. Amino acid residues that contribute to substrate specificity of class A beta-lactamase SME-1.

    PubMed

    Majiduddin, Fahd K; Palzkill, Timothy

    2005-08-01

    Carbapenem antibiotics are used as antibiotics of last resort because they possess a broad spectrum of antimicrobial activity and are not easily hydrolyzed by beta-lactamases. Recently, class A enzymes, such as the SME-1, NMC-A, and IMI-1 beta-lactamases, have been identified with the capacity to hydrolyze carbapenem antibiotics. Traditional class A beta-lactamases, such as TEM-1 and SHV-1, are unable to hydrolyze carbapenem antibiotics and exhibit some differences in sequence from those that are able to hydrolyze carbapenem antibiotics. The positions that differ may contribute to the unique substrate specificity of the class A carbapenemase SME-1. Codons in the SME-1 gene representing residues 104, 105, 132, 167, 237, and 241 were randomized by site-directed mutagenesis, and functional mutants were selected for the ability to hydrolyze imipenem, ampicillin, or cefotaxime. Although several positions are important for hydrolysis of beta-lactam antibiotics, no single position was found to uniquely contribute to carbapenem hydrolysis. The results of this study support a model whereby the carbapenemase activity of SME-1 is due to a highly distributed set of interactions that subtly alter the structure of the active-site pocket.

  4. Monitoring the Presence of 13 Active Compounds in Surface Water Collected from Rural Areas in Northwestern Spain

    PubMed Central

    Iglesias, Alejandra; Nebot, Carolina; Vázquez, Beatriz I.; Coronel-Olivares, Claudia; Franco Abuín, Carlos M.; Cepeda, Alberto

    2014-01-01

    Drug residues are considered environmental contaminants, and their occurrence has recently become a matter of concern. Analytical methods and monitoring systems are therefore required to control the continuous input of these drug residues into the environment. This article presents a suitable HPLC-ESI-MS/MS method for the simultaneous extraction, detection and quantification of residues of 13 drugs (antimicrobials, glucocorticosteroids, anti-inflammatories, anti-hypertensives, anti-cancer drugs and triphenylmethane dyes) in surface water. A monitoring study with 549 water samples was carried out in northwestern Spain to detect the presence of drug residues over two sampling periods during 2010, 2011 and 2012. Samples were collected from rural areas with and without farming activity and from urban areas. The 13 analytes were detected, and 18% of the samples collected showed positive results for the presence of at least one analyte. More collection sites were located in rural areas than in urban areas. However, more positive samples with higher concentrations and a larger number of analytes were detected in samples collected from sites located after the discharge of a WWTP. Results indicated that the WWTPs seems to act as a concentration point. Positive samples were also detected at a site located near a drinking water treatment plant. PMID:24837665

  5. Monitoring the presence of 13 active compounds in surface water collected from rural areas in northwestern Spain.

    PubMed

    Iglesias, Alejandra; Nebot, Carolina; Vázquez, Beatriz I; Coronel-Olivares, Claudia; Abuín, Carlos M Franco; Cepeda, Alberto

    2014-05-15

    Drug residues are considered environmental contaminants, and their occurrence has recently become a matter of concern. Analytical methods and monitoring systems are therefore required to control the continuous input of these drug residues into the environment. This article presents a suitable HPLC-ESI-MS/MS method for the simultaneous extraction, detection and quantification of residues of 13 drugs (antimicrobials, glucocorticosteroids, anti-inflammatories, anti-hypertensives, anti-cancer drugs and triphenylmethane dyes) in surface water. A monitoring study with 549 water samples was carried out in northwestern Spain to detect the presence of drug residues over two sampling periods during 2010, 2011 and 2012. Samples were collected from rural areas with and without farming activity and from urban areas. The 13 analytes were detected, and 18% of the samples collected showed positive results for the presence of at least one analyte. More collection sites were located in rural areas than in urban areas. However, more positive samples with higher concentrations and a larger number of analytes were detected in samples collected from sites located after the discharge of a WWTP. Results indicated that the WWTPs seems to act as a concentration point. Positive samples were also detected at a site located near a drinking water treatment plant.

  6. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  7. Active Site Desolvation and Thermostability Trade-Offs in the Evolution of Catalytically Diverse Triazine Hydrolases.

    PubMed

    Sugrue, Elena; Carr, Paul D; Scott, Colin; Jackson, Colin J

    2016-11-15

    The desolvation of ionizable residues in the active sites of enzymes and the subsequent effects on catalysis and thermostability have been studied in model systems, yet little about how enzymes can naturally evolve to include active sites with highly reactive and desolvated charges is known. Variants of triazine hydrolase (TrzN) with significant differences in their active sites have been isolated from different bacterial strains: TrzN from Nocardioides sp. strain MTD22 contains a catalytic glutamate residue (Glu241) that is surrounded by hydrophobic and aromatic second-shell residues (Pro214 and Tyr215), whereas TrzN from Nocardioides sp. strain AN3 has a noncatalytic glutamine residue (Gln241) at an equivalent position, surrounded by hydrophilic residues (Thr214 and His215). To understand how and why these variants have evolved, a series of TrzN mutants were generated and characterized. These results show that desolvation by second-shell residues increases the pK a of Glu241, allowing it to act as a general acid at neutral pH. However, significant thermostability trade-offs are required to incorporate the ionizable Glu241 in the active site and to then enclose it in a hydrophobic microenvironment. Analysis of high-resolution crystal structures shows that there are almost no structural changes to the overall configuration of the active site due to these mutations, suggesting that the changes in activity and thermostability are purely based on the altered electrostatics. The natural evolution of these enzyme isoforms provides a unique system in which to study the fundamental process of charged residue desolvation in enzyme catalysis and its relative contribution to the creation and evolution of an enzyme active site.

  8. Distinct parietal sites mediate the influences of mood, arousal, and their interaction on human recognition memory.

    PubMed

    Greene, Ciara M; Flannery, Oliver; Soto, David

    2014-12-01

    The two dimensions of emotion, mood valence and arousal, have independent effects on recognition memory. At present, however, it is not clear how those effects are reflected in the human brain. Previous research in this area has generally dealt with memory for emotionally valenced or arousing stimuli, but the manner in which interacting mood and arousal states modulate responses in memory substrates remains poorly understood. We investigated memory for emotionally neutral items while independently manipulating mood valence and arousal state by means of music exposure. Four emotional conditions were created: positive mood/high arousal, positive mood/low arousal, negative mood/high arousal, and negative mood/low arousal. We observed distinct effects of mood valence and arousal in parietal substrates of recognition memory. Positive mood increased activity in ventral posterior parietal cortex (PPC) and orbitofrontal cortex, whereas arousal condition modulated activity in dorsal PPC and the posterior cingulate. An interaction between valence and arousal was observed in left ventral PPC, notably in a parietal area distinct from the those identified for the main effects, with a stronger effect of mood on recognition memory responses here under conditions of relative high versus low arousal. We interpreted the PPC activations in terms of the attention-to-memory hypothesis: Increased arousal may lead to increased top-down control of memory, and hence dorsal PPC activation, whereas positive mood valence may result in increased activity in ventral PPC regions associated with bottom-up attention to memory. These findings indicate that distinct parietal sites mediate the influences of mood, arousal, and their interplay during recognition memory.

  9. Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

    PubMed Central

    Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

    2007-01-01

    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

  10. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Dioxin effects on wood duck (Aix sponsa) embryos from sites near paper mills

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beeman, D.K.; Melancon, M.J.; Fleming, W.J.

    Biological and biochemical variables were studied in wood duck embryos from four dioxin-contaminated sites near paper mills in the Southeastern United States and three reference sites. Sites were selected based on a history of dioxin contamination in both sediments and fish. In addition, wood duck embryos collected downstream from an Arkansas Superfund site with demonstrated dioxin-induced reproductive impairment served as positive controls. Whole clutches of eggs were collected from the wild after fifteen days of incubation and mechanically incubated. Two embryos per clutch were sacrificed at pipping and liver monooxygenase activities (BROD, EROD and MROD) were quantified. Hatching success wasmore » determined for the remainder of the nest. Preliminary results indicate no difference in monooxygenase activities across sites even though the authors have previously demonstrated induction of monooxygenase activity in wood duck embryos in laboratory studies. In addition, there were no differences in weight at pipping, liver weight and liver weight to body weight ratios. No differences were seen in hatching success or weight at hatch nor were there any gross morphological abnormalities. This may indicate that exposure of wood ducks nesting near these pulp paper mills is below those which cause elevated monooxygenase activities and reproductive impairment.« less

  12. Impact of signals and experience on trust and trusting behavior.

    PubMed

    Chen, Ying-Hueih; Chien, Shu-Hua; Wu, Jyh-Jeng; Tsai, Pei-Yin

    2010-10-01

    Trust is an essential factor that drives virtual interaction and transactions on the Internet. Researchers have investigated the trust development process, and identified several important factors that form the basis for trust. This research combines the signal perspective and trust theory to examine the impact of market signals and past experience on trust formation and trusting behavior. Three market signals, including brand image, Web-site investment, and privacy policies, are identified and empirically tested to determine their impact on consumer trust. Based on 322 active Web users, the quantitative results suggest that brand image, Web-site investment, privacy policies, and past experience all positively impact trust formation. Furthermore, trust shows a positive effect on Web-site stickiness. Both theoretical and practical implications of the results are also offered.

  13. Modification of Epigenetic Patterns in Low Birth Weight Children: Importance of Hypomethylation of the ACE Gene Promoter

    PubMed Central

    Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C.; Ierardi, Daniela Filippini; Franco, Maria do Carmo

    2014-01-01

    There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (P<0.001) in parallel with a higher ACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (P<0.001) and systolic blood pressure levels (P<0.001). We also observed that the methylation level was significantly lower in LBW children who are carriers of the DD genotype compared to NBW children with DD genotype (P<0.024). In conclusion, we are able to demonstrate that the hypomethylation in the 3 CpG sites of ACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels. PMID:25170764

  14. Modification of epigenetic patterns in low birth weight children: importance of hypomethylation of the ACE gene promoter.

    PubMed

    Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C; Ierardi, Daniela Filippini; Franco, Maria do Carmo

    2014-01-01

    There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (P<0.001) in parallel with a higher ACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (P<0.001) and systolic blood pressure levels (P<0.001). We also observed that the methylation level was significantly lower in LBW children who are carriers of the DD genotype compared to NBW children with DD genotype (P<0.024). In conclusion, we are able to demonstrate that the hypomethylation in the 3 CpG sites of ACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels.

  15. Detection of Tuberculosis Infection Hotspots Using Activity Spaces Based Spatial Approach in an Urban Tokyo, from 2003 to 2011.

    PubMed

    Izumi, Kiyohiko; Ohkado, Akihiro; Uchimura, Kazuhiro; Murase, Yoshiro; Tatsumi, Yuriko; Kayebeta, Aya; Watanabe, Yu; Ishikawa, Nobukatsu

    2015-01-01

    Identifying ongoing tuberculosis infection sites is crucial for breaking chains of transmission in tuberculosis-prevalent urban areas. Previous studies have pointed out that detection of local accumulation of tuberculosis patients based on their residential addresses may be limited by a lack of matching between residences and tuberculosis infection sites. This study aimed to identify possible tuberculosis hotspots using TB genotype clustering statuses and a concept of "activity space", a place where patients spend most of their waking hours. We further compared the spatial distribution by different residential statuses and describe urban environmental features of the detected hotspots. Culture-positive tuberculosis patients notified to Shinjuku city from 2003 to 2011 were enrolled in this case-based cross-sectional study, and their demographic and clinical information, TB genotype clustering statuses, and activity space were collected. Spatial statistics (Global Moran's I and Getis-Ord Gi* statistics) identified significant hotspots in 152 census tracts, and urban environmental features and tuberculosis patients' characteristics in these hotspots were assessed. Of the enrolled 643 culture-positive tuberculosis patients, 416 (64.2%) were general inhabitants, 42 (6.5%) were foreign-born people, and 184 were homeless people (28.6%). The percentage of overall genotype clustering was 43.7%. Genotype-clustered general inhabitants and homeless people formed significant hotspots around a major railway station, whereas the non-clustered general inhabitants formed no hotspots. This suggested the detected hotspots of activity spaces may reflect ongoing tuberculosis transmission sites and were characterized by smaller residential floor size and a higher proportion of non-working households. Activity space-based spatial analysis suggested possible TB transmission sites around the major railway station and it can assist in further comprehension of TB transmission dynamics in an urban setting in Japan.

  16. Slow Starter Enzymes: Role of Active Site Architecture in the Catalytic Control in the Biosynthesis of Taxadiene by Taxadiene Synthase.

    PubMed

    Ansbacher, Tamar; Freud, Yehoshua; Major, Dan Thomas

    2018-05-23

    Taxadiene synthase (TXS) catalyzes the formation of the natural product Taxa-4(5),11(12)-diene (henceforth Taxadiene). Taxadiene is the precursor in the formation of Taxol, which is an important natural anti-cancer agent. In the current study, we present a detailed mechanistic view of the biosynthesis of Taxadiene by TXS, using a hybrid quantum mechanics-molecular mechanics potential in conjunction with free energy simulation methods. The obtained free energy landscape displays initial endergonic steps followed by a step-wise downhill profile, which is an emerging free energy fingerprint for type I terpene synthases. We identify an active site Trp residue (W753) as a key feature of the TXS active site architecture and propose that this residue stabilized intermediate cations via -cation interactions. To validate our proposed active TXS model, we examine a previously reported W753H mutation, which leads to exclusive formation of the side product, cembrene A. The simulations of the W753H mutant show that in the mutant structure, the His side-chain is in perfect position to deprotonate the cembrenyl cation en route to cembrene formation, and that this abortive deprotonation is an energetically facile process. Based on the current model, we propose that an analogous mutation of Y841 to His could possibly lead to verticillane. The current simulations stress the importance of precise positioning of key active site residues in stabilizing intermediate carbocations. In view of the great pharmaceutical importance of taxadiene, a detailed understanding of the TXS mechanism can provide important clues towards a synthetic strategy for taxol manufacturing.

  17. The School Ground Classroom: A Curriculum to Teach K-6 Subjects Outdoors. First Edition.

    ERIC Educational Resources Information Center

    Green, Dan; And Others

    Suggesting that outdoor activities can be positive learning experiences, lesson plans and activities were designed to demonstrate that the outdoors is an interdisciplinary classroom, to be used on virtually any school site, and to teach subject matter taught as part of the standard curriculum. Seventeen interdisciplinary ideas with correlated…

  18. Engineering substrate promiscuity in halophilic alcohol dehydrogenase (HvADH2) by in silico design.

    PubMed

    Cassidy, Jennifer; Bruen, Larah; Rosini, Elena; Molla, Gianluca; Pollegioni, Loredano; Paradisi, Francesca

    2017-01-01

    An alcohol dehydrogenase from the halophilic archaeon Haloferax volcanii (HvADH2) has been engineered by rational design to broaden its substrate scope towards the conversion of a range of aromatic substrates, including flurbiprofenol, that is an intermediate of the non-steroidal anti-inflammatory drug, flurbiprofen. Wild-type HvADH2 showed minimal activity with flurbiprofenol (11.1 mU/mg). A homology model of HvADH2 was built and docking experiments with this substrate revealed that the biphenyl rings of flurbiprofenol formed strong interactions with residues F85 and F108, preventing its optimal binding in the active site. Mutations at position 85 however did not increase activity. Site directed mutagenesis at position F108 allowed the identification of three variants showing a significant (up to 2.3-fold) enhancement of activity towards flurbiprofenol, when compared to wild-type HvADH2. Interestingly, F108G variant did not show the classic inhibition in the presence of (R)-enantiomer when tested with rac-1-phenylethanol, underling its potential in racemic resolution of secondary alcohols.

  19. Design and Preparation of Supported Au Catalyst with Enhanced Catalytic Activities by Rationally Positioning Au Nanoparticles on Anatase.

    PubMed

    Wang, Liang; Wang, Hong; Rice, Andrew E; Zhang, Wei; Li, Xiaokun; Chen, Mingshu; Meng, Xiangju; Lewis, James P; Xiao, Feng-Shou

    2015-06-18

    A synergistic effect between individual components is crucial for increasing the activity of metal/metal oxide catalysts. The greatest challenge is how to control the synergistic effect to obtain enhanced catalytic performance. Through density functional theory calculations of model Au/TiO2 catalysts, it is suggested that there is strong interaction between Au nanoparticles and Ti species at the edge/corner sites of anatase, which is favorable for the formation of stable oxygen vacancies. Motivated by this theoretical analysis, we have rationally prepared Au nanoparticles attached to edge/corner sites of anatase support (Au/TiO2-EC), confirmed by their HR-TEM images. As expected, this strong interaction is well characterized by Raman, UV-visible, and XPS techniques. Very interestingly, compared with conventional Au catalysts, Au/TiO2-EC exhibits superior catalytic activity in the oxidations using O2. Our approach to controlling Au nanoparticle positioning on anatase to obtain enhanced catalytic activity offers an efficient strategy for developing more novel supported metal catalysts.

  20. Concise Synthesis and Biological Evaluation of 2-Aroyl-5-Amino Benzo[b]thiophene Derivatives As a Novel Class of Potent Antimitotic Agents

    PubMed Central

    Romagnoli, Romeo; Baraldi, Pier Giovanni; Lopez-Cara, Carlota; Preti, Delia; Tabrizi, Mojgan Aghazadeh; Balzarini, Jan; Bassetto, Marcella; Brancale, Andrea; Fu, Xian-Hua; Gao, Yang; Li, Jun; Zhang, Su-Zhan; Hamel, Ernest; Bortolozzi, Roberta; Basso, Giuseppe; Viola, Giampietro

    2014-01-01

    The biological importance of microtubules make them an interesting target for the synthesis of antitumor agents. The 2-(3′,4′,5′-trimethoxybenzoyl)-5-aminobenzo[b]thiophene moiety was identified as a novel scaffold for the preparation of potent inhibitors of microtubule polymerization acting through the colchicine site of tubulin. The position of the methoxy group on the benzo[b]thiophene was important for maximal antiproliferative activity. Structure–activity relationship analysis established that the best activities were obtained with amino and methoxy groups placed at the C-5 and C-7 positions, respectively. Compounds 3c–e showed more potent inhibition of tubulin polymerization than combretastatin A-4 and strong binding to the colchicine site. These compounds also demonstrated substantial antiproliferative activity, with IC50 values ranging from 2.6 to 18 nM in a variety of cancer cell lines. Importantly, compound 3c (50 mg/kg), significantly inhibited the growth of the human osteosarcoma MNNG/HOS xenograft in nude mice. PMID:24164557

  1. Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence*

    PubMed Central

    Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L.; Embrey, Kevin J.; Golovanov, Alexander P.

    2016-01-01

    The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly 15N-labeled Ras as well as [13C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. PMID:26565026

  2. Structure of the imipenem-hydrolyzing class A beta-lactamase SME-1 from Serratia marcescens.

    PubMed

    Sougakoff, Wladimir; L'Hermite, Guillaume; Pernot, Lucile; Naas, Thierry; Guillet, Valérie; Nordmann, Patrice; Jarlier, Vincent; Delettré, Jean

    2002-02-01

    The structure of the beta-lactamase SME-1 from Serratia marcescens, a class A enzyme characterized by its significant activity against imipenem, has been determined to 2.13 A resolution. The overall structure of SME-1 is similar to that of other class A beta-lactamases. In the active-site cavity, most of the residues found in SME-1 are conserved among class A beta-lactamases, except at positions 104, 105 and 237, where a tyrosine, a histidine and a serine are found, respectively, and at position 238, which is occupied by a cysteine forming a disulfide bridge with the other cysteine residue located at position 69. The crucial role played by this disulfide bridge in SME-1 was confirmed by site-directed mutagenesis of Cys69 to Ala, which resulted in a mutant unable to confer resistance to imipenem and all other beta-lactam antibiotics tested. Another striking structural feature found in SME-1 was the short distance separating the side chains of the active serine residue at position 70 and the strictly conserved glutamate at position 166, which is up to 1.4 A shorter in SME-1 compared with other class A beta-lactamases. Consequently, the SME-1 structure cannot accommodate the essential catalytic water molecule found between Ser70 and Glu166 in the other class A beta-lactamases described so far, suggesting that a significant conformational change may be necessary in SME-1 to properly position the hydrolytic water molecule involved in the hydrolysis of the acyl-enzyme intermediate.

  3. Allosteric modulation of Ras positions Q61 for a direct role in catalysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buhrman, Greg; Holzapfel, Genevieve; Fetics, Susan

    2010-11-03

    Ras and its effector Raf are key mediators of the Ras/Raf/MEK/ERK signal transduction pathway. Mutants of residue Q61 impair the GTPase activity of Ras and are found prominently in human cancers. Yet the mechanism through which Q61 contributes to catalysis has been elusive. It is thought to position the catalytic water molecule for nucleophilic attack on the {gamma}-phosphate of GTP. However, we previously solved the structure of Ras from crystals with symmetry of the space group R32 in which switch II is disordered and found that the catalytic water molecule is present. Here we present a structure of wild-type Rasmore » with calcium acetate from the crystallization mother liquor bound at a site remote from the active site and likely near the membrane. This results in a shift in helix 3/loop 7 and a network of H-bonding interactions that propagates across the molecule, culminating in the ordering of switch II and placement of Q61 in the active site in a previously unobserved conformation. This structure suggests a direct catalytic role for Q61 where it interacts with a water molecule that bridges one of the {gamma}-phosphate oxygen atoms to the hydroxyl group of Y32 to stabilize the transition state of the hydrolysis reaction. We propose that Raf together with the binding of Ca{sup 2+} and a negatively charged group mimicked in our structure by the acetate molecule induces the ordering of switch I and switch II to complete the active site of Ras.« less

  4. Comparing aye-aye (Daubentonia madagascariensis) presence and distribution between degraded and non-degraded forest within Ranomafana National Park, Madagascar.

    PubMed

    Farris, Zach J; Morelli, Toni Lyn; Sefczek, Timothy; Wright, Patricia C

    2011-01-01

    The aye-aye is considered the most widely distributed lemur in Madagascar; however, the effect of forest quality on aye-aye abundance is unknown. We compared aye-aye presence across degraded and non-degraded forest at Ranomafana National Park, Madagascar. We used secondary signs (feeding sites, high activity sites) as indirect cues of aye-aye presence and Canarium trees as an indicator of resource availability. All 3 measured variables indicated higher aye-aye abundance within non-degraded forest; however, the differences across forest type were not significant. Both degraded and non-degraded forests showed a positive correlation between feeding sites and high activity sites. We found that Canarium, an important aye-aye food source, was rare and had limited dispersal, particularly across degraded forest. This preliminary study provides baseline data for aye-aye activity and resource utilization across degraded and non-degraded forests. Copyright © 2011 S. Karger AG, Basel.

  5. Modulation of individual steps in group I intron catalysis by a peripheral metal ion.

    PubMed

    Forconi, Marcello; Piccirilli, Joseph A; Herschlag, Daniel

    2007-10-01

    Enzymes are complex macromolecules that catalyze chemical reactions at their active sites. Important information about catalytic interactions is commonly gathered by perturbation or mutation of active site residues that directly contact substrates. However, active sites are engaged in intricate networks of interactions within the overall structure of the macromolecule, and there is a growing body of evidence about the importance of peripheral interactions in the precise structural organization of the active site. Here, we use functional studies, in conjunction with published structural information, to determine the effect of perturbation of a peripheral metal ion binding site on catalysis in a well-characterized catalytic RNA, the Tetrahymena thermophila group I ribozyme. We perturbed the metal ion binding site by site-specifically introducing a phosphorothioate substitution in the ribozyme's backbone, replacing the native ligands (the pro-R (P) oxygen atoms at positions 307 and 308) with sulfur atoms. Our data reveal that these perturbations affect several reaction steps, including the chemical step, despite the absence of direct contacts of this metal ion with the atoms involved in the chemical transformation. As structural probing with hydroxyl radicals did not reveal significant change in the three-dimensional structure upon phosphorothioate substitution, the effects are likely transmitted through local, rather subtle conformational rearrangements. Addition of Cd(2+), a thiophilic metal ion, rescues some reaction steps but has deleterious effects on other steps. These results suggest that native interactions in the active site may have been aligned by the naturally occurring peripheral residues and interactions to optimize the overall catalytic cycle.

  6. A two-helix motif positions the active site of lysophosphatidic acid acyltransferase for catalysis within the membrane bilayer

    PubMed Central

    Robertson, Rosanna M.; Yao, Jiangwei; Gajewski, Stefan; Kumar, Gyanendra; Martin, Erik W.; Rock, Charles O.; White, Stephen W.

    2017-01-01

    Phosphatidic acid is the central intermediate in membrane phospholipid synthesis and is generated by two acyltransferases in a pathway conserved in all life forms. The second step in this pathway is catalyzed by 1-acyl-sn-glycero-3-phosphate acyltransferase, called PlsC in bacteria. The crystal structure of PlsC from Thermotoga maritima reveals an unusual hydrophobic/aromatic N-terminal two-helix motif linked to an acyltransferase αβ domain that contains the catalytic HX4D motif. PlsC dictates the acyl chain composition of the 2-position of phospholipids, and the acyl chain selectivity ‘ruler’ is an appropriately placed and closed hydrophobic tunnel. This was confirmed by site-directed mutagenesis and membrane composition analysis of Escherichia coli cells expressing the mutated proteins. MD simulations reveal that the two-helix motif represents a novel substructure that firmly anchors the protein to one leaflet of the membrane. This binding mode allows the PlsC active site to acylate lysophospholipids within the membrane bilayer using soluble acyl donors. PMID:28714993

  7. A Member of the p38 Mitogen-Activated Protein Kinase Family Is Responsible for Transcriptional Induction of Dopa decarboxylase in the Epidermis of Drosophila melanogaster during the Innate Immune Response▿ †

    PubMed Central

    Davis, Monica M.; Primrose, David A.; Hodgetts, Ross B.

    2008-01-01

    Drosophila innate immunity is controlled primarily by the activation of IMD (immune deficiency) or Toll signaling leading to the production of antimicrobial peptides (AMPs). IMD signaling also activates the JUN N-terminal kinase (JNK) cascade, which is responsible for immune induction of non-antimicrobial peptide immune gene transcription though the transcription factor AP-1. Transcription of the Dopa decarboxylase (Ddc) gene is induced in response to gram-negative and gram-positive septic injury, but not aseptic wounding. Transcription is induced throughout the epidermis and not specifically at the site of infection. Ddc transcripts are detectible within 2 h and remain high for several hours following infection with either gram-negative or gram-positive bacteria. Using Ddc-green fluorescent protein (GFP) reporter gene constructs, we show that a conserved consensus AP-1 binding site upstream of the Ddc transcription start site is required for induction. However, neither the Toll, IMD, nor JNK pathway is involved. Rather, Ddc transcription depends on a previously uncharacterized member of the p38 mitogen-activated protein kinase family, p38c. We propose that the involvement of DDC in a new pathway involved in Drosophila immunity increases the levels of dopamine, which is metabolized to produce reactive quinones that exert an antimicrobial effect on invading bacteria. PMID:18519585

  8. Involvement of Sp1 and Microsatellite Repressor Sequences in the Transcriptional Control of the Human CD30 Gene

    PubMed Central

    Croager, Emma J.; Gout, Alexander M.; Abraham, Lawrence J.

    2000-01-01

    CD30, as a member of the tumor necrosis factor (TNF) receptor family, is expressed on the surface of activated lymphoid cells. CD30 overexpression is a characteristic of lymphoproliferative diseases such as Hodgkin’s/non-Hodgkin’s lymphomas, embryonal carcinoma, and a number of Th2-associated diseases. The CD30 gene has been mapped to a region of the murine genome that is involved in susceptibility to systemic lupus erythematosus. Functionally, CD30 may play a role in the deletion of autoreactive T cells. We were interested in determining the molecular nature of CD30 overexpression. Sequence comparison has revealed significant identity between the TATA-less human and murine CD30 promoters; they share a number of common consensus binding motifs. Transfection assays identified three regions of transcriptional importance; the region between position −1.2 kb and −336 bp, containing a CCAT microsatellite sequence, a conserved Sp1 site at positions −43 to −38, and a downstream promoter element (DPE) at positions +24 to +29. EMSA and DNase I footprinting showed specific DNA-protein interactions of the CD30 promoter with the Sp1 site and the CCAT repeat region. The DPE element was shown to be essential for start site selection. We conclude that the conserved Sp1 site at −43 to −38 is associated with maximum reporter gene activity, the DPE element is required for start site selection, and the CCAT tetranucleotide repeats act to repress transcription. We also have shown that the microsatellite is multiallelic, when we screened a random healthy population. Further studies are required to determine whether microsatellite instability in the repressor predisposes susceptible individuals to CD30 overexpression. PMID:10793083

  9. Sodium and Potassium Ions in Proteins and Enzyme Catalysis.

    PubMed

    Vašák, Milan; Schnabl, Joachim

    2016-01-01

    The group I alkali metal ions Na(+) and K(+) are ubiquitous components of biological fluids that surround biological macromolecules. They play important roles other than being nonspecific ionic buffering agents or mediators of solute exchange and transport. Molecular evolution and regulated high intracellular and extracellular M(+) concentrations led to incorporation of selective Na(+) and K(+) binding sites into enzymes to stabilize catalytic intermediates or to provide optimal positioning of substrates. The mechanism of M(+) activation, as derived from kinetic studies along with structural analysis, has led to the classification of cofactor-like (type I) or allosteric effector (type II) activated enzymes. In the type I mechanism substrate anchoring to the enzyme active site is mediated by M(+), often acting in tandem with a divalent cation like Mg(2+), Mn(2+) or Zn(2+). In the allosteric type II mechanism, M(+) binding enhances enzyme activity through conformational transitions triggered upon binding to a distant site. In this chapter, following the discussion of the coordination chemistry of Na(+) and K(+) ions and the structural features responsible for the metal binding site selectivity in M(+)-activated enzymes, well-defined examples of M(+)-activated enzymes are used to illustrate the structural basis for type I and type II activation by Na(+) and K(+).

  10. Cloning and characterization of microbial activated Aedes aegypti MEK4 (AaMEK4): influences of noncatalytic domains on enzymatic activity.

    PubMed

    Wu, R C-C; Cho, W-L

    2014-10-01

    Protein kinases are known to be involved in a number of signal transduction cascades. Both the stress-activated Jun N-terminal kinase (JNK) and mitogen-activated protein kinase (MAPK) p38 pathways have been shown to correlate with the insect immune response to microbial infection. MAP kinase kinase 4 (MEK4) is an upstream kinase of JNK and p38 kinase. The cDNA of AaMEK4 was cloned and characterized. AaMEK4 was activated by microbial lysates of Gram-positive, Gram-negative bacteria and yeast. The conserved lysine (K112 ) and the putative phosphorylation sites (S238 and T242 ) were shown to be important for kinase activity by site-directed mutagenesis. A common MAPK docking site (MAPK_dsA) was found and in addition, a new nearby docking site, MAPK_dsB, was identified in the N-terminal noncatalytic domain of AaMEK4. MAPK_dsB was shown to be a unique element in the MEK4 family. In this study, both MAPK_dsA and _dsB were demonstrated to be important to AaMEK4 enzymatic activity for the downstream protein kinase, Aap38. © 2014 The Royal Entomological Society.

  11. Restoration of areas degraded by alluvial sand mining: use of soil microbiological activity and plant biomass growth to assess evolution of restored riparian vegetation.

    PubMed

    Venson, Graziela R; Marenzi, Rosemeri C; Almeida, Tito César M; Deschamps-Schmidt, Alexandre; Testolin, Renan C; Rörig, Leonardo R; Radetski, Claudemir M

    2017-03-01

    River or alluvial sand mining is causing a variety of environmental problems in the Itajaí-açú river basin in Santa Catarina State (south of Brazil). When this type of commercial activity degrades areas around rivers, environmental restoration programs need to be executed. In this context, the aim of this study was to assess the evolution of a restored riparian forest based on data on the soil microbial activity and plant biomass growth. A reference site and three sites with soil degradation were studied over a 3-year period. Five campaigns were performed to determine the hydrolysis of the soil enzyme fluorescein diacetate (FDA), and the biomass productivity was determined at the end of the studied period. The variation in the enzyme activity for the different campaigns at each site was low, but this parameter did differ significantly according to the site. Well-managed sites showed the highest biomass productivity, and this, in turn, showed a strong positive correlation with soil enzyme activity. In conclusion, soil enzyme activity could form the basis for monitoring and the early prediction of the success of vegetal restoration programs, since responses at the higher level of biological organization take longer, inhibiting the assessment of the project within an acceptable time frame.

  12. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction*

    PubMed Central

    Algasaier, Sana I.; Exell, Jack C.; Bennet, Ian A.; Thompson, Mark J.; Gotham, Victoria J. B.; Shaw, Steven J.; Craggs, Timothy D.; Finger, L. David; Grasby, Jane A.

    2016-01-01

    Human flap endonuclease-1 (hFEN1) catalyzes the essential removal of single-stranded flaps arising at DNA junctions during replication and repair processes. hFEN1 biological function must be precisely controlled, and consequently, the protein relies on a combination of protein and substrate conformational changes as a prerequisite for reaction. These include substrate bending at the duplex-duplex junction and transfer of unpaired reacting duplex end into the active site. When present, 5′-flaps are thought to thread under the helical cap, limiting reaction to flaps with free 5′-termini in vivo. Here we monitored DNA bending by FRET and DNA unpairing using 2-aminopurine exciton pair CD to determine the DNA and protein requirements for these substrate conformational changes. Binding of DNA to hFEN1 in a bent conformation occurred independently of 5′-flap accommodation and did not require active site metal ions or the presence of conserved active site residues. More stringent requirements exist for transfer of the substrate to the active site. Placement of the scissile phosphate diester in the active site required the presence of divalent metal ions, a free 5′-flap (if present), a Watson-Crick base pair at the terminus of the reacting duplex, and the intact secondary structure of the enzyme helical cap. Optimal positioning of the scissile phosphate additionally required active site conserved residues Tyr40, Asp181, and Arg100 and a reacting duplex 5′-phosphate. These studies suggest a FEN1 reaction mechanism where junctions are bound and 5′-flaps are threaded (when present), and finally the substrate is transferred onto active site metals initiating cleavage. PMID:26884332

  13. Environmental and individual PAH exposures near rural natural gas extraction.

    PubMed

    Paulik, L Blair; Hobbie, Kevin A; Rohlman, Diana; Smith, Brian W; Scott, Richard P; Kincl, Laurel; Haynes, Erin N; Anderson, Kim A

    2018-05-29

    Natural gas extraction (NGE) has expanded rapidly in the United States in recent years. Despite concerns, there is little information about the effects of NGE on air quality or personal exposures of people living or working nearby. Recent research suggests NGE emits polycyclic aromatic hydrocarbons (PAHs) into air. This study used low-density polyethylene passive samplers to measure concentrations of PAHs in air near active (n = 3) and proposed (n = 2) NGE sites. At each site, two concentric rings of air samplers were placed around the active or proposed well pad location. Silicone wristbands were used to assess personal PAH exposures of participants (n = 19) living or working near the sampling sites. All samples were analyzed for 62 PAHs using GC-MS/MS, and point sources were estimated using the fluoranthene/pyrene isomer ratio. ∑PAH was significantly higher in air at active NGE sites (Wilcoxon rank sum test, p < 0.01). PAHs in air were also more petrogenic (petroleum-derived) at active NGE sites. This suggests that PAH mixtures at active NGE sites may have been affected by direct emissions from petroleum sources at these sites. ∑PAH was also significantly higher in wristbands from participants who had active NGE wells on their properties than from participants who did not (Wilcoxon rank sum test, p < 0.005). There was a significant positive correlation between ∑PAH in participants' wristbands and ∑PAH in air measured closest to participants' homes or workplaces (simple linear regression, p < 0.0001). These findings suggest that living or working near an active NGE well may increase personal PAH exposure. This work also supports the utility of the silicone wristband to assess personal PAH exposure. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Enzyme functional evolution through improved catalysis of ancestrally nonpreferred substrates

    PubMed Central

    Huang, Ruiqi; Hippauf, Frank; Rohrbeck, Diana; Haustein, Maria; Wenke, Katrin; Feike, Janie; Sorrelle, Noah; Piechulla, Birgit; Barkman, Todd J.

    2012-01-01

    In this study, we investigated the role for ancestral functional variation that may be selected upon to generate protein functional shifts using ancestral protein resurrection, statistical tests for positive selection, forward and reverse evolutionary genetics, and enzyme functional assays. Data are presented for three instances of protein functional change in the salicylic acid/benzoic acid/theobromine (SABATH) lineage of plant secondary metabolite-producing enzymes. In each case, we demonstrate that ancestral nonpreferred activities were improved upon in a daughter enzyme after gene duplication, and that these functional shifts were likely coincident with positive selection. Both forward and reverse mutagenesis studies validate the impact of one or a few sites toward increasing activity with ancestrally nonpreferred substrates. In one case, we document the occurrence of an evolutionary reversal of an active site residue that reversed enzyme properties. Furthermore, these studies show that functionally important amino acid replacements result in substrate discrimination as reflected in evolutionary changes in the specificity constant (kcat/KM) for competing substrates, even though adaptive substitutions may affect KM and kcat separately. In total, these results indicate that nonpreferred, or even latent, ancestral protein activities may be coopted at later times to become the primary or preferred protein activities. PMID:22315396

  15. Enzyme functional evolution through improved catalysis of ancestrally nonpreferred substrates.

    PubMed

    Huang, Ruiqi; Hippauf, Frank; Rohrbeck, Diana; Haustein, Maria; Wenke, Katrin; Feike, Janie; Sorrelle, Noah; Piechulla, Birgit; Barkman, Todd J

    2012-02-21

    In this study, we investigated the role for ancestral functional variation that may be selected upon to generate protein functional shifts using ancestral protein resurrection, statistical tests for positive selection, forward and reverse evolutionary genetics, and enzyme functional assays. Data are presented for three instances of protein functional change in the salicylic acid/benzoic acid/theobromine (SABATH) lineage of plant secondary metabolite-producing enzymes. In each case, we demonstrate that ancestral nonpreferred activities were improved upon in a daughter enzyme after gene duplication, and that these functional shifts were likely coincident with positive selection. Both forward and reverse mutagenesis studies validate the impact of one or a few sites toward increasing activity with ancestrally nonpreferred substrates. In one case, we document the occurrence of an evolutionary reversal of an active site residue that reversed enzyme properties. Furthermore, these studies show that functionally important amino acid replacements result in substrate discrimination as reflected in evolutionary changes in the specificity constant (k(cat)/K(M)) for competing substrates, even though adaptive substitutions may affect K(M) and k(cat) separately. In total, these results indicate that nonpreferred, or even latent, ancestral protein activities may be coopted at later times to become the primary or preferred protein activities.

  16. Pitting corrosion of titanium. Interim report, June-December 1993

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Casillas, N.; Charlebois, S.J.; Smyrl, W.H.

    1994-01-20

    The breakdown of native and anodically-grown oxide films on Ti electrodes is investigated by scanning electrochemical microscopy (SECM), video microscopy, transmission electron microscopy and voltammetry. SECM is used to demonstrate that the oxidation of Br- on Ti occurs at microscopic surface sites (10 - 50 micrometer diameter, 30 sites/sq cm) that are randomly positioned across the oxide surface. After determining the position of the active sites for Br- oxidation, breakdown of the oxide is initiated by increasing the electrode potential to more positive values. Direct correspondence is observed between the location of the electroactive sites and corrosion pits, indicating thatmore » oxide breakdown is associated with a localized site of high electrical conductivity. The potential at which pitting is observed in voltammetric experiments is found to be proportional to the average oxide thickness, for values ranging between 20 and 100 A, indicating that breakdown is determined either by the magnitude of the electric field within the oxide or by the interfacial potential at the oxide/Br- solution interface. Pitting occurs at significantly lower potentials in Br- solutions than in C 1- solutions, suggesting a strong chemical interaction between the TiO2 surface and Br-. A mechanism of oxide breakdown is proposed that is based on the potential-dependent chemical dissolution of the oxide at microscopic surface sites.« less

  17. Homology modeling and molecular dynamics simulation of N-myristoyltransferase from protozoan parasites: active site characterization and insights into rational inhibitor design

    NASA Astrophysics Data System (ADS)

    Sheng, Chunquan; Ji, Haitao; Miao, Zhenyuan; Che, Xiaoyin; Yao, Jianzhong; Wang, Wenya; Dong, Guoqiang; Guo, Wei; Lü, Jiaguo; Zhang, Wannian

    2009-06-01

    Myristoyl-CoA:protein N-myristoyltransferase (NMT) is a cytosolic monomeric enzyme that catalyzes the transfer of the myristoyl group from myristoyl-CoA to the N-terminal glycine of a number of eukaryotic cellular and viral proteins. Recent experimental data suggest NMT from parasites could be a promising new target for the design of novel antiparasitic agents with new mode of action. However, the active site topology and inhibitor specificity of these enzymes remain unclear. In this study, three-dimensional models of NMT from Plasmodium falciparum (PfNMT), Leishmania major (LmNMT) and Trypanosoma brucei (TbNMT) were constructed on the basis of the crystal structures of fungal NMTs using homology modeling method. The models were further refined by energy minimization and molecular dynamics simulations. The active sites of PfNMT, LmNMT and TbNMT were characterized by multiple copy simultaneous search (MCSS). MCSS functional maps reveal that PfNMT, LmNMT and TbNMT share a similar active site topology, which is defined by two hydrophobic pockets, a hydrogen-bonding (HB) pocket, a negatively-charged HB pocket and a positively-charged HB pocket. Flexible docking approaches were then employed to dock known inhibitors into the active site of PfNMT. The binding mode, structure-activity relationships and selectivity of inhibitors were investigated in detail. From the results of molecular modeling, the active site architecture and certain key residues responsible for inhibitor binding were identified, which provided insights for the design of novel inhibitors of parasitic NMTs.

  18. Molecular dynamics explorations of active site structure in designed and evolved enzymes.

    PubMed

    Osuna, Sílvia; Jiménez-Osés, Gonzalo; Noey, Elizabeth L; Houk, K N

    2015-04-21

    This Account describes the use of molecular dynamics (MD) simulations to reveal how mutations alter the structure and organization of enzyme active sites. As proposed by Pauling about 70 years ago and elaborated by many others since then, biocatalysis is efficient when functional groups in the active site of an enzyme are in optimal positions for transition state stabilization. Changes in mechanism and covalent interactions are often critical parts of enzyme catalysis. We describe our explorations of the dynamical preorganization of active sites using MD, studying the fluctuations between active and inactive conformations normally concealed to static crystallography. MD shows how the various arrangements of active site residues influence the free energy of the transition state and relates the populations of the catalytic conformational ensemble to the enzyme activity. This Account is organized around three case studies from our laboratory. We first describe the importance of dynamics in evaluating a series of computationally designed and experimentally evolved enzymes for the Kemp elimination, a popular subject in the enzyme design field. We find that the dynamics of the active site is influenced not only by the original sequence design and subsequent mutations but also by the nature of the ligand present in the active site. In the second example, we show how microsecond MD has been used to uncover the role of remote mutations in the active site dynamics and catalysis of a transesterase, LovD. This enzyme was evolved by Tang at UCLA and Codexis, Inc., and is a useful commercial catalyst for the production of the drug simvastatin. X-ray analysis of inactive and active mutants did not reveal differences in the active sites, but relatively long time scale MD in solution showed that the active site of the wild-type enzyme preorganizes only upon binding of the acyl carrier protein (ACP) that delivers the natural acyl group to the active site. In the absence of bound ACP, a noncatalytic arrangement of the catalytic triad is dominant. Unnatural truncated substrates are inactive because of the lack of protein-protein interactions provided by the ACP. Directed evolution is able to gradually restore the catalytic organization of the active site by motion of the protein backbone that alters the active site geometry. In the third case, we demonstrate the key role of MD in combination with crystallography to identify the origins of substrate-dependent stereoselectivities in a number of Codexis-engineered ketoreductases, one of which is used commercially for the production of the antibiotic sulopenem. Here, mutations alter the shape of the active site as well as the accessibility of water to different regions of it. Each of these examples reveals something different about how mutations can influence enzyme activity and shows that directed evolution, like natural evolution, can increase catalytic activity in a variety of remarkable and often subtle ways.

  19. Redox competition mode of scanning electrochemical microscopy (RC-SECM) for visualisation of local catalytic activity.

    PubMed

    Eckhard, Kathrin; Chen, Xingxing; Turcu, Florin; Schuhmann, Wolfgang

    2006-12-07

    In order to locally analyse catalytic activity on modified surfaces a transient redox competition mode of scanning electrochemical microscopy (SECM) has been developed. In a bi-potentiostatic experiment the SECM tip competes with the sample for the very same analyte. This leads to a current decrease at the SECM tip, if it is positioned in close proximity to an active catalyst site on the surface. Specifically, local catalytic activity of a Pt-catalyst modified sample with respect to the catalytic reduction of molecular oxygen was investigated. At higher local catalytic activity the local 02 partial pressure within the gap between accurately positioned SECM tip and sample is depleted, leading to a noticeable tip current decrease over active sites. A flexible software module has been implemented into the SECM to adapt the competition conditions by proper definition of tip and sample potentials. A potential pulse profile enables the localised electrochemically induced generation of molecular oxygen prior to the competition detection. The current decay curves are recorded over the entire duration of the applied reduction pulse. Hence, a time resolved processing of the acquired current values provides movies of the local oxygen concentration against x,y-position. The SECM redox competition mode was verified with a macroscopic Pt-disk electrode as a test sample to demonstrate the feasibility of the approach. Moreover, highly dispersed electro-deposited spots of gold and platinum on glassy carbon were visualised using the redox competition mode of SECM. Catalyst spots of different nature as well as activity inhomogeneities within one spot caused by local variations in Pt-loading were visualised successfully.

  20. A case study on the feasibility and performance of an UWB-AoA real time location system for resources management of civil construction projects

    NASA Astrophysics Data System (ADS)

    Mok, Esmond; Xia, Linyuan; Retscher, Guenther; Tian, Hui

    2010-06-01

    The application of integrated satellite and modern wireless positioning technologies for ubiquitous real-time resources management in large scale civil engineering projects can greatly optimize the time and cost in the construction process, and is now the trend for modern construction project management. As the outdoor conditions of most civil construction sites are open to sky, satellite positioning with the popularly used Global Positioning System (GPS) has been proved to be very efficient and effective. However, the condition in indoor and underground construction site is very complicated due to the fact that different construction activities would be carried out in different congested areas, involving heavy construction plant, equipment, professionals and technical personnel. Nowadays different emerging technologies such as Wi-Fi and ZigBee can be adopted for position and tracking in indoor environments. Nevertheless, under the very complicated construction site conditions these technologies may fail due to movement of human resources and construction plant, variation of metrological conditions, and serious multipath effects of signals. It is considered that Ultra Wide Band (UWB) technology is more suitable for indoor construction site environments. In this paper, a case study on the attempt of integrating GPS with Ubisense Real-time Location System (RTLS) for resources management in an underground railway construction site is discussed. Laboratory and field tests have shown that the RTLS can provide better resources management capability in terms of positioning accuracy and stability than Wi-Fi and ZigBee technologies under complicated construction environments. The test results show that the system can normally achieve better than 15 cm accuracy, and better than 1 m under adverse geometrical site condition. However, the high instrumental set up cost and the requirement for high quality data transmission cable for high precision time synchronization between sensors may deter wide application of similar system for resources management in construction sites.

  1. Accurate placement of substrate RNA by Gar1 in H/ACA RNA-guided pseudouridylation.

    PubMed

    Wang, Peng; Yang, Lijiang; Gao, Yi Qin; Zhao, Xin Sheng

    2015-09-03

    H/ACA RNA-guided ribonucleoprotein particle (RNP), the most complicated RNA pseudouridylase so far known, uses H/ACA guide RNA for substrate capture and four proteins (Cbf5, Nop10, L7Ae and Gar1) for pseudouridylation. Although it was shown that Gar1 not only facilitates the product release, but also enhances the catalytic activity, the chemical role that Gar1 plays in this complicated machinery is largely unknown. Kinetics measurement on Pyrococcus furiosus RNPs at different temperatures making use of fluorescence anisotropy showed that Gar1 reduces the catalytic barrier through affecting the activation entropy instead of enthalpy. Site-directed mutagenesis combined with molecular dynamics simulations demonstrated that V149 in the thumb loop of Cbf5 is critical in placing the target uridine to the right position toward catalytic D85 of Cbf5. The enzyme elegantly aligns the position of uridine in the catalytic site with the help of Gar1. In addition, conversion of uridine to pseudouridine results in a rigid syn configuration of the target nucleotide in the active site and causes Gar1 to pull out the thumb. Both factors guarantee the efficient release of the product. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Monoubiquitination Inhibits the Actin Bundling Activity of Fascin*

    PubMed Central

    Lin, Shengchen; Lu, Shuang; Mulaj, Mentor; Fang, Bin; Keeley, Tyler; Wan, Lixin; Hao, Jihui; Muschol, Martin; Sun, Jianwei; Yang, Shengyu

    2016-01-01

    Fascin is an actin bundling protein that cross-links individual actin filaments into straight, compact, and stiff bundles, which are crucial for the formation of filopodia, stereocillia, and other finger-like membrane protrusions. The dysregulation of fascin has been implicated in cancer metastasis, hearing loss, and blindness. Here we identified monoubiquitination as a novel mechanism that regulates fascin bundling activity and dynamics. The monoubiquitination sites were identified to be Lys247 and Lys250, two residues located in a positive charge patch at the actin binding site 2 of fascin. Using a chemical ubiquitination method, we synthesized chemically monoubiquitinated fascin and determined the effects of monoubiquitination on fascin bundling activity and dynamics. Our data demonstrated that monoubiquitination decreased the fascin bundling EC50, delayed the initiation of bundle assembly, and accelerated the disassembly of existing bundles. By analyzing the electrostatic properties on the solvent-accessible surface of fascin, we proposed that monoubiquitination introduced steric hindrance to interfere with the interaction between actin filaments and the positively charged patch at actin binding site 2. We also identified Smurf1 as a E3 ligase regulating the monoubiquitination of fascin. Our findings revealed a previously unidentified regulatory mechanism for fascin, which will have important implications for the understanding of actin bundle regulation under physiological and pathological conditions. PMID:27879315

  3. De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

    PubMed

    Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

    2011-02-10

    Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.

  4. 77 FR 27539 - Petition for Waiver of Compliance

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-10

    ... position of the gate arm down and the flashing lights dark not be considered as an activation failure... docket number and may be submitted by any of the following methods: Web site: http://www.regulations.gov...

  5. Leopard frog PCB levels and evaluation of EROD as a biomarker in Green Bay ecosystem

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Y.W.; Karasov, W.H.; Patnode, K.P.

    1995-12-31

    The induction of mixed function oxidases has been shown to be a promising biomarker in many taxa of wildlife, though not yet tested for amphibians. The three hypotheses tested in this study were (1) activities of hepatic EROD of leopard frog (Rana pipiens) are induced following exposure to planar chlorinated PCBs, (2) tissue PCB residue levels of leopard frogs are positively correlated with their wetland sediment PCB levels, and (3) EROD activities are positively correlated with tissue PCB concentrations and sediment PCB. In the laboratory, EROD was increased 2--3 times seven days after i.p. injection with PCB 126 at dosesmore » {ge} 2.3 ppm (wet mass basis). Leopard frogs from seven sites along the Lower Fox River and Green Bay in 1994--1995 were assayed for hepatic EROD activities and total PCB levels in carcasses. Tissue PCB levels ranged from 3 to 152 ppb (including coplanar congeners) and were highest from sites with higher sediment PCB. EROD activity in frogs collected in August--September was not significantly correlated with frog body mass and was similar among sites with one exception. There was no significant correlation between EROD activity and tissue PCB concentration. This result was consistent with the fact that the frogs collected from the Green Bay ecosystem had relatively low PCB levels compared with what was required for induction in the laboratory. The authors conclude that EROD activity is not a sensitive biomarker of PCB exposure in leopard frogs in this ecosystem.« less

  6. Environmental and physical controls on northern terrestrial methane emissions across permafrost zones

    USGS Publications Warehouse

    Olefeldt, David; Turetsky, Merritt R.; Crill, Patrick M.; McGuire, A. David

    2013-01-01

    Methane (CH4) emissions from the northern high-latitude region represent potentially significant biogeochemical feedbacks to the climate system. We compiled a database of growing-season CH4 emissions from terrestrial ecosystems located across permafrost zones, including 303 sites described in 65 studies. Data on environmental and physical variables, including permafrost conditions, were used to assess controls on CH4 emissions. Water table position, soil temperature, and vegetation composition strongly influenced emissions and had interacting effects. Sites with a dense sedge cover had higher emissions than other sites at comparable water table positions, and this was an effect that was more pronounced at low soil temperatures. Sensitivity analysis suggested that CH4 emissions from ecosystems where the water table on average is at or above the soil surface (wet tundra, fen underlain by permafrost, and littoral ecosystems) are more sensitive to variability in soil temperature than drier ecosystems (palsa dry tundra, bog, and fen), whereas the latter ecosystems conversely are relatively more sensitive to changes of the water table position. Sites with near-surface permafrost had lower CH4 fluxes than sites without permafrost at comparable water table positions, a difference that was explained by lower soil temperatures. Neither the active layer depth nor the organic soil layer depth was related to CH4 emissions. Permafrost thaw in lowland regions is often associated with increased soil moisture, higher soil temperatures, and increased sedge cover. In our database, lowland thermokarst sites generally had higher emissions than adjacent sites with intact permafrost, but emissions from thermokarst sites were not statistically higher than emissions from permafrost-free sites with comparable environmental conditions. Overall, these results suggest that future changes to terrestrial high-latitude CH4 emissions will be more proximately related to changes in moisture, soil temperature, and vegetation composition than to increased availability of organic matter following permafrost thaw.

  7. Tailoring nanoscopic confines to maximize catalytic activity of hydronium ions

    NASA Astrophysics Data System (ADS)

    Shi, Hui; Eckstein, Sebastian; Vjunov, Aleksei; Camaioni, Donald M.; Lercher, Johannes A.

    2017-05-01

    Acid catalysis by hydronium ions is ubiquitous in aqueous-phase organic reactions. Here we show that hydronium ion catalysis, exemplified by intramolecular dehydration of cyclohexanol, is markedly influenced by steric constraints, yielding turnover rates that increase by up to two orders of magnitude in tight confines relative to an aqueous solution of a Brønsted acid. The higher activities in zeolites BEA and FAU than in water are caused by more positive activation entropies that more than offset higher activation enthalpies. The higher activity in zeolite MFI with pores smaller than BEA and FAU is caused by a lower activation enthalpy in the tighter confines that more than offsets a less positive activation entropy. Molecularly sized pores significantly enhance the association between hydronium ions and alcohols in a steric environment resembling the constraints in pockets of enzymes stabilizing active sites.

  8. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  9. Matriptase shedding is closely coupled with matriptase zymogen activation and requires de novo proteolytic cleavage likely involving its own activity

    PubMed Central

    Barndt, Robert; Gu, Yayun; Chen, Chien-Yu; Tseng, I-Chu; Su, Sheng-Fang; Wang, Jehng-Kang; Johnson, Michael D.

    2017-01-01

    The type 2 transmembrane serine protease matriptase is involved in many pathophysiological processes probably via its enzymatic activity, which depends on the dynamic relationship between zymogen activation and protease inhibition. Matriptase shedding can prolong the life of enzymatically active matriptase and increase accessibility to substrates. We show here that matriptase shedding occurs via a de novo proteolytic cleavage at sites located between the SEA domain and the CUB domain. Point or combined mutations at the four positively charged amino acid residues in the region following the SEA domain allowed Arg-186 to be identified as the primary cleavage site responsible for matriptase shedding. Kinetic studies further demonstrate that matriptase shedding is temporally coupled with matriptase zymogen activation. The onset of matriptase shedding lags one minute behind matriptase zymogen activation. Studies with active site triad Ser-805 point mutated matriptase, which no longer undergoes zymogen activation or shedding, further suggests that matriptase shedding depends on matriptase zymogen activation, and that matriptase proteolytic activity may be involved in its own shedding. Our studies uncover an autonomous mechanism coupling matriptase zymogen activation, proteolytic activity, and shedding such that a proportion of newly generated active matriptase escapes HAI-1-mediated rapid inhibition by shedding into the extracellular milieu. PMID:28829816

  10. Working Memory in the Processing of Long-Distance Dependencies: Interference and Filler Maintenance

    ERIC Educational Resources Information Center

    Ness, Tal; Meltzer-Asscher, Aya

    2017-01-01

    During the temporal delay between the filler and gap sites in long-distance dependencies, the "active filler" strategy can be implemented in two ways: the filler phrase can be actively maintained in working memory ("maintenance account"), or it can be retrieved only when the parser posits a gap ("retrieval account").…

  11. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  12. The Role of Publicly Funded Family Planning Sites In Health Insurance Enrollment.

    PubMed

    Yarger, Jennifer; Daniel, Sara; Biggs, M Antonia; Malvin, Jan; Brindis, Claire D

    2017-06-01

    Publicly funded family planning providers are well positioned to help uninsured individuals learn about health insurance coverage options and effectively navigate the enrollment process. Understanding how these providers are engaged in enrollment assistance and the challenges they face in providing assistance is important for maximizing their role in health insurance outreach and enrollment. In 2014, some 684 sites participating in California's family planning program were surveyed about their involvement in helping clients enroll in health insurance. Weighted univariate and bivariate analyses were conducted to examine enrollment activities and perceived barriers to facilitating enrollment by site characteristics. Most family planning program sites provided eligibility screening (68%), enrollment education (77%), on-site enrollment assistance (55%) and referrals for off-site enrollment support (91%). The proportion of sites offering each type of assistance was highest among community clinics (83-96%), primary care and multispecialty sites (65-95%), Title X-funded sites (72-98%), sites with contracts to provide primary care services (64-93%) and sites using only electronic health records (66-94%). Commonly identified barriers to providing assistance were lack of staff time (reported by 52% of sites), lack of funding (47%), lack of physical space (34%) and lack of staff knowledge (33%); only 20% of sites received funding to support enrollment activities. Although there were significant variations among them, publicly funded family planning providers in California are actively engaged in health insurance enrollment. Supporting their vital role in enrollment could help in the achievement of universal health insurance coverage. Copyright © 2017 by the Guttmacher Institute.

  13. Kinetic analysis of butyrylcholinesterase-catalyzed hydrolysis of acetanilides.

    PubMed

    Masson, Patrick; Froment, Marie-Thérèse; Gillon, Emilie; Nachon, Florian; Darvesh, Sultan; Schopfer, Lawrence M

    2007-09-01

    The aryl-acylamidase (AAA) activity of butyrylcholinesterase (BuChE) has been known for a long time. However, the kinetic mechanism of aryl-acylamide hydrolysis by BuChE has not been investigated. Therefore, the catalytic properties of human BuChE and its peripheral site mutant (D70G) toward neutral and charged aryl-acylamides were determined. Three neutral (o-nitroacetanilide, m-nitroacetanilide, o-nitrophenyltrifluoroacetamide) and one positively charged (3-(acetamido) N,N,N-trimethylanilinium, ATMA) acetanilides were studied. Hydrolysis of ATMA by wild-type and D70G enzymes showed a long transient phase preceding the steady state. The induction phase was characterized by a hysteretic "burst". This reflects the existence of two enzyme states in slow equilibrium with different catalytic properties. Steady-state parameters for hydrolysis of the three acetanilides were compared to catalytic parameters for hydrolysis of esters giving the same acetyl intermediate. Wild-type BuChE showed substrate activation while D70G displayed a Michaelian behavior with ATMA as with positively charged esters. Owing to the low affinity of BuChE for amide substrates, the hydrolysis kinetics of neutral amides was first order. Acylation was the rate-determining step for hydrolysis of aryl-acetylamide substrates. Slow acylation of the enzyme, relative to that by esters may, in part, be due suboptimal fit of the aryl-acylamides in the active center of BuChE. The hypothesis that AAA and esterase active sites of BuChE are non-identical was tested with mutant BuChE. It was found that mutations on the catalytic serine, S198C and S198D, led to complete loss of both activities. The silent variant (FS117) had neither esterase nor AAA activity. Mutation in the peripheral site (D70G) had the same effect on esterase and AAA activities. Echothiophate inhibited both activities identically. It was concluded that the active sites for esterase and AAA activities are identical, i.e. S198. This excludes any other residue present in the gorge for being the catalytic nucleophile pole.

  14. Structures of Arg- and Gln-type bacterial cysteine dioxygenase homologs: Arg- and Gln-type Bacterial CDO Homologs

    DOE PAGES

    Driggers, Camden M.; Hartman, Steven J.; Karplus, P. Andrew

    2015-01-01

    In some bacteria, cysteine is converted to cysteine sulfinic acid by cysteine dioxygenases (CDO) that are only ~15–30% identical in sequence to mammalian CDOs. Among bacterial proteins having this range of sequence similarity to mammalian CDO are some that conserve an active site Arg residue (“Arg-type” enzymes) and some having a Gln substituted for this Arg (“Gln-type” enzymes). Here, we describe a structure from each of these enzyme types by analyzing structures originally solved by structural genomics groups but not published: a Bacillus subtilis “Arg-type” enzyme that has cysteine dioxygenase activity (BsCDO), and a Ralstonia eutropha “Gln-type” CDO homolog ofmore » uncharacterized activity (ReCDOhom). The BsCDO active site is well conserved with mammalian CDO, and a cysteine complex captured in the active site confirms that the cysteine binding mode is also similar. The ReCDOhom structure reveals a new active site Arg residue that is hydrogen bonding to an iron-bound diatomic molecule we have interpreted as dioxygen. Notably, the Arg position is not compatible with the mode of Cys binding seen in both rat CDO and BsCDO. As sequence alignments show that this newly discovered active site Arg is well conserved among “Gln-type” CDO enzymes, we conclude that the “Gln-type” CDO homologs are not authentic CDOs but will have substrate specificity more similar to 3-mercaptopropionate dioxygenases.« less

  15. Structure based drug design: development of potent and selective factor IXa (FIXa) inhibitors.

    PubMed

    Wang, Shouming; Beck, Richard; Burd, Andrew; Blench, Toby; Marlin, Frederic; Ayele, Tenagne; Buxton, Stuart; Dagostin, Claudio; Malic, Maja; Joshi, Rina; Barry, John; Sajad, Mohammed; Cheung, Chiming; Shaikh, Shaheda; Chahwala, Suresh; Chander, Chaman; Baumgartner, Christine; Holthoff, Hans-Peter; Murray, Elizabeth; Blackney, Michael; Giddings, Amanda

    2010-02-25

    On the basis of our understanding on the binding interactions of the benzothiophene template within the FIXa active site by X-ray crystallography and molecular modeling studies, we developed our SAR strategy by targeting the 4-position of the template to access the S1 beta and S2-S4 sites. A number of highly selective and potent factor Xa (FXa) and FIXa inhibitors were identified by simple switch of functional groups with conformational changes toward the S2-S4 sites.

  16. Ternary structure reveals mechanism of a membrane diacylglycerol kinase

    PubMed Central

    Li, Dianfan; Stansfeld, Phillip J.; Sansom, Mark S. P.; Keogh, Aaron; Vogeley, Lutz; Howe, Nicole; Lyons, Joseph A.; Aragao, David; Fromme, Petra; Fromme, Raimund; Basu, Shibom; Grotjohann, Ingo; Kupitz, Christopher; Rendek, Kimberley; Weierstall, Uwe; Zatsepin, Nadia A.; Cherezov, Vadim; Liu, Wei; Bandaru, Sateesh; English, Niall J.; Gati, Cornelius; Barty, Anton; Yefanov, Oleksandr; Chapman, Henry N.; Diederichs, Kay; Messerschmidt, Marc; Boutet, Sébastien; Williams, Garth J.; Marvin Seibert, M.; Caffrey, Martin

    2015-01-01

    Diacylglycerol kinase catalyses the ATP-dependent conversion of diacylglycerol to phosphatidic acid in the plasma membrane of Escherichia coli. The small size of this integral membrane trimer, which has 121 residues per subunit, means that available protein must be used economically to craft three catalytic and substrate-binding sites centred about the membrane/cytosol interface. How nature has accomplished this extraordinary feat is revealed here in a crystal structure of the kinase captured as a ternary complex with bound lipid substrate and an ATP analogue. Residues, identified as essential for activity by mutagenesis, decorate the active site and are rationalized by the ternary structure. The γ-phosphate of the ATP analogue is positioned for direct transfer to the primary hydroxyl of the lipid whose acyl chain is in the membrane. A catalytic mechanism for this unique enzyme is proposed. The active site architecture shows clear evidence of having arisen by convergent evolution. PMID:26673816

  17. Ternary structure reveals mechanism of a membrane diacylglycerol kinase

    NASA Astrophysics Data System (ADS)

    Li, Dianfan; Stansfeld, Phillip J.; Sansom, Mark S. P.; Keogh, Aaron; Vogeley, Lutz; Howe, Nicole; Lyons, Joseph A.; Aragao, David; Fromme, Petra; Fromme, Raimund; Basu, Shibom; Grotjohann, Ingo; Kupitz, Christopher; Rendek, Kimberley; Weierstall, Uwe; Zatsepin, Nadia A.; Cherezov, Vadim; Liu, Wei; Bandaru, Sateesh; English, Niall J.; Gati, Cornelius; Barty, Anton; Yefanov, Oleksandr; Chapman, Henry N.; Diederichs, Kay; Messerschmidt, Marc; Boutet, Sébastien; Williams, Garth J.; Marvin Seibert, M.; Caffrey, Martin

    2015-12-01

    Diacylglycerol kinase catalyses the ATP-dependent conversion of diacylglycerol to phosphatidic acid in the plasma membrane of Escherichia coli. The small size of this integral membrane trimer, which has 121 residues per subunit, means that available protein must be used economically to craft three catalytic and substrate-binding sites centred about the membrane/cytosol interface. How nature has accomplished this extraordinary feat is revealed here in a crystal structure of the kinase captured as a ternary complex with bound lipid substrate and an ATP analogue. Residues, identified as essential for activity by mutagenesis, decorate the active site and are rationalized by the ternary structure. The γ-phosphate of the ATP analogue is positioned for direct transfer to the primary hydroxyl of the lipid whose acyl chain is in the membrane. A catalytic mechanism for this unique enzyme is proposed. The active site architecture shows clear evidence of having arisen by convergent evolution.

  18. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J

    1998-01-01

    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538

  19. Charge neutralization in the active site of the catalytic trimer of aspartate transcarbamoylase promotes diverse structural changes.

    PubMed

    Endrizzi, James A; Beernink, Peter T

    2017-11-01

    A classical model for allosteric regulation of enzyme activity posits an equilibrium between inactive and active conformations. An alternative view is that allosteric activation is achieved by increasing the potential for conformational changes that are essential for catalysis. In the present study, substitution of a basic residue in the active site of the catalytic (C) trimer of aspartate transcarbamoylase with a non-polar residue results in large interdomain hinge changes in the three chains of the trimer. One conformation is more open than the chains in both the wild-type C trimer and the catalytic chains in the holoenzyme, the second is closed similar to the bisubstrate-analog bound conformation and the third hinge angle is intermediate to the other two. The active-site 240s loop conformation is very different between the most open and closed chains, and is disordered in the third chain, as in the holoenzyme. We hypothesize that binding of anionic substrates may promote similar structural changes. Further, the ability of the three catalytic chains in the trimer to access the open and closed active-site conformations simultaneously suggests a cyclic catalytic mechanism, in which at least one of the chains is in an open conformation suitable for substrate binding whereas another chain is closed for catalytic turnover. Based on the many conformations observed for the chains in the isolated catalytic trimer to date, we propose that allosteric activation of the holoenzyme occurs by release of quaternary constraint into an ensemble of active-site conformations. © 2017 The Protein Society.

  20. Explicit treatment of active-site waters enhances quantum mechanical/implicit solvent scoring: Inhibition of CDK2 by new pyrazolo[1,5-a]pyrimidines.

    PubMed

    Hylsová, Michaela; Carbain, Benoit; Fanfrlík, Jindřich; Musilová, Lenka; Haldar, Susanta; Köprülüoğlu, Cemal; Ajani, Haresh; Brahmkshatriya, Pathik S; Jorda, Radek; Kryštof, Vladimír; Hobza, Pavel; Echalier, Aude; Paruch, Kamil; Lepšík, Martin

    2017-01-27

    We present comprehensive testing of solvent representation in quantum mechanics (QM)-based scoring of protein-ligand affinities. To this aim, we prepared 21 new inhibitors of cyclin-dependent kinase 2 (CDK2) with the pyrazolo[1,5-a]pyrimidine core, whose activities spanned three orders of magnitude. The crystal structure of a potent inhibitor bound to the active CDK2/cyclin A complex revealed that the biphenyl substituent at position 5 of the pyrazolo[1,5-a]pyrimidine scaffold was located in a previously unexplored pocket and that six water molecules resided in the active site. Using molecular dynamics, protein-ligand interactions and active-site water H-bond networks as well as thermodynamics were probed. Thereafter, all the inhibitors were scored by the QM approach utilizing the COSMO implicit solvent model. Such a standard treatment failed to produce a correlation with the experiment (R 2  = 0.49). However, the addition of the active-site waters resulted in significant improvement (R 2  = 0.68). The activities of the compounds could thus be interpreted by taking into account their specific noncovalent interactions with CDK2 and the active-site waters. In summary, using a combination of several experimental and theoretical approaches we demonstrate that the inclusion of explicit solvent effects enhance QM/COSMO scoring to produce a reliable structure-activity relationship with physical insights. More generally, this approach is envisioned to contribute to increased accuracy of the computational design of novel inhibitors. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  1. Observed TEC Anomalies by GNSS Sites Preceding the Aegean Sea Earthquake of 2014

    NASA Astrophysics Data System (ADS)

    Ulukavak, Mustafa; Yal&ccedul; ınkaya, Mualla

    2016-11-01

    In recent years, Total Electron Content (TEC) data, obtained from Global Navigation Satellites Systems (GNSS) receivers, has been widely used to detect seismo-ionospheric anomalies. In this study, Global Positioning System - Total Electron Content (GPS-TEC) data were used to investigate ionospheric abnormal behaviors prior to the 2014 Aegean Sea earthquake (40.305°N 25.453°E, 24 May 2014, 09:25:03 UT, Mw:6.9). The data obtained from three Continuously Operating Reference Stations in Turkey (CORS-TR) and two International GNSS Service (IGS) sites near the epicenter of the earthquake is used to detect ionospheric anomalies before the earthquake. Solar activity index (F10.7) and geomagnetic activity index (Dst), which are both related to space weather conditions, were used to analyze these pre-earthquake ionospheric anomalies. An examination of these indices indicated high solar activity between May 8 and 15, 2014. The first significant increase (positive anomalies) in Vertical Total Electron Content (VTEC) was detected on May 14, 2014 or 10 days before the earthquake. This positive anomaly can be attributed to the high solar activity. The indices do not imply high solar or geomagnetic activity after May 15, 2014. Abnormal ionospheric TEC changes (negative anomaly) were observed at all stations one day before the earthquake. These changes were lower than the lower bound by approximately 10-20 TEC unit (TECU), and may be considered as the ionospheric precursor of the 2014 Aegean Sea earthquake

  2. Positive allosteric modulators as an approach to nicotinic acetylcholine receptor- targeted therapeutics: advantages and limitations

    PubMed Central

    Williams, Dustin K.; Wang, Jingyi; Papke, Roger L.

    2011-01-01

    Neuronal nicotinic acetylcholine receptors (nAChR), recognized targets for drug development in cognitive and neuro-degenerative disorders, are allosteric proteins with dynamic interconversions between multiple functional states. Activation of the nAChR ion channel is primarily controlled by the binding of ligands (agonists, partial agonists, competitive antagonists) at conventional agonist binding sites, but is also regulated in either negative or positive ways by the binding of ligands to other modulatory sites. In this review, we discuss models for the activation and desensitization of nAChR, and the discovery of multiple types of ligands that influence those processes in both heteromeric nAChR, such as the high affinity nicotine receptors of the brain, and homomeric α7-type receptors. In recent years, α7 nAChRs have been identified as a potential target for therapeutic indications leading to the development of α7-selective agonists and partial agonists. However, unique properties of α7 nAChR, including low probability of channel opening and rapid desensitization, may limit the therapeutic usefulness of ligands binding exclusively to conventional agonist binding sites. New enthusiasm for the therapeutic targeting of α7 has come from the identification of α7-selective positive allosteric modulators (PAMs) that work effectively on the intrinsic factors that limit α7 ion channel activation. While these new drugs appear promising for therapeutic development, we also consider potential caveats and possible limitations for their use, including PAM-insensitive forms of desensitization and cytotoxicity issues. PMID:21575610

  3. Positive allosteric modulators as an approach to nicotinic acetylcholine receptor-targeted therapeutics: advantages and limitations.

    PubMed

    Williams, Dustin K; Wang, Jingyi; Papke, Roger L

    2011-10-15

    Neuronal nicotinic acetylcholine receptors (nAChR), recognized targets for drug development in cognitive and neuro-degenerative disorders, are allosteric proteins with dynamic interconversions between multiple functional states. Activation of the nAChR ion channel is primarily controlled by the binding of ligands (agonists, partial agonists, competitive antagonists) at conventional agonist binding sites, but is also regulated in either negative or positive ways by the binding of ligands to other modulatory sites. In this review, we discuss models for the activation and desensitization of nAChR, and the discovery of multiple types of ligands that influence those processes in both heteromeric nAChR, such as the high-affinity nicotine receptors of the brain, and homomeric α7-type receptors. In recent years, α7 nAChRs have been identified as a potential target for therapeutic indications leading to the development of α7-selective agonists and partial agonists. However, unique properties of α7 nAChR, including low probability of channel opening and rapid desensitization, may limit the therapeutic usefulness of ligands binding exclusively to conventional agonist binding sites. New enthusiasm for the therapeutic targeting of α7 has come from the identification of α7-selective positive allosteric modulators (PAMs) that work effectively on the intrinsic factors that limit α7 ion channel activation. While these new drugs appear promising for therapeutic development, we also consider potential caveats and possible limitations for their use, including PAM-insensitive forms of desensitization and cytotoxicity issues. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Design, Synthesis, in Vitro, and in Vivo Anticancer and Antiangiogenic Activity of Novel 3-Arylaminobenzofuran Derivatives Targeting the Colchicine Site on Tubulin

    PubMed Central

    Romagnoli, Romeo; Baraldi, Pier Giovanni; Salvador, Maria Kimatrai; Prencipe, Filippo; Lopez-Cara, Carlota; Ortega, Santiago Schiaffino; Brancale, Andrea; Hamel, Ernest; Castagliuolo, Ignazio; Mitola, Stefania; Ronca, Roberto; Bortolozzi, Roberta; Porcù, Elena; Basso, Giuseppe; Viola, Giampietro

    2015-01-01

    A new series of compounds characterized by the presence of a 2-methoxy/ethoxycarbonyl group, combined with either no substituent or a methoxy group at each of the four possible positions of the benzene portion of the 3-(3′,4′,5′-trimethoxyanilino)benzo[b]furan skeleton, were evaluated for antiproliferative activity against cancer cells in culture and, for selected, highly active compounds, inhibition of tubulin polymerization, cell cycle effects, and in vivo potency. The greatest antiproliferative activity occurred with a methoxy group introduced at the C-6 position, the least with this substituent at C-4. Thus far, the most promising compound in this series was 2-methoxycarbonyl-3-(3′,4′,5′-trimethoxyanilino)-6-methoxybenzo-[b]furan (3g), which inhibited cancer cell growth at nanomolar concentrations (IC50 values of 0.3–27 nM), bound to the colchicine site of tubulin, induced apoptosis, and showed, both in vitro and in vivo, potent vascular disrupting properties derived from the effect of this compound on vascular endothelial cells. Compound 3g had in vivo antitumor activity in a murine model comparable to the activity obtained with combretastatin A-4 phosphate. PMID:25785605

  5. Both positional and chemical variables control in vitro proteolytic cleavage of a presenilin ortholog

    PubMed Central

    Naing, Swe-Htet; Kalyoncu, Sibel; Smalley, David M.; Kim, Hyojung; Tao, Xingjian; George, Josh B.; Jonke, Alex P.; Oliver, Ryan C.; Urban, Volker S.; Torres, Matthew P.; Lieberman, Raquel L.

    2018-01-01

    Mechanistic details of intramembrane aspartyl protease (IAP) chemistry, which is central to many biological and pathogenic processes, remain largely obscure. Here, we investigated the in vitro kinetics of a microbial intramembrane aspartyl protease (mIAP) fortuitously acting on the renin substrate angiotensinogen and the C-terminal transmembrane segment of amyloid precursor protein (C100), which is cleaved by the presenilin subunit of γ-secretase, an Alzheimer disease (AD)-associated IAP. mIAP variants with substitutions in active-site and putative substrate-gating residues generally exhibit impaired, but not abolished, activity toward angiotensinogen and retain the predominant cleavage site (His–Thr). The aromatic ring, but not the hydroxyl substituent, within Tyr of the catalytic Tyr–Asp (YD) motif plays a catalytic role, and the hydrolysis reaction incorporates bulk water as in soluble aspartyl proteases. mIAP hydrolyzes the transmembrane region of C100 at two major presenilin cleavage sites, one corresponding to the AD-associated Aβ42 peptide (Ala–Thr) and the other to the non-pathogenic Aβ48 (Thr–Leu). For the former site, we observed more favorable kinetics in lipid bilayer–mimicking bicelles than in detergent solution, indicating that substrate–lipid and substrate–enzyme interactions both contribute to catalytic rates. High-resolution MS analyses across four substrates support a preference for threonine at the scissile bond. However, results from threonine-scanning mutagenesis of angiotensinogen demonstrate a competing positional preference for cleavage. Our results indicate that IAP cleavage is controlled by both positional and chemical factors, opening up new avenues for selective IAP inhibition for therapeutic interventions. PMID:29382721

  6. Multiple Glycogen-binding Sites in Eukaryotic Glycogen Synthase Are Required for High Catalytic Efficiency toward Glycogen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baskaran, Sulochanadevi; Chikwana, Vimbai M.; Contreras, Christopher J.

    2012-12-10

    Glycogen synthase is a rate-limiting enzyme in the biosynthesis of glycogen and has an essential role in glucose homeostasis. The three-dimensional structures of yeast glycogen synthase (Gsy2p) complexed with maltooctaose identified four conserved maltodextrin-binding sites distributed across the surface of the enzyme. Site-1 is positioned on the N-terminal domain, site-2 and site-3 are present on the C-terminal domain, and site-4 is located in an interdomain cleft adjacent to the active site. Mutation of these surface sites decreased glycogen binding and catalytic efficiency toward glycogen. Mutations within site-1 and site-2 reduced the V{sub max}/S{sub 0.5} for glycogen by 40- and 70-fold,more » respectively. Combined mutation of site-1 and site-2 decreased the V{sub max}/S{sub 0.5} for glycogen by >3000-fold. Consistent with the in vitro data, glycogen accumulation in glycogen synthase-deficient yeast cells ({Delta}gsy1-gsy2) transformed with the site-1, site-2, combined site-1/site-2, or site-4 mutant form of Gsy2p was decreased by up to 40-fold. In contrast to the glycogen results, the ability to utilize maltooctaose as an in vitro substrate was unaffected in the site-2 mutant, moderately affected in the site-1 mutant, and almost completely abolished in the site-4 mutant. These data show that the ability to utilize maltooctaose as a substrate can be independent of the ability to utilize glycogen. Our data support the hypothesis that site-1 and site-2 provide a 'toehold mechanism,' keeping glycogen synthase tightly associated with the glycogen particle, whereas site-4 is more closely associated with positioning of the nonreducing end during catalysis.« less

  7. Monitoring Ras Interactions with the Nucleotide Exchange Factor Son of Sevenless (Sos) Using Site-specific NMR Reporter Signals and Intrinsic Fluorescence.

    PubMed

    Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L; Embrey, Kevin J; Golovanov, Alexander P

    2016-01-22

    The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly (15)N-labeled Ras as well as [(13)C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Kinetics and Molecular Docking Studies of 6-Formyl Umbelliferone Isolated from Angelica decursiva as an Inhibitor of Cholinesterase and BACE1.

    PubMed

    Ali, Md Yousof; Seong, Su Hui; Reddy, Machireddy Rajeshkumar; Seo, Sung Yong; Choi, Jae Sue; Jung, Hyun Ah

    2017-09-24

    Coumarins, which have low toxicity, are present in some natural foods, and are used in various herbal remedies, have attracted interest in recent years because of their potential medicinal properties. In this study, we report the isolation of two natural coumarins, namely umbelliferone ( 1 ) and 6-formyl umbelliferone ( 2 ), from Angelica decursiva , and the synthesis of 8-formyl umbelliferone ( 3 ) from 1 . We investigated the anti-Alzheimer disease (anti-AD) potential of these coumarins by assessing their ability to inhibit acetylcholinesterase (AChE), butyrylcholinesterase (BChE), and β-site amyloid precursor protein (APP) cleaving enzyme 1 (BACE1). Among these coumarins, 2 exhibited poor inhibitory activity against AChE and BChE, and modest activity against BACE1. Structure-activity relationship analysis showed that 2 has an aldehyde group at the C-6 position, and exhibited strong anti-AD activity, whereas the presence or absence of an aldehyde group at the C-8 position reduced the anti-AD activity of 3 and 1 , respectively. In addition, 2 exhibited concentration-dependent inhibition of peroxynitrite-mediated protein tyrosine nitration. A kinetic study revealed that 2 and 3 non-competitively inhibited BACE1. To confirm enzyme inhibition, we predicted the 3D structures of AChE and BACE1, and used AutoDock 4.2 to simulate binding of coumarins to these enzymes. The blind docking studies demonstrated that these molecules could interact with both the catalytic active sites and peripheral anionic sites of AChE and BACE1. Together, our results indicate that 2 has an interesting inhibitory activity in vitro, and can be used in further studies to develop therapeutic modalities for the treatment of AD.

  9. Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination

    PubMed Central

    Rowley, Paul A.; Kachroo, Aashiq H.; Ma, Chien-Hui; Maciaszek, Anna D.; Guga, Piotr; Jayaram, Makkuni

    2015-01-01

    Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modification. The chemical chirality of MeP, in conjunction with mutant recombinases, reveals the stereochemical contributions of Arg-I and Arg-II. The SP preference of the native reaction is specified primarily by Arg-I. MeP reaction supported by Arg-II is nearly bias-free or RP-biased, depending on the Arg-I substituent. Positional conservation of the arginines does not translate into strict functional conservation. Charge reversal by glutamic acid substitution at Arg-I or Arg-II has opposite effects on Cre and Flp in MeP reactions. In Flp, the base immediately 5′ to the scissile MeP strongly influences the choice between the catalytic tyrosine and water as the nucleophile for strand scission, thus between productive recombination and futile hydrolysis. The recombinase active site embodies the evolutionary optimization of interactions that not only favor the normal reaction but also proscribe antithetical side reactions. PMID:25999343

  10. Subcellular Relocalization and Positive Selection Play Key Roles in the Retention of Duplicate Genes of Populus Class III Peroxidase Family[W][OPEN

    PubMed Central

    Ren, Lin-Ling; Liu, Yan-Jing; Liu, Hai-Jing; Qian, Ting-Ting; Qi, Li-Wang; Wang, Xiao-Ru; Zeng, Qing-Yin

    2014-01-01

    Gene duplication is the primary source of new genes and novel functions. Over the course of evolution, many duplicate genes lose their function and are eventually removed by deletion. However, some duplicates have persisted and evolved diverse functions. A particular challenge is to understand how this diversity arises and whether positive selection plays a role. In this study, we reconstructed the evolutionary history of the class III peroxidase (PRX) genes from the Populus trichocarpa genome. PRXs are plant-specific enzymes that play important roles in cell wall metabolism and in response to biotic and abiotic stresses. We found that two large tandem-arrayed clusters of PRXs evolved from an ancestral cell wall type PRX to vacuole type, followed by tandem duplications and subsequent functional specification. Substitution models identified seven positively selected sites in the vacuole PRXs. These positively selected sites showed significant effects on the biochemical functions of the enzymes. We also found that positive selection acts more frequently on residues adjacent to, rather than directly at, a critical active site of the enzyme, and on flexible regions rather than on rigid structural elements of the protein. Our study provides new insights into the adaptive molecular evolution of plant enzyme families. PMID:24934172

  11. Integration of high-risk human papillomavirus into cellular cancer-related genes in head and neck cancer cell lines.

    PubMed

    Walline, Heather M; Goudsmit, Christine M; McHugh, Jonathan B; Tang, Alice L; Owen, John H; Teh, Bin T; McKean, Erin; Glover, Thomas W; Graham, Martin P; Prince, Mark E; Chepeha, Douglas B; Chinn, Steven B; Ferris, Robert L; Gollin, Susanne M; Hoffmann, Thomas K; Bier, Henning; Brakenhoff, Ruud; Bradford, Carol R; Carey, Thomas E

    2017-05-01

    Human papillomavirus (HPV)-positive oropharyngeal cancer is generally associated with excellent response to therapy, but some HPV-positive tumors progress despite aggressive therapy. The purpose of this study was to evaluate viral oncogene expression and viral integration sites in HPV16- and HPV18-positive squamous cell carcinoma lines. E6/E7 alternate transcripts were assessed by reverse transcriptase-polymerase chain reaction (RT-PCR). Detection of integrated papillomavirus sequences (DIPS-PCR) and sequencing identified viral insertion sites and affected host genes. Cellular gene expression was assessed across viral integration sites. All HPV-positive cell lines expressed alternate HPVE6/E7 splicing indicative of active viral oncogenesis. HPV integration occurred within cancer-related genes TP63, DCC, JAK1, TERT, ATR, ETV6, PGR, PTPRN2, and TMEM237 in 8 head and neck squamous cell carcinoma (HNSCC) lines but UM-SCC-105 and UM-GCC-1 had only intergenic integration. HPV integration into cancer-related genes occurred in 7 of 9 HPV-positive cell lines and of these 6 were from tumors that progressed. HPV integration into cancer-related genes may be a secondary carcinogenic driver in HPV-driven tumors. © 2017 Wiley Periodicals, Inc. Head Neck 39: 840-852, 2017. © 2017 Wiley Periodicals, Inc.

  12. A population genetic analysis of the midget faded rattlesnake in Wyoming

    USGS Publications Warehouse

    Oyler-McCance, Sara J.; Parker, J.M.

    2010-01-01

    Little is known about the population biology of midget faded rattlesnakes, a sensitive subspecies of the Western Rattlesnake, despite conservation efforts to protect them. We conducted a molecular genetic study of midget faded rattlesnakes in southwestern Wyoming to investigate population genetic structure in this area, particularly with reference to Flaming Gorge Reservoir and its associated human activities, and to document levels of genetic diversity. We genotyped 229 snakes from 11 sampling sites using 9 microsatellite loci. We found significant levels of genetic structure among sites that were better explained by geographic region and isolation by distance than by position relative to waterways. Sites on either side of the reservoir at its widest point were not significantly different. Six of the sites showed signatures of a population bottleneck using an alpha value of 0.05. Three of these bottlenecked sites (the three most northern) were the most genetically distinct and occur in areas of greatest impact from human activity.

  13. Characterization of surface complexes in enhanced Raman scattering

    NASA Astrophysics Data System (ADS)

    Roy, D.; Furtak, T. E.

    1984-11-01

    An indicator molecule, para-nitrosodimethylanaline (p-NDMA), has been used to study the chemical nature of surface complexes involving the active site for SERS in the electrochemical environment. We present evidence for positively charged Ag atoms stabilized by coadsorbed Cl- ions as the primary sites which are produced during the oxidation reduction cycle treatment of an Ag electrode. Depending on the relative number of Cl- ions which influence the Ag site the active site demonstrates a greater or lesser electron accepting character toward p-NDMA. This character is influenced by the applied voltage and by the presence of Tl+ ions in the bulk of the solution near the surface. As in previously studied systems p-NDMA/Cl-/Ag complexes demonstrate charge transfer excitation which in this case is from the p-NDMA to the Ag site. These results further solidify the importance of complex formation in electrochemical SERS and suggest that caution should be applied when using SERS as a quantitative measure of surface coverage.

  14. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria.

    PubMed

    Yang, Yunpeng; Zhang, Lu; Huang, He; Yang, Chen; Yang, Sheng; Gu, Yang; Jiang, Weihong

    2017-01-24

    Catabolite control protein A (CcpA) is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR) and carbon catabolite activation (CCA), two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt) consensus site that is called a catabolite response element (cre) within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named cre var , has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA). It was found that the length of the intervening spacer of cre var can affect CcpA binding affinity, and moreover, the core palindromic sequence of cre var is the key structure for regulation. Such a variable architecture of cre var shows potential importance for CcpA's diverse and fine regulation. A total of 103 potential cre var sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs), and 30 sites were confirmed to be bound by CcpA. These 30 cre var sites are associated with 27 genes involved in many important pathways. Also of significance, the cre var sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria. In Gram-positive bacteria, the global regulator CcpA controls a large number of important physiological and metabolic processes. Although a typical consensus CcpA-binding site, cre, has been identified, it remains poorly explored for the diversity of CcpA-mediated catabolite regulation. Here, we discovered a novel flexible CcpA-binding site architecture (cre var ) that is highly variable in both length and base composition but follows certain principles, providing new insights into how CcpA can differentially recognize a variety of target genes to form a complicated regulatory network. A comprehensive search further revealed the wide distribution of cre var sites in Gram-positive bacteria, indicating it may have a universal function. This finding is the first to characterize such a highly flexible transcription factor-binding site architecture, which would be valuable for deeper understanding of CcpA-mediated global catabolite regulation in bacteria. Copyright © 2017 Yang et al.

  15. Spatially resolved thermal desorption/ionization coupled with mass spectrometry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jesse, Stephen; Van Berkel, Gary J; Ovchinnikova, Olga S

    2013-02-26

    A system and method for sub-micron analysis of a chemical composition of a specimen are described. The method includes providing a specimen for evaluation and a thermal desorption probe, thermally desorbing an analyte from a target site of said specimen using the thermally active tip to form a gaseous analyte, ionizing the gaseous analyte to form an ionized analyte, and analyzing a chemical composition of the ionized analyte. The thermally desorbing step can include heating said thermally active tip to above 200.degree. C., and positioning the target site and the thermally active tip such that the heating step forms themore » gaseous analyte. The thermal desorption probe can include a thermally active tip extending from a cantilever body and an apex of the thermally active tip can have a radius of 250 nm or less.« less

  16. Molecular dynamics simulation study of the "stay or leave" problem for two magnesium ions in gene transcription.

    PubMed

    Wu, Shaogui

    2017-06-01

    Two magnesium ions play important roles in nucleotide addition cycle (NAC) of gene transcription. However, at the end of each NAC, why does one ion stay in the active site while the other ion leaves with product pyrophosphate (PP i )? This problem still remains obscure. In this work, we studied the problem using all-atom molecular dynamics simulation combined with steered molecular dynamics and umbrella sampling simulation methods. Our simulations reveal that although both ions are located in the active site after chemistry, their detailed positions are not symmetrical, leading to their different forces from surrounding groups. One ion makes weaker contacts with PP i than the whole protein. Hence, PP i release is less likely to take it away. The other one forms tighter contacts with PP i relative to the protein. The formed (Mg 2+ -PP i ) 2- complex is found to break the contacts with surrounding protein residues one by one so as to dissociate from the active site. This effectively avoids the coexistence of two ions in the active site after PP i release and guarantees a reasonable Mg 2+ ion number in the active site for the next NAC. The observations from this work can provide valuable information for comprehensively understanding the molecular mechanism of transcription. Proteins 2017; 85:1002-1007. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  17. Path to Collagenolysis

    PubMed Central

    Prior, Stephen H.; Byrne, Todd S.; Tokmina-Roszyk, Dorota; Fields, Gregg B.

    2016-01-01

    Collagenolysis is essential in extracellular matrix homeostasis, but its structural basis has long been shrouded in mystery. We have developed a novel docking strategy guided by paramagnetic NMR that positions a triple-helical collagen V mimic (synthesized with nitroxide spin labels) in the active site of the catalytic domain of matrix metalloproteinase-12 (MMP-12 or macrophage metalloelastase) primed for catalysis. The collagenolytically productive complex forms by utilizing seven distinct subsites that traverse the entire length of the active site. These subsites bury ∼1,080 Å2 of surface area, over half of which is contributed by the trailing strand of the synthetic collagen V mimic, which also appears to ligate the catalytic zinc through the glycine carbonyl oxygen of its scissile G∼VV triplet. Notably, the middle strand also occupies the full length of the active site where it contributes extensive interfacial contacts with five subsites. This work identifies, for the first time, the productive and specific interactions of a collagen triple helix with an MMP catalytic site. The results uniquely demonstrate that the active site of the MMPs is wide enough to accommodate two strands from collagen triple helices. Paramagnetic relaxation enhancements also reveal an extensive array of encounter complexes that form over a large part of the catalytic domain. These transient complexes could possibly facilitate the formation of collagenolytically active complexes via directional Brownian tumbling. PMID:26887942

  18. Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism

    PubMed Central

    Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y.; Varnado, Brittany; Beutler, John A.; Murelli, Ryan P.; Le Grice, Stuart F. J.; Tang, Liang

    2015-01-01

    Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg2+. A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg2+ from Ca2+. Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution. PMID:26450964

  19. Substrate Specificity of Cysteine Proteases Beyond the S2 Pocket: Mutagenesis and Molecular Dynamics Investigation of Fasciola hepatica Cathepsins L

    PubMed Central

    Corvo, Ileana; Ferraro, Florencia; Merlino, Alicia; Zuberbühler, Kathrin; O'Donoghue, Anthony J.; Pastro, Lucía; Pi-Denis, Natalia; Basika, Tatiana; Roche, Leda; McKerrow, James H.; Craik, Charles S.; Caffrey, Conor R.; Tort, José F.

    2018-01-01

    Cysteine proteases are widespread in all life kingdoms, being central to diverse physiological processes based on a broad range of substrate specificity. Paralogous Fasciola hepatica cathepsin L proteases are essential to parasite invasion, tissue migration and reproduction. In spite of similarities in their overall sequence and structure, these enzymes often exhibit different substrate specificity. These preferences are principally determined by the amino acid composition of the active site's S2 subsite (pocket) of the enzyme that interacts with the substrate P2 residue (Schetcher and Berger nomenclature). Although secreted FhCL1 accommodates aliphatic residues in the S2 pocket, FhCL2 is also efficient in cleaving proline in that position. To understand these differences, we engineered the FhCL1 S2 subsite at three amino acid positions to render it identical to that present in FhCL2. The substitutions did not produce the expected increment in proline accommodation in P2. Rather, they decreased the enzyme's catalytic efficiency toward synthetic peptides. Nonetheless, a change in the P3 specificity was associated with the mutation of Leu67 to Tyr, a hinge residue between the S2 and S3 subsites that contributes to the accommodation of Gly in S3. Molecular dynamic simulations highlighted changes in the spatial distribution and secondary structure of the S2 and S3 pockets of the mutant FhCL1 enzymes. The reduced affinity and catalytic efficiency of the mutant enzymes may be due to a narrowing of the active site cleft that hinders the accommodation of substrates. Because the variations in the enzymatic activity measured could not be exclusively allocated to those residues lining the active site, other more external positions might modulate enzyme conformation, and, therefore, catalytic activity. PMID:29725596

  20. The influence of body position and microclimate on ketamine and metabolite distribution in decomposed skeletal remains.

    PubMed

    Cornthwaite, H M; Watterson, J H

    2014-10-01

    The influence of body position and microclimate on ketamine (KET) and metabolite distribution in decomposed bone tissue was examined. Rats received 75 mg/kg (i.p.) KET (n = 30) or remained drug-free (controls, n = 4). Following euthanasia, rats were divided into two groups and placed outdoors to decompose in one of the three positions: supine (SUP), prone (PRO) or upright (UPR). One group decomposed in a shaded, wooded microclimate (Site 1) while the other decomposed in an exposed sunlit microclimate with gravel substrate (Site 2), roughly 500 m from Site 1. Following decomposition, bones (lumbar vertebrae, thoracic vertebra, cervical vertebrae, rib, pelvis, femora, tibiae, humeri and scapulae) were collected and sorted for analysis. Clean, ground bones underwent microwave-assisted extraction using acetone : hexane mixture (1 : 1, v/v), followed by solid-phase extraction and analysis using GC-MS. Drug levels, expressed as mass normalized response ratios, were compared across all bone types between body position and microclimates. Bone type was a main effect (P < 0.05) for drug level and drug/metabolite level ratio for all body positions and microclimates examined. Microclimate and body position significantly influenced observed drug levels: higher levels were observed in carcasses decomposing in direct sunlight, where reduced entomological activity led to slowed decomposition. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Substrate specificity of mitochondrial intermediate peptidase analysed by a support-bound peptide library

    PubMed Central

    Marcondes, M.F.M.; Alves, F.M.; Assis, D.M.; Hirata, I.Y.; Juliano, L.; Oliveira, V.; Juliano, M.A.

    2015-01-01

    The substrate specificity of recombinant human mitochondrial intermediate peptidase (hMIP) using a synthetic support-bound FRET peptide library is presented. The collected fluorescent beads, which contained the hydrolysed peptides generated by hMIP, were sequenced by Edman degradation. The results showed that this peptidase presents a remarkable preference for polar uncharged residues at P1 and P1′ substrate positions: Ser = Gln > Thr at P1 and Ser > Thr at P1′. Non-polar residues were frequent at the substrate P3, P2, P2′ and P3′ positions. Analysis of the predicted MIP processing sites in imported mitochondrial matrix proteins shows these cleavages indeed occur between polar uncharged residues. Previous analysis of these processing sites indicated the importance of positions far from the MIP cleavage site, namely the presence of a hydrophobic residue (Phe or Leu) at P8 and a polar uncharged residue (Ser or Thr) at P5. To evaluate this, additional kinetic analyses were carried out, using fluorogenic substrates synthesized based on the processing sites attributed to MIP. The results described here underscore the importance of the P1 and P1′ substrate positions for the hydrolytic activity of hMIP. The information presented in this work will help in the design of new substrate-based inhibitors for this peptidase. PMID:26082885

  2. Interacting psychosocial and environmental correlates of leisure-time physical activity: a three-country study.

    PubMed

    Van Dyck, Delfien; Cerin, Ester; Conway, Terry L; De Bourdeaudhuij, Ilse; Owen, Neville; Kerr, Jacqueline; Cardon, Greet; Sallis, James F

    2014-07-01

    The main study objective was to examine the moderating effects of perceived enjoyment, barriers/benefits, perceived social support and self-efficacy, on the associations of perceived environmental attributes with walking for recreation and leisure-time moderate-to-vigorous physical activity, and whether these potential moderating effects differed by gender and study site. Data from three observational studies in the United States (Seattle and Baltimore), Australia (Adelaide), and Belgium (Ghent) were pooled. In total, 6014 adults (20-65 years, 55.7% women) were recruited in high-/low-walkable and high-/low-income neighborhoods. All participants completed the Neighborhood Environment Walkability Scale, a validated questionnaire on psychosocial attributes, and the International Physical Activity Questionnaire. General additive mixed models were conducted in R. Enjoyment of physical activity, perceived barriers to physical activity, perceived benefits of physical activity, social support from family and friends, and self-efficacy for physical activity moderated the relationships of specific perceived environmental characteristics with walking for recreation and/or leisure-time moderate-to-vigorous physical activity. Overall, moderating effects were in the same direction: environmental perceptions were positively associated with leisure-time activity, but associations were strongest in adults with less positive scores on psychosocial attributes. The findings were fairly consistent across gender and study sites. The present study findings are promising, as it seems that those who might benefit most from environmental interventions to promote physical activity, may mainly be adults at risk of being insufficiently active or those difficult to reach through individual health promotion programs.

  3. Molecular identification and transcriptional regulation of porcine IFIT2 gene.

    PubMed

    Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di

    2018-04-06

    IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.

  4. The glycoprotein character of multiple forms of Aspergillus polygalacturonase.

    PubMed

    Stratilová, E; Mislovicová, D; Kacuráková, M; Machová, E; Kolarová, N; Markovic, O; Jörnvall, H

    1998-02-01

    Comparisons of known primary structures of polygalacturonases show that extent and localization of potential N-glycosylation sites differ. Some sites are similar in position and adjacent to strictly conserved residues at the potential active site. The presence of N-acetylglucosamine and mannose in the molecules of two homogeneous, major Aspergillus sp. polygalacturonase forms was confirmed by IR spectroscopy. The purification method, based on interaction of the carbohydrate part with concanavalin A immobilized on chlorotriazine bead cellulose, was optimized. Deglycosylation with N-glycosidase F under denaturating and nondenaturating conditions led to molecular mass decreases followed by complete inactivation of the polygalacturonase enzyme activity. These results show the importance of glycosylation in these protein forms, while the comparative patterns establish both variability and some similarities in overall glycosylation architectures.

  5. Antimicrobial and anticancer activity of some novel fluorinated thiourea derivatives carrying sulfonamide moieties: synthesis, biological evaluation and molecular docking.

    PubMed

    Ghorab, Mostafa M; Alsaid, Mansour S; El-Gaby, Mohamed S A; Elaasser, Mahmoud M; Nissan, Yassin M

    2017-04-07

    Various thiourea derivatives have been used as starting materials for compounds with better biological activities. Molecular modeling tools are used to explore their mechanism of action. A new series of thioureas were synthesized. Fluorinated pyridine derivative 4a showed the highest antimicrobial activity (with MIC values ranged from 1.95 to 15.63 µg/mL). Interestingly, thiadiazole derivative 4c and coumarin derivative 4d exhibited selective antibacterial activities against Gram positive bacteria. Fluorinated pyridine derivative 4a was the most active against HepG2 with IC50 value of 4.8 μg/mL. Molecular docking was performed on the active site of MK-2 with good results. Novel compounds were obtained with good anticancer and antibacterial activity especially fluorinated pyridine derivative 4a and molecular docking study suggest good activity as mitogen activated protein kinase-2 inhibitor. Graphical abstract Compound 4a in the active site of MK-2.

  6. The impact of social media on children, adolescents, and families.

    PubMed

    O'Keeffe, Gwenn Schurgin; Clarke-Pearson, Kathleen

    2011-04-01

    Using social media Web sites is among the most common activity of today's children and adolescents. Any Web site that allows social interaction is considered a social media site, including social networking sites such as Facebook, MySpace, and Twitter; gaming sites and virtual worlds such as Club Penguin, Second Life, and the Sims; video sites such as YouTube; and blogs. Such sites offer today's youth a portal for entertainment and communication and have grown exponentially in recent years. For this reason, it is important that parents become aware of the nature of social media sites, given that not all of them are healthy environments for children and adolescents. Pediatricians are in a unique position to help families understand these sites and to encourage healthy use and urge parents to monitor for potential problems with cyberbullying, "Facebook depression," sexting, and exposure to inappropriate content.

  7. New Insights into the Role of T3 Loop in Determining Catalytic Efficiency of GH28 Endo-Polygalacturonases

    PubMed Central

    Tu, Tao; Meng, Kun; Luo, Huiying; Turunen, Ossi; Zhang, Lujia; Cheng, Yanli; Su, Xiaoyun; Ma, Rui; Shi, Pengjun; Wang, Yaru; Yang, Peilong; Yao, Bin

    2015-01-01

    Intramolecular mobility and conformational changes of flexible loops have important roles in the structural and functional integrity of proteins. The Achaetomium sp. Xz8 endo-polygalacturonase (PG8fn) of glycoside hydrolase (GH) family 28 is distinguished for its high catalytic activity (28,000 U/mg). Structure modeling indicated that PG8fn has a flexible T3 loop that folds partly above the substrate in the active site, and forms a hydrogen bond to the substrate by a highly conserved residue Asn94 in the active site cleft. Our research investigates the catalytic roles of Asn94 in T3 loop which is located above the catalytic residues on one side of the substrate. Molecular dynamics simulation performed on the mutant N94A revealed the loss of the hydrogen bond formed by the hydroxyl group at O34 of pentagalacturonic acid and the crucial ND2 of Asn94 and the consequent detachment and rotation of the substrate away from the active site, and that on N94Q caused the substrate to drift away from its place due to the longer side chain. In line with the simulations, site-directed mutagenesis at this site showed that this position is very sensitive to amino acid substitutions. Except for the altered K m values from 0.32 (wild type PG8fn) to 0.75–4.74 mg/ml, all mutants displayed remarkably lowered k cat (~3–20,000 fold) and k cat/K m (~8–187,500 fold) values and significantly increased △(△G) values (5.92–33.47 kJ/mol). Taken together, Asn94 in the GH28 T3 loop has a critical role in positioning the substrate in a correct way close to the catalytic residues. PMID:26327390

  8. Structural evidence for a copper-bound carbonate intermediate in the peroxidase and dismutase activities of superoxide dismutase.

    PubMed

    Strange, Richard W; Hough, Michael A; Antonyuk, Svetlana V; Hasnain, S Samar

    2012-01-01

    Copper-zinc superoxide dismutase (SOD) is of fundamental importance to our understanding of oxidative damage. Its primary function is catalysing the dismutation of superoxide to O(2) and H(2)O(2). SOD also reacts with H(2)O(2), leading to the formation of a strong copper-bound oxidant species that can either inactivate the enzyme or oxidise other substrates. In the presence of bicarbonate (or CO(2)) and H(2)O(2), this peroxidase activity is enhanced and produces the carbonate radical. This freely diffusible reactive oxygen species is proposed as the agent for oxidation of large substrates that are too bulky to enter the active site. Here, we provide direct structural evidence, from a 2.15 Å resolution crystal structure, of (bi)carbonate captured at the active site of reduced SOD, consistent with the view that a bound carbonate intermediate could be formed, producing a diffusible carbonate radical upon reoxidation of copper. The bound carbonate blocks direct access of substrates to Cu(I), suggesting that an adjunct to the accepted mechanism of SOD catalysed dismutation of superoxide operates, with Cu(I) oxidation by superoxide being driven via a proton-coupled electron transfer mechanism involving the bound carbonate rather than the solvent. Carbonate is captured in a different site when SOD is oxidised, being located in the active site channel adjacent to the catalytically important Arg143. This is the probable route of diffusion from the active site following reoxidation of the copper. In this position, the carbonate is poised for re-entry into the active site and binding to the reduced copper.

  9. Structural Evidence for a Copper-Bound Carbonate Intermediate in the Peroxidase and Dismutase Activities of Superoxide Dismutase

    PubMed Central

    Strange, Richard W.; Hough, Michael A.; Antonyuk, Svetlana V.; Hasnain, S. Samar

    2012-01-01

    Copper-zinc superoxide dismutase (SOD) is of fundamental importance to our understanding of oxidative damage. Its primary function is catalysing the dismutation of superoxide to O2 and H2O2. SOD also reacts with H2O2, leading to the formation of a strong copper-bound oxidant species that can either inactivate the enzyme or oxidise other substrates. In the presence of bicarbonate (or CO2) and H2O2, this peroxidase activity is enhanced and produces the carbonate radical. This freely diffusible reactive oxygen species is proposed as the agent for oxidation of large substrates that are too bulky to enter the active site. Here, we provide direct structural evidence, from a 2.15 Å resolution crystal structure, of (bi)carbonate captured at the active site of reduced SOD, consistent with the view that a bound carbonate intermediate could be formed, producing a diffusible carbonate radical upon reoxidation of copper. The bound carbonate blocks direct access of substrates to Cu(I), suggesting that an adjunct to the accepted mechanism of SOD catalysed dismutation of superoxide operates, with Cu(I) oxidation by superoxide being driven via a proton-coupled electron transfer mechanism involving the bound carbonate rather than the solvent. Carbonate is captured in a different site when SOD is oxidised, being located in the active site channel adjacent to the catalytically important Arg143. This is the probable route of diffusion from the active site following reoxidation of the copper. In this position, the carbonate is poised for re-entry into the active site and binding to the reduced copper. PMID:22984565

  10. Structure-Function Studies with the Unique Hexameric Form II Ribulose-1,5-bisphosphate Carboxylase/Oxygenase (Rubisco) from Rhodopseudomonas palustris*

    PubMed Central

    Satagopan, Sriram; Chan, Sum; Perry, L. Jeanne; Tabita, F. Robert

    2014-01-01

    The first x-ray crystal structure has been solved for an activated transition-state analog-bound form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco). This enzyme, from Rhodopseudomonas palustris, assembles as a unique hexamer with three pairs of catalytic large subunit homodimers around a central 3-fold symmetry axis. This oligomer arrangement is unique among all known Rubisco structures, including the form II homolog from Rhodospirillum rubrum. The presence of a transition-state analog in the active site locked the activated enzyme in a “closed” conformation and revealed the positions of critical active site residues during catalysis. Functional roles of two form II-specific residues (Ile165 and Met331) near the active site were examined via site-directed mutagenesis. Substitutions at these residues affect function but not the ability of the enzyme to assemble. Random mutagenesis and suppressor selection in a Rubisco deletion strain of Rhodobacter capsulatus identified a residue in the amino terminus of one subunit (Ala47) that compensated for a negative change near the active site of a neighboring subunit. In addition, substitution of the native carboxyl-terminal sequence with the last few dissimilar residues from the related R. rubrum homolog increased the enzyme's kcat for carboxylation. However, replacement of a longer carboxyl-terminal sequence with termini from either a form III or a form I enzyme, which varied both in length and sequence, resulted in complete loss of function. From these studies, it is evident that a number of subtle interactions near the active site and the carboxyl terminus account for functional differences between the different forms of Rubiscos found in nature. PMID:24942737

  11. Structure-function studies with the unique hexameric form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) from Rhodopseudomonas palustris.

    PubMed

    Satagopan, Sriram; Chan, Sum; Perry, L Jeanne; Tabita, F Robert

    2014-08-01

    The first x-ray crystal structure has been solved for an activated transition-state analog-bound form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco). This enzyme, from Rhodopseudomonas palustris, assembles as a unique hexamer with three pairs of catalytic large subunit homodimers around a central 3-fold symmetry axis. This oligomer arrangement is unique among all known Rubisco structures, including the form II homolog from Rhodospirillum rubrum. The presence of a transition-state analog in the active site locked the activated enzyme in a "closed" conformation and revealed the positions of critical active site residues during catalysis. Functional roles of two form II-specific residues (Ile(165) and Met(331)) near the active site were examined via site-directed mutagenesis. Substitutions at these residues affect function but not the ability of the enzyme to assemble. Random mutagenesis and suppressor selection in a Rubisco deletion strain of Rhodobacter capsulatus identified a residue in the amino terminus of one subunit (Ala(47)) that compensated for a negative change near the active site of a neighboring subunit. In addition, substitution of the native carboxyl-terminal sequence with the last few dissimilar residues from the related R. rubrum homolog increased the enzyme's kcat for carboxylation. However, replacement of a longer carboxyl-terminal sequence with termini from either a form III or a form I enzyme, which varied both in length and sequence, resulted in complete loss of function. From these studies, it is evident that a number of subtle interactions near the active site and the carboxyl terminus account for functional differences between the different forms of Rubiscos found in nature. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Structure of granzyme C reveals an unusual mechanism of protease autoinhibition

    PubMed Central

    Kaiserman, Dion; Buckle, Ashley M.; Van Damme, Petra; Irving, James A.; Law, Ruby H. P.; Matthews, Antony Y.; Bashtannyk-Puhalovich, Tanya; Langendorf, Chris; Thompson, Philip; Vandekerckhove, Joël; Gevaert, Kris; Whisstock, James C.; Bird, Phillip I.

    2009-01-01

    Proteases act in important homeostatic pathways and are tightly regulated. Here, we report an unusual structural mechanism of regulation observed by the 2.5-Å X-ray crystal structure of the serine protease, granzyme C. Although the active-site triad residues adopt canonical conformations, the oxyanion hole is improperly formed, and access to the primary specificity (S1) pocket is blocked through a reversible rearrangement involving Phe-191. Specifically, a register shift in the 190-strand preceding the active-site serine leads to Phe-191 filling the S1 pocket. Mutation of a unique Glu–Glu motif at positions 192–193 unlocks the enzyme, which displays chymase activity, and proteomic analysis confirms that activity of the wild-type protease can be released through interactions with an appropriate substrate. The 2.5-Å structure of the unlocked enzyme reveals unprecedented flexibility in the 190-strand preceding the active-site serine that results in Phe-191 vacating the S1 pocket. Overall, these observations describe a broadly applicable mechanism of protease regulation that cannot be predicted by template-based modeling or bioinformatic approaches alone. PMID:19299505

  13. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  14. Residues of E. coli topoisomerase I conserved for interaction with a specific cytosine base to facilitate DNA cleavage

    PubMed Central

    Narula, Gagandeep; Tse-Dinh, Yuk-Ching

    2012-01-01

    Bacterial and archaeal topoisomerase I display selectivity for a cytosine base 4 nt upstream from the DNA cleavage site. Recently, the solved crystal structure of Escherichia coli topoisomerase I covalently linked to a single-stranded oligonucleotide revealed that R169 and R173 interact with the cytosine base at the −4 position via hydrogen bonds while the phenol ring of Y177 wedges between the bases at the −4 and the −5 position. Substituting R169 to alanine changed the selectivity of the enzyme for the base at the −4 position from a cytosine to an adenine. The R173A mutant displayed similar sequence selectivity as the wild-type enzyme, but weaker cleavage and relaxation activity. Mutation of Y177 to serine or alanine rendered the enzyme inactive. Although mutation of each of these residues led to different outcomes, R169, R173 and Y177 work together to interact with a cytosine base at the −4 position to facilitate DNA cleavage. These strictly conserved residues might act after initial substrate binding as a Molecular Ruler to form a protein–DNA complex with the scissile phosphate positioned at the active site for optimal DNA cleavage by the tyrosine hydroxyl nucleophile to facilitate DNA cleavage in the reaction pathway. PMID:22833607

  15. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

  16. Mechanism of the asymmetric activation of the MinD ATPase by MinE

    PubMed Central

    Park, Kyung-Tae; Wu, Wei; Lovell, Scott; Lutkenhaus, Joe

    2012-01-01

    Summary MinD is a component of the Min system involved in the spatial regulation of cell division. It is an ATPase in the MinD/ParA/Mrp deviant Walker A motif family which is within the P loop GTPase superfamily. Its ATPase activity is stimulated by MinE, however, the mechanism of this activation is unclear. MinD forms a symmetric dimer with two binding sites for MinE, however, a recent model suggested that MinE occupying one site was sufficient for ATP hydrolysis. By generating heterodimers with one binding site for MinE we show that one binding site is sufficient for stimulation of the MinD ATPase. Furthermore, comparison of structures of MinD and related proteins led us to examine the role of N45 in the switch I region. An asparagine at this position is conserved in four of the deviant Walker A motif subfamilies (MinD, chromosomal ParAs, Get3 and FleN) and we find that N45 in MinD is essential for MinE stimulated ATPase activity and suggest that it is a key residue affected by MinE binding. PMID:22651575

  17. TGF-beta1 modulates focal adhesion kinase expression in rat intestinal epithelial IEC-6 cells via stimulatory and inhibitory Smad binding elements.

    PubMed

    Walsh, Mary F; Ampasala, Dinakar R; Rishi, Arun K; Basson, Marc D

    2009-02-01

    TGF-beta and FAK modulate cell migration, differentiation, proliferation and apoptosis, and TGF-beta promotes FAK transcription in intestinal epithelial cells via Smad-dependent and independent pathways. We utilized a 1320 bp FAK promoter-luciferase construct to characterize basal and TGF-beta-mediated FAK gene transcription in IEC-6 cells. Inhibiting JNK or Akt negated TGF-beta-stimulated promoter activity; ERK inhibition did not block the TGF-beta effect but increased basal activity. Co-transfection with Co-Smad4 enhanced the TGF-beta response while the inhibitory Smad7 abolished it. Serial deletions sequentially removing the four Smad binding elements (SBE) in the 5' untranslated region of the promoter revealed that the two most distal SBE's are positive regulators while SBE3 exerts a negative influence. Mutational deletion of two upstream p53 sites enhanced basal but did not affect TGF-beta-stimulated increases in promoter activity. TGF-beta increased DNA binding of Smad4, phospho-Smad2/3 and Runx1/AML1a to the most distal 435 bp containing 3 SBE and 2 AML1a sites by ChIP assay. However, although point mutation of SBE1 ablated the TGF-beta-mediated rise in SV40-promoter activity, mutation of AML1a sites did not. TGF-beta regulation of FAK transcription reflects a complex interplay between positive and negative non-Smad signals and SBE's, the last independent of p53 or AML1a.

  18. Statistical trend analysis of groundwater data at Louisiana Army Ammunition Plant

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhinge, D; Patel, J.; Skibinski, J.N.

    1994-12-31

    Statistical regression techniques were used to characterize temporal trends in groundwater monitoring data collected between 1980 and 1994 at Former Area P Lagoons, Louisiana Army Ammunition Plant (LAAP), a National Priorities List (NPL) site. Groundwater sampling data were evaluated for 12 wells (9 in the shallow aquifer and 3 in the deeper aquifer) and 9 contaminants of concern (COCs). A trend index (TI) was calculated from the sum of the number of improving and stable trends minus the number of deteriorating trends for each contaminant, each well, and the overall site. A positive TI indicates an improving trend for themore » site, contaminant, or well. Conversely, a negative TI indicates a deteriorating trend. The overall trend indices at the site for the shallow and deeper aquifers were found to be positive, indicating that the groundwater quality at Area P is generally improving. Interim remedial action was conducted at Area P from 1988 through 1990. The effect of remedial activities on groundwater quality was assessed by comparing the groundwater concentrations of nitro compounds measured immediately after the site remediation to those measured prior to the remedial action. The regression curves and the data indicated that a downward trend in the groundwater concentrations was observed immediately following the remediation activity at Area P. The trends from the regression analysis indicated that the overall remedy at Area P has been effective in reducing COC concentrations in groundwater.« less

  19. Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element.

    PubMed

    Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G

    2000-06-01

    The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.

  20. Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

    PubMed

    Mundus, D; Wollenzien, P

    1998-11-01

    Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.

  1. Synthesis and contractile activity of the C-terminal heptapeptide of substance P with N5-dimethyl glutamine in the 6-position. Active site studies.

    PubMed

    Poulos, C P; Pinas, N; Theodoropoulos, D

    1980-09-15

    The synthesis and testing of [N5-dimethyl-Gln6]-SP5-11 showed 37 +/- 12% contractile activity relative to SP, and intrinsic efficacy 98 +/- 4%. This finding indicates that the carboxamide groups of the dual Gln5-Cln6 moiety are not equally related with the contractile response of the C-terminal heptapeptide of SP.

  2. Dual evaluation of some novel 2-amino-substituted coumarinylthiazoles as anti-inflammatory-antimicrobial agents and their docking studies with COX-1/COX-2 active sites.

    PubMed

    Chandak, Navneet; Kumar, Pawan; Kaushik, Pawan; Varshney, Parul; Sharma, Chetan; Kaushik, Dhirender; Jain, Sudha; Aneja, Kamal R; Sharma, Pawan K

    2014-08-01

    Synthesis of total eighteen 2-amino-substituted 4-coumarinylthiazoles including sixteen new compounds (3a-o and 5b) bearing the benzenesulfonamide moiety is described in the present report. All the synthesized target compounds were examined for their in vivo anti-inflammatory (AI) activity and in vitro antimicrobial activity. Results revealed that six compounds (3 d, 3 f, 3 g, 3 h, 3 j and 3 n) exhibited pronounced anti-inflammatory activity comparable to the standard drug indomethacin. AI results were further confirmed by the docking studies of the most active (3n) and the least active compound (3a) with COX-1 and COX-2 active sites. In addition, most of the compounds exhibited moderate antimicrobial activity against Gram-positive bacteria as well as fungal yeast, S. cervisiae. Comparison between 3 and 5 indicated that incorporation of additional substituted pyrazole nucleus into the scaffold significantly enhanced AI activity.

  3. Rapid assessment of the geographical distribution of lymphatic filariasis in Uganda, by screening of schoolchildren for circulating filarial antigens.

    PubMed

    Onapa, A W; Simonsen, P E; Baehr, I; Pedersen, E M

    2005-03-01

    To permit improvements in the targeting of control activities, the geographical distribution of lymphatic filariasis in Uganda was assessed by using a rapid immunochromatographic card test to check school-aged children for Wuchereria bancrofti-specific circulating filarial antigens (CFA). Survey sites were selected to represent the various ecological and topographical diversities in the country. Overall, 17,533 children from 76 sites were examined. CFA-positive cases were detected at 31 of the sites, with prevalences ranging from 0.4% to 30.7%. There appeared to be strikingly more lymphatic filariasis in the north of the country than in the south. The main focus was north of the Victoria Nile, where 27 (66%) of 41 sites had CFA-positive cases, often at high prevalences. Only four (11.4%) of the 35 sites south of the Victoria Nile had CFA-positive cases, and all four were along the western rift valley and had relatively low CFA prevalences. Geostatistical interpolation was used to create a map showing the geographical distribution of CFA prevalences in Uganda (by ordinary kriging), and to assess the population exposed to W. bancrofti transmission. Estimates based on population data from 2002 indicated that approximately 8.7 million people (35.3% of the national population) lived in areas where > 1% of the school-aged children were CFA-positive. CFA prevalences generally decreased with increasing altitude, and no CFA-positive cases were found at sites that were > 1300 m above sea level. Although it gives an under-estimate of the overall community prevalence (a fact that should be taken into account when interpreting the present results and comparing them with the results of other surveys), the screening of schoolchildren for CFA was found to be a simple and useful approach for mapping the geographical distribution of lymphatic filariasis.

  4. Low-intensity pulsed ultrasound stimulation promotes osteoblast differentiation through hedgehog signaling.

    PubMed

    Matsumoto, Kenichi; Shimo, Tsuyoshi; Kurio, Naito; Okui, Tatsuo; Ibaragi, Soichiro; Kunisada, Yuki; Obata, Kyoichi; Masui, Masanori; Pai, Pang; Horikiri, Yuu; Yamanaka, Nobuyuki; Takigawa, Masaharu; Sasaki, Akira

    2018-06-01

    Low-intensity pulsed ultrasound (LIPUS) has been used as an adjunct to fracture healing therapies, but the mechanisms underlying its action are not known. We reported that sonic hedgehog (SHH) signaling was activated in osteoblasts at the dynamic remodeling site of a bone fracture. Mechanical stimulation is a crucial factor in bone remodeling, and it is related to the primary cilia as a sensor of hedgehog signaling. Here we observed that LIPUS promoted callus formation in accord with Gli2-positive cells after 14 days at the mouse femur fractured site compared with a control group. An immunofluorescence analysis showed that the numbers of primary cilia and cilia/osterix double-positive osteoblasts were increased at the fracture site by LIPUS. LIPUS stimulated not only the number and the length of primary cilia, but also the levels of ciliated protein, Ift88 mRNA, and SHH, Gli1, and Gli2 in MC3T3-E1 cells. Further experiments revealed that LIPUS stimulated osteogenic differentiation in the presence of smoothened agonist (SAG) treatment. These results indicate that LIPUS stimulates osteogenic differentiation and the maturation of osteoblasts by a primary cilium-mediated activation of hedgehog signaling. © 2017 Wiley Periodicals, Inc.

  5. Position-specific binding of FUS to nascent RNA regulates mRNA length

    PubMed Central

    Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen

    2015-01-01

    More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    DeVelice, R.L.; Hubbard, C.; Potkin, M.

    This study documents ecological characteristics of areas in the Exxon Valdez oil spill area in southcentral Alaska with contrasting marbled murelet (Brachyramphus marmoratus) detection levels. A total of 73 vegetation and 41 physical site variables were evaluated. Marbled murrelet activity level (number of detections) and the frequency of occupied behavior (behaviors indicative of nesting) increased with increasing area of coniferous forest. There was a positive relationship between activity level and the number of mossy platforms in trees. Significant correlations with an index of incoming solar radiation are interpreted as indicating a preference of marbled murrelets for sites sheltered from highmore » winds and severe cold during the nesting period.« less

  7. Effect of Locked-Nucleic Acid on a Biologically Active G-Quadruplex. A Structure-Activity Relationship of the Thrombin Aptamer

    PubMed Central

    Bonifacio, Laura; Church, Frank C.; Jarstfer, Michael B.

    2008-01-01

    Here we tested the ability to augment the biological activity of the thrombin aptamer, d(GGTTGGTGTGGTTGG), by using locked nucleic acid (LNA) to influence its G-quadruplex structure. Compared to un-substituted control aptamer, LNA-containing aptamers displayed varying degrees of thrombin inhibition. Aptamers with LNA substituted in either positions G5, T7, or G8 showed decreased thrombin inhibition, whereas LNA at position G2 displayed activity comparable to un-substituted control aptamer. Interestingly, the thermal stability of the substituted aptamers does not correlate to activity – the more stable aptamers with LNA in position G5, T7, or G8 showed the least thrombin inhibition, while a less stable aptamer with LNA at G2 was as active as the un-substituted aptamer. These results suggest that LNA substitution at sites G5, T7, and G8 directly perturbs aptamer-thrombin affinity. This further implies that for the thrombin aptamer, activity is not dictated solely by the stability of the G-quadruplex structure, but by specific interactions between the central TGT loop and thrombin and that LNA can be tolerated in a biologically active nucleic acid structure albeit in a position dependent fashion. PMID:19325759

  8. (D)- and (L)-cyclohexenyl-G, a new class of antiviral agents: synthesis, conformational analysis, molecular modeling, and biological activity.

    PubMed

    Wang, J; Froeyen, M; Hendrix, C; Andrei, C; Snoeck, R; Lescrinier, E; De Clercq, E; Herdewijn, P

    2001-01-01

    (D)- and (L)-cyclohexeneyl-G were synthesized enantioselectively starting from (R)-carvone. Both show potent and selective anti-herpesvirus activity (HSV-1, HSV-2, VZV, CMV). Molecular modeling demonstrates that both isomers are bound in the active site of HSV-1 thymidine kinase in a high-energy conformation with the base moiety orienting in an equatorial position. It is believed that the flexibility of the cyclohexene ring is essential for their antiviral activity.

  9. Absolute Side-chain Structure at Position 13 Is Required for the Inhibitory Activity of Bromein*

    PubMed Central

    Sawano, Yoriko; Hatano, Ken-ichi; Miyakawa, Takuya; Tanokura, Masaru

    2008-01-01

    Bromelain isoinhibitor (bromein), a cysteine proteinase inhibitor from pineapple stem, has a unique double-chain structure. The bromein precursor protein includes three homologous inhibitor domains, each containing an interchain peptide between the light and heavy chains. The interchain peptide in the single-chain precursor is immediately processed by bromelain, a target proteinase. In the present study, to clarify the essential inhibitory site of bromein, we constructed 44 kinds of site-directed and deletion mutants and investigated the inhibitory activity of each toward bromelain. As a result, the complete chemical structure of Leu13 in the light chain was revealed to be essential for inhibition. Pro12 prior to the leucine residue was also involved in the inhibitory activity and would control the location of the leucine side chain by the fixed φ dihedral angle of proline. Furthermore, the five-residue length of the interchain peptide was strictly required for the inhibitory activity. On the other hand, no inhibitory activity against bromelain was observed by the substitution of proline for the N terminus residue Thr15 of the interchain peptide. In summary, these mutational analyses of bromein demonstrated that the appropriate position and conformation of Leu13 are absolutely crucial for bromelain inhibition. PMID:18948264

  10. A New Glycan-Dependent CD4-Binding Site Neutralizing Antibody Exerts Pressure on HIV-1 In Vivo

    PubMed Central

    Freund, Natalia T.; Horwitz, Joshua A.; Nogueira, Lilian; Sievers, Stuart A.; Scharf, Louise; Scheid, Johannes F.; Gazumyan, Anna; Liu, Cassie; Velinzon, Klara; Goldenthal, Ariel; Sanders, Rogier W.; Moore, John P.; Bjorkman, Pamela J.; Seaman, Michael S.; Walker, Bruce D.; Klein, Florian; Nussenzweig, Michel C.

    2015-01-01

    The CD4 binding site (CD4bs) on the envelope glycoprotein is a major site of vulnerability that is conserved among different HIV-1 isolates. Many broadly neutralizing antibodies (bNAbs) to the CD4bs belong to the VRC01 class, sharing highly restricted origins, recognition mechanisms and viral escape pathways. We sought to isolate new anti-CD4bs bNAbs with different origins and mechanisms of action. Using a gp120 2CC core as bait, we isolated antibodies encoded by IGVH3-21 and IGVL3-1 genes with long CDRH3s that depend on the presence of the N-linked glycan at position-276 for activity. This binding mode is similar to the previously identified antibody HJ16, however the new antibodies identified herein are more potent and broad. The most potent variant, 179NC75, had a geometric mean IC80 value of 0.42 μg/ml against 120 Tier-2 HIV-1 pseudoviruses in the TZM.bl assay. Although this group of CD4bs glycan-dependent antibodies can be broadly and potently neutralizing in vitro, their in vivo activity has not been tested to date. Here, we report that 179NC75 is highly active when administered to HIV-1-infected humanized mice, where it selects for escape variants that lack a glycan site at position-276. The same glycan was absent from the virus isolated from the 179NC75 donor, implying that the antibody also exerts selection pressure in humans. PMID:26516768

  11. Orthosteric and allosteric potentiation of heteromeric neuronal nicotinic acetylcholine receptors.

    PubMed

    Wang, Jingyi; Lindstrom, Jon

    2018-06-01

    Heteromeric nicotinic ACh receptors (nAChRs) were thought to have two orthodox agonist-binding sites at two α/β subunit interfaces. Highly selective ligands are hard to develop by targeting orthodox agonist sites because of high sequence similarity of this binding pocket among different subunits. Recently, unorthodox ACh-binding sites have been discovered at some α/α and β/α subunit interfaces, such as α4/α4, α5/α4 and β3/α4. Targeting unorthodox sites may yield subtype-selective ligands, such as those for (α4β2) 2 α5, (α4β2) 2 β3 and (α6β2) 2 β3 nAChRs. The unorthodox sites have unique pharmacology. Agonist binding at one unorthodox site is not sufficient to activate nAChRs, but it increases activation from the orthodox sites. NS9283, a selective agonist for the unorthodox α4/α4 site, was initially thought to be a positive allosteric modulator (PAM). NS9283 activates nAChRs with three engineered α4/α4 sites. PAMs, on the other hand, act at allosteric sites where ACh cannot bind. Known PAM sites include the ACh-homologous non-canonical site (e.g. morantel at β/α), the C-terminus (e.g. Br-PBTC and 17β-estradiol), a transmembrane domain (e.g. LY2087101) or extracellular and transmembrane domain interfaces (e.g. NS206). Some of these PAMs, such as Br-PBTC and 17β-estradiol, require only one subunit to potentiate activation of nAChRs. In this review, we will discuss differences between activation from orthosteric and allosteric sites, their selective ligands and clinical implications. These studies have advanced understanding of the structure, assembly and pharmacology of heteromeric neuronal nAChRs. This article is part of a themed section on Nicotinic Acetylcholine Receptors. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v175.11/issuetoc. © 2017 The British Pharmacological Society.

  12. A Conserved Steroid Binding Site in Cytochrome c Oxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qin, Ling; Mills, Denise A.; Buhrow, Leann

    2010-09-02

    Micromolar concentrations of the bile salt deoxycholate are shown to rescue the activity of an inactive mutant, E101A, in the K proton pathway of Rhodobacter sphaeroides cytochrome c oxidase. A crystal structure of the wild-type enzyme reveals, as predicted, deoxycholate bound with its carboxyl group at the entrance of the K path. Since cholate is a known potent inhibitor of bovine oxidase and is seen in a similar position in the bovine structure, the crystallographically defined, conserved steroid binding site could reveal a regulatory site for steroids or structurally related molecules that act on the essential K proton path.

  13. Structural Determinants of Autoproteolysis of the Haemophilus influenzae Hap Autotransporter▿

    PubMed Central

    Kenjale, Roma; Meng, Guoyu; Fink, Doran L.; Juehne, Twyla; Ohashi, Tomoo; Erickson, Harold P.; Waksman, Gabriel; St. Geme, Joseph W.

    2009-01-01

    Haemophilus influenzae is a gram-negative bacterium that initiates infection by colonizing the upper respiratory tract. The H. influenzae Hap autotransporter protein mediates adherence, invasion, and microcolony formation in assays with respiratory epithelial cells and presumably facilitates colonization. The serine protease activity of Hap is associated with autoproteolytic cleavage and extracellular release of the HapS passenger domain, leaving the Hapβ C-terminal domain embedded in the outer membrane. Cleavage occurs most efficiently at the LN1036-37 peptide bond and to a lesser extent at three other sites. In this study, we utilized site-directed mutagenesis, homology modeling, and assays with a peptide library to characterize the structural determinants of Hap proteolytic activity and cleavage specificity. In addition, we used homology modeling to predict the S1, S2, and S4 subsite residues of the Hap substrate groove. Our results indicate that the P1 and P2 positions at the Hap cleavage sites are critical for cleavage, with leucine preferred over larger hydrophobic residues or other amino acids in these positions. The substrate groove is formed by L263 and N274 at the S1 subsite, R264 at the S2 subsite, and E265 at the S4 subsite. This information may facilitate design of approaches to block Hap activity and interfere with H. influenzae colonization. PMID:19687208

  14. Monoubiquitination Inhibits the Actin Bundling Activity of Fascin.

    PubMed

    Lin, Shengchen; Lu, Shuang; Mulaj, Mentor; Fang, Bin; Keeley, Tyler; Wan, Lixin; Hao, Jihui; Muschol, Martin; Sun, Jianwei; Yang, Shengyu

    2016-12-30

    Fascin is an actin bundling protein that cross-links individual actin filaments into straight, compact, and stiff bundles, which are crucial for the formation of filopodia, stereocillia, and other finger-like membrane protrusions. The dysregulation of fascin has been implicated in cancer metastasis, hearing loss, and blindness. Here we identified monoubiquitination as a novel mechanism that regulates fascin bundling activity and dynamics. The monoubiquitination sites were identified to be Lys 247 and Lys 250 , two residues located in a positive charge patch at the actin binding site 2 of fascin. Using a chemical ubiquitination method, we synthesized chemically monoubiquitinated fascin and determined the effects of monoubiquitination on fascin bundling activity and dynamics. Our data demonstrated that monoubiquitination decreased the fascin bundling EC 50 , delayed the initiation of bundle assembly, and accelerated the disassembly of existing bundles. By analyzing the electrostatic properties on the solvent-accessible surface of fascin, we proposed that monoubiquitination introduced steric hindrance to interfere with the interaction between actin filaments and the positively charged patch at actin binding site 2. We also identified Smurf1 as a E3 ligase regulating the monoubiquitination of fascin. Our findings revealed a previously unidentified regulatory mechanism for fascin, which will have important implications for the understanding of actin bundle regulation under physiological and pathological conditions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Activities and interim outcomes of a multi-site development project to promote cognitive support technology use and employment success among postsecondary students with traumatic brain injuries.

    PubMed

    Hendricks, Deborah J; Sampson, Elaine; Rumrill, Phillip; Leopold, Anne; Elias, Eileen; Jacobs, Karen; Nardone, Amanda; Scherer, Marcia; Stauffer, Callista

    2015-01-01

    This article describes the activities and interim outcomes of a multi-site development project called Project Career, designed to promote cognitive support technology (CST) use and employment success for college and university students with traumatic brain injuries (TBIs). To obtain early intervention results from participants in Project Career's first 18 months of operation. Fifty-six students with TBI have participated to date across three implementation sites in Massachusetts, Ohio, and West Virginia, with 25 of these participants being military veterans. Descriptive analyses provide information regarding the participants, the barriers they face due to their TBI in obtaining a post-secondary education, and the impact services provided by Project Career have had to date in ameliorating those difficulties. Inferential statistical analyses provide preliminary results regarding program effectiveness. Preliminary results indicate the program is encouraging students to use CST strategies in the form of iPads and cognitive enhancement applications (also known as 'apps'). Significant results indicate participants are more positive, independent, and social; participants have a more positive attitude toward technology after six months in the program; and participants reported significantly improved experiences with technology during their first six months in the program. Participating students are actively preparing for their careers after graduation through a wide range of intensive vocational supports provided by project staff members.

  16. Physiological (antioxidant) responses of estuarine fishes to variability in dissolved oxygen.

    PubMed

    Ross, S W; Dalton, D A; Kramer, S; Christensen, B L

    2001-11-01

    Cycles of dissolved oxygen (DO) in estuaries can range from anoxia to various levels of supersaturation (200-300%) over short time periods. Aerobic metabolism causes formation of damaging reactive oxygen species (ROS), a process exacerbated by high or low DO. Fish can generate physiological defenses (e.g. antioxidant enzymes) against ROS, however, there are little data tying this to environmental conditions. We investigated physiological defenses generated by estuarine fishes in response to high DO and various DO cycles. We hypothesized that chemical defenses and/or oxidative damage are related to patterns of DO supersaturation. Specific activities of antioxidants in fish tissues should be positively correlated with increasing levels of DO, if high DO levels are physiologically stressful. We caged common benthic fishes (longjaw mudsucker, Gillichthys mirabilis, and staghorn sculpin, Leptocottus armatus, in CA and spot, Leiostomus xanthurus and pinfish, Lagodon rhomboides, in NC) during summer 1998 in two estuarine sites in southern North Carolina and two in central California. At each site a water quality meter measured bottom DO, salinity, temperature, depth, pH and turbidity at 30 min intervals throughout the study. These sites exhibited a wide variety of dissolved oxygen patterns. After 2 weeks in the cages, fish gills and livers were analyzed for antioxidant enzymes (glutathione peroxidase, catalase and superoxide dismutase) and the metabolite glutathione. All fish exhibited antioxidant enzyme activity. There was a significant site-dependent effect on all enzyme activities at the NC sites, with the most activity at the site with the highest DO cycling and the most DO supersaturation. There was a trend towards higher enzyme activities under high DO levels at the CA sites.

  17. Activity screening of environmental metagenomic libraries reveals novel carboxylesterase families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Popovic, Ana; Hai, Tran; Tchigvintsev, Anatoly

    Metagenomics has made accessible an enormous reserve of global biochemical diversity. In order to tap into this vast resource of novel enzymes, we have screened over one million clones from metagenome DNA libraries derived from sixteen different environments for carboxylesterase activity and identified 714 positive hits. Here, we validated the esterase activity of 80 selected genes, which belong to 17 different protein families including unknown and cyclase-like proteins. Three metagenomic enzymes exhibited lipase activity, and seven proteins showed polyester depolymerization activity against polylactic acid and polycaprolactone. Detailed biochemical characterization of four new enzymes revealed their substrate preference, whereas their catalyticmore » residues were identified using site-directed mutagenesis. The crystal structure of the metal-ion dependent esterase MGS0169 from the amidohydrolase superfamily revealed a novel active site with a bound unknown ligand. Thus, activity-centered metagenomics has revealed diverse enzymes and novel families of microbial carboxylesterases, whose activity could not have been predicted using bioinformatics tools.« less

  18. Activity screening of environmental metagenomic libraries reveals novel carboxylesterase families

    DOE PAGES

    Popovic, Ana; Hai, Tran; Tchigvintsev, Anatoly; ...

    2017-03-08

    Metagenomics has made accessible an enormous reserve of global biochemical diversity. In order to tap into this vast resource of novel enzymes, we have screened over one million clones from metagenome DNA libraries derived from sixteen different environments for carboxylesterase activity and identified 714 positive hits. Here, we validated the esterase activity of 80 selected genes, which belong to 17 different protein families including unknown and cyclase-like proteins. Three metagenomic enzymes exhibited lipase activity, and seven proteins showed polyester depolymerization activity against polylactic acid and polycaprolactone. Detailed biochemical characterization of four new enzymes revealed their substrate preference, whereas their catalyticmore » residues were identified using site-directed mutagenesis. The crystal structure of the metal-ion dependent esterase MGS0169 from the amidohydrolase superfamily revealed a novel active site with a bound unknown ligand. Thus, activity-centered metagenomics has revealed diverse enzymes and novel families of microbial carboxylesterases, whose activity could not have been predicted using bioinformatics tools.« less

  19. APE1 incision activity at abasic sites in tandem repeat sequences.

    PubMed

    Li, Mengxia; Völker, Jens; Breslauer, Kenneth J; Wilson, David M

    2014-05-29

    Repetitive DNA sequences, such as those present in microsatellites and minisatellites, telomeres, and trinucleotide repeats (linked to fragile X syndrome, Huntington disease, etc.), account for nearly 30% of the human genome. These domains exhibit enhanced susceptibility to oxidative attack to yield base modifications, strand breaks, and abasic sites; have a propensity to adopt non-canonical DNA forms modulated by the positions of the lesions; and, when not properly processed, can contribute to genome instability that underlies aging and disease development. Knowledge on the repair efficiencies of DNA damage within such repetitive sequences is therefore crucial for understanding the impact of such domains on genomic integrity. In the present study, using strategically designed oligonucleotide substrates, we determined the ability of human apurinic/apyrimidinic endonuclease 1 (APE1) to cleave at apurinic/apyrimidinic (AP) sites in a collection of tandem DNA repeat landscapes involving telomeric and CAG/CTG repeat sequences. Our studies reveal the differential influence of domain sequence, conformation, and AP site location/relative positioning on the efficiency of APE1 binding and strand incision. Intriguingly, our data demonstrate that APE1 endonuclease efficiency correlates with the thermodynamic stability of the DNA substrate. We discuss how these results have both predictive and mechanistic consequences for understanding the success and failure of repair protein activity associated with such oxidatively sensitive, conformationally plastic/dynamic repetitive DNA domains. Published by Elsevier Ltd.

  20. Crystal Structures of Active Fully Assembled Substrate- and Product-Bound Complexes of UDP-N-Acetylmuramic Acid:l-Alanine Ligase (MurC) from Haemophilus influenzae

    PubMed Central

    Mol, Clifford D.; Brooun, Alexei; Dougan, Douglas R.; Hilgers, Mark T.; Tari, Leslie W.; Wijnands, Robert A.; Knuth, Mark W.; McRee, Duncan E.; Swanson, Ronald V.

    2003-01-01

    UDP-N-acetylmuramic acid:l-alanine ligase (MurC) catalyzes the addition of the first amino acid to the cytoplasmic precursor of the bacterial cell wall peptidoglycan. The crystal structures of Haemophilus influenzae MurC in complex with its substrate UDP-N-acetylmuramic acid (UNAM) and Mg2+ and of a fully assembled MurC complex with its product UDP-N-acetylmuramoyl-l-alanine (UMA), the nonhydrolyzable ATP analogue AMPPNP, and Mn2+ have been determined to 1.85- and 1.7-Å resolution, respectively. These structures reveal a conserved, three-domain architecture with the binding sites for UNAM and ATP formed at the domain interfaces: the N-terminal domain binds the UDP portion of UNAM, and the central and C-terminal domains form the ATP-binding site, while the C-terminal domain also positions the alanine. An active enzyme structure is thus assembled at the common domain interfaces when all three substrates are bound. The MurC active site clearly shows that the γ-phosphate of AMPPNP is positioned between two bound metal ions, one of which also binds the reactive UNAM carboxylate, and that the alanine is oriented by interactions with the positively charged side chains of two MurC arginine residues and the negatively charged alanine carboxyl group. These results indicate that significant diversity exists in binding of the UDP moiety of the substrate by MurC and the subsequent ligases in the bacterial cell wall biosynthesis pathway and that alterations in the domain packing and tertiary structure allow the Mur ligases to bind sequentially larger UNAM peptide substrates. PMID:12837790

  1. Crystal structures of active fully assembled substrate- and product-bound complexes of UDP-N-acetylmuramic acid:L-alanine ligase (MurC) from Haemophilus influenzae.

    PubMed

    Mol, Clifford D; Brooun, Alexei; Dougan, Douglas R; Hilgers, Mark T; Tari, Leslie W; Wijnands, Robert A; Knuth, Mark W; McRee, Duncan E; Swanson, Ronald V

    2003-07-01

    UDP-N-acetylmuramic acid:L-alanine ligase (MurC) catalyzes the addition of the first amino acid to the cytoplasmic precursor of the bacterial cell wall peptidoglycan. The crystal structures of Haemophilus influenzae MurC in complex with its substrate UDP-N-acetylmuramic acid (UNAM) and Mg(2+) and of a fully assembled MurC complex with its product UDP-N-acetylmuramoyl-L-alanine (UMA), the nonhydrolyzable ATP analogue AMPPNP, and Mn(2+) have been determined to 1.85- and 1.7-A resolution, respectively. These structures reveal a conserved, three-domain architecture with the binding sites for UNAM and ATP formed at the domain interfaces: the N-terminal domain binds the UDP portion of UNAM, and the central and C-terminal domains form the ATP-binding site, while the C-terminal domain also positions the alanine. An active enzyme structure is thus assembled at the common domain interfaces when all three substrates are bound. The MurC active site clearly shows that the gamma-phosphate of AMPPNP is positioned between two bound metal ions, one of which also binds the reactive UNAM carboxylate, and that the alanine is oriented by interactions with the positively charged side chains of two MurC arginine residues and the negatively charged alanine carboxyl group. These results indicate that significant diversity exists in binding of the UDP moiety of the substrate by MurC and the subsequent ligases in the bacterial cell wall biosynthesis pathway and that alterations in the domain packing and tertiary structure allow the Mur ligases to bind sequentially larger UNAM peptide substrates.

  2. Role of the RNA polymerase α subunits in CII-dependent activation of the bacteriophage λ pE promoter: identification of important residues and positioning of the α C-terminal domains

    PubMed Central

    Kedzierska, Barbara; Lee, David J.; Węgrzyn, Grzegorz; Busby, Stephen J. W.; Thomas, Mark S.

    2004-01-01

    The bacteriophage λ CII protein stimulates the activity of three phage promoters, pE, pI and paQ, upon binding to a site overlapping the –35 element at each promoter. Here we used preparations of RNA polymerase carrying a DNA cleavage reagent attached to specific residues in the C-terminal domain of the RNA polymerase α subunit (αCTD) to demonstrate that one αCTD binds near position –41 at pE, whilst the other αCTD binds further upstream. The αCTD bound near position –41 is oriented such that its 261 determinant is in close proximity to σ70. The location of αCTD in CII-dependent complexes at the pE promoter is very similar to that found at many activator-independent promoters, and represents an alternative configuration for αCTD at promoters where activators bind sites overlapping the –35 region. We also used an in vivo alanine scan analysis to show that the DNA-binding determinant of αCTD is involved in stimulation of the pE promoter by CII, and this was confirmed by in vitro transcription assays. We also show that whereas the K271E substitution in αCTD results in a drastic decrease in CII-dependent activation of pE, the pI and paQ promoters are less sensitive to this substitution, suggesting that the role of αCTD at the three lysogenic promoters may be different. PMID:14762211

  3. Children's Internet use in a family context: influence on family relationships and parental mediation.

    PubMed

    Lee, Sook-Jung; Chae, Young-Gil

    2007-10-01

    We conducted a survey of 222 fourth-, fifth-, and sixth-grade Korean children to examine (a) whether children's Internet use influences declines in family time and family communication and (b) how parental mediation techniques are related to children's online activities. According to the findings, total time using the Internet was related to perceived declines in family time but not related to family communication. The influence of the Internet on family time and family communication differed by the type of children's online activities. The analysis of the relationship between parental mediation techniques and children's online activities indicated that parents' recommendation of useful Web sites and co-using were positively related to frequency of children's educational online activities. However, parental restrictions on time and Web sites did not alter children's actual Internet usage.

  4. Agonist activation of α7 nicotinic acetylcholine receptors via an allosteric transmembrane site

    PubMed Central

    Gill, JasKiran K.; Savolainen, Mari; Young, Gareth T.; Zwart, Ruud; Sher, Emanuele; Millar, Neil S.

    2011-01-01

    Conventional nicotinic acetylcholine receptor (nAChR) agonists, such as acetylcholine, act at an extracellular “orthosteric” binding site located at the interface between two adjacent subunits. Here, we present evidence of potent activation of α7 nAChRs via an allosteric transmembrane site. Previous studies have identified a series of nAChR-positive allosteric modulators (PAMs) that lack agonist activity but are able to potentiate responses to orthosteric agonists, such as acetylcholine. It has been shown, for example, that TQS acts as a conventional α7 nAChR PAM. In contrast, we have found that a compound with close chemical similarity to TQS (4BP-TQS) is a potent allosteric agonist of α7 nAChRs. Whereas the α7 nAChR antagonist metyllycaconitine acts competitively with conventional nicotinic agonists, metyllycaconitine is a noncompetitive antagonist of 4BP-TQS. Mutation of an amino acid (M253L), located in a transmembrane cavity that has been proposed as being the binding site for PAMs, completely blocks agonist activation by 4BP-TQS. In contrast, this mutation had no significant effect on agonist activation by acetylcholine. Conversely, mutation of an amino acid located within the known orthosteric binding site (W148F) has a profound effect on agonist potency of acetylcholine (resulting in a shift of ∼200-fold in the acetylcholine dose-response curve), but had little effect on the agonist dose-response curve for 4BP-TQS. Computer docking studies with an α7 homology model provides evidence that both TQS and 4BP-TQS bind within an intrasubunit transmembrane cavity. Taken together, these findings provide evidence that agonist activation of nAChRs can occur via an allosteric transmembrane site. PMID:21436053

  5. Electrophysiological indices of brain activity to content and function words in discourse.

    PubMed

    Neumann, Yael; Epstein, Baila; Shafer, Valerie L

    2016-09-01

    An increase in positivity of event-related potentials (ERPs) at the lateral anterior sites has been hypothesized to be an index of semantic and discourse processing, with the right lateral anterior positivity (LAP) showing particular sensitivity to discourse factors. However, the research investigating the LAP is limited; it is unclear whether the effect is driven by word class (function word versus content word) or by a more general process of structure building triggered by elements of a determiner phrase (DP). To examine the neurophysiological indices of semantic/discourse integration using two different word categories (function versus content word) in the discourse contexts and to contrast processing of these word categories in meaningful versus nonsense contexts. Planned comparisons of ERPs time locked to a function word stimulus 'the' and a content word stimulus 'cats' in sentence-initial position were conducted in both discourse and nonsense contexts to examine the time course of processing following these word forms. A repeated-measures analysis of variance (ANOVA) for the Discourse context revealed a significant interaction of condition and site due to greater positivity for 'the' relative to 'cats' at anterior and superior sites. In the Nonsense context, there was a significant interaction of condition, time and site due to greater positivity for 'the' relative to 'cats' at anterior sites from 150 to 350 ms post-stimulus offset and at superior sites from 150 to 200 ms post-stimulus offset. Overall, greater positivity for both 'the' and 'cats' was observed in the discourse relative to the nonsense context beginning approximately 150 ms post-stimulus offset. Additionally, topographical analyses were highly correlated for the two word categories when processing meaningful discourse. This topographical pattern could be characterized as a prominent right LAP. The LAP was attenuated when the target stimulus word initiated a nonsense context. The results of this study support the view that the right LAP is an index of general discourse processing rather than an index of word class. These findings demonstrate that the LAP can be used to study discourse processing in populations with compromised metalinguistic skills, such as adults with aphasia or traumatic brain injury. © 2016 Royal College of Speech and Language Therapists.

  6. Assessing impacts of unconventional natural gas extraction on microbial communities in headwater stream ecosystems in Northwestern Pennsylvania

    PubMed Central

    Trexler, Ryan; Solomon, Caroline; Brislawn, Colin J.; Wright, Justin R.; Rosenberger, Abigail; McClure, Erin E.; Grube, Alyssa M.; Peterson, Mark P.; Keddache, Mehdi; Mason, Olivia U.; Hazen, Terry C.; Grant, Christopher J.; Lamendella, Regina

    2014-01-01

    Hydraulic fracturing and horizontal drilling have increased dramatically in Pennsylvania Marcellus shale formations, however the potential for major environmental impacts are still incompletely understood. High-throughput sequencing of the 16S rRNA gene was performed to characterize the microbial community structure of water, sediment, bryophyte, and biofilm samples from 26 headwater stream sites in northwestern Pennsylvania with different histories of fracking activity within Marcellus shale formations. Further, we describe the relationship between microbial community structure and environmental parameters measured. Approximately 3.2 million 16S rRNA gene sequences were retrieved from a total of 58 samples. Microbial community analyses showed significant reductions in species richness as well as evenness in sites with Marcellus shale activity. Beta diversity analyses revealed distinct microbial community structure between sites with and without Marcellus shale activity. For example, operational taxonomic units (OTUs) within the Acetobacteracea, Methylocystaceae, Acidobacteriaceae, and Phenylobacterium were greater than three log-fold more abundant in MSA+ sites as compared to MSA− sites. Further, several of these OTUs were strongly negatively correlated with pH and positively correlated with the number of wellpads in a watershed. It should be noted that many of the OTUs enriched in MSA+ sites are putative acidophilic and/or methanotrophic populations. This study revealed apparent shifts in the autochthonous microbial communities and highlighted potential members that could be responding to changing stream conditions as a result of nascent industrial activity in these aquatic ecosystems. PMID:25408683

  7. Prevalence and distribution of Baylisascaris procyonis in urban raccoons (Procyon lotor) in Winnipeg, Manitoba.

    PubMed

    Sexsmith, Jennifer L; Whiting, Terry L; Green, Chris; Orvis, Sheldon; Berezanski, Dean J; Thompson, Amy B

    2009-08-01

    The prevalence of Baylisascaris procyonis was estimated in the urban raccoon population of Winnipeg through the fecal flotation of raccoon feces collected at active latrines and through gross postmortem and fecal flotation of samples collected from nuisance raccoons. Fecal flotation of latrine-collected feces was positive in 33 of 89 samples and, of 52 latrines identified, 26 were positive on 1 or more occasions. Trapped individual raccoons subjected to postmortem examination were positive in 57 of 114 animals captured. Comparing a single fecal flotation to the gold standard of finding adult worms in the small intestine had a sensitivity of 78.9% and specificity of 92.9%. This study suggests that carriage of Baylisascaris procyonis is widespread in raccoons in the Winnipeg urban ecosystem. Raccoon latrines in Winnipeg should be treated as infectious sites and efforts should be made to limit access of pets and people at risk to those sites.

  8. Mitotic Cortical Waves Predict Future Division Sites by Encoding Positional and Size Information.

    PubMed

    Xiao, Shengping; Tong, Cheesan; Yang, Yang; Wu, Min

    2017-11-20

    Dynamic spatial patterns such as traveling waves could theoretically encode spatial information, but little is known about whether or how they are employed by biological systems, especially higher eukaryotes. Here, we show that concentric target or spiral waves of active Cdc42 and the F-BAR protein FBP17 are invoked in adherent cells at the onset of mitosis. These waves predict the future sites of cell divisions and represent the earliest known spatial cues for furrow assembly. Unlike interphase waves, the frequencies and wavelengths of the mitotic waves display size-dependent scaling properties. While the positioning role of the metaphase waves requires microtubule dynamics, spindle and microtubule-independent inhibitory signals are propagated by the mitotic waves to ensure the singularity of furrow formation. Taken together, we propose that metaphase cortical waves integrate positional and cell size information for division-plane specification in adhesion-dependent cytokinesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Monovalent Cation Activation of the Radical SAM Enzyme Pyruvate Formate-Lyase Activating Enzyme.

    PubMed

    Shisler, Krista A; Hutcheson, Rachel U; Horitani, Masaki; Duschene, Kaitlin S; Crain, Adam V; Byer, Amanda S; Shepard, Eric M; Rasmussen, Ashley; Yang, Jian; Broderick, William E; Vey, Jessica L; Drennan, Catherine L; Hoffman, Brian M; Broderick, Joan B

    2017-08-30

    Pyruvate formate-lyase activating enzyme (PFL-AE) is a radical S-adenosyl-l-methionine (SAM) enzyme that installs a catalytically essential glycyl radical on pyruvate formate-lyase. We show that PFL-AE binds a catalytically essential monovalent cation at its active site, yet another parallel with B 12 enzymes, and we characterize this cation site by a combination of structural, biochemical, and spectroscopic approaches. Refinement of the PFL-AE crystal structure reveals Na + as the most likely ion present in the solved structures, and pulsed electron nuclear double resonance (ENDOR) demonstrates that the same cation site is occupied by 23 Na in the solution state of the as-isolated enzyme. A SAM carboxylate-oxygen is an M + ligand, and EPR and circular dichroism spectroscopies reveal that both the site occupancy and the identity of the cation perturb the electronic properties of the SAM-chelated iron-sulfur cluster. ENDOR studies of the PFL-AE/[ 13 C-methyl]-SAM complex show that the target sulfonium positioning varies with the cation, while the observation of an isotropic hyperfine coupling to the cation by ENDOR measurements establishes its intimate, SAM-mediated interaction with the cluster. This monovalent cation site controls enzyme activity: (i) PFL-AE in the absence of any simple monovalent cations has little-no activity; and (ii) among monocations, going down Group 1 of the periodic table from Li + to Cs + , PFL-AE activity sharply maximizes at K + , with NH 4 + closely matching the efficacy of K + . PFL-AE is thus a type I M + -activated enzyme whose M + controls reactivity by interactions with the cosubstrate, SAM, which is bound to the catalytic iron-sulfur cluster.

  10. Connecting Active-Site Loop Conformations and Catalysis in Triosephosphate Isomerase: Insights from a Rare Variation at Residue 96 in the Plasmodial Enzyme.

    PubMed

    Pareek, Vidhi; Samanta, Moumita; Joshi, Niranjan V; Balaram, Hemalatha; Murthy, Mathur R N; Balaram, Padmanabhan

    2016-04-01

    Despite extensive research into triosephosphate isomerases (TIMs), there exists a gap in understanding of the remarkable conjunction between catalytic loop-6 (residues 166-176) movement and the conformational flip of Glu165 (catalytic base) upon substrate binding that primes the active site for efficient catalysis. The overwhelming occurrence of serine at position 96 (98% of the 6277 unique TIM sequences), spatially proximal to E165 and the loop-6 residues, raises questions about its role in catalysis. Notably, Plasmodium falciparum TIM has an extremely rare residue--phenylalanine--at this position whereas, curiously, the mutant F96S was catalytically defective. We have obtained insights into the influence of residue 96 on the loop-6 conformational flip and E165 positioning by combining kinetic and structural studies on the PfTIM F96 mutants F96Y, F96A, F96S/S73A, and F96S/L167V with sequence conservation analysis and comparative analysis of the available apo and holo structures of the enzyme from diverse organisms. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. HPLC-Based Activity Profiling: Discovery of Piperine as a Positive GABAA Receptor Modulator Targeting a Benzodiazepine-Independent Binding Site

    PubMed Central

    Zaugg, Janine; Baburin, Igor; Strommer, Barbara; Kim, Hyun-Jung; Hering, Steffen; Hamburger, Matthias

    2011-01-01

    A plant extract library was screened for GABAA receptor activity making use of a two-microelectrode voltage clamp assay on Xenopus laevis oocytes. An ethyl acetate extract of black pepper fruits [Piper nigrum L. (Piperaceae) 100 μg/mL] potentiated GABA-induced chloride currents through GABAA receptors (composed of α1, β2, and γ2S subunits) by 169.1 ± 2.4%. With the aid of an HPLC-based activity profiling approach, piperine (5) was identified as the main active compound, together with 12 structurally related less active or inactive piperamides (1–4, 6–13). Identification was achieved by on-line high-resolution mass spectrometry and off-line microprobe 1D and 2D NMR spectroscopy, using only milligram amounts of extract. Compound 5 induced a maximum potentiation of the chloride currents by 301.9 ± 26.5% with an EC50 of 52.4 ± 9.4 μM. A comparison of the modulatory activity of 5 and other naturally occurring piperamides enabled insights into structural features critical for GABAA receptor modulation. The stimulation of chloride currents through GABAA receptors by compound 5 was not antagonized by flumazenil (10 μM). These data show that piperine (5) represents a new scaffold of positive allosteric GABAA receptor modulators targeting a benzodiazepine-independent binding site. PMID:20085307

  12. Topography of eye-position sensitivity of saccades evoked electrically from the cat's superior colliculus.

    PubMed

    McIlwain, J T

    1990-03-01

    Saccades evoked electrically from the deep layers of the superior colliculus have been examined in the alert cat with its head fixed. Amplitudes of the vertical and horizontal components varied linearly with the starting position of the eye. The slopes of the linear-regression lines provided an estimate of the sensitivity of these components to initial eye position. In observations on 29 sites in nine cats, the vertical and horizontal components of saccades evoked from a given site were rarely influenced to the same degree by initial eye position. For most sites, the horizontal component was more sensitive than the vertical component. Sensitivities of vertical and horizontal components were lowest near the representations of the horizontal and vertical meridians, respectively, of the collicular retinotopic map, but otherwise exhibited no systematic retinotopic dependence. Estimates of component amplitudes for saccades evoked from the center of the oculomotor range also diverged significantly from those predicted from the retinotopic map. The results of this and previous studies indicate that electrical stimulation of the cat's superior colliculus cannot yield a unique oculomotor map or one that is in register everywhere with the sensory retinotopic map. Several features of these observations suggest that electrical stimulation of the colliculus produces faulty activation of a saccadic control system that computes target position with respect to the head and that small and large saccades are controlled differently.

  13. Role of the medial prefrontal cortex in cataplexy.

    PubMed

    Oishi, Yo; Williams, Rhiannan H; Agostinelli, Lindsay; Arrigoni, Elda; Fuller, Patrick M; Mochizuki, Takatoshi; Saper, Clifford B; Scammell, Thomas E

    2013-06-05

    Narcolepsy is characterized by chronic sleepiness and cataplexy, episodes of profound muscle weakness that are often triggered by strong, positive emotions. Narcolepsy with cataplexy is caused by a loss of orexin (also known as hypocretin) signaling, but almost nothing is known about the neural mechanisms through which positive emotions trigger cataplexy. Using orexin knock-out mice as a model of narcolepsy, we found that palatable foods, especially chocolate, markedly increased cataplexy and activated neurons in the medial prefrontal cortex (mPFC). Reversible suppression of mPFC activity using an engineered chloride channel substantially reduced cataplexy induced by chocolate but did not affect spontaneous cataplexy. In addition, neurons in the mPFC innervated parts of the amygdala and lateral hypothalamus that contain neurons active during cataplexy and that innervate brainstem regions known to regulate motor tone. These observations indicate that the mPFC is a critical site through which positive emotions trigger cataplexy.

  14. Role of the medial prefrontal cortex in cataplexy

    PubMed Central

    Oishi, Yo; Williams, Rhiannan H.; Agostinelli, Lindsay; Arrigoni, Elda; Fuller, Patrick M.; Mochizuki, Takatoshi; Saper, Clifford B.; Scammell, Thomas E.

    2013-01-01

    Narcolepsy is characterized by chronic sleepiness and cataplexy - episodes of profound muscle weakness that are often triggered by strong, positive emotions. Narcolepsy with cataplexy is caused by a loss of orexin (also known as hypocretin) signaling, but almost nothing is known about the neural mechanisms through which positive emotions trigger cataplexy. Using orexin knockout mice as a model of narcolepsy, we found that palatable foods, especially chocolate, markedly increased cataplexy and activated neurons in the medial prefrontal cortex (mPFC). Reversible suppression of mPFC activity using an engineered chloride channel substantially reduced cataplexy induced by chocolate but did not affect spontaneous cataplexy. In addition, neurons in the mPFC innervated parts of the amygdala and lateral hypothalamus that contain neurons active during cataplexy, and that innervate brainstem regions known to regulate motor tone. These observations indicate that the mPFC is a critical site through which positive emotions trigger cataplexy. PMID:23739971

  15. Synthesis, characterization, antimicrobial activity and theoretical studies of new thiophene-based tripodal ligands

    NASA Astrophysics Data System (ADS)

    Harit, Tarik; Bellaouchi, Reda; Asehraou, Abdeslam; Rahal, Mahmoud; Bouabdallah, Ibrahim; Malek, Fouad

    2017-04-01

    The synthesis of new thiophene-tripods with different side arms was reported. These compounds were obtained in good yields and their structures were confirmed by NMR spectroscopy, elemental analysis, infrared spectroscopy and mass spectrometry. The in vitro antibacterial and antifungal activities of these products were screened against Gram positive bacteria (Micrococcus luteus and Bacillus subtilis), Gram negative bacteria (Escherichia coli) and fungi (Candida pelliculosa). The obtained results showed that tripods containing a hydroxyl group in the side arm inhibited both Gram-positive and Gram-negative bacteria, while the tripod with an isopropyl side arm inhibited only the Gram-negative bacteria. DFT calculations with B3LYP/6-31G* level have been used to analyze the electronic and geometric characteristics. The molecular electrostatic potential surface (MEPS) indicated that the presence of electrophile site in the side arm could be responsible for activities against Gram-positive bacteria.

  16. Glutamine 57 at the complementary binding site face is a key determinant of morantel selectivity for {alpha}7 nicotinic receptors.

    PubMed

    Bartos, Mariana; Price, Kerry L; Lummis, Sarah C R; Bouzat, Cecilia

    2009-08-07

    Nicotinic receptors (AChRs) play key roles in synaptic transmission. We explored activation of neuronal alpha7 and mammalian muscle AChRs by morantel and oxantel. Our results revealed a novel action of morantel as a high efficacy and more potent agonist than ACh of alpha7 receptors. The EC(50) for activation by morantel of both alpha7 and alpha7-5HT(3A) receptors is 7-fold lower than that determined for ACh. The minimum morantel concentration required to activate alpha7-5HT(3A) channels is 6-fold lower than that of ACh, and activation episodes are more prolonged than in the presence of ACh. By contrast, oxantel is a weak agonist of alpha7 and alpha7-5HT(3A), and both drugs are very low efficacy agonists of muscle AChRs. The replacement of Gln(57) in alpha7 by glycine, which is found in the equivalent position of the muscle AChR, decreases the efficacy for activation and turns morantel into a partial agonist. The reverse mutation in the muscle AChR (epsilonG57Q) increases 7-fold the efficacy of morantel. The mutations do not affect activation by ACh or oxantel, indicating that this position is selective for morantel. In silico studies show that the tetrahydropyrimidinyl group, common to both drugs, is close to Trp(149) of the principal face of the binding site, whereas the other cyclic group is proximal to Gln(57) of the complementary face in morantel but not in oxantel. Thus, position 57 at the complementary face is a key determinant of the high selectivity of morantel for alpha7. These results provide new information for further progress in drug design.

  17. Active site remodeling switches HIV specificity of antiretroviral TRIMCyp

    PubMed Central

    Price, Amanda J; Marzetta, Flavia; Lammers, Michael; Ylinen, Laura M J; Schaller, Torsten; Wilson, Sam J; Towers, Greg J; James, Leo C

    2011-01-01

    TRIMCyps are primate antiretroviral proteins that potently inhibit HIV replication. Here we describe how rhesus macaque TRIMCyp (RhTC) has evolved to target and restrict HIV-2. We show that the ancestral cyclophilin A (CypA) domain of RhTC targets HIV-2 capsid with weak affinity, which is strongly increased in RhTC by two mutations (D66N and R69H) at the expense of HIV-1 binding. These mutations disrupt a constraining intramolecular interaction in CypA, triggering the complete restructuring (>16 Å) of an active site loop. This new configuration discriminates between divergent HIV-1 and HIV-2 loop conformations mediated by capsid residue 88. Viral sensitivity to RhTC restriction can be conferred or abolished by mutating position 88. Furthermore, position 88 determines the susceptibility of naturally occurring HIV-1 sequences to restriction. Our results reveal the complex molecular, structural and thermodynamic changes that underlie the ongoing evolutionary race between virus and host. PMID:19767750

  18. Bioengineered Nisin A Derivatives with Enhanced Activity against Both Gram Positive and Gram Negative Pathogens

    PubMed Central

    Field, Des; Begley, Maire; O’Connor, Paula M.; Daly, Karen M.; Hugenholtz, Floor; Cotter, Paul D.; Hill, Colin; Ross, R. Paul

    2012-01-01

    Nisin is a bacteriocin widely utilized in more than 50 countries as a safe and natural antibacterial food preservative. It is the most extensively studied bacteriocin, having undergone decades of bioengineering with a view to improving function and physicochemical properties. The discovery of novel nisin variants with enhanced activity against clinical and foodborne pathogens has recently been described. We screened a randomized bank of nisin A producers and identified a variant with a serine to glycine change at position 29 (S29G), with enhanced efficacy against S. aureus SA113. Using a site-saturation mutagenesis approach we generated three more derivatives (S29A, S29D and S29E) with enhanced activity against a range of Gram positive drug resistant clinical, veterinary and food pathogens. In addition, a number of the nisin S29 derivatives displayed superior antimicrobial activity to nisin A when assessed against a range of Gram negative food-associated pathogens, including E. coli, Salmonella enterica serovar Typhimurium and Cronobacter sakazakii. This is the first report of derivatives of nisin, or indeed any lantibiotic, with enhanced antimicrobial activity against both Gram positive and Gram negative bacteria. PMID:23056510

  19. An unconventional origin of metal-ion rescue and inhibition in the Tetrahymena group I ribozyme reaction.

    PubMed Central

    Shan, S O; Herschlag, D

    2000-01-01

    The presence of catalytic metal ions in RNA active sites has often been inferred from metal-ion rescue of modified substrates and sometimes from inhibitory effects of alternative metal ions. Herein we report that, in the Tetrahymena group I ribozyme reaction, the deleterious effect of a thio substitution at the pro-Sp position of the reactive phosphoryl group is rescued by Mn2+. However, analysis of the reaction of this thio substrate and of substrates with other modifications strongly suggest that this rescue does not stem from a direct Mn2+ interaction with the Sp sulfur. Instead, the apparent rescue arises from a Mn2+ ion interacting with the residue immediately 3' of the cleavage site, A(+1), that stabilizes the tertiary interactions between the oligonucleotide substrate (S) and the active site. This metal site is referred to as site D herein. We also present evidence that a previously observed Ca2+ ion that inhibits the chemical step binds to metal site D. These and other observations suggest that, whereas the interactions of Mn2+ at site D are favorable for the chemical reaction, the Ca2+ at site D exerts its inhibitory effect by disrupting the alignment of the substrates within the active site. These results emphasize the vigilance necessary in the design and interpretation of metal-ion rescue and inhibition experiments. Conversely, in-depth mechanistic analysis of the effects of site-specific substrate modifications can allow the effects of specific metal ion-RNA interactions to be revealed and the properties of individual metal-ion sites to be probed, even within the sea of metal ions bound to RNA. PMID:10864040

  20. Ternary structure reveals mechanism of a membrane diacylglycerol kinase

    DOE PAGES

    Li, Dianfan; Stansfeld, Phillip J.; Sansom, Mark S. P.; ...

    2015-12-17

    Diacylglycerol kinase catalyses the ATP-dependent conversion of diacylglycerol to phosphatidic acid in the plasma membrane of Escherichia coli. The small size of this integral membrane trimer, which has 121 residues per subunit, means that available protein must be used economically to craft three catalytic and substrate-binding sites centred about the membrane/cytosol interface. How nature has accomplished this extraordinary feat is revealed here in a crystal structure of the kinase captured as a ternary complex with bound lipid substrate and an ATP analogue. Residues, identified as essential for activity by mutagenesis, decorate the active site and are rationalized by the ternarymore » structure. The γ-phosphate of the ATP analogue is positioned for direct transfer to the primary hydroxyl of the lipid whose acyl chain is in the membrane. A catalytic mechanism for this unique enzyme is proposed. As a result, the active site architecture shows clear evidence of having arisen by convergent evolution.« less

  1. Influence of a multidimensional measure of attitudes on motives to use social networking sites.

    PubMed

    Krishnan, Archana; Hunt, Daniel Scot

    2015-03-01

    Positive attitudes toward a new communication technology tend to be a significant motivator in subsequent adoption and use. The recent spurt in the adoption of social media tools such as social networking sites (SNSs) demands the examination of attitudinal variables on motives to use these Web sites. This study explicated a multidimensional measure of attitudes toward SNSs and tested a theoretical model to examine the effect of attitudes on motives to use SNSs and SNS activity. Participants (N=674) completed a cross-sectional survey consisting of measures of attitudes toward SNSs, motives of SNS use, and level of activity. Results showed support for a revised model in which attitudinal variables-ease of use, self-disclosure, and social connection-strongly predicted motives of SNS use such as passing time, information/entertainment, social conformity, and, most importantly, socialization. The motive of using SNSs as a social tool superseded the direct effect of other motives on SNS activity, suggesting that users' primary activity on SNSs was for socialization and for relational development and maintenance.

  2. The serine 814 of TRPC6 is phosphorylated under unstimulated conditions.

    PubMed

    Bousquet, Simon M; Monet, Michael; Boulay, Guylain

    2011-03-23

    TRPC are nonselective cation channels involved in calcium entry. Their regulation by phosphorylation has been shown to modulate their routing and activity. TRPC6 activity increases following phosphorylation by Fyn, and is inhibited by protein kinase G and protein kinase C. A previous study by our group showed that TRPC6 is phosphorylated under unstimulated conditions in a human embryonic kidney cells line (HEK293). To investigate the mechanism responsible for this phosphorylation, we used a MS/MS approach combined with metabolic labeling and showed that the serine at position 814 is phosphorylated in unstimulated cells. The mutation of Ser(814) into Ala decreased basal phosphorylation but did not modify TRPC6 activity. Even though Ser(814) is within a consensus site for casein kinase II (CK2), we showed that CK2 is not involved in the phosphorylation of TRPC6 and does not modify its activity. In summary, we identified a new basal phosphorylation site (Ser(814)) on TRPC6 and showed that CK2 is not responsible for the phosphorylation of this site.

  3. The Serine 814 of TRPC6 Is Phosphorylated under Unstimulated Conditions

    PubMed Central

    Bousquet, Simon M.; Monet, Michael; Boulay, Guylain

    2011-01-01

    TRPC are nonselective cation channels involved in calcium entry. Their regulation by phosphorylation has been shown to modulate their routing and activity. TRPC6 activity increases following phosphorylation by Fyn, and is inhibited by protein kinase G and protein kinase C. A previous study by our group showed that TRPC6 is phosphorylated under unstimulated conditions in a human embryonic kidney cells line (HEK293). To investigate the mechanism responsible for this phosphorylation, we used a MS/MS approach combined with metabolic labeling and showed that the serine at position 814 is phosphorylated in unstimulated cells. The mutation of Ser814 into Ala decreased basal phosphorylation but did not modify TRPC6 activity. Even though Ser814 is within a consensus site for casein kinase II (CK2), we showed that CK2 is not involved in the phosphorylation of TRPC6 and does not modify its activity. In summary, we identified a new basal phosphorylation site (Ser814) on TRPC6 and showed that CK2 is not responsible for the phosphorylation of this site. PMID:21448286

  4. The pimeloyl-CoA synthetase BioW defines a new fold for adenylate-forming enzymes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Estrada, Paola; Manandhar, Miglena; Dong, Shi-Hui

    Reactions that activate carboxylates through acyl-adenylate intermediates are found throughout biology and include acyl- and aryl-CoA synthetases and tRNA synthetases. Here we describe the characterization of Aquifex aeolicus BioW, which represents a new protein fold within the superfamily of adenylating enzymes. Substrate-bound structures identified the enzyme active site and elucidated the mechanistic strategy for conjugating CoA to the seven-carbon α,ω-dicarboxylate pimelate, a biotin precursor. Proper position of reactive groups for the two half-reactions is achieved solely through movements of active site residues, as confirmed by site-directed mutational analysis. The ability of BioW to hydrolyze adenylates of noncognate substrates is reminiscentmore » of pre-transfer proofreading observed in some tRNA synthetases, and we show that this activity can be abolished by mutation of a single residue. These studies illustrate how BioW can carry out three different biologically prevalent chemical reactions (adenylation, thioesterification, and proofreading) in the context of a new protein fold.« less

  5. Exploiting protein flexibility to predict the location of allosteric sites

    PubMed Central

    2012-01-01

    Background Allostery is one of the most powerful and common ways of regulation of protein activity. However, for most allosteric proteins identified to date the mechanistic details of allosteric modulation are not yet well understood. Uncovering common mechanistic patterns underlying allostery would allow not only a better academic understanding of the phenomena, but it would also streamline the design of novel therapeutic solutions. This relatively unexplored therapeutic potential and the putative advantages of allosteric drugs over classical active-site inhibitors fuel the attention allosteric-drug research is receiving at present. A first step to harness the regulatory potential and versatility of allosteric sites, in the context of drug-discovery and design, would be to detect or predict their presence and location. In this article, we describe a simple computational approach, based on the effect allosteric ligands exert on protein flexibility upon binding, to predict the existence and position of allosteric sites on a given protein structure. Results By querying the literature and a recently available database of allosteric sites, we gathered 213 allosteric proteins with structural information that we further filtered into a non-redundant set of 91 proteins. We performed normal-mode analysis and observed significant changes in protein flexibility upon allosteric-ligand binding in 70% of the cases. These results agree with the current view that allosteric mechanisms are in many cases governed by changes in protein dynamics caused by ligand binding. Furthermore, we implemented an approach that achieves 65% positive predictive value in identifying allosteric sites within the set of predicted cavities of a protein (stricter parameters set, 0.22 sensitivity), by combining the current analysis on dynamics with previous results on structural conservation of allosteric sites. We also analyzed four biological examples in detail, revealing that this simple coarse-grained methodology is able to capture the effects triggered by allosteric ligands already described in the literature. Conclusions We introduce a simple computational approach to predict the presence and position of allosteric sites in a protein based on the analysis of changes in protein normal modes upon the binding of a coarse-grained ligand at predicted cavities. Its performance has been demonstrated using a newly curated non-redundant set of 91 proteins with reported allosteric properties. The software developed in this work is available upon request from the authors. PMID:23095452

  6. Exploiting protein flexibility to predict the location of allosteric sites.

    PubMed

    Panjkovich, Alejandro; Daura, Xavier

    2012-10-25

    Allostery is one of the most powerful and common ways of regulation of protein activity. However, for most allosteric proteins identified to date the mechanistic details of allosteric modulation are not yet well understood. Uncovering common mechanistic patterns underlying allostery would allow not only a better academic understanding of the phenomena, but it would also streamline the design of novel therapeutic solutions. This relatively unexplored therapeutic potential and the putative advantages of allosteric drugs over classical active-site inhibitors fuel the attention allosteric-drug research is receiving at present. A first step to harness the regulatory potential and versatility of allosteric sites, in the context of drug-discovery and design, would be to detect or predict their presence and location. In this article, we describe a simple computational approach, based on the effect allosteric ligands exert on protein flexibility upon binding, to predict the existence and position of allosteric sites on a given protein structure. By querying the literature and a recently available database of allosteric sites, we gathered 213 allosteric proteins with structural information that we further filtered into a non-redundant set of 91 proteins. We performed normal-mode analysis and observed significant changes in protein flexibility upon allosteric-ligand binding in 70% of the cases. These results agree with the current view that allosteric mechanisms are in many cases governed by changes in protein dynamics caused by ligand binding. Furthermore, we implemented an approach that achieves 65% positive predictive value in identifying allosteric sites within the set of predicted cavities of a protein (stricter parameters set, 0.22 sensitivity), by combining the current analysis on dynamics with previous results on structural conservation of allosteric sites. We also analyzed four biological examples in detail, revealing that this simple coarse-grained methodology is able to capture the effects triggered by allosteric ligands already described in the literature. We introduce a simple computational approach to predict the presence and position of allosteric sites in a protein based on the analysis of changes in protein normal modes upon the binding of a coarse-grained ligand at predicted cavities. Its performance has been demonstrated using a newly curated non-redundant set of 91 proteins with reported allosteric properties. The software developed in this work is available upon request from the authors.

  7. Functional and Structural Characterization of a Cation-dependent O-Methyltransferase from the Cyanobacterium Synechocystis sp. Strain PCC 6803*S⃞

    PubMed Central

    Kopycki, Jakub Grzegorz; Stubbs, Milton T.; Brandt, Wolfgang; Hagemann, Martin; Porzel, Andrea; Schmidt, Jürgen; Schliemann, Willibald; Zenk, Meinhart H.; Vogt, Thomas

    2008-01-01

    The coding sequence of the cyanobacterium Synechocystis sp. strain PCC 6803 slr0095 gene was cloned and functionally expressed in Escherichia coli. The corresponding enzyme was classified as a cation- and S-adenosyl-l-methionine-dependent O-methyltransferase (SynOMT), consistent with considerable amino acid sequence identities to eukaryotic O-methyltransferases (OMTs). The substrate specificity of SynOMT was similar with those of plant and mammalian CCoAOMT-like proteins accepting a variety of hydroxycinnamic acids and flavonoids as substrates. In contrast to the known mammalian and plant enzymes, which exclusively methylate the meta-hydroxyl position of aromatic di- and trihydroxy systems, Syn-OMT also methylates the para-position of hydroxycinnamic acids like 5-hydroxyferulic and 3,4,5-trihydroxycinnamic acid, resulting in the formation of novel compounds. The x-ray structure of SynOMT indicates that the active site allows for two alternative orientations of the hydroxylated substrates in comparison to the active sites of animal and plant enzymes, consistent with the observed preferred para-methylation and position promiscuity. Lys3 close to the N terminus of the recombinant protein appears to play a key role in the activity of the enzyme. The possible implications of these results with respect to modifications of precursors of polymers like lignin are discussed. PMID:18502765

  8. Autocatalytic activity and substrate specificity of the pestivirus N-terminal protease N{sup pro}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gottipati, Keerthi; Acholi, Sudheer; Ruggli, Nicolas

    Pestivirus N{sup pro} is the first protein translated in the viral polypeptide, and cleaves itself off co-translationally generating the N-terminus of the core protein. Once released, N{sup pro} blocks the host's interferon response by inducing degradation of interferon regulatory factor-3. N{sup pro'}s intracellular autocatalytic activity and lack of trans-activity have hampered in vitro cleavage studies to establish its substrate specificity and the roles of individual residues. We constructed N{sup pro}-GFP fusion proteins that carry the authentic cleavage site and determined the autoproteolytic activities of N{sup pro} proteins containing substitutions at the predicted catalytic sites Glu22 and Cys69, at Arg100 thatmore » forms a salt bridge with Glu22, and at the cleavage site Cys168. Contrary to previous reports, we show that N{sup pro'}s catalytic activity does not involve Glu22, which may instead be involved in protein stability. Furthermore, N{sup pro} does not have specificity for Cys168 at the cleavage site even though this residue is conserved throughout the pestivirus genus. - Highlights: • N{sup pro'}s autoproteolysis is studied using N{sup pro}-GFP fusion proteins. • N-terminal 17 amino acids are dispensable without loss of protease activity. • The putative catalytic residue Glu22 is not involved in protease catalysis. • No specificity for Cys168 at the cleavage site despite evolutionary conservation. • N{sup pro} prefers small amino acids with non-branched beta carbons at the P1 position.« less

  9. Mutations That Improve the pRE Promoter of Coliphage Lambda

    PubMed Central

    Mahoney, Michael E.; Wulff, Daniel L.

    1987-01-01

    The dya5 mutation, a C→T change at position -43 of the λ pRE promoter, results in a twofold increase in pRE activity in vivo. Smaller increases in pRE activity are found for the dya2 mutation, a T→C change at position -1 of pRE, and the dya3 mutation, an A→G change at +5 of pRE. The mutant p RE promoters retain complete dependence on cII protein for activity. These observations argue, at least for pRE-like promoters, that promoter activities are influenced by nucleotide sequences at least eight nucleotides to the 5'-side of the conventional -35 region consensus sequence, and by nucleotide sequences near the start-site of transcription. Although Hawley and McClure (1983) found A·T pairs more frequently than G·TC pairs in the region of -40 to -45 of prokaryotic promoters, other mutations that change a G·TC pair to an A·T pair at positions -41, -44 and -45 of pRE do not result in increased promoter activity. We also found that a T→C change at position -42 results in a mild decrease in promoter activity. These observations argue that Ts at positions -42 and -43 of pRE are required for maximum promoter activity, but do not support the hypothesis that As and Ts in the -40 to -45 region generally lead to higher promoter activities. PMID:2953648

  10. Mutagenic frequencies of site-specifically located O6-methylguanine in wild-type Escherichia coli and in a strain deficient in ada-methyltransferase.

    PubMed

    Rossi, S C; Topal, M D

    1991-02-01

    The adaptive response of Escherichia coli involves protection of the cells against the toxic and mutagenic consequences of exposure to high doses of a methylating agent by prior exposure to low doses of the agent. Ada protein, a major repair activity for O6-methylguanine, is activated to positively control the adaptive response; O6-methylguanine is one of the major mutagenic lesions produced by methylating agents. We investigated the mutation frequency of wild-type Escherichia coli and strains containing the ada-5 mutation in response to site-specifically synthesized O6-methylguanine under conditions in which the adaptive response was not induced. Site-directed mutagenesis and oligonucleotide self-selection techniques were used to isolate the progeny of M13mp18 DNAs constructed to contain O6-methylguanine at any of eight different positions. The progeny were isolated from E. coli strains isogeneic except for deficiency in Ada-methyltransferase repair, UvrABC excision repair, or both. The resulting O6-methylguanine mutation levels at each position were determined by using differential oligonucleotide hybridization. We found that the wild type had up to a 2.6-fold higher mutation frequency than ada-5 mutants. In addition, the mutation frequency varied with the position of the O6-methylguanine in the DNA in the wild type but not in ada-5 mutants; O6-methylguanine lesions at the 5' ends of runs of consecutive guanines gave the highest mutation frequencies. Determination of the mutation frequency of O6-methylguanine in wild-type and mutS cells showed that mismatch repair can affect O6-methylguanine mutation levels.

  11. 18F-FDG uptake assessed by PET/CT in abdominal aortic aneurysms is associated with cellular and molecular alterations prefacing wall deterioration and rupture.

    PubMed

    Courtois, Audrey; Nusgens, Betty V; Hustinx, Roland; Namur, Gauthier; Gomez, Pierre; Somja, Joan; Defraigne, Jean-Olivier; Delvenne, Philippe; Michel, Jean-Baptiste; Colige, Alain C; Sakalihasan, Natzi

    2013-10-01

    Rupture of abdominal aortic aneurysms (AAAs) leads to a significant morbidity and mortality in aging populations, and its prediction would be most beneficial to public health. Spots positive for uptake of (18)F-FDG detected by PET are found in 12% of AAA patients (PET+), who are most often symptomatic and at high rupture risk. Comparing the (18)F-FDG-positive site with a negative site from the same aneurysm and with samples collected from AAA patients with no (18)F-FDG uptake should allow the discrimination of biologic alterations that would help in identifying markers predictive of rupture. Biopsies of the AAA wall were obtained from patients with no (18)F-FDG uptake (PET0, n = 10) and from PET+ patients (n = 8), both at the site positive for uptake and at a distant negative site of the aneurysmal wall. Samples were analyzed by immunohistochemistry, quantitative real-time polymerase chain reaction, and zymography. The sites of the aneurysmal wall with a positive (18)F-FDG uptake were characterized by a strikingly increased number of adventitial inflammatory cells, highly proliferative, and by a drastic reduction of smooth muscle cells (SMCs) in the media as compared with their negative counterpart and with the PET0 wall. The expression of a series of genes involved in the maintenance and remodeling of the wall was significantly modified in the negative sites of PET+, compared with the PET0 wall, suggesting a systemic alteration of the aneurysmal wall. Furthermore, a striking increase of several matrix metalloproteinases (MMPs), notably the MMP1 and MMP13 collagenases, was observed in the positive sites, mainly in the adventitia. Moreover, PET+ patients were characterized by a higher circulating C-reactive protein. Positive (18)F-FDG uptake in the aneurysmal wall is associated with an active inflammatory process characterized by a dense infiltrate of proliferating leukocytes in the adventitia and an increased circulating C-reactive protein. Moreover, a loss of SMC in the media and alterations of the expression of genes involved in the remodeling of adventitia and collagen degradation potentially participate in the weakening of the aneurysmal wall preceding rupture.

  12. Chromosomal position effects in chicken lysozyme gene transgenic mice are correlated with suppression of DNase I hypersensitive site formation.

    PubMed Central

    Huber, M C; Bosch, F X; Sippel, A E; Bonifer, C

    1994-01-01

    The complete chicken lysozyme gene locus is expressed copy number dependently and at a high level in macrophages of transgenic mice. Gene expression independent of genomic position can only be achieved by the concerted action of all cis regulatory elements located on the lysozyme gene domain. Position independency of expression is lost if one essential cis regulatory region is deleted. Here we compared the DNase I hypersensitive site (DHS) pattern formed on the chromatin of position independently and position dependently expressed transgenes in order to assess the influence of deletions within the gene domain on active chromatin formation. We demonstrate, that in position independently expressed transgene all DHSs are formed with the authentic relative frequency on all genes. This is not the case for position dependently expressed transgenes. Our results show that the formation of a DHS during cellular differentiation does not occur autonomously. In case essential regulatory elements of the chicken lysozyme gene domain are lacking, the efficiency of DHS formation on remaining cis regulatory elements during myeloid differentiation is reduced and influenced by the chromosomal position. Hence, no individual regulatory element on the lysozyme domain is capable of organizing the chromatin structure of the whole locus in a dominant fashion. Images PMID:7937145

  13. Human prorenin structure sheds light on a novel mechanism of its autoinhibition and on its non-proteolytic activation by the (pro)renin receptor.

    PubMed

    Morales, Renaud; Watier, Yves; Böcskei, Zsolt

    2012-08-03

    Antibodies and prorenin mutants have long been used to structurally characterize prorenin, the inactive proenzyme form of renin. They were designed on the basis of homology models built using other aspartyl protease proenzyme structures since no structure was available for prorenin. Here, we present the first X-ray structure of a prorenin. The current structure of prorenin reveals that, in this zymogene, the active site of renin is blocked by the N-terminal residues of the mature version of the renin molecule, which are, in turn, covered by an Ω-shaped prosegment. This prevents access of substrates to the active site. The departure of the prosegment on activation induces an important global conformational change in the mature renin molecule with respect to prorenin: similar to other related enzymes such as pepsin or gastricsin, the segment that constitutes the N-terminal β-strand in renin is displaced from the renin active site by about 180° straight into the position that corresponds to the N-terminal β-strand of the prorenin prosegment. This way, the renin active site will become completely exposed and capable of carrying out its catalytic functions. A unique inactivation mechanism is also revealed, which does not make use of a lysine against the catalytic aspartates, probably in order to facilitate pH-independent activation [e.g., by the (pro)renin receptor]. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Methodological proceedings to evaluate the physical accessibility in urban historic sites.

    PubMed

    Ribeiro, Gabriela Sousa; Martins, Laura Bezerra; Monteiro, Circe Maria Gama

    2012-01-01

    Historic urban sites are set by cultural and social diversities, generating multiple activities and use and access to these sites should be available to all people including those with disabilities. Taking into consideration that using the same methodology that was used in different historic sites researches with positive results facilitates replication, we aimed to develop methodological procedures that identify conditions of physical accessibility in open public spaces and access to public buildings in historic urban sites to support proposals about design requirements for improvements to the problems diagnosed and control inadequacies of the physical environment. The study methods and techniques from different areas of knowledge culminated in a proposal built with an emphasis on user participation that could be applied with low cost and in relatively short period of time.

  15. Bovine viral diarrhea virus NS3 serine proteinase: polyprotein cleavage sites, cofactor requirements, and molecular model of an enzyme essential for pestivirus replication.

    PubMed Central

    Xu, J; Mendez, E; Caron, P R; Lin, C; Murcko, M A; Collett, M S; Rice, C M

    1997-01-01

    Members of the Flaviviridae encode a serine proteinase termed NS3 that is responsible for processing at several sites in the viral polyproteins. In this report, we show that the NS3 proteinase of the pestivirus bovine viral diarrhea virus (BVDV) (NADL strain) is required for processing at nonstructural (NS) protein sites 3/4A, 4A/4B, 4B/5A, and 5A/5B but not for cleavage at the junction between NS2 and NS3. Cleavage sites of the proteinase were determined by amino-terminal sequence analysis of the NS4A, NS4B, NS5A, and NS5B proteins. A conserved leucine residue is found at the P1 position of all four cleavage sites, followed by either serine (3/4A, 4B/5A, and 5A/5B sites) or alanine (4A/4B site) at the P1' position. Consistent with this cleavage site preference, a structural model of the pestivirus NS3 proteinase predicts a highly hydrophobic P1 specificity pocket. trans-Processing experiments implicate the 64-residue NS4A protein as an NS3 proteinase cofactor required for cleavage at the 4B/5A and 5A/5B sites. Finally, using a full-length functional BVDV cDNA clone, we demonstrate that a catalytically active NS3 serine proteinase is essential for pestivirus replication. PMID:9188600

  16. Exposure of northern leopard frogs in the Green Bay ecosystem to polychlorinated biphenyls, polychlorinated dibenzo-p-dioxins, and polychlorinated dibenzofurans is measured by direct chemistry but not hepatic ethoxyresorufin-O-deethylase activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Y.W.; Karasov, W.H.; Patnode, K.A.

    1999-10-01

    The authors measured concentrations of polychlorinated biphenyls (PCBs), polychlorinated dibenzo-p-dioxins (PCDDs), and polychlorinated dibenzofurans (PCDFs) in northern leopard frogs collected from the Green Bay ecosystem and explored the catalytic activity of hepatic cytochrome P450-associated monooxygenase (P450 enzyme) as a biomarker for exposure to aryl hydrocarbon receptor (AhR) agonists. The two hypotheses tested were PCH concentrations in northern leopard frogs would be positively correlated with sediment polychlorinated hydrocarbon (PCH) levels in wetland habitats along a contamination gradient and hepatic ethoxyresorufin-O-deethylase (EROD) activity of northern leopard frogs, which is presumably mediated by aryl hydrocarbon receptor (AhR), would be positively correlated with PCHmore » concentrations in frog carcasses from different collection sites. In 1994 and 1995, frogs from seven sites along the lower Fox River and Green Bay, USA, were assayed for hepatic EROD activities and whole carcass concentrations of PCBs, PCDDs, and PCDFs. Tissue total PCB concentrations ranging from 3 to 154 ng/g were significantly correlated with sediment PCB levels. Only one PCDD and two PCDFs at concentrations of 6 to 8 pg/g were found in the frogs collected with frog body weight and was similar among sites except for Peter's Marsh. No significant correlation was found between EROD activity and carcass PCB concentration. This result was consistent with the fact that the frogs collected from the Green Bay ecosystem had relatively low PCB concentrations compared with what was required for induction in the laboratory.« less

  17. Wobble pairs of the HDV ribozyme play specific roles in stabilization of active site dynamics.

    PubMed

    Sripathi, Kamali N; Banáš, Pavel; Réblová, Kamila; Šponer, Jiří; Otyepka, Michal; Walter, Nils G

    2015-02-28

    The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5') hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5') general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5') hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs.

  18. Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

    PubMed Central

    Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

    2015-01-01

    The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

  19. Radiocarbon in CO2 and Soil Organic Matter from Laboratory Incubations, Barrow, Alaska, 2012

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lydia Vaughn; Margaret Torn

    Dataset includes Delta14C measurements made from soil organic matter and CO2 from laboratory soil incubations of active layer soils collected in Barrow, Alaska in 2012. In addition to Delta14CO2, dataset CO2 production rates and carbon and nitrogen concentrations. Samples were collected from intensive study site 1 areas A, B, and C, and the site 0 and AB transects, from specified positions in high-centered, flat-centered, and low centered polygons.

  20. Radiocarbon in CO2 and Soil Organic Matter from Laboratory Incubations, Barrow, Alaska, 2014

    DOE Data Explorer

    Lydia Vaughn; Margaret Torn

    2018-02-20

    Dataset includes 14C measurements made from soil organic matter and CO2 from paired anaerobic and aerobic laboratory soil incubations of active layer soils collected in Barrow, Alaska in 2014. In addition to 14CO2, dataset includes CO2 production rates and carbon and nitrogen concentrations. Samples were collected from intensive study site 1 areas A, B, and C, and the site 0 and AB transects, from specified positions in high-centered, flat-centered, and low centered polygons.

  1. Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

    PubMed

    Tencomnao, T; Yu, R K; Kapitonov, D

    2001-02-16

    UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

  2. Searching for transcription factor binding sites in vector spaces

    PubMed Central

    2012-01-01

    Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338

  3. Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.

    PubMed Central

    Harris, M E; Pace, N R

    1995-01-01

    The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250

  4. DNA Physical Properties and Nucleosome Positions Are Major Determinants of HIV-1 Integrase Selectivity

    PubMed Central

    Naughtin, Monica; Haftek-Terreau, Zofia; Xavier, Johan; Meyer, Sam; Silvain, Maud; Jaszczyszyn, Yan; Levy, Nicolas; Miele, Vincent; Benleulmi, Mohamed Salah; Ruff, Marc; Parissi, Vincent; Vaillant, Cédric; Lavigne, Marc

    2015-01-01

    Retroviral integrases (INs) catalyse the integration of the reverse transcribed viral DNA into the host cell genome. This process is selective, and chromatin has been proposed to be a major factor regulating this step in the viral life cycle. However, the precise underlying mechanisms are still under investigation. We have developed a new in vitro integration assay using physiologically-relevant, reconstituted genomic acceptor chromatin and high-throughput determination of nucleosome positions and integration sites, in parallel. A quantitative analysis of the resulting data reveals a chromatin-dependent redistribution of the integration sites and establishes a link between integration sites and nucleosome positions. The co-activator LEDGF/p75 enhanced integration but did not modify the integration sites under these conditions. We also conducted an in cellulo genome-wide comparative study of nucleosome positions and human immunodeficiency virus type-1 (HIV-1) integration sites identified experimentally in vivo. These studies confirm a preferential integration in nucleosome-covered regions. Using a DNA mechanical energy model, we show that the physical properties of DNA probed by IN binding are important in determining IN selectivity. These novel in vitro and in vivo approaches confirm that IN has a preference for integration into a nucleosome, and suggest the existence of two levels of IN selectivity. The first depends on the physical properties of the target DNA and notably, the energy required to fit DNA into the IN catalytic pocket. The second depends on the DNA deformation associated with DNA wrapping around a nucleosome. Taken together, these results indicate that HIV-1 IN is a shape-readout DNA binding protein. PMID:26075397

  5. Microtubule-stabilizing properties of the avocado-derived toxins (+)-(R)-persin and (+)-(R)-tetrahydropersin in cancer cells and activity of related synthetic analogs.

    PubMed

    Field, Jessica J; Kanakkanthara, Arun; Brooke, Darby G; Sinha, Saptarshi; Pillai, Sushila D; Denny, William A; Butt, Alison J; Miller, John H

    2016-06-01

    The avocado toxin (+)-R-persin (persin) is active at low micromolar concentrations against breast cancer cells and synergizes with the estrogen receptor modulator 4-hydroxytamoxifen. Previous studies in the estrogen receptor-positive breast cancer cell line MCF-7 indicate that persin acts as a microtubule-stabilizing agent. In the present study, we further characterize the properties of persin and several new synthetic analogues in human ovarian cancer cells. Persin and tetrahydropersin cause G2M cell cycle arrest and increase intracellular microtubule polymerization. One analog (4-nitrophenyl)-deshydroxypersin prevents cell proliferation and blocks cells in G1 of the cell cycle rather than G2M, suggesting an additional mode of action of these compounds independent of microtubules. Persin can synergize with other microtubule-stabilizing agents, and is active against cancer cells that overexpress the P-glycoprotein drug efflux pump. Evidence from Flutax-1 competition experiments suggests that while the persin binding site on β-tubulin overlaps the classical taxoid site where paclitaxel and epothilone bind, persin retains activity in cell lines with single amino acid mutations that affect these other taxoid site ligands. This implies the existence of a unique binding location for persin at the taxoid site.

  6. Substrate-binding specificity of chitinase and chitosanase as revealed by active-site architecture analysis.

    PubMed

    Liu, Shijia; Shao, Shangjin; Li, Linlin; Cheng, Zhi; Tian, Li; Gao, Peiji; Wang, Lushan

    2015-12-11

    Chitinases and chitosanases, referred to as chitinolytic enzymes, are two important categories of glycoside hydrolases (GH) that play a key role in degrading chitin and chitosan, two naturally abundant polysaccharides. Here, we investigate the active site architecture of the major chitosanase (GH8, GH46) and chitinase families (GH18, GH19). Both charged (Glu, His, Arg, Asp) and aromatic amino acids (Tyr, Trp, Phe) are observed with higher frequency within chitinolytic active sites as compared to elsewhere in the enzyme structure, indicating significant roles related to enzyme function. Hydrogen bonds between chitinolytic enzymes and the substrate C2 functional groups, i.e. amino groups and N-acetyl groups, drive substrate recognition, while non-specific CH-π interactions between aromatic residues and substrate mainly contribute to tighter binding and enhanced processivity evident in GH8 and GH18 enzymes. For different families of chitinolytic enzymes, the number, type, and position of substrate atoms bound in the active site vary, resulting in different substrate-binding specificities. The data presented here explain the synergistic action of multiple enzyme families at a molecular level and provide a more reasonable method for functional annotation, which can be further applied toward the practical engineering of chitinases and chitosanases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. The structure of Pseudomonas P51 Cl-muconate lactonizing enzyme: Co-evolution of structure and dynamics with the dehalogenation function

    PubMed Central

    Kajander, Tommi; Lehtiö, Lari; Schlömann, Michael; Goldman, Adrian

    2003-01-01

    Bacterial muconate lactonizing enzymes (MLEs) catalyze the conversion of cis,cis-muconate as a part of the β-ketoadipate pathway, and some MLEs are also able to dehalogenate chlorinated muconates (Cl-MLEs). The basis for the Cl-MLEs dehalogenating activity is still unclear. To further elucidate the differences between MLEs and Cl-MLEs, we have solved the structure of Pseudomonas P51 Cl-MLE at 1.95 Å resolution. Comparison of Pseudomonas MLE and Cl-MLE structures reveals the presence of a large cavity in the Cl-MLEs. The cavity may be related to conformational changes on substrate binding in Cl-MLEs, at Gly52. Site-directed mutagenesis on Pseudomonas MLE core positions to the equivalent Cl-MLE residues showed that the variant Thr52Gly was rather inactive, whereas the Thr52Gly-Phe103Ser variant had regained part of the activity. These residues form a hydrogen bond in the Cl-MLEs. The Cl-MLE structure, as a result of the Thr-to-Gly change, is more flexible than MLE: As a mobile loop closes over the active site, a conformational change at Gly52 is observed in Cl-MLEs. The loose packing and structural motions in Cl-MLE may be required for the rotation of the lactone ring in the active site necessary for the dehalogenating activity of Cl-MLEs. Furthermore, we also suggest that differences in the active site mobile loop sequence between MLEs and Cl-MLEs result in lower active site polarity in Cl-MLEs, possibly affecting catalysis. These changes could result in slower product release from Cl-MLEs and make it a better enzyme for dehalogenation of substrate. PMID:12930985

  8. Selective aliphatic carbon-hydrogen bond activation of protected alcohol substrates by cytochrome P450 enzymes.

    PubMed

    Bell, Stephen G; Spence, Justin T J; Liu, Shenglan; George, Jonathan H; Wong, Luet-Lok

    2014-04-21

    Protected cyclohexanol and cyclohex-2-enol substrates, containing benzyl ether and benzoate ester moieties, were designed to fit into the active site of the Tyr96Ala mutant of cytochrome P450cam. The protected cyclohexanol substrates were efficiently and selectively hydroxylated by the mutant enzyme at the trans C-H bond of C-4 on the cyclohexyl ring. The selectivity of oxidation of the benzoate ester protected cyclohexanol could be altered by making alternative amino acid substitutions in the P450cam active site. The addition of the double bond in the cyclohexyl ring of the benzoate ester protected cyclohex-2-enol has a debilitative effect on the activity of the Tyr96Ala mutant with this substrate. However, the Phe87Ala/Tyr96Phe double mutant, which introduces space at a different location in the active site than the Tyr96Ala mutant, was able to efficiently hydroxylate the C-H bonds of 1-cyclohex-2-enyl benzoate at the allylic C-4 position. Mutations at Phe87 improved the selectivity of the oxidation of 1-phenyl-1-cyclohexylethylene to trans-4-phenyl-ethenylcyclohexanol (92%) when compared to single mutants at Tyr96 of P450cam.

  9. Positive selection in octopus haemocyanin indicates functional links to temperature adaptation.

    PubMed

    Oellermann, Michael; Strugnell, Jan M; Lieb, Bernhard; Mark, Felix C

    2015-07-05

    Octopods have successfully colonised the world's oceans from the tropics to the poles. Yet, successful persistence in these habitats has required adaptations of their advanced physiological apparatus to compensate impaired oxygen supply. Their oxygen transporter haemocyanin plays a major role in cold tolerance and accordingly has undergone functional modifications to sustain oxygen release at sub-zero temperatures. However, it remains unknown how molecular properties evolved to explain the observed functional adaptations. We thus aimed to assess whether natural selection affected molecular and structural properties of haemocyanin that explains temperature adaptation in octopods. Analysis of 239 partial sequences of the haemocyanin functional units (FU) f and g of 28 octopod species of polar, temperate, subtropical and tropical origin revealed natural selection was acting primarily on charge properties of surface residues. Polar octopods contained haemocyanins with higher net surface charge due to decreased glutamic acid content and higher numbers of basic amino acids. Within the analysed partial sequences, positive selection was present at site 2545, positioned between the active copper binding centre and the FU g surface. At this site, methionine was the dominant amino acid in polar octopods and leucine was dominant in tropical octopods. Sites directly involved in oxygen binding or quaternary interactions were highly conserved within the analysed sequence. This study has provided the first insight into molecular and structural mechanisms that have enabled octopods to sustain oxygen supply from polar to tropical conditions. Our findings imply modulation of oxygen binding via charge-charge interaction at the protein surface, which stabilize quaternary interactions among functional units to reduce detrimental effects of high pH on venous oxygen release. Of the observed partial haemocyanin sequence, residue 2545 formed a close link between the FU g surface and the active centre, suggesting a role as allosteric binding site. The prevalence of methionine at this site in polar octopods, implies regulation of oxygen affinity via increased sensitivity to allosteric metal binding. High sequence conservation of sites directly involved in oxygen binding indicates that functional modifications of octopod haemocyanin rather occur via more subtle mechanisms, as observed in this study.

  10. A novel protein factor is required for use of distal alternative 5' splice sites in vitro.

    PubMed Central

    Harper, J E; Manley, J L

    1991-01-01

    Adenovirus E1A pre-mRNA was used as a model to examine alternative 5' splice site selection during in vitro splicing reactions. Strong preference for the downstream 13S 5' splice site over the upstream 12S or 9S 5' splice sites was observed. However, the 12S 5' splice site was used efficiently when a mutant pre-mRNA lacking the 13S 5' splice site was processed, and 12S splicing from this substrate was not reduced by 13S splicing from a separate pre-mRNA, demonstrating that 13S splicing reduced 12S 5' splice site selection through a bona fide cis-competition. DEAE-cellulose chromatography of nuclear extract yielded two fractions with different splicing activities. The bound fraction contained all components required for efficient splicing of simple substrates but was unable to utilize alternative 5' splice sites. In contrast, the flow-through fraction, which by itself was inactive, contained an activity required for alternative splicing and was shown to stimulate 12S and 9S splicing, while reducing 13S splicing, when added to reactions carried out by the bound fraction. Furthermore, the activity, which we have called distal splicing factor (DSF), enhanced utilization of an upstream 5' splice site on a simian virus 40 early pre-mRNA, suggesting that the factor acts in a position-dependent, substrate-independent fashion. Several lines of evidence are presented suggesting that DSF is a non-small nuclear ribonucleoprotein protein. Finally, we describe a functional interaction between DSF and ASF, a protein that enhances use of downstream 5' splice sites. Images PMID:1658620

  11. Monoterpenoids (thymol, carvacrol and S-(+)-linalool) with anesthetic activity in silver catfish (Rhamdia quelen): evaluation of acetylcholinesterase and GABAergic activity

    PubMed Central

    Bianchini, A.E.; Garlet, Q.I.; da Cunha, J.A.; Bandeira, G.; Brusque, I.C.M.; Salbego, J.; Heinzmann, B.M.; Baldisserotto, B.

    2017-01-01

    This study evaluated the anesthetic potential of thymol and carvacrol, and their influence on acetylcholinesterase (AChE) activity in the muscle and brain of silver catfish (Rhamdia quelen). The AChE activity of S-(+)-linalool was also evaluated. We subsequently assessed the effects of thymol and S-(+)-linalool on the GABAergic system. Fish were exposed to thymol and carvacrol (25, 50, 75, and 100 mg/L) to evaluate time for anesthesia and recovery. Both compounds induced sedation at 25 mg/L and anesthesia with 50–100 mg/L. However, fish exposed to carvacrol presented strong muscle contractions and mortality. AChE activity was increased in the brain of fish at 50 mg/L carvacrol and 100 mg/L thymol, and decreased in the muscle at 100 mg/L carvacrol. S-(+)-linalool did not alter AChE activity. Anesthesia with thymol was reversed by exposure to picrotoxin (GABAA antagonist), similar to the positive control propofol, but was not reversed by flumazenil (antagonist of benzodiazepine binding site), as observed for the positive control diazepam. Picrotoxin did not reverse the effect of S-(+)-linalool. Thymol exposure at 50 mg/L is more suitable than carvacrol for anesthesia in silver catfish, because this concentration did not cause any mortality or interference with AChE activity. Thymol interacted with GABAA receptors, but not with the GABAA/benzodiazepine site. In contrast, S-(+)-linalool did not act in GABAA receptors in silver catfish. PMID:29069225

  12. Monoterpenoids (thymol, carvacrol and S-(+)-linalool) with anesthetic activity in silver catfish (Rhamdia quelen): evaluation of acetylcholinesterase and GABAergic activity.

    PubMed

    Bianchini, A E; Garlet, Q I; da Cunha, J A; Bandeira, G; Brusque, I C M; Salbego, J; Heinzmann, B M; Baldisserotto, B

    2017-10-19

    This study evaluated the anesthetic potential of thymol and carvacrol, and their influence on acetylcholinesterase (AChE) activity in the muscle and brain of silver catfish (Rhamdia quelen). The AChE activity of S-(+)-linalool was also evaluated. We subsequently assessed the effects of thymol and S-(+)-linalool on the GABAergic system. Fish were exposed to thymol and carvacrol (25, 50, 75, and 100 mg/L) to evaluate time for anesthesia and recovery. Both compounds induced sedation at 25 mg/L and anesthesia with 50-100 mg/L. However, fish exposed to carvacrol presented strong muscle contractions and mortality. AChE activity was increased in the brain of fish at 50 mg/L carvacrol and 100 mg/L thymol, and decreased in the muscle at 100 mg/L carvacrol. S-(+)-linalool did not alter AChE activity. Anesthesia with thymol was reversed by exposure to picrotoxin (GABAA antagonist), similar to the positive control propofol, but was not reversed by flumazenil (antagonist of benzodiazepine binding site), as observed for the positive control diazepam. Picrotoxin did not reverse the effect of S-(+)-linalool. Thymol exposure at 50 mg/L is more suitable than carvacrol for anesthesia in silver catfish, because this concentration did not cause any mortality or interference with AChE activity. Thymol interacted with GABAA receptors, but not with the GABAA/benzodiazepine site. In contrast, S-(+)-linalool did not act in GABAA receptors in silver catfish.

  13. Influence of different forms of acidities on soil microbiological properties and enzyme activities at an acid mine drainage contaminated site.

    PubMed

    Sahoo, Prafulla Kumar; Bhattacharyya, Pradip; Tripathy, Subhasish; Equeenuddin, Sk Md; Panigrahi, M K

    2010-07-15

    Assessment of microbial parameters, viz. microbial biomass, fluorescence diacetate, microbial respiration, acid phosphatase, beta-glucosidase and urease with respect to acidity helps in evaluating the quality of soils. This study was conducted to investigate the effects of different forms of acidities on soil microbial parameters in an acid mine drainage contaminated site around coal deposits in Jainta Hills of India. Total potential and exchangeable acidity, extractable and exchangeable aluminium were significantly higher in contaminated soil compared to the baseline (p<0.01). Different forms of acidity were significantly and positively correlated with each other (p<0.05). Further, all microbial properties were positively and significantly correlated with organic carbon and clay (p<0.05). The ratios of microbial parameters with organic carbon were negatively correlated with different forms of acidity. Principal component analysis and cluster analyses showed that the microbial activities are not directly influenced by the total potential acidity and extractable aluminium. Though acid mine drainage affected soils had higher microbial biomass and activities due to higher organic matter content than those of the baseline soils, the ratios of microbial parameters/organic carbon indicated suppression of microbial growth and activities due to acidity stress. 2010 Elsevier B.V. All rights reserved.

  14. [Effects of tree species transition on soil microbial community composition and functions in subtropical China].

    PubMed

    Ding, Guo Chang; Wang, Xiao Hua; Yang, Qi Fan; Lin, Qun Xing; Huang, Zhi Qun

    2017-11-01

    We employed a comparative study to examine the effects of tree species transition on soil microbial biomass, community composition and enzymes activities under Cunninghamia lanceolata (Lamb.) Hook, Eucalyptus grandis and a N-fixing species, Acacia melanoxylon in subtropical China. Results showed that the effect of tree species on soil microbial community and enzymes activities was significant only in the 0-10 cm soil layer. Reforestation with N-fixing species A. melanoxylon on the C. lanceolata harvest site significantly increased the total phospholipid fatty acid (PLFA), fungal PLFAs, Gram-positive bacterial PLFAs, Gram-negative bacterial PLFAs and actinomycetes biomasses in the 0-10 cm soil layer. The principal component analysis (PCA) showed that the soil microbial community composition in A. melanoxylon soil differed significantly from that in C. lanceolata and E. grandis soils. N-fixing species (A. melanoxylon) significantly enhanced the percent abundance of Gram-positive bacteria, Gram-negative bacteria and actinomycetes. Activities of cellobiohydrolase, N-acetyl-β-d-glucosaminidase and acid phosphatase were significantly higher under A. melanoxylon than under C. lanceolata and E. grandis plantations. Our results suggested that reforestation with N-fixing species, A. melanoxylon on C. lanceolata harvest site could increase soil microbial biomass, enzyme activities and soil organic matter content.

  15. Structural and Biochemical Studies of TIGAR (TP53-induced Glycolysis and Apoptosis Regulator)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, H.; Jogl, G

    2009-01-01

    Activation of the p53 tumor suppressor by cellular stress leads to variable responses ranging from growth inhibition to apoptosis. TIGAR is a novel p53-inducible gene that inhibits glycolysis by reducing cellular levels of fructose-2,6-bisphosphate, an activator of glycolysis and inhibitor of gluconeogenesis. Here we describe structural and biochemical studies of TIGAR from Danio rerio. The overall structure forms a histidine phosphatase fold with a phosphate molecule coordinated to the catalytic histidine residue and a second phosphate molecule in a position not observed in other phosphatases. The recombinant human and zebra fish enzymes hydrolyze fructose-2,6-bisphosphate as well as fructose-1,6-bisphosphate but notmore » fructose 6-phosphate in vitro. The TIGAR active site is open and positively charged, consistent with its enzymatic function as bisphosphatase. The closest related structures are the bacterial broad specificity phosphatase PhoE and the fructose-2,6-bisphosphatase domain of the bifunctional 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase. The structural comparison shows that TIGAR combines an accessible active site as observed in PhoE with a charged substrate-binding pocket as seen in the fructose-2,6-bisphosphatase domain of the bifunctional enzyme.« less

  16. DNA sequence templates adjacent nucleosome and ORC sites at gene amplification origins in Drosophila

    PubMed Central

    Liu, Jun; Zimmer, Kurt; Rusch, Douglas B.; Paranjape, Neha; Podicheti, Ram; Tang, Haixu; Calvi, Brian R.

    2015-01-01

    Eukaryotic origins of DNA replication are bound by the origin recognition complex (ORC), which scaffolds assembly of a pre-replicative complex (pre-RC) that is then activated to initiate replication. Both pre-RC assembly and activation are strongly influenced by developmental changes to the epigenome, but molecular mechanisms remain incompletely defined. We have been examining the activation of origins responsible for developmental gene amplification in Drosophila. At a specific time in oogenesis, somatic follicle cells transition from genomic replication to a locus-specific replication from six amplicon origins. Previous evidence indicated that these amplicon origins are activated by nucleosome acetylation, but how this affects origin chromatin is unknown. Here, we examine nucleosome position in follicle cells using micrococcal nuclease digestion with Ilumina sequencing. The results indicate that ORC binding sites and other essential origin sequences are nucleosome-depleted regions (NDRs). Nucleosome position at the amplicons was highly similar among developmental stages during which ORC is or is not bound, indicating that being an NDR is not sufficient to specify ORC binding. Importantly, the data suggest that nucleosomes and ORC have opposite preferences for DNA sequence and structure. We propose that nucleosome hyperacetylation promotes pre-RC assembly onto adjacent DNA sequences that are disfavored by nucleosomes but favored by ORC. PMID:26227968

  17. Structural insights into the catalytic mechanism of a family 18 exo-chitinase

    PubMed Central

    van Aalten, D. M. F.; Komander, D.; Synstad, B.; Gåseidnes, S.; Peter, M. G.; Eijsink, V. G. H.

    2001-01-01

    Chitinase B (ChiB) from Serratia marcescens is a family 18 exo-chitinase whose catalytic domain has a TIM-barrel fold with a tunnel-shaped active site. We have solved structures of three ChiB complexes that reveal details of substrate binding, substrate-assisted catalysis, and product displacement. The structure of an inactive ChiB mutant (E144Q) complexed with a pentameric substrate (binding in subsites −2 to +3) shows closure of the “roof” of the active site tunnel. It also shows that the sugar in the −1 position is distorted to a boat conformation, thus providing structural evidence in support of a previously proposed catalytic mechanism. The structures of the active enzyme complexed to allosamidin (an analogue of a proposed reaction intermediate) and of the active enzyme soaked with pentameric substrate show events after cleavage of the glycosidic bond. The latter structure shows reopening of the roof of the active site tunnel and enzyme-assisted product displacement in the +1 and +2 sites, allowing a water molecule to approach the reaction center. Catalysis is accompanied by correlated structural changes in the core of the TIM barrel that involve conserved polar residues whose functions were hitherto unknown. These changes simultaneously contribute to stabilization of the reaction intermediate and alternation of the pKa of the catalytic acid during the catalytic cycle. PMID:11481469

  18. The Role of the β5-α11 Loop in the Active-Site Dynamics of Acylated Penicillin-Binding Protein A from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fedarovich, Alena; Nicholas, Robert A.; Davies, Christopher

    Penicillin-binding protein A (PBPA) is a class B penicillin-binding protein that is important for cell division in Mycobacterium tuberculosis. We have determined a second crystal structure of PBPA in apo form and compared it with an earlier structure of apoenzyme. Significant structural differences in the active site region are apparent, including increased ordering of a β-hairpin loop and a shift of the SxN active site motif such that it now occupies a position that appears catalytically competent. Using two assays, including one that uses the intrinsic fluorescence of a tryptophan residue, we have also measured the second-order acylation rate constantsmore » for the antibiotics imipenem, penicillin G, and ceftriaxone. Of these, imipenem, which has demonstrable anti-tubercular activity, shows the highest acylation efficiency. Crystal structures of PBPA in complex with the same antibiotics were also determined, and all show conformational differences in the β5–α11 loop near the active site, but these differ for each β-lactam and also for each of the two molecules in the crystallographic asymmetric unit. Overall, these data reveal the β5–α11 loop of PBPA as a flexible region that appears important for acylation and provide further evidence that penicillin-binding proteins in apo form can occupy different conformational states.« less

  19. Salt Effect on the Antioxidant Activity of Red Microalgal Sulfated Polysaccharides in Soy-Bean Formula.

    PubMed

    Burg, Ariela; Oshrat, Levy-Ontman

    2015-10-20

    Sulfated polysaccharides produced by microalgae, which are known to exhibit various biological activities, may potentially serve as natural antioxidant sources. To date, only a few studies have examined the antioxidant bioactivity of red microalgal polysaccharides. In this research, the effect of different salts on the antioxidant activities of two red microalgal sulfated polysaccharides derived from Porphyridium sp. and Porphyridium aerugineum were studied in a soy bean-based infant milk formula. Salt composition and concentration were both shown to affect the polysaccharides' antioxidant activity. It can be postulated that the salt ions intefer with the polysaccharide chains' interactions and alter their structure, leading to a new three-dimensional structure that better exposes antiooxidant sites in comparison to the polysaccharide without salt supplement. Among the cations that were studied, Ca(2+) had the strongest enhancement effect on antioxidant activities of both polysaccharides. Understanding the effect of salts on polysaccharides' stucture, in addition to furthering knowledge on polysaccharide bioactivities, may also shed light on the position of the antioxidant active sites.

  20. Slow self-activation enhances the potency of viridin prodrugs.

    PubMed

    Blois, Joseph; Yuan, Hushan; Smith, Adam; Pacold, Michael E; Weissleder, Ralph; Cantley, Lewis C; Josephson, Lee

    2008-08-14

    When the viridin wortmannin (Wm) is modified by reaction with certain nucleophiles at the C20 position, the compounds obtained exhibit an improved antiproliferative activity even though a covalent reaction between C20 and a lysine in the active site of PI3 kinase is essential to Wm's ability to inhibit this enzyme. Here we show that this improved potency results from an intramolecular attack by the C6 hydroxyl group that slowly converts these inactive prodrugs to the active species Wm over the 48 h duration of the antiproliferative assay. Our results provide a guide for selecting Wm-like compounds to maximize kinase inhibition with the variety of protocols used to assess the role of PI3 kinase in biological systems, or for achieving optimal therapeutic effects in vivo . In addition, the slow self-activation of WmC20 derivatives provides a mechanism that can be exploited to obtain kinase inhibitors endowed with physical and pharmacokinetic properties far different from man-made kinase inhibitors because they do not bind to kinase active sites.

  1. Brain oscillations and BIS/BAS (behavioral inhibition/activation system) effects on processing masked emotional cues. ERS/ERD and coherence measures of alpha band.

    PubMed

    Balconi, Michela; Mazza, Guido

    2009-11-01

    Alpha brain oscillation modulation was analyzed in response to masked emotional facial expressions. In addition, behavioural activation (BAS) and behavioural inhibition systems (BIS) were considered as an explicative factor to verify the effect of motivational significance on cortical activity. Nineteen subjects were submitted to an ample range of facial expressions of emotions (anger, fear, surprise, disgust, happiness, sadness, and neutral). The results demonstrated that anterior frontal sites were more active than central and posterior sites in response to facial stimuli. Moreover, right-side responses varied as a function of emotional types, with an increased right-frontal activity for negative emotions. Finally, whereas higher BIS subjects generated a more right hemisphere activation for some negative emotions (such as fear, anger, and surprise), Reward-BAS subjects were more responsive to positive emotion (happiness) within the left hemisphere. Valence and potential threatening power of facial expressions were considered to elucidate these cortical differences.

  2. Multifaceted roles of Lys166 of ribulose-bisphosphate carboxylase/oxygenase as discerned by product analysis and chemical rescue of site-directed mutants.

    PubMed

    Harpel, Mark R; Larimer, Frank W; Hartman, Fred C

    2002-01-29

    Ab initio calculations [King, W. A., et al. (1998) Biochemistry 37, 15414-15422] of an active-site mimic of D-ribulose-1,5-bisphosphate carboxylase/oxygenase suggest that active-site Lys166 plays a role in carboxylation in addition to its functions in the initial deprotonation and final protonation steps. To test this postulate, the turnover of 1-(3)H-labeled D-ribulose 1,5-bisphosphate (RuBP) by impaired position-166 mutants was characterized. Although these mutants catalyze slow enolization of RuBP, most of the RuBP-enediol undergoes beta-elimination of phosphate to form 2,3-pentodiulose 5-phosphate, signifying deficiencies in normal carboxylation and oxygenation. Much of the remaining RuBP-enediol is carboxylated but forms pyruvate, rather than 3-phospho-D-glycerate, due to incapacity in protonation of the terminal aci-acid intermediate. As a further test of the postulate, the effects of subtle perturbation of the Lys166 side chain on the carboxylation/oxygenation partitioning ratio (tau) were determined. To eliminate a chemically reactive site, Cys58 was replaced by a seryl residue without any loss of activity. The virtually inactive K166C-C58S double mutant was chemically rescued by aminoethylation or aminopropylation to reinsert a lysyl-like side chain at position 166. Relative to the wild-type value, tau for the aminoethylated enzyme was increased by approximately 30%, and tau for the aminopropylated enzyme was decreased by approximately 80%. Thus, two lines of experimentation support the theoretically based conclusion for the importance of Lys166 in the reaction of RuBP-enediol with gaseous substrates.

  3. Viability and Burden of Leishmania in Extralesional Sites during Human Dermal Leishmaniasis

    PubMed Central

    Romero, Ibeth; Téllez, Jair; Suárez, Yazmín; Cardona, Maria; Figueroa, Roger; Zelazny, Adrian; Gore Saravia, Nancy

    2010-01-01

    Background The clinical and epidemiological significance of Leishmania DNA in extralesional sites is obscured by uncertainty of whether the DNA derives from viable parasites. To examine dissemination of Leishmania during active disease and the potential participation of human infection in transmission, Leishmania 7SLRNA was exploited to establish viability and estimate parasite burden in extralesional sites of dermal leishmaniasis patients. Methods The feasibility of discriminating parasite viability by PCR of Leishmania 7SLRNA was evaluated in relation with luciferase activity of luc transfected intracellular amastigotes in dose-response assays of Glucantime cytotoxicity. Monocytes, tonsil swabs, aspirates of normal skin and lesions of 28 cutaneous and 2 mucocutaneous leishmaniasis patients were screened by kDNA amplification/Southern blot. Positive samples were analyzed by quantitative PCR of Leishmania 7SLRNA genes and transcripts. Results 7SLRNA amplification coincided with luciferase activity, confirming discrimination of parasite viability. Of 22 patients presenting kDNA in extralesional samples, Leishmania 7SLRNA genes or transcripts were detected in one or more kDNA positive samples in 100% and 73% of patients, respectively. Gene and transcript copy number amplified from extralesional tissues were comparable to lesions. 7SLRNA transcripts were detected in 13/19 (68%) monocyte samples, 5/12 (42%) tonsil swabs, 4/11 (36%) normal skin aspirates, and 22/25 (88%) lesions; genes were quantifiable in 15/19 (79%) monocyte samples, 12/13 (92%) tonsil swabs, 8/11 (73%) normal skin aspirates. Conclusion Viable parasites are present in extralesional sites, including blood monocytes, tonsils and normal skin of dermal leishmaniasis patients. Leishmania 7SLRNA is an informative target for clinical and epidemiologic investigations of human leishmaniasis. PMID:20856851

  4. Solution structure of the parvulin-type PPIase domain of Staphylococcus aureus PrsA – Implications for the catalytic mechanism of parvulins

    PubMed Central

    Heikkinen, Outi; Seppala, Raili; Tossavainen, Helena; Heikkinen, Sami; Koskela, Harri; Permi, Perttu; Kilpeläinen, Ilkka

    2009-01-01

    Background Staphylococcus aureus is a Gram-positive pathogenic bacterium causing many kinds of infections from mild respiratory tract infections to life-threatening states as sepsis. Recent emergence of S. aureus strains resistant to numerous antibiotics has created a need for new antimicrobial agents and novel drug targets. S. aureus PrsA is a membrane associated extra-cytoplasmic lipoprotein which contains a parvulin-type peptidyl-prolyl cis-trans isomerase domain. PrsA is known to act as an essential folding factor for secreted proteins in Gram-positive bacteria and thus it is a potential target for antimicrobial drugs against S. aureus. Results We have solved a high-resolution solution structure of the parvulin-type peptidyl-prolyl cis-trans isomerase domain of S. aureus PrsA (PrsA-PPIase). The results of substrate peptide titrations pinpoint the active site and demonstrate the substrate preference of the enzyme. With detailed NMR spectroscopic investigation of the orientation and tautomeric state of the active site histidines we are able to give further insight into the structure of the catalytic site. NMR relaxation analysis gives information on the dynamic behaviour of PrsA-PPIase. Conclusion Detailed structural description of the S. aureus PrsA-PPIase lays the foundation for structure-based design of enzyme inhibitors. The structure resembles hPin1-type parvulins both structurally and regarding substrate preference. Even though a wealth of structural data is available on parvulins, the catalytic mechanism has yet to be resolved. The structure of S. aureus PrsA-PPIase and our findings on the role of the conserved active site histidines help in designing further experiments to solve the detailed catalytic mechanism. PMID:19309529

  5. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin

    PubMed Central

    Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.

    2007-01-01

    DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217

  6. Chemotactic Activity of Cyclophilin A in the Skin Mucus of Yellow Catfish (Pelteobagrus fulvidraco) and Its Active Site for Chemotaxis

    PubMed Central

    Dawar, Farman Ullah; Tu, Jiagang; Xiong, Yang; Lan, Jiangfeng; Dong, Xing Xing; Liu, Xiaoling; Khattak, Muhammad Nasir Khan; Mei, Jie; Lin, Li

    2016-01-01

    Fish skin mucus is a dynamic barrier for invading pathogens with a variety of anti-microbial enzymes, including cyclophilin A (CypA), a multi-functional protein with peptidyl-prolyl cis/trans isomerase (PPIase) activity. Beside various other immunological functions, CypA induces leucocytes migration in vitro in teleost. In the current study, we have discovered several novel immune-relevant proteins in yellow catfish skin mucus by mass spectrometry (MS). The CypA present among them was further detected by Western blot. Moreover, the CypA present in the skin mucus displayed strong chemotactic activity for yellow catfish leucocytes. Interestingly, asparagine (like arginine in mammals) at position 69 was the critical site in yellow catfish CypA involved in leucocyte attraction. These novel efforts do not only highlight the enzymatic texture of skin mucus, but signify CypA to be targeted for anti-inflammatory therapeutics. PMID:27589721

  7. A mini-library of TBA analogues containing 3'-3' and 5'-5' inversion of polarity sites.

    PubMed

    Esposito, V; Galeone, A; Mayol, L; Randazzo, A; Virgilio, A; Virno, A

    2007-01-01

    Several researches have been devoted to structure-activity relationship and to post-SELEX modifications of the thrombin binding aptamer (TBA), one of the first aptamers discovered by the SELEX methodology. However, no studies on TBA dealing with the effects of introduction of inversion of polarity sites have been reported yet. In this frame, we have undertaken the synthesis and the study of a mini-library composed of several TBA analogues containing a 3'-3' or a 5'-5' inversion of polarity site at different positions into the sequence. Particularly, in this article, we present preliminary results about their structural and biological properties.

  8. Combinatorial activation and concentration-dependent repression of the Drosophila even skipped stripe 3+7 enhancer

    PubMed Central

    Struffi, Paolo; Corado, Maria; Kaplan, Leah; Yu, Danyang; Rushlow, Christine; Small, Stephen

    2011-01-01

    Despite years of study, the precise mechanisms that control position-specific gene expression during development are not understood. Here, we analyze an enhancer element from the even skipped (eve) gene, which activates and positions two stripes of expression (stripes 3 and 7) in blastoderm stage Drosophila embryos. Previous genetic studies showed that the JAK-STAT pathway is required for full activation of the enhancer, whereas the gap genes hunchback (hb) and knirps (kni) are required for placement of the boundaries of both stripes. We show that the maternal zinc-finger protein Zelda (Zld) is absolutely required for activation, and present evidence that Zld binds to multiple non-canonical sites. We also use a combination of in vitro binding experiments and bioinformatics analysis to redefine the Kni-binding motif, and mutational analysis and in vivo tests to show that Kni and Hb are dedicated repressors that function by direct DNA binding. These experiments significantly extend our understanding of how the eve enhancer integrates positive and negative transcriptional activities to generate sharp boundaries in the early embryo. PMID:21865322

  9. Spectroscopic and computational insight into the activation of O2 by the mononuclear Cu center in polysaccharide monooxygenases.

    PubMed

    Kjaergaard, Christian H; Qayyum, Munzarin F; Wong, Shaun D; Xu, Feng; Hemsworth, Glyn R; Walton, Daniel J; Young, Nigel A; Davies, Gideon J; Walton, Paul H; Johansen, Katja Salomon; Hodgson, Keith O; Hedman, Britt; Solomon, Edward I

    2014-06-17

    Strategies for O2 activation by copper enzymes were recently expanded to include mononuclear Cu sites, with the discovery of the copper-dependent polysaccharide monooxygenases, also classified as auxiliary-activity enzymes 9-11 (AA9-11). These enzymes are finding considerable use in industrial biofuel production. Crystal structures of polysaccharide monooxygenases have emerged, but experimental studies are yet to determine the solution structure of the Cu site and how this relates to reactivity. From X-ray absorption near edge structure and extended X-ray absorption fine structure spectroscopies, we observed a change from four-coordinate Cu(II) to three-coordinate Cu(I) of the active site in solution, where three protein-derived nitrogen ligands coordinate the Cu in both redox states, and a labile hydroxide ligand is lost upon reduction. The spectroscopic data allowed for density functional theory calculations of an enzyme active site model, where the optimized Cu(I) and (II) structures were consistent with the experimental data. The O2 reactivity of the Cu(I) site was probed by EPR and stopped-flow absorption spectroscopies, and a rapid one-electron reduction of O2 and regeneration of the resting Cu(II) enzyme were observed. This reactivity was evaluated computationally, and by calibration to Cu-superoxide model complexes, formation of an end-on Cu-AA9-superoxide species was found to be thermodynamically favored. We discuss how this thermodynamically difficult one-electron reduction of O2 is enabled by the unique protein structure where two nitrogen ligands from His1 dictate formation of a T-shaped Cu(I) site, which provides an open coordination position for strong O2 binding with very little reorganization energy.

  10. Excavation of red squirrel middens by grizzly bears in the whitebark pine zone

    USGS Publications Warehouse

    Mattson, D.J.; Reinhart, Daniel P.

    1997-01-01

    Whitebark pine seeds Pinus albicaulis are an important food of grizzly Ursus arctos horribilis bears wherever whitebark pine is abundant in the contiguous United States of America; availability of seeds affects the distribution of bears, and the level of conflict between bears and humans. Almost all of the seeds consumed by bears are excavated from middens where red squirrels Tamiasciurus hudsonicus have cached whitebark pine cones.Relationships among the occupancy of middens by squirrels, the excavation of middens by bears, and site features were investigated in this study. Data were collected from radio-marked bears and from middens located from line transects on two study sites in the Yellowstone ecosystem.Densities of active middens were positively related to lodgepole pine Pinus contorta basal area and negatively related to steepness of slope.The probability that a midden was occupied by a squirrel (i.e. active) was positively related to lodgepole pine basal area in the surrounding stand, size of the midden and size of the whitebark pine cone crop, and negatively related to elevation and to bear excavation during the previous 2-12 months.The probability that a midden had been excavated by a bear during the previous 12 months was positively related to size of the midden, and to whitebark pine basal area and cone crop, and negatively related to nearness of roads and town sites.The influence of midden size on bear use was attributable to a positive relationship with the number of excavated cones. The positive association between bear excavations and whitebark pine basal area or cone crops was attributable to availability of pine seeds.Grizzly bears would benefit from the minimization of roads and other human facilities in the whitebark pine zone and from increases in the availability of whitebark pine seeds, potentially achieved by increasing the numbers of cone-producing whitebark pine trees, especially in lower elevations of the whitebark pine zone where red squirrels are more abundant.

  11. Competitive binding experiments can reduce the false positive results of affinity-based ultrafiltration-HPLC: A case study for identification of potent xanthine oxidase inhibitors from Perilla frutescens extract.

    PubMed

    Wang, Zhiqiang; Kwon, Shin Hwa; Hwang, Seung Hwan; Kang, Young-Hee; Lee, Jae-Yong; Lim, Soon Sung

    2017-03-24

    The purpose of this study was to assess the possibility of using competitive binding experiments with ultrafiltration-HPLC analysis to identify potent xanthine oxidase (XO) inhibitors from the Perilla frutescens extract as an attempt to reduce the number of false positive results. To isolate the enzyme-ligand complex from unbound compounds, the P. frutescens extract was either incubated in the absence of XO, in the presence of XO, or with the active site blocked XO before the ultrafiltration was performed. Allopurinaol was used as the XO active site blocker. The unbound compounds were subjected to HPLC analysis. The degree of total binding (TBD) and degree of specific binding (SBD) of each compound were calculated using the peak areas. TBD represents the binding affinities of compounds from the P. frutescens extract for the XO binding site. SBD represents the XO competitive binding between allopurinol and ligands from the extract samples. Two criteria were applied to select putative targets that could help avoid false positives. These include TBD>30% and SBD>10%. Using that approach, kaempferol-3-O-rutinoside, rosmarinic acid, methyl-rosmarinic acid, apigenin, and 4',5,7-trimethoxyflavone were identified, from total 11 compounds, as potent XO inhibitors. Finally, apigenin, 4',5,7-trimethoxyflavone, and luteolin were XO inhibitors verified through an XO inhibition assay and structural simulation of the complex. These results showed that the newly developed strategy has the advantage that the number of targets identified via ultrafiltration-HPLC can be narrowed from many false positives. However, not all false positives can be eliminated with this approach. Some potent inhibitors might also be excluded with the use of this method. The limitations of this method are also discussed herein. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. HPV Prevalence in Multiple Anatomical Sites among Men Who Have Sex with Men in Peru

    PubMed Central

    Blas, Magaly M.; Brown, Brandon; Menacho, Luis; Alva, Isaac E.; Silva-Santisteban, Alfonso; Carcamo, Cesar

    2015-01-01

    Background Human Papilloma Virus (HPV) infection is the most common sexually transmitted viral infection worldwide. HPV is highly prevalent in sexually active men who have sex with men (MSM) and has been associated with anal cancer, penile cancer, and oropharyngeal cancer. Methods From March to September 2011, we conducted a cross-sectional study of HPV prevalence among MSM above age 18 years. Participants were recruited using respondent driven sampling at Clinica Cayetano Heredia. All participants provided anal, genital, and oral samples for HPV DNA testing, and blood for HIV and HPV antibody testing. Results A total of 200 MSM were recruited in the study. The mean age was 34 years (range 18–59 years, SD = 9.4) and101 participants were HIV negative (99 HIV positive). HPV 6/11/16/18 or quadrivalent HPV vaccine (HPV4) genotype seroprevalence among HIV negative and positive MSM was 64.3% (55%-75.9%) and 93.8% (87.6%-99.2%) respectively (p<0.001). HIV positivity was associated with a higher prevalence of HPV4 and HPV 16/18 DNA at external genital sites and the anal canal. HPV4 DNA prevalence at external genital sites among HIV negative and positive MSM was 14.9% and 28.7% (p = 0.02) respectively, at anal canal was 50.9% and 79.0% (p = 0.001), and at the oral cavity was 9.9% and 8.5% (p = 0.6). Conclusions HPV4 seroprevalence was high in our study among both HIV positives and negatives, with HPV DNA prevalence much lower, and the anal canal being the anatomical site with the highest HPV DNA prevalence. HPV prevention interventions are needed among MSM at high-risk for HIV infection. PMID:26437318

  13. HPV Prevalence in Multiple Anatomical Sites among Men Who Have Sex with Men in Peru.

    PubMed

    Blas, Magaly M; Brown, Brandon; Menacho, Luis; Alva, Isaac E; Silva-Santisteban, Alfonso; Carcamo, Cesar

    2015-01-01

    Human Papilloma Virus (HPV) infection is the most common sexually transmitted viral infection worldwide. HPV is highly prevalent in sexually active men who have sex with men (MSM) and has been associated with anal cancer, penile cancer, and oropharyngeal cancer. From March to September 2011, we conducted a cross-sectional study of HPV prevalence among MSM above age 18 years. Participants were recruited using respondent driven sampling at Clinica Cayetano Heredia. All participants provided anal, genital, and oral samples for HPV DNA testing, and blood for HIV and HPV antibody testing. A total of 200 MSM were recruited in the study. The mean age was 34 years (range 18-59 years, SD = 9.4) and101 participants were HIV negative (99 HIV positive). HPV 6/11/16/18 or quadrivalent HPV vaccine (HPV4) genotype seroprevalence among HIV negative and positive MSM was 64.3% (55%-75.9%) and 93.8% (87.6%-99.2%) respectively (p<0.001). HIV positivity was associated with a higher prevalence of HPV4 and HPV 16/18 DNA at external genital sites and the anal canal. HPV4 DNA prevalence at external genital sites among HIV negative and positive MSM was 14.9% and 28.7% (p = 0.02) respectively, at anal canal was 50.9% and 79.0% (p = 0.001), and at the oral cavity was 9.9% and 8.5% (p = 0.6). HPV4 seroprevalence was high in our study among both HIV positives and negatives, with HPV DNA prevalence much lower, and the anal canal being the anatomical site with the highest HPV DNA prevalence. HPV prevention interventions are needed among MSM at high-risk for HIV infection.

  14. Mutational analysis of the antigenomic trans-acting delta ribozyme: the alterations of the middle nucleotides located on the P1 stem.

    PubMed Central

    Ananvoranich, S; Lafontaine, D A; Perreault, J P

    1999-01-01

    Our previous report on delta ribozyme cleavage using a trans -acting antigenomic delta ribozyme and a collection of short substrates showed that the middle nucleotides of the P1 stem, the substrate binding site, are essential for the cleavage activity. Here we have further investigated the effect of alterations in the P1 stem on the kinetic and thermodynamic parameters of delta ribozyme cleavage using various ribozyme variants carrying single base mutations at putative positions reported. The kinetic and thermodynamic values obtained in mutational studies of the two middle nucleotides of the P1 stem suggest that the binding and active sites of the delta ribozyme are uniquely formed. Firstly, the substrate and the ribozyme are engaged in the formation of a helix, known as the P1 stem, which may contain a weak hydrogen bond(s) or a bulge. Secondly, a tertiary interaction involving the base moieties in the middle of the P1 stem likely plays a role in defining the chemical environment. As a con-sequence, the active site might form simultaneously or subsequently to the binding site during later steps of the pathway. PMID:10037808

  15. The Nudix Hydrolase CDP-Chase, a CDP-Choline Pyrophosphatase, Is an Asymmetric Dimer with Two Distinct Enzymatic Activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duong-Ly, Krisna C.; Gabelli, Sandra B.; Xu, WenLian

    2011-09-06

    A Nudix enzyme from Bacillus cereus catalyzes the hydrolysis of CDP-choline to produce CMP and phosphocholine. Here, we show that in addition, the enzyme has a 3{prime} {yields} 5{prime} RNA exonuclease activity. The structure of the free enzyme, determined to a 1.8-{angstrom} resolution, shows that the enzyme is an asymmetric dimer. Each monomer consists of two domains, an N-terminal helical domain and a C-terminal Nudix domain. The N-terminal domain is placed relative to the C-terminal domain such as to result in an overall asymmetric arrangement with two distinct catalytic sites: one with an 'enclosed' Nudix pyrophosphatase site and the othermore » with a more open, less-defined cavity. Residues that may be important for determining the asymmetry are conserved among a group of uncharacterized Nudix enzymes from Gram-positive bacteria. Our data support a model where CDP-choline hydrolysis is catalyzed by the enclosed Nudix site and RNA exonuclease activity is catalyzed by the open site. CDP-Chase is the first identified member of a novel Nudix family in which structural asymmetry has a profound effect on the recognition of substrates.« less

  16. Activation of Escherichia coli antiterminator BglG requires its phosphorylation

    PubMed Central

    Rothe, Fabian M.; Bahr, Thomas; Stülke, Jörg; Rak, Bodo; Görke, Boris

    2012-01-01

    Transcriptional antiterminator proteins of the BglG family control the expression of enzyme II (EII) carbohydrate transporters of the bacterial phosphotransferase system (PTS). In the PTS, phosphoryl groups are transferred from phosphoenolpyruvate (PEP) via the phosphotransferases enzyme I (EI) and HPr to the EIIs, which phosphorylate their substrates during transport. Activity of the antiterminators is negatively controlled by reversible phosphorylation catalyzed by the cognate EIIs in response to substrate availability and positively controlled by the PTS. For the Escherichia coli BglG antiterminator, two different mechanisms for activation by the PTS were proposed. According to the first model, BglG is activated by HPr-catalyzed phosphorylation at a site distinct from the EII-dependent phosphorylation site. According to the second model, BglG is not activated by phosphorylation, but solely through interaction with EI and HPr, which are localized at the cell pole. Subsequently BglG is released from the cell pole to the cytoplasm as an active dimer. Here we addressed this discrepancy and found that activation of BglG requires phosphorylatable HPr or the HPr homolog FruB in vivo. Further, we uniquely demonstrate that purified BglG protein becomes phosphorylated by FruB as well as by HPr in vitro. Histidine residue 208 in BglG is essential for this phosphorylation. These data suggest that BglG is in fact activated by phosphorylation and that there is no principal difference between the PTS-exerted mechanisms controlling the activities of BglG family proteins in Gram-positive and Gram-negative bacteria. PMID:22984181

  17. Lymphotoxin activation by human T-cell leukemia virus type I-infected cell lines: role for NF-kappa B.

    PubMed

    Paul, N L; Lenardo, M J; Novak, K D; Sarr, T; Tang, W L; Ruddle, N H

    1990-11-01

    Human T-cell leukemia virus type I (HTLV-I)-infected T-cell lines constitutively produce high levels of biologically active lymphotoxin (LT; tumor necrosis factor-beta) protein and LT mRNA. To understand the regulation of LT transcription by HTLV-I, we analyzed the ability of a series of deletions of the LT promoter to drive the chloramphenicol acetyltransferase (CAT) reporter gene in HTLV-I-positive MT-2 cells. The smallest LT promoter fragment (-140 to +77) that was able to drive CAT activity contained a site that was similar to the immunoglobulin kappa-chain NF-kappa B-binding site. Since the HTLV-I tax gene activates the nuclear form of NF-kappa B, this finding suggested a possible means of HTLV-I activation of LT production. We found that the LT kappa B-like site specifically formed a complex with NF-kappa B-containing nuclear extract from MT-2, C81-66-45, and other activated T cells. Mutation of the LT kappa B site in the context of the LT promoter (-293 to +77) (mutant M1) reduced the ability of the promoter to drive the CAT gene in HTLV-I-infected and noninfected human T-cell lines. These data suggest a general role for NF-kappa B activation in the induction of LT gene transcription. Activation of LT in HTLV-I-infected cells may explain the pathology associated with HTLV-I infection, including the hypercalcemia that is prevalent in adult T-cell leukemia.

  18. Lymphotoxin activation by human T-cell leukemia virus type I-infected cell lines: role for NF-kappa B.

    PubMed Central

    Paul, N L; Lenardo, M J; Novak, K D; Sarr, T; Tang, W L; Ruddle, N H

    1990-01-01

    Human T-cell leukemia virus type I (HTLV-I)-infected T-cell lines constitutively produce high levels of biologically active lymphotoxin (LT; tumor necrosis factor-beta) protein and LT mRNA. To understand the regulation of LT transcription by HTLV-I, we analyzed the ability of a series of deletions of the LT promoter to drive the chloramphenicol acetyltransferase (CAT) reporter gene in HTLV-I-positive MT-2 cells. The smallest LT promoter fragment (-140 to +77) that was able to drive CAT activity contained a site that was similar to the immunoglobulin kappa-chain NF-kappa B-binding site. Since the HTLV-I tax gene activates the nuclear form of NF-kappa B, this finding suggested a possible means of HTLV-I activation of LT production. We found that the LT kappa B-like site specifically formed a complex with NF-kappa B-containing nuclear extract from MT-2, C81-66-45, and other activated T cells. Mutation of the LT kappa B site in the context of the LT promoter (-293 to +77) (mutant M1) reduced the ability of the promoter to drive the CAT gene in HTLV-I-infected and noninfected human T-cell lines. These data suggest a general role for NF-kappa B activation in the induction of LT gene transcription. Activation of LT in HTLV-I-infected cells may explain the pathology associated with HTLV-I infection, including the hypercalcemia that is prevalent in adult T-cell leukemia. Images PMID:1976820

  19. Structure-Based Alteration of Substrate Specificity and Catalytic Activity of Sulfite Oxidase from Sulfite Oxidation to Nitrate Reduction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qiu, James A.; Wilson, Heather L.; Rajagopalan, K.V.

    Eukaryotic sulfite oxidase is a dimeric protein that contains the molybdenum cofactor and catalyzes the metabolically essential conversion of sulfite to sulfate as the terminal step in the metabolism of cysteine and methionine. Nitrate reductase is an evolutionarily related molybdoprotein in lower organisms that is essential for growth on nitrate. In this study, we describe human and chicken sulfite oxidase variants in which the active site has been modified to alter substrate specificity and activity from sulfite oxidation to nitrate reduction. On the basis of sequence alignments and the known crystal structure of chicken sulfite oxidase, two residues are conservedmore » in nitrate reductases that align with residues in the active site of sulfite oxidase. On the basis of the crystal structure of yeast nitrate reductase, both positions were mutated in human sulfite oxidase and chicken sulfite oxidase. The resulting double-mutant variants demonstrated a marked decrease in sulfite oxidase activity but gained nitrate reductase activity. An additional methionine residue in the active site was proposed to be important in nitrate catalysis, and therefore, the triple variant was also produced. The nitrate reducing ability of the human sulfite oxidase triple mutant was nearly 3-fold greater than that of the double mutant. To obtain detailed structural data for the active site of these variants, we introduced the analogous mutations into chicken sulfite oxidase to perform crystallographic analysis. The crystal structures of the Mo domains of the double and triple mutants were determined to 2.4 and 2.1 {angstrom} resolution, respectively.« less

  20. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  1. Insulator protein Su(Hw) recruits SAGA and Brahma complexes and constitutes part of Origin Recognition Complex-binding sites in the Drosophila genome

    PubMed Central

    Vorobyeva, Nadezhda E.; Mazina, Marina U.; Golovnin, Anton K.; Kopytova, Daria V.; Gurskiy, Dmitriy Y.; Nabirochkina, Elena N.; Georgieva, Sofia G.; Georgiev, Pavel G.; Krasnov, Aleksey N.

    2013-01-01

    Despite increasing data on the properties of replication origins, molecular mechanisms underlying origin recognition complex (ORC) positioning in the genome are still poorly understood. The Su(Hw) protein accounts for the activity of best-studied Drosophila insulators. Here, we show that Su(Hw) recruits the histone acetyltransferase complex SAGA and chromatin remodeler Brahma to Su(Hw)-dependent insulators, which gives rise to regions with low nucleosome density and creates conditions for ORC binding. Depletion in Su(Hw) leads to a dramatic drop in the levels of SAGA, Brahma and ORC subunits and a significant increase in nucleosome density on Su(Hw)-dependent insulators, whereas artificial Su(Hw) recruitment itself is sufficient for subsequent SAGA, Brahma and ORC binding. In contrast to the majority of replication origins that associate with promoters of active genes, Su(Hw)-binding sites constitute a small proportion (6%) of ORC-binding sites that are localized preferentially in transcriptionally inactive chromatin regions termed BLACK and BLUE chromatin. We suggest that the key determinants of ORC positioning in the genome are DNA-binding proteins that constitute different DNA regulatory elements, including insulators, promoters and enhancers. Su(Hw) is the first example of such a protein. PMID:23609538

  2. DFT predictions, synthesis, stoichiometric structures and anti-diabetic activity of Cu (II) and Fe (III) complexes of quercetin, morin, and primuletin

    NASA Astrophysics Data System (ADS)

    Jabeen, Erum; Janjua, Naveed Kausar; Ahmed, Safeer; Murtaza, Iram; Ali, Tahir; Masood, Nosheen; Rizvi, Aysha Sarfraz; Murtaza, Gulam

    2017-12-01

    The current study is aimed at the synthesis of Cu (II) and Fe (III) complexes of three flavonoids {morin (mor), quercetin (quer) and primuletin (prim)} and characterization through UV-Vis spectroscopy, cyclic voltammetry, FTIR, and thermal analysis. Structure prediction through DFT calculation was supported by experimental data. Benesi-Hildebrand equation was modified to function for 1:2 Cu-flavonoid and 1:3 Fe-flavonoid complexes. DFT predictions revealed that out of poly chelation sites present in morin and quercetin, 3-OH site was utilized as preferable chelation site while primuletin chelated through 5-OH position. In-vivo trials revealed the complexes to have better anti-diabetic potential than respective flavonoid. Fls/M-Fls proved as antagonistic to Alloxan induced diabetes and also retained anti-diabetic activity even in the presence of (2-hydroxypropyl)-β-cyclodextrin (HPβCD).

  3. Two Active Site Divalent Ions in the Crystal Structure of the Hammerhead Ribozyme Bound to a Transition State Analogue.

    PubMed

    Mir, Aamir; Golden, Barbara L

    2016-02-02

    The crystal structure of the hammerhead ribozyme bound to the pentavalent transition state analogue vanadate reveals significant rearrangements relative to the previously determined structures. The active site contracts, bringing G10.1 closer to the cleavage site and repositioning a divalent metal ion such that it could, ultimately, interact directly with the scissile phosphate. This ion could also position a water molecule to serve as a general acid in the cleavage reaction. A second divalent ion is observed coordinated to O6 of G12. This metal ion is well-placed to help tune the pKA of G12. On the basis of this crystal structure as well as a wealth of biochemical studies, we propose a mechanism in which G12 serves as the general base and a magnesium-bound water serves as a general acid.

  4. Two active site divalent ions in the crystal structure of the hammerhead ribozyme bound to a transition state analogue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mir, Aamir; Golden, Barbara L.

    2015-11-09

    The crystal structure of the hammerhead ribozyme bound to the pentavalent transition state analogue vanadate reveals significant rearrangements relative to the previously determined structures. The active site contracts, bringing G10.1 closer to the cleavage site and repositioning a divalent metal ion such that it could, ultimately, interact directly with the scissile phosphate. This ion could also position a water molecule to serve as a general acid in the cleavage reaction. A second divalent ion is observed coordinated to O6 of G12. This metal ion is well-placed to help tune the p K A of G12. Finally, on the basis ofmore » this crystal structure as well as a wealth of biochemical studies, in this paper we propose a mechanism in which G12 serves as the general base and a magnesium-bound water serves as a general acid.« less

  5. De Novo Genome Project for the Aromatic Degrader Rhodococcus pyridinivorans Strain AK37

    PubMed Central

    Kriszt, Balázs; Táncsics, András; Cserháti, Mátyás; Tóth, Ákos; Nagy, István; Horváth, Balázs; Nagy, István; Tamura, Tomohiro; Szoboszlay, Sándor

    2012-01-01

    Here, we present the complete genome sequence of Rhodococcus pyridinivorans AK37 strain NCAIM PB1376, which was isolated from an oil-polluted site in Hungary. R. pyridinivorans AK37 is an aerobic, nonsporulating, nonmotile, Gram-positive bacterium with remarkable aromatic-decomposing activity. PMID:22328750

  6. Geocaching: 21st-Century Hide-and-Seek

    ERIC Educational Resources Information Center

    Schlatter, Barbara Elwood; Hurd, Amy R.

    2005-01-01

    Looking for a new adventure that combines technology and physical activity with nature? Try geocaching (pronounced geocashing)! Geocachers use Global Positioning System (GPS) receivers and satellite data to search and find hidden treasures (or caches) around the world. Enthusiasts visit web sites (e.g., www.geocaching.com) to discover the…

  7. The Impact of Social Media on College Students

    ERIC Educational Resources Information Center

    Mastrodicasa, Jeanna; Metellus, Paul

    2013-01-01

    There are numerous ways, positive and negative, in which social media impact college students. Understanding sheer volume of time and the type of activities for which college students use social networking sites is crucial for higher education administrators. Researchers have begun to empirically examine impacts on students' well-being and have…

  8. The crystal structure of Erwinia amylovora levansucrase provides a snapshot of the products of sucrose hydrolysis trapped into the active site.

    PubMed

    Wuerges, Jochen; Caputi, Lorenzo; Cianci, Michele; Boivin, Stephane; Meijers, Rob; Benini, Stefano

    2015-09-01

    Levansucrases are members of the glycoside hydrolase family and catalyse both the hydrolysis of the substrate sucrose and the transfer of fructosyl units to acceptor molecules. In the presence of sufficient sucrose, this may either lead to the production of fructooligosaccharides or fructose polymers. Aim of this study is to rationalise the differences in the polymerisation properties of bacterial levansucrases and in particular to identify structural features that determine different product spectrum in the levansucrase of the Gram-negative bacterium Erwinia amylovora (Ea Lsc, EC 2.4.1.10) as compared to Gram-positive bacteria such as Bacillus subtilis levansucrase. Ea is an enterobacterial pathogen responsible for the Fire Blight disease in rosaceous plants (e.g., apple and pear) with considerable interest for the agricultural industry. The crystal structure of Ea Lsc was solved at 2.77 Å resolution and compared to those of other fructosyltransferases from Gram-positive and Gram-negative bacteria. We propose the structural features, determining the different reaction products, to reside in just a few loops at the rim of the active site funnel. Moreover we propose that loop 8 may have a role in product length determination in Gluconacetobacter diazotrophicus LsdA and Microbacterium saccharophilum FFase. The Ea Lsc structure shows for the first time the products of sucrose hydrolysis still bound in the active site. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Combined Use of Residual Dipolar Couplings and Solution X-ray Scattering To Rapidly Probe Rigid-Body Conformational Transitions in a Non-phosphorylatable Active-Site Mutant of the 128 kDa Enzyme I Dimer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takayama, Yuki; Schwieters, Charles D.; Grishaev, Alexander

    2012-10-23

    The first component of the bacterial phosphotransferase system, enzyme I (EI), is a multidomain 128 kDa dimer that undergoes large rigid-body conformational transitions during the course of its catalytic cycle. Here we investigate the solution structure of a non-phosphorylatable active-site mutant in which the active-site histidine is substituted by glutamine. We show that perturbations in the relative orientations and positions of the domains and subdomains can be rapidly and reliably determined by conjoined rigid-body/torsion angle/Cartesian simulated annealing calculations driven by orientational restraints from residual dipolar couplings and shape and translation information afforded by small- and wide-angle X-ray scattering. Although histidinemore » and glutamine are isosteric, the conformational space available to a Gln side chain is larger than that for the imidazole ring of His. An additional hydrogen bond between the side chain of Gln189 located on the EIN{sup {alpha}/{beta}} subdomain and an aspartate (Asp129) on the EIN{sup {alpha}} subdomain results in a small ({approx}9{sup o}) reorientation of the EIN{sup {alpha}} and EIN{sup {alpha}/{beta}} subdomains that is in turn propagated to a larger reorientation ({approx}26{sup o}) of the EIN domain relative to the EIC dimerization domain, illustrating the positional sensitivity of the EIN domain and its constituent subdomains to small structural perturbations.« less

  10. Structural analyses of human thymidylate synthase reveal a site that may control conformational switching between active and inactive states.

    PubMed

    Chen, Dan; Jansson, Anna; Sim, Daniel; Larsson, Andreas; Nordlund, Pär

    2017-08-11

    Thymidylate synthase (TS) is the sole enzyme responsible for de novo biosynthesis of thymidylate (TMP) and is essential for cell proliferation and survival. Inhibition of human TS (hTS) has been extensively investigated for cancer chemotherapy, but several aspects of its activity and regulation are still uncertain. In this study, we performed comprehensive structural and biophysical studies of hTS using crystallography and thermal shift assay and provided the first detailed structural information on the conformational changes induced by ligand binding to the hTS active site. We found that upon binding of the antifolate agents raltitrexed and nolatrexed, the two insert regions in hTS, the functions of which are unclear, undergo positional shifts toward the catalytic center. We investigated the inactive conformation of hTS and found that the two insert regions are also involved in the conformational transition between the active and inactive state of hTS. Moreover, we identified a ligand-binding site in the dimer interface, suggesting that the cavity in the dimer interface could serve as an allosteric site of hTS to regulate the conformational switching between the active and inactive states. On the basis of these findings, we propose a regulatory mechanism of hTS activity that involves allosteric regulation of interactions of hTS with its own mRNA depending on cellular demands for TMP. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. ENDOTHELIN-STIMULATED HUMAN B-TYPE NATRIURETIC PEPTIDE GENE EXPRESSION IS MEDIATED BY YY1 IN ASSOCIATION WITH HDAC2

    PubMed Central

    Glenn, Denis J.; Wang, Feng; Chen, Songcang; Nishimoto, Minobu; Gardner, David G.

    2009-01-01

    Increased B-type natriuretic peptide (BNP) gene expression is regarded as one of the hallmarks of cardiac myocyte hypertrophy. Here we demonstrate that both basal and endothelin-1 (ET-1) -dependent stimulation of human (h) BNP gene transcription requires the presence of an intact Yin Yang 1 (YY1) binding site positioned at -62 bp relative to the transcription start site. Mutation of this site reduced both basal and stimulated hBNP promoter activity. This site was shown to bind YY1 both in vitro and within the context of the intact cell. The latter interaction increased following ET-1 treatment. Exposure to ET-1 also resulted in increased nuclear localization of YY1 and a reduction in acetylation of the YY1 protein. Overexpression of wild type YY1 increased both basal and endothelin-stimulated hBNP promoter activity, while a carboxy terminal deletion mutant of YY1 was devoid of activity. Treatment with the histone deacetylase inhibitor trichostatin A (TSA) resulted in decreased hBNP reporter activity. YY1 was shown to associate with histone deacetylase 2 (HDAC2), and HDAC2 was shown to associate directly with the hBNP promoter in the intact cell. Collectively these findings demonstrate that YY1 plays an important role in regulating the transcriptional activity of the hBNP gene promoter. These data suggest a model in which YY1 activates hBNP transcription through interaction with HDAC2. PMID:19139378

  12. Chemical Rescue of Enzymes: Proton Transfer in Mutants of Human Carbonic Anhydrase II

    PubMed Central

    Maupin, C. Mark; Castillo, Norberto; Taraphder, Srabani; Tu, Chingkuang; McKenna, Robert; Silverman, David N.; Voth, Gregory A.

    2011-01-01

    In human carbonic anhydrase II (HCA II) the mutation of position 64 from histidine to alanine (H64A) disrupts the rate limiting proton transfer (PT) event, resulting in a reduction of the catalytic activity of the enzyme as compared to the wild-type. Potential of mean force (PMF) calculations utilizing the multistate empirical valence bond (MS-EVB) methodology for H64A HCA II give a PT free energy barrier significantly higher than that found in the wild-type enzyme. This high barrier, determined in the absence of exogenous buffer and assuming no additional ionizable residues in the PT pathway, indicates the likelihood of alternate enzyme pathways that utilize either ionizable enzyme residues (self-rescue) and/or exogenous buffers (chemical rescue). It has been shown experimentally that the catalytic activity of H64A HCA II can be chemically rescued to near wild type levels by the addition of the exogenous buffer 4-methylimidazole (4MI). Crystallographic studies have identified two 4MI binding sites, yet site specific mutations intended to disrupt 4MI binding have demonstrated these sites to be non-productive. In the present work MS-EVB simulations show that binding of 4MI near Thr199 in the H64A HCA II mutant, a binding site determined by NMR spectroscopy, results in a viable chemical rescue pathway. Additional viable rescue pathways are also identified where 4MI acts as a proton transport intermediary from the active site to ionizable residues on the rim of the active site, revealing a probable mode of action for the chemical rescue pathway PMID:21452838

  13. A survey of tuberculosis infection control practices at the NIH/NIAID/DAIDS-supported clinical trial sites in low and middle income countries.

    PubMed

    Godfrey, Catherine; Tauscher, Gail; Hunsberger, Sally; Austin, Melissa; Scott, Lesley; Schouten, Jeffrey T; Luetkemeyer, Anne F; Benson, Constance; Coombs, Robert; Swindells, Susan

    2016-06-10

    Health care associated transmission of Mycobacterium tuberculosis (TB) is well described. A previous survey of infection control (IC) practices at clinical research sites in low and middle income countries (LMIC) funded by the National Institute of Allergy and Infectious Diseases (NIAID) conducting HIV research identified issues with respiratory IC practices. A guideline for TB IC based on international recommendations was developed and promulgated. This paper reports on adherence to the guideline at sites conducting or planning to conduct TB studies with the intention of supporting improvement. A survey was developed that assessed IC activities in three domains: facility level measures, administrative control measures and environmental measures. An external site monitor visited each site in 2013-2014, to complete the audit. A central review committee evaluated the site-level survey and results were tabulated. Fisher's exact test was performed to determine whether there were significant differences in practices at sites that had IC officers versus sites that did not have IC officers. Significance was assessed at p

  14. The role of conserved surface hydrophobic residues in the carbapenemase activity of the class D β-lactamases.

    PubMed

    Toth, Marta; Smith, Clyde A; Antunes, Nuno T; Stewart, Nichole K; Maltz, Lauren; Vakulenko, Sergei B

    2017-08-01

    Carbapenem-hydrolyzing class D β-lactamases (CHDLs) produce resistance to the last-resort carbapenem antibiotics and render these drugs ineffective for the treatment of life-threatening infections. Here, it is shown that among the clinically important CHDLs, OXA-143 produces the highest levels of resistance to carbapenems and has the highest catalytic efficiency against these substrates. Structural data demonstrate that acylated carbapenems entirely fill the active site of CHDLs, leaving no space for water molecules, including the deacylating water. Since the entrance to the active site is obstructed by the acylated antibiotic, the deacylating water molecule must take a different route for entry. It is shown that in OXA-143 the movement of a conserved hydrophobic valine residue on the surface opens a channel to the active site of the enzyme, which would not only allow the exchange of water molecules between the active site and the milieu, but would also create extra space for a water molecule to position itself in the vicinity of the scissile bond of the acyl-enzyme intermediate to perform deacylation. Structural analysis of the OXA-23 carbapenemase shows that in this enzyme movement of the conserved leucine residue, juxtaposed to the valine on the molecular surface, creates a similar channel to the active site. These data strongly suggest that all CHDLs may employ a mechanism whereupon the movement of highly conserved valine or leucine residues would allow a water molecule to access the active site to promote deacylation. It is further demonstrated that the 6α-hydroxyethyl group of the bound carbapenem plays an important role in the stabilization of this channel. The recognition of a universal deacylation mechanism for CHDLs suggests a direction for the future development of inhibitors and novel antibiotics for these enzymes of utmost clinical importance.

  15. STRUCTURAL AND FUNCTIONAL CONSEQUENCES OF CIRCULAR PERMUTATION ON THE ACTIVE SITE OF OLD YELLOW ENZYME.

    PubMed

    Daugherty, Ashley B; Horton, John R; Cheng, Xiaodong; Lutz, Stefan

    2015-02-06

    Circular permutation of the NADPH-dependent oxidoreductase Old Yellow Enzyme from Saccharomyces pastorianus (OYE1) can significantly enhance the enzyme's catalytic performance. Termini relocation into four regions of the protein (sectors I-IV) near the active site has proven effective in altering enzyme function. To better understand the structural consequences and rationalize the observed functional gains in these OYE1 variants, we selected representatives from sectors I-III for further characterization by biophysical methods and X-ray crystallography. These investigations not only show trends in enzyme stability and quaternary structure as a function of termini location, but also provide a possible explanation for the catalytic gains in our top-performing OYE variant (new N-terminus at residue 303; sector III). Crystallographic analysis indicates that termini relocation into sector III affects the loop β6 region (amino acid positions: 290-310) of OYE1 which forms a lid over the active site. Peptide backbone cleavage greatly enhances local flexibility, effectively converting the loop into a tether and consequently increasing the environmental exposure of the active site. Interestingly, such active site remodeling does not negatively impact the enzyme's activity and stereoselectivity, nor does it perturb the conformation of other key active site residues with the exception of Y375. These observations were confirmed in truncation experiments, deleting all residues of the loop β6 region in our OYE variant. Intrigued by the finding that circular permutation leaves most of the key catalytic residues unchanged, we also tested OYE permutants for possible additive or synergistic effects of amino acid substitutions. Distinct functional changes in these OYE variants were detected upon mutations at W116, known in native OYE1 to cause inversion of diastereo-selectivity for ( S )-carvone reduction. Our findings demonstrate the contribution of loop β6 toward determining the stereoselectivity of OYE1, an important insight for future OYE engineering efforts.

  16. Structural and Functional Consequences of Circular Permutation on the Active Site of Old Yellow Enzyme

    DOE PAGES

    Daugherty, Ashley B.; Horton, John R.; Cheng, Xiaodong; ...

    2014-12-09

    Circular permutation of the NADPH-dependent oxidoreductase Old Yellow Enzyme from Saccharomyces pastorianus (OYE1) can significantly enhance the enzyme’s catalytic performance. Termini relocation into four regions of the protein (sectors I–IV) near the active site has proven effective in altering enzyme function. To better understand the structural consequences and rationalize the observed functional gains in these OYE1 variants, we selected representatives from sectors I–III for further characterization by biophysical methods and X-ray crystallography. These investigations not only show trends in enzyme stability and quaternary structure as a function of termini location but also provide a possible explanation for the catalytic gainsmore » in our top-performing OYE variant (new N-terminus at residue 303; sector III). Crystallographic analysis indicates that termini relocation into sector III affects the loop β6 region (amino acid positions: 290–310) of OYE1, which forms a lid over the active site. Peptide backbone cleavage greatly enhances local flexibility, effectively converting the loop into a tether and consequently increasing the environmental exposure of the active site. Interestingly, such an active site remodeling does not negatively impact the enzyme’s activity and stereoselectivity; neither does it perturb the conformation of other key active site residues with the exception of Y375. These observations were confirmed in truncation experiments, deleting all residues of the loop β6 region in our OYE variant. Intrigued by the finding that circular permutation leaves most of the key catalytic residues unchanged, we also tested OYE permutants for possible additive or synergistic effects of amino acid substitutions. Distinct functional changes in these OYE variants were detected upon mutations at W116, known in native OYE1 to cause inversion of diastereoselectivity for (S)-carvone reduction. In conclusion, our findings demonstrate the contribution of loop β6 toward determining the stereoselectivity of OYE1, an important insight for future OYE engineering efforts.« less

  17. Identification of an essential active-site residue in the α-D-phosphohexomutase enzyme superfamily.

    PubMed

    Lee, Yingying; Mehra-Chaudhary, Ritcha; Furdui, Cristina; Beamer, Lesa J

    2013-06-01

    Enzymes in the α-d-phosphohexomutase superfamily catalyze the conversion of 1-phosphosugars to their 6-phospho counterparts. Their phosphoryl transfer reaction has long been proposed to require general acid-base catalysts, but candidate residues for these key roles have not been identified. In this study, we show through mutagenesis and kinetic studies that a histidine (His329) in the active site is critical for enzyme activity in a well-studied member of the superfamily, phosphomannomutase/phosphoglucomutase from Pseudomonas aeruginosa. Crystallographic characterization of an H329A mutant protein showed no significant changes from the wild-type enzyme, excluding structural disruption as the source of its compromised activity. Mutation of the structurally analogous lysine residue in a related protein, phosphoglucomutase from Salmonella typhimurium, also results in significant catalytic impairment. Analyses of protein-ligand complexes of the P. aeruginosa enzyme show that His329 is appropriately positioned to abstract a proton from the O1/O6 hydroxyl of the phosphosugar substrates, and thus may serve as the general base in the reaction. Histidine is strongly conserved at this position in many proteins in the superfamily, and lysine is also often conserved at a structurally corresponding position, particularly in the phosphoglucomutase enzyme sub-group. These studies shed light on the mechanism of this important enzyme superfamily, and may facilitate the design of mechanism-based inhibitors. Structural data have been deposited in the Protein Data Bank with accession number 4IL8. © 2013 The Authors Journal compilation © 2013 FEBS.

  18. The anticonvulsant stiripentol acts directly on the GABAA receptor as a positive allosteric modulator

    PubMed Central

    Fisher, Janet L.

    2009-01-01

    SUMMARY Stiripentol(STP) has been used as co-therapy for treatment of epilepsy for many years. Its mechanism of action has long been considered to be indirect, as it inhibits the enzymes responsible for metabolism of other anticonvulsant agents. However, a recent report suggested that STP might also act at the neuronal level, increasing inhibitory GABAergic neurotransmission. We examined the effect of STP on the functional properties of recombinant GABAA receptors (GABARs) and found that it was a positive allosteric modulator of these ion channels. Its activity showed some dependence on subunit composition, with greater potentiation of α3-containing receptors and reduced potentiation when the β1 or ε subunits were present. STP caused a leftward shift in the GABA concentration-response relationship, but did not increase the peak response of the receptors to a maximal GABA concentration. Although STP shares some functional characteristics with the neurosteroids, its activity was not inhibited by a neurosteroid site antagonist and was unaffected by a mutation in the α3 subunit that reduced positive modulation by neurosteroids. The differential effect of STP on β1- and β2/β3-containing receptors was not altered by mutations within the second transmembrane domain that affect modulation by loreclezole. These findings suggest that STP acts as a direct allosteric modulator of the GABAR at a site distinct from many commonly used anti-convulsant, sedative and anxiolytic drugs. Its higher activity at α3-containing receptors as well as its activity at δ-containing receptors may provide a unique opportunity to target selected populations of GABARs. PMID:18585399

  19. Evidence for a relief of repression mechanism for activation of the human telomerase reverse transcriptase promoter.

    PubMed

    Wang, Shuwen; Zhu, Jiyue

    2003-05-23

    The transcriptional activation of human telomerase reverse transcriptase (hTERT) is an important step during cellular immortalization and tumorigenesis. To study how this activation occurs during immortalization, we have established a set of genetically related pre-crisis cells and their immortal progeny. As expected, hTERT mRNA was detected in our telomerase-positive immortal cells but not in pre-crisis cells or telomerase-negative immortal cells. However, transiently transfected luciferase reporters controlled by hTERT promoter sequences exhibited similar levels of luciferase activity in both telomerase-positive and -negative cells, suggesting that the endogenous chromatin context is likely required for hTERT regulation. Analysis of chromatin susceptibility to DNase I digestion consistently identified a DNase I hypersensitivity site (DHS) near the hTERT transcription initiation site in telomerase-positive cells. In addition, the histone deacetylase inhibitor trichostatin A (TSA) induced hTERT transcription and also a general increase in chromatin sensitivity to DNase treatment in telomerase-negative cells. The TSA-induced hTERT transcription in pre-crisis cells was accompanied by the formation of a DHS at the hTERT promoter. Furthermore, the TSA-induced hTERT transcription and chromatin alterations were not blocked by cycloheximide, suggesting that this induction does not require de novo protein synthesis and that TSA induces hTERT expression through the inhibition of histone deacetylation at the hTERT promoter. Taken together, our results suggest that the endogenous chromatin environment plays a critical role in the regulation of hTERT expression during cellular immortalization.

  20. Folic acid modulates eNOS activity via effects on posttranslational modifications and protein–protein interactions☆

    PubMed Central

    Taylor, Sarah Y.; Dixon, Hannah M.; Yoganayagam, Shobana; Price, Natalie; Lang, Derek

    2013-01-01

    Folic acid enhances endothelial function and improves outcome in primary prevention of cardiovascular disease. The exact intracellular signalling mechanisms involved remain elusive and were therefore the subject of this study. Particular focus was placed on folic acid-induced changes in posttranslational modifications of endothelial nitric oxide synthase (eNOS). Cultured endothelial cells were exposed to folic acid in the absence or presence of phosphatidylinositol-3' kinase/Akt (PI3K/Akt) inhibitors. The phosphorylation status of eNOS was determined via western blotting. The activities of eNOS and PI3K/Akt were evaluated. The interaction of eNOS with caveolin-1, Heat-Shock Protein 90 and calmodulin was studied using co-immunoprecipitation. Intracellular localisation of eNOS was investigated using sucrose gradient centrifugation and confocal microscopy. Folic acid promoted eNOS dephosphorylation at negative regulatory sites, and increased phosphorylation at positive regulatory sites. Modulation of phosphorylation status was concomitant with increased cGMP concentrations, and PI3K/Akt activity. Inhibition of PI3K/Akt revealed specific roles for this kinase pathway in folic acid-mediated eNOS phosphorylation. Regulatory protein and eNOS protein associations were altered in favour of a positive regulatory effect in the absence of bulk changes in intracellular eNOS localisation. Folic acid-mediated eNOS activation involves the modulation of eNOS phosphorylation status at multiple residues and positive changes in important protein–protein interactions. Such intracellular mechanisms may in part explain improvements in clinical vascular outcome following folic acid treatment. PMID:23796957

  1. Locating the route of entry and binding sites of benzocaine and phenytoin in a bacterial voltage gated sodium channel.

    PubMed

    Martin, Lewis J; Corry, Ben

    2014-07-01

    Sodium channel blockers are used to control electrical excitability in cells as a treatment for epileptic seizures and cardiac arrhythmia, and to provide short term control of pain. Development of the next generation of drugs that can selectively target one of the nine types of voltage-gated sodium channel expressed in the body requires a much better understanding of how current channel blockers work. Here we make use of the recently determined crystal structure of the bacterial voltage gated sodium channel NavAb in molecular dynamics simulations to elucidate the position at which the sodium channel blocking drugs benzocaine and phenytoin bind to the protein as well as to understand how these drugs find their way into resting channels. We show that both drugs have two likely binding sites in the pore characterised by nonspecific, hydrophobic interactions: one just above the activation gate, and one at the entrance to the the lateral lipid filled fenestrations. Three independent methods find the same sites and all suggest that binding to the activation gate is slightly more favourable than at the fenestration. Both drugs are found to be able to pass through the fenestrations into the lipid with only small energy barriers, suggesting that this can represent the long posited hydrophobic entrance route for neutral drugs. Our simulations highlight the importance of a number of residues in directing drugs into and through the fenestration, and in forming the drug binding sites.

  2. Locating the Route of Entry and Binding Sites of Benzocaine and Phenytoin in a Bacterial Voltage Gated Sodium Channel

    PubMed Central

    Martin, Lewis J.; Corry, Ben

    2014-01-01

    Sodium channel blockers are used to control electrical excitability in cells as a treatment for epileptic seizures and cardiac arrhythmia, and to provide short term control of pain. Development of the next generation of drugs that can selectively target one of the nine types of voltage-gated sodium channel expressed in the body requires a much better understanding of how current channel blockers work. Here we make use of the recently determined crystal structure of the bacterial voltage gated sodium channel NavAb in molecular dynamics simulations to elucidate the position at which the sodium channel blocking drugs benzocaine and phenytoin bind to the protein as well as to understand how these drugs find their way into resting channels. We show that both drugs have two likely binding sites in the pore characterised by nonspecific, hydrophobic interactions: one just above the activation gate, and one at the entrance to the the lateral lipid filled fenestrations. Three independent methods find the same sites and all suggest that binding to the activation gate is slightly more favourable than at the fenestration. Both drugs are found to be able to pass through the fenestrations into the lipid with only small energy barriers, suggesting that this can represent the long posited hydrophobic entrance route for neutral drugs. Our simulations highlight the importance of a number of residues in directing drugs into and through the fenestration, and in forming the drug binding sites. PMID:24992293

  3. AF1q is a novel TCF7 co-factor which activates CD44 and promotes breast cancer metastasis.

    PubMed

    Park, Jino; Schlederer, Michaela; Schreiber, Martin; Ice, Ryan; Merkel, Olaf; Bilban, Martin; Hofbauer, Sebastian; Kim, Soojin; Addison, Joseph; Zou, Jie; Ji, Chunyan; Bunting, Silvia T; Wang, Zhengqi; Shoham, Menachem; Huang, Gang; Bago-Horvath, Zsuzsanna; Gibson, Laura F; Rojanasakul, Yon; Remick, Scot; Ivanov, Alexey; Pugacheva, Elena; Bunting, Kevin D; Moriggl, Richard; Kenner, Lukas; Tse, William

    2015-08-21

    AF1q is an MLL fusion partner that was identified from acute myeloid leukemia (AML) patients with t (1; 11) (q21; q23) chromosomal abnormality. The function of AF1q is not yet fully known, however, elevated AF1q expression is associated with poor clinical outcomes in various malignancies. Here, we show that AF1q specifically binds to T-cell-factor-7 (TCF7) in the Wnt signaling pathway and results in transcriptional activation of CD44 as well as multiple downstream targets of the TCF7/LEF1. In addition, enhanced AF1q expression promotes breast cancer cell proliferation, migration, mammosphere formation, and chemo-resistance. In xenograft models, enforced AF1q expression in breast cancer cells also promotes liver metastasis and lung colonization. In a cohort of 63 breast cancer patients, higher percentages of AF1q-positive cancer cells in primary sites were associated with significantly poorer overall survival (OS), disease-free survival (DFS), and brain metastasis-free survival (b-MFS). Using paired primary/metastatic samples from the same patients, we demonstrate that AF1q-positive breast cancer cells become dynamically dominant in the metastatic sites compared to the primary sites. Our findings indicate that breast cancer cells with a hyperactive AF1q/TCF7/CD44 regulatory axis in the primary sites may represent "metastatic founder cells" which have invasive properties.

  4. Efficient Photocatalytic H2 Evolution: Controlled Dewetting-Dealloying to Fabricate Site-Selective High-Activity Nanoporous Au Particles on Highly Ordered TiO2 Nanotube Arrays.

    PubMed

    Nguyen, Nhat Truong; Altomare, Marco; Yoo, JeongEun; Schmuki, Patrik

    2015-05-27

    Anodic self-organized TiO2 nanostumps are formed and exploited for self-ordering dewetting of Au-Ag sputtered films. This forms ordered particle configurations at the tube top (crown position) or bottom (ground position). By dealloying from a minimal amount of noble metal, porous Au nanoparticles are then formed, which, when in the crown position, allow for a drastically improved photocatalytic H2 production compared with nanoparticles produced by conventional dewetting processes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Mechanistic and Structural Analyses of the Roles of Active Site Residues in the Yeast Polyamine Oxidase Fms1: Characterization of the N195A and D94N Enzymes†

    PubMed Central

    Adachi, Mariya S.; Taylor, Alexander B.; Hart, P. John; Fitzpatrick, Paul F.

    2012-01-01

    The flavoprotein Fms1 from Saccharomyces cerevisiae catalyzes the oxidation of spermine in the biosynthetic pathway for pantothenic acid. The same reaction is catalyzed by the mammalian polyamine and spermine oxidases. The active site of Fms1 contains three amino acid residues positioned to interact with the polyamine substrate, His67, Asn195, and Asp94. These three residues form a hydrogen-bonding triad with Asn195 the central residue. Previous studies of the effects of mutating His67 are consistent with that residue being important both for interacting with the substrate and for maintaining the hydrogen bonds in the triad (Adachi, M. S., Taylor, A. B., Hart, P. J., and Fitzpatrick, P. F. (2012) Biochemistry 51, 4888-4897). The N195A and D94N enzymes have now been characterized to evaluate their roles in catalysis. Both mutations primarily affect the reductive half-reaction. With N1-acetylspermine as substrate, the rate constant for flavin reduction decreases ~450-fold for both mutations; the effects with spermine as substrate are smaller, 20- to 40-fold. The kcat/Kamine and kcat pH profiles with N1acetylspermine are only slightly changed from the profiles for the wild-type enzyme, consistent with the pKa values arising from the amine substrate or product and not from active site residues. The structure of the N195A enzyme was determined at a resolution of 2.0 Å. The structure shows a molecule of tetraethylene glycol in the active site and establishes that the mutation has no effect on the protein structure. Overall, the results are consistent with the role of Asn195 and Asp94 being to properly position the polyamine substrate for oxidation. PMID:23034052

  6. Mechanistic and structural analyses of the roles of active site residues in yeast polyamine oxidase Fms1: characterization of the N195A and D94N enzymes.

    PubMed

    Adachi, Mariya S; Taylor, Alexander B; Hart, P John; Fitzpatrick, Paul F

    2012-10-30

    Flavoprotein Fms1 from Saccharomyces cerevisiae catalyzes the oxidation of spermine in the biosynthetic pathway for pantothenic acid. The same reaction is catalyzed by the mammalian polyamine and spermine oxidases. The active site of Fms1 contains three amino acid residues positioned to interact with the polyamine substrate, His67, Asn195, and Asp94. These three residues form a hydrogen-bonding triad with Asn195 being the central residue. Previous studies of the effects of mutating His67 are consistent with that residue being important both for interacting with the substrate and for maintaining the hydrogen bonds in the triad [Adachi, M. S., Taylor, A. B., Hart, P. J., and Fitzpatrick, P. F. (2012) Biochemistry 51, 4888-4897]. The N195A and D94N enzymes have now been characterized to evaluate their roles in catalysis. Both mutations primarily affect the reductive half-reaction. With N(1)-acetylspermine as the substrate, the rate constant for flavin reduction decreases ~450-fold for both mutations; the effects with spermine as the substrate are smaller, 20-40-fold. The k(cat)/K(amine)- and k(cat)-pH profiles with N(1)-acetylspermine are only slightly changed from the profiles for the wild-type enzyme, consistent with the pK(a) values arising from the amine substrate or product and not from active site residues. The structure of the N195A enzyme was determined at a resolution of 2.0 Å. The structure shows a molecule of tetraethylene glycol in the active site and establishes that the mutation has no effect on the protein structure. Overall, the results are consistent with the role of Asn195 and Asp94 being to properly position the polyamine substrate for oxidation.

  7. Towards a mechanistic and physiological understanding of a ferredoxin disulfide reductase from the domains Archaea and Bacteria.

    PubMed

    Prakash, Divya; Walters, Karim A; Martinie, Ryan J; McCarver, Addison C; Kumar, Adepu K; Lessner, Daniel J; Krebs, Carsten; Golbeck, John H; Ferry, James G

    2018-05-02

    Disulfide reductases reduce other proteins and are critically important for cellular redox signaling and homeostasis. Methanosarcina acetivorans is a methane-producing microbe from the domain Archaea that produces a ferredoxin:disulfide reductase (FDR) for which the crystal structure has been reported, yet its biochemical mechanism and physiological substrates are unknown. FDR and the extensively characterized plant-type ferredoxin:thioredoxin reductase (FTR) belong to a distinct class of disulfide reductases that contain a unique active-site [4Fe-4S] cluster. The results reported here support a mechanism for FDR similar to that reported for FTR with notable exceptions. Unlike FTR, FDR contains a rubredoxin [1Fe-0S] center postulated to mediate electron transfer from ferredoxin to the active-site [4Fe-4S] cluster.  UV-Vis, EPR and Mӧssbauer spectroscopic data indicated that two-electron reduction of the active-site disulfide in FDR involves a one-electron-reduced [4Fe-4S]1+ intermediate previously hypothesized for FTR. Our results support a role for an active-site tyrosine in FDR that occupies the equivalent position of an essential histidine in the active-site of FTR. Of note, one of seven Trxs encoded in the genome (Trx5) and methanoredoxin, a glutaredoxin-like enzyme from M. acetivorans, were reduced by FDR advancing the physiological understanding of FDRs role in the redox metabolism of methanoarchaea. Finally, bioinformatics analyses show FDR homologs are widespread in diverse microbes from the domain Bacteria. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  8. The Transcription Factor AlsR Binds and Regulates the Promoter of the alsSD Operon Responsible for Acetoin Formation in Bacillus subtilis

    PubMed Central

    Frädrich, Claudia; March, Anika; Fiege, Kerstin; Hartmann, Anja; Jahn, Dieter

    2012-01-01

    Bacillus subtilis forms acetoin under anaerobic fermentative growth conditions and as a product of the aerobic carbon overflow metabolism. Acetoin formation from pyruvate requires α-acetolactate synthase and acetolactate decarboxylase, both encoded by the alsSD operon. The alsR gene, encoding the LysR-type transcriptional regulator AlsR, was found to be essential for the in vivo expression of alsSD in response to anaerobic acetate accumulation, the addition of acetate, low pH, and the aerobic stationary phase. The expressions of the alsSD operon and the alsR regulatory gene were independent of other regulators of the anaerobic regulatory network, including ResDE, Fnr, and ArfM. A negative autoregulation of alsR was observed. In vitro transcription from the alsSD promoter using purified B. subtilis RNA polymerase required AlsR. DNA binding studies with purified recombinant AlsR in combination with promoter mutagenesis experiments identified a 19-bp high-affinity palindromic binding site (TAAT-N11-ATTA) at positions −76 to −58 (regulatory binding site [RBS]) and a low-affinity site (AT-N11-AT) at positions −41 to −27 (activator binding site [ABS]) upstream of the transcriptional start site of alsSD. The RBS and ABS were found to be essential for in vivo alsSD transcription. AlsR binding to both sites induced the formation of higher-order, transcription-competent complexes. The AlsR protein carrying the S100A substitution at the potential coinducer binding site still bound to the RBS and ABS. However, AlsR(S100A) failed to form the higher-order complex and to initiate in vivo and in vitro transcription. A model for AlsR promoter binding and transcriptional activation was deduced. PMID:22178965

  9. Structural studies of viperin, an antiviral radical SAM enzyme.

    PubMed

    Fenwick, Michael K; Li, Yue; Cresswell, Peter; Modis, Yorgo; Ealick, Steven E

    2017-06-27

    Viperin is an IFN-inducible radical S -adenosylmethionine (SAM) enzyme that inhibits viral replication. We determined crystal structures of an anaerobically prepared fragment of mouse viperin (residues 45-362) complexed with S -adenosylhomocysteine (SAH) or 5'-deoxyadenosine (5'-dAdo) and l-methionine (l-Met). Viperin contains a partial (βα) 6 -barrel fold with a disordered N-terminal extension (residues 45-74) and a partially ordered C-terminal extension (residues 285-362) that bridges the partial barrel to form an overall closed barrel structure. Cys84, Cys88, and Cys91 located after the first β-strand bind a [4Fe-4S] cluster. The active site architecture of viperin with bound SAH (a SAM analog) or 5'-dAdo and l-Met (SAM cleavage products) is consistent with the canonical mechanism of 5'-deoxyadenosyl radical generation. The viperin structure, together with sequence alignments, suggests that vertebrate viperins are highly conserved and that fungi contain a viperin-like ortholog. Many bacteria and archaebacteria also express viperin-like enzymes with conserved active site residues. Structural alignments show that viperin is similar to several other radical SAM enzymes, including the molybdenum cofactor biosynthetic enzyme MoaA and the RNA methyltransferase RlmN, which methylates specific nucleotides in rRNA and tRNA. The viperin putative active site contains several conserved positively charged residues, and a portion of the active site shows structural similarity to the GTP-binding site of MoaA, suggesting that the viperin substrate may be a nucleoside triphosphate of some type.

  10. Effect of substrate RNA sequence on the cleavage reaction by a short ribozyme.

    PubMed Central

    Ohmichi, T; Okumoto, Y; Sugimoto, N

    1998-01-01

    Leadzyme is a ribozyme that requires Pb2+. The catalytic sequence, CUGGGAGUCC, binds to an RNA substrate, GGACC downward arrowGAGCCAG, cleaving the RNA substrate at one site. We have investigated the effect of the substrate sequence on the cleavage activity of leadzyme using mutant substrates in order to structurally understand the RNA catalysis. The results showed that leadzyme acted as a catalyst for single site cleavage of a C5 deletion mutant substrate, GGAC downward arrowGAGCCAG, as well as the wild-type substrate. However, a mutant substrate GGACCGACCAG, which had G8 deleted from the wild-type substrate, was not cleaved. Kinetic studies by surface plasmon resonance indicated that the difference between active and inactive structures reflected the slow association and dissociation rate constants of complex formation induced by Pb2+rather than differences in complex stability. CD spectra showed that the active form of the substrate-leadzyme complex was rearranged by Pb2+binding. The G8 of the wild-type substrate, which was absent in the inactive complex, is not near the cleavage site. Thus, these results show that the active substrate-leadzyme complex has a Pb2+binding site at the junction between the unpaired region (asymmetric internal loop) and the stem region, which is distal to the cleavage site. Pb2+may play a role in rearranging the bases in the asymmetric internal loop to the correct position for catalysis. PMID:9837996

  11. Chloromethane to olefins over H-SAPO-34: Probing the hydrocarbon pool mechanism

    DOE PAGES

    Fickel, Dustin W.; Sabnis, Kaiwalya D.; Li, Luanyi; ...

    2016-09-09

    In this paper, by means of in situ FTIR and ex situ 13C NMR studies, the initial periods of the chloromethane-to-olefins (CTO) reaction over SAPO-34 were probed in order to investigate the activation period of the reaction and to elucidate the formation of the catalyst active site. A methylated benzene species has been observed to form during the initial activation period of the reaction, and a direct positive correlation was constructed between the formation of this species and the catalytic activity. The data thus indicate that these methylated benzene species contribute to the formation of active sites within SAPO-34 formore » the CTO reaction. This is the first known report identifying a direct semi-quantitative correlation between the catalyst activity and growth of a methylated benzene active species, during the activation period of the chloromethane to olefins reaction. Finally, the findings here in correspond well to those reported for the methanol to olefins reaction, suggesting that a similar ‘hydrocarbon pool’ mechanism may be responsible for the formation of light olefins in CTO chemistry as well.« less

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fickel, Dustin W.; Sabnis, Kaiwalya D.; Li, Luanyi

    In this paper, by means of in situ FTIR and ex situ 13C NMR studies, the initial periods of the chloromethane-to-olefins (CTO) reaction over SAPO-34 were probed in order to investigate the activation period of the reaction and to elucidate the formation of the catalyst active site. A methylated benzene species has been observed to form during the initial activation period of the reaction, and a direct positive correlation was constructed between the formation of this species and the catalytic activity. The data thus indicate that these methylated benzene species contribute to the formation of active sites within SAPO-34 formore » the CTO reaction. This is the first known report identifying a direct semi-quantitative correlation between the catalyst activity and growth of a methylated benzene active species, during the activation period of the chloromethane to olefins reaction. Finally, the findings here in correspond well to those reported for the methanol to olefins reaction, suggesting that a similar ‘hydrocarbon pool’ mechanism may be responsible for the formation of light olefins in CTO chemistry as well.« less

  13. [Bioecological studies of Aedes (St) aegypti in an urban area with low vector density in Camagüey province].

    PubMed

    Diéguez Fernández, Lorenzo; Cabrera Fernández, Sonia María; Prada Noy, Yasnaya; González Larrinaga, Eddy; Rodríguez de la Vega, Ricardo

    2011-01-01

    The control of the breeding sites of mosquitoes of medical importance is essential for the anti-vector fighting programs; however, the efforts made so far have not great enough since the confirmed dengue fever cases gradually increase. To provide information on the main breeding sites of Aedes aegypti in an urban area with low vector density in Camagüey province. The urban universe was fully surveyed from January to December 2007. The collection procedure in the positive containers followed the National Vector Control program methodology. The characteristics of each container were written in a customized study form of positive blocks. The representative percentage of each positive container, as well as the proportion of larvae per container were determined. Aedes aegypti formed colonies in 44 different containers, being the artificial reservoirs the predominant ones (97.73%). The majority were permanent, useful and unchangeable. Following the population's criteria, the combination of permanent plus useful is valid in 17 types of containers accounting for 38.36% and contributing 180 positive containers for 81.08% of the total number. The tanks placed on the ground reached 36.03% positivity. The high number of mosquito-positive tanks demands greater individual responsibility in improving domestic sanitation and thus, the increase of awareness in order to achieve more active community involvement in this regard. The latter together with the strengthening of transectoriality will allow having an impact on the elimination and final disposal of all the useless materials that may serve as possible breeding sites of mosquitoes.

  14. Disappointment and regret enhance corrugator reactivity in a gambling task

    PubMed Central

    Wu, Yin; Clark, Luke

    2015-01-01

    This study investigated how the corrugator and zygomaticus respond to decision outcomes (i.e., gains and losses). We used a gambling task in which participants were presented with obtained followed by non-obtained outcomes. Activity at the corrugator site was sensitive to decision outcomes, such that higher obtained losses (disappointment) and higher non-obtained gains (regret) both heightened corrugator reactivity. Activity at the zygomaticus site was not responsive to obtained or non-obtained outcomes, but did show sensitivity to emotional images in the same participants, in the form of a positive linear relationship with self-reported emotional valence. Corrugator activity was negatively related to emotional valence. The findings indicate the sensitivity of corrugator to objective decision outcomes and also counterfactual comparisons, highlighting the utility of facial electromyography in research on decision making and gambling behavior. PMID:25345723

  15. Interaction Between the Biotin Carboxyl Carrier Domain and the Biotin Carboxylase Domain in Pyruvate Carboxylase from Rhizobium etli†

    PubMed Central

    Lietzan, Adam D.; Menefee, Ann L.; Zeczycki, Tonya N.; Kumar, Sudhanshu; Attwood, Paul V.; Wallace, John C.; Cleland, W. Wallace; Maurice, Martin St.

    2011-01-01

    Pyruvate carboxylase (PC) catalyzes the ATP-dependent carboxylation of pyruvate to oxaloacetate, an important anaplerotic reaction in mammalian tissues. To effect catalysis, the tethered biotin of PC must gain access to active sites in both the biotin carboxylase domain and the carboxyl transferase domain. Previous studies have demonstrated that a mutation of threonine 882 to alanine in PC from Rhizobium etli renders the carboxyl transferase domain inactive and favors the positioning of biotin in the biotin carboxylase domain. We report the 2.4 Å resolution X-ray crystal structure of the Rhizobium etli PC T882A mutant which reveals the first high-resolution description of the domain interaction between the biotin carboxyl carrier protein domain and the biotin carboxylase domain. The overall quaternary arrangement of Rhizobium etli PC remains highly asymmetrical and is independent of the presence of allosteric activator. While biotin is observed in the biotin carboxylase domain, its access to the active site is precluded by the interaction between Arg353 and Glu248, revealing a mechanism for regulating carboxybiotin access to the BC domain active site. The binding location for the biotin carboxyl carrier protein domain demonstrates that tethered biotin cannot bind in the biotin carboxylase domain active site in the same orientation as free biotin, helping to explain the difference in catalysis observed between tethered biotin and free biotin substrates in biotin carboxylase enzymes. Electron density located in the biotin carboxylase domain active site is assigned to phosphonoacetate, offering a probable location for the putative carboxyphosphate intermediate formed during biotin carboxylation. The insights gained from the T882A Rhizobium etli PC crystal structure provide a new series of catalytic snapshots in PC and offer a revised perspective on catalysis in the biotin-dependent enzyme family. PMID:21958016

  16. A Triple Mutant in the Ω-loop of TEM-1 β-Lactamase Changes the Substrate Profile via a Large Conformational Change and an Altered General Base for Catalysis*

    PubMed Central

    Stojanoski, Vlatko; Chow, Dar-Chone; Hu, Liya; Sankaran, Banumathi; Gilbert, Hiram F.; Prasad, B. V. Venkataram; Palzkill, Timothy

    2015-01-01

    β-Lactamases are bacterial enzymes that hydrolyze β-lactam antibiotics. TEM-1 is a prevalent plasmid-encoded β-lactamase in Gram-negative bacteria that efficiently catalyzes the hydrolysis of penicillins and early cephalosporins but not oxyimino-cephalosporins. A previous random mutagenesis study identified a W165Y/E166Y/P167G triple mutant that displays greatly altered substrate specificity with increased activity for the oxyimino-cephalosporin, ceftazidime, and decreased activity toward all other β-lactams tested. Surprisingly, this mutant lacks the conserved Glu-166 residue critical for enzyme function. Ceftazidime contains a large, bulky side chain that does not fit optimally in the wild-type TEM-1 active site. Therefore, it was hypothesized that the substitutions in the mutant expand the binding site in the enzyme. To investigate structural changes and address whether there is an enlargement in the active site, the crystal structure of the triple mutant was solved to 1.44 Å. The structure reveals a large conformational change of the active site Ω-loop structure to create additional space for the ceftazidime side chain. The position of the hydroxyl group of Tyr-166 and an observed shift in the pH profile of the triple mutant suggests that Tyr-166 participates in the hydrolytic mechanism of the enzyme. These findings indicate that the highly conserved Glu-166 residue can be substituted in the mechanism of serine β-lactamases. The results reveal that the robustness of the overall β-lactamase fold coupled with the plasticity of an active site loop facilitates the evolution of enzyme specificity and mechanism. PMID:25713062

  17. Arginine residues on the opposite side of the active site stimulate the catalysis of ribosome depurination by ricin A chain by interacting with the P-protein stalk.

    PubMed

    Li, Xiao-Ping; Kahn, Peter C; Kahn, Jennifer Nielsen; Grela, Przemyslaw; Tumer, Nilgun E

    2013-10-18

    Ricin inhibits protein synthesis by depurinating the α-sarcin/ricin loop (SRL). Ricin holotoxin does not inhibit translation unless the disulfide bond between the A (RTA) and B (RTB) subunits is reduced. Ricin holotoxin did not bind ribosomes or depurinate them but could depurinate free RNA. When RTA is separated from RTB, arginine residues located at the interface are exposed to the solvent. Because this positively charged region, but not the active site, is blocked by RTB, we mutated arginine residues at or near the interface of RTB to determine if they are critical for ribosome binding. These variants were structurally similar to wild type RTA but could not bind ribosomes. Their K(m) values and catalytic rates (k(cat)) for an SRL mimic RNA were similar to those of wild type, indicating that their activity was not altered. However, they showed an up to 5-fold increase in K(m) and up to 38-fold decrease in kcat toward ribosomes. These results suggest that the stalk binding stimulates the catalysis of ribosome depurination by RTA. The mutated arginines have side chains behind the active site cleft, indicating that the ribosome binding surface of RTA is on the opposite side of the surface that interacts with the SRL. We propose that stalk binding stimulates the catalysis of ribosome depurination by orienting the active site of RTA toward the SRL and thereby allows docking of the target adenine into the active site. This model may apply to the translation factors that interact with the stalk.

  18. Engineering acidic Streptomyces rubiginosus D-xylose isomerase by rational enzyme design.

    PubMed

    Waltman, Mary Jo; Yang, Zamin Koo; Langan, Paul; Graham, David E; Kovalevsky, Andrey

    2014-02-01

    To maximize bioethanol production from lignocellulosic biomass, all sugars must be utilized. Yeast fermentation can be improved by introducing the d-xylose isomerase enzyme to convert the pentose sugar d-xylose, which cannot be fermented by Saccharomyces cerevisiae, into the fermentable ketose d-xylulose. The low activity of d-xylose isomerase, especially at the low pH required for optimal fermentation, limits its use. A rational enzyme engineering approach was undertaken, and seven amino acid positions were replaced to improve the activity of Streptomyces rubiginosus d-xylose isomerase towards its physiological substrate at pH values below 6. The active-site design was guided by mechanistic insights and the knowledge of amino acid protonation states at low pH obtained from previous joint X-ray/neutron crystallographic experiments. Tagging the enzyme with 6 or 12 histidine residues at the N-terminus resulted in a significant increase in the active-site affinity towards substrate at pH 5.8. Substituting an asparagine at position 215, which hydrogen bonded to the metal-bound Glu181 and Asp245, with an aspartate gave a variant with almost an order of magnitude lower KM than measured for the native enzyme, with a 4-fold increase in activity. Other studied variants showed similar (Asp57Asn, Glu186Gln/Asn215Asp), lower (Asp57His, Asn247Asp, Lys289His, Lys289Glu) or no (Gln256Asp, Asp287Asn, ΔAsp287) activity in acidic conditions relative to the native enzyme.

  19. The role of physical activity in bone health: a new hypothesis to reduce risk of vertebral fracture.

    PubMed

    Sinaki, Mehrsheed

    2007-08-01

    Locomotion has always been a major criterion for human survival. Thus, it is no surprise that science supports the dependence of bone health on weight-bearing physical activities. The effect of physical activity on bone is site-specific. Determining how to perform osteogenic exercises, especially in individuals who have osteopenia or osteoporosis, without exceeding the biomechanical competence of bone always poses a dilemma and must occur under medical advice. This article presents the hypothesis that back exercises performed in a prone position, rather than a vertical position, may have a greater effect on decreasing the risk for vertebral fractures without resulting in compression fracture. The risk for vertebral fractures can be reduced through improvement in the horizontal trabecular connection of vertebral bodies.

  20. Effect of electrical polarization of hydroxyapatite ceramics on new bone formation.

    PubMed

    Itoh, S; Nakamura, S; Kobayashi, T; Shinomiya, K; Yamashita, K; Itoh, S

    2006-03-01

    Large surface charges can be induced on hydroxyapatite (HAp) ceramics by proton transport polarization, but this does not affect beta-tricalcium phosphate (TCP) because of its low polarizability. We wished to examine differences in osteogenic cell activity and new bone growth between positively or negatively surface-charged HAp and HAp/TCP plates using a calvarial bone defect model. In the first group of rats, test pieces were placed with their positively charged surfaces face down on the dura mater. In the second group, test pieces were placed with their negatively charged surfaces face down on the dura mater. A third group received noncharged test pieces. Histological examination, including enzymatic staining for osteoblasts and osteoclasts, was carried out. While no bone formation was observed at the pericranium, direct bone formation on the cranial bone debris and new bone growth expanded from the margins of the sites of injury to bridge across both the positively and negatively charged surfaces of HAp and HAp/TCP plates occurred. Electrical polarization of implanted plates, including positive charge, led to enhanced osteoblast activity, though decreased osteoclast activity was seen on the positively charged plate surface. Thus, polarization of HAp ceramics may modulate new bone formation and resorption.

  1. Dual allosteric activation mechanisms in monomeric human glucokinase

    PubMed Central

    Whittington, A. Carl; Larion, Mioara; Bowler, Joseph M.; Ramsey, Kristen M.; Brüschweiler, Rafael; Miller, Brian G.

    2015-01-01

    Cooperativity in human glucokinase (GCK), the body’s primary glucose sensor and a major determinant of glucose homeostatic diseases, is fundamentally different from textbook models of allostery because GCK is monomeric and contains only one glucose-binding site. Prior work has demonstrated that millisecond timescale order-disorder transitions within the enzyme’s small domain govern cooperativity. Here, using limited proteolysis, we map the site of disorder in unliganded GCK to a 30-residue active-site loop that closes upon glucose binding. Positional randomization of the loop, coupled with genetic selection in a glucokinase-deficient bacterium, uncovers a hyperactive GCK variant with substantially reduced cooperativity. Biochemical and structural analysis of this loop variant and GCK variants associated with hyperinsulinemic hypoglycemia reveal two distinct mechanisms of enzyme activation. In α-type activation, glucose affinity is increased, the proteolytic susceptibility of the active site loop is suppressed and the 1H-13C heteronuclear multiple quantum coherence (HMQC) spectrum of 13C-Ile–labeled enzyme resembles the glucose-bound state. In β-type activation, glucose affinity is largely unchanged, proteolytic susceptibility of the loop is enhanced, and the 1H-13C HMQC spectrum reveals no perturbation in ensemble structure. Leveraging both activation mechanisms, we engineer a fully noncooperative GCK variant, whose functional properties are indistinguishable from other hexokinase isozymes, and which displays a 100-fold increase in catalytic efficiency over wild-type GCK. This work elucidates specific structural features responsible for generating allostery in a monomeric enzyme and suggests a general strategy for engineering cooperativity into proteins that lack the structural framework typical of traditional allosteric systems. PMID:26283387

  2. Dual allosteric activation mechanisms in monomeric human glucokinase.

    PubMed

    Whittington, A Carl; Larion, Mioara; Bowler, Joseph M; Ramsey, Kristen M; Brüschweiler, Rafael; Miller, Brian G

    2015-09-15

    Cooperativity in human glucokinase (GCK), the body's primary glucose sensor and a major determinant of glucose homeostatic diseases, is fundamentally different from textbook models of allostery because GCK is monomeric and contains only one glucose-binding site. Prior work has demonstrated that millisecond timescale order-disorder transitions within the enzyme's small domain govern cooperativity. Here, using limited proteolysis, we map the site of disorder in unliganded GCK to a 30-residue active-site loop that closes upon glucose binding. Positional randomization of the loop, coupled with genetic selection in a glucokinase-deficient bacterium, uncovers a hyperactive GCK variant with substantially reduced cooperativity. Biochemical and structural analysis of this loop variant and GCK variants associated with hyperinsulinemic hypoglycemia reveal two distinct mechanisms of enzyme activation. In α-type activation, glucose affinity is increased, the proteolytic susceptibility of the active site loop is suppressed and the (1)H-(13)C heteronuclear multiple quantum coherence (HMQC) spectrum of (13)C-Ile-labeled enzyme resembles the glucose-bound state. In β-type activation, glucose affinity is largely unchanged, proteolytic susceptibility of the loop is enhanced, and the (1)H-(13)C HMQC spectrum reveals no perturbation in ensemble structure. Leveraging both activation mechanisms, we engineer a fully noncooperative GCK variant, whose functional properties are indistinguishable from other hexokinase isozymes, and which displays a 100-fold increase in catalytic efficiency over wild-type GCK. This work elucidates specific structural features responsible for generating allostery in a monomeric enzyme and suggests a general strategy for engineering cooperativity into proteins that lack the structural framework typical of traditional allosteric systems.

  3. A non-contact technique for measuring eccrine sweat gland activity using passive thermal imaging.

    PubMed

    Krzywicki, Alan T; Berntson, Gary G; O'Kane, Barbara L

    2014-10-01

    An approach for monitoring eccrine sweat gland activity using high resolution Mid-Wave Infrared (MWIR) imaging (3-5 μm wave band) is described. This technique is non-contact, passive, and provides high temporal and spatial resolution. Pore activity was monitored on the face and on the volar surfaces of the distal and medial phalanges of the index and middle fingers while participants performed a series of six deep inhalation and exhalation exercises. Two metrics called the Pore Activation Index (PAI) and Pore Count (PC) were defined as size-weighted and unweighted measures of active sweat gland counts respectively. PAI transient responses on the finger tips were found to be positively correlated to Skin Conductance Responses (SCRs). PAI responses were also observed on the face, although the finger sites appeared to be more responsive. Results indicate that thermal imaging of the pore response may provide a useful, non-contact, correlate measure for electrodermal responses recorded from related sites. Published by Elsevier B.V.

  4. [Roosting-site characteristics of wintering black-necked cranes (Grus nigricollis) at Napahai, Yunnan].

    PubMed

    He, Peng; Kong, De-Jun; Liu, Qiang; Yu, Hong-Zhong; Zhao, Jian-Lin; Yang, Xiao-Jun

    2011-04-01

    From November 2009 to April 2010, roosting-site characteristics of black-necked cranes (Grus nigricollis) were observed at Napahai Provincial Nature Reserve, Shangri-La, Yunnan, China. The positions of roosting-sites were determined by triangulation with markers and field correction. All of the 63 roosting-sites observed were located in patchy marshes with water, which contained some mud on the bottom and 81% of the roosting-sites were covered by plants. They also had a certain distance to areas of human activities and had a certain distance to the shore. A comparison of roosting sites and random sites showed that roosting-sites had thicker mud layers, a higher ratio of open water, longer distance to roads, villages, and farmland, and water depth. Another comparison of before and after usage of roosting-sites found a significant difference in area of marsh patch. Principal component analysis indicated that the usage of roosting-site of black-necked cranes was affected by human disturbance, area of marsh patch, and the condition of the shallow water environment.

  5. Site-specific crosslinking of 4-thiouridine-modified human tRNA(3Lys) to reverse transcriptase from human immunodeficiency virus type I.

    PubMed Central

    Mishima, Y; Steitz, J A

    1995-01-01

    We have mapped specific RNA-protein contacts between human immunodeficiency virus (HIV) type I reverse transcriptase (RT) and its natural primer, human tRNA(3Lys), using a site-specific crosslinking strategy. Four different tRNA(3Lys) constructs with a single 32P-labeled 4-thiouridine (4-thioU) residue at positions -1, 16, 36 or 41 were synthesized. After incubation with RT followed by irradiation, crosslinks were localized to either the p66 or p51 subunit of RT by digestion with nuclease and SDS gel fractionation. 4-thioU at position -1 or 16 transferred label to the p66 subunit almost exclusively (> 90%), whereas position 36 labeled both p66 and p51 (3:1). Position 41 yielded no detectable crosslinks. The region of p66 contacted by position -1 of tRNA(3Lys) was localized to the 203 C-terminal amino acids of RT by CNBr cleavage, whereas a 127 amino acid-CNBr peptide (residues 230-357) from both p66 and p51 was labeled by position 36. Functionality of the 4-thioU-modified tRNA(3Lys)(-1) crosslinked to RT in the presence of an RNA but not a DNA template was demonstrated by the ability of the tRNA to be extended. These results localize the 5' half of the tRNA on the interface between the two RT subunits, closer to the RNase H domain than to the polymerase active site, in accord with previous suggestions. They argue further that a specific binding site for the 5' end of the primer tRNA(3Lys) may exist within the C-terminal portion of the p66 subunit, which could be important for the initiation of reverse transcription. Images PMID:7540137

  6. The X-ray Crystal Structures of Human {alpha}-Phosphomannomutase 1 Reveal the Structural Basis of Congenital Disorder of Glycosylation Type 1a

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Silvaggi,N.; Zhang, C.; Lu, Z.

    2006-01-01

    Carbohydrate-deficient glycoprotein syndrome type 1a (CDG-1a) is a congenital disease characterized by severe defects in nervous system development. It is caused by mutations in alpha -phosphomannomutase (of which there are two isozymes, {alpha}-PMM1 and {alpha}-PPM2). Here we report the X-ray crystal structures of human {alpha}-PMM1 in the open conformation, with and without the bound substrate, {alpha}-D-mannose 1-phosphate. {alpha}-PMM1, like most Haloalkanoic Acid Dehalogenase Superfamily (HADSF) members, consists of two domains, the cap and core, which open to bind substrate and then close to provide a solvent exclusive environment for catalysis. The substrate phosphate group is observed at a positively chargedmore » site of the cap domain, rather than at the core domain phosphoryl-transfer site defined by the D19 nucleophile and Mg{sup 2+} cofactor. This suggests that substrate binds first to the cap and then is swept into the active site upon cap closure. The orientation of the acid/base residue D21 suggests that {alpha}-PMM uses a different method of protecting the aspartylphosphate from hydrolysis than the HADSF member {beta}-phosphoglucomutase. It is hypothesized that the electrostatic repulsion of positive charges at the interface of the cap and core domains stabilizes {alpha}-PMM1 in the open conformation, and that the negatively charged substrate binds to the cap, thereby facilitating its closure over the core domain. The two isozymes {alpha}-PMM1 and {alpha}-PMM2 are shown to have a conserved active-site structure and to display similar kinetic properties. Analysis of the known mutation sites in the context of the structures reveals the genotype-phenotype relationship underlying CDG-1a.« less

  7. Discovery of Selective Inhibitors of Imidazoleglycerol-Phosphate Dehydratase from Mycobacterium tuberculosis by Virtual Screening

    NASA Astrophysics Data System (ADS)

    Podshivalov, D.; Mandzhieva, Yu. B.; Sidorov-Biryukov, D. D.; Timofeev, V. I.; Kuranova, I. P.

    2018-01-01

    Bacterial imidazoleglycerol-phosphate dehydratase from Mycobacterium tuberculosis (HisB- Mt) is a convenient target for the discovery of selective inhibitors as potential antituberculosis drugs. The virtual screening was performed to find compounds suitable for the design of selective inhibitors of HisB- Mt. The positions of four ligands, which were selected based on the docking scoring function and docked to the activesite region of the enzyme, were refined by molecular dynamics simulation. The nearest environment of the ligands was determined. These compounds selectively bind to functionally essential active-site residues, thus blocking access of substrates to the active site of the enzyme, and can be used as lead compounds for the design of selective inhibitors of HisB- M.

  8. Site-selective post-translational modification of proteins using an unnatural amino acid, 3-azidotyrosine.

    PubMed

    Ohno, Satoshi; Matsui, Megumi; Yokogawa, Takashi; Nakamura, Masashi; Hosoya, Takamitsu; Hiramatsu, Toshiyuki; Suzuki, Masaaki; Hayashi, Nobuhiro; Nishikawa, Kazuya

    2007-03-01

    An efficient method for site-selective modification of proteins using an unnatural amino acid, 3-azidotyrosine has been developed. This method utilizes the yeast amber suppressor tRNA(Tyr)/mutated tyrosyl-tRNA synthetase pair as a carrier of 3-azidotyrosine in an Escherichia coli cell-free translation system, and triarylphosphine derivatives for specific modification of the azido group. Using rat calmodulin (CaM) as a model protein, we prepared several unnatural CaM molecules, each carrying an azidotyrosine at predetermined positions 72, 78, 80 or 100, respectively. Post-translational modification of these proteins with a conjugate compound of triarylphosphine and biotin produced site-selectively biotinylated CaM molecules. Reaction efficiency was similar among these proteins irrespective of the position of introduction, and site-specificity of biotinylation was confirmed using mass spectrometry. In addition, CBP-binding activity of the biotinylated CaMs was confirmed to be similar to that of wild-type CaM. This method is intrinsically versatile in that it should be easily applicable to introducing any other desirable compounds (e.g., probes and cross-linkers) into selected sites of proteins as far as appropriate derivative compounds of triarylphosphine could be chemically synthesized. Elucidation of molecular mechanisms of protein functions and protein-to-protein networks will be greatly facilitated by making use of these site-selectively modified proteins.

  9. A New Structural Form in the SAM/Metal-Dependent O;#8209;Methyltransferase Family: MycE from the Mycinamicin Biosynthetic Pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akey, David L.; Li, Shengying; Konwerski, Jamie R.

    2012-08-01

    O-linked methylation of sugar substituents is a common modification in the biosynthesis of many natural products and is catalyzed by multiple families of S-adenosyl-l-methionine (SAM or AdoMet)-dependent methyltransferases (MTs). Mycinamicins, potent antibiotics from Micromonospora griseorubida, can be methylated at two positions on a 6-deoxyallose substituent. The first methylation is catalyzed by MycE, a SAM- and metal-dependent MT. Crystal structures were determined for MycE bound to the product S-adenosyl-l-homocysteine (AdoHcy) and magnesium, both with and without the natural substrate mycinamicin VI. This represents the first structure of a natural product sugar MT in complex with its natural substrate. MycE is amore » tetramer of a two-domain polypeptide, comprising a C-terminal catalytic MT domain and an N-terminal auxiliary domain, which is important for quaternary assembly and for substrate binding. The symmetric MycE tetramer has a novel MT organization in which each of the four active sites is formed at the junction of three monomers within the tetramer. The active-site structure supports a mechanism in which a conserved histidine acts as a general base, and the metal ion helps to position the methyl acceptor and to stabilize a hydroxylate intermediate. A conserved tyrosine is suggested to support activity through interactions with the transferred methyl group from the SAM methyl donor. The structure of the free enzyme reveals a dramatic order-disorder transition in the active site relative to the S-adenosyl-L-homocysteine complexes, suggesting a mechanism for product/substrate exchange through concerted movement of five loops and the polypeptide C-terminus.« less

  10. Diacylglycerol Acyltransferase 1 Is Regulated by Its N-Terminal Domain in Response to Allosteric Effectors.

    PubMed

    Caldo, Kristian Mark P; Acedo, Jeella Z; Panigrahi, Rashmi; Vederas, John C; Weselake, Randall J; Lemieux, M Joanne

    2017-10-01

    Diacylglycerol acyltransferase 1 (DGAT1) is an integral membrane enzyme catalyzing the final and committed step in the acyl-coenzyme A (CoA)-dependent biosynthesis of triacylglycerol (TAG). The biochemical regulation of TAG assembly remains one of the least understood areas of primary metabolism to date. Here, we report that the hydrophilic N-terminal domain of Brassica napus DGAT1 (BnaDGAT1 1-113 ) regulates activity based on acyl-CoA/CoA levels. The N-terminal domain is not necessary for acyltransferase activity and is composed of an intrinsically disordered region and a folded segment. We show that the disordered region has an autoinhibitory function and a dimerization interface, which appears to mediate positive cooperativity, whereas the folded segment of the cytosolic region was found to have an allosteric site for acyl-CoA/CoA. Under increasing acyl-CoA levels, the binding of acyl-CoA with this noncatalytic site facilitates homotropic allosteric activation. Enzyme activation, on the other hand, is prevented under limiting acyl-CoA conditions (low acyl-CoA-to-CoA ratio), whereby CoA acts as a noncompetitive feedback inhibitor through interaction with the same folded segment. The three-dimensional NMR solution structure of the allosteric site revealed an α-helix with a loop connecting a coil fragment. The conserved amino acid residues in the loop interacting with CoA were identified, revealing details of this important regulatory element for allosteric regulation. Based on these results, a model is proposed illustrating the role of the N-terminal domain of BnaDGAT1 as a positive and negative modulator of TAG biosynthesis. © 2017 American Society of Plant Biologists. All Rights Reserved.

  11. DRoP: a water analysis program identifies Ras-GTP-specific pathway of communication between membrane-interacting regions and the active site.

    PubMed

    Kearney, Bradley M; Johnson, Christian W; Roberts, Daniel M; Swartz, Paul; Mattos, Carla

    2014-02-06

    Ras GTPase mediates several cellular signal transduction pathways and is found mutated in a large number of cancers. It is active in the GTP-bound state, where it interacts with effector proteins, and at rest in the GDP-bound state. The catalytic domain is tethered to the membrane, with which it interacts in a nucleotide-dependent manner. Here we present the program Detection of Related Solvent Positions (DRoP) for crystallographic water analysis on protein surfaces and use it to study Ras. DRoP reads and superimposes multiple Protein Data Bank coordinates, transfers symmetry-related water molecules to the position closest to the protein surface, and ranks the waters according to how well conserved and tightly clustered they are in the set of structures. Coloring according to this rank allows visualization of the results. The effector-binding region of Ras is hydrated with highly conserved water molecules at the interface between the P-loop, switch I, and switch II, as well as at the Raf-RBD binding pocket. Furthermore, we discovered a new conserved water-mediated H-bonding network present in Ras-GTP, but not in Ras-GDP, that links the nucleotide sensor residues R161 and R164 on helix 5 to the active site. The double mutant RasN85A/N86A, where the final link between helix 5 and the nucleotide is not possible, is a severely impaired enzyme, while the single mutant RasN86A, with partial connection to the active site, has a wild-type hydrolysis rate. DRoP was instrumental in determining the water-mediated connectivity networks that link two lobes of the catalytic domain in Ras. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. A Compact Viral Processing Proteinase/Ubiquitin Hydrolase from the OTU Family

    PubMed Central

    Chenon, Mélanie; Andreani, Jessica; Guerois, Raphaël; Jupin, Isabelle; Bressanelli, Stéphane

    2013-01-01

    Turnip yellow mosaic virus (TYMV) - a member of the alphavirus-like supergroup of viruses - serves as a model system for positive-stranded RNA virus membrane-bound replication. TYMV encodes a precursor replication polyprotein that is processed by the endoproteolytic activity of its internal cysteine proteinase domain (PRO). We recently reported that PRO is actually a multifunctional enzyme with a specific ubiquitin hydrolase (DUB) activity that contributes to viral infectivity. Here, we report the crystal structure of the 150-residue PRO. Strikingly, PRO displays no homology to other processing proteinases from positive-stranded RNA viruses, including that of alphaviruses. Instead, the closest structural homologs of PRO are DUBs from the Ovarian tumor (OTU) family. In the crystal, one molecule's C-terminus inserts into the catalytic cleft of the next, providing a view of the N-terminal product complex in replication polyprotein processing. This allows us to locate the specificity determinants of PRO for its proteinase substrates. In addition to the catalytic cleft, at the exit of which the active site is unusually pared down and solvent-exposed, a key element in molecular recognition by PRO is a lobe N-terminal to the catalytic domain. Docking models and the activities of PRO and PRO mutants in a deubiquitylating assay suggest that this N-terminal lobe is also likely involved in PRO's DUB function. Our data thus establish that DUBs can evolve to specifically hydrolyze both iso- and endopeptide bonds with different sequences. This is achieved by the use of multiple specificity determinants, as recognition of substrate patches distant from the cleavage sites allows a relaxed specificity of PRO at the sites themselves. Our results thus shed light on how such a compact protein achieves a diversity of key functions in viral genome replication and host-pathogen interaction. PMID:23966860

  13. The Interaction of FABP with Kapα

    PubMed Central

    Amber-Vitos, Ortal; Kucherenko, Nataly; Nachliel, Esther; Gutman, Menachem; Tsfadia, Yossi

    2015-01-01

    Gene-activating lipophilic compounds are carried into the nucleus when loaded on fatty-acid-binding proteins (FABP). Some of these proteins are recognized by the α-Karyopherin (Kapα) through its nuclear localization signal (NLS) consisting of three positive residues that are not in a continuous sequence. The Importin system can distinguish between FABP loaded with activating and non-activating compounds. In the present study, we introduced molecular dynamics as a tool for clarifying the mechanism by which FABP4, loaded with activating ligand (linoleate) is recognized by Kapα. In the first phase, we simulated the complex between KapαΔIBB (termed “Armadillo”) that was crystallized with two NLS hepta-peptides. The trajectory revealed that the crystal-structure orientation of the peptides is rapidly lost and new interactions dominate. Though, the NLS sequence of FABP4 is cryptic, since the functional residues are not in direct sequence, implicating more than one possible conformation. Therefore, four possible docked conformations were generated, in which the NLS of FABP4 is interacting with either the major or the minor sites of Kapα, and the N → C vectors are parallel or anti-parallel. Out of these four basic starting positions, only the FABP4-minor site complex exhibited a large number of contact points. In this complex, the FABP interacts with the minor and the major sites, suppressing the self-inhibitory interaction of the Kapα, rendering it free to react with Kapβ. Finally, we propose that the transportable conformation generated an extended hydrophobic domain which expanded out of the boundary of the FABP4, allowing the loaded linoleate to partially migrate out of the FABP into a joint complex in which the Kapα contributes part of a combined binding pocket. PMID:26284534

  14. Design of HIV-1 Protease Inhibitors with Amino-bis-tetrahydrofuran Derivatives as P2-Ligands to Enhance Backbone-Binding Interactions. Synthesis, Biological Evaluation, and Protein-Ligand X-ray Studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghosh, Arun K.; Martyr, Cuthbert D.; Osswald, Heather L.

    Structure-based design, synthesis, and biological evaluation of a series of very potent HIV-1 protease inhibitors are described. In an effort to improve backbone ligand–binding site interactions, we have incorporated basic-amines at the C4 position of the bis-tetrahydrofuran (bis-THF) ring. We speculated that these substituents would make hydrogen bonding interactions in the flap region of HIV-1 protease. Synthesis of these inhibitors was performed diastereoselectively. A number of inhibitors displayed very potent enzyme inhibitory and antiviral activity. Inhibitors 25f, 25i, and 25j were evaluated against a number of highly-PI-resistant HIV-1 strains, and they exhibited improved antiviral activity over darunavir. Two high resolutionmore » X-ray structures of 25f- and 25g-bound HIV-1 protease revealed unique hydrogen bonding interactions with the backbone carbonyl group of Gly48 as well as with the backbone NH of Gly48 in the flap region of the enzyme active site. These ligand–binding site interactions are possibly responsible for their potent activity.« less

  15. Interactions of p-Nitrobenzene Diazonium Fluoroborate and Analogs with the Active Sites of Acetylcholine-Receptor and -Esterase*

    PubMed Central

    Mautner, Henry G.; Bartels, Eva

    1970-01-01

    p-Nitrobenzene diazonium fluoroborate (NDF) is a potent inhibitor of the carbamylcholine-induced depolarization of the electroplax and of acetylcholinesterase. It probably forms covalent bonds with the acetylcholine-receptor and -esterase at the active site of the proteins. Its inhibitory strength is at least the same as that of trimethylammonium diazonium fluoroborate (TDF). The p-acetoxy analog, with its weaker electron-withdrawing group, is about ten times weaker as an inhibitor than the trimethylammonium or p-nitro analogs, both of which have strong electron-withdrawing groups. After treatment of the electroplax preparation with dithiothreitol, NDF remains an irreversible receptor-inhibitor, while TDF becomes a potent reversible receptor-activator. TDF is self-inhibitory: applied before reduction, it no longer depolarizes. Although the first observations on TDF suggested that the compound labels both proteins by virtue of the steric complementary of its trimethylammonium group to a negative subsite in the proteins, the present study indicates that it is the positively charged diazonium group that reacts with the active sites of the proteins to form a covalent bond with an appropriate amino-acid residue. PMID:5272331

  16. Identification of the Regulon of AphB and Its Essential Roles in LuxR and Exotoxin Asp Expression in the Pathogen Vibrio alginolyticus.

    PubMed

    Gao, Xiating; Liu, Yang; Liu, Huan; Yang, Zhen; Liu, Qin; Zhang, Yuanxing; Wang, Qiyao

    2017-10-15

    In Vibrio species, AphB is essential to activate virulence cascades by sensing low-pH and anaerobiosis signals; however, its regulon remains largely unknown. Here, AphB is found to be a key virulence regulator in Vibrio alginolyticus , a pathogen for marine animals and humans. Chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq) enabled the detection of 20 loci in the V. alginolyticus genome that contained AphB-binding peaks. An AphB-specific binding consensus was confirmed by electrophoretic mobility shift assays (EMSAs), and the regulation of genes flanking such binding sites was demonstrated using quantitative real-time PCR analysis. AphB binds directly to its own promoter and positively controls its own expression in later growth stages. AphB also activates the expression of the exotoxin Asp by binding directly to the promoter regions of asp and the master quorum-sensing (QS) regulator luxR DNase I footprinting analysis uncovered distinct AphB-binding sites (BBS) in these promoters. Furthermore, a BBS in the luxR promoter region overlaps that of LuxR-binding site I, which mediates the positive control of luxR promoter activity by AphB. This study provides new insights into the AphB regulon and reveals the mechanisms underlying AphB regulation of physiological adaptation and QS-controlled virulence in V. alginolyticus IMPORTANCE In this work, AphB is determined to play essential roles in the expression of genes associated with QS, physiology, and virulence in V. alginolyticus , a pathogen for marine animals and humans. AphB was found to bind directly to 20 genes and control their expression by a 17-bp consensus binding sequence. Among the 20 genes, the aphB gene itself was identified to be positively autoregulated, and AphB also positively controlled asp and luxR expression. Taken together, these findings improve our understanding of the roles of AphB in controlling physiological adaptation and QS-controlled virulence gene expression. Copyright © 2017 American Society for Microbiology.

  17. Recent evolutions in flexor tendon repairs and rehabilitation.

    PubMed

    Tang, Jin Bo

    2018-06-01

    This article reviews some recent advancements in repair and rehabilitation of the flexor tendons. These include placing sparse or no peripheral suture when the core suture is strong and sufficiently tensioned, allowing the repair site to be slightly bulky, aggressively releasing the pulleys (including the entire A2 pulley or both the A3 and A4 pulleys when necessary), placing a shorter splint with less restricted wrist positioning, and allowing out-of-splint active motion. The reported outcomes have been favourable with few or no repair ruptures and no function-disturbing tendon bowstringing. These changes favour easier surgeries. The recent reports have cause to re-evaluate long-held guidelines of a non-bulky repair site and the necessity of a standard peripheral suture. Emerging understanding posits that minor clinically noticeable tendon bowstringing does not affect hand function, and that free wrist positioning and out-of-splint motion are safe when strong surgical repairs are used and the pulleys are properly released.

  18. Micropillars with a controlled number of site-controlled quantum dots

    NASA Astrophysics Data System (ADS)

    Kaganskiy, Arsenty; Gericke, Fabian; Heuser, Tobias; Heindel, Tobias; Porte, Xavier; Reitzenstein, Stephan

    2018-02-01

    We report on the realization of micropillars with site-controlled quantum dots (SCQDs) in the active layer. The SCQDs are grown via the buried stressor approach which allows for the positioned growth and device integration of a controllable number of QDs with high optical quality. This concept is very powerful as the number and the position of SCQDs in the cavity can be simultaneously controlled by the design of the buried-stressor. The fabricated micropillars exhibit a high degree of position control for the QDs above the buried stressor and Q-factors of up to 12 000 at an emission wavelength of around 930 nm. We experimentally analyze and numerically model the cavity Q-factor, the mode volume, the Purcell factor, and the photon-extraction efficiency as a function of the aperture diameter of the buried stressor. Exploiting these SCQD micropillars, we experimentally observe a Purcell enhancement in the single-QD regime with FP = 4.3 ± 0.3.

  19. Dissecting relative contributions of cis- and trans-determinants to nucleosome distribution by comparing Tetrahymena macronuclear and micronuclear chromatin.

    PubMed

    Xiong, Jie; Gao, Shan; Dui, Wen; Yang, Wentao; Chen, Xiao; Taverna, Sean D; Pearlman, Ronald E; Ashlock, Wendy; Miao, Wei; Liu, Yifan

    2016-12-01

    The ciliate protozoan Tetrahymena thermophila contains two types of structurally and functionally differentiated nuclei: the transcriptionally active somatic macronucleus (MAC) and the transcriptionally silent germ-line micronucleus (MIC). Here, we demonstrate that MAC features well-positioned nucleosomes downstream of transcription start sites and flanking splice sites. Transcription-associated trans-determinants promote nucleosome positioning in MAC. By contrast, nucleosomes in MIC are dramatically delocalized. Nucleosome occupancy in MAC and MIC are nonetheless highly correlated with each other, as well as with in vitro reconstitution and predictions based upon DNA sequence features, revealing unexpectedly strong contributions from cis-determinants. In particular, well-positioned nucleosomes are often matched with GC content oscillations. As many nucleosomes are coordinately accommodated by both cis- and trans-determinants, we propose that their distribution is shaped by the impact of these nucleosomes on the mutational and transcriptional landscape, and driven by evolutionary selection. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Structure of ATP-Bound Human ATP:Cobalamin Adenosyltransferase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schubert,H.; Hill, C.

    Mutations in the gene encoding human ATP:cobalamin adenosyltransferase (hATR) can result in the metabolic disorder known as methylmalonic aciduria (MMA). This enzyme catalyzes the final step in the conversion of cyanocobalamin (vitamin B{sub 12}) to the essential human cofactor adenosylcobalamin. Here we present the 2.5 {angstrom} crystal structure of ATP bound to hATR refined to an R{sub free} value of 25.2%. The enzyme forms a tightly associated trimer, where the monomer comprises a five-helix bundle and the active sites lie on the subunit interfaces. Only two of the three active sites within the trimer contain the bound ATP substrate, therebymore » providing examples of apo- and substrate-bound-active sites within the same crystal structure. Comparison of the empty and occupied sites indicates that twenty residues at the enzyme's N-terminus become ordered upon binding of ATP to form a novel ATP-binding site and an extended cleft that likely binds cobalamin. The structure explains the role of 20 invariant residues; six are involved in ATP binding, including Arg190, which hydrogen bonds to ATP atoms on both sides of the scissile bond. Ten of the hydrogen bonds are required for structural stability, and four are in positions to interact with cobalamin. The structure also reveals how the point mutations that cause MMA are deficient in these functions.« less

  1. Cell cycle entry triggers a switch between two modes of Cdc42 activation during yeast polarization

    PubMed Central

    Witte, Kristen; Strickland, Devin; Glotzer, Michael

    2017-01-01

    Cell polarization underlies many cellular and organismal functions. The GTPase Cdc42 orchestrates polarization in many contexts. In budding yeast, polarization is associated with a focus of Cdc42•GTP which is thought to self sustain by recruiting a complex containing Cla4, a Cdc42-binding effector, Bem1, a scaffold, and Cdc24, a Cdc42 GEF. Using optogenetics, we probe yeast polarization and find that local recruitment of Cdc24 or Bem1 is sufficient to induce polarization by triggering self-sustaining Cdc42 activity. However, the response to these perturbations depends on the recruited molecule, the cell cycle stage, and existing polarization sites. Before cell cycle entry, recruitment of Cdc24, but not Bem1, induces a metastable pool of Cdc42 that is sustained by positive feedback. Upon Cdk1 activation, recruitment of either Cdc24 or Bem1 creates a stable site of polarization that induces budding and inhibits formation of competing sites. Local perturbations have therefore revealed unexpected features of polarity establishment. DOI: http://dx.doi.org/10.7554/eLife.26722.001 PMID:28682236

  2. Active sites of two orthologous cytochromes P450 2E1: Differences revealed by spectroscopic methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anzenbacherova, Eva; Hudecek, Jiri; Murgida, Daniel

    2005-12-09

    Cytochromes P450 2E1 of human and minipig origin were examined by absorption spectroscopy under high hydrostatic pressure and by resonance Raman spectroscopy. Human enzyme tends to denature to the P420 form more easily than the minipig form; moreover, the apparent compressibility of the heme active site (as judged from a redshift of the absorption maximum with pressure) is greater than that of the minipig counterpart. Relative compactness of the minipig enzyme is also seen in the Raman spectra, where the presence of planar heme conformation was inferred from band positions characteristic of the low-spin heme with high degree of symmetry.more » In this respect, the CYP2E1 seems to be another example of P450 conformational heterogeneity as shown, e.g., by Davydov et al. for CYP3A4 [Biochem. Biophys. Res. Commun. 312 (2003) 121-130]. The results indicate that the flexibility of the CYP active site is likely one of its basic structural characteristics.« less

  3. Phonological awareness predicts activation patterns for print and speech

    PubMed Central

    Frost, Stephen J.; Landi, Nicole; Mencl, W. Einar; Sandak, Rebecca; Fulbright, Robert K.; Tejada, Eleanor T.; Jacobsen, Leslie; Grigorenko, Elena L.; Constable, R. Todd; Pugh, Kenneth R.

    2009-01-01

    Using fMRI, we explored the relationship between phonological awareness (PA), a measure of metaphonological knowledge of the segmental structure of speech, and brain activation patterns during processing of print and speech in young readers from six to ten years of age. Behavioral measures of PA were positively correlated with activation levels for print relative to speech tokens in superior temporal and occipito-temporal regions. Differences between print-elicited activation levels in superior temporal and inferior frontal sites were also correlated with PA measures with the direction of the correlation depending on stimulus type: positive for pronounceable pseudowords and negative for consonant strings. These results support and extend the many indications in the behavioral and neurocognitive literature that PA is a major component of skill in beginning readers and point to a developmental trajectory by which written language engages areas originally shaped by speech for learners on the path toward successful literacy acquisition. PMID:19306061

  4. Three-dimensional structure of thymidine phosphorylase from E. coli in complex with 3'-azido-2'-fluoro-2',3'-dideoxyuridine

    NASA Astrophysics Data System (ADS)

    Timofeev, V. I.; Abramchik, Yu. A.; Fateev, I. V.; Zhukhlistova, N. E.; Murav'eva, T. I.; Kuranova, I. P.; Esipov, R. S.

    2013-11-01

    The three-dimensional structures of thymidine phosphorylase from E. coli containing the bound sulfate ion in the phosphate-binding site and of the complex of thymidine phosphorylase with sulfate in the phosphate-binding site and the inhibitor 3'-azido-2'-fluoro-2',3'-dideoxyuridine (N3F-ddU) in the nucleoside-binding site were determined at 1.55 and 1.50 Å resolution, respectively. The amino-acid residues involved in the ligand binding and the hydrogen-bond network in the active site occupied by a large number of bound water molecules are described. A comparison of the structure of thymidine phosphorylase in complex with N3F-ddU with the structure of pyrimidine nucleoside phosphorylase from St. Aureus in complex with the natural substrate thymidine (PDB_ID: 3H5Q) shows that the substrate and the inhibitor in the nucleoside-binding pocket have different orientations. It is suggested that the position of N3F-ddU can be influenced by the presence of the azido group, which prefers a hydrophobic environment. In both structures, the active sites of the subunits are in the open conformation.

  5. Prescribed burning and wildfire risk in the 1998 fire season in Florida

    Treesearch

    John M. Pye; Jeffrey P. Prestemon; David T. Butry; Karen L. Abt

    2003-01-01

    Measures of understory burning activity in and around FIA plots in northeastern Florida were not significantly associated with reduced burning probability in the extreme fire season of 1998. In this unusual year, burn probability was greatest on ordinarily wetter sites, especially baldcypress stands, and positively associated with understory vegetation. Moderate...

  6. Simulations of CYP51A from Aspergillus fumigatus in a model bilayer provide insights into triazole drug resistance.

    PubMed

    Nash, Anthony; Rhodes, Johanna

    2018-04-01

    Azole antifungal drugs target CYP51A in Aspergillus fumigatus by binding with the active site of the protein, blocking ergosterol biosynthesis. Resistance to azole antifungal drugs is now common, with a leucine to histidine amino acid substitution at position 98 the most frequent, predominantly conferring resistance to itraconazole, although cross-resistance has been reported in conjunction with other mutations. In this study, we create a homology model of CYP51A using a recently published crystal structure of the paralog protein CYP51B. The derived structures, wild type, and L98H mutant are positioned within a lipid membrane bilayer and subjected to molecular dynamics simulations in order improve the accuracy of both models. The structural analysis from our simulations suggests a decrease in active site surface from the formation of hydrogen bonds between the histidine substitution and neighboring polar side chains, potentially preventing the binding of azole drugs. This study yields a biologically relevant structure and set of dynamics of the A. fumigatus Lanosterol 14 alpha-demethylase enzyme and provides further insight into azole antifungal drug resistance.

  7. Role of the conserved amino acids of the 'SDN' loop (Ser130, Asp131 and Asn132) in a class A beta-lactamase studied by site-directed mutagenesis.

    PubMed

    Jacob, F; Joris, B; Lepage, S; Dusart, J; Frère, J M

    1990-10-15

    Ser130, Asp131 and Asn132 ('SDN') are highly conserved residues in class A beta-lactamases forming one wall of the active-site cavity. All three residues of the SDN loop in Streptomyces albus G beta-lactamase were modified by site-directed mutagenesis. The mutant proteins were expressed in Streptomyces lividans, purified from culture supernatants and their kinetic parameters were determined for several substrates. Ser130 was substituted by Asn, Ala and Gly. The first modification yielded an almost totally inactive protein, whereas the smaller-side-chain mutants (A and G) retained some activity, but were less stable than the wild-type enzyme. Ser130 might thus be involved in maintaining the structure of the active-site cavity. Mutations of Asp131 into Glu and Gly proved to be highly detrimental to enzyme stability, reflecting significant structural perturbations. Mutation of Asn132 into Ala resulted in a dramatically decreased enzymic activity (more than 100-fold) especially toward cephalosporin substrates, kcat. being the most affected parameter, which would indicate a role of Asn132 in transition-state stabilization rather than in ground-state binding. Comparison of the N132A and the previously described N132S mutant enzymes underline the importance of an H-bond-forming residue at position 132 for the catalytic process.

  8. The contexts and early Acheulean archaeology of the EF-HR paleo-landscape (Olduvai Gorge, Tanzania).

    PubMed

    de la Torre, Ignacio; Albert, Rosa M; Macphail, Richard; McHenry, Lindsay J; Pante, Michael C; Rodríguez-Cintas, Ágata; Stanistreet, Ian G; Stollhofen, Harald

    2017-08-03

    Renewed fieldwork at the early Acheulean site of EF-HR (Olduvai Gorge, Tanzania) has included detailed stratigraphic studies of the sequence, extended excavations in the main site, and has placed eleven additional trenches within an area of nearly 1 km 2 , to sample the same stratigraphic interval as in the main trench across the broader paleo-landscape. Our new stratigraphic work suggests that EF-HR is positioned higher in the Bed II sequence than previously proposed, which has implications for the age of the site and its stratigraphic correlation to other Olduvai Middle Bed II sites. Geological research shows that the main EF-HR site was situated at the deepest part of an incised valley formed through river erosion. Archaeological excavations at the main site and nearby trenches have unearthed a large new assemblage, with more than 3000 fossils and artefacts, including a hundred handaxes in stratigraphic position. In addition, our test-trenching approach has detected conspicuous differences in the density of artefacts across the landscape, with a large cluster of archaeological material in and around the main trench, and less intense human activity at the same level in the more distant satellite trenches. All of these aspects are discussed in this paper in the light of site formation processes, behavioral contexts, and their implications for our understanding of the early Acheulean at Olduvai Gorge. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Cumulative Industrial Activity Alters Lotic Fish Assemblages in Two Boreal Forest Watersheds of Alberta, Canada

    NASA Astrophysics Data System (ADS)

    Scrimgeour, Garry J.; Hvenegaard, Paul J.; Tchir, John

    2008-12-01

    We evaluated the cumulative effects of land use disturbance resulting from forest harvesting, and exploration and extraction of oil and gas resources on the occurrence and structure of stream fish assemblages in the Kakwa and Simonette watersheds in Alberta, Canada. Logistic regression models showed that the occurrence of numerically dominant species in both watersheds was related to two metrics defining industrial activity (i.e., percent disturbance and road density), in addition to stream wetted width, elevation, reach slope, and percent fines. Occurrences of bull trout, slimy sculpin, and white sucker were negatively related to percent disturbance and that of Arctic grayling, and mountain whitefish were positively related to percent disturbance and road density. Assessments of individual sites showed that 76% of the 74 and 46 test sites in the Kakwa and Simonette watersheds were possibly impaired or impaired. Impaired sites in the Kakwa Watershed supported lower densities of bull trout, mountain whitefish, and rainbow trout, but higher densities of Arctic grayling compared to appropriate reference sites. Impaired sites in the Simonette Watershed supported lower densities of bull trout, but higher densities of lake chub compared to reference sites. Our data suggest that current levels of land use disturbance alters the occurrence and structure of stream fish assemblages.

  10. BOREAS Level-0 ER-2 Navigation Data

    NASA Technical Reports Server (NTRS)

    Strub, Richard; Dominguez, Roseanne; Newcomer, Jeffrey A.; Hall, Forrest G. (Editor)

    2000-01-01

    The BOREAS Staff Science effort covered those activities that were BOREAS community-level activities or required uniform data collection procedures across sites and time. These activities included the acquisition, processing, and archiving of aircraft navigation/attitude data to complement the digital image data. The level-0 ER-2 navigation data files contain aircraft attitude and position information acquired during the digital image and photographic data collection missions. Temporally, the data were acquired from April to September 1994. Data were recorded at intervals of 5 seconds. The data are stored in tabular ASCII files.

  11. The architecture of the spliceosomal U4/U6.U5 tri-snRNP

    PubMed Central

    Nguyen, Thi Hoang Duong; Galej, Wojciech P.; Bai, Xiao-chen; Savva, Christos G.; Newman, Andrew J.; Scheres, Sjors H. W.; Nagai, Kiyoshi

    2015-01-01

    U4/U6.U5 tri-snRNP is a 1.5 MDa pre-assembled spliceosomal complex comprising U5 snRNA, extensively base-paired U4/U6 snRNAs and >30 proteins, including the key components Prp8, Brr2 and Snu114. The tri-snRNP combines with a pre-mRNA substrate bound to U1 and U2 snRNPs and transforms into a catalytically active spliceosome following extensive compositional and conformational changes triggered by unwinding of the U4/U6 snRNAs. CryoEM single-particle reconstruction of yeast tri-snRNP at 5.9Å resolution reveals the essentially complete organization of its RNA and protein components. The single-stranded region of U4 snRNA between its 3′-stem-loop and the U4/U6 snRNA stem I is loaded into the Brr2 helicase active site ready for unwinding. Snu114 and the N-terminal domain of Prp8 position U5 snRNA to insert its Loop I, which aligns the exons for splicing, into the Prp8 active site cavity. The structure provides crucial insights into the activation process and the active site of the spliceosome. PMID:26106855

  12. Food odors trigger Drosophila males to deposit a pheromone that guides aggregation and female oviposition decisions

    PubMed Central

    Lin, Chun-Chieh; Prokop-Prigge, Katharine A; Preti, George; Potter, Christopher J

    2015-01-01

    Animals use olfactory cues for navigating complex environments. Food odors in particular provide crucial information regarding potential foraging sites. Many behaviors occur at food sites, yet how food odors regulate such behaviors at these sites is unclear. Using Drosophila melanogaster as an animal model, we found that males deposit the pheromone 9-tricosene upon stimulation with the food-odor apple cider vinegar. This pheromone acts as a potent aggregation pheromone and as an oviposition guidance cue for females. We use genetic, molecular, electrophysiological, and behavioral approaches to show that 9-tricosene activates antennal basiconic Or7a receptors, a receptor activated by many alcohols and aldehydes such as the green leaf volatile E2-hexenal. We demonstrate that loss of Or7a positive neurons or the Or7a receptor abolishes aggregation behavior and oviposition site-selection towards 9-tricosene and E2-hexenal. 9-Tricosene thus functions via Or7a to link food-odor perception with aggregation and egg-laying decisions. DOI: http://dx.doi.org/10.7554/eLife.08688.001 PMID:26422512

  13. Chloride sensing by WNK1 kinase involves inhibition of autophosphorylation

    PubMed Central

    Piala, Alexander T.; Moon, Thomas M.; Akella, Radha; He, Haixia; Cobb, Melanie H.; Goldsmith, Elizabeth J.

    2014-01-01

    WNK1 [with no lysine (K)] is a serine-threonine kinase associated with a form of familial hypertension. WNK1 is at the top of a kinase cascade leading to phosphorylation of several cotransporters, in particular those transporting sodium, potassium, and chloride (NKCC), sodium and chloride (NCC), and potassium and chloride (KCC). The responsiveness of NKCC, NCC, and KCC to changes in extracellular chloride parallels their phosphorylation state, provoking the proposal that these transporters are controlled by a chloride-sensitive protein kinase. Here, we found that chloride stabilizes the inactive conformation of WNK1, preventing kinase autophosphorylation and activation. Crystallographic studies of inactive WNK1 in the presence of chloride revealed that chloride binds directly to the catalytic site, providing a basis for the unique position of the catalytic lysine. Mutagenesis of the chloride binding site rendered the kinase less sensitive to inhibition of autophosphorylation by chloride, validating the binding site. Thus, these data suggest that WNK1 functions as a chloride sensor through direct binding of a regulatory chloride ion to the active site, which inhibits autophosphorylation. PMID:24803536

  14. A PLC-γ1 Feedback Pathway Regulates Lck Substrate Phosphorylation at the T-Cell Receptor and SLP-76 Complex.

    PubMed

    Belmont, Judson; Gu, Tao; Mudd, Ashley; Salomon, Arthur R

    2017-08-04

    Phospholipase C gamma 1 (PLC-γ1) occupies a critically important position in the T-cell signaling pathway. While its functions as a regulator of both Ca 2+ signaling and PKC-family kinases are well characterized, PLC-γ1's role in the regulation of early T-cell receptor signaling events is incompletely understood. Activation of the T-cell receptor leads to the formation of a signalosome complex between SLP-76, LAT, PLC-γ1, Itk, and Vav1. Recent studies have revealed the existence of both positive and negative feedback pathways from SLP-76 to the apical kinase in the pathway, Lck. To determine if PLC-γ1 contributes to the regulation of these feedback networks, we performed a quantitative phosphoproteomic analysis of PLC-γ1-deficient T cells. These data revealed a previously unappreciated role for PLC-γ1 in the positive regulation of Zap-70 and T-cell receptor tyrosine phosphorylation. Conversely, PLC-γ1 negatively regulated the phosphorylation of SLP-76-associated proteins, including previously established Lck substrate phosphorylation sites within this complex. While the positive and negative regulatory phosphorylation sites on Lck were largely unchanged, Tyr 192 phosphorylation was elevated in Jgamma1. The data supports a model wherein Lck's targeting, but not its kinase activity, is altered by PLC-γ1, possibly through Lck Tyr 192 phosphorylation and increased association of the kinase with protein scaffolds SLP-76 and TSAd.

  15. Selection of the simplest RNA that binds isoleucine

    PubMed Central

    LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

    2003-01-01

    We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

  16. Alteration of the Regiospecificity of Human Heme Oxygenase-1 by Unseating of the Heme but not Disruption of the Distal Hydrogen Bonding Network†

    PubMed Central

    Wang, Jinling; Evans, John P.; Ogura, Hiroshi; La Mar, Gerd N.; Ortiz de Montellano, Paul R.

    2008-01-01

    Heme oxygenase regiospecifically oxidizes heme at the α-meso position to give biliverdin IXα, CO, and iron. The heme orientation within the active site, which is thought to determine the oxidation regiospecificity, is shown here for the human enzyme (hHO1) to be largely determined by interactions between the heme carboxylic acid groups and residues Arg183 and Lys18 but not Tyr134. Mutation of either Arg183 or Lys18 individually does not significantly alter the NADPH-cytochrome P450 reductase-dependent reaction regiochemistry, but partially shifts the oxidation to the β/δ-meso positions in the reaction supported by ascorbic acid. Mutation of Glu29 to a lysine, which places a positive charge where it can interact with a heme carboxyl if the heme rotates by ~90°, causes a slight loss of regiospecificity, but combined with the R183E and K18E mutations results primarily in β/δ-meso oxidation of the heme under all conditions. NMR analysis of heme binding to the triple K18E/E29K/R183E mutant confirms rotation of the heme in the active site. Kinetic studies demonstrate that mutations of Arg183 greatly impair the rate of the P450 reductase-dependent reaction, in accord with the earlier finding that Arg183 is involved in binding of the reductase to hHO1, but have little effect on the ascorbate reaction. Mutations of Asp140 and Tyr58 that disrupt the active site hydrogen bonding network, impair catalytic rates but do not influence the oxidation regiochemistry. The results indicate both that the oxidation regiochemistry is largely controlled by ionic interactions of the heme propionic acid groups with the protein and that shifts in regiospecificity involve rotation of the heme about an axis perpendicular to the heme plane. PMID:16388581

  17. Labeled nucleotide phosphate (NP) probes

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2009-02-03

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  18. Composition for nucleic acid sequencing

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  19. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-06-06

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  20. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-05-30

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  1. Different integrated geophysical approaches to investigate archaeological sites in urban and suburban area.

    NASA Astrophysics Data System (ADS)

    Piro, Salvatore; Papale, Enrico; Zamuner, Daniela

    2016-04-01

    Geophysical methods are frequently used in archaeological prospection in order to provide detailed information about the presence of structures in the subsurface as well as their position and their geometrical reconstruction, by measuring variations of some physical properties. Often, due to the limited size and depth of an archaeological structure, it may be rather difficult to single out its position and extent because of the generally low signal-to-noise ratio. This problem can be overcome by improving data acquisition, processing techniques and by integrating different geophysical methods. In this work, two sites of archaeological interest, were investigated employing several methods (Ground Penetrating Radar (GPR), Electrical Resistivity Tomography (ERT), Fluxgate Differential Magnetic) to obtain precise and detailed maps of subsurface bodies. The first site, situated in a suburban area between Itri and Fondi, in the Aurunci Natural Regional Park (Central Italy), is characterized by the presence of remains of past human activity dating from the third century B.C. The second site, is instead situated in an urban area in the city of Rome (Basilica di Santa Balbina), where historical evidence is also present. The methods employed, allowed to determine the position and the geometry of some structures in the subsurface related to this past human activity. To have a better understanding of the subsurface, we then performed a qualitative and quantitative integration of this data, which consists in fusing the data from all the methods used, to have a complete visualization of the investigated area. Qualitative integration consists in graphically overlaying the maps obtained by the single methods; this method yields only images, not new data that may be subsequently analyzed. Quantitative integration is instead performed by mathematical and statistical solutions, which allows to have a more accurate reconstruction of the subsurface and generates new data with high information content.

  2. An active site mutant of Escherichia coli cyclopropane fatty acid synthase forms new non-natural fatty acids providing insights on the mechanism of the enzymatic reaction.

    PubMed

    E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique

    2013-12-01

    We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  3. Investigation on Quantitative Structure Activity Relationships and Pharmacophore Modeling of a Series of mGluR2 Antagonists

    PubMed Central

    Zhang, Meng-Qi; Zhang, Xiao-Le; Li, Yan; Fan, Wen-Jia; Wang, Yong-Hua; Hao, Ming; Zhang, Shu-Wei; Ai, Chun-Zhi

    2011-01-01

    MGluR2 is G protein-coupled receptor that is targeted for diseases like anxiety, depression, Parkinson’s disease and schizophrenia. Herein, we report the three-dimensional quantitative structure–activity relationship (3D-QSAR) studies of a series of 1,3-dihydrobenzo[ b][1,4]diazepin-2-one derivatives as mGluR2 antagonists. Two series of models using two different activities of the antagonists against rat mGluR2, which has been shown to be very similar to the human mGluR2, (activity I: inhibition of [3H]-LY354740; activity II: mGluR2 (1S,3R)-ACPD inhibition of forskolin stimulated cAMP.) were derived from datasets composed of 137 and 69 molecules respectively. For activity I study, the best predictive model obtained from CoMFA analysis yielded a Q2 of 0.513, R2 ncv of 0.868, R2 pred = 0.876, while the CoMSIA model yielded a Q2 of 0.450, R2 ncv = 0.899, R2 pred = 0.735. For activity II study, CoMFA model yielded statistics of Q2 = 0.5, R2 ncv = 0.715, R2 pred = 0.723. These results prove the high predictability of the models. Furthermore, a combined analysis between the CoMFA, CoMSIA contour maps shows that: (1) Bulky substituents in R7, R3 and position A benefit activity I of the antagonists, but decrease it when projected in R8 and position B; (2) Hydrophilic groups at position A and B increase both antagonistic activity I and II; (3) Electrostatic field plays an essential rule in the variance of activity II. In search for more potent mGluR2 antagonists, two pharmacophore models were developed separately for the two activities. The first model reveals six pharmacophoric features, namely an aromatic center, two hydrophobic centers, an H-donor atom, an H-acceptor atom and an H-donor site. The second model shares all features of the first one and has an additional acceptor site, a positive N and an aromatic center. These models can be used as guidance for the development of new mGluR2 antagonists of high activity and selectivity. This work is the first report on 3D-QSAR modeling of these mGluR2 antagonists. All the conclusions may lead to a better understanding of the mechanism of antagonism and be helpful in the design of new potent mGluR2 antagonists. PMID:22016641

  4. Investigation on quantitative structure activity relationships and pharmacophore modeling of a series of mGluR2 antagonists.

    PubMed

    Zhang, Meng-Qi; Zhang, Xiao-Le; Li, Yan; Fan, Wen-Jia; Wang, Yong-Hua; Hao, Ming; Zhang, Shu-Wei; Ai, Chun-Zhi

    2011-01-01

    MGluR2 is G protein-coupled receptor that is targeted for diseases like anxiety, depression, Parkinson's disease and schizophrenia. Herein, we report the three-dimensional quantitative structure-activity relationship (3D-QSAR) studies of a series of 1,3-dihydrobenzo[ b][1,4]diazepin-2-one derivatives as mGluR2 antagonists. Two series of models using two different activities of the antagonists against rat mGluR2, which has been shown to be very similar to the human mGluR2, (activity I: inhibition of [(3)H]-LY354740; activity II: mGluR2 (1S,3R)-ACPD inhibition of forskolin stimulated cAMP.) were derived from datasets composed of 137 and 69 molecules respectively. For activity I study, the best predictive model obtained from CoMFA analysis yielded a Q(2) of 0.513, R(2) (ncv) of 0.868, R(2) (pred) = 0.876, while the CoMSIA model yielded a Q(2) of 0.450, R(2) (ncv) = 0.899, R(2) (pred) = 0.735. For activity II study, CoMFA model yielded statistics of Q(2) = 0.5, R(2) (ncv) = 0.715, R(2) (pred) = 0.723. These results prove the high predictability of the models. Furthermore, a combined analysis between the CoMFA, CoMSIA contour maps shows that: (1) Bulky substituents in R(7), R(3) and position A benefit activity I of the antagonists, but decrease it when projected in R(8) and position B; (2) Hydrophilic groups at position A and B increase both antagonistic activity I and II; (3) Electrostatic field plays an essential rule in the variance of activity II. In search for more potent mGluR2 antagonists, two pharmacophore models were developed separately for the two activities. The first model reveals six pharmacophoric features, namely an aromatic center, two hydrophobic centers, an H-donor atom, an H-acceptor atom and an H-donor site. The second model shares all features of the first one and has an additional acceptor site, a positive N and an aromatic center. These models can be used as guidance for the development of new mGluR2 antagonists of high activity and selectivity. This work is the first report on 3D-QSAR modeling of these mGluR2 antagonists. All the conclusions may lead to a better understanding of the mechanism of antagonism and be helpful in the design of new potent mGluR2 antagonists.

  5. Mineralogical impact on long-term patterns of soil nitrogen and phosphorus enzyme activities

    NASA Astrophysics Data System (ADS)

    Mikutta, Robert; Turner, Stephanie; Meyer-Stüve, Sandra; Guggenberger, Georg; Dohrmann, Reiner; Schippers, Axel

    2014-05-01

    Soil chronosequences provide a unique opportunity to study microbial activity over time in mineralogical diverse soils of different ages. The main objective of this study was to test the effect of mineralogical properties, nutrient and organic matter availability over whole soil pro-files on the abundance and activity of the microbial communities. We focused on microbio-logical processes involved in nitrogen and phosphorus cycling at the 120,000-year Franz Josef soil chronosequence. Microbial abundances (microbial biomass and total cell counts) and enzyme activities (protease, urease, aminopeptidase, and phosphatase) were determined and related to nutrient contents and mineralogical soil properties. Both, microbial abundances and enzyme activities decreased with soil depth at all sites. In the organic layers, microbial biomass and the activities of N-hydrolyzing enzymes showed their maximum at the intermediate-aged sites, corresponding to a high aboveground biomass. In contrast, the phosphatase activity increased with site age. The activities of N-hydrolyzing enzymes were positively correlated with total carbon and nitrogen contents, whereas the phosphatase activity was negatively correlated with the phosphorus content. In the mineral soil, the enzyme activities were generally low, thus reflecting the presence of strongly sorbing minerals. Sub-strate-normalized enzyme activities correlated negatively to clay content as well as poorly crystalline Al and Fe oxyhydroxides, supporting the view that the evolution of reactive sec-ondary mineral phases alters the activity of the microbial communities by constraining sub-strate availability. Our data suggest a strong mineralogical influence on nutrient cycling par-ticularly in subsoil environments.

  6. Ultrasonographic measurements of lower trapezius muscle thickness at rest and during isometric contraction: a reliability study.

    PubMed

    Talbott, Nancy R; Witt, Dexter W

    2014-07-01

    The purpose of this study was to determine the intra-rater reliability and inter-rater reliability of ultrasound imaging (USI) thickness measurements of the lower trapezius (LT) at rest and during active contractions when the transverse process and the lamina were used as reference sites for the measurement process. Twenty healthy individuals between the ages of 22 and 32 years volunteered. With the subject prone and the shoulder in 145° of abduction, images of the LT were taken bilaterally by one examiner as the subject: (1) rested; (2) actively held the test position; and (3) actively held the test position while holding a weight. Ten subjects returned and testing was repeated by the same examiner and by a second examiner. LT thickness measurements were recorded at the level of the transverse process and at the level of the lamina. Intra-class correlation coefficients (ICC) for within session intra-rater reliability (ICC3,3) ranged from 0.951 to 0.986 for both measurement sites while between session intra-rater reliability (ICC3,2) ranged from 0.935 to 0.962. Within session inter-rater reliability (ICC2,2) ranged from 0.934 to 0.973. USI can be used to reliably measure LT thickness at rest, during active contraction and during active contraction when holding a weight. The described protocol can be utilized during shoulder examinations to provide an additional assessment tool for monitoring changes in LT thickness.

  7. Diels-Alder active-template synthesis of rotaxanes and metal-ion-switchable molecular shuttles.

    PubMed

    Crowley, James D; Hänni, Kevin D; Leigh, David A; Slawin, Alexandra M Z

    2010-04-14

    A synthesis of [2]rotaxanes in which Zn(II) or Cu(II) Lewis acids catalyze a Diels-Alder cycloaddition to form the axle while simultaneously acting as the template for the assembly of the interlocked molecules is described. Coordination of the Lewis acid to a multidentate endotopic 2,6-di(methyleneoxymethyl)pyridyl- or bipyridine-containing macrocycle orients a chelated dienophile through the macrocycle cavity. Lewis acid activation of the double bond causes it to react with an incoming "stoppered" diene, affording the [2]rotaxane in up to 91% yield. Unusually for an active-template synthesis, the metal binding site "lives on" in these rotaxanes. This was exploited in the synthesis of a molecular shuttle containing two different ligating sites in which the position of the macrocycle could be switched by complexation with metal ions [Zn(II) and Pd(II)] with different preferred coordination geometries.

  8. Activity-based assay for ricin-like toxins

    DOEpatents

    Keener, William K.; Ward, Thomas E.

    2007-02-06

    A method of detecting N-glycosylase activity in a sample involves incubating an oligodeoxyribonucleotide substrate containing a deoxyadenosine or deoxyuridine residue with the sample to be tested such that the N-glycosylase, if present, hydrolyzes the deoxyadenosine or deoxyuridine residue to result in an N-glycosylase product having an abasic site. A primer is annealed to the N-glycosylase product, and the primer is extended with a DNA polymerase, such as Taq DNA polymerase, that pauses at abasic sites. The resulting extension products are melted from the N-glycosylase product, allowed to form hairpins due to self-complementarity, and further extended in the presence of labeled precursors to result in labeled products. Extension products synthesized from undigested substrate as template do not result in labeled products. Thus, detection of labeled products results in detection of N-glycosylase activity. Oligodeoxyribonucleotide substrates, primer, and positive controls and a kit for N-glycosylase assay are also disclosed.

  9. A dynamically coupled allosteric network underlies binding cooperativity in Src kinase

    PubMed Central

    Foda, Zachariah H.; Shan, Yibing; Kim, Eric T.; Shaw, David E.; Seeliger, Markus A.

    2015-01-01

    Protein tyrosine kinases are attractive drug targets because many human diseases are associated with the deregulation of kinase activity. However, how the catalytic kinase domain integrates different signals and switches from an active to an inactive conformation remains incompletely understood. Here we identify an allosteric network of dynamically coupled amino acids in Src kinase that connects regulatory sites to the ATP- and substrate-binding sites. Surprisingly, reactants (ATP and peptide substrates) bind with negative cooperativity to Src kinase while products (ADP and phosphopeptide) bind with positive cooperativity. We confirm the molecular details of the signal relay through the allosteric network by biochemical studies. Experiments on two additional protein tyrosine kinases indicate that the allosteric network may be largely conserved among these enzymes. Our work provides new insights into the regulation of protein tyrosine kinases and establishes a potential conduit by which resistance mutations to ATP-competitive kinase inhibitors can affect their activity. PMID:25600932

  10. Disappointment and regret enhance corrugator reactivity in a gambling task.

    PubMed

    Wu, Yin; Clark, Luke

    2015-04-01

    This study investigated how the corrugator and zygomaticus respond to decision outcomes (i.e., gains and losses). We used a gambling task in which participants were presented with obtained followed by non-obtained outcomes. Activity at the corrugator site was sensitive to decision outcomes, such that higher obtained losses (disappointment) and higher non-obtained gains (regret) both heightened corrugator reactivity. Activity at the zygomaticus site was not responsive to obtained or non-obtained outcomes, but did show sensitivity to emotional images in the same participants, in the form of a positive linear relationship with self-reported emotional valence. Corrugator activity was negatively related to emotional valence. The findings indicate the sensitivity of corrugator to objective decision outcomes and also counterfactual comparisons, highlighting the utility of facial electromyography in research on decision making and gambling behavior. © 2014 The Authors. Psychophysiology published by Wiley Periodicals, Inc. on behalf of Society for Psychophysiological Research.

  11. Interaction of mining activities and aquatic environment: A review from Greek mine sites.

    NASA Astrophysics Data System (ADS)

    Vasileiou, Eleni; Kallioras, Andreas

    2016-04-01

    In Greece a significant amount of mineral and ore deposits have been recorded accompanied by large industrial interest and a long mining history. Today many active and/or abandoned mine sites are scattered within the country; while mining activities take place in different sites for exploiting various deposits (clay, limestone, slate, gypsum, kaolin, mixed sulphide ores (lead, zinc, olivine, pozzolan, quartz lignite, nickel, magnesite, aluminum, bauxite, gold, marbles etc). The most prominent recent ones are: (i) the lignite exploitation that is extended in the area of Ptolemais (Western Macedonia) and Megalopolis (Central Peloponnese); and (ii) the major bauxite deposits located in central Greece within the Parnassos-Ghiona geotectonic zone and on Euboea Island. In the latter area, significant ores of magnesite were exploited and mixed sulphide ores. Centuries of intensive mining exploitation and metallurgical treatment of lead-silver deposits in Greece, have also resulted in significant abandoned sites, such as the one in Lavrion. Mining activities in Lavrio, were initiated in ancient times and continued until the 1980s, resulting in the production of significant waste stockpiles deposited in the area, crucial for the local water resources. Ιn many mining sites, environmental pressures are also recorded after the mine closure to the aquatic environment, as the surface waters flow through waste dump areas and contaminated soils. This paper aims to the geospatial visualization of the mining activities in Greece, in connection to their negative (surface- and/or ground-water pollution; overpumping due to extensive dewatering practices) or positive (enhanced groundwater recharge; pit lakes, improvement of water budget in the catchment scale) impacts on local water resources.

  12. Mutations close to a hub residue affect the distant active site of a GH1 β-glucosidase.

    PubMed

    Souza, Valquiria P; Ikegami, Cecília M; Arantes, Guilherme M; Marana, Sandro R

    2018-01-01

    The tertiary structure of proteins has been represented as a network, in which residues are nodes and their contacts are edges. Protein structure networks contain residues, called hubs or central, which are essential to form short connection pathways between any pair of nodes. Hence hub residues may effectively spread structural perturbations through the protein. To test whether modifications nearby to hub residues could affect the enzyme active site, mutations were introduced in the β-glycosidase Sfβgly (PDB-ID: 5CG0) directed to residues that form an α-helix (260-265) and a β-strand (335-337) close to one of its main hub residues, F251, which is approximately 14 Å from the Sfβgly active site. Replacement of residues A263 and A264, which side-chains project from the α-helix towards F251, decreased the rate of substrate hydrolysis. Mutation A263F was shown to weaken noncovalent interactions involved in transition state stabilization within the Sfβgly active site. Mutations placed on the opposite side of the same α-helix did not show these effects. Consistently, replacement of V336, which side-chain protrudes from a β-strand face towards F251, inactivated Sfβgly. Next to V336, mutation S337F also caused a decrease in noncovalent interactions involved in transition state stabilization. Therefore, we suggest that mutations A263F, A264F, V336F and S337F may directly perturb the position of the hub F251, which could propagate these perturbations into the Sfβgly active site through short connection pathways along the protein network.

  13. Structural Characterization of a Human-Type Corrinoid Adenosyltransferase Confirms That Coenzyme B[subscript 12] Is Synthesized through a Four-Coordinate Intermediate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    St. Maurice, Martin; Mera, Paola; Park, Kiyoung

    ATP:cob(I)alamin adenosyltransferases (ACAs) catalyze the transfer of the 5{prime}-deoxyadenosyl moiety from ATP to the upper axial ligand position of cobalamin in the synthesis of coenzyme B{sub 12}. For the ACA-catalyzed reaction to proceed, cob(II)alamin must be reduced to cob(I)alamin in the enzyme active site. This reduction is facilitated through the generation of a four-coordinate cob(II)alamin intermediate on the enzyme. We have determined the high-resolution crystal structure of a human-type ACA from Lactobacillus reuteri with a four-coordinate cob(II)alamin bound in the enzyme active site and with the product, adenosylcobalamin, partially occupied in the active site. The assembled structures represent snapshots ofmore » the steps in the ACA-catalyzed formation of the cobalt-carbon bond of coenzyme B{sub 12}. The structures define the corrinoid binding site and provide visual evidence for a base-off, four-coordinate cob(II)alamin intermediate. The complete structural description of ACA-mediated catalysis reveals the molecular features of four-coordinate cob(II)alamin stabilization and provides additional insights into the molecular basis for dysfunction in human patients suffering from methylmalonic aciduria.« less

  14. Structure of tropinone reductase-II complexed with NADP+ and pseudotropine at 1.9 A resolution: implication for stereospecific substrate binding and catalysis.

    PubMed

    Yamashita, A; Kato, H; Wakatsuki, S; Tomizaki, T; Nakatsu, T; Nakajima, K; Hashimoto, T; Yamada, Y; Oda, J

    1999-06-15

    Tropinone reductase-II (TR-II) catalyzes the NADPH-dependent reduction of the carbonyl group of tropinone to a beta-hydroxyl group. The crystal structure of TR-II complexed with NADP+ and pseudotropine (psi-tropine) has been determined at 1.9 A resolution. A seven-residue peptide near the active site, disordered in the unliganded structure, is fixed in the ternary complex by participation of the cofactor and substrate binding. The psi-tropine molecule is bound in an orientation which satisfies the product configuration and the stereochemical arrangement toward the cofactor. The substrate binding site displays a complementarity to the bound substrate (psi-tropine) in its correct orientation. In addition, electrostatic interactions between the substrate and Glu156 seem to specify the binding position and orientation of the substrate. A comparison between the active sites in TR-II and TR-I shows that they provide different van der Waals surfaces and electrostatic features. These differences likely contribute to the correct binding mode of the substrates, which are in opposite orientations in TR-II and TR-I, and to different reaction stereospecificities. The active site structure in the TR-II ternary complex also suggests that the arrangement of the substrate, cofactor, and catalytic residues is stereoelectronically favorable for the reaction.

  15. Investigating mycobacterial topoisomerase I mechanism from the analysis of metal and DNA substrate interactions at the active site.

    PubMed

    Cao, Nan; Tan, Kemin; Annamalai, Thirunavukkarasu; Joachimiak, Andrzej; Tse-Dinh, Yuk-Ching

    2018-06-14

    We have obtained new crystal structures of Mycobacterium tuberculosis topoisomerase I, including structures with ssDNA substrate bound to the active site, with and without Mg2+ ion present. Significant enzyme conformational changes upon DNA binding place the catalytic tyrosine in a pre-transition state position for cleavage of a specific phosphodiester linkage. Meanwhile, the enzyme/DNA complex with bound Mg2+ ion may represent the post-transition state for religation in the enzyme's multiple-step DNA relaxation catalytic cycle. The first observation of Mg2+ ion coordinated with the TOPRIM residues and DNA phosphate in a type IA topoisomerase active site allows assignment of likely catalytic role for the metal and draws a comparison to the proposed mechanism for type IIA topoisomerases. The critical function of a strictly conserved glutamic acid in the DNA cleavage step was assessed through site-directed mutagenesis. The functions assigned to the observed Mg2+ ion can account for the metal requirement for DNA rejoining but not DNA cleavage by type IA topoisomerases. This work provides new structural insights into a more stringent requirement for DNA rejoining versus cleavage in the catalytic cycle of this essential enzyme, and further establishes the potential for selective interference of DNA rejoining by this validated TB drug target.

  16. Ligand uptake in Mycobacterium tuberculosis truncated hemoglobins is controlled by both internal tunnels and active site water molecules.

    PubMed

    Boron, Ignacio; Bustamante, Juan Pablo; Davidge, Kelly S; Singh, Sandip; Bowman, Lesley Ah; Tinajero-Trejo, Mariana; Carballal, Sebastián; Radi, Rafael; Poole, Robert K; Dikshit, Kanak; Estrin, Dario A; Marti, Marcelo A; Boechi, Leonardo

    2015-01-01

    Mycobacterium tuberculosis, the causative agent of human tuberculosis, has two proteins belonging to the truncated hemoglobin (trHb) family. Mt-trHbN presents well-defined internal hydrophobic tunnels that allow O 2 and • NO to migrate easily from the solvent to the active site, whereas Mt-trHbO possesses tunnels interrupted by a few bulky residues, particularly a tryptophan at position G8. Differential ligand migration rates allow Mt-trHbN to detoxify • NO, a crucial step for pathogen survival once under attack by the immune system, much more efficiently than Mt-trHbO. In order to investigate the differences between these proteins, we performed experimental kinetic measurements, • NO decomposition, as well as molecular dynamics simulations of the wild type Mt-trHbN and two mutants, VG8F and VG8W. These mutations affect both the tunnels accessibility as well as the affinity of distal site water molecules, thus modifying the ligand access to the iron. We found that a single mutation allows Mt-trHbN to acquire ligand migration rates comparable to those observed for Mt-trHbO, confirming that ligand migration is regulated by the internal tunnel architecture as well as by water molecules stabilized in the active site.

  17. Clinical usefulness of fracture site in situ block on lumbar spine transverse process fracture.

    PubMed

    Park, Jun-Mo; Kwak, Kyung-Hwa

    2014-11-01

    Lumbar spine transverse process fractures (LSTPFs) are uncommon and frequently overlooked on plain film radiographs. Even when recognized, they are often regarded as trivial and minimally painful injuries compared with combined serious major abdominal, pelvic, and spinal injuries. Conservative treatments are usually offered to patients with LSTPFs. This report presents 4 cases of LSTPFs where symptoms did not improve after more than 1 week of conservative management. Local anesthetics and steroids were injected directly into the fracture site under computed tomography guidance, referred to as a fracture site in situ block, in an attempt to accelerate the return to daily lives and professional activities. Three of the 4 patients returned to their daily lives almost immediately after completing the procedure. Although the procedure was appropriately performed at L4, 1 patient still complained of pain. This patient's all films were meticulously re-examined, and it was determined that a transverse process fracture was present at not only L4 but also L1. This report introduces a method of active treatment to help patients with LSTPFs quickly return to their daily lives and professional activities. The positive results in these cases suggest that fracture site in situ block might be a useful option for treating patients with LSTPFs. © 2014 World Institute of Pain.

  18. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  19. Glycerol dehydratation by the B12-independent enzyme may not involve the migration of a hydroxyl group: a computational study.

    PubMed

    Feliks, Mikolaj; Ullmann, G Matthias

    2012-06-21

    A combination of continuum electrostatic and density functional calculations has been employed to study the mechanism of the B(12)-independent glycerol dehydratase, a novel glycyl-radical enzyme involved in the microbial conversion of glycerol to 3-hydroxylpropionaldehyde. The calculations indicate that the dehydratation of glycerol by the B(12)-independent enzyme does not need to involve a mechanistically complicated migration of the middle hydroxyl group to one of the two terminal positions of a molecule, as previously suggested. Instead, the reaction can proceed in three elementary steps. First, a radical transfer from the catalytically active Cys433 to the ligand generates a substrate-related intermediate. Second, a hydroxyl group splits off at the middle position of the ligand and is protonated by the neighboring His164 to form a water molecule. The other active site residue Glu435 accepts a proton from one of the terminal hydroxyl groups of the ligand and a C═O double bond is created. Third, the reaction is completed by a radical back transfer from the product-related intermediate to Cys433. On the basis of our calculations, the catalytic functions of the active site residues have been suggested. Cys433 is a radical relay site; His164 and Glu435 make up a proton accepting/donating system; Asn156, His281, and Asp447 form a network of hydrogen bonds responsible for the electrostatic stabilization of the transition state. A synergistic participation of these residues in the reaction seems to be crucial for the catalysis.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Slade, Daniel J.; Fang, Pengfei; Dreyton, Christina J.

    Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ionsmore » that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs.« less

  1. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    PubMed

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Salt Effect on the Antioxidant Activity of Red Microalgal Sulfated Polysaccharides in Soy-Bean Formula

    PubMed Central

    Burg, Ariela; Oshrat, Levy-Ontman

    2015-01-01

    Sulfated polysaccharides produced by microalgae, which are known to exhibit various biological activities, may potentially serve as natural antioxidant sources. To date, only a few studies have examined the antioxidant bioactivity of red microalgal polysaccharides. In this research, the effect of different salts on the antioxidant activities of two red microalgal sulfated polysaccharides derived from Porphyridium sp. and Porphyridium aerugineum were studied in a soy bean-based infant milk formula. Salt composition and concentration were both shown to affect the polysaccharides’ antioxidant activity. It can be postulated that the salt ions intefer with the polysaccharide chains’ interactions and alter their structure, leading to a new three-dimensional structure that better exposes antiooxidant sites in comparison to the polysaccharide without salt supplement. Among the cations that were studied, Ca2+ had the strongest enhancement effect on antioxidant activities of both polysaccharides. Understanding the effect of salts on polysaccharides’ stucture, in addition to furthering knowledge on polysaccharide bioactivities, may also shed light on the position of the antioxidant active sites. PMID:26492255

  3. Delafloxacin, a non-zwitterionic fluoroquinolone in Phase III of clinical development: evaluation of its pharmacology, pharmacokinetics, pharmacodynamics and clinical efficacy.

    PubMed

    Van Bambeke, Françoise

    2015-01-01

    Delafloxacin is a fluoroquinolone lacking a basic substituent in position 7. It shows MICs remarkably low against Gram-positive organisms and anaerobes and similar to those of ciprofloxacin against Gram-negative bacteria. It remains active against most fluoroquinolone-resistant strains, except enterococci. Its potency is further increased in acidic environments (found in many infection sites). Delafloxacin is active on staphylococci growing intracellularly or in biofilms. It is currently evaluated as an intravenous and intravenous/oral stepdown therapy in Phase III trials for the treatment of complicated skin/skin structure infections. It was also granted as Qualified Infectious Disease Product for the treatment of acute bacterial skin and skin structure infections and community-acquired bacterial pneumonia, due to its high activity on pneumococci and atypical pathogens.

  4. Electrochemical activity of Fe-MIL-100 as a positive electrode for Na-ion batteries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sava Gallis, Dorina F.; Pratt III, Harry D.; Anderson, Travis M.

    2016-01-01

    Here we investigate the electrochemical activity of metal-organic frameworks (MOFs) as positive electrodes for Na-ion batteries in coin cell configurations. The performance of Fe-MIL-100 material is highly dependent on the choice of sodium salt source, and electrolyte system. The overall capacity fades over many cycles, however the high Coulombic efficiency is maintained. This can be correlated with inaccessibility of active sites for Na intercalation, due to the increase of extra carbonaceous material inside the pores. High resolution synchrotron powder X-ray and pair distribution function analyses of the as-made and cycled electrodes reveal the structure maintains the long-range order with progressivemore » cycling. This finding suggests that careful consideration of all variables in battery components, and especially electrolyte selection can lead to greatly improved performances.« less

  5. Low- and room-temperature X-ray structures of protein kinase A ternary complexes shed new light on its activity.

    PubMed

    Kovalevsky, Andrey Y; Johnson, Hanna; Hanson, B Leif; Waltman, Mary Jo; Fisher, S Zoe; Taylor, Susan; Langan, Paul

    2012-07-01

    Post-translational protein phosphorylation by protein kinase A (PKA) is a ubiquitous signalling mechanism which regulates many cellular processes. A low-temperature X-ray structure of the ternary complex of the PKA catalytic subunit (PKAc) with ATP and a 20-residue peptidic inhibitor (IP20) at the physiological Mg(2+) concentration of ∼0.5 mM (LT PKA-MgATP-IP20) revealed a single metal ion in the active site. The lack of a second metal in LT PKA-MgATP-IP20 renders the β- and γ-phosphoryl groups of ATP very flexible, with high thermal B factors. Thus, the second metal is crucial for tight positioning of the terminal phosphoryl group for transfer to a substrate, as demonstrated by comparison of the former structure with that of the LT PKA-Mg(2)ATP-IP20 complex obtained at high Mg(2+) concentration. In addition to its kinase activity, PKAc is also able to slowly catalyze the hydrolysis of ATP using a water molecule as a substrate. It was found that ATP can be readily and completely hydrolyzed to ADP and a free phosphate ion in the crystals of the ternary complex PKA-Mg(2)ATP-IP20 by X-ray irradiation at room temperature. The cleavage of ATP may be aided by X-ray-generated free hydroxyl radicals, a very reactive chemical species, which move rapidly through the crystal at room temperature. The phosphate anion is clearly visible in the electron-density maps; it remains in the active site but slides about 2 Å from its position in ATP towards Ala21 of IP20, which mimics the phosphorylation site. The phosphate thus pushes the peptidic inhibitor away from the product ADP, while resulting in dramatic conformational changes of the terminal residues 24 and 25 of IP20. X-ray structures of PKAc in complex with the nonhydrolysable ATP analogue AMP-PNP at both room and low temperature demonstrated no temperature effects on the conformation and position of IP20.

  6. Photoactivable analogs for labeling 25-hydroxyvitamin D3 serum binding protein and for 1,25-dihydroxyvitamin D3 intestinal receptor protein

    NASA Technical Reports Server (NTRS)

    Kutner, A.; Link, R. P.; Schnoes, H. K.; DeLuca, H. F.

    1986-01-01

    3-Azidobenzoates and 3-azidonitrobenzoates of 25-hydroxyvitamin D3 as well as 3-deoxy-3-azido-25-hydroxyvitamin D3 and 3-deoxy-3-azido-1,25-dihydroxyvitamin D3 were prepared as photoaffinity labels for vitamin D serum binding protein and 1,25-dihydroxyvitamin D3 intestinal receptor protein. The compounds prepared were easily activated by short- or long-wavelength uv light, as monitored by uv and ir spectrometry. The efficacy of the compounds to compete with 25-hydroxyvitamin D3 or 1,25-dihydroxyvitamin D3 for the binding site of serum binding protein and receptor, respectively, was studied to evaluate the vitamin D label with the highest affinity for the protein. The presence of an azidobenzoate or azidonitrobenzoate substituent at the C-3 position of 25-OH-D3 significantly decreased (10(4)- to 10(6)-fold) the binding activity. However, the labels containing the azido substituent attached directly to the vitamin D skeleton at the C-3 position showed a high affinity, only 20- to 150-fold lower than that of the parent compounds with their respective proteins. Therefore, 3-deoxy-3-azidovitamins present potential ligands for photolabeling of vitamin D proteins and for studying the structures of the protein active sites.

  7. Determination of the location of positive charges in gas-phase polypeptide polycations by tandem mass spectrometry

    NASA Astrophysics Data System (ADS)

    Kjeldsen, Frank; Savitski, Mikhail M.; Adams, Christopher M.; Zubarev, Roman A.

    2006-06-01

    Location of protonated sites in electrospray-ionized gas-phase peptides and proteins was performed with tandem mass spectrometry using ion activation by both electron capture dissociation (ECD) and collisional activation dissociation (CAD). Charge-carrying sites were assigned based on the increment in the charge state of fragment ions compared to that of the previous fragment in the same series. The property of ECD to neutralize preferentially the least basic site was confirmed by the analysis of three thousand ECD mass spectra of doubly charged tryptic peptides. Multiply charged cations of bradykinin, neurotensin and melittin were studied in detail. For n+ precursors, ECD revealed the positions of (n - 1) most basic sites, while CAD could in principle locate alln charges. However, ECD introduced minimal proton mobilization and produced more conclusive data than CAD, for which N- and C-terminal data often disagreed. Consistent with the dominance of one charge conformer and its preservation in ECD, the average charge states of complementary fragments of n+ ions almost always added up to (n - 1)+, while the similar figure in CAD often deviated from n+, indicating extensive charge isomerization under collisional excitation. For bradykinin and neurotensin, the charge assignments were largely in agreement with the intrinsic gas-phase basicity of the respective amino acid residues. For melittin ions in higher charge states, ECD revealed the charging at both intrinsically basic as well as at less basic residues, which was attributed to charge sharing with other groups due to the presence of secondary and higher order structures in this larger polypeptide.

  8. Oxidative potential of ambient water-soluble PM2.5 measured by Dithiothreitol (DTT) and Ascorbic Acid (AA) assays in the southeastern United States: contrasts in sources and health associations

    NASA Astrophysics Data System (ADS)

    Fang, T.; Verma, V.; Bates, J. T.; Abrams, J.; Klein, M.; Strickland, M. J.; Sarnat, S. E.; Chang, H. H.; Mulholland, J. A.; Tolbert, P. E.; Russell, A. G.; Weber, R. J.

    2015-11-01

    The ability of certain components of particulate matter to induce oxidative stress through catalytic generation of reactive oxygen species (ROS) in vivo may be one mechanism accounting for observed linkages between ambient aerosols and adverse health outcomes. A variety of assays have been used to measure this so-called aerosol oxidative potential. We developed a semi-automated system to quantify oxidative potential of filter aqueous extracts utilizing the dithiothreitol (DTT) assay and have recently developed a similar semi-automated system using the ascorbic acid (AA) assay. Approximately 500 PM2.5 filter samples collected in contrasting locations in the southeastern US were analyzed using both assays. We found that water-soluble DTT activity on a per air volume basis was more spatially uniform than water-soluble AA activity. DTT activity was higher in winter than in summer/fall, whereas AA activity was higher in summer/fall compared to winter, with highest levels near highly trafficked highways. DTT activity was correlated with organic and metal species, whereas AA activity was correlated with water-soluble metals (especially water-soluble Cu, r=0.70-0.91 at most sites). Source apportionment models, Positive Matrix Factorization (PMF) and a Chemical Mass Balance Method with ensemble-averaged source impact profiles (CMB-E), suggest a strong contribution from secondary processes (e.g., organic aerosol oxidation or metal mobilization by formation of an aqueous particle with secondary acids) and traffic emissions to both DTT and AA activities in urban Atlanta. Biomass burning was a large source for DTT activity, but insignificant for AA. DTT activity was well correlated with PM2.5 mass (r=0.49-0.86 across sites/seasons), while AA activity did not co-vary strongly with mass. A linear model was developed to estimate DTT and AA activities for the central Atlanta Jefferson Street site, based on the CMB-E sources that are statistically significant with positive coefficients. The model was used to estimate oxidative potential at this site over the period 1998-2009. Time-series epidemiological analyses were conducted to assess daily emergency department (ED) visits data for the five-county Atlanta metropolitan area based on the estimated 10 year backcast oxidative potential. Results suggest that estimated DTT activity was associated with ED visits for both asthma/wheeze and congestive heart failure, while AA activity was not linked to any health outcomes. The findings point to the importance of both organic components and transition metals from biomass burning and mobile sources to adverse health outcomes in this region.

  9. Synthetic alleles at position 121 define a functional domain of human interleukin-1 beta.

    PubMed

    Ambrosetti, D C; Palla, E; Mirtella, A; Galeotti, C; Solito, E; Navarra, P; Parente, L; Melli, M

    1996-06-01

    The non-conservative substitution of the tyrosine residue at position 121 of human interleukin-1 beta (IL-1 beta) generates protein mutants showing strong reduction of the capacity to induce (a) prostaglandin E2 (PGE2) release from fibroblasts and smooth muscle cells, (b) murine T-cells proliferation and (c) activation of interleukin-6 (IL-6) gene expression. It is generally accepted that these functions are mediated by the type-I interleukin-1 receptor (IL-1RI). However, the mutant proteins maintain the binding affinity to the types-I and II IL-1 receptors, which is the same as the control IL-1 beta, suggesting that this amino acid substitution does not alter the structure of the molecule, except locally. Thus we have identified a new functional site of IL-1 beta different from the known receptor binding region, responsible for fundamental IL-1 beta functions. Moreover, we show that the same mutants maintain at least two hypothalamic functions, that is, the in vitro short-term PGE2 release from rat hypothalamus and the induction of fever in rabbits. This result suggests that there is yet another site of the molecule responsible for the hypothalamic functions, implying that multiple active sites on the IL-1 beta molecule, possibly binding to more than one receptor chain, trigger different signals.

  10. Non-RVD mutations that enhance the dynamics of the TAL repeat array along the superhelical axis improve TALEN genome editing efficacy

    PubMed Central

    Tochio, Naoya; Umehara, Kohei; Uewaki, Jun-ichi; Flechsig, Holger; Kondo, Masaharu; Dewa, Takehisa; Sakuma, Tetsushi; Yamamoto, Takashi; Saitoh, Takashi; Togashi, Yuichi; Tate, Shin-ichi

    2016-01-01

    Transcription activator-like effector (TALE) nuclease (TALEN) is widely used as a tool in genome editing. The DNA binding part of TALEN consists of a tandem array of TAL-repeats that form a right-handed superhelix. Each TAL-repeat recognises a specific base by the repeat variable diresidue (RVD) at positions 12 and 13. TALEN comprising the TAL-repeats with periodic mutations to residues at positions 4 and 32 (non-RVD sites) in each repeat (VT-TALE) exhibits increased efficacy in genome editing compared with a counterpart without the mutations (CT-TALE). The molecular basis for the elevated efficacy is unknown. In this report, comparison of the physicochemical properties between CT- and VT-TALEs revealed that VT-TALE has a larger amplitude motion along the superhelical axis (superhelical motion) compared with CT-TALE. The greater superhelical motion in VT-TALE enabled more TAL-repeats to engage in the target sequence recognition compared with CT-TALE. The extended sequence recognition by the TAL-repeats improves site specificity with limiting the spatial distribution of FokI domains to facilitate their dimerization at the desired site. Molecular dynamics simulations revealed that the non-RVD mutations alter inter-repeat hydrogen bonding to amplify the superhelical motion of VT-TALE. The TALEN activity is associated with the inter-repeat hydrogen bonding among the TAL repeats. PMID:27883072

  11. Implementing a user-driven online quality improvement toolkit for cancer care.

    PubMed

    Luck, Jeff; York, Laura S; Bowman, Candice; Gale, Randall C; Smith, Nina; Asch, Steven M

    2015-05-01

    Peer-to-peer collaboration within integrated health systems requires a mechanism for sharing quality improvement lessons. The Veterans Health Administration (VA) developed online compendia of tools linked to specific cancer quality indicators. We evaluated awareness and use of the toolkits, variation across facilities, impact of social marketing, and factors influencing toolkit use. A diffusion of innovations conceptual framework guided the collection of user activity data from the Toolkit Series SharePoint site and an online survey of potential Lung Cancer Care Toolkit users. The VA Toolkit Series site had 5,088 unique visitors in its first 22 months; 5% of users accounted for 40% of page views. Social marketing communications were correlated with site usage. Of survey respondents (n = 355), 54% had visited the site, of whom 24% downloaded at least one tool. Respondents' awareness of the lung cancer quality performance of their facility, and facility participation in quality improvement collaboratives, were positively associated with Toolkit Series site use. Facility-level lung cancer tool implementation varied widely across tool types. The VA Toolkit Series achieved widespread use and a high degree of user engagement, although use varied widely across facilities. The most active users were aware of and active in cancer care quality improvement. Toolkit use seemed to be reinforced by other quality improvement activities. A combination of user-driven tool creation and centralized toolkit development seemed to be effective for leveraging health information technology to spread disease-specific quality improvement tools within an integrated health care system. Copyright © 2015 by American Society of Clinical Oncology.

  12. Landslide hazard assessment of the Black sea coastline (Caucasus, Russia) via drones

    NASA Astrophysics Data System (ADS)

    Kazeev, Andrey; Postoev, German; Fedotova, Ksenia

    2017-04-01

    Landslide hazard assessment of slopes of Sochi was performed along the railway between the cities Tuapse and Adler (total length 103 km). The railway passes through the territory with active development of hazardous geological processes such as landslides, rock falls and debris-flows. By the beginning of 2016, 36 landslide sites were discovered along the railway (total length 34 km), 48 rock-fall sites (length 31 km), and 5 debris-flow sites (length 0.14 km). In recent years the intensification of deformations was observed. For instance, during previous 10 years (1996¬¬-2005) 28 sudden deformations occurred due to slope processes, which caused interruptions in traffic. And in the present decade (2006-2015), 72 deformations were recorded. High landslide activity and economic loss determined the necessity of complex investigations of engineering geological conditions of landslides development and causes of its intensification. The protection strategy development was needed to minimize negative consequences. Thus, the investigations of landslide situation along the railway "Tuapse - Adler" included the categorization of landslide sites by level of hazard, with risk assessment based on numerical criteria. Preliminary evaluation of landslide hazard for the railway was conducted via the analysis of archived engineering-geological documents. 13 of 36 landslide sites (total length 13 km) were selected, reflecting the variety and peculiarities of landslide displacements on slopes (both active and inactive sites). Visual field observations of landslide slopes using drone "DJI Phantom 4" were completed during the second stage of this investigation. High-resolution photographs of landslide cirques, cracks, scarp walls, vegetation features were obtained via drone, which would have been impossible to obtain from the ground in conditions of dense subtropical vegetation cover. Possible approaches to the landslide activity and hazard assessment were evaluated: slope stability analysis, geophysical monitoring methods, analysis of critical deformations and critical velocities of displacement, the analysis of changes of conditions of landslide development during its displacement, as well as scoring approaches to landslide hazard and risk assessment. As the result, the method of probabilistic estimation of landslide activity and hazard has been proposed, based on selection and analysis of main factors, influencing landslide displacements. Slope steepness, landslide thickness, slope length, bedrock dip, slope relief, cracks, vegetation patterns and other factors were used for assessment of activity of landslide sites. The investigation was based on the proposed probabilistic method of assessment of landslide activity and hazard. The considered landslide sites were ranked by the rate of activity as inactive, potentially active and active. The most active sites were used to identify potentially the most hazardous sites. Furthermore, the following factors were additionally considered: the damage of railroad facilities due to landslide, landslide activity, thickness of landslide at the toe of the slope, bedrock stratification, the conditions for the cirque development, the position of the sliding surface relatively to the railway, the involvement of bedrock into displaced mass. As the result, the investigated railroad sites were divided into three categories: non-hazardous, potentially hazardous and hazardous. The research was supported by Russian Scientific Foundation (Project № 16-17-00125).

  13. The Dimer Interfaces of Protease and Extra-Protease Domains Influence the Activation of Protease and the Specificity of GagPol Cleavage

    PubMed Central

    Pettit, Steven C.; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H.

    2003-01-01

    Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation. PMID:12477841

  14. The dimer interfaces of protease and extra-protease domains influence the activation of protease and the specificity of GagPol cleavage.

    PubMed

    Pettit, Steven C; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H

    2003-01-01

    Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation.

  15. Dioxygenase Activity of Epidermal Lipoxygenase-3 Unveiled

    PubMed Central

    Zheng, Yuxiang; Brash, Alan R.

    2010-01-01

    Epidermal lipoxygenase-3 (eLOX3) exhibits hydroperoxide isomerase activity implicated in epidermal barrier formation, but its potential dioxygenase activity has remained elusive. We identified herein a synthetic fatty acid, 9E,11Z,14Z-20:3ω6, that was oxygenated by eLOX3 specifically to the 9S-hydroperoxide. Reaction showed a pronounced lag phase, which suggested that eLOX3 is deficient in its activation step. Indeed, we found that high concentrations of hydroperoxide activator (e.g. 65 μm) overcame a prolonged lag phase (>1 h) and unveiled a dioxygenase activity with arachidonic acid; the main products were the 5-, 9-, and 7-hydroperoxyeicosatetraenoic acids (HPETEs). These were R/S mixtures (ranging from ∼50:50 to 73:27), and as the bis-allylic 7-HPETE can be formed only inside the enzyme active site, the results indicate there is oxygen availability along either face of the reacting fatty acid radical. That the active site oxygen supply is limited is implied from the need for continuous re-activation, as carbon radical leakage leaves the enzyme in the unactivated ferrous state. An Ala-to-Gly mutation, known to affect the positioning of O2 in the active site of other lipoxygenase enzymes, led to more readily activated reaction and a significant increase in the 9R- over the 5-HPETE. Activation and cycling of the ferric enzyme are thus promoted using the 9E,11Z,14Z-20:3ω6 substrate, by continuous hydroperoxide activation, or by the Ala-to-Gly mutation. We suggest that eLOX3 represents one end of a spectrum among lipoxygenases where activation is inefficient, favoring hydroperoxide isomerase cycling, with the opposite end represented by readily activated enzymes in which dioxygenase activity is prominent. PMID:20921226

  16. Detection of rotavirus before and after monovalent rotavirus vaccine introduction and vaccine effectiveness among children in mainland Tanzania.

    PubMed

    Jani, Bhavin; Hokororo, Adolfine; Mchomvu, Jackson; Cortese, Margaret M; Kamugisha, Christopher; Mujuni, Delphinius; Kallovya, Dotto; Parashar, Umesh D; Mwenda, Jason M; Lyimo, DaFrossa; Materu, Antonia; Omari, Kakuri Frank; Waziri, Mark; Laswai, Theresia; Juma, Hamisi; Mlay, Josephine; Dogani, Juliana; Stephen, Eugenia; Seugendo, Mwanisha; Nkumbi, Uyanjo; Lyakurwa, Anna; Matojo, Anivera; Bendera, Elice; Senyota, Jonathan; Msingwa, Veronica; Fungo, Yohana; Michael, Fausta; Mpamba, Amina; Chambo, Alfred; Cholobi, Happy; Lyamuya, Faraja; Chami, Inviollatha; Mchome, Esther; Mshana, Amina Mohamed; Mushi, Edward; Mariki, Uforo; Chard, Ronica; Tuju, Deborah; Ambokile, Nuswe; Lukwale, Fatuma; Kyessi, Furaha; Khamis, Asha; Michael, Innocent; Macha, Doreen; Saguti, Angelina

    2018-04-11

    Monovalent rotavirus vaccine (RV1) was introduced in Tanzania in January 2013 under the Reach Every Child initiative, to be given at ages 6 and 10 weeks. We used the sentinel hospital rotavirus surveillance system to examine the rotavirus detection rate before and after vaccine introduction and estimate vaccine effectiveness. Before vaccine introduction, rotavirus surveillance was established at two mainland hospitals; children admitted for acute diarrhea were eligible for enrollment and stools were tested for rotavirus antigen. We compared the rotavirus positivity rate in the pre-vaccine period (Tanga Hospital, 2009 and 2011; Bugando Medical Centre, 2012) to that from post-introduction years, 2014-2015. In 2013, surveillance was established at 9 additional hospitals. We examined rotavirus positivity among infants at these sites for 2014-2015. We obtained vaccine records and calculated vaccine effectiveness at 3 sites using case-test-negative control design. At Tanga Hospital, the rotavirus positivity rate among infants was 41% (102/251) pre-vaccine and 14% (28/197) in post-vaccine years (rate ratio: 0.35 [95% CI 0.22-0.54]). At Bugando, the positivity rate was 58% (83/143) pre-vaccine, and 18% (49/277) post-introduction (rate ratio 0.30 [95% CI 0.210.44]). Results were similar among children <5 years. At the new sites, the median site rotavirus positivity rate among infants was 26% in 2014 (range 19-44%) and 18% in 2015 (range 16-33%). The effectiveness of ≥1 RV1 dose against rotavirus hospitalization among children 5-23 months was 53% (95% CI: -14, 81), and 66% (95% CI: 9-87) against hospitalization with intravenous rehydration. Following introduction, peak rotavirus activity occurred later in the year and appeared more concentrated in time. Rotavirus surveillance data from Tanzania indicate that the rotavirus positivity rate among children hospitalized with diarrhea that were enrolled was substantially reduced after vaccine introduction. Low positivity rates among infants were detected at hospitals across the country. Overall, the data support that rotavirus vaccine has been successfully introduced and is effective in Tanzanian children. Copyright © 2018. Published by Elsevier Ltd.

  17. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  18. Spectroscopic studies on the active site of hydroperoxide lyase; the influence of detergents on its conformation.

    PubMed

    Noordermeer, M A; Veldink, G A; Vliegenthart, J F

    2001-02-02

    Expression of high quantities of alfalfa hydroperoxide lyase in Escherichia coli made it possible to study its active site and structure in more detail. Circular dichroism (CD) spectra showed that hydroperoxide lyase consists for about 75% of alpha-helices. Electron paramagnetic resonance (EPR) spectra confirmed its classification as a cytochrome P450 enzyme. The positive influence of detergents on the enzyme activity is paralleled by a spin state transition of the heme Fe(III) from low to high spin. EPR and CD spectra showed that detergents induce a subtle conformational change, which might result in improved substrate binding. Because hydroperoxide lyase is thought to be a membrane bound protein and detergents mimic a membrane environment, the more active, high spin form likely represents the in vivo conformation. Furthermore, the spin state appeared to be temperature-dependent, with the low spin state favored at low temperature. Point mutants of the highly conserved cysteine in domain D indicated that this residue might be involved in heme binding.

  19. The tyrosine kinase Stitcher activates Grainy head and epidermal wound healing in Drosophila.

    PubMed

    Wang, Shenqiu; Tsarouhas, Vasilios; Xylourgidis, Nikos; Sabri, Nafiseh; Tiklová, Katarína; Nautiyal, Naumi; Gallio, Marco; Samakovlis, Christos

    2009-07-01

    Epidermal injury initiates a cascade of inflammation, epithelial remodelling and integument repair at wound sites. The regeneration of the extracellular barrier and damaged tissue repair rely on the precise orchestration of epithelial responses triggered by the injury. Grainy head (Grh) transcription factors induce gene expression to crosslink the extracellular barrier in wounded flies and mice. However, the activation mechanisms and functions of Grh factors in re-epithelialization remain unknown. Here we identify stitcher (stit), a new Grh target in Drosophila melanogaster. stit encodes a Ret-family receptor tyrosine kinase required for efficient epidermal wound healing. Live imaging analysis reveals that Stit promotes actin cable assembly during wound re-epithelialization. Stit activation also induces extracellular signal-regulated kinase (ERK) phosphorylation along with the Grh-dependent expression of stit and barrier repair genes at the wound sites. The transcriptional stimulation of stit on injury triggers a positive feedback loop increasing the magnitude of epithelial responses. Thus, Stit activation upon wounding coordinates cytoskeletal rearrangements and the level of Grh-mediated transcriptional wound responses.

  20. Charge-Triggered Membrane Insertion of Matrix Metalloproteinase-7, Supporter of Innate Immunity and Tumors.

    PubMed

    Prior, Stephen H; Fulcher, Yan G; Koppisetti, Rama K; Jurkevich, Alexander; Van Doren, Steven R

    2015-11-03

    Matrix metalloproteinase-7 (MMP-7) sheds signaling proteins from cell surfaces to activate bacterial killing, wound healing, and tumorigenesis. The mechanism targeting soluble MMP-7 to membranes has been investigated. Nuclear magnetic resonance structures of the zymogen, free and bound to membrane mimics without and with anionic lipid, reveal peripheral binding to bilayers through paramagnetic relaxation enhancements. Addition of cholesterol sulfate partially embeds the protease in the bilayer, restricts its diffusion, and tips the active site away from the bilayer. Its insertion of hydrophobic residues organizes the lipids, pushing the head groups and sterol sulfate outward toward the enzyme's positive charge on the periphery of the enlarged interface. Fluorescence probing demonstrates a similar mode of binding to plasma membranes and internalized vesicles of colon cancer cells. Binding of bilayered micelles induces allosteric activation and conformational change in the auto-inhibitory peptide and the adjacent scissile site, illustrating a potential intermediate in the activation of the zymogen. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. The Antibiotic Novobiocin Binds and Activates the ATPase That Powers Lipopolysaccharide Transport.

    PubMed

    May, Janine M; Owens, Tristan W; Mandler, Michael D; Simpson, Brent W; Lazarus, Michael B; Sherman, David J; Davis, Rebecca M; Okuda, Suguru; Massefski, Walter; Ruiz, Natividad; Kahne, Daniel

    2017-12-06

    Novobiocin is an orally active antibiotic that inhibits DNA gyrase by binding the ATP-binding site in the ATPase subunit. Although effective against Gram-positive pathogens, novobiocin has limited activity against Gram-negative organisms due to the presence of the lipopolysaccharide-containing outer membrane, which acts as a permeability barrier. Using a novobiocin-sensitive Escherichia coli strain with a leaky outer membrane, we identified a mutant with increased resistance to novobiocin. Unexpectedly, the mutation that increases novobiocin resistance was not found to alter gyrase, but the ATPase that powers lipopolysaccharide (LPS) transport. Co-crystal structures, biochemical, and genetic evidence show novobiocin directly binds this ATPase. Novobiocin does not bind the ATP binding site but rather the interface between the ATPase subunits and the transmembrane subunits of the LPS transporter. This interaction increases the activity of the LPS transporter, which in turn alters the permeability of the outer membrane. We propose that novobiocin will be a useful tool for understanding how ATP hydrolysis is coupled to LPS transport.

  2. Characterization of active-site residues of the NIa protease from tobacco vein mottling virus.

    PubMed

    Hwang, D C; Kim, D H; Lee, J S; Kang, B H; Han, J; Kim, W; Song, B D; Choi, K Y

    2000-10-31

    Nuclear inclusion a (NIa) protease of tobacco vein mottling virus is responsible for the processing of the viral polyprotein into functional proteins. In order to identify the active-site residues of the TVMV NIa protease, the putative active-site residues, His-46, Asp-81 and Cys-151, were mutated individually to generate H46R, H46A, D81E, D81N, C151S, and C151A, and their mutational effects on the proteolytic activities were examined. Proteolytic activity was completely abolished by the mutations of H46R, H46A, D81N, and C151A, suggesting that the three residues are crucial for catalysis. The mutation of D81E decreased kcat marginally by about 4.7-fold and increased Km by about 8-fold, suggesting that the aspartic acid at position 81 is important for substrate binding but can be substituted by glutamate without any significant decrease in catalysis. The replacement of Cys-151 by Ser to mimic the catalytic triad of chymotrypsin-like serine protease resulted in the drastic decrease in kcat by about 1,260-fold. This result might be due to the difference of the active-site geometry between the NIa protease and chymotrypsin. The protease exhibited a bell-shaped pH-dependent profile with a maximum activity approximately at pH 8.3 and with the abrupt changes at the respective pKa values of approximately 6.6 and 9.2, implying the involvement of a histidine residue in catalysis. Taken together, these results demonstrate that the three residues, His-46, Asp-81, and Cys-151, play a crucial role in catalysis of the TVMV NIa protease.

  3. Biochemical effects of lead, zinc, and cadmium from mining on fish in the Tri-States district of northeastern Oklahoma, USA

    USGS Publications Warehouse

    Schmitt, Christopher J.; Whyte, Jeffrey J.; Brumbaugh, William G.; Tillitt, Donald E.

    2005-01-01

    We assessed the exposure of fish from the Spring and Neosho Rivers in northeast Oklahoma, USA, to lead, zinc, and cadmium from historical mining in the Tri-States Mining District (TSMD). Fish (n = 74) representing six species were collected in October 2001 from six sites on the Spring and Neosho Rivers influenced to differing degrees by mining. Additional samples were obtained from the Big River, a heavily contaminated stream in eastern Missouri, USA, and from reference sites. Blood from each fish was analyzed for Pb, Zn, Cd, Fe, and hemoglobin (Hb). Blood also was analyzed for ??-aminolevulinic acid dehydratase (ALA-D) activity. The activity of ALA-D, an enzyme involved in heme synthesis, is inhibited by Pb. Concentrations of Fe and Hb were highly correlated (r = 0.89, p < 0.01) across all species and locations and typically were greater in common carp (Cyprinus carpio) than in other taxa. Concentrations of Pb, Zn, and Cd typically were greatest in fish from sites most heavily affected by mining and lowest in reference samples. The activity of ALA-D, but not concentrations of Hb or Fe, also differed significantly (p < 0.01) among sites and species. Enzyme activity was lowest in fish from mining-contaminated sites and greatest in reference fish, and was correlated negatively with Pb in most species. Statistically significant (p < 0.01) linear regression models that included negative terms for blood Pb explained as much as 68% of the total variation in ALA-D activity, but differences among taxa were highly evident. Positive correlations with Zn were documented in the combined data for channel catfish (Ictalurus punctatus) and flathead catfish (Pylodictis olivaris), as has been reported for other taxa, but not in bass (Micropterus spp.) or carp. In channel catfish, ALA-D activity appeared to be more sensitive to blood Pb than in the other species investigated (i.e., threshold concentrations for inhibition were lower). Such among-species differences are consistent with previous studies. Enzyme activity was inhibited by more than 50% relative to reference sites in channel catfish from several TSMD sites. Collectively, our results indicate that Pb is both bioavailable and active biochemically in the Spring-Neosho River system. ?? 2005 SETAC.

  4. Ultrastructural and functional fate of recycled vesicles in hippocampal synapses

    PubMed Central

    Rey, Stephanie A.; Smith, Catherine A.; Fowler, Milena W.; Crawford, Freya; Burden, Jemima J.; Staras, Kevin

    2015-01-01

    Efficient recycling of synaptic vesicles is thought to be critical for sustained information transfer at central terminals. However, the specific contribution that retrieved vesicles make to future transmission events remains unclear. Here we exploit fluorescence and time-stamped electron microscopy to track the functional and positional fate of vesicles endocytosed after readily releasable pool (RRP) stimulation in rat hippocampal synapses. We show that most vesicles are recovered near the active zone but subsequently take up random positions in the cluster, without preferential bias for future use. These vesicles non-selectively queue, advancing towards the release site with further stimulation in an actin-dependent manner. Nonetheless, the small subset of vesicles retrieved recently in the stimulus train persist nearer the active zone and exhibit more privileged use in the next RRP. Our findings reveal heterogeneity in vesicle fate based on nanoscale position and timing rules, providing new insights into the origins of future pool constitution. PMID:26292808

  5. Mechanism of phosphoryl transfer and protein-protein interaction in the PTS system-an NMR study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rajagopal, P.; Klevit, R.E.

    1994-12-01

    HPr and Enzyme IIA{sup Glc} are two of the components of the bacterial PTS (phosphoenolpyruvate: sugar phosphotranferase system) and are involved in the phosphorylation and concomitant translocation of sugars across the membrane. These PTS protein complexes also regulate sugar transport. HPr, phosphorylated at a histidine N1 site by Enzyme I and phosphoenol pyruvate, transfers the phosphoryl group to a histidine N3 position in Enzyme IIA{sup Glc}. HPrs from Gram-positive bacteria undergo regulatory phosphorylation at Ser{sup 46}, whereby phosphorylation of the histidine residue is inhibited. Conversely, histidine phosphorylation inhibits phosphorylation at Ser{sup 46}. HPrs from Gram-negative bacteria possess a serine residuemore » at position 46, but do not undergo regulatory phosphorylation. HPr forms an open-faced sandwich structure with a four-strand S-sheet and 2 to 3 helices lying on top of the sheet. The active-site histidine and Ser{sup 46} occur in conformationally flexible regions. P-His-HPr from the Gram-positive bacterium Bacillus subtilus has been investigated by both homonuclear and heteronuclear two-dimensional and three-dimensional NMR experiments using an in-situ enzymatic regeneration system to maintain a constant level of P-His-HPr. The results show that localized conformational changes occur in the vicinity of the active-site histidine and also near Ser{sup 46}. HPr-Enzyme IIA{sup Glc} complexes from both Bacillus subtilis and Gram-negative Escherichia coli were also studied by a variety of {sup 15}N-edited two-dimensional NMR experiments, which were performed on uniformly {sup 15}N-labeled HPr complexed to unlabeled Enzyme IIA{sup Glc}. The complex is in fast exchange with a molecular weight of about 27 kDa. The focus of our work is to assess the changes undergone by HPr (the smaller of the two components), and so all the experiments were performed with excess Enzyme IIA present in the system.« less

  6. Continuous monitoring of surface deformation at Long Valley Caldera, California, with GPS

    USGS Publications Warehouse

    Dixon, T.H.; Mao, A.; Bursik, M.; Heflin, M.; Langbein, J.; Stein, R.; Webb, F.

    1997-01-01

    Continuous Global Positioning System (GPS) measurements at Long Valley Caldera, an active volcanic region in east central California, have been made on the south side of the resurgent dome since early 1993. A site on the north side of the dome was added in late 1994. Special adaptations for autonomous operation in remote regions and enhanced vertical precision were made. The data record ongoing volcanic deformation consistent with uplift and expansion of the surface above a shallow magma chamber. Measurement precisions (1 standard error) for "absolute" position coordinates, i.e., relative to a global reference frame, are 3-4 mm (north), 5-6 mm (east), and 10-12 mm (vertical) using 24 hour solutions. Corresponding velocity uncertainties for a 12 month period are about 2 mm/yr in the horizontal components and 3-4 mm/yr in the vertical component. High precision can also be achieved for relative position coordinates on short (<10 km) baselines using broadcast ephemerides and observing times as short as 3 hours, even when data are processed rapidly on site. Comparison of baseline length changes across the resurgent dome between the two GPS sites and corresponding two-color electronic distance measurements indicates similar extension rates within error (???2 mm/yr) once we account for a random walk noise component in both systems that may reflect spurious monument motion. Both data sets suggest a pause in deformation for a 3.5 month period in mid-1995, when the extension rate across the dome decreased essentially to zero. Three dimensional positioning data from the two GPS stations suggest a depth (5.8??1.6 km) and location (west side of the resurgent dome) of a major inflation center, in agreement with other geodetic techniques, near the top of a magma chamber inferred from seismic data. GPS systems similar to those installed at Long Valley can provide a practical method for near real-time monitoring and hazard assessment on many active volcanoes.

  7. A mutational analysis of U12-dependent splice site dinucleotides

    PubMed Central

    DIETRICH, ROSEMARY C.; FULLER, JOHN D.; PADGETT, RICHARD A.

    2005-01-01

    Introns spliced by the U12-dependent minor spliceosome are divided into two classes based on their splice site dinucleotides. The /AU-AC/ class accounts for about one-third of U12-dependent introns in humans, while the /GU-AG/ class accounts for the other two-thirds. We have investigated the in vivo and in vitro splicing phenotypes of mutations in these dinucleotide sequences. A 5′ A residue can splice to any 3′ residue, although C is preferred. A 5′ G residue can splice to 3′ G or U residues with a preference for G. Little or no splicing was observed to 3′ A or C residues. A 5′ U or C residue is highly deleterious for U12-dependent splicing, although some combinations, notably 5′ U to 3′ U produced detectable spliced products. The dependence of 3′ splice site activity on the identity of the 5′ residue provides evidence for communication between the first and last nucleotides of the intron. Most mutants in the second position of the 5′ splice site and the next to last position of the 3′ splice site were defective for splicing. Double mutants of these residues showed no evidence of communication between these nucleotides. Varying the distance between the branch site and the 3′ splice site dinucleotide in the /GU-AG/ class showed that a somewhat larger range of distances was functional than for the /AU-AC/ class. The optimum branch site to 3′ splice site distance of 11–12 nucleotides appears to be the same for both classes. PMID:16043500

  8. Effects of tetraethylammonium on potassium currents in a molluscan neurons

    PubMed Central

    1981-01-01

    The effects of tetraethylammonium (TEA) on the delayed K+ current and on the Ca2+-activated K+ current of the Aplysia pacemaker neurons R-15 and L-6 were studied. The delayed outward K+ current was measured in Ca2+-free ASW containing tetrodotoxin (TTX), using brief depolarizing clamp pulses. External TEA blocks the delayed K+ current reversibly in a dose-dependent manner. The experimental results are well fitted with a Michaelis-Menten expression, assuming a one-to-one reaction between TEA and a receptor site, with an apparent dissociation constant of 6.0 mM. The block depends on membrane voltage and is reduced at positive membrane potentials. The Ca2+-activated K+ current was measured in Ca2+- free artificial seawater (ASW) containing TTX, using internal Ca2+ ion injection to directly activate the K+ conductance. External TEA and a number of other quaternary ammonium ions block the Ca2+-activated K+ current reversibly in a dose-dependent manner. TEA is the most effective blocker, with an apparent dissociation constant, for a one-to- one reaction with a receptor site, of 0.4 mM. The block decreases with depolarization. The Ca2+-activated K+ current was also measured after intracellular iontophoretic TEA injection. Internal TEA blocks the Ca2+- activated K+ current (but the block is only apparent at positive membrane potentials), is increased by depolarization, and is irreversible. The effects of external and internal TEA can be seen in measurements of the total outward K+ current at different membrane potentials in normal ASW. PMID:6265594

  9. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    PubMed

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  10. Rocky Flats Environmental Technology Site Ecological Monitoring Program 1995 annual report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-05-31

    The Ecological Monitoring Program (ECMP) was established at the Rocky Flats Environmental Technology Site (Site) in September 1992. At that time, EcMP staff developed a Program Plan that was peer-reviewed by scientists from western universities before submittal to DOE RFFO in January 1993. The intent of the program is to measure several quantitative variables at different ecological scales in order to characterize the Rocky Flats ecosystem. This information is necessary to document ecological conditions at the Site in impacted and nonimpacted areas to determine if Site practices have had ecological impacts, either positive or negative. This information can be usedmore » by managers interested in future use scenarios and CERCLA activities. Others interested in impact analysis may also find the information useful. In addition, these measurements are entered into a database which will serve as a long-term information repository that will document long-term trends and potential future changes to the Site, both natural and anthropogenic.« less

  11. National Guard Counterdrug Programs

    DTIC Science & Technology

    2001-02-14

    comparisons to locate indoor Marijuana grows, outdoor infrastructure - Monitor activity at known sites - Meth labs, stash houses, marijuana grows - Real...Identifies key signatures of structures for indoor growth of cannabis - Vehiclelvessel surveillance * Video capabilities for evidence e Global Positioning...System Navigational Equipment - Identify marijuana locations for ground recovery Contact Information Voice (703) 607-5665 DSN Voice 327-5665 FAX (703

  12. Methods and compositions for controlling gene expression by RNA processing

    DOEpatents

    Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

    2017-08-29

    The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

  13. Calorimetric study of mutant human lysozymes with partially introduced Ca2+ binding sites and its efficient refolding system from inclusion bodies.

    PubMed

    Koshiba, T; Tsumoto, K; Masaki, K; Kawano, K; Nitta, K; Kumagai, I

    1998-08-01

    During the process of evolution, ancestral lysozymes evolved into calcium-binding lysozymes by acquiring three critical aspartate residues at positions 86, 91 and 92. To investigate the process of the acquisition of calcium-binding ability, two of the aspartates were partially introduced into human lysozyme at positions 86, 91 and 92. These mutants (HLQ86D, HLA92D and HLQ86D/D91Q/A92D), having two critical aspartates in calcium-binding sites, were expressed in Escherichia coli as non-active inclusion bodies. For the preparation of lysozyme samples, a refolding system using thioredoxin was established. This system allowed for effective refolding of wild-type and mutant lysozymes, and 100% of activity was recovered within 4 days. The calcium ion dependence of the melting temperature (Tm) of wild-type and mutant lysozymes was investigated by differential scanning calorimetry at pH 4.5. The Tm values of wild-type, HLQ86D and HLA92D mutants were not dependent on calcium ion concentration. However, the Tm of HLQ86D/D91Q/A92D was 4 degrees higher in the presence of 50 mM CaCl2 than in its absence, and the calcium-binding constant of this mutant was estimated to be 2.25(+/-0.25)x10(2) M(-1) at pH 4.5. Moreover, the calcium-binding ability of this mutant was confirmed by the result using Sephadex G-25 gel chromatography. These results indicate that it is indispensable to have at least two aspartates at positions 86 and 92 for acquisition of calcium-binding ability. The process of the acquisition of calcium-binding site during evolution of calcium-binding lysozyme is discussed.

  14. Conformational motions regulate phosphoryl transfer in related protein tyrosine phosphatases

    PubMed Central

    Whittier, Sean K.; Hengge, Alvan C.; Loria, J. Patrick

    2014-01-01

    Many studies have implicated a role for conformational motions during the catalytic cycle, acting to optimize the binding pocket or facilitate product release, but a more intimate role in the chemical reaction has not been described. We address this by monitoring active-site loop motion in two protein tyrosine phosphatases (PTPs) using NMR spectroscopy. The PTPs, YopH and PTP1B, have very different catalytic rates, however we find in both that the active-site loop closes to its catalytically competent position at rates that mirror the phosphotyrosine cleavage kinetics. This loop contains the catalytic acid, suggesting that loop closure occurs concomitantly with the protonation of the leaving group tyrosine and explains the different kinetics of two otherwise chemically and mechanistically indistinguishable enzymes. PMID:23970698

  15. Mechanism of Enzyme Repair by the AAA+ Chaperone Rubisco Activase.

    PubMed

    Bhat, Javaid Y; Miličić, Goran; Thieulin-Pardo, Gabriel; Bracher, Andreas; Maxwell, Andrew; Ciniawsky, Susanne; Mueller-Cajar, Oliver; Engen, John R; Hartl, F Ulrich; Wendler, Petra; Hayer-Hartl, Manajit

    2017-09-07

    How AAA+ chaperones conformationally remodel specific target proteins in an ATP-dependent manner is not well understood. Here, we investigated the mechanism of the AAA+ protein Rubisco activase (Rca) in metabolic repair of the photosynthetic enzyme Rubisco, a complex of eight large (RbcL) and eight small (RbcS) subunits containing eight catalytic sites. Rubisco is prone to inhibition by tight-binding sugar phosphates, whose removal is catalyzed by Rca. We engineered a stable Rca hexamer ring and analyzed its functional interaction with Rubisco. Hydrogen/deuterium exchange and chemical crosslinking showed that Rca structurally destabilizes elements of the Rubisco active site with remarkable selectivity. Cryo-electron microscopy revealed that Rca docks onto Rubisco over one active site at a time, positioning the C-terminal strand of RbcL, which stabilizes the catalytic center, for access to the Rca hexamer pore. The pulling force of Rca is fine-tuned to avoid global destabilization and allow for precise enzyme repair. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Direct and indirect effects of metal contamination on soil biota in a Zn-Pb post-mining and smelting area (S Poland).

    PubMed

    Kapusta, Paweł; Szarek-Łukaszewska, Grażyna; Stefanowicz, Anna M

    2011-06-01

    Effects of metal contamination on soil biota activity were investigated at 43 sites in 5 different habitats (defined by substratum and vegetation type) in a post-mining area. Sites were characterised in terms of soil pH and texture, nutrient status, total and exchangeable metal concentrations, as well as plant species richness and cover, abundances of enchytraeids, nematodes and tardigrades, and microbial respiration and biomass. The concentrations of total trace metals were highest in soils developed on mining waste (metal-rich dolomite), but these habitats were more attractive than sandy sites for plants and soil biota because of their higher content of organic matter, clay and nutrients. Soil mesofauna and microbes were strongly dependent on natural habitat properties. Pollution (exchangeable Zn and Cd) negatively affected only enchytraeid density; due to a positive relationship between enchytraeids and microbes it indirectly reduced microbial activity. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Quantitative assessment of groundwater quality using a biological indicator: some preliminary observations.

    PubMed

    Pfeil, R M; Venkat, J A; Plimmer, J R; Sham, S; Davis, K; Nair, P P

    1994-02-01

    The genotoxicity of groundwater was evaluated, using a novel application of the SOS microplate assay (SOSMA). Organic residues were extracted from groundwater samples from Maryland, Pennsylvania, and Delaware by using C-18 bonded silica solid phase extraction tubes. Total organic carbon content (TOC) of water samples was also determined. The genotoxicity of the extracts was determined by the SOSMA. Relative activity (RA) as determined by the SOSMA is a quantitative measure of genotoxicity based on a comparison to the activity of the mutagen, 4-nitroquinoline oxide. Low levels of RA (about 2x background) were detected in waters from sites within these states. There was considerable temporal and spatial variation in the observed RA, but no definite patterns were observed in the variation. Between sampling sites there was a positive correlation between RA and TOC; however, this relationship appeared to be reversed occasionally within a sampling site. The extraction and bioassay methods provide an easy and relatively inexpensive means of determining water quality.

  18. Analysis of Phosphorylation of the Receptor-Like Protein Kinase HAESA during Arabidopsis Floral Abscission

    PubMed Central

    Taylor, Isaiah; Wang, Ying; Seitz, Kati; Baer, John; Bennewitz, Stefan; Mooney, Brian P.; Walker, John C.

    2016-01-01

    Receptor-like protein kinases (RLKs) are the largest family of plant transmembrane signaling proteins. Here we present functional analysis of HAESA, an RLK that regulates floral organ abscission in Arabidopsis. Through in vitro and in vivo analysis of HAE phosphorylation, we provide evidence that a conserved phosphorylation site on a region of the HAE protein kinase domain known as the activation segment positively regulates HAE activity. Additional analysis has identified another putative activation segment phosphorylation site common to multiple RLKs that potentially modulates HAE activity. Comparative analysis suggests that phosphorylation of this second activation segment residue is an RLK specific adaptation that may regulate protein kinase activity and substrate specificity. A growing number of RLKs have been shown to exhibit biologically relevant dual specificity toward serine/threonine and tyrosine residues, but the mechanisms underlying dual specificity of RLKs are not well understood. We show that a phospho-mimetic mutant of both HAE activation segment residues exhibits enhanced tyrosine auto-phosphorylation in vitro, indicating phosphorylation of this residue may contribute to dual specificity of HAE. These results add to an emerging framework for understanding the mechanisms and evolution of regulation of RLK activity and substrate specificity. PMID:26784444

  19. Significance of the enzymatic properties of yeast S39A enolase to the catalytic mechanism.

    PubMed

    Brewer, J M; Glover, C V; Holland, M J; Lebioda, L

    1998-04-02

    The S39A mutant of yeast enolase (isozyme 1), prepared by site-directed mutagenesis, has a relative Vmax of 0.01% and an activation constant for Mg2+ ca. 10-fold higher, compared with native enzyme. It is correctly folded. There is little effect of solvent viscosity on activity. We think that the loop Ser36-His43 fails to move to the 'closed' position upon catalytic Mg2+ binding, weakening several electrostatic interactions involved in the mechanism.

  20. Probing electrostatic interactions and ligand binding in aspartyl-tRNA synthetase through site-directed mutagenesis and computer simulations.

    PubMed

    Thompson, Damien; Lazennec, Christine; Plateau, Pierre; Simonson, Thomas

    2008-05-15

    Faithful genetic code translation requires that each aminoacyl-tRNA synthetase recognise its cognate amino acid ligand specifically. Aspartyl-tRNA synthetase (AspRS) distinguishes between its negatively-charged Asp substrate and two competitors, neutral Asn and di-negative succinate, using a complex network of electrostatic interactions. Here, we used molecular dynamics simulations and site-directed mutagenesis experiments to probe these interactions further. We attempt to decrease the Asp/Asn binding free energy difference via single, double and triple mutations that reduce the net positive charge in the active site of Escherichia coli AspRS. Earlier, Glutamine 199 was changed to a negatively-charged glutamate, giving a computed reduction in Asp affinity in good agreement with experiment. Here, Lysine 198 was changed to a neutral leucine; then, Lys198 and Gln199 were mutated simultaneously. Both mutants are predicted to have reduced Asp binding and improved Asn binding, but the changes are insufficient to overcome the initial, high specificity of the native enzyme, which retains a preference for Asp. Probing the aminoacyl-adenylation reaction through pyrophosphate exchange experiments, we found no detectable activity for the mutant enzymes, indicating weaker Asp binding and/or poorer transition state stabilization. The simulations show that the mutations' effect is partly offset by proton uptake by a nearby histidine. Therefore, we performed additional simulations where the nearby Histidines 448 and 449 were mutated to neutral or negative residues: (Lys198Leu, His448Gln, His449Gln), and (Lys198Leu, His448Glu, His449Gln). This led to unexpected conformational changes and loss of active site preorganization, suggesting that the AspRS active site has a limited structural tolerance for electrostatic modifications. The data give insights into the complex electrostatic network in the AspRS active site and illustrate the difficulty in engineering charged-to-neutral changes of the preferred ligand. 2007 Wiley-Liss, Inc.

Top