Active Site Characterization of Proteases Sequences from Different Species of Aspergillus.
Morya, V K; Yadav, Virendra K; Yadav, Sangeeta; Yadav, Dinesh
2016-09-01
A total of 129 proteases sequences comprising 43 serine proteases, 36 aspartic proteases, 24 cysteine protease, 21 metalloproteases, and 05 neutral proteases from different Aspergillus species were analyzed for the catalytically active site residues using MEROPS database and various bioinformatics tools. Different proteases have predominance of variable active site residues. In case of 24 cysteine proteases of Aspergilli, the predominant active site residues observed were Gln193, Cys199, His364, Asn384 while for 43 serine proteases, the active site residues namely Asp164, His193, Asn284, Ser349 and Asp325, His357, Asn454, Ser519 were frequently observed. The analysis of 21 metalloproteases of Aspergilli revealed Glu298 and Glu388, Tyr476 as predominant active site residues. In general, Aspergilli species-specific active site residues were observed for different types of protease sequences analyzed. The phylogenetic analysis of these 129 proteases sequences revealed 14 different clans representing different types of proteases with diverse active site residues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nicholas, R.A.; Suzuki, H.; Hirota, Y.
This paper reports the sequence of the active site peptide of penicillin-binding protein 1b from Escherichia coli. Purified penicillin-binding protein 1b was labeled with (/sup 14/C)penicillin G, digested with trypsin, and partially purified by gel filtration. Upon further purification by high-pressure liquid chromatography, two radioactive peaks were observed, and the major peak, representing over 75% of the applied radioactivity, was submitted to amino acid analysis and sequencing. The sequence Ser-Ile-Gly-Ser-Leu-Ala-Lys was obtained. The active site nucleophile was identified by digesting the purified peptide with aminopeptidase M and separating the radioactive products on high-pressure liquid chromatography. Amino acid analysis confirmed thatmore » the serine residue in the middle of the sequence was covalently bonded to the (/sup 14/C)penicilloyl moiety. A comparison of this sequence to active site sequences of other penicillin-binding proteins and beta-lactamases is presented.« less
Active site of tripeptidyl peptidase II from human erythrocytes is of the subtilisin type.
Tomkinson, B; Wernstedt, C; Hellman, U; Zetterqvist, O
1987-01-01
The present report presents evidence that the amino acid sequence around the serine of the active site of human tripeptidyl peptidase II is of the subtilisin type. The enzyme from human erythrocytes was covalently labeled at its active site with [3H]diisopropyl fluorophosphate, and the protein was subsequently reduced, alkylated, and digested with trypsin. The labeled tryptic peptides were purified by gel filtration and repeated reversed-phase HPLC, and their amino-terminal sequences were determined. Residue 9 contained the radioactive label and was, therefore, considered to be the active serine residue. The primary structure of the part of the active site (residues 1-10) containing this residue was concluded to be Xaa-Thr-Gln-Leu-Met-Asx-Gly-Thr-Ser-Met. This amino acid sequence is homologous to the sequence surrounding the active serine of the microbial peptidases subtilisin and thermitase. These data demonstrate that human tripeptidyl peptidase II represents a potentially distinct class of human peptidases and raise the question of an evolutionary relationship between the active site of a mammalian peptidase and that of the subtilisin family of serine peptidases. PMID:3313395
Sun, Zhizeng; Mehta, Shrenik C; Adamski, Carolyn J; Gibbs, Richard A; Palzkill, Timothy
2016-09-12
CphA is a Zn(2+)-dependent metallo-β-lactamase that efficiently hydrolyzes only carbapenem antibiotics. To understand the sequence requirements for CphA function, single codon random mutant libraries were constructed for residues in and near the active site and mutants were selected for E. coli growth on increasing concentrations of imipenem, a carbapenem antibiotic. At high concentrations of imipenem that select for phenotypically wild-type mutants, the active-site residues exhibit stringent sequence requirements in that nearly all residues in positions that contact zinc, the substrate, or the catalytic water do not tolerate amino acid substitutions. In addition, at high imipenem concentrations a number of residues that do not directly contact zinc or substrate are also essential and do not tolerate substitutions. Biochemical analysis confirmed that amino acid substitutions at essential positions decreased the stability or catalytic activity of the CphA enzyme. Therefore, the CphA active - site is fragile to substitutions, suggesting active-site residues are optimized for imipenem hydrolysis. These results also suggest that resistance to inhibitors targeted to the CphA active site would be slow to develop because of the strong sequence constraints on function.
Active site of tripeptidyl peptidase II from human erythrocytes is of the subtilisin type
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomkinson, B.; Wernstedt, C.; Hellman, U.
1987-11-01
The present report presents evidence that the amino acid sequence around the serine of the active site of human tripeptidyl peptidase II is of the subtilisin type. The enzyme from human erythrocytes was covalently labeled at its active site with (/sup 3/H)diisopropyl fluorophosphate, and the protein was subsequently reduced, alkylated, and digested with trypsin. The labeled tryptic peptides were purified by gel filtration and repeated reversed-phase HPLC, and their amino-terminal sequences were determined. Residue 9 contained the radioactive label and was, therefore, considered to be the active serine residue. The primary structure of the part of the active site (residuesmore » 1-10) containing this residue was concluded to be Xaa-Thr-Gln-Leu-Met-Asx-Gly-Thr-Ser-Met. This amino acid sequence is homologous to the sequence surrounding the active serine of the microbial peptidases subtilisin and thermitase. These data demonstrate that human tripeptidyl peptidase II represents a potentially distinct class of human peptidases and raise the question of an evolutionary relationship between the active site of a mammalian peptidase and that of the subtilisin family of serine peptidases.« less
Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit
2003-01-01
Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563
Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan
2013-01-01
A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-09-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. © 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-01-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. PMID:26073648
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Composition for nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-08-26
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-06-06
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-05-30
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Isolation and characterization of target sequences of the chicken CdxA homeobox gene.
Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A
1993-01-01
The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943
Pattern similarity study of functional sites in protein sequences: lysozymes and cystatins
Nakai, Shuryo; Li-Chan, Eunice CY; Dou, Jinglie
2005-01-01
Background Although it is generally agreed that topography is more conserved than sequences, proteins sharing the same fold can have different functions, while there are protein families with low sequence similarity. An alternative method for profile analysis of characteristic conserved positions of the motifs within the 3D structures may be needed for functional annotation of protein sequences. Using the approach of quantitative structure-activity relationships (QSAR), we have proposed a new algorithm for postulating functional mechanisms on the basis of pattern similarity and average of property values of side-chains in segments within sequences. This approach was used to search for functional sites of proteins belonging to the lysozyme and cystatin families. Results Hydrophobicity and β-turn propensity of reference segments with 3–7 residues were used for the homology similarity search (HSS) for active sites. Hydrogen bonding was used as the side-chain property for searching the binding sites of lysozymes. The profiles of similarity constants and average values of these parameters as functions of their positions in the sequences could identify both active and substrate binding sites of the lysozyme of Streptomyces coelicolor, which has been reported as a new fold enzyme (Cellosyl). The same approach was successfully applied to cystatins, especially for postulating the mechanisms of amyloidosis of human cystatin C as well as human lysozyme. Conclusion Pattern similarity and average index values of structure-related properties of side chains in short segments of three residues or longer were, for the first time, successfully applied for predicting functional sites in sequences. This new approach may be applicable to studying functional sites in un-annotated proteins, for which complete 3D structures are not yet available. PMID:15904486
Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D
1998-08-15
Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both autophosphorylation/activation and protein phosphatase-mediated dephosphorylation/inactivation processes. Taken together, our results identify Thr402 as the regulatory autophosphorylation site of auto-kinase, which is a C-terminal catalytic fragment of PAK2.
Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D
1998-01-01
Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both autophosphorylation/activation and protein phosphatase-mediated dephosphorylation/inactivation processes. Taken together, our results identify Thr402 as the regulatory autophosphorylation site of auto-kinase, which is a C-terminal catalytic fragment of PAK2. PMID:9693111
Sequence requirement of the ade6-4095 meiotic recombination hotspot in Schizosaccharomyces pombe.
Foulis, Steven J; Fowler, Kyle R; Steiner, Walter W
2018-02-01
Homologous recombination occurs at a greatly elevated frequency in meiosis compared to mitosis and is initiated by programmed double-strand DNA breaks (DSBs). DSBs do not occur at uniform frequency throughout the genome in most organisms, but occur preferentially at a limited number of sites referred to as hotspots. The location of hotspots have been determined at nucleotide-level resolution in both the budding and fission yeasts, and while several patterns have emerged regarding preferred locations for DSB hotspots, it remains unclear why particular sites experience DSBs at much higher frequency than other sites with seemingly similar properties. Short sequence motifs, which are often sites for binding of transcription factors, are known to be responsible for a number of hotspots. In this study we identified the minimum sequence required for activity of one of such motif identified in a screen of random sequences capable of producing recombination hotspots. The experimentally determined sequence, GGTCTRGACC, closely matches the previously inferred sequence. Full hotspot activity requires an effective sequence length of 9.5 bp, whereas moderate activity requires an effective sequence length of approximately 8.2 bp and shows significant association with DSB hotspots. In combination with our previous work, this result is consistent with a large number of different sequence motifs capable of producing recombination hotspots, and supports a model in which hotspots can be rapidly regenerated by mutation as they are lost through recombination.
Labeled nucleotide phosphate (NP) probes
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2009-02-03
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Langley, Alexander R.; Gräf, Stefan; Smith, James C.; Krude, Torsten
2016-01-01
Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. PMID:27587586
Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten
2016-12-01
Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
EEG and ECG changes during simulator operation reflect mental workload and vigilance.
Dussault, Caroline; Jouanin, Jean-Claude; Philippe, Matthieu; Guezennec, Charles-Yannick
2005-04-01
Performing mission tasks in a simulator influences many neurophysiological measures. Quantitative assessments of electroencephalography (EEG) and electrocardiography (ECG) have made it possible to develop indicators of mental workload and to estimate relative physiological responses to cognitive requirements. To evaluate the effects of mental workload without actual physical risk, we studied the cortical and cardiovascular changes that occurred during simulated flight. There were 12 pilots (8 novices and 4 experts) who simulated a flight composed of 10 sequences that induced several different mental workload levels. EEG was recorded at 12 electrode sites during rest and flight sequences; ECG activity was also recorded. Subjective tests were used to evaluate anxiety and vigilance levels. Theta band activity was lower during the two simulated flight rest sequences than during visual and instrument flight sequences at central, parietal, and occipital sites (p < 0.05). On the other hand, rest sequences resulted in higher beta (at the C4 site; p < 0.05) and gamma (at the central, parietal, and occipital sites; p < 0.05) power than active segments. The mean heart rate (HR) was not significantly different during any simulated flight sequence, but HR was lower for expert subjects than for novices. The subjective tests revealed no significant anxiety and high values for vigilance levels before and during flight. The different flight sequences performed on the simulator resulted in electrophysiological changes that expressed variations in mental workload. These results corroborate those found during study of real flights, particularly during sequences requiring the heaviest mental workload.
Nucleic acid analysis using terminal-phosphate-labeled nucleotides
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-04-22
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.
2004-08-06
The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less
Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart
1999-01-01
Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456
Ward, T R; Hoang, M L; Prusty, R; Lau, C K; Keil, R L; Fangman, W L; Brewer, B J
2000-07-01
In the ribosomal DNA of Saccharomyces cerevisiae, sequences in the nontranscribed spacer 3' of the 35S ribosomal RNA gene are important to the polar arrest of replication forks at a site called the replication fork barrier (RFB) and also to the cis-acting, mitotic hyperrecombination site called HOT1. We have found that the RFB and HOT1 activity share some but not all of their essential sequences. Many of the mutations that reduce HOT1 recombination also decrease or eliminate fork arrest at one of two closely spaced RFB sites, RFB1 and RFB2. A simple model for the juxtaposition of RFB and HOT1 sequences is that the breakage of strands in replication forks arrested at RFB stimulates recombination. Contrary to this model, we show here that HOT1-stimulated recombination does not require the arrest of forks at the RFB. Therefore, while HOT1 activity is independent of replication fork arrest, HOT1 and RFB require some common sequences, suggesting the existence of a common trans-acting factor(s).
Zerbe, Philipp; Chiang, Angela; Yuen, Macaire; Hamberger, Björn; Hamberger, Britta; Draper, Jason A.; Britton, Robert; Bohlmann, Jörg
2012-01-01
The labdanoid diterpene alcohol cis-abienol is a major component of the aromatic oleoresin of balsam fir (Abies balsamea) and serves as a valuable bioproduct material for the fragrance industry. Using high-throughput 454 transcriptome sequencing and metabolite profiling of balsam fir bark tissue, we identified candidate diterpene synthase sequences for full-length cDNA cloning and functional characterization. We discovered a bifunctional class I/II cis-abienol synthase (AbCAS), along with the paralogous levopimaradiene/abietadiene synthase and isopimaradiene synthase, all of which are members of the gymnosperm-specific TPS-d subfamily. The AbCAS-catalyzed formation of cis-abienol proceeds via cyclization and hydroxylation at carbon C-8 of a postulated carbocation intermediate in the class II active site, followed by cleavage of the diphosphate group and termination of the reaction sequence without further cyclization in the class I active site. This reaction mechanism is distinct from that of synthases of the isopimaradiene- or levopimaradiene/abietadiene synthase type, which employ deprotonation reactions in the class II active site and secondary cyclizations in the class I active site, leading to tricyclic diterpenes. Comparative homology modeling suggested the active site residues Asp-348, Leu-617, Phe-696, and Gly-723 as potentially important for the specificity of AbCAS. As a class I/II bifunctional enzyme, AbCAS is a promising target for metabolic engineering of cis-abienol production. PMID:22337889
Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.
Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T
1993-01-01
A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829
An in-silico insight into the characteristics of β-propeller phytase.
Mathew, Akash; Verma, Anukriti; Gaur, Smriti
2014-06-01
Phytase is an enzyme that is found extensively in the plant kingdom and in some species of bacteria and fungi. This paper identifies and analyses the available full length sequences of β-propeller phytases (BPP). BPP was chosen due to its potential applicability in the field of aquaculture. The sequences were obtained from the Uniprot database and subject to various online bioinformatics tools to elucidate the physio-chemical characteristics, secondary structures and active site compositions of BPP. Protparam and SOPMA were used to analyse the physiochemical and secondary structure characteristics, while the Expasy online modelling tool and CASTp were used to model the 3-D structure and identify the active sites of the BPP sequences. The amino acid compositions of the four sequences were compared and composed in a graphical format to identify similarities and highlight the potentially important amino acids that form the active site of BPP. This study aims to analyse BPP and contribute to the clarification of the molecular mechanism involved in the enzyme activity of BPP and contribute in part to the possibility of constructing a synthetic version of BPP.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.
2004-08-06
Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less
Catling, A D; Schaeffer, H J; Reuter, C W; Reddy, G R; Weber, M J
1995-10-01
Mammalian MEK1 and MEK2 contain a proline-rich (PR) sequence that is absent both from the yeast homologs Ste7 and Byr1 and from a recently cloned activator of the JNK/stress-activated protein kinases, SEK1/MKK4. Since this PR sequence occurs in MEKs that are regulated by Raf family enzymes but is missing from MEKs and SEKs activated independently of Raf, we sought to investigate the role of this sequence in MEK1 and MEK2 regulation and function. Deletion of the PR sequence from MEK1 blocked the ability of MEK1 to associate with members of the Raf family and markedly attenuated activation of the protein in vivo following growth factor stimulation. In addition, this sequence was necessary for efficient activation of MEK1 in vitro by B-Raf but dispensable for activation by a novel MEK1 activator which we have previously detected in fractionated fibroblast extracts. Furthermore, we found that a phosphorylation site within the PR sequence of MEK1 was required for sustained MEK1 activity in response to serum stimulation of quiescent fibroblasts. Consistent with this observation, we observed that MEK2, which lacks a phosphorylation site at the corresponding position, was activated only transiently following serum stimulation. Finally, we found that deletion of the PR sequence from a constitutively activated MEK1 mutant rendered the protein nontransforming in Rat1 fibroblasts. These observations indicate a critical role for the PR sequence in directing specific protein-protein interactions important for the activation, inactivation, and downstream functioning of the MEKs.
Catling, A D; Schaeffer, H J; Reuter, C W; Reddy, G R; Weber, M J
1995-01-01
Mammalian MEK1 and MEK2 contain a proline-rich (PR) sequence that is absent both from the yeast homologs Ste7 and Byr1 and from a recently cloned activator of the JNK/stress-activated protein kinases, SEK1/MKK4. Since this PR sequence occurs in MEKs that are regulated by Raf family enzymes but is missing from MEKs and SEKs activated independently of Raf, we sought to investigate the role of this sequence in MEK1 and MEK2 regulation and function. Deletion of the PR sequence from MEK1 blocked the ability of MEK1 to associate with members of the Raf family and markedly attenuated activation of the protein in vivo following growth factor stimulation. In addition, this sequence was necessary for efficient activation of MEK1 in vitro by B-Raf but dispensable for activation by a novel MEK1 activator which we have previously detected in fractionated fibroblast extracts. Furthermore, we found that a phosphorylation site within the PR sequence of MEK1 was required for sustained MEK1 activity in response to serum stimulation of quiescent fibroblasts. Consistent with this observation, we observed that MEK2, which lacks a phosphorylation site at the corresponding position, was activated only transiently following serum stimulation. Finally, we found that deletion of the PR sequence from a constitutively activated MEK1 mutant rendered the protein nontransforming in Rat1 fibroblasts. These observations indicate a critical role for the PR sequence in directing specific protein-protein interactions important for the activation, inactivation, and downstream functioning of the MEKs. PMID:7565670
Mathupala, S P; Lowe, S E; Podkovyrov, S M; Zeikus, J G
1993-08-05
The complete nucleotide sequence of the gene encoding the dual active amylopullulanase of Thermoanaerobacter ethanolicus 39E (formerly Clostridium thermohydrosulfuricum) was determined. The structural gene (apu) contained a single open reading frame 4443 base pairs in length, corresponding to 1481 amino acids, with an estimated molecular weight of 162,780. Analysis of the deduced sequence of apu with sequences of alpha-amylases and alpha-1,6 debranching enzymes enabled the identification of four conserved regions putatively involved in substrate binding and in catalysis. The conserved regions were localized within a 2.9-kilobase pair gene fragment, which encoded a M(r) 100,000 protein that maintained the dual activities and thermostability of the native enzyme. The catalytic residues of amylopullulanase were tentatively identified by using hydrophobic cluster analysis for comparison of amino acid sequences of amylopullulanase and other amylolytic enzymes. Asp597, Glu626, and Asp703 were individually modified to their respective amide form, or the alternate acid form, and in all cases both alpha-amylase and pullulanase activities were lost, suggesting the possible involvement of 3 residues in a catalytic triad, and the presence of a putative single catalytic site within the enzyme. These findings substantiate amylopullulanase as a new type of amylosaccharidase.
Amino acid sequence of human cholinesterase. Annual report, 30 September 1984-30 September 1985
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lockridge, O.
1985-10-01
The active-site serine residue is located 198 amino acids from the N-terminal. The active-site peptide was isolated from three different genetic types of human serum cholinesterase: from usual, atypical, and atypical-silent genotypes. It was found that the amino acid sequence of the active-site peptide was identical in all three genotypes. Comparison of the complete sequences of cholinesterase from human serum and acetylcholinesterase from the electric organ of Torpedo californica shows an identity of 53%. Cholinesterase is of interest to the Department of Defense because cholinesterase protects against organophosphate poisons of the type used in chemical warfare. The structural results presentedmore » here will serve as the basis for cloning the gene for cholinesterase. The potential uses of large amounts of cholinesterase would be for cleaning up spills of organophosphates and possibly for detoxifying exposed personnel.« less
Taccardi, Bruno; Punske, Bonnie B; Sachse, Frank; Tricoche, Xavier; Colli-Franzone, Piero; Pavarino, Luca F; Zabawa, Christine
2005-10-01
There are no published data showing the three-dimensional sequence of repolarization and the associated potential fields in the ventricles. Knowledge of the sequence of repolarization has medical relevance because high spatial dispersion of recovery times and action potential durations favors cardiac arrhythmias. In this study we describe measured and simulated 3-D excitation and recovery sequences and activation-recovery intervals (ARIs) (measured) or action potential durations (APDs) (simulated) in the ventricular walls. We recorded from 600 to 1400 unipolar electrograms from canine ventricular walls during atrial and ventricular pacing at 350-450 ms cycle length. Measured excitation and recovery times and ARIs were displayed as 2-D maps in transmural planes or 3-D maps in the volume explored, using specially developed software. Excitation and recovery sequences and APD distributions were also simulated in parallelepipedal slabs using anisotropic monodomain or bidomain models based on the Lou-Rudy version 1 model with homogeneous membrane properties. Simulations showed that in the presence of homogeneous membrane properties, the sequence of repolarization was similar but not identical to the excitation sequence. In a transmural plane perpendicular to epicardial fiber direction, both activation and recovery pathways starting from an epicardial pacing site returned toward the epicardium at a few cm distance from the pacing site. However, APDs were not constant, but had a dispersion of approximately 14 ms in the simulated domain. The maximum APD value was near the pacing site and two minima appeared along a line perpendicular to fiber directions, passing through the pacing site. Electrical measurements in dog ventricles showed that, for short cycle lengths, both excitation and recovery pathways, starting from an epicardial pacing site, returned toward the epicardium. For slower pacing rates, pathways of recovery departed from the pathway of excitation. Highest ARI values were observed near the pacing site in part of the experiments. In addition, maps of activation-recovery intervals showed mid-myocardial clusters with activation-recovery intervals that were slightly longer than ARIs closer to the epi- or endocardium, suggesting the presence of M cells in those areas. Transmural dispersion of measured ARIs was on the order of 20-25 ms. Potential distributions during recovery were less affected by myocardial anisotropy than were excitation potentials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Soo-Ik; Hammes, G.G.
1989-11-01
Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chickenmore » and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the {beta}-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution.« less
Driggers, Camden M.; Hartman, Steven J.; Karplus, P. Andrew
2015-01-01
In some bacteria, cysteine is converted to cysteine sulfinic acid by cysteine dioxygenases (CDO) that are only ~15–30% identical in sequence to mammalian CDOs. Among bacterial proteins having this range of sequence similarity to mammalian CDO are some that conserve an active site Arg residue (“Arg-type” enzymes) and some having a Gln substituted for this Arg (“Gln-type” enzymes). Here, we describe a structure from each of these enzyme types by analyzing structures originally solved by structural genomics groups but not published: a Bacillus subtilis “Arg-type” enzyme that has cysteine dioxygenase activity (BsCDO), and a Ralstonia eutropha “Gln-type” CDO homolog ofmore » uncharacterized activity (ReCDOhom). The BsCDO active site is well conserved with mammalian CDO, and a cysteine complex captured in the active site confirms that the cysteine binding mode is also similar. The ReCDOhom structure reveals a new active site Arg residue that is hydrogen bonding to an iron-bound diatomic molecule we have interpreted as dioxygen. Notably, the Arg position is not compatible with the mode of Cys binding seen in both rat CDO and BsCDO. As sequence alignments show that this newly discovered active site Arg is well conserved among “Gln-type” CDO enzymes, we conclude that the “Gln-type” CDO homologs are not authentic CDOs but will have substrate specificity more similar to 3-mercaptopropionate dioxygenases.« less
Sequence features of viral and human Internal Ribosome Entry Sites predictive of their activity
Elias-Kirma, Shani; Nir, Ronit; Segal, Eran
2017-01-01
Translation of mRNAs through Internal Ribosome Entry Sites (IRESs) has emerged as a prominent mechanism of cellular and viral initiation. It supports cap-independent translation of select cellular genes under normal conditions, and in conditions when cap-dependent translation is inhibited. IRES structure and sequence are believed to be involved in this process. However due to the small number of IRESs known, there have been no systematic investigations of the determinants of IRES activity. With the recent discovery of thousands of novel IRESs in human and viruses, the next challenge is to decipher the sequence determinants of IRES activity. We present the first in-depth computational analysis of a large body of IRESs, exploring RNA sequence features predictive of IRES activity. We identified predictive k-mer features resembling IRES trans-acting factor (ITAF) binding motifs across human and viral IRESs, and found that their effect on expression depends on their sequence, number and position. Our results also suggest that the architecture of retroviral IRESs differs from that of other viruses, presumably due to their exposure to the nuclear environment. Finally, we measured IRES activity of synthetically designed sequences to confirm our prediction of increasing activity as a function of the number of short IRES elements. PMID:28922394
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.
2003-06-01
OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less
Molecular cloning of the pheromone biosynthesis-activating neuropeptide in Helicoverpa zea.
Davis, M T; Vakharia, V N; Henry, J; Kempe, T G; Raina, A K
1992-01-01
Pheromone biosynthesis-activating neuropeptide (PBAN) regulates sex pheromone biosynthesis in female Helicoverpa (Heliothis) zea. Two oligonucleotide probes representing two overlapping amino acid regions of PBAN were used to screen 2.5 x 10(5) recombinant plaques, and a positive recombinant clone was isolated. Sequence analysis of the isolated clone showed that the PBAN gene is interrupted after the codon encoding amino acid 14 by a 0.63-kilobase (kb) intron. Preceding the PBAN amino acid sequence is a 10-amino acid sequence containing a pentapeptide Phe-Thr-Pro-Arg-Leu, which is followed by a Gly-Arg-Arg processing site. Immediately after the PBAN amino acid sequence is a Gly-Arg processing site and a short stretch of 10 amino acids. This 10-amino acid sequence contains a repeat of the PBAN C-terminal pentapeptide Phe-Ser-Pro-Arg-Leu and is terminated by another Gly-Arg processing site. It is suggested that the PBAN gene in H. zea might carry, besides PBAN, a 7- and an 8-residue amidated peptide, which share with PBAN the core C-terminal pentapeptide Phe-(Ser or Thr)-Pro-Arg-Leu-NH2. The C-terminal pentapeptide sequence of PBAN represents the minimum sequence required for pheromonotropic activity in H. zea and also bears a high degree of homology to the pyrokinin family of insect peptides with myotropic activity. It is possible that the putative heptapeptide and octapeptide might be new members of the pyrokinin family, with pheromonotropic and/or myotropic activities. Thus, the PBAN gene products, besides affecting sexual behavior, might have broad influence on many biological processes in H. zea. Images PMID:1729680
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Tavares, D; Tully, K; Dobner, P R
1999-10-15
The promoter region of the mouse high affinity neurotensin receptor (Ntr-1) gene was characterized, and sequences required for expression in neuroblastoma cell lines that express high affinity NT-binding sites were characterized. Me(2)SO-induced neuronal differentiation of N1E-115 neuroblastoma cells increased both the expression of the endogenous Ntr-1 gene and reporter genes driven by NTR-1 promoter sequences by 3-4-fold. Deletion analysis revealed that an 83-base pair promoter region containing the transcriptional start site is required for Me(2)SO activation. Detailed mutational analysis of this region revealed that a CACCC box and the central region of a large GC-rich palindrome are the crucial cis-regulatory elements required for Me(2)SO induction. The CACCC box is bound by at least one factor that is induced upon Me(2)SO treatment of N1E-115 cells. The Me(2)SO effect was found to be both selective and cell type-restricted. Basal expression in the neuroblastoma cell lines required a distinct set of sequences, including an Sp1-like sequence, and a sequence resembling an NGFI-A-binding site; however, a more distal 5' sequence was found to repress basal activity in N1E-115 cells. These results provide evidence that Ntr-1 gene regulation involves both positive and negative regulatory elements located in the 5'-flanking region and that Ntr-1 gene activation involves the coordinate activation or induction of several factors, including a CACCC box binding complex.
Characterization of a native hammerhead ribozyme derived from schistosomes
OSBORNE, EDITH M.; SCHAAK, JANELL E.; DEROSE, VICTORIA J.
2005-01-01
A recent re-examination of the role of the helices surrounding the conserved core of the hammerhead ribozyme has identified putative loop–loop interactions between stems I and II in native hammerhead sequences. These extended hammerhead sequences are more active at low concentrations of divalent cations than are minimal hammerheads. The loop–loop interactions are proposed to stabilize a more active conformation of the conserved core. Here, a kinetic and thermodynamic characterization of an extended hammerhead sequence derived from Schistosoma mansoni is performed. Biphasic kinetics are observed, suggesting the presence of at least two conformers, one cleaving with a fast rate and the other with a slow rate. Replacing loop II with a poly(U) sequence designed to eliminate the interaction between the two loops results in greatly diminished activity, suggesting that the loop–loop interactions do aid in forming a more active conformation. Previous studies with minimal hammerheads have shown deleterious effects of Rp-phosphorothioate substitutions at the cleavage site and 5′ to A9, both of which could be rescued with Cd2+. Here, phosphorothioate modifications at the cleavage site and 5′ to A9 were made in the schistosome-derived sequence. In Mg2+, both phosphorothioate substitutions decreased the overall fraction cleaved without significantly affecting the observed rate of cleavage. The addition of Cd2+ rescued cleavage in both cases, suggesting that these are still putative metal binding sites in this native sequence. PMID:15659358
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin
2011-01-01
Ventricular arrhythmias represent one of leading causes for sudden cardiac death, a significant problem in public health. Noninvasive imaging of cardiac electric activities associated with ventricular arrhythmias plays an important role in better our understanding of the mechanisms and optimizing the treatment options. The present study aims to rigorously validate a novel three-dimensional (3-D) cardiac electrical imaging (3-DCEI) technique with the aid of 3-D intra-cardiac mapping during paced rhythm and ventricular tachycardia (VT) in the rabbit heart. Body surface potentials and intramural bipolar electrical recordings were simultaneously measured in a closed-chest condition in thirteen healthy rabbits. Single-site pacing and dual-site pacing were performed from ventricular walls and septum. VTs and premature ventricular complexes (PVCs) were induced by intravenous norepinephrine (NE). The non-invasively imaged activation sequence correlated well with invasively measured counterparts, with a correlation coefficient of 0.72 and a relative error of 0.30 averaged over all paced beats and NE-induced PVCs and VT beats. The averaged distance from imaged site of initial activation to measured site determined from intra-cardiac mapping was ∼5mm. These promising results suggest that 3-DCEI is feasible to non-invasively localize the origins and image activation sequence of focal ventricular arrhythmias.
Lee, Ciaran M; Davis, Timothy H; Bao, Gang
2018-04-01
What is the topic of this review? In this review, we analyse the performance of recently described tools for CRISPR/Cas9 guide RNA design, in particular, design tools that predict CRISPR/Cas9 activity. What advances does it highlight? Recently, many tools designed to predict CRISPR/Cas9 activity have been reported. However, the majority of these tools lack experimental validation. Our analyses indicate that these tools have poor predictive power. Our preliminary results suggest that target site accessibility should be considered in order to develop better guide RNA design tools with improved predictive power. The recent adaptation of the clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system for targeted genome engineering has led to its widespread application in many fields worldwide. In order to gain a better understanding of the design rules of CRISPR/Cas9 systems, several groups have carried out large library-based screens leading to some insight into sequence preferences among highly active target sites. To facilitate CRISPR/Cas9 design, these studies have spawned a plethora of guide RNA (gRNA) design tools with algorithms based solely on direct or indirect sequence features. Here, we demonstrate that the predictive power of these tools is poor, suggesting that sequence features alone cannot accurately inform the cutting efficiency of a particular CRISPR/Cas9 gRNA design. Furthermore, we demonstrate that DNA target site accessibility influences the activity of CRISPR/Cas9. With further optimization, we hypothesize that it will be possible to increase the predictive power of gRNA design tools by including both sequence and target site accessibility metrics. © 2017 The Authors. Experimental Physiology © 2017 The Physiological Society.
The amino acid sequence around the active-site cysteine and histidine residues of stem bromelain
Husain, S. S.; Lowe, G.
1970-01-01
Stem bromelain that had been irreversibly inhibited with 1,3-dibromo[2-14C]-acetone was reduced with sodium borohydride and carboxymethylated with iodoacetic acid. After digestion with trypsin and α-chymotrypsin three radioactive peptides were isolated chromatographically. The amino acid sequences around the cross-linked cysteine and histidine residues were determined and showed a high degree of homology with those around the active-site cysteine and histidine residues of papain and ficin. PMID:5420046
Armstrong, Craig T; Anderson, J L Ross; Denton, Richard M
2014-04-15
The regulation of the 2-oxoglutarate dehydrogenase complex is central to intramitochondrial energy metabolism. In the present study, the active full-length E1 subunit of the human complex has been expressed and shown to be regulated by Ca2+, adenine nucleotides and NADH, with NADH exerting a major influence on the K0.5 value for Ca2+. We investigated two potential Ca2+-binding sites on E1, which we term site 1 (D114ADLD) and site 2 (E139SDLD). Comparison of sequences from vertebrates with those from Ca2+-insensitive non-vertebrate complexes suggest that site 1 may be the more important. Consistent with this view, a mutated form of E1, D114A, shows a 6-fold decrease in sensitivity for Ca2+, whereas variant ∆site1 (in which the sequence of site 1 is replaced by A114AALA) exhibits an almost complete loss of Ca2+ activation. Variant ∆site2 (in which the sequence is replaced with A139SALA) shows no measurable change in Ca2+ sensitivity. We conclude that site 1, but not site 2, forms part of a regulatory Ca2+-binding site, which is distinct from other previously described Ca2+-binding sites.
Satagopan, Sriram; Chan, Sum; Perry, L. Jeanne; Tabita, F. Robert
2014-01-01
The first x-ray crystal structure has been solved for an activated transition-state analog-bound form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco). This enzyme, from Rhodopseudomonas palustris, assembles as a unique hexamer with three pairs of catalytic large subunit homodimers around a central 3-fold symmetry axis. This oligomer arrangement is unique among all known Rubisco structures, including the form II homolog from Rhodospirillum rubrum. The presence of a transition-state analog in the active site locked the activated enzyme in a “closed” conformation and revealed the positions of critical active site residues during catalysis. Functional roles of two form II-specific residues (Ile165 and Met331) near the active site were examined via site-directed mutagenesis. Substitutions at these residues affect function but not the ability of the enzyme to assemble. Random mutagenesis and suppressor selection in a Rubisco deletion strain of Rhodobacter capsulatus identified a residue in the amino terminus of one subunit (Ala47) that compensated for a negative change near the active site of a neighboring subunit. In addition, substitution of the native carboxyl-terminal sequence with the last few dissimilar residues from the related R. rubrum homolog increased the enzyme's kcat for carboxylation. However, replacement of a longer carboxyl-terminal sequence with termini from either a form III or a form I enzyme, which varied both in length and sequence, resulted in complete loss of function. From these studies, it is evident that a number of subtle interactions near the active site and the carboxyl terminus account for functional differences between the different forms of Rubiscos found in nature. PMID:24942737
Satagopan, Sriram; Chan, Sum; Perry, L Jeanne; Tabita, F Robert
2014-08-01
The first x-ray crystal structure has been solved for an activated transition-state analog-bound form II ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco). This enzyme, from Rhodopseudomonas palustris, assembles as a unique hexamer with three pairs of catalytic large subunit homodimers around a central 3-fold symmetry axis. This oligomer arrangement is unique among all known Rubisco structures, including the form II homolog from Rhodospirillum rubrum. The presence of a transition-state analog in the active site locked the activated enzyme in a "closed" conformation and revealed the positions of critical active site residues during catalysis. Functional roles of two form II-specific residues (Ile(165) and Met(331)) near the active site were examined via site-directed mutagenesis. Substitutions at these residues affect function but not the ability of the enzyme to assemble. Random mutagenesis and suppressor selection in a Rubisco deletion strain of Rhodobacter capsulatus identified a residue in the amino terminus of one subunit (Ala(47)) that compensated for a negative change near the active site of a neighboring subunit. In addition, substitution of the native carboxyl-terminal sequence with the last few dissimilar residues from the related R. rubrum homolog increased the enzyme's kcat for carboxylation. However, replacement of a longer carboxyl-terminal sequence with termini from either a form III or a form I enzyme, which varied both in length and sequence, resulted in complete loss of function. From these studies, it is evident that a number of subtle interactions near the active site and the carboxyl terminus account for functional differences between the different forms of Rubiscos found in nature. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna
2009-11-01
The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.
Chibani, Kamel; Tarrago, Lionel; Gualberto, José Manuel; Wingsle, Gunnar; Rey, Pascal; Jacquot, Jean-Pierre; Rouhier, Nicolas
2012-01-01
Plant thioredoxins (Trxs) constitute a complex family of thiol oxidoreductases generally sharing a WCGPC active site sequence. Some recently identified plant Trxs (Clot, Trx-like1 and -2, Trx-lilium1, -2, and -3) display atypical active site sequences with altered residues between the two conserved cysteines. The transcript expression patterns, subcellular localizations, and biochemical properties of some representative poplar (Populus spp.) isoforms were investigated. Measurements of transcript levels for the 10 members in poplar organs indicate that most genes are constitutively expressed. Using transient expression of green fluorescent protein fusions, Clot and Trx-like1 were found to be mainly cytosolic, whereas Trx-like2.1 was located in plastids. All soluble recombinant proteins, except Clot, exhibited insulin reductase activity, although with variable efficiencies. Whereas Trx-like2.1 and Trx-lilium2.2 were efficiently regenerated both by NADPH-Trx reductase and glutathione, none of the proteins were reduced by the ferredoxin-Trx reductase. Only Trx-like2.1 supports the activity of plastidial thiol peroxidases and methionine sulfoxide reductases employing a single cysteine residue for catalysis and using a glutathione recycling system. The second active site cysteine of Trx-like2.1 is dispensable for this reaction, indicating that the protein possesses a glutaredoxin-like activity. Interestingly, the Trx-like2.1 active site replacement, from WCRKC to WCGPC, suppresses its capacity to use glutathione as a reductant but is sufficient to allow the regeneration of target proteins employing two cysteines for catalysis, indicating that the nature of the residues composing the active site sequence is crucial for substrate selectivity/recognition. This study provides another example of the cross talk existing between the glutathione/glutaredoxin and Trx-dependent pathways. PMID:22523226
Ryner, L C; Takagaki, Y; Manley, J L
1989-01-01
To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911
Distribution and Features of the Six Classes of Peroxiredoxins
Poole, Leslie B.; Nelson, Kimberly J.
2016-01-01
Peroxiredoxins are cysteine-dependent peroxide reductases that group into 6 different, structurally discernable classes. In 2011, our research team reported the application of a bioinformatic approach called active site profiling to extract active site-proximal sequence segments from the 29 distinct, structurally-characterized peroxiredoxins available at the time. These extracted sequences were then used to create unique profiles for the six groups which were subsequently used to search GenBank(nr), allowing identification of ∼3500 peroxiredoxin sequences and their respective subgroups. Summarized in this minireview are the features and phylogenetic distributions of each of these peroxiredoxin subgroups; an example is also provided illustrating the use of the web accessible, searchable database known as PREX to identify subfamily-specific peroxiredoxin sequences for the organism Vitis vinifera (grape). PMID:26810075
Fibronectin tetrapeptide is target for syphilis spirochete cytadherence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thomas, D.D.; Baseman, J.B.; Alderete, J.F.
1985-11-01
The syphilis bacterium, Treponema pallidum, parasitizes host cells through recognition of fibronectin (Fn) on cell surfaces. The active site of the Fn molecule has been identified as a four-amino acid sequence, arg-gly-asp-ser (RGDS), located on each monomer of the cell-binding domain. The synthetic heptapeptide gly-arg-gly-asp-ser-pro-cys (GRGDSPC), with the active site sequence RGDS, specifically competed with SVI-labeled cell-binding domain acquisition by T. pallidum. Additionally, the same heptapeptide with the RGDS sequence diminished treponemal attachment to HEp-2 and HT1080 cell monolayers. Related heptapeptides altered in one key amino acid within the RGDS sequence failed to inhibit Fn cell-binding domain acquisition or parasitismmore » of host cells by T. pallidum. The data support the view that T. pallidum cytadherence of host cells is through recognition of the RGDS sequence also important for eukaryotic cell-Fn binding.« less
Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S
2011-01-21
DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.
Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok
2011-02-01
RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Adhikari, Utpal Kumar; Rahman, M Mizanur
2017-04-01
The nirk gene encoding the copper-containing nitrite reductase (CuNiR), a key catalytic enzyme in the environmental denitrification process that helps to produce nitric oxide from nitrite. The molecular mechanism of denitrification process is definitely complex and in this case a theoretical investigation has been conducted to know the sequence information and amino acid composition of the active site of CuNiR enzyme using various Bioinformatics tools. 10 Fasta formatted sequences were retrieved from the NCBI database and the domain and disordered regions identification and phylogenetic analyses were done on these sequences. The comparative modeling of protein was performed through Modeller 9v14 program and visualized by PyMOL tools. Validated protein models were deposited in the Protein Model Database (PMDB) (PMDB id: PM0080150 to PM0080159). Active sites of nirk encoding CuNiR enzyme were identified by Castp server. The PROCHECK showed significant scores for four protein models in the most favored regions of the Ramachandran plot. Active sites and cavities prediction exhibited that the amino acid, namely Glycine, Alanine, Histidine, Aspartic acid, Glutamic acid, Threonine, and Glutamine were common in four predicted protein models. The present in silico study anticipates that active site analyses result will pave the way for further research on the complex denitrification mechanism of the selected species in the experimental laboratory. Copyright © 2016. Published by Elsevier Ltd.
De Marco, L; Mazzucato, M; Masotti, A; Ruggeri, Z M
1994-03-04
Glycoprotein (GP) Ib alpha is required for expression of the highest affinity alpha-thrombin-binding site on platelets, possibly contributing to platelet activation through a pathway involving cleavage of a specific receptor. This function may be important for the initiation of hemostasis and may also play a role in the development of pathological vascular occlusion. We have now identified a discrete sequence in the extracytoplasmic domain of GP Ib alpha, including residues 271-284 of the mature protein, which appears to be part of the high affinity alpha-thrombin-binding site. Synthetic peptidyl mimetics of this sequence inhibit alpha-thrombin binding to GP Ib as well as platelet activation and aggregation induced by subnanomolar concentrations of the agonist; they also inhibit alpha-thrombin binding to purified glycocalicin, the isolated extracytoplasmic portion of GP Ib alpha. The inhibitory peptides interfere with the clotting of fibrinogen by alpha-thrombin but not with the amidolytic activity of the enzyme on a small synthetic substrate, a finding compatible with the concept that the identified GP Ib alpha sequence interacts with the anion-binding exosite of alpha-thrombin but not with its active proteolytic site. The crucial structural elements of this sequence necessary for thrombin binding appear to be a cluster of negatively charged residues as well as three tyrosine residues that, in the native protein, may be sulfated. GP Ib alpha has no significant overall sequence homology with the thrombin inhibitor, hirudin, nor with the specific thrombin receptor on platelets; all three molecules, however, possess a distinct region rich in negatively charged residues that appear to be involved in thrombin binding. This may represent a case of convergent evolution of unrelated proteins for high affinity interaction with the same ligand.
Sequence signatures of allosteric proteins towards rational design.
Namboodiri, Saritha; Verma, Chandra; Dhar, Pawan K; Giuliani, Alessandro; Nair, Achuthsankar S
2010-12-01
Allostery is the phenomenon of changes in the structure and activity of proteins that appear as a consequence of ligand binding at sites other than the active site. Studying mechanistic basis of allostery leading to protein design with predetermined functional endpoints is an important unmet need of synthetic biology. Here, we screened the amino acid sequence landscape in search of sequence-signatures of allostery using Recurrence Quantitative Analysis (RQA) method. A characteristic vector, comprised of 10 features extracted from RQA was defined for amino acid sequences. Using Principal Component Analysis, four factors were found to be important determinants of allosteric behavior. Our sequence-based predictor method shows 82.6% accuracy, 85.7% sensitivity and 77.9% specificity with the current dataset. Further, we show that Laminarity-Mean-hydrophobicity representing repeated hydrophobic patches is the most crucial indicator of allostery. To our best knowledge this is the first report that describes sequence determinants of allostery based on hydrophobicity. As an outcome of these findings, we plan to explore possibility of inducing allostery in proteins.
Multiple splicing defects in an intronic false exon.
Sun, H; Chasin, L A
2000-09-01
Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.
Facile Site-Directed Mutagenesis of Large Constructs Using Gibson Isothermal DNA Assembly.
Yonemoto, Isaac T; Weyman, Philip D
2017-01-01
Site-directed mutagenesis is a commonly used molecular biology technique to manipulate biological sequences, and is especially useful for studying sequence determinants of enzyme function or designing proteins with improved activity. We describe a strategy using Gibson Isothermal DNA Assembly to perform site-directed mutagenesis on large (>~20 kbp) constructs that are outside the effective range of standard techniques such as QuikChange II (Agilent Technologies), but more reliable than traditional cloning using restriction enzymes and ligation.
Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M
1984-01-01
Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178
Arjomand, Maryam Rezaei; Habibi-Rezaei, Mehran; Ahmadian, Gholamreza; Hassanzadeh, Malihe; Karkhane, Ali Asghar; Asadifar, Mandana; Amanlou, Massoud
2016-11-01
Inulinases are classified as hydrolases and widely used in the food and medical industries. Here, we report the deletion of a six-membered adjacent active site loop fragment ( 74 YGSDVT 79 sequence) from third Ω-loop of the exo-inulinase containing aspartate residue from Aspergillus niger to study its structural and functional importance. Site-directed mutagenesis was used to create the mutant of the exo-inulinase (Δ6SL). To investigate the stability of the region spanning this loop, MD simulations were performed 80ns for 20-85 residues. Molecular docking was performed to compare the interactions in the active sites of enzymes with fructose as a ligand. Accordingly, the functional thermostability of the exo-inulinase was significantly decreased upon loop fragment deletion. Evaluation of the kinetics parameters (V max , K m , k cat and, k cat /K m ) and activation energy (E a ) of the catalysis of enzymes indicated the importance of the deleted sequence on the catalytic performance of the enzyme. In conclusion, six-membered adjacent active site loop fragment not only plays a crucial role in the stability of the enzyme, but also it involves in the enzyme catalysis through lowering the activation energy of the catalysis and effective improving the catalytic performance. Copyright © 2016. Published by Elsevier B.V.
Mass Spectrometry to Identify New Biomarkers of Nerve Agent Exposure
2009-04-01
covalent bond with the active site serine in the consensus sequence GXSXG of esterases and proteases. However, the site of attachment to proteins...that have no active site serine has only recently been recognized as tyrosine. In last year’s report we provided mass spectrometry evidence that...PMID: 18502412 Lockridge O, Xue W, Gaydess A, Grigoryan H, Ding SJ, Schopfer LM, Hinrichs SH, Masson P. Pseudo- esterase activity of human albumin
APE1 incision activity at abasic sites in tandem repeat sequences.
Li, Mengxia; Völker, Jens; Breslauer, Kenneth J; Wilson, David M
2014-05-29
Repetitive DNA sequences, such as those present in microsatellites and minisatellites, telomeres, and trinucleotide repeats (linked to fragile X syndrome, Huntington disease, etc.), account for nearly 30% of the human genome. These domains exhibit enhanced susceptibility to oxidative attack to yield base modifications, strand breaks, and abasic sites; have a propensity to adopt non-canonical DNA forms modulated by the positions of the lesions; and, when not properly processed, can contribute to genome instability that underlies aging and disease development. Knowledge on the repair efficiencies of DNA damage within such repetitive sequences is therefore crucial for understanding the impact of such domains on genomic integrity. In the present study, using strategically designed oligonucleotide substrates, we determined the ability of human apurinic/apyrimidinic endonuclease 1 (APE1) to cleave at apurinic/apyrimidinic (AP) sites in a collection of tandem DNA repeat landscapes involving telomeric and CAG/CTG repeat sequences. Our studies reveal the differential influence of domain sequence, conformation, and AP site location/relative positioning on the efficiency of APE1 binding and strand incision. Intriguingly, our data demonstrate that APE1 endonuclease efficiency correlates with the thermodynamic stability of the DNA substrate. We discuss how these results have both predictive and mechanistic consequences for understanding the success and failure of repair protein activity associated with such oxidatively sensitive, conformationally plastic/dynamic repetitive DNA domains. Published by Elsevier Ltd.
Currin, Andrew; Swainston, Neil; Day, Philip J.
2015-01-01
The amino acid sequence of a protein affects both its structure and its function. Thus, the ability to modify the sequence, and hence the structure and activity, of individual proteins in a systematic way, opens up many opportunities, both scientifically and (as we focus on here) for exploitation in biocatalysis. Modern methods of synthetic biology, whereby increasingly large sequences of DNA can be synthesised de novo, allow an unprecedented ability to engineer proteins with novel functions. However, the number of possible proteins is far too large to test individually, so we need means for navigating the ‘search space’ of possible protein sequences efficiently and reliably in order to find desirable activities and other properties. Enzymologists distinguish binding (K d) and catalytic (k cat) steps. In a similar way, judicious strategies have blended design (for binding, specificity and active site modelling) with the more empirical methods of classical directed evolution (DE) for improving k cat (where natural evolution rarely seeks the highest values), especially with regard to residues distant from the active site and where the functional linkages underpinning enzyme dynamics are both unknown and hard to predict. Epistasis (where the ‘best’ amino acid at one site depends on that or those at others) is a notable feature of directed evolution. The aim of this review is to highlight some of the approaches that are being developed to allow us to use directed evolution to improve enzyme properties, often dramatically. We note that directed evolution differs in a number of ways from natural evolution, including in particular the available mechanisms and the likely selection pressures. Thus, we stress the opportunities afforded by techniques that enable one to map sequence to (structure and) activity in silico, as an effective means of modelling and exploring protein landscapes. Because known landscapes may be assessed and reasoned about as a whole, simultaneously, this offers opportunities for protein improvement not readily available to natural evolution on rapid timescales. Intelligent landscape navigation, informed by sequence-activity relationships and coupled to the emerging methods of synthetic biology, offers scope for the development of novel biocatalysts that are both highly active and robust. PMID:25503938
Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin
2012-01-01
Single-beat imaging of myocardial activation promises to aid in both cardiovascular research and clinical medicine. In the present study we validate a three-dimensional (3D) cardiac electrical imaging (3DCEI) technique with the aid of simultaneous 3D intracardiac mapping to assess its capability to localize endocardial and epicardial initiation sites and image global activation sequences during pacing and ventricular tachycardia (VT) in the canine heart. Body surface potentials were measured simultaneously with bipolar electrical recordings in a closed-chest condition in healthy canines. Computed tomography images were obtained after the mapping study to construct realistic geometry models. Data analysis was performed on paced rhythms and VTs induced by norepinephrine (NE). The noninvasively reconstructed activation sequence was in good agreement with the simultaneous measurements from 3D cardiac mapping with a correlation coefficient of 0.74 ± 0.06, a relative error of 0.29 ± 0.05, and a root mean square error of 9 ± 3 ms averaged over 460 paced beats and 96 ectopic beats including premature ventricular complexes, couplets, and nonsustained monomorphic VTs and polymorphic VTs. Endocardial and epicardial origins of paced beats were successfully predicted in 72% and 86% of cases, respectively, during left ventricular pacing. The NE-induced ectopic beats initiated in the subendocardium by a focal mechanism. Sites of initial activation were estimated to be ∼7 mm from the measured initiation sites for both the paced beats and ectopic beats. For the polymorphic VTs, beat-to-beat dynamic shifts of initiation site and activation pattern were characterized by the reconstruction. The present results suggest that 3DCEI can noninvasively image the 3D activation sequence and localize the origin of activation of paced beats and NE-induced VTs in the canine heart with good accuracy. This 3DCEI technique offers the potential to aid interventional therapeutic procedures for treating ventricular arrhythmias arising from epicardial or endocardial sites and to noninvasively assess the mechanisms of these arrhythmias.
Han, Chengzong; Pogwizd, Steven M.; Killingsworth, Cheryl R.
2012-01-01
Single-beat imaging of myocardial activation promises to aid in both cardiovascular research and clinical medicine. In the present study we validate a three-dimensional (3D) cardiac electrical imaging (3DCEI) technique with the aid of simultaneous 3D intracardiac mapping to assess its capability to localize endocardial and epicardial initiation sites and image global activation sequences during pacing and ventricular tachycardia (VT) in the canine heart. Body surface potentials were measured simultaneously with bipolar electrical recordings in a closed-chest condition in healthy canines. Computed tomography images were obtained after the mapping study to construct realistic geometry models. Data analysis was performed on paced rhythms and VTs induced by norepinephrine (NE). The noninvasively reconstructed activation sequence was in good agreement with the simultaneous measurements from 3D cardiac mapping with a correlation coefficient of 0.74 ± 0.06, a relative error of 0.29 ± 0.05, and a root mean square error of 9 ± 3 ms averaged over 460 paced beats and 96 ectopic beats including premature ventricular complexes, couplets, and nonsustained monomorphic VTs and polymorphic VTs. Endocardial and epicardial origins of paced beats were successfully predicted in 72% and 86% of cases, respectively, during left ventricular pacing. The NE-induced ectopic beats initiated in the subendocardium by a focal mechanism. Sites of initial activation were estimated to be ∼7 mm from the measured initiation sites for both the paced beats and ectopic beats. For the polymorphic VTs, beat-to-beat dynamic shifts of initiation site and activation pattern were characterized by the reconstruction. The present results suggest that 3DCEI can noninvasively image the 3D activation sequence and localize the origin of activation of paced beats and NE-induced VTs in the canine heart with good accuracy. This 3DCEI technique offers the potential to aid interventional therapeutic procedures for treating ventricular arrhythmias arising from epicardial or endocardial sites and to noninvasively assess the mechanisms of these arrhythmias. PMID:21984548
Vipond, I B; Moon, B J; Halford, S E
1996-02-13
The EcoRV restriction endonuclease cleaves DNA at its recognition sequence more readily with Mg2+ as the cofactor than with Mn2+ but, at noncognate sequences that differ from the EcoRV site by one base pair, Mn2+ gives higher rates than Mg2+. A mutant of EcoRV, in which an isoleucine near the active site was replaced by leucine, showed the opposite behavior. It had low activity with Mg2+, but, in the presence of Mn2+ ions, it cleaved the recognition site faster than wild-type EcoRV with either Mn2+ or Mg2+. The mutant was also more specific for the recognition sequence than the native enzyme: the noncognate DNA cleavages by wild-type EcoRV and Mn2+ were not detected with the mutant. Further mutagenesis showed that the protein required the same acidic residues at its active site as wild-type EcoRV. The Ile-->Leu mutation seems to perturb the configuration of the metal-binding ligands at the active site so that the protein has virtually no affinity for Mg2+ yet it can still bind Mn2+ ions, though the latter only occurs when the protein is at the recognition site. This contrasts to wild-type EcoRV, where Mn2+ ions bind readily to complexes with either cognate and noncognate DNA and only Mg2+ shows the discrimination between the complexes. The structural perturbation is a specific consequence of leucine in place of isoleucine, since mutants with valine or alanine were similar to wild-type EcoRV.
Walderhaug, M O; Post, R L; Saccomani, G; Leonard, R T; Briskin, D P
1985-03-25
Three membrane-bound adenosine triphosphatases were investigated for homology in the sequence of four amino acids about the active site of phosphorylation. The ATPases were as follows: sodium-potassium-dependent ATPase from dog kidney, Na,K-ATPase; hydrogen-potassium-dependent ATPase from hog gastric mucosa, H,K-ATPase, an ATPase similar to Na,K-ATPase; and an ATPase activity in the plasma membrane of corn, Zea mays, roots (CR-ATPase), a higher plant ATPase. A membrane preparation containing an ATPase of Acholeplasma laidlawii, a prokaryote, (AL) was also investigated. For most of the experiments, the preparations were phosphorylated from [gamma-32P]ATP, denatured in acid, and subjected to proteolytic digestion. Radioactive phosphopeptides were separated by high voltage paper electrophoresis and characterized by sensitivity to chemical reagents. In gastric H,K-ATPase, the aspartate residue at the active site was determined directly by labeling with [3H]borohydride. A common sequence around the active site was found for Na,K-ATPase, H,K-ATPase, and CR-ATPase. This sequence, -Cys-(Ser/Thr)-Asp(P)-Lys-, is similar to that in the calcium ion-transport ATPase of sarcoplasmic reticulum. The AL membrane preparation showed an acylphosphate that turned over rapidly after a chase of labeled membranes with unlabeled ATP. The corresponding sequence was different from that of the three ATPases. An acylphosphate was on two polypeptides with molecular weights of about 80,000 and 60,000; these appear not to correspond to subunits of a Na+-stimulated ATPase in this organism (Lewis, R. N. A. H., and McElhaney, R. N. (1983) Biochim. Biophys. Acta 735, 113-122).
Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium
Cai, Yongping; Lin, Yi
2013-01-01
In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048
Ryon, J J; Fixman, E D; Houchens, C; Zong, J; Lieberman, P M; Chang, Y N; Hayward, G S; Hayward, S D
1993-01-01
Herpesvirus papio (HVP) is a B-lymphotropic baboon virus with an estimated 40% homology to Epstein-Barr virus (EBV). We have cloned and sequenced ori-Lyt of herpesvirus papio and found a striking degree of nucleotide homology (89%) with ori-Lyt of EBV. Transcriptional elements form an integral part of EBV ori-Lyt. The promoter and enhancer domains of EBV ori-Lyt are conserved in herpesvirus papio. The EBV ori-Lyt promoter contains four binding sites for the EBV lytic cycle transactivator Zta, and the enhancer includes one Zta and two Rta response elements. All five of the Zta response elements and one of the Rta motifs are conserved in HVP ori-Lyt, and the HVP DS-L leftward promoter and the enhancer were activated in transient transfection assays by the EBV Zta and Rta transactivators. The EBV ori-Lyt enhancer contains a palindromic sequence, GGTCAGCTGACC, centered on a PvuII restriction site. This sequence, with a single base change, is also present in the HVP ori-Lyt enhancer. DNase I footprinting demonstrated that the PvuII sequence was bound by a protein present in a Raji nuclear extract. Mobility shift and competition assays using oligonucleotide probes identified this sequence as a binding site for the cellular transcription factor MLTF. Mutagenesis of the binding site indicated that MLTF contributes significantly to the constitutive activity of the ori-Lyt enhancer. The high degree of conservation of cis-acting signal sequences in HVP ori-Lyt was further emphasized by the finding that an HVP ori-Lyt-containing plasmid was replicated in Vero cells by a set of cotransfected EBV replication genes. The central domain of EBV ori-Lyt contains two related AT-rich palindromes, one of which is partially duplicated in the HVP sequence. The AT-rich palindromes are functionally important cis-acting motifs. Deletion of these palindromes severely diminished replication of an ori-Lyt target plasmid. Images PMID:8389916
Chang, Yun-Juan; Peacock, Aaron D.; Long, Philip E.; Stephen, John R.; McKinley, James P.; Macnaughton, Sarah J.; Hussain, A. K. M. Anwar; Saxton, Arnold M.; White, David C.
2001-01-01
Microbially mediated reduction and immobilization of U(VI) to U(IV) plays a role in both natural attenuation and accelerated bioremediation of uranium-contaminated sites. To realize bioremediation potential and accurately predict natural attenuation, it is important to first understand the microbial diversity of such sites. In this paper, the distribution of sulfate-reducing bacteria (SRB) in contaminated groundwater associated with a uranium mill tailings disposal site at Shiprock, N.Mex., was investigated. Two culture-independent analyses were employed: sequencing of clone libraries of PCR-amplified dissimilatory sulfite reductase (DSR) gene fragments and phospholipid fatty acid (PLFA) biomarker analysis. A remarkable diversity among the DSR sequences was revealed, including sequences from δ-Proteobacteria, gram-positive organisms, and the Nitrospira division. PLFA analysis detected at least 52 different mid-chain-branched saturate PLFA and included a high proportion of 10me16:0. Desulfotomaculum and Desulfotomaculum-like sequences were the most dominant DSR genes detected. Those belonging to SRB within δ-Proteobacteria were mainly recovered from low-uranium (≤302 ppb) samples. One Desulfotomaculum-like sequence cluster overwhelmingly dominated high-U (>1,500 ppb) sites. Logistic regression showed a significant influence of uranium concentration over the dominance of this cluster of sequences (P = 0.0001). This strong association indicates that Desulfotomaculum has remarkable tolerance and adaptation to high levels of uranium and suggests the organism's possible involvement in natural attenuation of uranium. The in situ activity level of Desulfotomaculum in uranium-contaminated environments and its comparison to the activities of other SRB and other functional groups should be an important area for future research. PMID:11425735
Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; He, Bin
2011-08-01
Imaging cardiac excitation within ventricular myocardium is important in the treatment of cardiac arrhythmias and might help improve our understanding of arrhythmia mechanisms. This study sought to rigorously assess the imaging performance of a 3-dimensional (3D) cardiac electrical imaging (3DCEI) technique with the aid of 3D intracardiac mapping from up to 216 intramural sites during paced rhythm and norepinephrine (NE)-induced ventricular tachycardia (VT) in the rabbit heart. Body surface potentials and intramural bipolar electrical recordings were simultaneously measured in a closed-chest condition in 13 healthy rabbits. Single-site pacing and dual-site pacing were performed from ventricular walls and septum. VTs and premature ventricular complexes (PVCs) were induced by intravenous NE. Computed tomography images were obtained to construct geometry models. The noninvasively imaged activation sequence correlated well with invasively measured counterpart, with a correlation coefficient of 0.72 ± 0.04, and a relative error of 0.30 ± 0.02 averaged over 520 paced beats as well as 73 NE-induced PVCs and VT beats. All PVCs and VT beats initiated in the subendocardium by a nonreentrant mechanism. The averaged distance from the imaged site of initial activation to the pacing site or site of arrhythmias determined from intracardiac mapping was ∼5 mm. For dual-site pacing, the double origins were identified when they were located at contralateral sides of ventricles or at the lateral wall and the apex. 3DCEI can noninvasively delineate important features of focal or multifocal ventricular excitation. It offers the potential to aid in localizing the origins and imaging activation sequences of ventricular arrhythmias, and to provide noninvasive assessment of the underlying arrhythmia mechanisms. Copyright © 2011 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
Han, Chengzong; Pogwizd, Steven M.; Killingsworth, Cheryl R.; He, Bin
2011-01-01
Background Imaging cardiac excitation within ventricular myocardium is important in the treatment of cardiac arrhythmias and might help improve our understanding of arrhythmia mechanisms. Objective This study aims to rigorously assess the imaging performance of a three-dimensional (3-D) cardiac electrical imaging (3-DCEI) technique with the aid of 3-D intra-cardiac mapping from up to 216 intramural sites during paced rhythm and norepinephrine (NE) induced ventricular tachycardia (VT) in the rabbit heart. Methods Body surface potentials and intramural bipolar electrical recordings were simultaneously measured in a closed-chest condition in thirteen healthy rabbits. Single-site pacing and dual-site pacing were performed from ventricular walls and septum. VTs and premature ventricular complexes (PVCs) were induced by intravenous NE. Computer tomography images were obtained to construct geometry model. Results The non-invasively imaged activation sequence correlated well with invasively measured counterparts, with a correlation coefficient of 0.72±0.04, and a relative error of 0.30±0.02 averaged over 520 paced beats as well as 73 NE-induced PVCs and VT beats. All PVCs and VT beats initiated in the subendocardium by a nonreentrant mechanism. The averaged distance from imaged site of initial activation to pacing site or site of arrhythmias determined from intra-cardiac mapping was ~5mm. For dual-site pacing, the double origins were identified when they were located at contralateral sides of ventricles or at the lateral wall and the apex. Conclusion 3-DCEI can non-invasively delineate important features of focal or multi-focal ventricular excitation. It offers the potential to aid in localizing the origins and imaging activation sequence of ventricular arrhythmias, and to provide noninvasive assessment of the underlying arrhythmia mechanisms. PMID:21397046
Effect of substrate RNA sequence on the cleavage reaction by a short ribozyme.
Ohmichi, T; Okumoto, Y; Sugimoto, N
1998-01-01
Leadzyme is a ribozyme that requires Pb2+. The catalytic sequence, CUGGGAGUCC, binds to an RNA substrate, GGACC downward arrowGAGCCAG, cleaving the RNA substrate at one site. We have investigated the effect of the substrate sequence on the cleavage activity of leadzyme using mutant substrates in order to structurally understand the RNA catalysis. The results showed that leadzyme acted as a catalyst for single site cleavage of a C5 deletion mutant substrate, GGAC downward arrowGAGCCAG, as well as the wild-type substrate. However, a mutant substrate GGACCGACCAG, which had G8 deleted from the wild-type substrate, was not cleaved. Kinetic studies by surface plasmon resonance indicated that the difference between active and inactive structures reflected the slow association and dissociation rate constants of complex formation induced by Pb2+rather than differences in complex stability. CD spectra showed that the active form of the substrate-leadzyme complex was rearranged by Pb2+binding. The G8 of the wild-type substrate, which was absent in the inactive complex, is not near the cleavage site. Thus, these results show that the active substrate-leadzyme complex has a Pb2+binding site at the junction between the unpaired region (asymmetric internal loop) and the stem region, which is distal to the cleavage site. Pb2+may play a role in rearranging the bases in the asymmetric internal loop to the correct position for catalysis. PMID:9837996
A DNA sequence element that advances replication origin activation time in Saccharomyces cerevisiae.
Pohl, Thomas J; Kolor, Katherine; Fangman, Walton L; Brewer, Bonita J; Raghuraman, M K
2013-11-06
Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time.
One recognition sequence, seven restriction enzymes, five reaction mechanisms
Gowers, Darren M.; Bellamy, Stuart R.W.; Halford, Stephen E.
2004-01-01
The diversity of reaction mechanisms employed by Type II restriction enzymes was investigated by analysing the reactions of seven endonucleases at the same DNA sequence. NarI, KasI, Mly113I, SfoI, EgeI, EheI and BbeI cleave DNA at several different positions in the sequence 5′-GGCGCC-3′. Their reactions on plasmids with one or two copies of this sequence revealed five distinct mechanisms. These differ in terms of the number of sites the enzyme binds, and the number of phosphodiester bonds cleaved per turnover. NarI binds two sites, but cleaves only one bond per DNA-binding event. KasI also cuts only one bond per turnover but acts at individual sites, preferring intact to nicked sites. Mly113I cuts both strands of its recognition sites, but shows full activity only when bound to two sites, which are then cleaved concertedly. SfoI, EgeI and EheI cut both strands at individual sites, in the manner historically considered as normal for Type II enzymes. Finally, BbeI displays an absolute requirement for two sites in close physical proximity, which are cleaved concertedly. The range of reaction mechanisms for restriction enzymes is thus larger than commonly imagined, as is the number of enzymes needing two recognition sites. PMID:15226412
Grichnik, J M; French, B A; Schwartz, R J
1988-01-01
The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124
Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène
2008-06-01
The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.
Alternative Polyadenylation Regulates CELF1/CUGBP1 Target Transcripts Following T Cell Activation
Beisang, Daniel; Reilly, Cavan; Bohjanen, Paul R.
2014-01-01
Alternative polyadenylation (APA) is an evolutionarily conserved mechanism for regulating gene expression. Transcript 3′ end shortening through changes in polyadenylation site usage occurs following T cell activation, but the consequences of APA on gene expression are poorly understood. We previously showed that GU-rich elements (GREs) found in the 3′ untranslated regions of select transcripts mediate rapid mRNA decay by recruiting the protein CELF1/CUGBP1. Using a global RNA sequencing approach, we found that a network of CELF1 target transcripts involved in cell division underwent preferential 3′ end shortening via APA following T cell activation, resulting in decreased inclusion of CELF1 binding sites and increased transcript expression. We present a model whereby CELF1 regulates APA site selection following T cell activation through reversible binding to nearby GRE sequences. These findings provide insight into the role of APA in controlling cellular proliferation during biological processes such as development, oncogenesis and T cell activation PMID:25123787
phiC31 Integrase-Mediated Site-Specific Recombination in Barley
Rubtsova, Myroslava; Kumlehn, Jochen; Gils, Mario
2012-01-01
The Streptomyces phage phiC31 integrase was tested for its feasibility in excising transgenes from the barley genome through site-specific recombination. We produced transgenic barley plants expressing an active phiC31 integrase and crossed them with transgenic barley plants carrying a target locus for recombination. The target sequence involves a reporter gene encoding green fluorescent protein (GFP), which is flanked by the attB and attP recognition sites for the phiC31 integrase. This sequence disruptively separates a gusA coding sequence from an upstream rice actin promoter. We succeeded in producing site-specific recombination events in the hybrid progeny of 11 independent barley plants carrying the above target sequence after crossing with plants carrying a phiC31 expression cassette. Some of the hybrids displayed fully executed recombination. Excision of the GFP gene fostered activation of the gusA gene, as visualized in tissue of hybrid plants by histochemical staining. The recombinant loci were detected in progeny of selfed F1, even in individuals lacking the phiC31 transgene, which provides evidence of stability and generative transmission of the recombination events. In several plants that displayed incomplete recombination, extrachromosomal excision circles were identified. Besides the technical advance achieved in this study, the generated phiC31 integrase-expressing barley plants provide foundational stock material for use in future approaches to barley genetic improvement, such as the production of marker-free transgenic plants or switching transgene activity. PMID:23024817
Vickers, Timothy A.; Freier, Susan M.; Bui, Huynh-Hoa; Watt, Andrew; Crooke, Stanley T.
2014-01-01
A new strategy for identifying potent RNase H-dependent antisense oligonucleotides (ASOs) is presented. Our analysis of the human transcriptome revealed that a significant proportion of genes contain unique repeated sequences of 16 or more nucleotides in length. Activities of ASOs targeting these repeated sites in several representative genes were compared to those of ASOs targeting unique single sites in the same transcript. Antisense activity at repeated sites was also evaluated in a highly controlled minigene system. Targeting both native and minigene repeat sites resulted in significant increases in potency as compared to targeting of non-repeated sites. The increased potency at these sites is a result of increased frequency of ASO/RNA interactions which, in turn, increases the probability of a productive interaction between the ASO/RNA heteroduplex and human RNase H1 in the cell. These results suggest a new, highly efficient strategy for rapid identification of highly potent ASOs. PMID:25334092
Rombel, I T; McMorran, B J; Lamont, I L
1995-02-20
Many bacteria respond to a lack of iron in the environment by synthesizing siderophores, which act as iron-scavenging compounds. Fluorescent pseudomonads synthesize strain-specific but chemically related siderophores called pyoverdines or pseudobactins. We have investigated the mechanisms by which iron controls expression of genes involved in pyoverdine metabolism in Pseudomonas aeruginosa. Transcription of these genes is repressed by the presence of iron in the growth medium. Three promoters from these genes were cloned and the activities of the promoters were dependent on the amounts of iron in the growth media. Two of the promoters were sequenced and the transcriptional start site were identified by S1 nuclease analysis. Sequences similar to the consensus binding site for the Fur repressor protein, which controls expression of iron-repressible genes in several gram-negative species, were not present in the promoters, suggesting that they are unlikely to have a high affinity for Fur. However, comparison of the promoter sequences with those of iron-regulated genes from other Pseudomonas species and also the iron-regulated exotoxin gene of P. aeruginosa allowed identification of a shared sequence element, with the consensus sequence (G/C)CTAAAT-CCC, which is likely to act as a binding site for a transcriptional activator protein. Mutations in this sequence greatly reduced the activities of the promoters characterized here as well as those of other iron-regulated promoters. The requirement for this motif in the promoters of iron-regulated genes of different Pseudomonas species indicates that similar mechanisms are likely to be involved in controlling expression of a range of iron-regulated genes in pseudomonads.
Schultz, Sharon J; Zhang, Miaohua; Champoux, James J
2010-03-19
The RNase H activity of reverse transcriptase is required during retroviral replication and represents a potential target in antiviral drug therapies. Sequence features flanking a cleavage site influence the three types of retroviral RNase H activity: internal, DNA 3'-end-directed, and RNA 5'-end-directed. Using the reverse transcriptases of HIV-1 (human immunodeficiency virus type 1) and Moloney murine leukemia virus (M-MuLV), we evaluated how individual base preferences at a cleavage site direct retroviral RNase H specificity. Strong test cleavage sites (designated as between nucleotide positions -1 and +1) for the HIV-1 and M-MuLV enzymes were introduced into model hybrid substrates designed to assay internal or DNA 3'-end-directed cleavage, and base substitutions were tested at specific nucleotide positions. For internal cleavage, positions +1, -2, -4, -5, -10, and -14 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV significantly affected RNase H cleavage efficiency, while positions -7 and -12 for HIV-1 and positions -4, -9, and -11 for M-MuLV had more modest effects. DNA 3'-end-directed cleavage was influenced substantially by positions +1, -2, -4, and -5 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV. Cleavage-site distance from the recessed end did not affect sequence preferences for M-MuLV reverse transcriptase. Based on the identified sequence preferences, a cleavage site recognized by both HIV-1 and M-MuLV enzymes was introduced into a sequence that was otherwise resistant to RNase H. The isolated RNase H domain of M-MuLV reverse transcriptase retained sequence preferences at positions +1 and -2 despite prolific cleavage in the absence of the polymerase domain. The sequence preferences of retroviral RNase H likely reflect structural features in the substrate that favor cleavage and represent a novel specificity determinant to consider in drug design. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
DNA sequence templates adjacent nucleosome and ORC sites at gene amplification origins in Drosophila
Liu, Jun; Zimmer, Kurt; Rusch, Douglas B.; Paranjape, Neha; Podicheti, Ram; Tang, Haixu; Calvi, Brian R.
2015-01-01
Eukaryotic origins of DNA replication are bound by the origin recognition complex (ORC), which scaffolds assembly of a pre-replicative complex (pre-RC) that is then activated to initiate replication. Both pre-RC assembly and activation are strongly influenced by developmental changes to the epigenome, but molecular mechanisms remain incompletely defined. We have been examining the activation of origins responsible for developmental gene amplification in Drosophila. At a specific time in oogenesis, somatic follicle cells transition from genomic replication to a locus-specific replication from six amplicon origins. Previous evidence indicated that these amplicon origins are activated by nucleosome acetylation, but how this affects origin chromatin is unknown. Here, we examine nucleosome position in follicle cells using micrococcal nuclease digestion with Ilumina sequencing. The results indicate that ORC binding sites and other essential origin sequences are nucleosome-depleted regions (NDRs). Nucleosome position at the amplicons was highly similar among developmental stages during which ORC is or is not bound, indicating that being an NDR is not sufficient to specify ORC binding. Importantly, the data suggest that nucleosomes and ORC have opposite preferences for DNA sequence and structure. We propose that nucleosome hyperacetylation promotes pre-RC assembly onto adjacent DNA sequences that are disfavored by nucleosomes but favored by ORC. PMID:26227968
2014-01-01
Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182
Influence of active site location on catalytic activity in de novo-designed zinc metalloenzymes.
Zastrow, Melissa L; Pecoraro, Vincent L
2013-04-17
While metalloprotein design has now yielded a number of successful metal-bound and even catalytically active constructs, the question of where to put a metal site along a linear, repetitive sequence has not been thoroughly addressed. Often several possibilities in a given sequence may exist that would appear equivalent but may in fact differ for metal affinity, substrate access, or protein dynamics. We present a systematic variation of active site location for a hydrolytically active ZnHis3O site contained within a de novo-designed three-stranded coiled coil. We find that the maximal rate, substrate access, and metal-binding affinity are dependent on the selected position, while catalytic efficiency for p-nitrophenyl acetate hydrolysis can be retained regardless of the location of the active site. This achievement demonstrates how efficient, tailor-made enzymes which control rate, pKa, substrate and solvent access (and selectivity), and metal-binding affinity may be realized. These findings may be applied to the more advanced de novo design of constructs containing secondary interactions, such as hydrogen-bonding channels. We are now confident that changes to location for accommodating such channels can be achieved without location-dependent loss of catalytic efficiency. These findings bring us closer to our ultimate goal of incorporating the secondary interactions we believe will be necessary in order to improve both active site properties and the catalytic efficiency to be competitive with the native enzyme, carbonic anhydrase.
Provost, Jean; Gurev, Viatcheslav; Trayanova, Natalia; Konofagou, Elisa E.
2011-01-01
Background Electromechanical Wave Imaging (EWI) is an entirely non-invasive, ultrasound-based imaging method capable of mapping the electromechanical activation sequence of the ventricles in vivo. Given the broad accessibility of ultrasound scanners in the clinic, the application of EWI could constitute a flexible surrogate for the 3D electrical activation. Objective The purpose of this report is to reproduce the electromechanical wave (EW) using an anatomically-realistic electromechanical model, and establish the capability of EWI to map the electrical activation sequence in vivo when pacing from different locations. Methods EWI was performed in one canine during pacing from three different sites. A high-resolution dynamic model of coupled cardiac electromechanics of the canine heart was used to predict the experimentally recorded electromechanical wave. The simulated 3D electrical activation sequence was then compared with the experimental EW. Results The electrical activation sequence and the EW were highly correlated for all pacing sites. The relationship between the electrical activation and the EW onset was found to be linear with a slope of 1.01 to 1.17 for different pacing schemes and imaging angles. Conclusions The accurate reproduction of the EW in simulations indicates that the model framework is capable of accurately representing the cardiac electromechanics and thus testing new hypotheses. The one-to-one correspondence between the electrical activation sequence and the EW indicates that EWI could be used to map the cardiac electrical activity. This opens the door for further exploration of the technique in assisting in the early detection, diagnosis and treatment monitoring of rhythm dysfunction. PMID:21185403
Engineering peptide ligase specificity by proteomic identification of ligation sites.
Weeks, Amy M; Wells, James A
2018-01-01
Enzyme-catalyzed peptide ligation is a powerful tool for site-specific protein bioconjugation, but stringent enzyme-substrate specificity limits its utility. We developed an approach for comprehensively characterizing peptide ligase specificity for N termini using proteome-derived peptide libraries. We used this strategy to characterize the ligation efficiency for >25,000 enzyme-substrate pairs in the context of the engineered peptide ligase subtiligase and identified a family of 72 mutant subtiligases with activity toward N-terminal sequences that were previously recalcitrant to modification. We applied these mutants individually for site-specific bioconjugation of purified proteins, including antibodies, and in algorithmically selected combinations for sequencing of the cellular N terminome with reduced sequence bias. We also developed a web application to enable algorithmic selection of the most efficient subtiligase variant(s) for bioconjugation to user-defined sequences. Our methods provide a new toolbox of enzymes for site-specific protein modification and a general approach for rapidly defining and engineering peptide ligase specificity.
Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.
Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E
2013-04-01
Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.
Landini, P; Volkert, M R
1995-04-07
The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.
A DNA Sequence Element That Advances Replication Origin Activation Time in Saccharomyces cerevisiae
Pohl, Thomas J.; Kolor, Katherine; Fangman, Walton L.; Brewer, Bonita J.; Raghuraman, M. K.
2013-01-01
Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time. PMID:24022751
Ni, Xiangyang; Westpheling, Janet
1997-01-01
The chi63 promoter directs glucose-sensitive, chitin-dependent transcription of a gene involved in the utilization of chitin as carbon source. Analysis of 5′ and 3′ deletions of the promoter region revealed that a 350-bp segment is sufficient for wild-type levels of expression and regulation. The analysis of single base changes throughout the promoter region, introduced by random and site-directed mutagenesis, identified several sequences to be important for activity and regulation. Single base changes at −10, −12, −32, −33, −35, and −37 upstream of the transcription start site resulted in loss of activity from the promoter, suggesting that bases in these positions are important for RNA polymerase interaction. The sequences centered around −10 (TATTCT) and −35 (TTGACC) in this promoter are, in fact, prototypical of eubacterial promoters. Overlapping the RNA polymerase binding site is a perfect 12-bp direct repeat sequence. Some base changes within this direct repeat resulted in constitutive expression, suggesting that this sequence is an operator for negative regulation. Other base changes resulted in loss of glucose repression while retaining the requirement for chitin induction, suggesting that this sequence is also involved in glucose repression. The fact that cis-acting mutations resulted in glucose resistance but not inducer independence rules out the possibility that glucose repression acts exclusively by inducer exclusion. The fact that mutations that affect glucose repression and chitin induction fall within the same direct repeat sequence module suggests that the direct repeat sequence facilitates both chitin induction and glucose repression. PMID:9371809
Han, Chengzong; Pogwizd, Steven M; Yu, Long; Zhou, Zhaoye; Killingsworth, Cheryl R; He, Bin
2015-01-15
Noninvasive cardiac activation imaging of ventricular tachycardia (VT) is important in the clinical diagnosis and treatment of arrhythmias in heart failure (HF) patients. This study investigated the ability of the three-dimensional cardiac electrical imaging (3DCEI) technique for characterizing the activation patterns of spontaneously occurring and norepinephrine (NE)-induced VTs in a newly developed arrhythmogenic canine model of nonischemic HF. HF was induced by aortic insufficiency followed by aortic constriction in three canines. Up to 128 body-surface ECGs were measured simultaneously with bipolar recordings from up to 232 intramural sites in a closed-chest condition. Data analysis was performed on the spontaneously occurring VTs (n=4) and the NE-induced nonsustained VTs (n=8) in HF canines. Both spontaneously occurring and NE-induced nonsustained VTs initiated by a focal mechanism primarily from the subendocardium, but occasionally from the subepicardium of left ventricle. Most focal initiation sites were located at apex, right ventricular outflow tract, and left lateral wall. The NE-induced VTs were longer, more rapid, and had more focal sites than the spontaneously occurring VTs. Good correlation was obtained between imaged activation sequence and direct measurements (averaged correlation coefficient of ∼0.70 over 135 VT beats). The reconstructed initiation sites were ∼10 mm from measured initiation sites, suggesting good localization in such a large animal model with cardiac size similar to a human. Both spontaneously occurring and NE-induced nonsustained VTs had focal initiation in this canine model of nonischemic HF. 3DCEI is feasible to image the activation sequence and help define arrhythmia mechanism of nonischemic HF-associated VTs. Copyright © 2015 the American Physiological Society.
A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon
Carlo, Troy; Sierra, Rebecca; Berget, Susan M.
2000-01-01
Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741
Johnson, Glynis; Moore, Samuel W
2009-01-01
We have previously described anti-acetylcholinesterase antibodies that display acetylcholinesterase-like catalytic activity. No evidence of contaminating enzymes was found, and the antibodies are kinetically and apparently structurally distinct from both acetylcholinesterase (AChE) and butyrylcholinesterase. We have also mimicked the antibody catalytic sites in anti-anti-idiotypic (Ab3) antibodies. Independently from us, similar acetylcholinesterase-like antibodies have been raised as anti-idiotypic (Ab2) antibodies against a non-catalytic anti-acetylcholinesterase antibody, AE-2. In this paper, we describe an epitope analysis, using synthetic peptides in ELISA and competition ELISA, and a peptide array, of five catalytic anti-acetylcholinesterase antibodies (Ab1s), three catalytic Ab3s, as well as antibody AE-2 and a non-catalytic Ab2. The catalytic Ab1s and Ab3s recognized three Pro- and Gly-containing sequences ((40)PPMGPRRFL, (78)PGFEGTE, and (258)PPGGTGGNDTELVAC) on the AChE surface. As these sequences do not adjoin in the AChE structure, recognition would appear to be due to cross-reaction. This was confirmed by the observation that the sequences superimpose structurally. The non-catalytic antibodies, AE-2 and the Ab2, recognized AChE's peripheral anionic site (PAS), in particular, the sequence (70)YQYVD, which contains two of the site's residues. The crystal structure of the AChE tetramer (Bourne et al., 1999) shows direct interaction and high complementarity between the (257)CPPGGTGGNDTELVAC sequence and the PAS. Antibodies recognizing the sequence and the PAS may, in turn, be complementary; this may account for the apparent paradox of catalytic development in both Ab1s and Ab2s. The PAS binds, but does not hydrolyze, substrate. The catalytic Ab1s, therefore, recognize a site that may function as a substrate analog, and this, together with the presence of an Arg-Glu salt bridge in the epitope, suggests mechanisms whereby catalytic activity may have developed. In conclusion, the development of AChE-like catalytic activity in anti-AChE Ab1s and Ab2s appears to be the result of a combination of structural complementarity to a substrate-binding site, charge complementarity to a salt bridge, and specific structural peculiarities of the AChE molecule. Copyright 2008 John Wiley & Sons, Ltd.
Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.
de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J
2002-09-01
The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
Yeager, C.M.; Kornosky, J.L.; Housman, D.C.; Grote, E.E.; Belnap, J.; Kuske, C.R.
2004-01-01
The objective of this study was to characterize the community structure and activity of N2-fixing microorganisms in mature and poorly developed biological soil crusts from both the Colorado Plateau and Chihuahuan Desert. Nitrogenase activity was approximately 10 and 2.5 times higher in mature crusts than in poorly developed crusts at the Colorado Plateau site and Chihuahuan Desert site, respectively. Analysis of nifH sequences by clone sequencing and the terminal restriction fragment length polymorphism technique indicated that the crust diazotrophic community was 80 to 90% heterocystous cyanobacteria most closely related to Nostoc spp. and that the composition of N2-fixing species did not vary significantly between the poorly developed and mature crusts at either site. In contrast, the abundance of nifH sequences was approximately 7.5 times greater (per microgram of total DNA) in mature crusts than in poorly developed crusts at a given site as measured by quantitative PCR. 16S rRNA gene clone sequencing and microscopic analysis of the cyanobacterial community within both crust types demonstrated a transition from a Microcoleus vaginatus-dominated, poorly developed crust to mature crusts harboring a greater percentage of Nostoc and Scytonema spp. We hypothesize that ecological factors, such as soil instability and water stress, may constrain the growth of N2-fixing microorganisms at our study sites and that the transition to a mature, nitrogen-producing crust initially requires bioengineering of the surface microenvironment by Microcoleus vaginatus.
A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches
Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael
2012-01-01
Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521
Sequence-Specific Targeting of Dosage Compensation in Drosophila Favors an Active Chromatin Context
Gelbart, Marnie; Tolstorukov, Michael Y.; Plachetka, Annette; Kharchenko, Peter V.; Jung, Youngsook L.; Gorchakov, Andrey A.; Larschan, Erica; Gu, Tingting; Minoda, Aki; Riddle, Nicole C.; Schwartz, Yuri B.; Elgin, Sarah C. R.; Karpen, Gary H.; Pirrotta, Vincenzo; Kuroda, Mitzi I.; Park, Peter J.
2012-01-01
The Drosophila MSL complex mediates dosage compensation by increasing transcription of the single X chromosome in males approximately two-fold. This is accomplished through recognition of the X chromosome and subsequent acetylation of histone H4K16 on X-linked genes. Initial binding to the X is thought to occur at “entry sites” that contain a consensus sequence motif (“MSL recognition element” or MRE). However, this motif is only ∼2 fold enriched on X, and only a fraction of the motifs on X are initially targeted. Here we ask whether chromatin context could distinguish between utilized and non-utilized copies of the motif, by comparing their relative enrichment for histone modifications and chromosomal proteins mapped in the modENCODE project. Through a comparative analysis of the chromatin features in male S2 cells (which contain MSL complex) and female Kc cells (which lack the complex), we find that the presence of active chromatin modifications, together with an elevated local GC content in the surrounding sequences, has strong predictive value for functional MSL entry sites, independent of MSL binding. We tested these sites for function in Kc cells by RNAi knockdown of Sxl, resulting in induction of MSL complex. We show that ectopic MSL expression in Kc cells leads to H4K16 acetylation around these sites and a relative increase in X chromosome transcription. Collectively, our results support a model in which a pre-existing active chromatin environment, coincident with H3K36me3, contributes to MSL entry site selection. The consequences of MSL targeting of the male X chromosome include increase in nucleosome lability, enrichment for H4K16 acetylation and JIL-1 kinase, and depletion of linker histone H1 on active X-linked genes. Our analysis can serve as a model for identifying chromatin and local sequence features that may contribute to selection of functional protein binding sites in the genome. PMID:22570616
Position-specific binding of FUS to nascent RNA regulates mRNA length
Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen
2015-01-01
More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buchman, A.R.; Kimmerly, W.J.; Rine, J.
1988-01-01
Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less
Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C
1992-01-01
Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867
Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.
Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio
2009-08-13
Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.
Functional Evolution of PLP-dependent Enzymes based on Active-Site Structural Similarities
Catazaro, Jonathan; Caprez, Adam; Guru, Ashu; Swanson, David; Powers, Robert
2014-01-01
Families of distantly related proteins typically have very low sequence identity, which hinders evolutionary analysis and functional annotation. Slowly evolving features of proteins, such as an active site, are therefore valuable for annotating putative and distantly related proteins. To date, a complete evolutionary analysis of the functional relationship of an entire enzyme family based on active-site structural similarities has not yet been undertaken. Pyridoxal-5’-phosphate (PLP) dependent enzymes are primordial enzymes that diversified in the last universal ancestor. Using the Comparison of Protein Active Site Structures (CPASS) software and database, we show that the active site structures of PLP-dependent enzymes can be used to infer evolutionary relationships based on functional similarity. The enzymes successfully clustered together based on substrate specificity, function, and three-dimensional fold. This study demonstrates the value of using active site structures for functional evolutionary analysis and the effectiveness of CPASS. PMID:24920327
Functional evolution of PLP-dependent enzymes based on active-site structural similarities.
Catazaro, Jonathan; Caprez, Adam; Guru, Ashu; Swanson, David; Powers, Robert
2014-10-01
Families of distantly related proteins typically have very low sequence identity, which hinders evolutionary analysis and functional annotation. Slowly evolving features of proteins, such as an active site, are therefore valuable for annotating putative and distantly related proteins. To date, a complete evolutionary analysis of the functional relationship of an entire enzyme family based on active-site structural similarities has not yet been undertaken. Pyridoxal-5'-phosphate (PLP) dependent enzymes are primordial enzymes that diversified in the last universal ancestor. Using the comparison of protein active site structures (CPASS) software and database, we show that the active site structures of PLP-dependent enzymes can be used to infer evolutionary relationships based on functional similarity. The enzymes successfully clustered together based on substrate specificity, function, and three-dimensional-fold. This study demonstrates the value of using active site structures for functional evolutionary analysis and the effectiveness of CPASS. © 2014 Wiley Periodicals, Inc.
Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters
Wozniak, Christopher E.; Hughes, Kelly T.
2008-01-01
Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950
Steer, J H; Kroeger, K M; Abraham, L J; Joyce, D A
2000-06-16
Glucocorticoid drugs suppress tumor necrosis factor-alpha (TNF-alpha) synthesis by activated monocyte/macrophages, contributing to an anti-inflammatory action in vivo. In lipopolysaccharide (LPS)-activated human monocytic THP-1 cells, glucocorticoids acted primarily on the TNF-alpha promoter to suppress a burst of transcriptional activity that occurred between 90 min and 3 h after LPS exposure. LPS increased nuclear c-Jun/ATF-2, NF-kappaB(1)/Rel-A, and Rel-A/C-Rel transcription factor complexes, which bound specifically to oligonucleotide sequences from the -106 to -88 base pair (bp) region of the promoter. The glucocorticoid, dexamethasone, suppressed nuclear binding activity of these complexes prior to and during the critical phase of TNF-alpha transcription. Site-directed mutagenesis in TNF-alpha promoter-luciferase reporter constructs showed that the adjacent c-Jun/ATF-2 (-106 to -99 bp) and NF-kappaB (-97 to -88 bp) binding sites each contributed to the LPS-stimulated expression. Mutating both sites largely prevented dexamethasone from suppressing TNF-alpha promoter-luciferase reporters. LPS exposure also increased nuclear Egr-1 and PU.1 abundance. The Egr-1/Sp1 (-172 to -161 bp) binding sites and the PU.1-binding Ets site (-116 to -110 bp) each contributed to the LPS-stimulated expression but not to glucocorticoid response. Dexamethasone suppressed the abundance of the c-Fos/c-Jun complex in THP-1 cell nuclei, but there was no direct evidence for c-Fos/c-Jun transactivation through sites in the -172 to -52 bp region. Small contributions to glucocorticoid response were attributable to promoter sequences outside the -172 to -88 bp region and to sequences in the TNF-alpha 3'-untranslated region. We conclude that glucocorticoids suppress LPS-stimulated secretion of TNF-alpha from human monocytic cells largely through antagonizing transactivation by c-Jun/ATF-2 and NF-kappaB complexes at binding sites in the -106 to -88 bp region of the TNF-alpha promoter.
Protein Information Resource: a community resource for expert annotation of protein data
Barker, Winona C.; Garavelli, John S.; Hou, Zhenglin; Huang, Hongzhan; Ledley, Robert S.; McGarvey, Peter B.; Mewes, Hans-Werner; Orcutt, Bruce C.; Pfeiffer, Friedhelm; Tsugita, Akira; Vinayaka, C. R.; Xiao, Chunlin; Yeh, Lai-Su L.; Wu, Cathy
2001-01-01
The Protein Information Resource, in collaboration with the Munich Information Center for Protein Sequences (MIPS) and the Japan International Protein Information Database (JIPID), produces the most comprehensive and expertly annotated protein sequence database in the public domain, the PIR-International Protein Sequence Database. To provide timely and high quality annotation and promote database interoperability, the PIR-International employs rule-based and classification-driven procedures based on controlled vocabulary and standard nomenclature and includes status tags to distinguish experimentally determined from predicted protein features. The database contains about 200 000 non-redundant protein sequences, which are classified into families and superfamilies and their domains and motifs identified. Entries are extensively cross-referenced to other sequence, classification, genome, structure and activity databases. The PIR web site features search engines that use sequence similarity and database annotation to facilitate the analysis and functional identification of proteins. The PIR-International databases and search tools are accessible on the PIR web site at http://pir.georgetown.edu/ and at the MIPS web site at http://www.mips.biochem.mpg.de. The PIR-International Protein Sequence Database and other files are also available by FTP. PMID:11125041
The active site of O-GlcNAc transferase imposes constraints on substrate sequence
Rafie, Karim; Blair, David E.; Borodkin, Vladimir S.; Albarbarawi, Osama; van Aalten, Daan M. F.
2016-01-01
O-GlcNAc transferase (OGT) glycosylates a diverse range of intracellular proteins with O-linked N-acetylglucosamine (O-GlcNAc), an essential and dynamic post-translational modification in metazoa. Although this enzyme modifies hundreds of proteins with O-GlcNAc, it is not understood how OGT achieves substrate specificity. In this study, we describe the application of a high-throughput OGT assay on a library of peptides. The sites of O-GlcNAc modification were mapped by ETD-mass spectrometry, and found to correlate with previously detected O-GlcNAc sites. Crystal structures of four acceptor peptides in complex with human OGT suggest that a combination of size and conformational restriction defines sequence specificity in the −3 to +2 subsites. This work reveals that while the N-terminal TPR repeats of hOGT may play a role in substrate recognition, the sequence restriction imposed by the peptide-binding site makes a significant contribution to O-GlcNAc site specificity. PMID:26237509
Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J
2000-12-01
The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.
NASA Astrophysics Data System (ADS)
Poston, Chloe N.; Higgs, Richard E.; You, Jinsam; Gelfanova, Valentina; Hale, John E.; Knierman, Michael D.; Siegel, Robert; Gutierrez, Jesus A.
2014-07-01
De novo sequencing by mass spectrometry (MS) allows for the determination of the complete amino acid (AA) sequence of a given protein based on the mass difference of detected ions from MS/MS fragmentation spectra. The technique relies on obtaining specific masses that can be attributed to characteristic theoretical masses of AAs. A major limitation of de novo sequencing by MS is the inability to distinguish between the isobaric residues leucine (Leu) and isoleucine (Ile). Incorrect identification of Ile as Leu or vice versa often results in loss of activity in recombinant antibodies. This functional ambiguity is commonly resolved with costly and time-consuming AA mutation and peptide sequencing experiments. Here, we describe a set of orthogonal biochemical protocols, which experimentally determine the identity of Ile or Leu residues in monoclonal antibodies (mAb) based on the selectivity that leucine aminopeptidase shows for n-terminal Leu residues and the cleavage preference for Leu by chymotrypsin. The resulting observations are combined with germline frequencies and incorporated into a logistic regression model, called Predictor for Xle Sites (PXleS) to provide a statistical likelihood for the identity of Leu at an ambiguous site. We demonstrate that PXleS can generate a probability for an Xle site in mAbs with 96% accuracy. The implementation of PXleS precludes the expression of several possible sequences and, therefore, reduces the overall time and resources required to go from spectra generation to a biologically active sequence for a mAb when an Ile or Leu residue is in question.
Poston, Chloe N; Higgs, Richard E; You, Jinsam; Gelfanova, Valentina; Hale, John E; Knierman, Michael D; Siegel, Robert; Gutierrez, Jesus A
2014-07-01
De novo sequencing by mass spectrometry (MS) allows for the determination of the complete amino acid (AA) sequence of a given protein based on the mass difference of detected ions from MS/MS fragmentation spectra. The technique relies on obtaining specific masses that can be attributed to characteristic theoretical masses of AAs. A major limitation of de novo sequencing by MS is the inability to distinguish between the isobaric residues leucine (Leu) and isoleucine (Ile). Incorrect identification of Ile as Leu or vice versa often results in loss of activity in recombinant antibodies. This functional ambiguity is commonly resolved with costly and time-consuming AA mutation and peptide sequencing experiments. Here, we describe a set of orthogonal biochemical protocols, which experimentally determine the identity of Ile or Leu residues in monoclonal antibodies (mAb) based on the selectivity that leucine aminopeptidase shows for n-terminal Leu residues and the cleavage preference for Leu by chymotrypsin. The resulting observations are combined with germline frequencies and incorporated into a logistic regression model, called Predictor for Xle Sites (PXleS) to provide a statistical likelihood for the identity of Leu at an ambiguous site. We demonstrate that PXleS can generate a probability for an Xle site in mAbs with 96% accuracy. The implementation of PXleS precludes the expression of several possible sequences and, therefore, reduces the overall time and resources required to go from spectra generation to a biologically active sequence for a mAb when an Ile or Leu residue is in question.
Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M
1989-10-05
We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.
Stereodivergent synthesis with a programmable molecular machine
NASA Astrophysics Data System (ADS)
Kassem, Salma; Lee, Alan T. L.; Leigh, David A.; Marcos, Vanesa; Palmer, Leoni I.; Pisano, Simone
2017-09-01
It has been convincingly argued that molecular machines that manipulate individual atoms, or highly reactive clusters of atoms, with Ångström precision are unlikely to be realized. However, biological molecular machines routinely position rather less reactive substrates in order to direct chemical reaction sequences, from sequence-specific synthesis by the ribosome to polyketide synthases, where tethered molecules are passed from active site to active site in multi-enzyme complexes. Artificial molecular machines have been developed for tasks that include sequence-specific oligomer synthesis and the switching of product chirality, a photo-responsive host molecule has been described that is able to mechanically twist a bound molecular guest, and molecular fragments have been selectively transported in either direction between sites on a molecular platform through a ratchet mechanism. Here we detail an artificial molecular machine that moves a substrate between different activating sites to achieve different product outcomes from chemical synthesis. This molecular robot can be programmed to stereoselectively produce, in a sequential one-pot operation, an excess of any one of four possible diastereoisomers from the addition of a thiol and an alkene to an α,β-unsaturated aldehyde in a tandem reaction process. The stereodivergent synthesis includes diastereoisomers that cannot be selectively synthesized through conventional iminium-enamine organocatalysis. We anticipate that future generations of programmable molecular machines may have significant roles in chemical synthesis and molecular manufacturing.
Protein model discrimination using mutational sensitivity derived from deep sequencing.
Adkar, Bharat V; Tripathi, Arti; Sahoo, Anusmita; Bajaj, Kanika; Goswami, Devrishi; Chakrabarti, Purbani; Swarnkar, Mohit K; Gokhale, Rajesh S; Varadarajan, Raghavan
2012-02-08
A major bottleneck in protein structure prediction is the selection of correct models from a pool of decoys. Relative activities of ∼1,200 individual single-site mutants in a saturation library of the bacterial toxin CcdB were estimated by determining their relative populations using deep sequencing. This phenotypic information was used to define an empirical score for each residue (RankScore), which correlated with the residue depth, and identify active-site residues. Using these correlations, ∼98% of correct models of CcdB (RMSD ≤ 4Å) were identified from a large set of decoys. The model-discrimination methodology was further validated on eleven different monomeric proteins using simulated RankScore values. The methodology is also a rapid, accurate way to obtain relative activities of each mutant in a large pool and derive sequence-structure-function relationships without protein isolation or characterization. It can be applied to any system in which mutational effects can be monitored by a phenotypic readout. Copyright © 2012 Elsevier Ltd. All rights reserved.
Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.
Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart
2014-01-15
High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter
[Study on ITS sequences of Aconitum vilmorinianum and its medicinal adulterant].
Zhang, Xiao-nan; Du, Chun-hua; Fu, De-huan; Gao, Li; Zhou, Pei-jun; Wang, Li
2012-09-01
To analyze and compare the ITS sequences of Aconitum vilmorinianum and its medicinal adulterant Aconitum austroyunnanense. Total genomic DNA were extracted from sample materials by improved CTAB method, ITS sequences of samples were amplified using PCR systems, directly sequenced and analyzed using software DNAStar, ClustalX1.81 and MEGA 4.0. 299 consistent sites, 19 variable sites and 13 informative sites were found in ITS1 sequences, 162 consistent sites, 2 variable sites and 1 informative sites were found in 5.8S sequences, 217 consistent sites, 3 variable sites and 1 informative site were found in ITS2 sequences. Base transition and transversion was not found only in 5.8S sequences, 2 sites transition and 1 site transversion were found in ITS1 sequences, only 1 site transversion was found in ITS2 sequences comparting the ITS sequences data matrix. By analyzing the ITS sequences data matrix from 2 population of Aconitum vilmorinianum and 3 population of Aconitum austroyunnanense, we found a stable informative site at the 596th base in ITS2 sequences, in all the samples of Aconitum vilmorinianum the base was C, and in all the samples of Aconitum austroyunnanense the base was A. Aconitum vilmorinianum and Aconitum austroyunnanense can be identified by their characters of ITS sequences, and the variable sites in ITS1 sequences are more than in ITS2 sequences.
Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H
1997-02-28
The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.
Fukuda, Masatora; Kurihara, Kei; Yamaguchi, Shota; Oyama, Yui; Deshimaru, Masanobu
2014-01-01
Adenosine-to-inosine (A-to-I) RNA editing is an endogenous regulatory mechanism involved in various biological processes. Site-specific, editing-state–dependent degradation of target RNA may be a powerful tool both for analyzing the mechanism of RNA editing and for regulating biological processes. Previously, we designed an artificial hammerhead ribozyme (HHR) for selective, site-specific RNA cleavage dependent on the A-to-I RNA editing state. In the present work, we developed an improved strategy for constructing a trans-acting HHR that specifically cleaves target editing sites in the adenosine but not the inosine state. Specificity for unedited sites was achieved by utilizing a sequence encoding the intrinsic cleavage specificity of a natural HHR. We used in vitro selection methods in an HHR library to select for an extended HHR containing a tertiary stabilization motif that facilitates HHR folding into an active conformation. By using this method, we successfully constructed highly active HHRs with unedited-specific cleavage. Moreover, using HHR cleavage followed by direct sequencing, we demonstrated that this ribozyme could cleave serotonin 2C receptor (HTR2C) mRNA extracted from mouse brain, depending on the site-specific editing state. This unedited-specific cleavage also enabled us to analyze the effect of editing state at the E and C sites on editing at other sites by using direct sequencing for the simultaneous quantification of the editing ratio at multiple sites. Our approach has the potential to elucidate the mechanism underlying the interdependencies of different editing states in substrate RNA with multiple editing sites. PMID:24448449
Knutson, Stacy T.; Westwood, Brian M.; Leuthaeuser, Janelle B.; Turner, Brandon E.; Nguyendac, Don; Shea, Gabrielle; Kumar, Kiran; Hayden, Julia D.; Harper, Angela F.; Brown, Shoshana D.; Morris, John H.; Ferrin, Thomas E.; Babbitt, Patricia C.
2017-01-01
Abstract Protein function identification remains a significant problem. Solving this problem at the molecular functional level would allow mechanistic determinant identification—amino acids that distinguish details between functional families within a superfamily. Active site profiling was developed to identify mechanistic determinants. DASP and DASP2 were developed as tools to search sequence databases using active site profiling. Here, TuLIP (Two‐Level Iterative clustering Process) is introduced as an iterative, divisive clustering process that utilizes active site profiling to separate structurally characterized superfamily members into functionally relevant clusters. Underlying TuLIP is the observation that functionally relevant families (curated by Structure‐Function Linkage Database, SFLD) self‐identify in DASP2 searches; clusters containing multiple functional families do not. Each TuLIP iteration produces candidate clusters, each evaluated to determine if it self‐identifies using DASP2. If so, it is deemed a functionally relevant group. Divisive clustering continues until each structure is either a functionally relevant group member or a singlet. TuLIP is validated on enolase and glutathione transferase structures, superfamilies well‐curated by SFLD. Correlation is strong; small numbers of structures prevent statistically significant analysis. TuLIP‐identified enolase clusters are used in DASP2 GenBank searches to identify sequences sharing functional site features. Analysis shows a true positive rate of 96%, false negative rate of 4%, and maximum false positive rate of 4%. F‐measure and performance analysis on the enolase search results and comparison to GEMMA and SCI‐PHY demonstrate that TuLIP avoids the over‐division problem of these methods. Mechanistic determinants for enolase families are evaluated and shown to correlate well with literature results. PMID:28054422
Kang, J J; Yokoi, T J; Holland, M J
1995-12-01
The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.
Knutson, Stacy T; Westwood, Brian M; Leuthaeuser, Janelle B; Turner, Brandon E; Nguyendac, Don; Shea, Gabrielle; Kumar, Kiran; Hayden, Julia D; Harper, Angela F; Brown, Shoshana D; Morris, John H; Ferrin, Thomas E; Babbitt, Patricia C; Fetrow, Jacquelyn S
2017-04-01
Protein function identification remains a significant problem. Solving this problem at the molecular functional level would allow mechanistic determinant identification-amino acids that distinguish details between functional families within a superfamily. Active site profiling was developed to identify mechanistic determinants. DASP and DASP2 were developed as tools to search sequence databases using active site profiling. Here, TuLIP (Two-Level Iterative clustering Process) is introduced as an iterative, divisive clustering process that utilizes active site profiling to separate structurally characterized superfamily members into functionally relevant clusters. Underlying TuLIP is the observation that functionally relevant families (curated by Structure-Function Linkage Database, SFLD) self-identify in DASP2 searches; clusters containing multiple functional families do not. Each TuLIP iteration produces candidate clusters, each evaluated to determine if it self-identifies using DASP2. If so, it is deemed a functionally relevant group. Divisive clustering continues until each structure is either a functionally relevant group member or a singlet. TuLIP is validated on enolase and glutathione transferase structures, superfamilies well-curated by SFLD. Correlation is strong; small numbers of structures prevent statistically significant analysis. TuLIP-identified enolase clusters are used in DASP2 GenBank searches to identify sequences sharing functional site features. Analysis shows a true positive rate of 96%, false negative rate of 4%, and maximum false positive rate of 4%. F-measure and performance analysis on the enolase search results and comparison to GEMMA and SCI-PHY demonstrate that TuLIP avoids the over-division problem of these methods. Mechanistic determinants for enolase families are evaluated and shown to correlate well with literature results. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Human germline and pan-cancer variomes and their distinct functional profiles
Pan, Yang; Karagiannis, Konstantinos; Zhang, Haichen; Dingerdissen, Hayley; Shamsaddini, Amirhossein; Wan, Quan; Simonyan, Vahan; Mazumder, Raja
2014-01-01
Identification of non-synonymous single nucleotide variations (nsSNVs) has exponentially increased due to advances in Next-Generation Sequencing technologies. The functional impacts of these variations have been difficult to ascertain because the corresponding knowledge about sequence functional sites is quite fragmented. It is clear that mapping of variations to sequence functional features can help us better understand the pathophysiological role of variations. In this study, we investigated the effect of nsSNVs on more than 17 common types of post-translational modification (PTM) sites, active sites and binding sites. Out of 1 705 285 distinct nsSNVs on 259 216 functional sites we identified 38 549 variations that significantly affect 10 major functional sites. Furthermore, we found distinct patterns of site disruptions due to germline and somatic nsSNVs. Pan-cancer analysis across 12 different cancer types led to the identification of 51 genes with 106 nsSNV affected functional sites found in 3 or more cancer types. 13 of the 51 genes overlap with previously identified Significantly Mutated Genes (Nature. 2013 Oct 17;502(7471)). 62 mutations in these 13 genes affecting functional sites such as DNA, ATP binding and various PTM sites occur across several cancers and can be prioritized for additional validation and investigations. PMID:25232094
Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I
2001-01-01
A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988
Gao, Yu-Fei; Li, Bi-Qing; Cai, Yu-Dong; Feng, Kai-Yan; Li, Zhan-Dong; Jiang, Yang
2013-01-27
Identification of catalytic residues plays a key role in understanding how enzymes work. Although numerous computational methods have been developed to predict catalytic residues and active sites, the prediction accuracy remains relatively low with high false positives. In this work, we developed a novel predictor based on the Random Forest algorithm (RF) aided by the maximum relevance minimum redundancy (mRMR) method and incremental feature selection (IFS). We incorporated features of physicochemical/biochemical properties, sequence conservation, residual disorder, secondary structure and solvent accessibility to predict active sites of enzymes and achieved an overall accuracy of 0.885687 and MCC of 0.689226 on an independent test dataset. Feature analysis showed that every category of the features except disorder contributed to the identification of active sites. It was also shown via the site-specific feature analysis that the features derived from the active site itself contributed most to the active site determination. Our prediction method may become a useful tool for identifying the active sites and the key features identified by the paper may provide valuable insights into the mechanism of catalysis.
Amino acid sequence of tyrosinase from Neurospora crassa.
Lerch, K
1978-01-01
The amino-acid sequence of tyrosinase from Neurospora crassa (monophenol,dihydroxyphenylalanine:oxygen oxidoreductase, EC 1.14.18.1) is reported. This copper-containing oxidase consists of a single polypeptide chain of 407 amino acids. The primary structure was determined by automated and manual sequence analysis on fragments produced by cleavage with cyanogen bromide and on peptides obtained by digestion with trypsin, pepsin, thermolysin, or chymotrypsin. The amino terminus of the protein is acetylated and the single cysteinyl residue 96 is covalently linked via a thioether bridge to histidyl residue 94. The formation and the possible role of this unusual structure in Neurospora tyrosinase is discussed. Dye-sensitized photooxidation of apotyrosinase and active-site-directed inactivation of the native enzyme indicate the possible involvement of histidyl residues 188, 192, 289, and 305 or 306 as ligands to the active-site copper as well as in the catalytic mechanism of this monooxygenase. PMID:151279
An ultra-sparse code underliesthe generation of neural sequences in a songbird
NASA Astrophysics Data System (ADS)
Hahnloser, Richard H. R.; Kozhevnikov, Alexay A.; Fee, Michale S.
2002-09-01
Sequences of motor activity are encoded in many vertebrate brains by complex spatio-temporal patterns of neural activity; however, the neural circuit mechanisms underlying the generation of these pre-motor patterns are poorly understood. In songbirds, one prominent site of pre-motor activity is the forebrain robust nucleus of the archistriatum (RA), which generates stereotyped sequences of spike bursts during song and recapitulates these sequences during sleep. We show that the stereotyped sequences in RA are driven from nucleus HVC (high vocal centre), the principal pre-motor input to RA. Recordings of identified HVC neurons in sleeping and singing birds show that individual HVC neurons projecting onto RA neurons produce bursts sparsely, at a single, precise time during the RA sequence. These HVC neurons burst sequentially with respect to one another. We suggest that at each time in the RA sequence, the ensemble of active RA neurons is driven by a subpopulation of RA-projecting HVC neurons that is active only at that time. As a population, these HVC neurons may form an explicit representation of time in the sequence. Such a sparse representation, a temporal analogue of the `grandmother cell' concept for object recognition, eliminates the problem of temporal interference during sequence generation and learning attributed to more distributed representations.
USDA-ARS?s Scientific Manuscript database
Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...
Li, Jian-min; Chen, Wei; Jia, Xiu-jie; An, Xiao-ping; Li, Bing; Fan, Ying-ru; Tong, Yi-gang
2005-05-01
To obtain CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site and to express human-mouse chimeric antibody directed against Chikungunya Virus by using the cell line. The fusion gene of FRT and HBsAg was constructed by PCR and cloned into the MCS of pCI-neo to construct pCI-FRT-HBsAg. The pCI-FRT-HBsAg was transfected into CHO/dhfr(-) cells and cell clones with high expression of HBsAg were screened by detecting the amount of HBsAg with ELISA. A CHO cell clone with the highest expression was chosen and named as CHO/dhfr(-) FRT(+). pAFRT HFLF, a expression plasmid of chimeric antibody with RFT sequence was transfected into CHO/dhfr(-) FRT(+) cells and cell clones with high expression of the chimeric antibody were screened by increasing concentration of MTX. A CHO cell clone with high expression of the chimeric antibody was cultured in large scale and supernatant was collected from which the chimeric antibody was purified. The purified chimeric antibody was analyzed by SDS-PAGE, Western blot and IFA. A CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site was obtained successfully. A cell clone with yield of 5 mg/L of chimeric antibody was obtained, as compared with routine CHO cell expression system with a yield of 2 mg/L. A cell line with integrated FRT sequence in the chromosome transcription active site was obtained and with it human-mouse chimeric antibody directed against Chikungunya virus was expressed. This system lays a solid foundation which can be used for expressing antibodies and other proteins.
Suh, E R; Waring, R B
1990-01-01
It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465
Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan
2007-07-01
Flavanone 3beta-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the beta-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction).
The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase
NASA Astrophysics Data System (ADS)
Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy
2016-04-01
Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.
Means, A L; Farnham, P J
1990-02-01
We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).
Identification of an inducible regulator of c-myb expression during T-cell activation.
Phan, S C; Feeley, B; Withers, D; Boxer, L M
1996-01-01
Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306
Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald
2013-01-01
Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487
Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald
2013-08-01
Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.
Ketchum, Myles J; Weyand, Theodore G; Weed, Peter F; Winsauer, Peter J
2016-05-01
Learning is believed to be reflected in the activity of the hippocampus. However, neural correlates of learning have been difficult to characterize because hippocampal activity is integrated with ongoing behavior. To address this issue, male rats (n = 5) implanted with electrodes (n = 14) in the CA1 subfield responded during two tasks within a single test session. In one task, subjects acquired a new 3-response sequence (acquisition), whereas in the other task, subjects completed a well-rehearsed 3-response sequence (performance). Both tasks though could be completed using an identical response topography and used the same sensory stimuli and schedule of reinforcement. More important, comparing neural patterns during sequence acquisition to those during sequence performance allows for a subtractive approach whereby activity associated with learning could potentially be dissociated from the activity associated with ongoing behavior. At sites where CA1 activity was closely associated with behavior, the patterns of activity were differentially modulated by key position and the serial position of a response within the schedule of reinforcement. Temporal shifts between peak activity and responding on particular keys also occurred during sequence acquisition, but not during sequence performance. Ethanol disrupted CA1 activity while producing rate-decreasing effects in both tasks and error-increasing effects that were more selective for sequence acquisition than sequence performance. Ethanol also produced alterations in the magnitude of modulations and temporal pattern of CA1 activity, although these effects were not selective for sequence acquisition. Similar to ethanol, hippocampal micro-stimulation decreased response rate in both tasks and selectively increased the percentage of errors during sequence acquisition, and provided a more direct demonstration of hippocampal involvement during sequence acquisition. Together, these results strongly support the notion that ethanol disrupts sequence acquisition by disrupting hippocampal activity and that the hippocampus is necessary for the conditioned associations required for sequence acquisition. © 2015 Wiley Periodicals, Inc.
Ketchum, Myles J.; Weyand, Theodore G.; Weed, Peter F.; Winsauer, Peter J.
2015-01-01
Learning is believed to be reflected in the activity of the hippocampus. However, neural correlates of learning have been difficult to characterize because hippocampal activity is integrated with ongoing behavior. To address this issue, male rats (n=5) implanted with electrodes (n=14) in the CA1 subfield responded during two tasks within a single test session. In one task, subjects acquired a new 3-response sequence (acquisition), whereas in the other task, subjects completed a well-rehearsed 3-response sequence (performance). Both tasks though could be completed using an identical response topography and used the same sensory stimuli and schedule of reinforcement. More important, comparing neural patterns during sequence acquisition to those during sequence performance allows for a subtractive approach whereby activity associated with learning could potentially be dissociated from the activity associated with ongoing behavior. At sites where CA1 activity was closely associated with behavior, the patterns of activity were differentially modulated by key position and the serial position of a response within the schedule of reinforcement. Temporal shifts between peak activity and responding on particular keys also occurred during sequence acquisition, but not during sequence performance. Ethanol disrupted CA1 activity while producing rate-decreasing effects in both tasks and error-increasing effects that were more selective for sequence acquisition than sequence performance. Ethanol also produced alterations in the magnitude of modulations and temporal pattern of CA1 activity, although these effects were not selective for sequence acquisition. Similar to ethanol, hippocampal micro-stimulation decreased response rate in both tasks and selectively increased the percentage of errors during sequence acquisition, and provided a more direct demonstration of hippocampal involvement during sequence acquisition. Together, these results strongly support the notion that ethanol disrupts sequence acquisition by disrupting hippocampal activity and that the hippocampus is necessary for the conditioned associations required for sequence acquisition. PMID:26482846
Target mimicry provides a new mechanism for regulation of microRNA activity.
Franco-Zorrilla, José Manuel; Valli, Adrián; Todesco, Marco; Mateos, Isabel; Puga, María Isabel; Rubio-Somoza, Ignacio; Leyva, Antonio; Weigel, Detlef; García, Juan Antonio; Paz-Ares, Javier
2007-08-01
MicroRNAs (miRNA) regulate key aspects of development and physiology in animals and plants. These regulatory RNAs act as guides of effector complexes to recognize specific mRNA sequences based on sequence complementarity, resulting in translational repression or site-specific cleavage. In plants, most miRNA targets are cleaved and show almost perfect complementarity with the miRNAs around the cleavage site. Here, we examined the non-protein coding gene IPS1 (INDUCED BY PHOSPHATE STARVATION 1) from Arabidopsis thaliana. IPS1 contains a motif with sequence complementarity to the phosphate (Pi) starvation-induced miRNA miR-399, but the pairing is interrupted by a mismatched loop at the expected miRNA cleavage site. We show that IPS1 RNA is not cleaved but instead sequesters miR-399. Thus, IPS1 overexpression results in increased accumulation of the miR-399 target PHO2 mRNA and, concomitantly, in reduced shoot Pi content. Engineering of IPS1 to be cleavable abolishes its inhibitory activity on miR-399. We coin the term 'target mimicry' to define this mechanism of inhibition of miRNA activity. Target mimicry can be generalized beyond the control of Pi homeostasis, as demonstrated using artificial target mimics.
Inhibition of trypanosomal cysteine proteinases by their propeptides.
Lalmanach, G; Lecaille, F; Chagas, J R; Authié, E; Scharfstein, J; Juliano, M A; Gauthier, F
1998-09-25
The ability of the prodomains of trypanosomal cysteine proteinases to inhibit their active form was studied using a set of 23 overlapping 15-mer peptides covering the whole prosequence of congopain, the major cysteine proteinase of Trypanosoma congolense. Three consecutive peptides with a common 5-mer sequence YHNGA were competitive inhibitors of congopain. A shorter synthetic peptide consisting of this 5-mer sequence flanked by two Ala residues (AYHNGAA) also inhibited purified congopain. No residue critical for inhibition was identified in this sequence, but a significant improvement in Ki value was obtained upon N-terminal elongation. Procongopain-derived peptides did not inhibit lysosomal cathepsins B and L but did inhibit native cruzipain (from Dm28c clone epimastigotes), the major cysteine proteinase of Trypanosoma cruzi, the proregion of which also contains the sequence YHNGA. The positioning of the YHNGA inhibitory sequence within the prosegment of trypanosomal proteinases is similar to that covering the active site in the prosegment of cysteine proteinases, the three-dimensional structure of which has been resolved. This strongly suggests that trypanosomal proteinases, despite their long C-terminal extension, have a prosegment that folds similarly to that in related mammal and plant cysteine proteinases, resulting in reverse binding within the active site. Such reverse binding could also occur for short procongopain-derived inhibitory peptides, based on their resistance to proteolysis and their ability to retain inhibitory activity after prolonged incubation. In contrast, homologous peptides in related cysteine proteinases did not inhibit trypanosomal proteinases and were rapidly cleaved by these enzymes.
Chimeras of human complement C9 reveal the site recognized by complement regulatory protein CD59.
Hüsler, T; Lockert, D H; Kaufman, K M; Sodetz, J M; Sims, P J
1995-02-24
CD59 antigen is a membrane glycoprotein that inhibits the activity of the C9 component of the C5b-9 membrane attack complex, thereby protecting human cells from lysis by human complement. The complement-inhibitory activity of CD59 is species-selective and is most effective toward C9 derived from human or other primate plasma. By contrast, rabbit C9, which can substitute for human C9 in the membrane attack complex, mediates unrestricted lysis of human cells. To identify the peptide segment of human C9 that is recognized by CD59, rabbit C9 cDNA clones were isolated, characterized, and used to construct hybrid cDNAs for expression of full-length human/rabbit C9 chimeras in COS-7 cells. All resulting chimeras were hemolytically active, when tested against chicken erythrocytes bearing C5b-8 complexes. Assays performed in the presence or absence of CD59 revealed that this inhibitor reduced the hemolytic activity of those chimeras containing human C9 sequence between residues 334-415, irrespective of whether the remainder of the protein contained human or rabbit sequence. By contrast, when this segment of C9 contained rabbit sequence, lytic activity was unaffected by CD59. These data establish that human C9 residues 334-415 contain the site recognized by CD59, and they suggest that sequence variability within this segment of C9 is responsible for the observed species-selective inhibitory activity of CD59.
Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B
1989-01-01
The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501
Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor L.; Brow, Mary Ann D.; Dahlberg, James E.
2007-12-11
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.
Invasive cleavage of nucleic acids
Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.
1999-01-01
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.
Invasive cleavage of nucleic acids
Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.
2002-01-01
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.
Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow; Mary Ann D.; Dahlberg, James E.
2010-11-09
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.
Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.
2000-01-01
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.
Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James E.
2005-04-05
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.
Trexler, Ryan; Solomon, Caroline; Brislawn, Colin J.; Wright, Justin R.; Rosenberger, Abigail; McClure, Erin E.; Grube, Alyssa M.; Peterson, Mark P.; Keddache, Mehdi; Mason, Olivia U.; Hazen, Terry C.; Grant, Christopher J.; Lamendella, Regina
2014-01-01
Hydraulic fracturing and horizontal drilling have increased dramatically in Pennsylvania Marcellus shale formations, however the potential for major environmental impacts are still incompletely understood. High-throughput sequencing of the 16S rRNA gene was performed to characterize the microbial community structure of water, sediment, bryophyte, and biofilm samples from 26 headwater stream sites in northwestern Pennsylvania with different histories of fracking activity within Marcellus shale formations. Further, we describe the relationship between microbial community structure and environmental parameters measured. Approximately 3.2 million 16S rRNA gene sequences were retrieved from a total of 58 samples. Microbial community analyses showed significant reductions in species richness as well as evenness in sites with Marcellus shale activity. Beta diversity analyses revealed distinct microbial community structure between sites with and without Marcellus shale activity. For example, operational taxonomic units (OTUs) within the Acetobacteracea, Methylocystaceae, Acidobacteriaceae, and Phenylobacterium were greater than three log-fold more abundant in MSA+ sites as compared to MSA− sites. Further, several of these OTUs were strongly negatively correlated with pH and positively correlated with the number of wellpads in a watershed. It should be noted that many of the OTUs enriched in MSA+ sites are putative acidophilic and/or methanotrophic populations. This study revealed apparent shifts in the autochthonous microbial communities and highlighted potential members that could be responding to changing stream conditions as a result of nascent industrial activity in these aquatic ecosystems. PMID:25408683
RNA-programmed genome editing in human cells
Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer
2013-01-01
Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978
Zhang, Haihan; Huang, Tinglin; Liu, Tingting
2013-01-01
Drinking water reservoir plays a vital role in the security of urban water supply, yet little is known about microbial community diversity harbored in the sediment of this oligotrophic freshwater environmental ecosystem. In the present study, integrating community level physiological profiles (CLPPs), nested polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) and clone sequence technologies, we examined the sediment urease and protease activities, bacterial community functional diversity, genetic diversity of bacterial and fungal communities in sediments from six sampling sites of Zhou cun drinking water reservoir, eastern China. The results showed that sediment urease activity was markedly distinct along the sites, ranged from 2.48 to 11.81 mg NH3-N/(g·24h). The highest average well color development (AWCD) was found in site C, indicating the highest metabolic activity of heterotrophic bacterial community. Principal component analysis (PCA) revealed tremendous differences in the functional (metabolic) diversity patterns of the sediment bacterial communities from different sites. Meanwhile, DGGE fingerprints also indicated spatial changes of genetic diversity of sediment bacterial and fungal communities. The sequence BLAST analysis of all the sediment samples found that Comamonas sp. was the dominant bacterial species harbored in site A. Alternaria alternate, Allomyces macrogynus and Rhizophydium sp. were most commonly detected fungal species in sediments of the Zhou cun drinking water reservoir. The results from this work provide new insights about the heterogeneity of sediment microbial community metabolic activity and genetic diversity in the oligotrophic drinking water reservoir. PMID:24205265
Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.
Salter, Jason D; Smith, Harold C
2018-05-23
The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Genome-wide mapping of autonomous promoter activity in human cells
van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas
2017-01-01
Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146
Inferring gene expression from ribosomal promoter sequences, a crowdsourcing approach
Meyer, Pablo; Siwo, Geoffrey; Zeevi, Danny; Sharon, Eilon; Norel, Raquel; Segal, Eran; Stolovitzky, Gustavo; Siwo, Geoffrey; Rider, Andrew K.; Tan, Asako; Pinapati, Richard S.; Emrich, Scott; Chawla, Nitesh; Ferdig, Michael T.; Tung, Yi-An; Chen, Yong-Syuan; Chen, Mei-Ju May; Chen, Chien-Yu; Knight, Jason M.; Sahraeian, Sayed Mohammad Ebrahim; Esfahani, Mohammad Shahrokh; Dreos, Rene; Bucher, Philipp; Maier, Ezekiel; Saeys, Yvan; Szczurek, Ewa; Myšičková, Alena; Vingron, Martin; Klein, Holger; Kiełbasa, Szymon M.; Knisley, Jeff; Bonnell, Jeff; Knisley, Debra; Kursa, Miron B.; Rudnicki, Witold R.; Bhattacharjee, Madhuchhanda; Sillanpää, Mikko J.; Yeung, James; Meysman, Pieter; Rodríguez, Aminael Sánchez; Engelen, Kristof; Marchal, Kathleen; Huang, Yezhou; Mordelet, Fantine; Hartemink, Alexander; Pinello, Luca; Yuan, Guo-Cheng
2013-01-01
The Gene Promoter Expression Prediction challenge consisted of predicting gene expression from promoter sequences in a previously unknown experimentally generated data set. The challenge was presented to the community in the framework of the sixth Dialogue for Reverse Engineering Assessments and Methods (DREAM6), a community effort to evaluate the status of systems biology modeling methodologies. Nucleotide-specific promoter activity was obtained by measuring fluorescence from promoter sequences fused upstream of a gene for yellow fluorescence protein and inserted in the same genomic site of yeast Saccharomyces cerevisiae. Twenty-one teams submitted results predicting the expression levels of 53 different promoters from yeast ribosomal protein genes. Analysis of participant predictions shows that accurate values for low-expressed and mutated promoters were difficult to obtain, although in the latter case, only when the mutation induced a large change in promoter activity compared to the wild-type sequence. As in previous DREAM challenges, we found that aggregation of participant predictions provided robust results, but did not fare better than the three best algorithms. Finally, this study not only provides a benchmark for the assessment of methods predicting activity of a specific set of promoters from their sequence, but it also shows that the top performing algorithm, which used machine-learning approaches, can be improved by the addition of biological features such as transcription factor binding sites. PMID:23950146
Papantonis, Argyris; Sourmeli, Sissy; Lecanidou, Rena
2008-05-09
From the different cis-elements clustered on silkmoth chorion gene promoters, C/EBP binding sites predominate. Their sequence composition and dispersal vary amongst promoters of diverse developmental specificity. Occupancy of these sites by BmC/EBP was examined through Southwestern and ChIP assays modified to suit ovarian follicular cells. For the genes studied, binding of BmC/EBP coincided with the respective stages of transcriptional activation. However, the factor was reloaded on promoter sequences long after individual gene repression. Furthermore, suppression of BmC/EBP transcription in developing follicles resulted in de-regulation of chorion gene expression. A biphasic function of BmC/EBP, according to which it may act as both an activator and a repressor during silkmoth choriogenesis, is considered under the light of the presented data.
Genome-Wide Analysis of A-to-I RNA Editing.
Savva, Yiannis A; Laurent, Georges St; Reenan, Robert A
2016-01-01
Adenosine (A)-to-inosine (I) RNA editing is a fundamental posttranscriptional modification that ensures the deamination of A-to-I in double-stranded (ds) RNA molecules. Intriguingly, the A-to-I RNA editing system is particularly active in the nervous system of higher eukaryotes, altering a plethora of noncoding and coding sequences. Abnormal RNA editing is highly associated with many neurological phenotypes and neurodevelopmental disorders. However, the molecular mechanisms underlying RNA editing-mediated pathogenesis still remain enigmatic and have attracted increasing attention from researchers. Over the last decade, methods available to perform genome-wide transcriptome analysis, have evolved rapidly. Within the RNA editing field researchers have adopted next-generation sequencing technologies to identify RNA-editing sites within genomes and to elucidate the underlying process. However, technical challenges associated with editing site discovery have hindered efforts to uncover comprehensive editing site datasets, resulting in the general perception that the collections of annotated editing sites represent only a small minority of the total number of sites in a given organism, tissue, or cell type of interest. Additionally to doubts about sensitivity, existing RNA-editing site lists often contain high percentages of false positives, leading to uncertainty about their validity and usefulness in downstream studies. An accurate investigation of A-to-I editing requires properly validated datasets of editing sites with demonstrated and transparent levels of sensitivity and specificity. Here, we describe a high signal-to-noise method for RNA-editing site detection using single-molecule sequencing (SMS). With this method, authentic RNA-editing sites may be differentiated from artifacts. Machine learning approaches provide a procedure to improve upon and experimentally validate sequencing outcomes through use of computationally predicted, iterative feedback loops. Subsequent use of extensive Sanger sequencing validations can generate accurate editing site lists. This approach has broad application and accurate genome-wide editing analysis of various tissues from clinical specimens or various experimental organisms is now a possibility.
Regulated expression of a repressor protein: FadR activates iclR.
Gui, L; Sunnarborg, A; LaPorte, D C
1996-01-01
The control of the glyoxylate bypass operon (aceBAK) of Escherichia coli is mediated by two regulatory proteins, IclMR and FadR. IclMR is a repressor protein which has previously been shown to bind to a site which overlaps the aceBAK promoter. FAR is a repressor/activator protein which participates in control of the genes of fatty acid metabolism. A sequence just upstream of the iclR promoter bears a striking resemblance to FadR binding sites found in the fatty acid metabolic genes. The in vitro binding specificity of FadR, determined by oligonucleotide selection, was in good agreement with the sequences of these sites. The ability of FadR to bind to the site associated with iclR was demonstrated by gel shift and DNase I footprint analyses. Disruption of FadR or inactivation of the FadR binding site of iclR decreased the expression of an iclR::lacZ operon fusion, indicating that FadR activates the expression of iclR. It has been reported that disruption of fadR increases the expression of aceBAK. We observed a similar increase when we inactivated the FadR binding site of an iclR+ allele. This result suggests that FadR regulates aceBAK indirectly by altering the expression of IclR. PMID:8755903
Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.
Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A
2016-03-18
Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.
NASA Technical Reports Server (NTRS)
Hwang, I.; Harper, J. F.; Liang, F.; Sze, H.
2000-01-01
To investigate how calmodulin regulates a unique subfamily of Ca(2+) pumps found in plants, we examined the kinetic properties of isoform ACA2 identified in Arabidopsis. A recombinant ACA2 was expressed in a yeast K616 mutant deficient in two endogenous Ca(2+) pumps. Orthovanadate-sensitive (45)Ca(2+) transport into vesicles isolated from transformants demonstrated that ACA2 is a Ca(2+) pump. Ca(2+) pumping by the full-length protein (ACA2-1) was 4- to 10-fold lower than that of the N-terminal truncated ACA2-2 (Delta2-80), indicating that the N-terminal domain normally acts to inhibit the pump. An inhibitory sequence (IC(50) = 4 microM) was localized to a region within valine-20 to leucine-44, because a peptide corresponding to this sequence lowered the V(max) and increased the K(m) for Ca(2+) of the constitutively active ACA2-2 to values comparable to the full-length pump. The peptide also blocked the activity (IC(50) = 7 microM) of a Ca(2+) pump (AtECA1) belonging to a second family of Ca(2+) pumps. This inhibitory sequence appears to overlap with a calmodulin-binding site in ACA2, previously mapped between aspartate-19 and arginine-36 (J.F. Harper, B. Hong, I. Hwang, H.Q. Guo, R. Stoddard, J.F. Huang, M.G. Palmgren, H. Sze inverted question mark1998 J Biol Chem 273: 1099-1106). These results support a model in which the pump is kept "unactivated" by an intramolecular interaction between an autoinhibitory sequence located between residues 20 and 44 and a site in the Ca(2+) pump core that is highly conserved between different Ca(2+) pump families. Results further support a model in which activation occurs as a result of Ca(2+)-induced binding of calmodulin to a site overlapping or immediately adjacent to the autoinhibitory sequence.
Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.
Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G
1992-01-01
opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family. PMID:1392590
E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.
Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B
2017-01-01
Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.
Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J
2008-10-15
The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.
Lucas, James E; Siegel, Justin B
2015-01-01
Enzyme active site residues are often highly conserved, indicating a significant role in function. In this study we quantitate the functional contribution for all conserved molecular interactions occurring within a Michaelis complex for mannitol 2-dehydrogenase derived from Pseudomonas fluorescens (pfMDH). Through systematic mutagenesis of active site residues, we reveal that the molecular interactions in pfMDH mediated by highly conserved residues not directly involved in reaction chemistry can be as important to catalysis as those directly involved in the reaction chemistry. This quantitative analysis of the molecular interactions within the pfMDH active site provides direct insight into the functional role of each molecular interaction, several of which were unexpected based on canonical sequence conservation and structural analyses. PMID:25752240
Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun
2016-11-01
As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.
Jurka, Jerzy W.
1997-01-01
Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.
Positive selection in octopus haemocyanin indicates functional links to temperature adaptation.
Oellermann, Michael; Strugnell, Jan M; Lieb, Bernhard; Mark, Felix C
2015-07-05
Octopods have successfully colonised the world's oceans from the tropics to the poles. Yet, successful persistence in these habitats has required adaptations of their advanced physiological apparatus to compensate impaired oxygen supply. Their oxygen transporter haemocyanin plays a major role in cold tolerance and accordingly has undergone functional modifications to sustain oxygen release at sub-zero temperatures. However, it remains unknown how molecular properties evolved to explain the observed functional adaptations. We thus aimed to assess whether natural selection affected molecular and structural properties of haemocyanin that explains temperature adaptation in octopods. Analysis of 239 partial sequences of the haemocyanin functional units (FU) f and g of 28 octopod species of polar, temperate, subtropical and tropical origin revealed natural selection was acting primarily on charge properties of surface residues. Polar octopods contained haemocyanins with higher net surface charge due to decreased glutamic acid content and higher numbers of basic amino acids. Within the analysed partial sequences, positive selection was present at site 2545, positioned between the active copper binding centre and the FU g surface. At this site, methionine was the dominant amino acid in polar octopods and leucine was dominant in tropical octopods. Sites directly involved in oxygen binding or quaternary interactions were highly conserved within the analysed sequence. This study has provided the first insight into molecular and structural mechanisms that have enabled octopods to sustain oxygen supply from polar to tropical conditions. Our findings imply modulation of oxygen binding via charge-charge interaction at the protein surface, which stabilize quaternary interactions among functional units to reduce detrimental effects of high pH on venous oxygen release. Of the observed partial haemocyanin sequence, residue 2545 formed a close link between the FU g surface and the active centre, suggesting a role as allosteric binding site. The prevalence of methionine at this site in polar octopods, implies regulation of oxygen affinity via increased sensitivity to allosteric metal binding. High sequence conservation of sites directly involved in oxygen binding indicates that functional modifications of octopod haemocyanin rather occur via more subtle mechanisms, as observed in this study.
Dunn, Matthew P; Di Gregorio, Anna
2009-04-15
In Ciona intestinalis, leprecan was identified as a target of the notochord-specific transcription factor Ciona Brachyury (Ci-Bra) (Takahashi, H., Hotta, K., Erives, A., Di Gregorio, A., Zeller, R.W., Levine, M., Satoh, N., 1999. Brachyury downstream notochord differentiation in the ascidian embryo. Genes Dev. 13, 1519-1523). By screening approximately 14 kb of the Ci-leprecan locus for cis-regulatory activity, we have identified a 581-bp minimal notochord-specific cis-regulatory module (CRM) whose activity depends upon T-box binding sites located at the 3'-end of its sequence. These sites are specifically bound in vitro by a GST-Ci-Bra fusion protein, and mutations that abolish binding in vitro result in loss or decrease of regulatory activity in vivo. Serial deletions of the 581-bp notochord CRM revealed that this sequence is also able to direct expression in muscle cells through the same T-box sites that are utilized by Ci-Bra in the notochord, which are also bound in vitro by the muscle-specific T-box activators Ci-Tbx6b and Ci-Tbx6c. Additionally, we created plasmids aimed to interfere with the function of Ci-leprecan and categorized the resulting phenotypes, which consist of variable dislocations of notochord cells along the anterior-posterior axis. Together, these observations provide mechanistic insights generally applicable to T-box transcription factors and their target sequences, as well as a first set of clues on the function of Leprecan in early chordate development.
Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.
Cox, J M; Sloan, L S; Schepartz, A
1995-12-01
HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.
Singh, Vinod Kumar; Krishnamachari, Annangarachari
2016-09-01
Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS) requires an essential consensus sequence (ACS) for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC) denoted as ORC-ACS and non-replicating ACS sequences (nrACS), that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.
Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning.
Heredia, Jeremiah D; Park, Jihye; Brubaker, Riley J; Szymanski, Steven K; Gill, Kevin S; Procko, Erik
2018-06-01
Chemokine receptors CXCR4 and CCR5 regulate WBC trafficking and are engaged by the HIV-1 envelope glycoprotein gp120 during infection. We combine a selection of human CXCR4 and CCR5 libraries comprising nearly all of ∼7000 single amino acid substitutions with deep sequencing to define sequence-activity landscapes for surface expression and ligand interactions. After consideration of sequence constraints for surface expression, known interaction sites with HIV-1-blocking Abs were appropriately identified as conserved residues following library sorting for Ab binding, validating the use of deep mutational scanning to map functional interaction sites in G protein-coupled receptors. Chemokine CXCL12 was found to interact with residues extending asymmetrically into the CXCR4 ligand-binding cavity, similar to the binding surface of CXCR4 recognized by an antagonistic viral chemokine previously observed crystallographically. CXCR4 mutations distal from the chemokine binding site were identified that enhance chemokine recognition. This included disruptive mutations in the G protein-coupling site that diminished calcium mobilization, as well as conservative mutations to a membrane-exposed site (CXCR4 residues H79 2.45 and W161 4.50 ) that increased ligand binding without loss of signaling. Compared with CXCR4-CXCL12 interactions, CCR5 residues conserved for gp120 (HIV-1 BaL strain) interactions map to a more expansive surface, mimicking how the cognate chemokine CCL5 makes contacts across the entire CCR5 binding cavity. Acidic substitutions in the CCR5 N terminus and extracellular loops enhanced gp120 binding. This study demonstrates how comprehensive mutational scanning can define functional interaction sites on receptors, and novel mutations that enhance receptor activities can be found simultaneously. Copyright © 2018 by The American Association of Immunologists, Inc.
Kulik, Natallia; Slámová, Kristýna; Ettrich, Rüdiger; Křen, Vladimír
2015-01-28
β-N-Acetylhexosaminidase (GH20) from the filamentous fungus Talaromyces flavus, previously identified as a prominent enzyme in the biosynthesis of modified glycosides, lacks a high resolution three-dimensional structure so far. Despite of high sequence identity to previously reported Aspergillus oryzae and Penicilluim oxalicum β-N-acetylhexosaminidases, this enzyme tolerates significantly better substrate modification. Understanding of key structural features, prediction of effective mutants and potential substrate characteristics prior to their synthesis are of general interest. Computational methods including homology modeling and molecular dynamics simulations were applied to shad light on the structure-activity relationship in the enzyme. Primary sequence analysis revealed some variable regions able to influence difference in substrate affinity of hexosaminidases. Moreover, docking in combination with consequent molecular dynamics simulations of C-6 modified glycosides enabled us to identify the structural features required for accommodation and processing of these bulky substrates in the active site of hexosaminidase from T. flavus. To access the reliability of predictions on basis of the reported model, all results were confronted with available experimental data that demonstrated the principal correctness of the predictions as well as the model. The main variable regions in β-N-acetylhexosaminidases determining difference in modified substrate affinity are located close to the active site entrance and engage two loops. Differences in primary sequence and the spatial arrangement of these loops and their interplay with active site amino acids, reflected by interaction energies and dynamics, account for the different catalytic activity and substrate specificity of the various fungal and bacterial β-N-acetylhexosaminidases.
Busk, Peter Kamp; Lange, Lene
2013-06-01
Functional prediction of carbohydrate-active enzymes is difficult due to low sequence identity. However, similar enzymes often share a few short motifs, e.g., around the active site, even when the overall sequences are very different. To exploit this notion for functional prediction of carbohydrate-active enzymes, we developed a simple algorithm, peptide pattern recognition (PPR), that can divide proteins into groups of sequences that share a set of short conserved sequences. When this method was used on 118 glycoside hydrolase 5 proteins with 9% average pairwise identity and representing four characterized enzymatic functions, 97% of the proteins were sorted into groups correlating with their enzymatic activity. Furthermore, we analyzed 8,138 glycoside hydrolase 13 proteins including 204 experimentally characterized enzymes with 28 different functions. There was a 91% correlation between group and enzyme activity. These results indicate that the function of carbohydrate-active enzymes can be predicted with high precision by finding short, conserved motifs in their sequences. The glycoside hydrolase 61 family is important for fungal biomass conversion, but only a few proteins of this family have been functionally characterized. Interestingly, PPR divided 743 glycoside hydrolase 61 proteins into 16 subfamilies useful for targeted investigation of the function of these proteins and pinpointed three conserved motifs with putative importance for enzyme activity. Furthermore, the conserved sequences were useful for cloning of new, subfamily-specific glycoside hydrolase 61 proteins from 14 fungi. In conclusion, identification of conserved sequence motifs is a new approach to sequence analysis that can predict carbohydrate-active enzyme functions with high precision.
Methods and compositions for controlling gene expression by RNA processing
Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.
2017-08-29
The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.
Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D
2014-05-27
We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.
Revisiting and re-engineering the classical zinc finger peptide: consensus peptide-1 (CP-1).
Besold, Angelique N; Widger, Leland R; Namuswe, Frances; Michalek, Jamie L; Michel, Sarah L J; Goldberg, David P
2016-04-01
Zinc plays key structural and catalytic roles in biology. Structural zinc sites are often referred to as zinc finger (ZF) sites, and the classical ZF contains a Cys2His2 motif that is involved in coordinating Zn(II). An optimized Cys2His2 ZF, named consensus peptide 1 (CP-1), was identified more than 20 years ago using a limited set of sequenced proteins. We have reexamined the CP-1 sequence, using our current, much larger database of sequenced proteins that have been identified from high-throughput sequencing methods, and found the sequence to be largely unchanged. The CCHH ligand set of CP-1 was then altered to a CAHH motif to impart hydrolytic activity. This ligand set mimics the His2Cys ligand set of peptide deformylase (PDF), a hydrolytically active M(II)-centered (M = Zn or Fe) protein. The resultant peptide [CP-1(CAHH)] was evaluated for its ability to coordinate Zn(II) and Co(II) ions, adopt secondary structure, and promote hydrolysis. CP-1(CAHH) was found to coordinate Co(II) and Zn(II) and a pentacoordinate geometry for Co(II)-CP-1(CAHH) was implicated from UV-vis data. This suggests a His2Cys(H2O)2 environment at the metal center. The Zn(II)-bound CP-1(CAHH) was shown to adopt partial secondary structure by 1-D (1)H NMR spectroscopy. Both Zn(II)-CP-1(CAHH) and Co(II)-CP-1(CAHH) show good hydrolytic activity toward the test substrate 4-nitrophenyl acetate, exhibiting faster rates than most active synthetic Zn(II) complexes.
Selection of the simplest RNA that binds isoleucine
LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL
2003-01-01
We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881
Qiao, Huan; May, James M.
2012-01-01
Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872
A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.
Håvik, B; Ragnhildstveit, E; Lorens, J B; Saelemyr, K; Fauske, O; Knudsen, L K; Fjose, A
1999-12-20
The paired domain (PD) is an evolutionarily conserved DNA-binding domain encoded by the Pax gene family of developmental regulators. The Pax proteins are transcription factors and are involved in a variety of processes such as brain development, patterning of the central nervous system (CNS), and B-cell development. In this report we demonstrate that the zebrafish Pax2 PD can interact with a novel type of DNA sequences in vitro, the triple-A motif, consisting of a heptameric nucleotide sequence G/CAAACA/TC with an invariant core of three adjacent adenosines. This recognition sequence was found to be conserved in known natural Pax5 repressor elements involved in controlling the expression of the p53 and J-chain genes. By identifying similar high affinity binding sites in potential target genes of the Pax2 protein, including the pax2 gene itself, we obtained further evidence that the triple-A sites are biologically significant. The putative natural target sites also provide a basis for defining an extended consensus recognition sequence. In addition, we observed in transformation assays a direct correlation between Pax2 repressor activity and the presence of triple-A sites. The results suggest that a transcriptional regulatory function of Pax proteins can be modulated by PD binding to different categories of target sequences. Copyright 1999 Academic Press.
Type III restriction-modification enzymes: a historical perspective.
Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara
2014-01-01
Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.
Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells.
Le Billan, Florian; Khan, Junaid A; Lamribet, Khadija; Viengchareun, Say; Bouligand, Jérôme; Fagart, Jérôme; Lombès, Marc
2015-09-01
Aldosterone exerts its effects mainly by activating the mineralocorticoid receptor (MR), a transcription factor that regulates gene expression through complex and dynamic interactions with coregulators and transcriptional machinery, leading to fine-tuned control of vectorial ionic transport in the distal nephron. To identify genome-wide aldosterone-regulated MR targets in human renal cells, we set up a chromatin immunoprecipitation (ChIP) assay by using a specific anti-MR antibody in a differentiated human renal cell line expressing green fluorescent protein (GFP)-MR. This approach, coupled with high-throughput sequencing, allowed identification of 974 genomic MR targets. Computational analysis identified an MR response element (MRE) including single or multiple half-sites and palindromic motifs in which the AGtACAgxatGTtCt sequence was the most prevalent motif. Most genomic MR-binding sites (MBSs) are located >10 kb from the transcriptional start sites of target genes (84%). Specific aldosterone-induced recruitment of MR on the first most relevant genomic sequences was further validated by ChIP-quantitative (q)PCR and correlated with concomitant and positive aldosterone-activated transcriptional regulation of the corresponding gene, as assayed by RT-qPCR. It was notable that most MBSs lacked MREs but harbored DNA recognition motifs for other transcription factors (FOX, EGR1, AP1, PAX5) suggesting functional interaction. This work provides new insights into aldosterone MR-mediated renal signaling and opens relevant perspectives for mineralocorticoid-related pathophysiology. © FASEB.
Jensen, Sigmund; Lynch, Michael D J; Ray, Jessica L; Neufeld, Josh D; Hovland, Martin
2015-10-01
Deep-sea coral reefs do not receive sunlight and depend on plankton. Little is known about the plankton composition at such reefs, even though they constitute habitats for many invertebrates and fish. We investigated plankton communities from three reefs at 260-350 m depth at hydrocarbon fields off the mid-Norwegian coast using a combination of cultivation and small subunit (SSU) rRNA gene and transcript sequencing. Eight months incubations of a reef water sample with minimal medium, supplemented with carbon dioxide and gaseous alkanes at in situ-like conditions, enabled isolation of mostly Alphaproteobacteria (Sulfitobacter, Loktanella), Gammaproteobacteria (Colwellia) and Flavobacteria (Polaribacter). The relative abundance of isolates in the original sample ranged from ∼ 0.01% to 0.80%. Comparisons of bacterial SSU sequences from filtered plankton of reef and non-reef control samples indicated high abundance and metabolic activity of primarily Alphaproteobacteria (SAR11 Ia), Gammaproteobacteria (ARCTIC96BD-19), but also of Deltaproteobacteria (Nitrospina, SAR324). Eukaryote SSU sequences indicated metabolically active microalgae and animals, including codfish, at the reef sites. The plankton community composition varied between reefs and differed between DNA and RNA assessments. Over 5000 operational taxonomic units were detected, some indicators of reef sites (e.g. Flavobacteria, Cercozoa, Demospongiae) and some more active at reef sites (e.g. Gammaproteobacteria, Ciliophora, Copepoda). © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Binding sites for interaction of peroxiredoxin 6 with surfactant protein A
Krishnaiah, Saikumari Y; Dodia, Chandra; Sorokina, Elena M; Li, Haitao; Feinstein, Sheldon I; Fisher, Aron B
2016-01-01
Peroxiredoxin 6 (Prdx6) is a bifunctional enzyme with peroxidase and phospholipase A2 (PLA2) activities. This protein participates in the degradation and remodeling of internalized dipalmitoylphosphatidylcholine (DPPC), the major phospholipid component of lung surfactant. We have shown previously that the PLA2 activity of Prdx6 is inhibited by the lung surfactant-associated protein called surfactant protein A (SP-A) through direct protein-protein interaction. Docking of SPA and Prdx6 was modeled using the ZDOCK (zlab.bu.edu) program in order to predict molecular sites for binding of the two proteins. The predicted peptide sequences were evaluated for binding to the opposite protein using isothermal titration calorimetry and circular dichroism measurement followed by determination of the effect of the SP-A peptide on the PLA2 activity of Prdx6. The sequences 195EEEAKKLFPK204.in the Prdx6 helix and 83DEELQTELYEIKHQIL99 in SP-A were identified as the sites for hydrophobic interaction and H+-bonding between the 2 proteins. Treatment of mouse endothelial cells with the SP-A peptide inhibited their recovery from lipid peroxidation associated with oxidative stress indicating inhibition of Prdx6 activity by the peptide in the intact cell. PMID:26723227
Improving CRISPR-Cas specificity with chemical modifications in single-guide RNAs.
Ryan, Daniel E; Taussig, David; Steinfeld, Israel; Phadnis, Smruti M; Lunstad, Benjamin D; Singh, Madhurima; Vuong, Xuan; Okochi, Kenji D; McCaffrey, Ryan; Olesiak, Magdalena; Roy, Subhadeep; Yung, Chong Wing; Curry, Bo; Sampson, Jeffrey R; Bruhn, Laurakay; Dellinger, Douglas J
2018-01-25
CRISPR systems have emerged as transformative tools for altering genomes in living cells with unprecedented ease, inspiring keen interest in increasing their specificity for perfectly matched targets. We have developed a novel approach for improving specificity by incorporating chemical modifications in guide RNAs (gRNAs) at specific sites in their DNA recognition sequence ('guide sequence') and systematically evaluating their on-target and off-target activities in biochemical DNA cleavage assays and cell-based assays. Our results show that a chemical modification (2'-O-methyl-3'-phosphonoacetate, or 'MP') incorporated at select sites in the ribose-phosphate backbone of gRNAs can dramatically reduce off-target cleavage activities while maintaining high on-target performance, as demonstrated in clinically relevant genes. These findings reveal a unique method for enhancing specificity by chemically modifying the guide sequence in gRNAs. Our approach introduces a versatile tool for augmenting the performance of CRISPR systems for research, industrial and therapeutic applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.
Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E
2004-01-01
AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.
Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V
2002-12-12
Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.
An att site-based recombination reporter system for genome engineering and synthetic DNA assembly.
Bland, Michael J; Ducos-Galand, Magaly; Val, Marie-Eve; Mazel, Didier
2017-07-14
Direct manipulation of the genome is a widespread technique for genetic studies and synthetic biology applications. The tyrosine and serine site-specific recombination systems of bacteriophages HK022 and ΦC31 are widely used for stable directional exchange and relocation of DNA sequences, making them valuable tools in these contexts. We have developed site-specific recombination tools that allow the direct selection of recombination events by embedding the attB site from each system within the β-lactamase resistance coding sequence (bla). The HK and ΦC31 tools were developed by placing the attB sites from each system into the signal peptide cleavage site coding sequence of bla. All possible open reading frames (ORFs) were inserted and tested for recombination efficiency and bla activity. Efficient recombination was observed for all tested ORFs (3 for HK, 6 for ΦC31) as shown through a cointegrate formation assay. The bla gene with the embedded attB site was functional for eight of the nine constructs tested. The HK/ΦC31 att-bla system offers a simple way to directly select recombination events, thus enhancing the use of site-specific recombination systems for carrying out precise, large-scale DNA manipulation, and adding useful tools to the genetics toolbox. We further show the power and flexibility of bla to be used as a reporter for recombination.
Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R
1992-01-01
The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011
Kyöstiö, S R; Cramer, C L; Lacy, G H
1991-01-01
The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878
Many human accelerated regions are developmental enhancers
Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.
2013-01-01
The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637
Lee, Jae Hoon; Sundin, George W; Zhao, Youfu
2016-06-01
The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.
2012-01-01
Background The mycobacteriophage large serine recombinase Bxb1 catalyzes site-specific recombination between its corresponding attP and attB recognition sites. Previously, we and others have shown that Bxb1 has catalytic activity in various eukaryotic species including Nicotiana tabacum, Schizosaccharomyces pombe, insects and mammalian cells. Results In this work, the Bxb1 recombinase gene was transformed and constitutively expressed in Arabidopsis thaliana plants harboring a chromosomally integrated attP and attB-flanked target sequence. The Bxb1 recombinase successfully excised the target sequence in a conservative manner and the resulting recombination event was heritably transmitted to subsequent generations in the absence of the recombinase transgene. In addition, we also show that Bxb1 recombinase expressing plants can be manually crossed with att-flanked target transgenic plants to generate excised progeny. Conclusion The Bxb1 large serine recombinase performs site-specific recombination in Arabidopsis thaliana germinal tissue, producing stable lines free of unwanted DNA. The precise site-specific deletion produced by Bxb1 in planta demonstrates that this enzyme can be a useful tool for the genetic engineering of plants without selectable marker transgenes or other undesirable exogenous sequences. PMID:22436504
Sun, Jian; Zhang, Qiang; Zhou, Jia; Wei, Qinping
2014-01-01
We used a next-generation, Illumina-based sequencing approach to characterize the bacterial community development of apple rhizosphere soil in a replant site (RePlant) and a new planting site (NewPlant) in Beijing. Dwarfing apple nurseries of ‘Fuji’/SH6/Pingyitiancha trees were planted in the spring of 2013. Before planting, soil from the apple rhizosphere of the replant site (ReSoil) and from the new planting site (NewSoil) was sampled for analysis on the Illumina MiSeq platform. In late September, the rhizosphere soil from both sites was resampled (RePlant and NewPlant). More than 16,000 valid reads were obtained for each replicate, and the community was composed of five dominant groups (Proteobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes and Actinobacteria). The bacterial diversity decreased after apple planting. Principal component analyses revealed that the rhizosphere samples were significantly different among treatments. Apple nursery planting showed a large impact on the soil bacterial community, and the community development was significantly different between the replanted and newly planted soils. Verrucomicrobia were less abundant in RePlant soil, while Pseudomonas and Lysobacter were increased in RePlant compared with ReSoil and NewPlant. Both RePlant and ReSoil showed relatively higher invertase and cellulase activities than NewPlant and NewSoil, but only NewPlant soil showed higher urease activity, and this soil also had the higher plant growth. Our experimental results suggest that planting apple nurseries has a significant impact on soil bacterial community development at both replant and new planting sites, and planting on new site resulted in significantly higher soil urease activity and a different bacterial community composition. PMID:25360786
DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus
Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...
2014-08-23
Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less
A novel site-specific recombination system derived from bacteriophage phiMR11.
Rashel, Mohammad; Uchiyama, Jumpei; Ujihara, Takako; Takemura, Iyo; Hoshiba, Hiroshi; Matsuzaki, Shigenobu
2008-04-04
We report identification of a novel site-specific DNA recombination system that functions in both in vivo and in vitro, derived from lysogenic Staphylococcus aureus phage phiMR11. In silico analysis of the phiMR11 genome indicated orf1 as a putative integrase gene. Phage and bacterial attachment sites (attP and attB, respectively) and attachment junctions were determined and their nucleotide sequences decoded. Sequences of attP and attB were mostly different to each other except for a two bp common core that was the crossover point. We found several inverted repeats adjacent to the core sequence of attP as potential protein binding sites. The precise and efficient integration properties of phiMR11 integrase were shown on attP and attB in Escherichia coli and the minimum size of attP was found to be 34bp. In in vitro assays using crude or purified integrase, only buffer and substrate DNAs were required for the recombination reaction, indicating that other bacterially encoded factors are not essential for activity.
Amicosante, G; Oratore, A; Joris, B; Galleni, M; Frère, J M; Van Beeumen, J
1988-01-01
Both forms of the chromosome-encoded beta-lactamase of Citrobacter diversus react with beta-iodopenicillanate at a rate characteristic of class A beta-lactamases. The active site of form I was labelled with the same reagent. The sequence of the peptide obtained after trypsin hydrolysis is identical with that of a peptide obtained in a similar manner from the chromosome-encoded beta-lactamase of Klebsiella pneumoniae. PMID:2848500
Krassowski, Michal; Paczkowska, Marta; Cullion, Kim; Huang, Tina; Dzneladze, Irakli; Ouellette, B F Francis; Yamada, Joseph T; Fradet-Turcotte, Amelie
2018-01-01
Abstract Interpretation of genetic variation is needed for deciphering genotype-phenotype associations, mechanisms of inherited disease, and cancer driver mutations. Millions of single nucleotide variants (SNVs) in human genomes are known and thousands are associated with disease. An estimated 21% of disease-associated amino acid substitutions corresponding to missense SNVs are located in protein sites of post-translational modifications (PTMs), chemical modifications of amino acids that extend protein function. ActiveDriverDB is a comprehensive human proteo-genomics database that annotates disease mutations and population variants through the lens of PTMs. We integrated >385,000 published PTM sites with ∼3.6 million substitutions from The Cancer Genome Atlas (TCGA), the ClinVar database of disease genes, and human genome sequencing projects. The database includes site-specific interaction networks of proteins, upstream enzymes such as kinases, and drugs targeting these enzymes. We also predicted network-rewiring impact of mutations by analyzing gains and losses of kinase-bound sequence motifs. ActiveDriverDB provides detailed visualization, filtering, browsing and searching options for studying PTM-associated mutations. Users can upload mutation datasets interactively and use our application programming interface in pipelines. Integrative analysis of mutations and PTMs may help decipher molecular mechanisms of phenotypes and disease, as exemplified by case studies of TP53, BRCA2 and VHL. The open-source database is available at https://www.ActiveDriverDB.org. PMID:29126202
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Kim, Shin-Hee; Chen, Zongyan; Yoshida, Asuka; Paldurai, Anandan; Xiao, Sa; Samal, Siba K
2017-01-01
Newcastle disease virus (NDV) causes a devastating poultry disease worldwide. Frequent outbreaks of NDV in chickens vaccinated with conventional live vaccines suggest a need to develop new vaccines that are genetically matched against circulating NDV strains, such as the genotype V virulent strains currently circulating in Mexico and Central America. In this study, a reverse genetics system was developed for the virulent NDV strain Mexico/01/10 strain and used to generate highly attenuated vaccine candidates by individually modifying the cleavage site sequence of fusion (F) protein. The cleavage site sequence of parental virus was individually changed to those of the avirulent NDV strain LaSota and other serotypes of avian paramyxoviruses (APMV serotype-2, -3, -4, -6, -7, -8, and -9). In general, these mutations affected cell-to-cell fusion activity in vitro and the efficiency of the F protein cleavage and made recombinant Mexico/01/10 (rMex) virus highly attenuated in chickens. When chickens were immunized with the rMex mutant viruses and challenged with the virulent parent virus, there was reduced challenge virus shedding compared to birds immunized with the heterologous vaccine strain LaSota. Among the vaccine candidates, rMex containing the cleavage site sequence of APMV-2 induced the highest neutralizing antibody titer and completely protected chickens from challenge virus shedding. These results show the role of the F protein cleavage site sequence of each APMV type in generating genotype V-matched vaccines and the efficacy of matched vaccine strains to provide better protection against NDV strains currently circulating in Mexico.
Li, Liqi; Luo, Qifa; Xiao, Weidong; Li, Jinhui; Zhou, Shiwen; Li, Yongsheng; Zheng, Xiaoqi; Yang, Hua
2017-02-01
Palmitoylation is the covalent attachment of lipids to amino acid residues in proteins. As an important form of protein posttranslational modification, it increases the hydrophobicity of proteins, which contributes to the protein transportation, organelle localization, and functions, therefore plays an important role in a variety of cell biological processes. Identification of palmitoylation sites is necessary for understanding protein-protein interaction, protein stability, and activity. Since conventional experimental techniques to determine palmitoylation sites in proteins are both labor intensive and costly, a fast and accurate computational approach to predict palmitoylation sites from protein sequences is in urgent need. In this study, a support vector machine (SVM)-based method was proposed through integrating PSI-BLAST profile, physicochemical properties, [Formula: see text]-mer amino acid compositions (AACs), and [Formula: see text]-mer pseudo AACs into the principal feature vector. A recursive feature selection scheme was subsequently implemented to single out the most discriminative features. Finally, an SVM method was implemented to predict palmitoylation sites in proteins based on the optimal features. The proposed method achieved an accuracy of 99.41% and Matthews Correlation Coefficient of 0.9773 for a benchmark dataset. The result indicates the efficiency and accuracy of our method in prediction of palmitoylation sites based on protein sequences.
Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences
Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K.; Maitra, S. S.
2015-01-01
Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700
NASA Astrophysics Data System (ADS)
Rauf, Muhammad; Saeed, Nasir A.; Habib, Imran; Ahmed, Moddassir; Shahzad, Khurram; Mansoor, Shahid; Ali, Rashid
2017-02-01
Structure prediction can provide information about function and active sites of protein which helps to design new functional proteins. H+-pyrophosphatase is transmembrane protein involved in establishing proton motive force for active transport of Na+ across membrane by Na+/H+ antiporters. A full length novel H+-pyrophosphatase gene was isolated from halophytic grass Leptochloa fusca using RT-PCR and RACE method. Full length LfVP1 gene sequence of 2292 nucleotides encodes protein of 764 amino acids. DNA and protein sequences were used for characterization using bioinformatics tools. Various important potential sites were predicted by PROSITE webserver. Primary structural analysis showed LfVP1 as stable protein and Grand average hydropathy (GRAVY) indicated that LfVP1 protein has good hydrosolubility. Secondary structure analysis showed that LfVP1 protein sequence contains significant proportion of alpha helix and random coil. Protein membrane topology suggested the presence of 14 transmembrane domains and presence of catalytic domain in TM3. Three dimensional structure from LfVP1 protein sequence also indicated the presence of 14 transmembrane domains and hydrophobicity surface model showed amino acid hydrophobicity. Ramachandran plot showed that 98% amino acid residues were predicted in the favored region.
Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M
2000-10-06
Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.
Zandvakili, Arya; Campbell, Ian; Weirauch, Matthew T.
2018-01-01
Cells use thousands of regulatory sequences to recruit transcription factors (TFs) and produce specific transcriptional outcomes. Since TFs bind degenerate DNA sequences, discriminating functional TF binding sites (TFBSs) from background sequences represents a significant challenge. Here, we show that a Drosophila regulatory element that activates Epidermal Growth Factor signaling requires overlapping, low-affinity TFBSs for competing TFs (Pax2 and Senseless) to ensure cell- and segment-specific activity. Testing available TF binding models for Pax2 and Senseless, however, revealed variable accuracy in predicting such low-affinity TFBSs. To better define parameters that increase accuracy, we developed a method that systematically selects subsets of TFBSs based on predicted affinity to generate hundreds of position-weight matrices (PWMs). Counterintuitively, we found that degenerate PWMs produced from datasets depleted of high-affinity sequences were more accurate in identifying both low- and high-affinity TFBSs for the Pax2 and Senseless TFs. Taken together, these findings reveal how TFBS arrangement can be constrained by competition rather than cooperativity and that degenerate models of TF binding preferences can improve identification of biologically relevant low affinity TFBSs. PMID:29617378
Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan
2007-01-01
Flavanone 3β-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the β-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction). PMID:17535823
Setayesh-Mehr, Zahra; Asoodeh, Ahmad
2017-12-01
The hypertension is one of the highest risk factors for stroke, myocardial infarction, vascular disease and chronic kidney disease. Angiotensin converting enzyme (ACE) has an important role in the physiological regulation of cardiovascular system. ACE inhibition is a key purpose for hypertension treatment. In this study, two peptides named HL-7 with the sequence of YLYELAR (MW: 927.07Da) and HL-10 with the sequence of AFPYYGHHLG (MW: 1161.28Da) were identified from scorpion venom of H. lepturus. The inhibitory activity of HL-7 and HL-10 was examined on rabbit ACE. The inhibition mechanisms were assayed by kinetic and docking studies. The IC 50 values for ACE inhibition of HL-7 and HL-10 were 9.37µM and 17.22µM, respectively. Lineweaver-Burk plots showed that two peptides inhibited rabbit ACE with competitive manner. The molecular docking conformed experimental results and showed that the two peptides interacted with N-domain and C-domain active sites. Also, docking study revealed that the two peptides can form hydrogen and hydrophobic bonds at their binding sites. Both peptides had higher affinity to N-domain. Our results showed that HL-7 exhibited more strong interactions with amino acids at active site. It seems that HL-10 peptide could occupy more space, thereby inhibiting the substrate entrance to active site. Copyright © 2017 Elsevier Inc. All rights reserved.
The Minimal Replicator of Epstein-Barr Virus oriP
Yates, John L.; Camiolo, Sarah M.; Bashaw, Jacqueline M.
2000-01-01
oriP is a 1.7-kb region of the Epstein-Barr virus (EBV) chromosome that supports the replication and stable maintenance of plasmids in human cells. oriP contains two essential components, called the DS and the FR, both of which contain multiple binding sites for the EBV-encoded protein, EBNA-1. The DS appears to function as the replicator of oriP, while the FR acts in conjunction with EBNA-1 to prevent the loss of plasmids from proliferating cells. Because of EBNA-1's role in stabilizing plasmids through the FR, it has not been entirely clear to what extent EBNA-1 might be required for replication from oriP per se, and a recent study has questioned whether EBNA-1 has any direct role in replication. In the present study we found that plasmids carrying oriP required EBNA-1 to replicate efficiently even when assayed only 2 days after plasmids were introduced into the cell lines 143B and 293. Significantly, using 293 cells it was demonstrated that the plasmid-retention function of EBNA-1 and the FR did not contribute significantly to the accumulation of replicated plasmids, and the DS supported efficient EBNA-1-dependent replication in the absence of the FR. The DS contains two pairs of closely spaced EBNA-1 binding sites, and a previous study had shown that both sites within either pair are required for activity. However, it was unclear from previous work what additional sequences within the DS might be required. We found that each “half” of the DS, including a pair of closely spaced EBNA-1 binding sites, had significant replicator activity when the other half had been deleted. The only significant DNA sequences that the two halves of the DS share in common, other than EBNA-1 binding sites, is a 9-bp sequence that is present twice in the “left half” and once in the “right half.” These nonamer repeats, while not essential for activity, contributed significantly to the activity of each half of the DS. Two thymines occur at unique positions within EBNA-1 binding sites 1 and 4 at the DS and become sensitive to oxidation by permanganate when EBNA-1 binds, but mutation of each to the consensus base, adenine, actually improved the activity of each half of the DS slightly. In conclusion, the DS of oriP is an EBNA-1-dependent replicator, and its minimal active core appears to be simply two properly spaced EBNA-1 binding sites. PMID:10775587
Detection of nucleic acid sequences by invader-directed cleavage
Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert
1999-01-01
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.
Detection of the CLOCK/BMAL1 heterodimer using a nucleic acid probe with cycling probe technology.
Nakagawa, Kazuhiro; Yamamoto, Takuro; Yasuda, Akio
2010-09-15
An isothermal signal amplification technique for specific DNA sequences, known as cycling probe technology (CPT), has enabled rapid acquisition of genomic information. Here we report an analogous technique for the detection of an activated transcription factor, a transcription element-binding assay with fluorescent amplification by apurinic/apyrimidinic (AP) site lysis cycle (TEFAL). This simple amplification assay can detect activated transcription factors by using a unique nucleic acid probe containing a consensus binding sequence and an AP site, which enables the CPT reaction with AP endonuclease. In this article, we demonstrate that this method detects the functional CLOCK/BMAL1 heterodimer via the TEFAL probe containing the E-box consensus sequence to which the CLOCK/BMAL1 heterodimer binds. Using TEFAL combined with immunoassays, we measured oscillations in the amount of CLOCK/BMAL1 heterodimer in serum-stimulated HeLa cells. Furthermore, we succeeded in measuring the circadian accumulation of the functional CLOCK/BMAL1 heterodimer in human buccal mucosa cells. TEFAL contributes greatly to the study of transcription factor activation in mammalian tissues and cell extracts and is a powerful tool for less invasive investigation of human circadian rhythms. 2010 Elsevier Inc. All rights reserved.
Double layer zinc-UDP coordination polymers: structure and properties.
Qiu, Qi-Ming; Gu, Leilei; Ma, Hongwei; Yan, Li; Liu, Minghua; Li, Hui
2018-05-17
A homochiral Zn-UDP coordination polymer with an alternating parallel ABAB sequence was constructed and studied by X-ray single crystal diffraction analysis. Its crystal structure shows that there are potentially open sites in the 2D layers. The activation of the sites makes the coordination polymer a fluorescent sensor for novel heterogeneous detection of amino acids.
Acetylation of the RhoA GEF Net1A controls its subcellular localization and activity
Song, Eun Hyeon; Oh, Wonkyung; Ulu, Arzu; Carr, Heather S.; Zuo, Yan; Frost, Jeffrey A.
2015-01-01
ABSTRACT Net1 isoform A (Net1A) is a RhoA GEF that is required for cell motility and invasion in multiple cancers. Nuclear localization of Net1A negatively regulates its activity, and we have recently shown that Rac1 stimulates Net1A relocalization to the plasma membrane to promote RhoA activation and cytoskeletal reorganization. However, mechanisms controlling the subcellular localization of Net1A are not well understood. Here, we show that Net1A contains two nuclear localization signal (NLS) sequences within its N-terminus and that residues surrounding the second NLS sequence are acetylated. Treatment of cells with deacetylase inhibitors or expression of active Rac1 promotes Net1A acetylation. Deacetylase inhibition is sufficient for Net1A relocalization outside the nucleus, and replacement of the N-terminal acetylation sites with arginine residues prevents cytoplasmic accumulation of Net1A caused by deacetylase inhibition or EGF stimulation. By contrast, replacement of these sites with glutamine residues is sufficient for Net1A relocalization, RhoA activation and downstream signaling. Moreover, the N-terminal acetylation sites are required for rescue of F-actin accumulation and focal adhesion maturation in Net1 knockout MEFs. These data indicate that Net1A acetylation regulates its subcellular localization to impact on RhoA activity and actin cytoskeletal organization. PMID:25588829
Efficient activation of transcription in yeast by the BPV1 E2 protein.
Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M
1989-01-01
The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584
Fine-tuning the onset of myogenesis by homeobox proteins that interact with the Myf5 limb enhancer
Daubas, Philippe; Duval, Nathalie; Bajard, Lola; Langa Vives, Francina; Robert, Benoît; Mankoo, Baljinder S.; Buckingham, Margaret
2015-01-01
ABSTRACT Skeletal myogenesis in vertebrates is initiated at different sites of skeletal muscle formation during development, by activation of specific control elements of the myogenic regulatory genes. In the mouse embryo, Myf5 is the first myogenic determination gene to be expressed and its spatiotemporal regulation requires multiple enhancer sequences, extending over 120 kb upstream of the Mrf4-Myf5 locus. An enhancer, located at −57/−58 kb from Myf5, is responsible for its activation in myogenic cells derived from the hypaxial domain of the somite, that will form limb muscles. Pax3 and Six1/4 transcription factors are essential activators of this enhancer, acting on a 145-bp core element. Myogenic progenitor cells that will form the future muscle masses of the limbs express the factors necessary for Myf5 activation when they delaminate from the hypaxial dermomyotome and migrate into the forelimb bud, however they do not activate Myf5 and the myogenic programme until they have populated the prospective muscle masses. We show that Msx1 and Meox2 homeodomain-containing transcription factors bind in vitro and in vivo to specific sites in the 145-bp element, and are implicated in fine-tuning activation of Myf5 in the forelimb. Msx1, when bound between Pax and Six sites, prevents the binding of these key activators, thus inhibiting transcription of Myf5 and consequent premature myogenic differentiation. Meox2 is required for Myf5 activation at the onset of myogenesis via direct binding to other homeodomain sites in this sequence. Thus, these homeodomain factors, acting in addition to Pax3 and Six1/4, fine-tune the entry of progenitor cells into myogenesis at early stages of forelimb development. PMID:26538636
Identification of the promoter of the myelomonocytic leukocyte integrin CD11b.
Hickstein, D D; Baker, D M; Gollahon, K A; Back, A L
1992-01-01
The CD11b (or macrophage-1 antigen; MAC-1) subunit of the leukocyte integrin family forms a noncovalently associated heterodimeric structure with the CD18 (beta) subunit on the surface of human granulocytes and monocyte/macrophages, where it enables these myeloid cells to participate in a variety of adherence-related activities. Expression of the CD11b subunit is restricted to cells of the myelomonocytic lineage and depends upon the stage of differentiation with the most mature myeloid cells expressing the highest levels of CD11b. To study the regulation of CD11b expression, a genomic clone corresponding to the 5' region of the CD11b gene was isolated from a human chromosome 16 library. Primer extension and RNase protection assays identified two major transcriptional start sites, located 90 base pairs and 54 base pairs upstream from the initiation methionine. DNA sequence analysis of 1.7 kilobases of the 5' flanking sequence of the CD11b gene indicated the absence of a "CAAT" or "TATA" box; however, potential binding sites for the transcription activators Sp1, PU.1, ets, and AP-2 are present, as well as retinoic acid response elements. The 1.7-kilobase CD11b promoter sequence displayed functional activity in transient transfection assays in the monocytic cell line THP-1 and the myeloid cell line HL-60. In contrast, this 1.7-kilobase promoter sequence did not display functional activity in the Jurkat T-lymphoid cell line. Detailed characterization of the CD11b promoter sequence should provide insight into the molecular events regulating the tissue-specific and developmental stage-specific expression of the CD11b molecule in myelomonocytic cells. Images PMID:1347945
Karim, Kazi Muhammad Rezaul; Husaini, Ahmad; Sing, Ngieng Ngui; Sinang, Fazia Mohd; Roslan, Hairul Azman; Hussain, Hasnain
2018-04-01
In this study, an alpha-amylase enzyme from a locally isolated Aspergillus flavus NSH9 was purified and characterized. The extracellular α-amylase was purified by ammonium sulfate precipitation and anion-exchange chromatography at a final yield of 2.55-fold and recovery of 11.73%. The molecular mass of the purified α-amylase was estimated to be 54 kDa using SDS-PAGE and the enzyme exhibited optimal catalytic activity at pH 5.0 and temperature of 50 °C. The enzyme was also thermally stable at 50 °C, with 87% residual activity after 60 min. As a metalloenzymes containing calcium, the purified α-amylase showed significantly increased enzyme activity in the presence of Ca 2+ ions. Further gene isolation and characterization shows that the α-amylase gene of A. flavus NSH9 contained eight introns and an open reading frame that encodes for 499 amino acids with the first 21 amino acids presumed to be a signal peptide. Analysis of the deduced peptide sequence showed the presence of three conserved catalytic residues of α-amylase, two Ca 2+ -binding sites, seven conserved peptide sequences, and several other properties that indicates the protein belongs to glycosyl hydrolase family 13 capable of acting on α-1,4-bonds only. Based on sequence similarity, the deduced peptide sequence of A. flavus NSH9 α-amylase was also found to carry two potential surface/secondary-binding site (SBS) residues (Trp 237 and Tyr 409) that might be playing crucial roles in both the enzyme activity and also the binding of starch granules.
Dong, Xinran; Wang, Xiao; Zhang, Feng; Tian, Weidong
2016-01-01
Accelerated evolution of regulatory sequence can alter the expression pattern of target genes, and cause phenotypic changes. In this study, we used DNase I hypersensitive sites (DHSs) to annotate putative regulatory sequences in the human genome, and conducted a genome-wide analysis of the effects of accelerated evolution on regulatory sequences. Working under the assumption that local ancient repeat elements of DHSs are under neutral evolution, we discovered that ∼0.44% of DHSs are under accelerated evolution (ace-DHSs). We found that ace-DHSs tend to be more active than background DHSs, and are strongly associated with epigenetic marks of active transcription. The target genes of ace-DHSs are significantly enriched in neuron-related functions, and their expression levels are positively selected in the human brain. Thus, these lines of evidences strongly suggest that accelerated evolution on regulatory sequences plays important role in the evolution of human-specific phenotypes. PMID:27401230
Another heritage from the RNA world: self-excision of intron sequence from nuclear pre-tRNAs.
Weber, U; Beier, H; Gross, H J
1996-06-15
The intervening sequences of nuclear tRNA precursors are known to be excised by tRNA splicing endonuclease. We show here that a T7 transcript corresponding to a pre-tRNA(Tyr) from Arabidopsis thaliana has a highly specific activity for autolytic intron excision. Self-cleavage occurs precisely at the authentic 3'-splice site and at the phosphodiester bond one nucleotide downstream of the authentic 5'-splice site. The reaction results in fragments with 2',3'-cyclic phosphate and 5'-OH termini. It is resistant to proteinase K and/or SDS treatment and is not inhibited by added tRNA. The self-cleavage depends on Mg2+ and is stimulated by spermine and Triton X-100. A set of sequence variants at the cleavage sites has been analysed for autolytic intron excision and, in parallel, for enzymatic in vitro splicing in wheat germ S23 extract. Single-stranded loops are a prerequisite for both reactions. Self-cleavage not only occurs at pyrimidine-A but also at U-U bonds. Since intron self-excision is only about five times slower than the enzymatic intron excision in a wheat germ S23 extract, we propose that the splicing endonuclease may function by improving the preciseness and efficiency of an inherent pre-tRNA self-cleavage activity.
NASA Astrophysics Data System (ADS)
Zaidner, Yossi; Frumkin, Amos; Friesem, David; Tsatskin, Alexander; Shahack-Gross, Ruth
2016-04-01
Middle Paleolithic human occupation in the Levant (250-50 ka ago) has been recorded in roofed (cave and rockshelter) and open-air sites. Research at these different types of sites yielded different perspectives on the Middle Paleolithic human behavior and evolution. Until recently, open-air Middle Paleolithic sites in the Levant were found in three major sedimentary environments: fluvial, lake-margin and spring. Here we describe a unique depositional environment and formation processes at the recently discovered open-air site of Nesher Ramla (Israel) and discuss their contribution to understanding site formation processes in open-air sites in the Levant. The site is 8-m-thick Middle Paleolithic sequence (OSL dated to 170-80 ka) that is located in a karst sinkhole formed by gravitational deformation and sagging into underground voids. The sedimentary sequence was shaped by gravitational collapse, cyclic colluviation of soil and gravel into the depression, waterlogging, in situ pedogenesis and human occupation. Original bedding and combustion features are well-preserved in the Lower archaeological sequence, a rare occurrence in comparison to other open-air archaeological sites. This phenomenon coincides with episodes of fast sedimentation/burial, which also allowed better preservation of microscopic remains such as ash. The Upper archaeological sequence does not exhibit bedding or preservation of ash, despite presence of heat-affected lithic artifacts, which makes it similar to other open-air sites in the Levant. We suggest that rate of burial is the major factor that caused the difference between the Upper and Lower sequences. The differences in the burial rate may be connected to environmental and vegetation changes at the end of MIS 6. We also identified an interplay between sediment in-wash and density of human activity remains, i.e. during episodes of low natural sediment input the density of artifacts is higher relative to episodes with high rate of sediment in-wash. The detailed analysis of natural and anthropogenic processes at Nesher Ramla suggests a much wider spectrum of processes than previously reported for southern Levantine Paleolithic sites. Nesher Ramla shares certain depositional and post-depositional characteristics with both cave and open-air sites and provides a better insight into processes which control both types of sites.
Oyola-Robles, Delise; Gay, Darren C; Trujillo, Uldaeliz; Sánchez-Parés, John M; Bermúdez, Mei-Ling; Rivera-Díaz, Mónica; Carballeira, Néstor M; Baerga-Ortiz, Abel
2013-07-01
Polyunsaturated fatty acids (PUFAs) are made in some strains of deep-sea bacteria by multidomain proteins that catalyze condensation, ketoreduction, dehydration, and enoyl-reduction. In this work, we have used the Udwary-Merski Algorithm sequence analysis tool to define the boundaries that enclose the dehydratase (DH) domains in a PUFA multienzyme. Sequence analysis revealed the presence of four areas of high structure in a region that was previously thought to contain only two DH domains as defined by FabA-homology. The expression of the protein fragment containing all four protein domains resulted in an active enzyme, while shorter protein fragments were not soluble. The tetradomain fragment was capable of catalyzing the conversion of crotonyl-CoA to β-hydroxybutyryl-CoA efficiently, as shown by UV absorbance change as well as by chromatographic retention of reaction products. Sequence alignments showed that the two novel domains contain as much sequence conservation as the FabA-homology domains, suggesting that they too may play a functional role in the overall reaction. Structure predictions revealed that all domains belong to the hotdog protein family: two of them contain the active site His70 residue present in FabA-like DHs, while the remaining two do not. Replacing the active site His residues in both FabA domains for Ala abolished the activity of the tetradomain fragment, indicating that the DH activity is contained within the FabA-homology regions. Taken together, these results provide a first glimpse into a rare arrangement of DH domains which constitute a defining feature of the PUFA synthases. Copyright © 2013 The Protein Society.
Wu, Yushu; Wang, Lei; Jiang, Wei
2017-03-15
Sensitive detection of uracil-DNA glycosylase (UDG) activity is beneficial for evaluating the repairing process of DNA lesions. Here, toehold-mediated strand displacement reaction (TSDR)-dependent fluorescent strategy was constructed for sensitive detection of UDG activity. A single-stranded DNA (ssDNA) probe with two uracil bases and a trigger sequence were designed. A hairpin probe with toehold domain was designed, and a reporter probe was also designed. Under the action of UDG, two uracil bases were removed from ssDNA probe, generating apurinic/apyrimidinic (AP) sites. Then, the AP sites could inhibit the TSDR between ssDNA probe and hairpin probe, leaving the trigger sequence in ssDNA probe still free. Subsequently, the trigger sequence was annealed with the reporter probe, initiating the polymerization and nicking amplification reaction. As a result, numerous G-quadruplex (G4) structures were formed, which could bind with N-methyl-mesoporphyrin IX (NMM) to generate enhanced fluorescent signal. In the absence of UDG, the ssDNA probe could hybridize with the toehold domain of the hairpin probe to initiate TSDR, blocking the trigger sequence, and then the subsequent amplification reaction would not occur. The proposed strategy was successfully implemented for detecting UDG activity with a detection limit of 2.7×10 -5 U/mL. Moreover, the strategy could distinguish UDG well from other interference enzymes. Furthermore, the strategy was also applied for detecting UDG activity in HeLa cells lysate with low effect of cellular components. These results indicated that the proposed strategy offered a promising tool for sensitive quantification of UDG activity in UDG-related function study and disease prognosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Oyola-Robles, Delise; Gay, Darren C; Trujillo, Uldaeliz; Sánchez-Parés, John M; Bermúdez, Mei-Ling; Rivera-Díaz, Mónica; Carballeira, Néstor M; Baerga-Ortiz, Abel
2013-01-01
Polyunsaturated fatty acids (PUFAs) are made in some strains of deep-sea bacteria by multidomain proteins that catalyze condensation, ketoreduction, dehydration, and enoyl-reduction. In this work, we have used the Udwary-Merski Algorithm sequence analysis tool to define the boundaries that enclose the dehydratase (DH) domains in a PUFA multienzyme. Sequence analysis revealed the presence of four areas of high structure in a region that was previously thought to contain only two DH domains as defined by FabA-homology. The expression of the protein fragment containing all four protein domains resulted in an active enzyme, while shorter protein fragments were not soluble. The tetradomain fragment was capable of catalyzing the conversion of crotonyl-CoA to β-hydroxybutyryl-CoA efficiently, as shown by UV absorbance change as well as by chromatographic retention of reaction products. Sequence alignments showed that the two novel domains contain as much sequence conservation as the FabA-homology domains, suggesting that they too may play a functional role in the overall reaction. Structure predictions revealed that all domains belong to the hotdog protein family: two of them contain the active site His70 residue present in FabA-like DHs, while the remaining two do not. Replacing the active site His residues in both FabA domains for Ala abolished the activity of the tetradomain fragment, indicating that the DH activity is contained within the FabA-homology regions. Taken together, these results provide a first glimpse into a rare arrangement of DH domains which constitute a defining feature of the PUFA synthases. PMID:23696301
Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.
Pietrowski, D; Förster, M
2000-01-01
The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Storrs, Richard Wood
1992-08-01
Catalytic immunoglobin fragments were studied Nuclear Magnetic Resonance spectroscopy to identify amino acid residues responsible for the catalytic activity. Small, hybrid sequence peptides were analyzed for helix propagation following covalent initiation and for activity related to the protein from which the helical sequence was derived. Hydrolysis of p-nitrophenyl carbonates and esters by specific immunoglobins is thought to involve charge complementarity. The pK of the transition state analog P-nitrophenyl phosphate bound to the immunoglobin fragment was determined by 31P-NMR to verify the juxtaposition of a positively charged amino acid to the binding/catalytic site. Optical studies of immunoglobin mediated photoreversal of cis,more » syn cyclobutane thymine dimers implicated tryptophan as the photosensitizing chromophore. Research shows the chemical environment of a single tryptophan residue is altered upon binding of the thymine dimer. This tryptophan residue was localized to within 20 Å of the binding site through the use of a nitroxide paramagnetic species covalently attached to the thymine dimer. A hybrid sequence peptide was synthesized based on the bee venom peptide apamin in which the helical residues of apamin were replaced with those from the recognition helix of the bacteriophage 434 repressor protein. Oxidation of the disufide bonds occured uniformly in the proper 1-11, 3-15 orientation, stabilizing the 434 sequence in an α-helix. The glycine residue stopped helix propagation. Helix propagation in 2,2,2-trifluoroethanol mixtures was investigated in a second hybrid sequence peptide using the apamin-derived disulfide scaffold and the S-peptide sequence. The helix-stop signal previously observed was not observed in the NMR NOESY spectrum. Helical connectivities were seen throughout the S-peptide sequence. The apamin/S-peptide hybrid binded to the S-protein (residues 21-166 of ribonuclease A) and reconstituted enzymatic activity.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Storrs, R.W.
1992-08-01
Catalytic immunoglobin fragments were studied Nuclear Magnetic Resonance spectroscopy to identify amino acid residues responsible for the catalytic activity. Small, hybrid sequence peptides were analyzed for helix propagation following covalent initiation and for activity related to the protein from which the helical sequence was derived. Hydrolysis of p-nitrophenyl carbonates and esters by specific immunoglobins is thought to involve charge complementarity. The pK of the transition state analog P-nitrophenyl phosphate bound to the immunoglobin fragment was determined by [sup 31]P-NMR to verify the juxtaposition of a positively charged amino acid to the binding/catalytic site. Optical studies of immunoglobin mediated photoreversal ofmore » cis, syn cyclobutane thymine dimers implicated tryptophan as the photosensitizing chromophore. Research shows the chemical environment of a single tryptophan residue is altered upon binding of the thymine dimer. This tryptophan residue was localized to within 20 [Angstrom] of the binding site through the use of a nitroxide paramagnetic species covalently attached to the thymine dimer. A hybrid sequence peptide was synthesized based on the bee venom peptide apamin in which the helical residues of apamin were replaced with those from the recognition helix of the bacteriophage 434 repressor protein. Oxidation of the disufide bonds occured uniformly in the proper 1-11, 3-15 orientation, stabilizing the 434 sequence in an [alpha]-helix. The glycine residue stopped helix propagation. Helix propagation in 2,2,2-trifluoroethanol mixtures was investigated in a second hybrid sequence peptide using the apamin-derived disulfide scaffold and the S-peptide sequence. The helix-stop signal previously observed was not observed in the NMR NOESY spectrum. Helical connectivities were seen throughout the S-peptide sequence. The apamin/S-peptide hybrid binded to the S-protein (residues 21-166 of ribonuclease A) and reconstituted enzymatic activity.« less
Karin, Michael; Hibi, Masahiko; Lin, Anning
1997-01-01
An isolated polypeptide (JNK) characterized by having a molecular weight of 46kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.
Oncoprotein protein kinase antibody kit
Karin, Michael [San Diego, CA; Hibi, Masahiko [San Diego, CA; Lin, Anning [La Jolla, CA
2008-12-23
An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.
Karin, Michael; Hibi, Masahiko; Lin, Anning; Davis, Roger; Derijard, Benoit
2003-02-04
An isolated polypeptide (JNK) characterized by having a molecular weight of 46kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.
Karin, Michael; Hibi, Masahiko; Lin, Anning
1997-01-01
An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.
Karin, Michael; Hibi, Masahiko; Lin, Anning
1998-01-01
An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.
Langin, D; Laurell, H; Holst, L S; Belfrage, P; Holm, C
1993-01-01
The human hormone-sensitive lipase (HSL) gene encodes a 786-aa polypeptide (85.5 kDa). It is composed of nine exons spanning approximately 11 kb, with exons 2-5 clustered in a 1.1-kb region. The putative catalytic site (Ser423) and a possible lipid-binding region in the C-terminal part are encoded by exons 6 and 9, respectively. Exon 8 encodes the phosphorylation site (Ser551) that controls cAMP-mediated activity and a second site (Ser553) that is phosphorylated by 5'-AMP-activated protein kinase. Human HSL showed 83% identity with the rat enzyme and contained a 12-aa deletion immediately upstream of the phosphorylation sites with an unknown effect on the activity control. Besides the catalytic site motif (Gly-Xaa-Ser-Xaa-Gly) found in most lipases, HSL shows no homology with other known lipases or proteins, except for a recently reported unexpected homology between the region surrounding its catalytic site and that of the lipase 2 of Moraxella TA144, an antarctic psychrotrophic bacterium. The gene of lipase 2, which catalyses lipolysis below 4 degrees C, was absent in the genomic DNA of five other Moraxella strains living at 37 degrees C. The lipase 2-like sequence in HSL may reflect an evolutionarily conserved cold adaptability that might be of critical survival value when low-temperature-mobilized endogenous lipids are the primary energy source (e.g., in poikilotherms or hibernators). The finding that HSL at 10 degrees C retained 3- to 5-fold more of its 37 degrees C catalytic activity than lipoprotein lipase or carboxyl ester lipase is consistent with this hypothesis. Images Fig. 5 PMID:8506334
Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.
Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S
2015-12-01
Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.
Kerovuo, Janne; Lauraeus, Marko; Nurminen, Päivi; Kalkkinen, Nisse; Apajalahti, Juha
1998-01-01
The Bacillus subtilis strain VTT E-68013 was chosen for purification and characterization of its excreted phytase. Purified enzyme had maximal phytase activity at pH 7 and 55°C. Isolated enzyme required calcium for its activity and/or stability and was readily inhibited by EDTA. The enzyme proved to be highly specific since, of the substrates tested, only phytate, ADP, and ATP were hydrolyzed (100, 75, and 50% of the relative activity, respectively). The phytase gene (phyC) was cloned from the B. subtilis VTT E-68013 genomic library. The deduced amino acid sequence (383 residues) showed no homology to the sequences of other phytases nor to those of any known phosphatases. PhyC did not have the conserved RHGXRXP sequence found in the active site of known phytases, and therefore PhyC appears not to be a member of the phytase subfamily of histidine acid phosphatases but a novel enzyme having phytase activity. Due to its pH profile and optimum, it could be an interesting candidate for feed applications. PMID:9603817
Increasing the structural coverage of tuberculosis drug targets.
Baugh, Loren; Phan, Isabelle; Begley, Darren W; Clifton, Matthew C; Armour, Brianna; Dranow, David M; Taylor, Brandy M; Muruthi, Marvin M; Abendroth, Jan; Fairman, James W; Fox, David; Dieterich, Shellie H; Staker, Bart L; Gardberg, Anna S; Choi, Ryan; Hewitt, Stephen N; Napuli, Alberto J; Myers, Janette; Barrett, Lynn K; Zhang, Yang; Ferrell, Micah; Mundt, Elizabeth; Thompkins, Katie; Tran, Ngoc; Lyons-Abbott, Sally; Abramov, Ariel; Sekar, Aarthi; Serbzhinskiy, Dmitri; Lorimer, Don; Buchko, Garry W; Stacy, Robin; Stewart, Lance J; Edwards, Thomas E; Van Voorhis, Wesley C; Myler, Peter J
2015-03-01
High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus "homolog-rescue" strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. Of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structures would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PSAPF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases. Copyright © 2014 Elsevier Ltd. All rights reserved.
Increasing the structural coverage of tuberculosis drug targets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baugh, Loren; Phan, Isabelle; Begley, Darren W.
High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. We found that of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structuresmore » would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PS APF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases.« less
Increasing the structural coverage of tuberculosis drug targets
Baugh, Loren; Phan, Isabelle; Begley, Darren W.; ...
2014-12-19
High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. We found that of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structuresmore » would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1 Å, >85% side chain identity, and ≥80% PS APF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases.« less
Increasing the Structural Coverage of Tuberculosis Drug Targets
Baugh, Loren; Phan, Isabelle; Begley, Darren W.; Clifton, Matthew C.; Armour, Brianna; Dranow, David M.; Taylor, Brandy M.; Muruthi, Marvin M.; Abendroth, Jan; Fairman, James W.; Fox, David; Dieterich, Shellie H.; Staker, Bart L.; Gardberg, Anna S.; Choi, Ryan; Hewitt, Stephen N.; Napuli, Alberto J.; Myers, Janette; Barrett, Lynn K.; Zhang, Yang; Ferrell, Micah; Mundt, Elizabeth; Thompkins, Katie; Tran, Ngoc; Lyons-Abbott, Sally; Abramov, Ariel; Sekar, Aarthi; Serbzhinskiy, Dmitri; Lorimer, Don; Buchko, Garry W.; Stacy, Robin; Stewart, Lance J.; Edwards, Thomas E.; Van Voorhis, Wesley C.; Myler, Peter J.
2015-01-01
High-resolution three-dimensional structures of essential Mycobacterium tuberculosis (Mtb) proteins provide templates for TB drug design, but are available for only a small fraction of the Mtb proteome. Here we evaluate an intra-genus “homolog-rescue” strategy to increase the structural information available for TB drug discovery by using mycobacterial homologs with conserved active sites. Of 179 potential TB drug targets selected for x-ray structure determination, only 16 yielded a crystal structure. By adding 1675 homologs from nine other mycobacterial species to the pipeline, structures representing an additional 52 otherwise intractable targets were solved. To determine whether these homolog structures would be useful surrogates in TB drug design, we compared the active sites of 106 pairs of Mtb and non-TB mycobacterial (NTM) enzyme homologs with experimentally determined structures, using three metrics of active site similarity, including superposition of continuous pharmacophoric property distributions. Pair-wise structural comparisons revealed that 19/22 pairs with >55% overall sequence identity had active site Cα RMSD <1Å, >85% side chain identity, and ≥80% PSAPF (similarity based on pharmacophoric properties) indicating highly conserved active site shape and chemistry. Applying these results to the 52 NTM structures described above, 41 shared >55% sequence identity with the Mtb target, thus increasing the effective structural coverage of the 179 Mtb targets over three-fold (from 9% to 32%). The utility of these structures in TB drug design can be tested by designing inhibitors using the homolog structure and assaying the cognate Mtb enzyme; a promising test case, Mtb cytidylate kinase, is described. The homolog-rescue strategy evaluated here for TB is also generalizable to drug targets for other diseases. PMID:25613812
Overlapping activation-induced cytidine deaminase hotspot motifs in Ig class-switch recombination
Han, Li; Masani, Shahnaz; Yu, Kefei
2011-01-01
Ig class-switch recombination (CSR) is directed by the long and repetitive switch regions and requires activation-induced cytidine deaminase (AID). One of the conserved switch-region sequence motifs (AGCT) is a preferred site for AID-mediated DNA-cytosine deamination. By using somatic gene targeting and recombinase-mediated cassette exchange, we established a cell line-based CSR assay that allows manipulation of switch sequences at the endogenous locus. We show that AGCT is only one of a family of four WGCW motifs in the switch region that can facilitate CSR. We go on to show that it is the overlap of AID hotspots at WGCW sites on the top and bottom strands that is critical. This finding leads to a much clearer model for the difference between CSR and somatic hypermutation. PMID:21709240
Identification of novel antibody-reactive detection sites for comprehensive gluten monitoring.
Röckendorf, Niels; Meckelein, Barbara; Scherf, Katharina A; Schalk, Kathrin; Koehler, Peter; Frey, Andreas
2017-01-01
Certain cereals like wheat, rye or barley contain gluten, a protein mixture that can trigger celiac disease (CD). To make gluten-free diets available for affected individuals the gluten content of foodstuff must be monitored. For this purpose, antibody-based assays exist which rely on the recognition of certain linear gluten sequence motifs. Yet, not all CD-active gluten constituents and fragments formed during food processing/fermentation may be covered by those tests. In this study, we therefore assayed the coverage of reportedly CD-active gluten components by currently available detection antibodies and determined the antibody-inducing capacity of wheat gluten constituents in order to provide novel diagnostic targets for comprehensive gluten quantitation. Immunizations of outbred mice with purified gliadins and glutenins were conducted and the linear target recognition profile of the sera was recorded using synthetic peptide arrays that covered the sequence space of gluten constituents present in those preparations. The resulting murine immunorecognition profile of gluten demonstrated that further linear binding sites beyond those recognized by the monoclonal antibodies α20, R5 and G12 exist and may be exploitable as diagnostic targets. We conclude that the safety of foodstuffs for CD patients can be further improved by complementing current tests with antibodies directed against additional CD-active gluten components. Currently unrepresented linear gluten detection sites in glutenins and α-gliadins suggest sequences QQQYPS, PQQSFP, QPGQGQQG and QQPPFS as novel targets for antibody generation.
Identification of novel antibody-reactive detection sites for comprehensive gluten monitoring
Röckendorf, Niels; Meckelein, Barbara; Scherf, Katharina A.; Schalk, Kathrin; Koehler, Peter
2017-01-01
Certain cereals like wheat, rye or barley contain gluten, a protein mixture that can trigger celiac disease (CD). To make gluten-free diets available for affected individuals the gluten content of foodstuff must be monitored. For this purpose, antibody-based assays exist which rely on the recognition of certain linear gluten sequence motifs. Yet, not all CD-active gluten constituents and fragments formed during food processing/fermentation may be covered by those tests. In this study, we therefore assayed the coverage of reportedly CD-active gluten components by currently available detection antibodies and determined the antibody-inducing capacity of wheat gluten constituents in order to provide novel diagnostic targets for comprehensive gluten quantitation. Immunizations of outbred mice with purified gliadins and glutenins were conducted and the linear target recognition profile of the sera was recorded using synthetic peptide arrays that covered the sequence space of gluten constituents present in those preparations. The resulting murine immunorecognition profile of gluten demonstrated that further linear binding sites beyond those recognized by the monoclonal antibodies α20, R5 and G12 exist and may be exploitable as diagnostic targets. We conclude that the safety of foodstuffs for CD patients can be further improved by complementing current tests with antibodies directed against additional CD-active gluten components. Currently unrepresented linear gluten detection sites in glutenins and α-gliadins suggest sequences QQQYPS, PQQSFP, QPGQGQQG and QQPPFS as novel targets for antibody generation. PMID:28759621
Hu, Sarah K; Campbell, Victoria; Connell, Paige; Gellene, Alyssa G; Liu, Zhenfeng; Terrado, Ramon; Caron, David A
2016-04-01
Microbial eukaryotes fulfill key ecological positions in marine food webs. Molecular approaches that connect protistan diversity and biogeography to their diverse metabolisms will greatly improve our understanding of marine ecosystem function. The majority of molecular-based studies to date use 18S rRNA gene sequencing to characterize natural microbial assemblages, but this approach does not necessarily discriminate between active and non-active cells. We incorporated RNA sequencing into standard 18S rRNA gene sequence surveys with the purpose of assessing those members of the protistan community contributing to biogeochemical cycling (active organisms), using the ratio of cDNA (reverse transcribed from total RNA) to 18S rRNA gene sequences within major protistan taxonomic groups. Trophically important phytoplankton, such as diatoms and chlorophytes exhibited seasonal trends in relative activity. Additionally, both radiolaria and ciliates displayed previously unreported high relative activities below the euphotic zone. This study sheds new light on the relative metabolic activity of specific protistan groups and how microbial communities respond to changing environmental conditions. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts
Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.
2000-01-01
Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792
Miller, D.N.; Smith, R.L.
2009-01-01
Groundwater nitrification is a poorly characterized process affecting the speciation and transport of nitrogen. Cores from two sites in a plume of contamination were examined using culture-based and molecular techniques targeting nitrification processes. The first site, located beneath a sewage effluent infiltration bed, received treated effluent containing O2 (> 300????M) and NH4+ (51-800????M). The second site was 2.5??km down-gradient near the leading edge of the ammonium zone within the contaminant plume and featured vertical gradients of O2, NH4+, and NO3- (0-300, 0-500, and 100-200????M with depth, respectively). Ammonia- and nitrite-oxidizers enumerated by the culture-based MPN method were low in abundance at both sites (1.8 to 350??g- 1 and 33 to 35,000??g- 1, respectively). Potential nitrifying activity measured in core material in the laboratory was also very low, requiring several weeks for products to accumulate. Molecular analysis of aquifer DNA (nested PCR followed by cloning and 16S rDNA sequencing) detected primarily sequences associated with the Nitrosospira genus throughout the cores at the down-gradient site and a smaller proportion from the Nitrosomonas genus in the deeper anoxic, NH4+ zone at the down-gradient site. Only a single Nitrosospira sequence was detected beneath the infiltration bed. Furthermore, the majority of Nitrosospira-associated sequences represent an unrecognized cluster. We conclude that an uncharacterized group associated with Nitrosospira dominate at the geochemically stable, down-gradient site, but found little evidence for Betaproteobacteria nitrifiers beneath the infiltration beds where geochemical conditions were more variable.
NASA Astrophysics Data System (ADS)
Miller, Daniel N.; Smith, Richard L.
2009-01-01
Groundwater nitrification is a poorly characterized process affecting the speciation and transport of nitrogen. Cores from two sites in a plume of contamination were examined using culture-based and molecular techniques targeting nitrification processes. The first site, located beneath a sewage effluent infiltration bed, received treated effluent containing O 2 (> 300 µM) and NH 4+ (51-800 µM). The second site was 2.5 km down-gradient near the leading edge of the ammonium zone within the contaminant plume and featured vertical gradients of O 2, NH 4+, and NO 3- (0-300, 0-500, and 100-200 µM with depth, respectively). Ammonia- and nitrite-oxidizers enumerated by the culture-based MPN method were low in abundance at both sites (1.8 to 350 g - 1 and 33 to 35,000 g - 1 , respectively). Potential nitrifying activity measured in core material in the laboratory was also very low, requiring several weeks for products to accumulate. Molecular analysis of aquifer DNA (nested PCR followed by cloning and 16S rDNA sequencing) detected primarily sequences associated with the Nitrosospira genus throughout the cores at the down-gradient site and a smaller proportion from the Nitrosomonas genus in the deeper anoxic, NH 4+ zone at the down-gradient site. Only a single Nitrosospira sequence was detected beneath the infiltration bed. Furthermore, the majority of Nitrosospira-associated sequences represent an unrecognized cluster. We conclude that an uncharacterized group associated with Nitrosospira dominate at the geochemically stable, down-gradient site, but found little evidence for Betaproteobacteria nitrifiers beneath the infiltration beds where geochemical conditions were more variable.
Förch, Patrik; Merendino, Livia; Martínez, Concepción; Valcárcel, Juan
2003-01-01
The splicing factor U2AF(65), U2 small nuclear ribonucleoprotein particle (snRNP) auxillary factor of 65 kDa, binds to pyrimidine-rich sequences at 3' splice sites to recruit U2 snRNP to pre-mRNAs. We report that U2AF(65) can also promote the recruitment of U1 snRNP to weak 5' splice sites that are followed by uridine-rich sequences. The arginine- and serine-rich domain of U2AF(65) is critical for U1 recruitment, and we discuss the role of its RNA-RNA annealing activity in this novel function of U2AF(65). PMID:12558503
Giresi, Paul G.; Lieb, Jason D.
2009-01-01
The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047
Binding sites for interaction of peroxiredoxin 6 with surfactant protein A.
Krishnaiah, Saikumari Y; Dodia, Chandra; Sorokina, Elena M; Li, Haitao; Feinstein, Sheldon I; Fisher, Aron B
2016-04-01
Peroxiredoxin 6 (Prdx6) is a bifunctional enzyme with peroxidase and phospholipase A2 (PLA2) activities. This protein participates in the degradation and remodeling of internalized dipalmitoylphosphatidylcholine (DPPC), the major phospholipid component of lung surfactant. We have shown previously that the PLA2 activity of Prdx6 is inhibited by the lung surfactant-associated protein called surfactant protein A (SP-A) through direct protein-protein interaction. Docking of SPA and Prdx6 was modeled using the ZDOCK (zlab.bu.edu) program in order to predict molecular sites for binding of the two proteins. The predicted peptide sequences were evaluated for binding to the opposite protein using isothermal titration calorimetry and circular dichroism measurement followed by determination of the effect of the SP-A peptide on the PLA2 activity of Prdx6. The sequences 195EEEAKKLFPK204.in the Prdx6 helix and 83DEELQTELYEIKHQIL99 in SP-A were identified as the sites for hydrophobic interaction and H(+)-bonding between the 2 proteins. Treatment of mouse endothelial cells with the SP-A peptide inhibited their recovery from lipid peroxidation associated with oxidative stress indicating inhibition of Prdx6 activity by the peptide in the intact cell. Copyright © 2015 Elsevier B.V. All rights reserved.
Engineering synthetic TAL effectors with orthogonal target sites
Garg, Abhishek; Lohmueller, Jason J.; Silver, Pamela A.; Armel, Thomas Z.
2012-01-01
The ability to engineer biological circuits that process and respond to complex cellular signals has the potential to impact many areas of biology and medicine. Transcriptional activator-like effectors (TALEs) have emerged as an attractive component for engineering these circuits, as TALEs can be designed de novo to target a given DNA sequence. Currently, however, the use of TALEs is limited by degeneracy in the site-specific manner by which they recognize DNA. Here, we propose an algorithm to computationally address this problem. We apply our algorithm to design 180 TALEs targeting 20 bp cognate binding sites that are at least 3 nt mismatches away from all 20 bp sequences in putative 2 kb human promoter regions. We generated eight of these synthetic TALE activators and showed that each is able to activate transcription from a targeted reporter. Importantly, we show that these proteins do not activate synthetic reporters containing mismatches similar to those present in the genome nor a set of endogenous genes predicted to be the most likely targets in vivo. Finally, we generated and characterized TALE repressors comprised of our orthogonal DNA binding domains and further combined them with shRNAs to accomplish near complete repression of target gene expression. PMID:22581776
Li, Yan; Loh, Ying Ru; Hung, Alvin W; Kang, CongBao
2018-06-21
Zika virus (ZIKV) protease is a two-component complex in which NS3 contains the catalytic triad and NS2B cofactor region is important for protease folding and activity. A protease construct-eZiPro without the transmembrane domains of NS2B was designed. Structural study on eZiPro reveals that the Thr-Gly-Lys-Arg (TGKR) sequence at the C-terminus of NS2B binds to the active site after cleavage. The bZiPro construct only contains NS2B cofactor region and the N-terminus of NS3 without any artificial linker or protease cleavage site, giving rise to an empty pocket accessible to substrate and inhibitor binding. Herein, we demonstrate that the TGKR sequence of NS2B in eZiPro is dynamic. Peptides from NS2B with various lengths exhibit different binding affinities to bZiPro. TGKR binding to the active site in eZiPro does not affect protease binding to small-molecule compounds. Our results suggest that eZiPro will also be useful for evaluating small-molecule protease inhibitors. Copyright © 2018 Elsevier Inc. All rights reserved.
Gordon, Gina C.; Cameron, Jeffrey C.; Pfleger, Brian F.
2017-03-28
Ribonucleases facilitate rapid turnover of RNA, providing cells with another mechanism to adjust transcript and protein levels in response to environmental conditions. While many examples have been documented, a comprehensive list of RNase targets is not available. To address this knowledge gap, we compared levels of RNA sequencing coverage of Escherichia coli and a corresponding RNase III mutant to expand the list of known RNase III targets. RNase III is a widespread endoribonuclease that binds and cleaves double-stranded RNA in many critical transcripts. RNase III cleavage at novel sites found in aceEF, proP, tnaC, dctA, pheM, sdhC, yhhQ, glpT, aceK,more » and gluQ accelerated RNA decay, consistent with previously described targets wherein RNase III cleavage initiates rapid degradation of secondary messages by other RNases. In contrast, cleavage at three novel sites in the ahpF, pflB, and yajQ transcripts led to stabilized secondary transcripts. Two other novel sites in hisL and pheM overlapped with transcriptional attenuators that likely serve to ensure turnover of these highly structured RNAs. Many of the new RNase III target sites are located on transcripts encoding metabolic enzymes. For instance, two novel RNase III sites are located within transcripts encoding enzymes near a key metabolic node connecting glycolysis and the tricarboxylic acid (TCA) cycle. Pyruvate dehydrogenase activity was increased in an rnc deletion mutant compared to the wild-type (WT) strain in early stationary phase, confirming the novel link between RNA turnover and regulation of pathway activity. Identification of these novel sites suggests that mRNA turnover may be an underappreciated mode of regulating metabolism. IMPORTANCE: The concerted action and overlapping functions of endoribonucleases, exoribonucleases, and RNA processing enzymes complicate the study of global RNA turnover and recycling of specific transcripts. More information about RNase specificity and activity is needed to make predictions of transcript half-life and to design synthetic transcripts with optimal stability. RNase III does not have a conserved target sequence but instead recognizes RNA secondary structure. Prior to this study, only a few RNase III target sites in E. coli were known, so we used RNA sequencing to provide a more comprehensive list of cleavage sites and to examine the impact of RNase III on transcript degradation. Finally, with this added information on how RNase III participates in transcript regulation and recycling, a more complete picture of RNA turnover can be developed for E. coli. Similar approaches could be used to augment our understanding of RNA turnover in other bacteria.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gordon, Gina C.; Cameron, Jeffrey C.; Pfleger, Brian F.
Ribonucleases facilitate rapid turnover of RNA, providing cells with another mechanism to adjust transcript and protein levels in response to environmental conditions. While many examples have been documented, a comprehensive list of RNase targets is not available. To address this knowledge gap, we compared levels of RNA sequencing coverage of Escherichia coli and a corresponding RNase III mutant to expand the list of known RNase III targets. RNase III is a widespread endoribonuclease that binds and cleaves double-stranded RNA in many critical transcripts. RNase III cleavage at novel sites found in aceEF, proP, tnaC, dctA, pheM, sdhC, yhhQ, glpT, aceK,more » and gluQ accelerated RNA decay, consistent with previously described targets wherein RNase III cleavage initiates rapid degradation of secondary messages by other RNases. In contrast, cleavage at three novel sites in the ahpF, pflB, and yajQ transcripts led to stabilized secondary transcripts. Two other novel sites in hisL and pheM overlapped with transcriptional attenuators that likely serve to ensure turnover of these highly structured RNAs. Many of the new RNase III target sites are located on transcripts encoding metabolic enzymes. For instance, two novel RNase III sites are located within transcripts encoding enzymes near a key metabolic node connecting glycolysis and the tricarboxylic acid (TCA) cycle. Pyruvate dehydrogenase activity was increased in an rnc deletion mutant compared to the wild-type (WT) strain in early stationary phase, confirming the novel link between RNA turnover and regulation of pathway activity. Identification of these novel sites suggests that mRNA turnover may be an underappreciated mode of regulating metabolism. IMPORTANCE: The concerted action and overlapping functions of endoribonucleases, exoribonucleases, and RNA processing enzymes complicate the study of global RNA turnover and recycling of specific transcripts. More information about RNase specificity and activity is needed to make predictions of transcript half-life and to design synthetic transcripts with optimal stability. RNase III does not have a conserved target sequence but instead recognizes RNA secondary structure. Prior to this study, only a few RNase III target sites in E. coli were known, so we used RNA sequencing to provide a more comprehensive list of cleavage sites and to examine the impact of RNase III on transcript degradation. Finally, with this added information on how RNase III participates in transcript regulation and recycling, a more complete picture of RNA turnover can be developed for E. coli. Similar approaches could be used to augment our understanding of RNA turnover in other bacteria.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hou, Xiaomin; Meehan, Edward J.; Xie, Jieming
2008-10-27
A novel type 1 ribosome-inactivating protein (RIP) designated cucurmosin was isolated from the sarcocarp of Cucurbita moschata (pumpkin). Besides rRNA N-glycosidase activity, cucurmosin exhibits strong cytotoxicities to three cancer cell lines of both human and murine origins, but low toxicity to normal cells. Plant genomic DNA extracted from the tender leaves was amplified by PCR between primers based on the N-terminal sequence and X-ray sequence of the C-terminal. The complete mature protein sequence was obtained from N-terminal protein sequencing and partial DNA sequencing, confirmed by high resolution crystal structure analysis. The crystal structure of cucurmosin has been determined at 1.04more » {angstrom}, a resolution that has never been achieved before for any RIP. The structure contains two domains: a large N-terminal domain composed of seven {alpha}-helices and eight {beta}-strands, and a smaller C-terminal domain consisting of three {alpha}-helices and two {beta}-strands. The high resolution structure established a glycosylation pattern of GlcNAc{sub 2}Man3Xyl. Asn225 was identified as a glycosylation site. Residues Tyr70, Tyr109, Glu158 and Arg161 define the active site of cucurmosin as an RNA N-glycosidase. The structural basis of cytotoxicity difference between cucurmosin and trichosanthin is discussed.« less
c-rel activates but v-rel suppresses transcription from kappa B sites.
Inoue, J; Kerr, L D; Ransone, L J; Bengal, E; Hunter, T; Verma, I M
1991-01-01
We show that the product of the protooncogene c-rel is a constituent of an NF-kappa B-like complex that binds to the kappa B site originally identified in the enhancer of immunoglobulin kappa light chain gene. c-rel protein synthesized in bacteria binds to the kappa B site in a sequence-specific manner. The rel-kappa B complex can be disrupted by incubation with anti-rel antibodies. The rel protein can form oligomers. The c-rel protein can activate transcription from promoters containing kappa B sites; v-rel, on the other hand, suppresses the transcription of genes linked to kappa B sites. Thus, v-rel may interfere with the normal transcriptional machinery of the cell by acting as a dominant negative mutant. Images PMID:2023921
Hook, Gregory; Hook, Vivian; Kindy, Mark
2015-01-01
The cysteine protease cathepsin B is a potential drug target for reducing brain amyloid-β peptides (Aβ) and improving memory in Alzheimer’s disease (AD), because reduction of cathepsin B in transgenic mice expressing human wild-type amyloid-β protein precursor (AβPP) results in significantly decreased brain Aβ. Cathepsin B cleaves the wild-type β-secretase site sequence in AβPP to produce Aβ and cathepsin B inhibitors administered to animal models expressing AβPP containing the wild-type β-secretase site sequence reduce brain Aβ in a manner consistent with β-secretase inhibition. But such inhibitors could act either by direct inhibition of cathepsin B β-secretase activity or by off-target inhibition of the other β-secretase, the aspartyl protease BACE1. To evaluate that issue, we orally administered a cysteine protease inhibitor, E64d, to normal guinea pigs or transgenic mice expressing human AβPP, both of which express the human wild-type β-secretase site sequence. In guinea pigs, oral E64d administration caused a dose-dependent reduction of up to 92% in brain, CSF and plasma of Aβ(40) and Aβ(42), a reduction of up to 50% in the C-terminal β-secretase fragment (CTFβ), and a 91% reduction in brain cathepsin B activity but increased brain BACE1 activity by 20%. In transgenic AD mice, oral E64d administration improved memory deficits and reduced brain Aβ(40) and Aβ(42), amyloid plaque, brain CTFβ, and brain cathepsin B activity but increased brain BACE1 activity. We conclude that E64d likely reduces brain Aβ by inhibiting cathepsin B and not BACE1 β-secretase activity and that E64d therefore may have potential for treating AD patients. PMID:21613740
Malur, Achut G.; Gupta, Neera K.; De, Bishnu P.; Banerjee, Amiya K.
2002-01-01
The large protein (L) of the human parainfluenza virus type 3 (HPIV3) is the functional RNA-dependent RNA polymerase, which possesses highly conserved residues QGDNQ located within motif C of domain III comprising the putative polymerase active site. We have characterized the role of the QGDNQ residues as well as the residues flanking this region in the polymerase activity of the L protein by site-directed mutagenesis and examining the polymerase activity of the wild-type and mutant L proteins by an in vivo minigenome replication assay and an in vitro mRNA transcription assay. All mutations in the QGDNQ residues abolished transcription while mutations in the flanking residues gave rise to variable polymerase activities. These observations support the contention that the QGDNQ sequence is absolutely required for the polymerase activity of the HPIV3 RNA-dependent RNA polymerase. PMID:12064576
Chen, M; Hieng, S; Qian, X; Costa, R; Ou, J H
1994-11-15
Hepatitis B virus (HBV) ENI enhancer can activate the expression of HBV and non-HBV genes in a liver-specific manner. By performing the electrophoretic mobility-shift assays, we demonstrated that the three related, liver-enriched, transcription factors, HNF3 alpha, HNF3 beta, and HNF3 gamma could all bind to the 2c site of HBV ENI enhancer. Mutations introduced in the 2c site to abolish the binding by HNF3 reduced the enhancer activity approximately 15-fold. Moreover, expression of HNF3 antisense sequences to suppress the expression of HNF3 in Huh-7 hepatoma cells led to reduction of the ENI enhancer activity. These results indicate that HNF3 positively regulates the ENI enhancer activity and this regulation is most likely mediated through the 2c site. The requirement of HNF3 for the ENI enhancer activity could explain the liver specificity of this enhancer element.
Kyro, Kelly; Manandhar, Surya P.; Mullen, Daniel; Schmidt, Walter K.; Distefano, Mark D.
2012-01-01
Rce1p catalyzes the proteolytic trimming of C-terminal tripeptides from isoprenylated proteins containing CAAX-box sequences. Because Rce1p processing is a necessary component in the Ras pathway of oncogenic signal transduction, Rce1p holds promise as a potential target for therapeutic intervention. However, its mechanism of proteolysis and active site have yet to be defined. Here, we describe synthetic peptide analogues that mimic the natural lipidated Rce1p substrate and incorporate photolabile groups for photoaffinity-labeling applications. These photoactive peptides are designed to crosslink to residues in or near the Rce1p active site. By incorporating the photoactive group via p-benzoyl-L-phenylalanine (Bpa) residues directly into the peptide substrate sequence, the labeling efficiency was substantially increased relative to a previously-synthesized compound. Incorporation of biotin on the N-terminus of the peptides permitted photolabeled Rce1p to be isolated via streptavidin affinity capture. Our findings further suggest that residues outside the CAAX-box sequence are in contact with Rce1p, which has implications for future inhibitor design. PMID:22079863
Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M
2005-04-19
The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
Widespread alternative and aberrant splicing revealed by lariat sequencing
Stepankiw, Nicholas; Raghavan, Madhura; Fogarty, Elizabeth A.; Grimson, Andrew; Pleiss, Jeffrey A.
2015-01-01
Alternative splicing is an important and ancient feature of eukaryotic gene structure, the existence of which has likely facilitated eukaryotic proteome expansions. Here, we have used intron lariat sequencing to generate a comprehensive profile of splicing events in Schizosaccharomyces pombe, amongst the simplest organisms that possess mammalian-like splice site degeneracy. We reveal an unprecedented level of alternative splicing, including alternative splice site selection for over half of all annotated introns, hundreds of novel exon-skipping events, and thousands of novel introns. Moreover, the frequency of these events is far higher than previous estimates, with alternative splice sites on average activated at ∼3% the rate of canonical sites. Although a subset of alternative sites are conserved in related species, implying functional potential, the majority are not detectably conserved. Interestingly, the rate of aberrant splicing is inversely related to expression level, with lowly expressed genes more prone to erroneous splicing. Although we validate many events with RNAseq, the proportion of alternative splicing discovered with lariat sequencing is far greater, a difference we attribute to preferential decay of aberrantly spliced transcripts. Together, these data suggest the spliceosome possesses far lower fidelity than previously appreciated, highlighting the potential contributions of alternative splicing in generating novel gene structures. PMID:26261211
Rudolph, G; Bechmann, M; Berninger, T; Kutschbach, E; Held, U; Tornow, R P; Kalpadakis, P; Zol'nikova, I V; Shamshinova, A M
2001-01-01
A new method of multifocal electroretinography making use of scanning laser ophthalmoscope with a wavelength of 630 nm (SLO-m-ERG), evoking short spatial visual stimuli on the retina, is proposed. Algorithm of presenting the visual stimuli and analysis of distribution of local electroretinograms on the surface of the retina is based on short m-sequences. Mathematical cross correlation analysis shows a three-dimensional distribution of bioelectrical activity of the retina in the central visual field. In normal subjects the cone bioelectrical activity is the maximum in the macular area (corresponding to the density of cone distribution) and absent in the blind spot. The method detects the slightest pathological changes in the retina under control of the site of stimulation and ophthalmoscopic picture of the fundus oculi. The site of the pathological process correlates with the topography of changes in bioelectrical activity of the examined retinal area in diseases of the macular area and pigmented retinitis detectable by ophthalmoscopy.
GATA: A graphic alignment tool for comparative sequenceanalysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nix, David A.; Eisen, Michael B.
2005-01-01
Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collinearity assumption is often invalid. For example, enhancers contain clusters of transcription factor binding sites that change in number, orientation, and spacing during evolution yet the enhancer retains its activity. Dotplot analysis is often used to estimate non-coding sequence relatedness. Yet dotmore » plots do not actually align sequences and thus cannot account well for base insertions or deletions. Moreover, they lack an adequate statistical framework for comparing sequence relatedness and are limited to pairwise comparisons. Lastly, dot plots and dynamic programming text outputs fail to provide an intuitive means for visualizing DNA alignments.« less
Karin, M.; Hibi, M.; Lin, A.
1997-02-25
An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE is disclosed. The polypeptide has serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences. The method of detection of JNK is also provided. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites. 44 figs.
Karin, Michael; Hibi, Masahiko; Lin, Anning
2001-02-27
An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD or 55 kD as determined by reducing SDS-PAGE, having serine and theonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.
Karin, Michael; Hibi, Masahiko; Lin, Anning
1999-01-01
An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD or 55 kD as determined by reducing SDS-PAGE, having serine and theonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.
The Beads of Translation: Using Beads to Translate mRNA into a Polypeptide Bracelet
ERIC Educational Resources Information Center
Dunlap, Dacey; Patrick, Patricia
2012-01-01
During this activity, by making beaded bracelets that represent the steps of translation, students simulate the creation of an amino acid chain. They are given an mRNA sequence that they translate into a corresponding polypeptide chain (beads). This activity focuses on the events and sites of translation. The activity provides students with a…
Protospacer Adjacent Motif (PAM)-Distal Sequences Engage CRISPR Cas9 DNA Target Cleavage
Ethier, Sylvain; Schmeing, T. Martin; Dostie, Josée; Pelletier, Jerry
2014-01-01
The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5′NGG3′ protospacer adjacent motifs (PAM). Yet among 43 ChIP-seq sites harboring seed regions analyzed for mutational status, we find editing only at the intended on-target locus and one off-target site. In vitro analysis of target site recognition revealed that interactions between the 5′ end of the guide and PAM-distal target sequences are necessary to efficiently engage Cas9 nucleolytic activity, providing an explanation for why off-target editing is significantly lower than expected from ChIP-seq data. PMID:25275497
Li, Guang-Qi; Zang, Xiao-Nan; Zhang, Xue-Cheng; Lu, Ning; Ding, Yan; Gong, Le; Chen, Wen-Chao
2014-03-15
To study the response of Gracilaria lemaneiformis to heat stress, two key enzymes - ubiquitin-activating enzyme (E1) and ubiquitin-conjugating enzyme (E2) - of the Ubiquitin/26S proteasome pathway (UPP) were studied in three strains of G. lemaneiformis-wild type, heat-tolerant cultivar 981 and heat-tolerant cultivar 07-2. The full length DNA sequence of E1 contained only one exon. The open reading frame (ORF) sequence was 981 nucleotides encoding 326 amino acids, which contained conserved ATP binding sites (LYDRQIRLWGLE, ELAKNVLLAGV, LKEMN, VVCAI) and the ubiquitin-activating domains (VVCAI…LMTEAC, VFLDLGDEYSYQ, AIVGGMWGRE). The gene sequence of E2 contained four exons and three introns. The sum of the four exons gave an open reading frame sequence of 444 nucleotides encoding 147 amino acids, which contained a conserved ubiquitin-activating domain (GSICLDIL), ubiquitin-conjugating domains (RIYHPNIN, KVLLSICSLL, DDPLV) and ubiquitin-ligase (E3) recognition sites (KRI, YPF, WSP). Real-time-PCR analysis of transcription levels of E1 and E2 under heat shock conditions (28°C and 32°C) showed that in wild type, transcriptions of E1 and E2 were up-regulated at 28°C, while at 32°C, transcriptions of the two enzymes were below the normal level. In cultivar 981 and cultivar 07-2 of G. lemaneiformis, the transcription levels of the two enzymes were up-regulated at 32°C, and transcription level of cultivar 07-2 was even higher than that of cultivar 981. These results suggest that the UPP plays an important role in high temperature resistance of G. lemaneiformis and the bioactivity of UPP is directly related to the heat-resistant ability of G. lemaneiformis. Copyright © 2013 Elsevier B.V. All rights reserved.
Hocum, Jonah D; Battrell, Logan R; Maynard, Ryan; Adair, Jennifer E; Beard, Brian C; Rawlings, David J; Kiem, Hans-Peter; Miller, Daniel G; Trobridge, Grant D
2015-07-07
Analyzing the integration profile of retroviral vectors is a vital step in determining their potential genotoxic effects and developing safer vectors for therapeutic use. Identifying retroviral vector integration sites is also important for retroviral mutagenesis screens. We developed VISA, a vector integration site analysis server, to analyze next-generation sequencing data for retroviral vector integration sites. Sequence reads that contain a provirus are mapped to the human genome, sequence reads that cannot be localized to a unique location in the genome are filtered out, and then unique retroviral vector integration sites are determined based on the alignment scores of the remaining sequence reads. VISA offers a simple web interface to upload sequence files and results are returned in a concise tabular format to allow rapid analysis of retroviral vector integration sites.
Freimuth, P; Anderson, C W
1993-03-01
The sequence of a 1158-base pair fragment of the human adenovirus serotype 12 (Ad12) genome was determined. This segment encodes the precursors for virion components Mu and VI. Both Ad12 precursors contain two sequences that conform to a consensus sequence motif for cleavage by the endoproteinase of adenovirus 2 (Ad2). Analysis of the amino terminus of VI and of the peptide fragments found in Ad12 virions demonstrated that these sites are cleaved during Ad12 maturation. This observation suggests that the recognition motif for adenovirus endoproteinases is highly conserved among human serotypes. The adenovirus 2 endoproteinase polypeptide requires additional co-factors for activity (C. W. Anderson, Protein Expression Purif., 1993, 4, 8-15). Synthetic Ad12 or Ad2 pVI carboxy-terminal peptides each permitted efficient cleavage of an artificial endoproteinase substrate by recombinant Ad2 endoproteinase polypeptide.
Meyer, Georg F; Harrison, Neil R; Wuerger, Sophie M
2013-08-01
An extensive network of cortical areas is involved in multisensory object and action recognition. This network draws on inferior frontal, posterior temporal, and parietal areas; activity is modulated by familiarity and the semantic congruency of auditory and visual component signals even if semantic incongruences are created by combining visual and auditory signals representing very different signal categories, such as speech and whole body actions. Here we present results from a high-density ERP study designed to examine the time-course and source location of responses to semantically congruent and incongruent audiovisual speech and body actions to explore whether the network involved in action recognition consists of a hierarchy of sequentially activated processing modules or a network of simultaneously active processing sites. We report two main results:1) There are no significant early differences in the processing of congruent and incongruent audiovisual action sequences. The earliest difference between congruent and incongruent audiovisual stimuli occurs between 240 and 280 ms after stimulus onset in the left temporal region. Between 340 and 420 ms, semantic congruence modulates responses in central and right frontal areas. Late differences (after 460 ms) occur bilaterally in frontal areas.2) Source localisation (dipole modelling and LORETA) reveals that an extended network encompassing inferior frontal, temporal, parasaggital, and superior parietal sites are simultaneously active between 180 and 420 ms to process auditory–visual action sequences. Early activation (before 120 ms) can be explained by activity in mainly sensory cortices. . The simultaneous activation of an extended network between 180 and 420 ms is consistent with models that posit parallel processing of complex action sequences in frontal, temporal and parietal areas rather than models that postulate hierarchical processing in a sequence of brain regions. Copyright © 2013 Elsevier Ltd. All rights reserved.
Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M
2014-01-13
Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The high processivity and fidelity of group II intron reverse transcriptases along with their novel template-switching activity, which can directly link RNA-seq adaptor sequences to cDNAs during reverse transcription, open new approaches for RNA-seq and the identification and profiling of non-coding RNAs, with potentially wide applications in research and biotechnology.
USDA-ARS?s Scientific Manuscript database
In order to identify amino acid residues crucial for the enzymatic activity of ^8-sphingolipid desaturases, a sequence comparison was performed among ^8-sphingolipid desaturases and ^6-fatty acid desaturase from various plants. In addition to the known conserved cytb5 (cytochrome b5) HPGG motif and...
novPTMenzy: a database for enzymes involved in novel post-translational modifications
Khater, Shradha; Mohanty, Debasisa
2015-01-01
With the recent discoveries of novel post-translational modifications (PTMs) which play important roles in signaling and biosynthetic pathways, identification of such PTM catalyzing enzymes by genome mining has been an area of major interest. Unlike well-known PTMs like phosphorylation, glycosylation, SUMOylation, no bioinformatics resources are available for enzymes associated with novel and unusual PTMs. Therefore, we have developed the novPTMenzy database which catalogs information on the sequence, structure, active site and genomic neighborhood of experimentally characterized enzymes involved in five novel PTMs, namely AMPylation, Eliminylation, Sulfation, Hydroxylation and Deamidation. Based on a comprehensive analysis of the sequence and structural features of these known PTM catalyzing enzymes, we have created Hidden Markov Model profiles for the identification of similar PTM catalyzing enzymatic domains in genomic sequences. We have also created predictive rules for grouping them into functional subfamilies and deciphering their mechanistic details by structure-based analysis of their active site pockets. These analytical modules have been made available as user friendly search interfaces of novPTMenzy database. It also has a specialized analysis interface for some PTMs like AMPylation and Eliminylation. The novPTMenzy database is a unique resource that can aid in discovery of unusual PTM catalyzing enzymes in newly sequenced genomes. Database URL: http://www.nii.ac.in/novptmenzy.html PMID:25931459
Croager, Emma J.; Gout, Alexander M.; Abraham, Lawrence J.
2000-01-01
CD30, as a member of the tumor necrosis factor (TNF) receptor family, is expressed on the surface of activated lymphoid cells. CD30 overexpression is a characteristic of lymphoproliferative diseases such as Hodgkin’s/non-Hodgkin’s lymphomas, embryonal carcinoma, and a number of Th2-associated diseases. The CD30 gene has been mapped to a region of the murine genome that is involved in susceptibility to systemic lupus erythematosus. Functionally, CD30 may play a role in the deletion of autoreactive T cells. We were interested in determining the molecular nature of CD30 overexpression. Sequence comparison has revealed significant identity between the TATA-less human and murine CD30 promoters; they share a number of common consensus binding motifs. Transfection assays identified three regions of transcriptional importance; the region between position −1.2 kb and −336 bp, containing a CCAT microsatellite sequence, a conserved Sp1 site at positions −43 to −38, and a downstream promoter element (DPE) at positions +24 to +29. EMSA and DNase I footprinting showed specific DNA-protein interactions of the CD30 promoter with the Sp1 site and the CCAT repeat region. The DPE element was shown to be essential for start site selection. We conclude that the conserved Sp1 site at −43 to −38 is associated with maximum reporter gene activity, the DPE element is required for start site selection, and the CCAT tetranucleotide repeats act to repress transcription. We also have shown that the microsatellite is multiallelic, when we screened a random healthy population. Further studies are required to determine whether microsatellite instability in the repressor predisposes susceptible individuals to CD30 overexpression. PMID:10793083
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spannaus, Ralf; Bodem, Jochen, E-mail: Jochen.Bodem@vim.uni-wuerzburg.de
2014-04-15
In contrast to orthoretroviruses, the foamy virus protease is only active as a protease-reverse transcriptase fusion protein and requires viral RNA for activation. Maturation of foamy viral proteins seems to be restricted to a single cleavage site in Gag and Pol. We provide evidence that unprocessed Gag is required for optimal infectivity, which is unique among retroviruses. Analyses of the cleavage site sequences of the Gag and Pol cleavage sites revealed a high similarity compared to those of Lentiviruses. We show that positions P2' and P2 are invariant and that Gag and Pol cleavage sites are processed with similar efficiencies.more » The RNase H domain is essential for protease activity, but can functionally be substituted by RNase H domains of other retroviruses. Thus, the RNase H domain might be involved in the stabilization of the protease dimer, while the RT domain is essential for RNA dependent protease activation. - Highlights: • Unprocessed Gag is required for optimal infectivity of foamy viruses. • Positions P2 and P2' are invariant in the foamy viral cleavage sites. • The RNaseH domain is essential for protease activity. • The RNaseH domains of other retroviruses support foamy viral protease activity.« less
Naveilhan, P; Baudet, C; Jabbour, W; Wion, D
1994-09-01
A model that may explain the limited division potential of certain cells such as human fibroblasts in culture is presented. The central postulate of this theory is that there exists, prior to certain key exons that code for materials needed for cell division, a unique sequence of specific repeating segments of DNA. One copy of such repeating segments is deleted during each cell cycle in cells that are not protected from such deletion through methylation of their cytosine residues. According to this theory, the means through which such repeated sequences are removed, one per cycle, is through the sequential action of enzymes that act much as bacterial restriction enzymes do--namely to produce scissions in both strands of DNA in areas that correspond to the DNA base sequence recognition specificities of such enzymes. After the first scission early in a replicative cycle, that enzyme becomes inhibited, but the cleavage of the first site exposes the closest site in the repetitive element to the action of a second restriction enzyme after which that enzyme also becomes inhibited. Then repair occurs, regenerating the original first site. Through this sequential activation and inhibition of two different restriction enzymes, only one copy of the repeating sequence is deleted during each cell cycle. In effect, the repeating sequence operates as a precise counter of the numbers of cell doubling that have occurred since the cells involved differentiated during development.
Genomic structure of the human D-site binding protein (DBP) gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shutler, G.; Glassco, T.; Kang, Xiaolin
1996-06-15
The human gene for the D-Site Binding Protein (DBP) has been sequenced and characterized. This gene is a member of the b/ZIP family of transcription factors and is one of three genes forming the PAR sub-family. DBP has been implicated in the diurnal regulation of a variety of liver-specific genes. Examination of the genomic structure of DBP reveals that the gene is divided into four exons and is contained within a relatively compact region of approximately 6 kb. These exons appear to correspond to functional divisions the DBP protein. Exon 1 contains a long 5{prime} UTR, and conservation between themore » rat and the human genes of the presence of small open reading frames within this region suggests that is may play a role in translational control. Exon 2 contains a limited region of similarity to the other PAR domain genes, which may be part of a potential activation domain. Exon 3 contains the PAR domain and differs by only 1 of 71 amino acids between rat and human. Exon 4, containing both the basic and the leucine zipper domains, is likewise highly conserved. The overall degree of homology between the rat and the human cDNA sequences is 82% for the nucleic acid sequence and 92% for the protein sequence. comparison of the rat and human proximal promoters reveals extensive sequence conservation, with two previously characterized DNA binding sites being conserved at the functional and sequence levels. 31 refs., 4 figs.« less
The Interaction of FABP with Kapα
Amber-Vitos, Ortal; Kucherenko, Nataly; Nachliel, Esther; Gutman, Menachem; Tsfadia, Yossi
2015-01-01
Gene-activating lipophilic compounds are carried into the nucleus when loaded on fatty-acid-binding proteins (FABP). Some of these proteins are recognized by the α-Karyopherin (Kapα) through its nuclear localization signal (NLS) consisting of three positive residues that are not in a continuous sequence. The Importin system can distinguish between FABP loaded with activating and non-activating compounds. In the present study, we introduced molecular dynamics as a tool for clarifying the mechanism by which FABP4, loaded with activating ligand (linoleate) is recognized by Kapα. In the first phase, we simulated the complex between KapαΔIBB (termed “Armadillo”) that was crystallized with two NLS hepta-peptides. The trajectory revealed that the crystal-structure orientation of the peptides is rapidly lost and new interactions dominate. Though, the NLS sequence of FABP4 is cryptic, since the functional residues are not in direct sequence, implicating more than one possible conformation. Therefore, four possible docked conformations were generated, in which the NLS of FABP4 is interacting with either the major or the minor sites of Kapα, and the N → C vectors are parallel or anti-parallel. Out of these four basic starting positions, only the FABP4-minor site complex exhibited a large number of contact points. In this complex, the FABP interacts with the minor and the major sites, suppressing the self-inhibitory interaction of the Kapα, rendering it free to react with Kapβ. Finally, we propose that the transportable conformation generated an extended hydrophobic domain which expanded out of the boundary of the FABP4, allowing the loaded linoleate to partially migrate out of the FABP into a joint complex in which the Kapα contributes part of a combined binding pocket. PMID:26284534
ChIP-seq Accurately Predicts Tissue-Specific Activity of Enhancers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Visel, Axel; Blow, Matthew J.; Li, Zirong
2009-02-01
A major yet unresolved quest in decoding the human genome is the identification of the regulatory sequences that control the spatial and temporal expression of genes. Distant-acting transcriptional enhancers are particularly challenging to uncover since they are scattered amongst the vast non-coding portion of the genome. Evolutionary sequence constraint can facilitate the discovery of enhancers, but fails to predict when and where they are active in vivo. Here, we performed chromatin immunoprecipitation with the enhancer-associated protein p300, followed by massively-parallel sequencing, to map several thousand in vivo binding sites of p300 in mouse embryonic forebrain, midbrain, and limb tissue. Wemore » tested 86 of these sequences in a transgenic mouse assay, which in nearly all cases revealed reproducible enhancer activity in those tissues predicted by p300 binding. Our results indicate that in vivo mapping of p300 binding is a highly accurate means for identifying enhancers and their associated activities and suggest that such datasets will be useful to study the role of tissue-specific enhancers in human biology and disease on a genome-wide scale.« less
Babinska, A; Clement, C C; Swiatkowska, M; Szymanski, J; Shon, A; Ehrlich, Y H; Kornecki, E; Salifu, M O
2014-07-01
Peptides with enhanced resistance to proteolysis, based on the amino acid sequence of the F11 receptor molecule (F11R, aka JAM-A/Junctional adhesion molecule-A), were designed, prepared, and examined as potential candidates for the development of anti-atherosclerotic and anti-thrombotic therapeutic drugs. A sequence at the N-terminal of F11R together with another sequence located in the first Ig-loop of this protein, were identified to form a steric active-site operating in the F11R-dependent adhesion between cells that express F11R molecules on their external surface. In silico modeling of the complex between two polypeptide chains with the sequences positioned in the active-site was used to generate peptide-candidates designed to inhibit homophilic interactions between surface-located F11R molecules. The two lead F11R peptides were modified with D-Arg and D-Lys at selective sites, for attaining higher stability to proteolysis in vivo. Using molecular docking experiments we tested different conformational states and the putative binding affinity between two selected D-Arg and D-Lys-modified F11R peptides and the proposed binding pocket. The inhibitory effects of the F11R peptide 2HN-(dK)-SVT-(dR)-EDTGTYTC-CONH2 on antibody-induced platelet aggregation and on the adhesion of platelets to cytokine-inflammed endothelial cells are reported in detail, and the results point out the significant potential utilization of F11R peptides for the prevention and treatment of atherosclerotic plaques and associated thrombotic events. © 2014 Wiley Periodicals, Inc.
Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J
1992-03-01
The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary.
Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J
1992-01-01
The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788
In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome
2013-01-01
Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Detecting Coevolution in and among Protein Domains
Yeang, Chen-Hsiang; Haussler, David
2007-01-01
Correlated changes of nucleic or amino acids have provided strong information about the structures and interactions of molecules. Despite the rich literature in coevolutionary sequence analysis, previous methods often have to trade off between generality, simplicity, phylogenetic information, and specific knowledge about interactions. Furthermore, despite the evidence of coevolution in selected protein families, a comprehensive screening of coevolution among all protein domains is still lacking. We propose an augmented continuous-time Markov process model for sequence coevolution. The model can handle different types of interactions, incorporate phylogenetic information and sequence substitution, has only one extra free parameter, and requires no knowledge about interaction rules. We employ this model to large-scale screenings on the entire protein domain database (Pfam). Strikingly, with 0.1 trillion tests executed, the majority of the inferred coevolving protein domains are functionally related, and the coevolving amino acid residues are spatially coupled. Moreover, many of the coevolving positions are located at functionally important sites of proteins/protein complexes, such as the subunit linkers of superoxide dismutase, the tRNA binding sites of ribosomes, the DNA binding region of RNA polymerase, and the active and ligand binding sites of various enzymes. The results suggest sequence coevolution manifests structural and functional constraints of proteins. The intricate relations between sequence coevolution and various selective constraints are worth pursuing at a deeper level. PMID:17983264
Cooper, James; Ding, Yi; Song, Jiuzhou; Zhao, Keji
2017-11-01
Increased chromatin accessibility is a feature of cell-type-specific cis-regulatory elements; therefore, mapping of DNase I hypersensitive sites (DHSs) enables the detection of active regulatory elements of transcription, including promoters, enhancers, insulators and locus-control regions. Single-cell DNase sequencing (scDNase-seq) is a method of detecting genome-wide DHSs when starting with either single cells or <1,000 cells from primary cell sources. This technique enables genome-wide mapping of hypersensitive sites in a wide range of cell populations that cannot be analyzed using conventional DNase I sequencing because of the requirement for millions of starting cells. Fresh cells, formaldehyde-cross-linked cells or cells recovered from formalin-fixed paraffin-embedded (FFPE) tissue slides are suitable for scDNase-seq assays. To generate scDNase-seq libraries, cells are lysed and then digested with DNase I. Circular carrier plasmid DNA is included during subsequent DNA purification and library preparation steps to prevent loss of the small quantity of DHS DNA. Libraries are generated for high-throughput sequencing on the Illumina platform using standard methods. Preparation of scDNase-seq libraries requires only 2 d. The materials and molecular biology techniques described in this protocol should be accessible to any general molecular biology laboratory. Processing of high-throughput sequencing data requires basic bioinformatics skills and uses publicly available bioinformatics software.
Wang, Qian-Fei; Lauring, Josh; Schlissel, Mark S.
2000-01-01
The RAG-2 gene encodes a component of the V(D)J recombinase which is essential for the assembly of antigen receptor genes in B and T lymphocytes. Previously, we reported that the transcription factor BSAP (PAX-5) regulates the murine RAG-2 promoter in B-cell lines. A partially overlapping but distinct region of the proximal RAG-2 promoter was also identified as an important element for promoter activity in T cells; however, the responsible factor was unknown. In this report, we present data demonstrating that c-Myb binds to a Myb consensus site within the proximal promoter and is critical for its activity in T-lineage cells. We show that c-Myb can transactivate a RAG-2 promoter-reporter construct in cotransfection assays and that this transactivation depends on the proximal promoter Myb consensus site. By using a chromatin immunoprecipitation (ChIP) strategy, fractionation of chromatin with anti-c-Myb antibody specifically enriched endogenous RAG-2 promoter DNA sequences. DNase I genomic footprinting revealed that the c-Myb site is occupied in a tissue-specific fashion in vivo. Furthermore, an integrated RAG-2 promoter construct with mutations at the c-Myb site was not enriched in the ChIP assay, while a wild-type integrated promoter construct was enriched. Finally, this lack of binding of c-Myb to a chromosomally integrated mutant RAG-2 promoter construct in vivo was associated with a striking decrease in promoter activity. We conclude that c-Myb regulates the RAG-2 promoter in T cells by binding to this consensus c-Myb binding site. PMID:11094072
NASA Technical Reports Server (NTRS)
Mukhopadhyay, C. K.; Mazumder, B.; Lindley, P. F.; Fox, P. L.
1997-01-01
Free transition metal ions oxidize lipids and lipoproteins in vitro; however, recent evidence suggests that free metal ion-independent mechanisms are more likely in vivo. We have shown previously that human ceruloplasmin (Cp), a serum protein containing seven Cu atoms, induces low density lipoprotein oxidation in vitro and that the activity depends on the presence of a single, chelatable Cu atom. We here use biochemical and molecular approaches to determine the site responsible for Cp prooxidant activity. Experiments with the His-specific reagent diethylpyrocarbonate (DEPC) showed that one or more His residues was specifically required. Quantitative [14C]DEPC binding studies indicated the importance of a single His residue because only one was exposed upon removal of the prooxidant Cu. Plasmin digestion of [14C]DEPC-treated Cp (and N-terminal sequence analysis of the fragments) showed that the critical His was in a 17-kDa region containing four His residues in the second major sequence homology domain of Cp. A full length human Cp cDNA was modified by site-directed mutagenesis to give His-to-Ala substitutions at each of the four positions and was transfected into COS-7 cells, and low density lipoprotein oxidation was measured. The prooxidant site was localized to a region containing His426 because CpH426A almost completely lacked prooxidant activity whereas the other mutants expressed normal activity. These observations support the hypothesis that Cu bound at specific sites on protein surfaces can cause oxidative damage to macromolecules in their environment. Cp may serve as a model protein for understanding mechanisms of oxidant damage by copper-containing (or -binding) proteins such as Cu, Zn superoxide dismutase, and amyloid precursor protein.
Ono, K; Ohtomo, T; Sato, S; Sugamata, Y; Suzuki, M; Hisamoto, N; Ninomiya-Tsuji, J; Tsuchiya, M; Matsumoto, K
2001-06-29
TAK1, a member of the MAPKKK family, is involved in the intracellular signaling pathways mediated by transforming growth factor beta, interleukin 1, and Wnt. TAK1 kinase activity is specifically activated by the TAK1-binding protein TAB1. The C-terminal 68-amino acid sequence of TAB1 (TAB1-C68) is sufficient for TAK1 interaction and activation. Analysis of various truncated versions of TAB1-C68 defined a C-terminal 30-amino acid sequence (TAB1-C30) necessary for TAK1 binding and activation. NMR studies revealed that the TAB1-C30 region has a unique alpha-helical structure. We identified a conserved sequence motif, PYVDXA/TXF, in the C-terminal domain of mammalian TAB1, Xenopus TAB1, and its Caenorhabditis elegans homolog TAP-1, suggesting that this motif constitutes a specific TAK1 docking site. Alanine substitution mutagenesis showed that TAB1 Phe-484, located in the conserved motif, is crucial for TAK1 binding and activation. The C. elegans homolog of TAB1, TAP-1, was able to interact with and activate the C. elegans homolog of TAK1, MOM-4. However, the site in TAP-1 corresponding to Phe-484 of TAB1 is an alanine residue (Ala-364), and changing this residue to Phe abrogates the ability of TAP-1 to interact with and activate MOM-4. These results suggest that the Phe or Ala residue within the conserved motif of the TAB1-related proteins is important for interaction with and activation of specific TAK1 MAPKKK family members in vivo.
Ionescu, Crina-Maria; Svobodová Vařeková, Radka; Prehn, Jochen H. M.; Huber, Heinrich J.; Koča, Jaroslav
2012-01-01
The pro-apoptotic proteins Bax and Bak are essential for executing programmed cell death (apoptosis), yet the mechanism of their activation is not properly understood at the structural level. For the first time in cell death research, we calculated intra-protein charge transfer in order to study the structural alterations and their functional consequences during Bax activation. Using an electronegativity equalization model, we investigated the changes in the Bax charge profile upon activation by a functional peptide of its natural activator protein, Bim. We found that charge reorganizations upon activator binding mediate the exposure of the functional sites of Bax, rendering Bax active. The affinity of the Bax C-domain for its binding groove is decreased due to the Arg94-mediated abrogation of the Ser184-Asp98 interaction. We further identified a network of charge reorganizations that confirms previous speculations of allosteric sensing, whereby the activation information is conveyed from the activation site, through the hydrophobic core of Bax, to the well-distanced functional sites of Bax. The network was mediated by a hub of three residues on helix 5 of the hydrophobic core of Bax. Sequence and structural alignment revealed that this hub was conserved in the Bak amino acid sequence, and in the 3D structure of folded Bak. Our results suggest that allostery mediated by charge transfer is responsible for the activation of both Bax and Bak, and that this might be a prototypical mechanism for a fast activation of proteins during signal transduction. Our method can be applied to any protein or protein complex in order to map the progress of allosteric changes through the proteins' structure. PMID:22719244
In silico structural analysis of group 3, 6 and 9 allergens from Dermatophagoides farinae.
Teng, Feixiang; Yu, Lili; Bian, Yonghua; Sun, Jinxia; Wu, Juansong; Ling, Cunbao; Yang, Li; Wang, Yungang; Cui, Yubao
2015-05-01
Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) are the predominant source of dust mite allergens, which provoke allergic diseases, such as rhinitis, asthma and eczema. Of the 30 allergen groups produced by D. farinae, the Der f 3, Der f 6 and Der f 9 allergens are all trypsin‑associated proteins, however little else is currently known about them. The present study used in silico tools to compare the amino acid sequences, and predict the secondary and tertiary structures of Der f 3, Der f 6 and Der f 9 allergens. Protein sequence alignment detected ~46% identity between Der f 3, Der f 6 and Der f 9. Furthermore, each protein was shown to contain three active sites and two highly conserved trypsin functional domains. Predictions of the secondary and tertiary structure identified α‑helices, β‑sheets and random coils. The active sites of the three proteins appeared to fold onto each other in a three‑dimensional model, constituting the active site of the enzyme. Epitope analysis demonstrated that Der f 3, Der f 6 and Der f 9 have 4‑5 potential epitopes located in random coils, and the epitope sequences of Der f 3, Der f 6 and Der f 9 were shown to overlap in two domains (at amino acids 83‑87 and 179‑180); however the residues in these two domains were not identical. The present study aimed to conduct a biochemical and genetic analysis of these three allergens, and to potentially contribute to the development of vaccines for allergen‑specific immunotherapy.
Abdelkafi, Slim; Ogata, Hiroyuki; Barouh, Nathalie; Fouquet, Benjamin; Lebrun, Régine; Pina, Michel; Scheirlinckx, Frantz; Villeneuve, Pierre; Carrière, Frédéric
2009-11-01
An esterase (CpEst) showing high specific activities on tributyrin and short chain vinyl esters was obtained from Carica papaya latex after an extraction step with zwitterionic detergent and sonication, followed by gel filtration chromatography. Although the protein could not be purified to complete homogeneity due to its presence in high molecular mass aggregates, a major protein band with an apparent molecular mass of 41 kDa was obtained by SDS-PAGE. This material was digested with trypsin and the amino acid sequences of the tryptic peptides were determined by LC/ESI/MS/MS. These sequences were used to identify a partial cDNA (679 bp) from expressed sequence tags (ESTs) of C. papaya. Based upon EST sequences, a full-length gene was identified in the genome of C. papaya, with an open reading frame of 1029 bp encoding a protein of 343 amino acid residues, with a theoretical molecular mass of 38 kDa. From sequence analysis, CpEst was identified as a GDSL-motif carboxylester hydrolase belonging to the SGNH protein family and four potential N-glycosylation sites were identified. The putative catalytic triad was localised (Ser(35)-Asp(307)-His(310)) with the nucleophile serine being part of the GDSL-motif. A 3D-model of CpEst was built from known X-ray structures and sequence alignments and the catalytic triad was found to be exposed at the surface of the molecule, thus confirming the results of CpEst inhibition by tetrahydrolipstatin suggesting a direct accessibility of the inhibitor to the active site.
Cameranesi, María M.; Morán-Barrio, Jorgelina; Limansky, Adriana S.; Repizo, Guillermo D.; Viale, Alejandro M.
2018-01-01
Members of the genus Acinetobacter possess distinct plasmid types which provide effective platforms for the acquisition, evolution, and dissemination of antimicrobial resistance structures. Many plasmid-borne resistance structures are bordered by short DNA sequences providing potential recognition sites for the host XerC and XerD site-specific tyrosine recombinases (XerC/D-like sites). However, whether these sites are active in recombination and how they assist the mobilization of associated resistance structures is still poorly understood. Here we characterized the plasmids carried by Acinetobacter baumannii Ab242, a multidrug-resistant clinical strain belonging to the ST104 (Oxford scheme) which produces an OXA-58 carbapenem-hydrolyzing class-D β-lactamase (CHDL). Plasmid sequencing and characterization of replication, stability, and adaptive modules revealed the presence in Ab242 of three novel plasmids lacking self-transferability functions which were designated pAb242_9, pAb242_12, and pAb242_25, respectively. Among them, only pAb242_25 was found to carry an adaptive module encompassing an ISAba825-blaOXA-58 arrangement accompanied by a TnaphA6 transposon, the whole structure conferring simultaneous resistance to carbapenems and aminoglycosides. Ab242 plasmids harbor several XerC/D-like sites, with most sites found in pAb242_25 located in the vicinity or within the adaptive module described above. Electrotransformation of susceptible A. nosocomialis cells with Ab242 plasmids followed by imipenem selection indicated that the transforming plasmid form was a co-integrate resulting from the fusion of pAb242_25 and pAb242_12. Further characterization by cloning and sequencing studies indicated that a XerC/D site in pAb242_25 and another in pAb242_12 provided the active sister pair for the inter-molecular site-specific recombination reaction mediating the fusion of these two plasmids. Moreover, the resulting co-integrate was found also to undergo intra-molecular resolution at the new pair of XerC/D sites generated during fusion thus regenerating the original pAb242_25 and pAb242_12 plasmids. These observations provide the first evidence indicating that XerC/D-like sites in A. baumannii plasmids can provide active pairs for site-specific recombination mediating inter-molecular fusions and intra-molecular resolutions. The overall results shed light on the evolutionary dynamics of A. baumannii plasmids and the underlying mechanisms of dissemination of genetic structures responsible for carbapenem and other antibiotics resistance among the Acinetobacter clinical population. PMID:29434581
Plasmid partition system of the P1par family from the pWR100 virulence plasmid of Shigella flexneri.
Sergueev, Kirill; Dabrazhynetskaya, Alena; Austin, Stuart
2005-05-01
P1par family members promote the active segregation of a variety of plasmids and plasmid prophages in gram-negative bacteria. Each has genes for ParA and ParB proteins, followed by a parS partition site. The large virulence plasmid pWR100 of Shigella flexneri contains a new P1par family member: pWR100par. Although typical parA and parB genes are present, the putative pWR100parS site is atypical in sequence and organization. However, pWR100parS promoted accurate plasmid partition in Escherichia coli when the pWR100 Par proteins were supplied. Unique BoxB hexamer motifs within parS define species specificities among previously described family members. Although substantially different from P1parS from the P1 plasmid prophage of E. coli, pWR100parS has the same BoxB sequence. As predicted, the species specificity of the two types proved identical. They also shared partition-mediated incompatibility, consistent with the proposed mechanistic link between incompatibility and species specificity. Among several informative sequence differences between pWR100parS and P1parS is the presence of a 21-bp insert at the center of the pWR100parS site. Deletion of this insert left much of the parS activity intact. Tolerance of central inserts with integral numbers of helical DNA turns reflects the critical topology of these sites, which are bent by binding the host IHF protein.
Detection of nucleic acids by multiple sequential invasive cleavages
Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann D.
1999-01-01
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of human cytomegalovirus nucleic acid in a sample.
Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.
2005-03-29
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.
Detection of nucleic acids by multiple sequential invasive cleavages 02
Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann D.
2002-01-01
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of human cytomegalovirus nucleic acid in a sample.
Detection of nucleic acids by multiple sequential invasive cleavages
Hall, Jeff G; Lyamichev, Victor I; Mast, Andrea L; Brow, Mary Ann D
2012-10-16
The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of human cytomegalovirus nucleic acid in a sample.
Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H
1988-01-01
cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787
Biomimetic Artificial Epigenetic Code for Targeted Acetylation of Histones.
Taniguchi, Junichi; Feng, Yihong; Pandian, Ganesh N; Hashiya, Fumitaka; Hidaka, Takuya; Hashiya, Kaori; Park, Soyoung; Bando, Toshikazu; Ito, Shinji; Sugiyama, Hiroshi
2018-06-13
While the central role of locus-specific acetylation of histone proteins in eukaryotic gene expression is well established, the availability of designer tools to regulate acetylation at particular nucleosome sites remains limited. Here, we develop a unique strategy to introduce acetylation by constructing a bifunctional molecule designated Bi-PIP. Bi-PIP has a P300/CBP-selective bromodomain inhibitor (Bi) as a P300/CBP recruiter and a pyrrole-imidazole polyamide (PIP) as a sequence-selective DNA binder. Biochemical assays verified that Bi-PIPs recruit P300 to the nucleosomes having their target DNA sequences and extensively accelerate acetylation. Bi-PIPs also activated transcription of genes that have corresponding cognate DNA sequences inside living cells. Our results demonstrate that Bi-PIPs could act as a synthetic programmable histone code of acetylation, which emulates the bromodomain-mediated natural propagation system of histone acetylation to activate gene expression in a sequence-selective manner.
Dong, Xinran; Wang, Xiao; Zhang, Feng; Tian, Weidong
2016-10-01
Accelerated evolution of regulatory sequence can alter the expression pattern of target genes, and cause phenotypic changes. In this study, we used DNase I hypersensitive sites (DHSs) to annotate putative regulatory sequences in the human genome, and conducted a genome-wide analysis of the effects of accelerated evolution on regulatory sequences. Working under the assumption that local ancient repeat elements of DHSs are under neutral evolution, we discovered that ∼0.44% of DHSs are under accelerated evolution (ace-DHSs). We found that ace-DHSs tend to be more active than background DHSs, and are strongly associated with epigenetic marks of active transcription. The target genes of ace-DHSs are significantly enriched in neuron-related functions, and their expression levels are positively selected in the human brain. Thus, these lines of evidences strongly suggest that accelerated evolution on regulatory sequences plays important role in the evolution of human-specific phenotypes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Functional dissection of the alphavirus capsid protease: sequence requirements for activity.
Thomas, Saijo; Rai, Jagdish; John, Lijo; Günther, Stephan; Drosten, Christian; Pützer, Brigitte M; Schaefer, Stephan
2010-11-18
The alphavirus capsid is multifunctional and plays a key role in the viral life cycle. The nucleocapsid domain is released by the self-cleavage activity of the serine protease domain within the capsid. All alphaviruses analyzed to date show this autocatalytic cleavage. Here we have analyzed the sequence requirements for the cleavage activity of Chikungunya virus capsid protease of genus alphavirus. Amongst alphaviruses, the C-terminal amino acid tryptophan (W261) is conserved and found to be important for the cleavage. Mutating tryptophan to alanine (W261A) completely inactivated the protease. Other amino acids near W261 were not having any effect on the activity of this protease. However, serine protease inhibitor AEBSF did not inhibit the activity. Through error-prone PCR we found that isoleucine 227 is important for the effective activity. The loss of activity was analyzed further by molecular modelling and comparison of WT and mutant structures. It was found that lysine introduced at position 227 is spatially very close to the catalytic triad and may disrupt electrostatic interactions in the catalytic site and thus inactivate the enzyme. We are also examining other sequence requirements for this protease activity. We analyzed various amino acid sequence requirements for the activity of ChikV capsid protease and found that amino acids outside the catalytic triads are important for the activity.
Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao
2014-01-24
Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.
Goonesekere, Nalin C W; Shipely, Krysten; O'Connor, Kevin
2010-06-01
The Pfam database is an important tool in genome annotation, since it provides a collection of curated protein families. However, a subset of these families, known as domains of unknown function (DUFs), remains poorly characterized. We have related sequences from DUF404, DUF407, DUF482, DUF608, DUF810, DUF853, DUF976 and DUF1111 to homologs in PDB, within the midnight zone (9-20%) of sequence identity. These relationships were extended to provide functional annotation by sequence analysis and model building. Also described are examples of residue plasticity within enzyme active sites, and change of function within homologous sequences of a DUF. Copyright 2010 Elsevier Ltd. All rights reserved.
Stafford, Kate A.; Palmer III, Arthur G.
2014-01-01
Ribonuclease H1 (RNase H) enzymes are well-conserved endonucleases that are present in all domains of life and are particularly important in the life cycle of retroviruses as domains within reverse transcriptase. Despite extensive study, especially of the E. coli homolog, the interaction of the highly negatively charged active site with catalytically required magnesium ions remains poorly understood. In this work, we describe molecular dynamics simulations of the E. coli homolog in complex with magnesium ions, as well as simulations of other homologs in their apo states. Collectively, these results suggest that the active site is highly rigid in the apo state of all homologs studied and is conformationally preorganized to favor the binding of a magnesium ion. Notably, representatives of bacterial, eukaryotic, and retroviral RNases H all exhibit similar active-site rigidity, suggesting that this dynamic feature is only subtly modulated by amino acid sequence and is primarily imposed by the distinctive RNase H protein fold. PMID:25075292
The dynamics of genome replication using deep sequencing
Müller, Carolin A.; Hawkins, Michelle; Retkute, Renata; Malla, Sunir; Wilson, Ray; Blythe, Martin J.; Nakato, Ryuichiro; Komata, Makiko; Shirahige, Katsuhiko; de Moura, Alessandro P.S.; Nieduszynski, Conrad A.
2014-01-01
Eukaryotic genomes are replicated from multiple DNA replication origins. We present complementary deep sequencing approaches to measure origin location and activity in Saccharomyces cerevisiae. Measuring the increase in DNA copy number during a synchronous S-phase allowed the precise determination of genome replication. To map origin locations, replication forks were stalled close to their initiation sites; therefore, copy number enrichment was limited to origins. Replication timing profiles were generated from asynchronous cultures using fluorescence-activated cell sorting. Applying this technique we show that the replication profiles of haploid and diploid cells are indistinguishable, indicating that both cell types use the same cohort of origins with the same activities. Finally, increasing sequencing depth allowed the direct measure of replication dynamics from an exponentially growing culture. This is the first time this approach, called marker frequency analysis, has been successfully applied to a eukaryote. These data provide a high-resolution resource and methodological framework for studying genome biology. PMID:24089142
Ali, Abid; Azam, Mohd W; Khan, Asad U
2018-06-01
New Delhi metallo β-lactamase-1 is one of the carbapenemases, causing hydrolysis of almost all β-lactamase antibiotics. Seventeen different NDM variants have been reported so far, they varied in their sequences either by single or multiple amino acid substitutions. Hence, it is important to understand its structural and functional relation. In the earlier studies role of active site residues has been studied but non-active site residues has not studied in detail. Therefore, we have initiated to further comprehend its structure and function relation by mutating some of its non-active site residues. A laboratory mutant of NDM-1 was generated by PCR-based site-directed mutagenesis, replacing Q to A at 123 position. The MICs of imipenem and meropenem for NDM-1 Q123A were found increased by 2 fold as compare to wild type and so the hydrolytic activity was enhanced (Kcat/Km) as compared to NDM-1 wild type. GOLD fitness scores were also found in favour of kinetics data. Secondary structure for α-helical content was determined by Far-UV circular dichroism (CD), which showed significant conformational changes. We conclude a noteworthy role of non-active-site amino acid residues in the catalytic activity of NDM-1. This study also provides an insight of emergence of new variants through natural evolution. Copyright © 2018 Elsevier B.V. All rights reserved.
Alkaline phosphatase from the hyperthermophilic bacterium T. maritima requires cobalt for activity
Wojciechowski, Cheryl L.; Cardia, James P.; Kantrowitz, Evan R.
2002-01-01
The hyperthermophilic bacterium Thermotoga maritima encodes a gene sharing sequence similarities with several known genes for alkaline phosphatase (AP). The putative gene was isolated and the corresponding protein expressed in Escherichia coli, with and without a predicted signal sequence. The recombinant protein showed phosphatase activity toward the substrate p-nitrophenyl-phosphate with a kcat of 16 s−1 and a Km of 175 μM at a pH optimum of 8.0 when assayed at 25°C. T. maritima phosphatase activity increased at high temperatures, reaching a maximum kcat of 100 s−1, with a Km of 93 μM at 65°C. Activity was stable at 65°C for >24 h and at 90°C for 5 h. Phosphatase activity was dependent on divalent metal ions, specifically Co(II) and Mg(II). Circular dichroism spectra showed that the enzyme gains secondary structure on addition of these metals. Zinc, the most common divalent metal ion required for activity in known APs, was shown to inhibit the T. maritima phosphatase enzyme at concentrations above 0.3 moles Zn: 1 mole monomer. All activity was abolished in the presence of 0.1 mM EDTA. The T. maritima AP primary sequence is 28% identical when compared with E. coli AP. Based on a structural model, the active sites are superimposable except for two residues near the E. coli AP Mg binding site, D153 and K328 (E. coli numbering) corresponding to histidine and tryptophan in T. maritima AP, respectively. Sucrose-density gradient sedimentation experiments showed that the protein exists in several quaternary forms predominated by an octamer. PMID:11910033
BIOPEP database and other programs for processing bioactive peptide sequences.
Minkiewicz, Piotr; Dziuba, Jerzy; Iwaniak, Anna; Dziuba, Marta; Darewicz, Małgorzata
2008-01-01
This review presents the potential for application of computational tools in peptide science based on a sample BIOPEP database and program as well as other programs and databases available via the World Wide Web. The BIOPEP application contains a database of biologically active peptide sequences and a program enabling construction of profiles of the potential biological activity of protein fragments, calculation of quantitative descriptors as measures of the value of proteins as potential precursors of bioactive peptides, and prediction of bonds susceptible to hydrolysis by endopeptidases in a protein chain. Other bioactive and allergenic peptide sequence databases are also presented. Programs enabling the construction of binary and multiple alignments between peptide sequences, the construction of sequence motifs attributed to a given type of bioactivity, searching for potential precursors of bioactive peptides, and the prediction of sites susceptible to proteolytic cleavage in protein chains are available via the Internet as are other approaches concerning secondary structure prediction and calculation of physicochemical features based on amino acid sequence. Programs for prediction of allergenic and toxic properties have also been developed. This review explores the possibilities of cooperation between various programs.
Villa, James P.; Bertenshaw, Greg P.; Bond, Judith S.
2008-01-01
SUMMARY The protease domains of the evolutionarily-related α and ß subunits of meprin metalloproteases are approximately 55% identical at the amino acid level, however, their substrate and peptide bond specificities differ markedly. The meprin ß subunit favors acidic residues proximal to the scissile bond, while the α subunit prefers small or aromatic amino acids flanking the scissile bond. Thus gastrin, a peptide that contains a string of five Glu residues, is an excellent substrate for meprin ß while it is not hydrolyzed by meprin α. Work herein aimed to identify critical amino acids in the meprin active sites that determine the substrate specificity differences. Sequence alignments and homology models, based on the crystal structure of the crayfish astacin, showed electrostatic differences within the meprin active sites. Site-directed mutagenesis of active site residues demonstrated that replacement of a hydrophobic residue by a basic amino acid enabled the meprin α protease to cleave gastrin. The meprin αY199K mutant was most effective; the corresponding mutation of meprin ßK185Y resulted in decreased activity toward gastrin. Peptide cleavage site determinations and kinetic analyses using a variety of peptides extended evidence that meprin αTyr199/ßLys185 are substrate specificity determinants in meprin active sites. These studies shed light on the molecular basis for the substrate specificity differences of astacin metalloproteinases. PMID:12888571
Keresztessy, Z; Brown, K; Dunn, M A; Hughes, M A
2001-01-01
The coding sequence of the mature cyanogenic beta-glucosidase (beta-glucoside glucohydrolase, EC 3.2.1.21; linamarase) was cloned into the vector pYX243 modified to contain the SUC2 yeast secretion signal sequence and expressed in Saccharomyces cerevisiae. The recombinant enzyme is active, glycosylated and showed similar stability to the plant protein. Michaelis constants for hydrolysis of the natural substrate, linamarin (K(m)=1.06 mM) and the synthetic p-nitrophenyl beta-D-glucopyranoside (PNP-Glc; K(m)=0.36 mM), as well as apparent pK(a) values of the free enzyme and the enzyme-substrate complexes (pK(E)(1)=4.4-4.8, pK(E)(2)=6.7-7.2, pK(ES)(1)=3.9-4.4, pK(ES)(2)=8.3) were very similar to those of the plant enzyme. Site-directed mutagenesis was carried out to study the function of active-site residues based on a homology model generated for the enzyme using the MODELLER program. Changing Glu-413 to Gly destroyed enzyme activity, consistent with it being the catalytic nucleophile. The Gln-339Glu mutation also abolished activity, confirming a function in positioning the catalytic diad. The Ala-201Val mutation shifted the pK(a) of the acid/base catalyst Glu-198 from 7.22 to 7.44, reflecting a change in its hydrophobic environment. A Phe-269Asn change increased K(m) for linamarin hydrolysis 16-fold (16.1 mM) and that for PNP-Glc only 2.5-fold (0.84 mM), demonstrating that Phe-269 contributes to the cyanogenic specificity of the cassava beta-glucosidase. PMID:11139381
NASA Technical Reports Server (NTRS)
Bachmann, M.; Shiraishi, N.; Campbell, W. H.; Yoo, B. C.; Harmon, A. C.; Huber, S. C.; Davies, E. (Principal Investigator)
1996-01-01
Spinach leaf NADH:nitrate reductase (NR) responds to light/dark signals and photosynthetic activity in part as a result of rapid regulation by reversible protein phosphorylation. We have identified the major regulatory phosphorylation site as Ser-543, which is located in the hinge 1 region connecting the cytochrome b domain with the molybdenum-pterin cofactor binding domain of NR, using recombinant NR fragments containing or lacking the phosphorylation site sequence. Studies with NR partial reactions indicated that the block in electron flow caused by phosphorylation also could be localized to the hinge 1 region. A synthetic peptide (NR6) based on the phosphorylation site sequence was phosphorylated readily by NR kinase (NRk) in vitro. NR6 kinase activity tracked the ATP-dependent inactivation of NR during several chromatographic steps and completely inhibited inactivation/phosphorylation of native NR in vitro. Two forms of NRk were resolved by using anion exchange chromatography. Studies with synthetic peptide analogs indicated that both forms of NRk had similar specificity determinants, requiring a basic residue at P-3 (i.e., three amino acids N-terminal to the phosphorylated serine) and a hydrophobic residue at P-5. Both forms are strictly calcium dependent but belong to distinct families of protein kinases because they are distinct immunochemically.
Wang, Juan; Shibayama, Yuki; Kobori, Hiroyuki; Liu, Ya; Kobara, Hideki; Masaki, Tsutomu; Wang, Zhiyu
2017-01-01
High glucose has been demonstrated to induce angiotensinogen (AGT) synthesis in the renal proximal tubular cells (RPTCs) of rats, which may further activate the intrarenal renin-angiotensin system (RAS) and contribute to diabetic nephropathy. This study aimed to investigate the effects of high glucose on AGT in the RPTCs of human origin and identify the glucose-responsive transcriptional factor(s) that bind(s) to the DNA sequences of AGT promoter in human RPTCs. Human kidney (HK)-2 cells were treated with normal glucose (5.5 mM) and high glucose (15.0 mM), respectively. Levels of AGT mRNA and AGT secretion of HK-2 cells were measured by real-time polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA), respectively. Consecutive 5’-end deletion mutant constructs and different site-directed mutagenesis products of human AGT promoter sequences were respectively transfected into HK-2 cells, followed by AGT promoter activity measurement through dual luciferase assay. High glucose significantly augmented the levels of AGT mRNA and AGT secretion of HK-2 cells, compared with normal glucose treatment. High glucose also significantly augmented AGT promoter activity in HK-2 cells transfected with the constructs of human AGT promoter sequences, compared with normal glucose treatment. Hepatocyte nuclear factor (HNF)-5 was found to be one of the glucose-responsive transcriptional factors of AGT in human RPTCs, since the mutation of its binding sites within AGT promoter sequences abolished the above effects of high glucose on AGT promoter activity as well as levels of AGT mRNA and its secretion. The present study has demonstrated, for the first time, that high glucose augments AGT in human RPTCs through HNF-5, which provides a potential therapeutic target for diabetic nephropathy. PMID:29053707
Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A
2004-09-01
Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.
Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...
2015-09-21
The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jie; Overall, Christopher C.; Johnson, Rudd C.
The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less
Expanding proteome coverage with orthogonal-specificity α-Lytic proteases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meyer, Jesse G.; Kim, Sangtae; Maltby, David A.
2014-03-01
Bottom-up proteomics studies traditionally involve proteome digestion with a single protease, trypsin. However, trypsin alone does not generate peptides that encompass the entire proteome. Alternative proteases have been explored, but most have specificity for charged amino acid side chains. Therefore, additional proteases that improve proteome coverage by cleavage at sequences complimentary to trypsin may increase proteome coverage. We demonstrate the novel application of two proteases for bottom-up proteomics: wild type alpha-lytic protease (WaLP), and an active site mutant of WaLP, M190A alpha-lytic protease (MaLP). We assess several relevant factors including MS/MS fragmentation, peptide length, peptide yield, and protease specificity. Bymore » combining data from separate digestions with trypsin, LysC, WaLP, and MaLP, proteome coverage was increased 101% compared to trypsin digestion alone. To demonstrate how the gained sequence coverage can access additional PTM information, we show identification of a number of novel phosphorylation sites in the S. pombe proteome and include an illustrative example from the protein MPD2, wherein two novel sites are identified, one in a tryptic peptide too short to identify and the other in a sequence devoid of tryptic sites. The specificity of WaLP and MaLP for aliphatic amino acid side chains was particularly valuable for coverage of membrane protein sequences, which increased 350% when the data from trypsin, LysC, WaLP, and MaLP were combined.« less
Joseph, Thomas T; Osman, Roman
2012-01-01
In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand "seed region" have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways.
Joseph, Thomas T.; Osman, Roman
2012-01-01
In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand “seed region” have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways. PMID:23028290
The genomic structure of the human UFO receptor.
Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W
1993-02-01
Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.
Isolation of Notl sites from chromosome 22q11
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ten Hoeve, J.; Groffen, J.; Heisterkamp, N.
1993-12-01
Chromosome 22q11 contains a large number of interesting loci, including genes associated with cancer and developmental defects. The region is also the site of the lambda immunoglobulin variable and constants regions and the BCR, [gamma]-glutamyl transpeptidase, and GGT-like activity multigene families. Because of the complexities associated with mapping highly related gene families, the authors have examined the utility of mapping large areas of DNA using a defined approach. A total of 21 complete NotI sites from band q11 were cloned and ordered into six noncontiguous clusters of sites using a combination of somatic cell hybrid panels, NotI jumping and linkingmore » libraries, and fluorescence in situ hybridization. The largest cluster spanned an estimated 2 Mb of NotI fragments, the smallest 115 kb. Approximately 3.5 Mb of band q11 could be examined for rearrangements in NotI restriction enzyme fragments. A number of conserved sequences, two genes, and a minimum of two families of related sequences were identified adjacent to NotI sites. 51 refs., 5 figs., 4 tabs.« less
Discovery and characterization of a new family of lytic polysaccharide monooxygenases.
Hemsworth, Glyn R; Henrissat, Bernard; Davies, Gideon J; Walton, Paul H
2014-02-01
Lytic polysaccharide monooxygenases (LPMOs) are a recently discovered class of enzymes capable of oxidizing recalcitrant polysaccharides. They are attracting considerable attention owing to their potential use in biomass conversion, notably in the production of biofuels. Previous studies have identified two discrete sequence-based families of these enzymes termed AA9 (formerly GH61) and AA10 (formerly CBM33). Here, we report the discovery of a third family of LPMOs. Using a chitin-degrading exemplar from Aspergillus oryzae, we show that the three-dimensional structure of the enzyme shares some features of the previous two classes of LPMOs, including a copper active center featuring the 'histidine brace' active site, but is distinct in terms of its active site details and its EPR spectroscopy. The newly characterized AA11 family expands the LPMO clan, potentially broadening both the range of potential substrates and the types of reactive copper-oxygen species formed at the active site of LPMOs.
Leong, Wai-Mun; Ripen, Adiratna Mat; Mirsafian, Hoda; Mohamad, Saharuddin Bin; Merican, Amir Feisal
2018-06-07
High-depth next generation sequencing data provide valuable insights into the number and distribution of RNA editing events. Here, we report the RNA editing events at cellular level of human primary monocyte using high-depth whole genomic and transcriptomic sequencing data. We identified over a ten thousand putative RNA editing sites and 69% of the sites were A-to-I editing sites. The sites enriched in repetitive sequences and intronic regions. High-depth sequencing datasets revealed that 90% of the canonical sites were edited at lower frequencies (<0.7). Single and multiple human monocytes and brain tissues samples were analyzed through genome sequence independent approach. The later approach was observed to identify more editing sites. Monocytes was observed to contain more C-to-U editing sites compared to brain tissues. Our results establish comparable pipeline that can address current limitations as well as demonstrate the potential for highly sensitive detection of RNA editing events in single cell type. Copyright © 2018 Elsevier Inc. All rights reserved.
Hassan, Mubashir; Abbas, Qamar; Raza, Hussain; Moustafa, Ahmed A; Seo, Sung-Yum
2017-07-25
Misfolding and structural alteration in proteins lead to serious malfunctions and cause various diseases in humans. Mutations at the active binding site in tyrosinase impair structural stability and cause lethal albinism by abolishing copper binding. To evaluate the histidine mutational effect, all mutated structures were built using homology modelling. The protein sequence was retrieved from the UniProt database, and 3D models of original and mutated human tyrosinase sequences were predicted by changing the residual positions within the target sequence separately. Structural and mutational analyses were performed to interpret the significance of mutated residues (N 180 , R 202 , Q 202 , R 211 , Y 363 , R 367 , Y 367 and D 390 ) at the active binding site of tyrosinases. CSpritz analysis depicted that 23.25% residues actively participate in the instability of tyrosinase. The accuracy of predicted models was confirmed through online servers ProSA-web, ERRAT score and VERIFY 3D values. The theoretical pI and GRAVY generated results also showed the accuracy of the predicted models. The CCA negative correlation results depicted that the replacement of mutated residues at His within the active binding site disturbs the structural stability of tyrosinases. The predicted CCA scores of Tyr 367 (-0.079) and Q/R 202 (0.032) revealed that both mutations have more potential to disturb the structural stability. MD simulation analyses of all predicted models justified that Gln 202 , Arg 202 , Tyr 367 and D 390 replacement made the protein structures more susceptible to destabilization. Mutational results showed that the replacement of His with Q/R 202 and Y/R 363 has a lethal effect and may cause melanin associated diseases such as OCA1. Taken together, our computational analysis depicts that the mutated residues such as Q/R 202 and Y/R 363 actively participate in instability and misfolding of tyrosinases, which may govern OCA1 through disturbing the melanin biosynthetic pathway.
Lee, Sooncheol; Kang, Changwon
2011-05-06
The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.
The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.
Murray, Vincent; Chen, Jon K; Tanaka, Mark M
2016-07-01
The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.
RNase L targets distinct sites in influenza A virus RNAs.
Cooper, Daphne A; Banerjee, Shuvojit; Chakrabarti, Arindam; García-Sastre, Adolfo; Hesselberth, Jay R; Silverman, Robert H; Barton, David J
2015-03-01
Influenza A virus (IAV) infections are influenced by type 1 interferon-mediated antiviral defenses and by viral countermeasures to these defenses. When IAV NS1 protein is disabled, RNase L restricts virus replication; however, the RNAs targeted for cleavage by RNase L under these conditions have not been defined. In this study, we used deep-sequencing methods to identify RNase L cleavage sites within host and viral RNAs from IAV PR8ΔNS1-infected A549 cells. Short hairpin RNA knockdown of RNase L allowed us to distinguish between RNase L-dependent and RNase L-independent cleavage sites. RNase L-dependent cleavage sites were evident at discrete locations in IAV RNA segments (both positive and negative strands). Cleavage in PB2, PB1, and PA genomic RNAs suggests that viral RNPs are susceptible to cleavage by RNase L. Prominent amounts of cleavage mapped to specific regions within IAV RNAs, including some areas of increased synonymous-site conservation. Among cellular RNAs, RNase L-dependent cleavage was most frequent at precise locations in rRNAs. Our data show that RNase L targets specific sites in both host and viral RNAs to restrict influenza virus replication when NS1 protein is disabled. RNase L is a critical component of interferon-regulated and double-stranded-RNA-activated antiviral host responses. We sought to determine how RNase L exerts its antiviral activity during influenza virus infection. We enhanced the antiviral activity of RNase L by disabling a viral protein, NS1, that inhibits the activation of RNase L. Then, using deep-sequencing methods, we identified the host and viral RNAs targeted by RNase L. We found that RNase L cleaved viral RNAs and rRNAs at very precise locations. The direct cleavage of IAV RNAs by RNase L highlights an intimate battle between viral RNAs and an antiviral endonuclease. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Pseudoexon activation increases phenotype severity in a Becker muscular dystrophy patient.
Greer, Kane; Mizzi, Kayla; Rice, Emily; Kuster, Lukas; Barrero, Roberto A; Bellgard, Matthew I; Lynch, Bryan J; Foley, Aileen Reghan; O Rathallaigh, Eoin; Wilton, Steve D; Fletcher, Sue
2015-07-01
We report a dystrophinopathy patient with an in-frame deletion of DMD exons 45-47, and therefore a genetic diagnosis of Becker muscular dystrophy, who presented with a more severe than expected phenotype. Analysis of the patient DMD mRNA revealed an 82 bp pseudoexon, derived from intron 44, that disrupts the reading frame and is expected to yield a nonfunctional dystrophin. Since the sequence of the pseudoexon and canonical splice sites does not differ from the reference sequence, we concluded that the genomic rearrangement promoted recognition of the pseudoexon, causing a severe dystrophic phenotype. We characterized the deletion breakpoints and identified motifs that might influence selection of the pseudoexon. We concluded that the donor splice site was strengthened by juxtaposition of intron 47, and loss of intron 44 silencer elements, normally located downstream of the pseudoexon donor splice site, further enhanced pseudoexon selection and inclusion in the DMD transcript in this patient.
Swaney, Danielle L; Wenger, Craig D; Thomson, James A; Coon, Joshua J
2009-01-27
Protein phosphorylation is central to the understanding of cellular signaling, and cellular signaling is suggested to play a major role in the regulation of human embryonic stem (ES) cell pluripotency. Here, we describe the use of conventional tandem mass spectrometry-based sequencing technology--collision-activated dissociation (CAD)--and the more recently developed method electron transfer dissociation (ETD) to characterize the human ES cell phosphoproteome. In total, these experiments resulted in the identification of 11,995 unique phosphopeptides, corresponding to 10,844 nonredundant phosphorylation sites, at a 1% false discovery rate (FDR). Among these phosphorylation sites are 5 localized to 2 pluripotency critical transcription factors--OCT4 and SOX2. From these experiments, we conclude that ETD identifies a larger number of unique phosphopeptides than CAD (8,087 to 3,868), more frequently localizes the phosphorylation site to a specific residue (49.8% compared with 29.6%), and sequences whole classes of phosphopeptides previously unobserved.
Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S
2016-01-01
Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271
Manoharan, Vinoth K; Varghese, Berin P; Paldurai, Anandan; Samal, Siba K
2018-01-01
Newcastle disease (ND) causes severe economic loss to poultry industry worldwide. Frequent outbreaks of ND in commercial chickens vaccinated with live vaccines suggest a need to develop improved vaccines that are genetically matched against circulating Newcastle disease virus (NDV) strains. In this study, the fusion protein cleavage site (FPCS) sequence of NDV strain Banjarmasin/010 (Banj), a genotype VII NDV, was individually modified using primer mutagenesis to those of avian paramyxovirus (APMV) serotypes 2, 7 and 8 and compared with the recombinant Banjarmasin (rBanj) with avirulent NDV LaSota cleavage site (rBanj-LaSota). These FPCS mutations changed the in vitro cell-to-cell fusion activity and made rBanj FPCS mutant viruses highly attenuated in chickens. When chickens immunized with the rBanj FPCS mutant viruses and challenged with the virulent Banj, there was reduced challenge virus shedding observed compared to chickens immunized with the heterologous vaccine strain LaSota. Among the genotype VII NDV Banj vaccine candidates, rBanj-LaSota and rBanj containing FPCS of APMV-8 induced highest neutralizing antibody titers and protected chickens with reduced challenge virus shedding. These results show the effect of the F protein cleavage site sequence in generating genotype VII matched NDV vaccines.
Wallace, A. C.; Borkakoti, N.; Thornton, J. M.
1997-01-01
It is well established that sequence templates such as those in the PROSITE and PRINTS databases are powerful tools for predicting the biological function and tertiary structure for newly derived protein sequences. The number of X-ray and NMR protein structures is increasing rapidly and it is apparent that a 3D equivalent of the sequence templates is needed. Here, we describe an algorithm called TESS that automatically derives 3D templates from structures deposited in the Brookhaven Protein Data Bank. While a new sequence can be searched for sequence patterns, a new structure can be scanned against these 3D templates to identify functional sites. As examples, 3D templates are derived for enzymes with an O-His-O "catalytic triad" and for the ribonucleases and lysozymes. When these 3D templates are applied to a large data set of nonidentical proteins, several interesting hits are located. This suggests that the development of a 3D template database may help to identify the function of new protein structures, if unknown, as well as to design proteins with specific functions. PMID:9385633
Yasukochi, Yoshiki; Satta, Yoko
2015-03-25
The human cytochrome P450 (CYP) 2D6 gene is a member of the CYP2D gene subfamily, along with the CYP2D7P and CYP2D8P pseudogenes. Although the CYP2D6 enzyme has been studied extensively because of its clinical importance, the evolution of the CYP2D subfamily has not yet been fully understood. Therefore, the goal of this study was to reveal the evolutionary process of the human drug metabolic system. Here, we investigate molecular evolution of the CYP2D subfamily in primates by comparing 14 CYP2D sequences from humans to New World monkey genomes. Window analysis and statistical tests revealed that entire genomic sequences of paralogous genes were extensively homogenized by gene conversion during molecular evolution of CYP2D genes in primates. A neighbor-joining tree based on genomic sequences at the nonsubstrate recognition sites showed that CYP2D6 and CYP2D8 genes were clustered together due to gene conversion. In contrast, a phylogenetic tree using amino acid sequences at substrate recognition sites did not cluster the CYP2D6 and CYP2D8 genes, suggesting that the functional constraint on substrate specificity is one of the causes for purifying selection at the substrate recognition sites. Our results suggest that the CYP2D gene subfamily in primates has evolved to maintain the regioselectivity for a substrate hydroxylation activity between individual enzymes, even though extensive gene conversion has occurred across CYP2D coding sequences. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Yasukochi, Yoshiki; Satta, Yoko
2015-01-01
The human cytochrome P450 (CYP) 2D6 gene is a member of the CYP2D gene subfamily, along with the CYP2D7P and CYP2D8P pseudogenes. Although the CYP2D6 enzyme has been studied extensively because of its clinical importance, the evolution of the CYP2D subfamily has not yet been fully understood. Therefore, the goal of this study was to reveal the evolutionary process of the human drug metabolic system. Here, we investigate molecular evolution of the CYP2D subfamily in primates by comparing 14 CYP2D sequences from humans to New World monkey genomes. Window analysis and statistical tests revealed that entire genomic sequences of paralogous genes were extensively homogenized by gene conversion during molecular evolution of CYP2D genes in primates. A neighbor-joining tree based on genomic sequences at the nonsubstrate recognition sites showed that CYP2D6 and CYP2D8 genes were clustered together due to gene conversion. In contrast, a phylogenetic tree using amino acid sequences at substrate recognition sites did not cluster the CYP2D6 and CYP2D8 genes, suggesting that the functional constraint on substrate specificity is one of the causes for purifying selection at the substrate recognition sites. Our results suggest that the CYP2D gene subfamily in primates has evolved to maintain the regioselectivity for a substrate hydroxylation activity between individual enzymes, even though extensive gene conversion has occurred across CYP2D coding sequences. PMID:25808902
Park, Hongmarn; Yakhnin, Helen; Connolly, Michael; Romeo, Tony
2015-01-01
ABSTRACT Csr is a conserved global regulatory system that represses or activates gene expression posttranscriptionally. CsrA of Escherichia coli is a homodimeric RNA binding protein that regulates transcription elongation, translation initiation, and mRNA stability by binding to the 5′ untranslated leader or initial coding sequence of target transcripts. pnp mRNA, encoding the 3′ to 5′ exoribonuclease polynucleotide phosphorylase (PNPase), was previously identified as a CsrA target by transcriptome sequencing (RNA-seq). Previous studies also showed that RNase III and PNPase participate in a pnp autoregulatory mechanism in which RNase III cleavage of the untranslated leader, followed by PNPase degradation of the resulting 5′ fragment, leads to pnp repression by an undefined translational repression mechanism. Here we demonstrate that CsrA binds to two sites in pnp leader RNA but only after the transcript is fully processed by RNase III and PNPase. In the absence of processing, both of the binding sites are sequestered in an RNA secondary structure, which prevents CsrA binding. The CsrA dimer bridges the upstream high-affinity site to the downstream site that overlaps the pnp Shine-Dalgarno sequence such that bound CsrA causes strong repression of pnp translation. CsrA-mediated translational repression also leads to a small increase in the pnp mRNA decay rate. Although CsrA has been shown to regulate translation and mRNA stability of numerous genes in a variety of organisms, this is the first example in which prior mRNA processing is required for CsrA-mediated regulation. IMPORTANCE CsrA protein represses translation of numerous mRNA targets, typically by binding to multiple sites in the untranslated leader region preceding the coding sequence. We found that CsrA represses translation of pnp by binding to two sites in the pnp leader transcript but only after it is processed by RNase III and PNPase. Processing by these two ribonucleases alters the mRNA secondary structure such that it becomes accessible to the ribosome for translation as well as to CsrA. As one of the CsrA binding sites overlaps the pnp ribosome binding site, bound CsrA prevents ribosome binding. This is the first example in which regulation by CsrA requires prior mRNA processing and should link pnp expression to conditions affecting CsrA activity. PMID:26438818
Detection of possible restriction sites for type II restriction enzymes in DNA sequences.
Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L
2011-01-01
In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.
Hidalgo, A R; Akond, M A; Kita, K; Kataoka, M; Shimizu, S
2001-12-01
Two conjugated polyketone reductases (CPRs) were isolated from Candida parapsilosis IFO 0708. The primary structures of CPRs (C1 and C2) were analyzed by amino acid sequencing. The amino acid sequences of both enzymes had high similarity to those of several proteins of the aldo-keto-reductase (AKR) superfamily. However, several amino acid residues in the putative active sites of AKRs were not conserved in CPRs-C1 and -C2.
NASA Technical Reports Server (NTRS)
Nordheim, A.; Rich, A.
1983-01-01
Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.
Harris, Golda G.; Lombardi, Patrick M.; Pemberton, Travis A.; Matsui, Tsutomu; Weiss, Thomas M.; Cole, Kathryn E.; Köksal, Mustafa; Murphy, Frank V.; Vedula, L. Sangeetha; Chou, Wayne K.W.; Cane, David E.; Christianson, David W.
2015-01-01
Geosmin synthase from Streptomyces coelicolor (ScGS) catalyzes an unusual, metal-dependent terpenoid cyclization and fragmentation reaction sequence. Two distinct active sites are required for catalysis: the N-terminal domain catalyzes the ionization and cyclization of farnesyl diphosphate to form germacradienol and inorganic pyrophosphate (PPi), and the C-terminal domain catalyzes the protonation, cyclization, and fragmentation of germacradienol to form geosmin and acetone through a retro-Prins reaction. A unique αα domain architecture is predicted for ScGS based on amino acid sequence: each domain contains the metal-binding motifs typical of a class I terpenoid cyclase, and each domain requires Mg2+ for catalysis. Here, we report the X-ray crystal structure of the unliganded N-terminal domain of ScGS and the structure of its complex with 3 Mg2+ ions and alendronate. These structures highlight conformational changes required for active site closure and catalysis. Although neither full-length ScGS nor constructs of the C-terminal domain could be crystallized, homology models of the C-terminal domain were constructed based on ~36% sequence identity with the N-terminal domain. Small-angle X-ray scattering experiments yield low resolution molecular envelopes into which the N-terminal domain crystal structure and the C-terminal domain homology model were fit, suggesting possible αα domain architectures as frameworks for bifunctional catalysis. PMID:26598179
Molecular determinants of origin discrimination by Orc1 initiators in archaea.
Dueber, Erin C; Costa, Alessandro; Corn, Jacob E; Bell, Stephen D; Berger, James M
2011-05-01
Unlike bacteria, many eukaryotes initiate DNA replication from genomic sites that lack apparent sequence conservation. These loci are identified and bound by the origin recognition complex (ORC), and subsequently activated by a cascade of events that includes recruitment of an additional factor, Cdc6. Archaeal organisms generally possess one or more Orc1/Cdc6 homologs, belonging to the Initiator clade of ATPases associated with various cellular activities (AAA(+)) superfamily; however, these proteins recognize specific sequences within replication origins. Atomic resolution studies have shown that archaeal Orc1 proteins contact double-stranded DNA through an N-terminal AAA(+) domain and a C-terminal winged-helix domain (WHD), but use remarkably few base-specific contacts. To investigate the biochemical effects of these associations, we mutated the DNA-interacting elements of the Orc1-1 and Orc1-3 paralogs from the archaeon Sulfolobus solfataricus, and tested their effect on origin binding and deformation. We find that the AAA(+) domain has an unpredicted role in controlling the sequence selectivity of DNA binding, despite an absence of base-specific contacts to this region. Our results show that both the WHD and ATPase region influence origin recognition by Orc1/Cdc6, and suggest that not only DNA sequence, but also local DNA structure help define archaeal initiator binding sites. © The Author(s) 2011. Published by Oxford University Press.
Merotto, Aldo; Jasieniuk, Marie; Osuna, Maria D; Vidotto, Francesco; Ferrero, Aldo; Fischer, Albert J
2009-02-25
Resistance to ALS-inhibiting herbicides in Cyperus difformis has evolved rapidly in many rice areas worldwide. This study identified the mechanism of resistance, assessed cross-resistance patterns to all five chemical groups of ALS-inhibiting herbicides in four C. difformis biotypes, and attempted to sequence the ALS gene. Whole-plant and ALS enzyme activity dose-response assays indicated that the WA biotype was resistant to all ALS-inhibiting herbicides evaluated. The IR biotype was resistant to bensulfuron-methyl, orthosulfamuron, imazethapyr, and propoxycarbazone-sodium and less resistant to bispyribac-sodium and halosulfuron-methyl, and susceptible to penoxsulam. ALS enzyme activity assays indicated that resistance is due to an altered target site yet mutations previously found to endow target-site resistance in weeds were not detected in the sequences obtained. The inability to detect resistance mutations in C. difformis may result from the presence of additional ALS genes, which were not amplified by the primers used. This study reports the first ALS gene sequence from Cyperus difformis. Certain ALS-inhibiting herbicides can still be used to control some resistant C. difformis biotypes. However, because cross-resistance to all five classes of ALS-inhibitors was detected in other resistant biotypes, these herbicides should only be used within an integrated weed management program designed to delay the evolution of herbicide resistance.
Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carte, Jason; Wang, Ruiying; Li, Hong
An RNA-based gene silencing pathway that protects bacteria and archaea from viruses and other genome invaders is hypothesized to arise from guide RNAs encoded by CRISPR loci and proteins encoded by the cas genes. CRISPR loci contain multiple short invader-derived sequences separated by short repeats. The presence of virus-specific sequences within CRISPR loci of prokaryotic genomes confers resistance against corresponding viruses. The CRISPR loci are transcribed as long RNAs that must be processed to smaller guide RNAs. Here we identified Pyrococcus furiosus Cas6 as a novel endoribonuclease that cleaves CRISPR RNAs within the repeat sequences to release individual invader targetingmore » RNAs. Cas6 interacts with a specific sequence motif in the 5{prime} region of the CRISPR repeat element and cleaves at a defined site within the 3{prime} region of the repeat. The 1.8 angstrom crystal structure of the enzyme reveals two ferredoxin-like folds that are also found in other RNA-binding proteins. The predicted active site of the enzyme is similar to that of tRNA splicing endonucleases, and concordantly, Cas6 activity is metal-independent. cas6 is one of the most widely distributed CRISPR-associated genes. Our findings indicate that Cas6 functions in the generation of CRISPR-derived guide RNAs in numerous bacteria and archaea.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.
1987-06-01
To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less
Mohr, Peter G; Deng, Yi-Mo; McKimm-Breschkin, Jennifer L
2015-04-22
The neuraminidases (NAs) of MDCK passaged human influenza A(H3N2) strains isolated since 2005 are reported to have dual functions of cleavage of sialic acid and receptor binding. NA agglutination of red blood cells (RBCs) can be inhibited by neuraminidase inhibitors (NAIs), thus distinguishing it from haemagglutinin (HA) binding. We wanted to know if viruses prior to 2005 can demonstrate this property. Pairs of influenza A(H3N2) isolates ranging from 1993-2008 passaged in parallel only in eggs or in MDCK cells were tested for inhibition of haemagglutination by various NAIs. Only viruses isolated since 1994 and cultured in MDCK cells bound chicken RBCs solely through their NA. NAI inhibition of agglutination of turkey RBCs was seen for some, but not all of these same MDCK grown viruses. Efficacy of inhibition of enzyme activity and haemagglutination differed between NAIs. For many viruses lower concentrations of oseltamivir could inhibit agglutination compared to zanamivir, although they could both inhibit enzyme activity at comparable concentrations. An E119V mutation reduced sensitivity to oseltamivir and 4-aminoDANA for both the enzyme assay and inhibition of agglutination. Sequence analysis of the NAs and HAs of some paired viruses revealed mutations in the haemagglutinin of all egg passaged viruses. For many of the paired egg and MDCK cultured viruses we found no differences in their NA sequences by Sanger sequencing. However, deep sequencing of MDCK grown isolates revealed low levels of variant populations with mutations at either D151 or T148 in the NA, suggesting mutations at either site may be able to confer this property. The NA active site of MDCK cultured human influenza A(H3N2) viruses isolated since 1994 can express dual enzyme and receptor binding functions. Binding correlated with either D151 or T148 mutations. The catalytic and receptor binding sites do not appear to be structurally identical since relative concentrations of the NAIs to inhibit enzyme activity and agglutination differ.
The Origins of Specificity in the Microcin-Processing Protease TldD/E.
Ghilarov, Dmitry; Serebryakova, Marina; Stevenson, Clare E M; Hearnshaw, Stephen J; Volkov, Dmitry S; Maxwell, Anthony; Lawson, David M; Severinov, Konstantin
2017-10-03
TldD and TldE proteins are involved in the biosynthesis of microcin B17 (MccB17), an Escherichia coli thiazole/oxazole-modified peptide toxin targeting DNA gyrase. Using a combination of biochemical and crystallographic methods we show that E. coli TldD and TldE interact to form a heterodimeric metalloprotease. TldD/E cleaves the N-terminal leader sequence from the modified MccB17 precursor peptide, to yield mature antibiotic, while it has no effect on the unmodified peptide. Both proteins are essential for the activity; however, only the TldD subunit forms a novel metal-containing active site within the hollow core of the heterodimer. Peptide substrates are bound in a sequence-independent manner through β sheet interactions with TldD and are likely cleaved via a thermolysin-type mechanism. We suggest that TldD/E acts as a "molecular pencil sharpener": unfolded polypeptides are fed through a narrow channel into the active site and processively truncated through the cleavage of short peptides from the N-terminal end. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Zheng, Zhaoqing; Keifer, Joyce
2014-01-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I–III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI–III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression. PMID:24443176
Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce
2014-08-01
Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.
Van Sandt, Vicky S. T.; Stieperaere, Herman; Guisez, Yves; Verbelen, Jean-Pierre; Vissenberg, Kris
2007-01-01
Background and Aims In angiosperms xyloglucan endotransglucosylase (XET)/hydrolase (XTH) is involved in reorganization of the cell wall during growth and development. The location of oligo-xyloglucan transglucosylation activity and the presence of XTH expressed sequence tags (ESTs) in the earliest diverging extant plants, i.e. in bryophytes and algae, down to the Phaeophyta was examined. The results provide information on the presence of an XET growth mechanism in bryophytes and algae and contribute to the understanding of the evolution of cell wall elongation in general. Methods Representatives of the different plant lineages were pressed onto an XET test paper and assayed. XET or XET-related activity was visualized as the incorporation of fluorescent signal. The Physcomitrella genome database was screened for the presence of XTHs. In addition, using the 3′ RACE technique searches were made for the presence of possible XTH ESTs in the Charophyta. Key Results XET activity was found in the three major divisions of bryophytes at sites corresponding to growing regions. In the Physcomitrella genome two putative XTH-encoding cDNA sequences were identified that contain all domains crucial for XET activity. Furthermore, XET activity was located at the sites of growth in Chara (Charophyta) and Ulva (Chlorophyta) and a putative XTH ancestral enzyme in Chara was identified. No XET activity was identified in the Rhodophyta or Phaeophyta. Conclusions XET activity was shown to be present in all major groups of green plants. These data suggest that an XET-related growth mechanism originated before the evolutionary divergence of the Chlorobionta and open new insights in the evolution of the mechanisms of primary cell wall expansion. PMID:17098750
Williams, Kevin R; Doak, Thomas G; Herrick, Glenn
2002-01-01
Background Ciliates employ massive chromatid breakage and de novo telomere formation during generation of the somatic macronucleus. Positions flanking the 81-MAC locus are reproducibly cut. But those flanking the Common Region are proposed to often escape cutting, generating three nested macronuclear chromosomes, two retaining "arms" still appended to the Common Region. Arm-distal positions must differ (in cis) from the Common Region flanks. Results The Common-Region-flanking positions also differ from the arm-distal positions in that they are "multi-TAS" regions: anchored PCR shows heterogeneous patterns of telomere addition sites, but arm-distal sites do not. The multi-TAS patterns are reproducible, but are sensitive to the sequence of the allele being processed. Thus, random degradation following chromatid cutting does not create this heterogeneity; these telomere addition sites also must be dictated by cis-acting sequences. Conclusions Most ciliates show such micro-heterogeneity in the precise positions of telomere addition sites. Telomerase is believed to be tightly associated with, and act in concert with, the chromatid-cutting nuclease: heterogeneity must be the result of intervening erosion activity. Our "weak-sites" hypothesis explains the correlation between alternative chromatid cutting at the Common Region boundaries and their multi-TAS character: when the chromatid-breakage machine encounters either a weak binding site or a weak cut site at these regions, then telomerase dissociates prematurely, leaving the new end subject to erosion by an exonuclease, which pauses at cis-acting sequences; telomerase eventually heals these resected termini. Finally, we observe TAS positioning influenced by trans-allelic interactions, reminiscent of transvection. PMID:12199911
Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu
2006-06-01
VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation.
Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu
2006-01-01
VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation. PMID:16757746
Combined sequence and structure analysis of the fungal laccase family.
Kumar, S V Suresh; Phale, Prashant S; Durani, S; Wangikar, Pramod P
2003-08-20
Plant and fungal laccases belong to the family of multi-copper oxidases and show much broader substrate specificity than other members of the family. Laccases have consequently been of interest for potential industrial applications. We have analyzed the essential sequence features of fungal laccases based on multiple sequence alignments of more than 100 laccases. This has resulted in identification of a set of four ungapped sequence regions, L1-L4, as the overall signature sequences that can be used to identify the laccases, distinguishing them within the broader class of multi-copper oxidases. The 12 amino acid residues in the enzymes serving as the copper ligands are housed within these four identified conserved regions, of which L2 and L4 conform to the earlier reported copper signature sequences of multi-copper oxidases while L1 and L3 are distinctive to the laccases. The mapping of regions L1-L4 on to the three-dimensional structure of the Coprinus cinerius laccase indicates that many of the non-copper-ligating residues of the conserved regions could be critical in maintaining a specific, more or less C-2 symmetric, protein conformational motif characterizing the active site apparatus of the enzymes. The observed intraprotein homologies between L1 and L3 and between L2 and L4 at both the structure and the sequence levels suggest that the quasi C-2 symmetric active site conformational motif may have arisen from a structural duplication event that neither the sequence homology analysis nor the structure homology analysis alone would have unraveled. Although the sequence and structure homology is not detectable in the rest of the protein, the relative orientation of region L1 with L2 is similar to that of L3 with L4. The structure duplication of first-shell and second-shell residues has become cryptic because the intraprotein sequence homology noticeable for a given laccase becomes significant only after comparing the conservation pattern in several fungal laccases. The identified motifs, L1-L4, can be useful in searching the newly sequenced genomes for putative laccase enzymes. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 83: 386-394, 2003.
Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S
1992-09-05
We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or the consensus ERE was blunted by the antiestrogen tamoxifen. Based on these studies, we believe the 3'-fos ERE sequence we have identified may be a major cis-acting element involved in the physiological regulation of the gene by estrogens in vivo.
Oem, Jae-Ku; Xiang, Zhonghua; Zhou, Yan; Babiuk, Lorne A; Liu, Qiang
2007-09-01
Hepatitis C virus (HCV) causes severe liver diseases in a large population worldwide. HCV protein translation is controlled by an internal ribosomal entry site (IRES) within the 5'-untranslated region (UTR). HCV IRES-dependent translation is critical for HCV-associated pathogenesis. To develop a plasmid DNA transfection system by using RNA polymerase I promoter and terminator sequences for studying HCV IRES-dependent translation. A gene cassette containing HCV 5'-UTR, Renilla luciferase reporter gene, and HCV 3'-UTR was inserted between RNA polymerase I promoter and terminator sequences. HCV IRES-directed translation was determined by luciferase assay after transfection. Transfection of the RNA polymerase I-HCV IRES plasmid into human hepatoma Huh-7 and HepG2 cells resulted in luciferase gene expression. Deletion of the IIIf domain in HCV IRES dramatically reduced luciferase activity. Our results indicated that the plasmid vector system-based on RNA polymerase I promoter and terminator sequences represents an effective approach for the study of HCV IRES-dependent translation.
Genotype to Phenotype Mapping of the E. coli lac Promoter
NASA Astrophysics Data System (ADS)
Otwinowski, Jakub; Nemenman, Ilya
2014-03-01
Genotype-to-phenotype maps and the related fitness landscapes that include epistatic interactions are difficult to measure because of their high dimensional structure. Here we construct such a map using the recently collected corpora of high-throughput sequence data from the 75 base pairs long mutagenized E. coli lac promoter region, where each sequence is associated with induced transcriptional activity measured by a fluorescent reporter. We find that the additive (non-epistatic) contributions of individual mutations account for about two-thirds of the explainable phenotype variance, while pairwise epistasis explains about 7% of the variance for the full mutagenized sequence and about 15% for the subsequence associated with protein binding sites. Surprisingly, there is no evidence for third order epistatic contributions, and our inferred fitness landscape is essentially single peaked, with a small amount of antagonistic epistasis. We identify transcription factor (CRP) and RNA polymerase binding sites in the promotor region and their interactions. We conclude with a cautionary note that inferred properties of fitness landscapes may be severely influenced by biases in the sequence data. Funded in part by HFSP and James S. McDonnell Foundation.
Effect of the SH3-SH2 domain linker sequence on the structure of Hck kinase.
Meiselbach, Heike; Sticht, Heinrich
2011-08-01
The coordination of activity in biological systems requires the existence of different signal transduction pathways that interact with one another and must be precisely regulated. The Src-family tyrosine kinases, which are found in many signaling pathways, differ in their physiological function despite their high overall structural similarity. In this context, the differences in the SH3-SH2 domain linkers might play a role for differential regulation, but the structural consequences of linker sequence remain poorly understood. We have therefore performed comparative molecular dynamics simulations of wildtype Hck and of a mutant Hck in which the SH3-SH2 domain linker is replaced by the corresponding sequence from the homologous kinase Lck. These simulations reveal that linker replacement not only affects the orientation of the SH3 domain itself, but also leads to an alternative conformation of the activation segment in the Hck kinase domain. The sequence of the SH3-SH2 domain linker thus exerts a remote effect on the active site geometry and might therefore play a role in modulating the structure of the inactive kinase or in fine-tuning the activation process itself.
Molecular evolution of miraculin-like proteins in soybean Kunitz super-family.
Selvakumar, Purushotham; Gahloth, Deepankar; Tomar, Prabhat Pratap Singh; Sharma, Nidhi; Sharma, Ashwani Kumar
2011-12-01
Miraculin-like proteins (MLPs) belong to soybean Kunitz super-family and have been characterized from many plant families like Rutaceae, Solanaceae, Rubiaceae, etc. Many of them possess trypsin inhibitory activity and are involved in plant defense. MLPs exhibit significant sequence identity (~30-95%) to native miraculin protein, also belonging to Kunitz super-family compared with a typical Kunitz family member (~30%). The sequence and structure-function comparison of MLPs with that of a classical Kunitz inhibitor have demonstrated that MLPs have evolved to form a distinct group within Kunitz super-family. Sequence analysis of new genes along with available MLP sequences in the literature revealed three major groups for these proteins. A significant feature of Rutaceae MLP type 2 sequences is the presence of phosphorylation motif. Subtle changes are seen in putative reactive loop residues among different MLPs suggesting altered specificities to specific proteases. In phylogenetic analysis, Rutaceae MLP type 1 and type 2 proteins clustered together on separate branches, whereas native miraculin along with other MLPs formed distinct clusters. Site-specific positive Darwinian selection was observed at many sites in both the groups of Rutaceae MLP sequences with most of the residues undergoing positive selection located in loop regions. The results demonstrate the sequence and thereby the structure-function divergence of MLPs as a distinct group within soybean Kunitz super-family due to biotic and abiotic stresses of local environment.
The hppA gene of Helicobacter pylori encodes the class C acid phosphatase precursor.
Godlewska, Renata; Bujnicki, Janusz M; Ostrowski, Jerzy; Jagusztyn-Krynicka, Elzbieta K
2002-08-14
Screening of the Helicobacter pylori genomic library with sera from infected humans and from immunized rabbits resulted in identification of the 25 kDa protein cell envelope (HppA) which exhibits acid phosphatase activity. Enzyme activity was demonstrated by specific enzymatic assays with whole-cell protein preparations of H. pylori strain N6 and from Escherichia coli carrying the hppA gene (pUWM192). HppA showed optimum activity at pH 5.6 and was resistant to inhibition by EDTA. Bioinformatics analysis and site-directed mutagenesis of two putative active site residues (D73 and D192) provide further insight into the sequence-structure-function relationships of HppA as a member of the DDDD phosphohydrolase superfamily.
The Centromere: Chromatin Foundation for the Kinetochore Machinery
Fukagawa, Tatsuo; Earnshaw, William C.
2014-01-01
Since discovery of the centromere-specific histone H3 variant CENP-A, centromeres have come to be defined as chromatin structures that establish the assembly site for the complex kinetochore machinery. In most organisms, centromere activity is defined epigenetically, rather than by specific DNA sequences. In this review, we describe selected classic work and recent progress in studies of centromeric chromatin with a focus on vertebrates. We consider possible roles for repetitive DNA sequences found at most centromeres, chromatin factors and modifications that assemble and activate CENP-A chromatin for kinetochore assembly, plus the use of artificial chromosomes and kinetochores to study centromere function. PMID:25203206
LenVarDB: database of length-variant protein domains.
Mutt, Eshita; Mathew, Oommen K; Sowdhamini, Ramanathan
2014-01-01
Protein domains are functionally and structurally independent modules, which add to the functional variety of proteins. This array of functional diversity has been enabled by evolutionary changes, such as amino acid substitutions or insertions or deletions, occurring in these protein domains. Length variations (indels) can introduce changes at structural, functional and interaction levels. LenVarDB (freely available at http://caps.ncbs.res.in/lenvardb/) traces these length variations, starting from structure-based sequence alignments in our Protein Alignments organized as Structural Superfamilies (PASS2) database, across 731 structural classification of proteins (SCOP)-based protein domain superfamilies connected to 2 730 625 sequence homologues. Alignment of sequence homologues corresponding to a structural domain is available, starting from a structure-based sequence alignment of the superfamily. Orientation of the length-variant (indel) regions in protein domains can be visualized by mapping them on the structure and on the alignment. Knowledge about location of length variations within protein domains and their visual representation will be useful in predicting changes within structurally or functionally relevant sites, which may ultimately regulate protein function. Non-technical summary: Evolutionary changes bring about natural changes to proteins that may be found in many organisms. Such changes could be reflected as amino acid substitutions or insertions-deletions (indels) in protein sequences. LenVarDB is a database that provides an early overview of observed length variations that were set among 731 protein families and after examining >2 million sequences. Indels are followed up to observe if they are close to the active site such that they can affect the activity of proteins. Inclusion of such information can aid the design of bioengineering experiments.
2014-01-01
Background Protein sites evolve at different rates due to functional and biophysical constraints. It is usually considered that the main structural determinant of a site’s rate of evolution is its Relative Solvent Accessibility (RSA). However, a recent comparative study has shown that the main structural determinant is the site’s Local Packing Density (LPD). LPD is related with dynamical flexibility, which has also been shown to correlate with sequence variability. Our purpose is to investigate the mechanism that connects a site’s LPD with its rate of evolution. Results We consider two models: an empirical Flexibility Model and a mechanistic Stress Model. The Flexibility Model postulates a linear increase of site-specific rate of evolution with dynamical flexibility. The Stress Model, introduced here, models mutations as random perturbations of the protein’s potential energy landscape, for which we use simple Elastic Network Models (ENMs). To account for natural selection we assume a single active conformation and use basic statistical physics to derive a linear relationship between site-specific evolutionary rates and the local stress of the mutant’s active conformation. We compare both models on a large and diverse dataset of enzymes. In a protein-by-protein study we found that the Stress Model outperforms the Flexibility Model for most proteins. Pooling all proteins together we show that the Stress Model is strongly supported by the total weight of evidence. Moreover, it accounts for the observed nonlinear dependence of sequence variability on flexibility. Finally, when mutational stress is controlled for, there is very little remaining correlation between sequence variability and dynamical flexibility. Conclusions We developed a mechanistic Stress Model of evolution according to which the rate of evolution of a site is predicted to depend linearly on the local mutational stress of the active conformation. Such local stress is proportional to LPD, so that this model explains the relationship between LPD and evolutionary rate. Moreover, the model also accounts for the nonlinear dependence between evolutionary rate and dynamical flexibility. PMID:24716445
On the inhibition of muscle membrane chloride conductance by aromatic carboxylic acids
Palade, PT; Barchi, RL
1977-01-01
25 aromatic carboxylic acids which are analogs of benzoic acid were tested in the rat diaphragm preparation for effects on chloride conductance (G(Cl)). Of the 25, 19 were shown to reduce membrane G(Cl) with little effect on other membrane parameters, although their apparent K(i) varied widely. This inhibition was reversible if exposure times were not prolonged. The most effective analog studied was anthracene-9-COOH (9-AC; K(i) = 1.1 x 10(-5) M). Active analogs produced concentration-dependent inhibition of a type consistent with interaction at a single site or group of sites having similar binding affinities, although a correlation could also be shown between lipophilicity and K(i). Structure-activity analysis indicated that hydrophobic ring substitution usually increased inhibitory activity while para polar substitutions reduced effectiveness. These compounds do not appear to inhibit G(Cl) by altering membrane surface charge and the inhibition produced is not voltage dependent. Qualitative characteristics of the I-V relationship for Cl(-) current are not altered. Conductance to all anions is not uniformly altered by these acids as would be expected from steric occlusion of a common channel. Concentrations of 9-AC reducing G(Cl) by more than 90 percent resulted in slight augmentation of G(I). The complete conductance sequence obtained at high levels of 9-AC was the reverse of that obtained under control conditions. Permeability sequences underwent progressive changes with increasing 9-AC concentration and ultimately inverted at high levels of the analog. Aromatic carboxylic acids appear to inhibit G(Cl) by binding to a specific intramembrane site and altering the selectivity sequence of the membrane anion channel. PMID:894246
User's Manual for the New England Water-Use Data System (NEWUDS)
Horn, Marilee A.
2003-01-01
Water is used in a variety of ways that need to be understood for effective management of water resources. Water-use activities need to be categorized and included in a database management system to understand current water uses and to provide information to water-resource management policy decisionmakers. The New England Water-Use Data System (NEWUDS) is a complex database developed to store water-use information that allows water to be tracked from a point of water-use activity (called a 'Site'), such as withdrawal from a resource (reservoir or aquifer), to a second Site, such as distribution to a user (business or irrigator). NEWUDS conceptual model consists of 10 core entities: system, owner, address, location, site, data source, resource, conveyance, transaction/rate, and alias, with tables available to store user-defined details. Three components--site (with both a From Site and a To Site), a conveyance that connects them, and a transaction/rate associated with the movement of water over a specific time interval form the core of the basic NEWUDS network model. The most important step in correctly translating real-world water-use activities into a storable format in NEWUDS depends on choosing the appropriate sites and linking them correctly in a network to model the flow of water from the initial From Site to the final To Site. Ten water-use networks representing real-world activities are described--three withdrawal networks, three return networks, two user networks, two complex community-system networks. Ten case studies of water use, one for each network, also are included in this manual to illustrate how to compile, store, and retrieve the appropriate data. The sequence of data entry into tables is critical because there are many foreign keys. The recommended core entity sequence is (1) system, (2) owner, (3) address, (4) location, (5) site, (6) data source, (7) resource, (8) conveyance, (9) transaction, and (10) rate; with (11) alias and (12) user-defined detail subject areas populated as needed. After each step in data entry, quality-assurance queries should be run to ensure the data are correctly entered so that it can be retrieved accurately. The point of data storage is retrieval. Several retrieval queries that focus on retrieving only relevant data to specific questions are presented in this manual as examples for the NEWUDS user.
Nguyen, Tuan; Ruan, Zheng; Oruganty, Krishnadev; Kannan, Natarajan
2015-01-01
Mitogen activated protein kinases (MAPKs) form a closely related family of kinases that control critical pathways associated with cell growth and survival. Although MAPKs have been extensively characterized at the biochemical, cellular, and structural level, an integrated evolutionary understanding of how MAPKs differ from other closely related protein kinases is currently lacking. Here, we perform statistical sequence comparisons of MAPKs and related protein kinases to identify sequence and structural features associated with MAPK functional divergence. We show, for the first time, that virtually all MAPK-distinguishing sequence features, including an unappreciated short insert segment in the β4-β5 loop, physically couple distal functional sites in the kinase domain to the D-domain peptide docking groove via the C-terminal flanking tail (C-tail). The coupling mediated by MAPK-specific residues confers an allosteric regulatory mechanism unique to MAPKs. In particular, the regulatory αC-helix conformation is controlled by a MAPK-conserved salt bridge interaction between an arginine in the αC-helix and an acidic residue in the C-tail. The salt-bridge interaction is modulated in unique ways in individual sub-families to achieve regulatory specificity. Our study is consistent with a model in which the C-tail co-evolved with the D-domain docking site to allosterically control MAPK activity. Our study provides testable mechanistic hypotheses for biochemical characterization of MAPK-conserved residues and new avenues for the design of allosteric MAPK inhibitors. PMID:25799139
UBF-binding site arrays form pseudo-NORs and sequester the RNA polymerase I transcription machinery
Mais, Christine; Wright, Jane E.; Prieto, José-Luis; Raggett, Samantha L.; McStay, Brian
2005-01-01
Human ribosomal genes (rDNA) are located in nucleolar organizer regions (NORs) on the short arms of acrocentric chromosomes. Metaphase NORs that were transcriptionally active in the previous cell cycle appear as prominent chromosomal features termed secondary constrictions that are achromatic in chromosome banding and positive in silver staining. The architectural RNA polymerase I (pol I) transcription factor UBF binds extensively across rDNA throughout the cell cycle. To determine if UBF binding underpins NOR structure, we integrated large arrays of heterologous UBF-binding sequences at ectopic sites on human chromosomes. These arrays efficiently recruit UBF even to sites outside the nucleolus and, during metaphase, form novel silver stainable secondary constrictions, termed pseudo-NORs, morphologically similar to NORs. We demonstrate for the first time that in addition to UBF the other components of the pol I machinery are found associated with sequences across the entire human rDNA repeat. Remarkably, a significant fraction of these same pol I factors are sequestered by pseudo-NORs independent of both transcription and nucleoli. Because of the heterologous nature of the sequence employed, we infer that sequestration is mediated primarily by protein–protein interactions with UBF. These results suggest that extensive binding of UBF is responsible for formation and maintenance of the secondary constriction at active NORs. Furthermore, we propose that UBF mediates recruitment of the pol I machinery to nucleoli independently of promoter elements. PMID:15598984
Baht, Gurpreet S; O'Young, Jason; Borovina, Antonia; Chen, Hong; Tye, Coralee E; Karttunen, Mikko; Lajoie, Gilles A; Hunter, Graeme K; Goldberg, Harvey A
2010-05-27
Acidic phosphoproteins of mineralized tissues such as bone and dentin are believed to play important roles in HA (hydroxyapatite) nucleation and growth. BSP (bone sialoprotein) is the most potent known nucleator of HA, an activity that is thought to be dependent on phosphorylation of the protein. The present study identifies the role phosphate groups play in mineral formation. Recombinant BSP and peptides corresponding to residues 1-100 and 133-205 of the rat sequence were phosphorylated with CK2 (protein kinase CK2). Phosphorylation increased the nucleating activity of BSP and BSP-(133-205), but not BSP-(1-100). MS analysis revealed that the major site phosphorylated within BSP-(133-205) was Ser136, a site adjacent to the series of contiguous glutamate residues previously implicated in HA nucleation. The critical role of phosphorylated Ser136 in HA nucleation was confirmed by site-directed mutagenesis and functional analyses. Furthermore, peptides corresponding to the 133-148 sequence of rat BSP were synthesized with or without a phosphate group on Ser136. As expected, the phosphopeptide was a more potent nucleator. The mechanism of nucleation was investigated using molecular-dynamics simulations analysing BSP-(133-148) interacting with the {100} crystal face of HA. Both phosphorylated and non-phosphorylated sequences adsorbed to HA in extended conformations with alternating residues in contact with and facing away from the crystal face. However, this alternating-residue pattern was more pronounced when Ser136 was phosphorylated. These studies demonstrate a critical role for Ser136 phosphorylation in BSP-mediated HA nucleation and identify a unique mode of interaction between the nucleating site of the protein and the {100} face of HA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ferraro,D.; Brown, E.; Yu, C.
The initial step involved in oxidative hydroxylation of monoaromatic and polyaromatic compounds by the microorganism Sphingobium yanoikuyae strain B1 (B1), previously known as Sphingomonas yanoikuyae strain B1 and Beijerinckia sp. strain B1, is performed by a set of multiple terminal Rieske non-heme iron oxygenases. These enzymes share a single electron donor system consisting of a reductase and a ferredoxin (BPDO-F{sub B1}). One of the terminal Rieske oxygenases, biphenyl 2,3-dioxygenase (BPDO-O{sub B1}), is responsible for B1's ability to dihydroxylate large aromatic compounds, such as chrysene and benzo(a)pyrene. Results: In this study, crystal structures of BPDO-O{sub B1} in both native and biphenylmore » bound forms are described. Sequence and structural comparisons to other Rieske oxygenases show this enzyme to be most similar, with 43.5 % sequence identity, to naphthalene dioxygenase from Pseudomonas sp. strain NCIB 9816-4. While structurally similar to naphthalene 1,2-dioxygenase, the active site entrance is significantly larger than the entrance for naphthalene 1,2-dioxygenase. Differences in active site residues also allow the binding of large aromatic substrates. There are no major structural changes observed upon binding of the substrate. BPDO-F{sub B1} has large sequence identity to other bacterial Rieske ferredoxins whose structures are known and demonstrates a high structural homology; however, differences in side chain composition and conformation around the Rieske cluster binding site are noted. Conclusion: This is the first structure of a Rieske oxygenase that oxidizes substrates with five aromatic rings to be reported. This ability to catalyze the oxidation of larger substrates is a result of both a larger entrance to the active site as well as the ability of the active site to accommodate larger substrates. While the biphenyl ferredoxin is structurally similar to other Rieske ferredoxins, there are distinct changes in the amino acids near the iron-sulfur cluster. Because this ferredoxin is used by multiple oxygenases present in the B1 organism, this ferredoxin-oxygenase system provides the structural platform to dissect the balance between promiscuity and selectivity in protein-protein electron transport systems.« less
Zaman, Junaid A B; Sauer, William H; Alhusseini, Mahmood I; Baykaner, Tina; Borne, Ryan T; Kowalewski, Christopher A B; Busch, Sonia; Zei, Paul C; Park, Shirley; Viswanathan, Mohan N; Wang, Paul J; Brachmann, Johannes; Krummen, David E; Miller, John M; Rappel, Wouter Jan; Narayan, Sanjiv M; Peters, Nicholas S
2018-01-01
The mechanisms by which persistent atrial fibrillation (AF) terminates via localized ablation are not well understood. To address the hypothesis that sites where localized ablation terminates persistent AF have characteristics identifiable with activation mapping during AF, we systematically examined activation patterns acquired only in cases of unequivocal termination by ablation. We recruited 57 patients with persistent AF undergoing ablation, in whom localized ablation terminated AF to sinus rhythm or organized tachycardia. For each site, we performed an offline analysis of unprocessed unipolar electrograms collected during AF from multipolar basket catheters using the maximum -dV/dt assignment to construct isochronal activation maps for multiple cycles. Additional computational modeling and phase analysis were used to study mechanisms of map variability. At all sites of AF termination, localized repetitive activation patterns were observed. Partial rotational circuits were observed in 26 of 57 (46%) cases, focal patterns in 19 of 57 (33%), and complete rotational activity in 12 of 57 (21%) cases. In computer simulations, incomplete segments of partial rotations coincided with areas of slow conduction characterized by complex, multicomponent electrograms, and variations in assigning activation times at such sites substantially altered mapped mechanisms. Local activation mapping at sites of termination of persistent AF showed repetitive patterns of rotational or focal activity. In computer simulations, complete rotational activation sequence was observed but was sensitive to assignment of activation timing particularly in segments of slow conduction. The observed phenomena of repetitive localized activation and the mechanism by which local ablation terminates putative AF drivers require further investigation. © 2018 American Heart Association, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Phillips, J.; Warby, C; Whitby, F
2009-01-01
Uroporphyrinogen decarboxylase (URO-D; EC 4.1.1.37), the fifth enzyme of the heme biosynthetic pathway, is required for the production of heme, vitamin B12, siroheme, and chlorophyll precursors. URO-D catalyzes the sequential decarboxylation of four acetate side chains in the pyrrole groups of uroporphyrinogen to produce coproporphyrinogen. URO-D is a stable homodimer, with the active-site clefts of the two subunits adjacent to each other. It has been hypothesized that the two catalytic centers interact functionally, perhaps by shuttling of reaction intermediates between subunits. We tested this hypothesis by construction of a single-chain protein (single-chain URO-D) in which the two subunits were connectedmore » by a flexible linker. The crystal structure of this protein was shown to be superimposable with wild-type activity and to have comparable catalytic activity. Mutations that impaired one or the other of the two active sites of single-chain URO-D resulted in approximately half of wild-type activity. The distributions of reaction intermediates were the same for mutant and wild-type sequences and were unaltered in a competition experiment using I and III isomer substrates. These observations indicate that communication between active sites is not required for enzyme function and suggest that the dimeric structure of URO-D is required to achieve conformational stability and to create a large active-site cleft.« less
Tanimura, Akira; Dan, Shingo; Yoshida, Mitsuaki
1998-01-01
The expression of human T-cell leukemia virus type 1 (HTLV-1) is activated by interaction of a viral transactivator protein, Tax, and cellular transcription factor, CREB (cyclic AMP response element binding protein), which bind to a 21-bp enhancer in the long terminal repeats (LTR). THP (Tax-helping protein) was previously determined to enhance the transactivation by Tax protein. Here we report novel forms of the human homolog of a member of the Gli oncogene family, Gli2 (also termed Gli2/THP), an extended form of a zinc finger protein, THP, which was described previously. Four possible isoforms (hGli2 α, β, γ, and δ) are formed by combinations of two independent alternative splicings, and all the isoforms could bind to a DNA motif, TRE2S, in the LTR. The longer isoforms, α and β, were abundantly expressed in various cell lines including HTLV-1-infected T-cell lines. Fusion proteins of the hGli2 isoforms with the DNA-binding domain of Gal4 activated transcription when the reporter contained a Gal4-binding site and one copy of the 21-bp sequence, to which CREB binds. This activation was observed only in the presence of Tax. The 21-bp sequence in the reporter was also essential for the activation. These results suggest that simultaneous binding of hGli2 and CREB to the respective sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the LTR contains the 21-bp and TRE2S sequences in the vicinity. PMID:9557682
DOE Office of Scientific and Technical Information (OSTI.GOV)
Senko, John M.; Wanjugi, Pauline; Lucas, Melanie
2008-06-12
We characterized the microbiologically mediated oxidative precipitation of Fe(II) from coalminederived acidic mine drainage (AMD) along flow-paths at two sites in northern Pennsylvania. At the Gum Boot site, dissolved Fe(II) was efficiently removed from AMD whereas minimal Fe(II) removal occurred at the Fridays-2 site. Neither site received human intervention to treat the AMD. Culturable Fe(II) oxidizing bacteria were most abundant at sampling locations along the AMD flow path corresponding to greatest Fe(II) removal and where overlying water contained abundant dissolved O2. Rates of Fe(II) oxidation determined in laboratory-based sediment incubations were also greatest at these sampling locations. Ribosomal RNA intergenicmore » spacer analysis and sequencing of partial 16S rRNA genes recovered from sediment bacterial communities revealed similarities among populations at points receiving regular inputs of Fe(II)-rich AMD and provided evidence for the presence of bacterial lineages capable of Fe(II) oxidation. A notable difference between bacterial communities at the two sites was the abundance of Chloroflexi-affiliated 16S rRNA gene sequences in clone libraries derived from the Gum Boot sediments. Our results suggest that inexpensive and reliable AMD treatment strategies can be implemented by mimicking the conditions present at the Gum Boot field site.« less
Mojo Hand, a TALEN design tool for genome editing applications.
Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C
2013-01-16
Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.
NASA Astrophysics Data System (ADS)
Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.
2005-09-01
The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.
Variation in opsin genes correlates with signaling ecology in North American fireflies
Sander, Sarah E.; Hall, David W.
2015-01-01
Genes underlying signal reception should evolve to maximize signal detection in a particular environment. In animals, opsins, the protein component of visual pigments, are predicted to evolve according to this expectation. Fireflies are known for their bioluminescent mating signals. The eyes of nocturnal species are expected to maximize detection of conspecific signal colors emitted in the typical low-light environment. This is not expected for species that have transitioned to diurnal activity in bright daytime environments. Here we test the hypothesis that opsin gene sequence plays a role in modifying firefly eye spectral sensitivity. We use genome and transcriptome sequencing in four firefly species, transcriptome sequencing in six additional species, and targeted gene sequencing in 28 other species to identify all opsin genes present in North American fireflies and to elucidate amino acid sites under positive selection. We also determine whether amino acid substitutions in opsins are linked to evolutionary changes in signal mode, signal color, and light environment. We find only two opsins, one long wavelength and one ultraviolet, in all firefly species and identify 25 candidate sites that may be involved in determining spectral sensitivity. In addition, we find elevated rates of evolution at transitions to diurnal activity, and changes in selective constraint on LW opsin associated with changes in light environment. Our results suggest that changes in eye spectral sensitivity are at least partially due to opsin sequence. Fireflies continue to be a promising system in which to investigate the evolution of signals, receptors, and signaling environments. PMID:26289828
Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J
2005-09-22
The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.
Trypsin-like Proteins of the Fungi as Possible Markers of Phytopathogenicity
USDA-ARS?s Scientific Manuscript database
Sequences of peptidases with conserved motifs around the active site residues that are characteristic of trypsins (similar to trypsin peptidases, STP) were obtained from publicly available fungal genomes and related databases. Among the 74 fungal genomes, 30 species of parasitic Ascomycota contained...
Fuentes-Pananá, Ezequiel M.; Swaminathan, Sankar; Ling, Paul D.
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (−1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates. PMID:9847397
Fuentes-Pananá, E M; Swaminathan, S; Ling, P D
1999-01-01
The Epstein-Barr virus (EBV) EBNA2 protein is a transcriptional activator that controls viral latent gene expression and is essential for EBV-driven B-cell immortalization. EBNA2 is expressed from the viral C promoter (Cp) and regulates its own expression by activating Cp through interaction with the cellular DNA binding protein CBF1. Through regulation of Cp and EBNA2 expression, EBV controls the pattern of latent protein expression and the type of latency established. To gain further insight into the important regulatory elements that modulate Cp usage, we isolated and sequenced the Cp regions corresponding to nucleotides 10251 to 11479 of the EBV genome (-1079 to +144 relative to the transcription initiation site) from the EBV-like lymphocryptoviruses found in baboons (herpesvirus papio; HVP) and Rhesus macaques (RhEBV). Sequence comparison of the approximately 1,230-bp Cp regions from these primate viruses revealed that EBV and HVP Cp sequences are 64% conserved, EBV and RhEBV Cp sequences are 66% conserved, and HVP and RhEBV Cp sequences are 65% conserved relative to each other. Approximately 50% of the residues are conserved among all three sequences, yet all three viruses have retained response elements for glucocorticoids, two positionally conserved CCAAT boxes, and positionally conserved TATA boxes. The putative EBNA2 100-bp enhancers within these promoters contain 54 conserved residues, and the binding sites for CBF1 and CBF2 are well conserved. Cp usage in the HVP- and RhEBV-transformed cell lines was detected by S1 nuclease protection analysis. Transient-transfection analysis showed that promoters of both HVP and RhEBV are responsive to EBNA2 and that they bind CBF1 and CBF2 in gel mobility shift assays. These results suggest that similar mechanisms for regulation of latent gene expression are conserved among the EBV-related lymphocryptoviruses found in nonhuman primates.
Active Site Sharing and Subterminal Hairpin Recognition in a New Class of DNA Transposases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ronning, Donald R.; Guynet, Catherine; Ton-Hoang, Bao
2010-07-20
Many bacteria harbor simple transposable elements termed insertion sequences (IS). In Helicobacter pylori, the chimeric IS605 family elements are particularly interesting due to their proximity to genes encoding gastric epithelial invasion factors. Protein sequences of IS605 transposases do not bear the hallmarks of other well-characterized transposases. We have solved the crystal structure of full-length transposase (TnpA) of a representative member, ISHp608. Structurally, TnpA does not resemble any characterized transposase; rather, it is related to rolling circle replication (RCR) proteins. Consistent with RCR, Mg{sup 2+} and a conserved tyrosine, Tyr127, are essential for DNA nicking and the formation of a covalentmore » intermediate between TnpA and DNA. TnpA is dimeric, contains two shared active sites, and binds two DNA stem loops representing the conserved inverted repeats near each end of ISHp608. The cocrystal structure with stem-loop DNA illustrates how this family of transposases specifically recognizes and pairs ends, necessary steps during transposition.« less
Improving CRISPR–Cas specificity with chemical modifications in single-guide RNAs
Ryan, Daniel E; Taussig, David; Steinfeld, Israel; Phadnis, Smruti M; Lunstad, Benjamin D; Singh, Madhurima; Vuong, Xuan; Okochi, Kenji D; McCaffrey, Ryan; Olesiak, Magdalena; Roy, Subhadeep; Yung, Chong Wing; Curry, Bo; Sampson, Jeffrey R; Dellinger, Douglas J
2018-01-01
Abstract CRISPR systems have emerged as transformative tools for altering genomes in living cells with unprecedented ease, inspiring keen interest in increasing their specificity for perfectly matched targets. We have developed a novel approach for improving specificity by incorporating chemical modifications in guide RNAs (gRNAs) at specific sites in their DNA recognition sequence (‘guide sequence’) and systematically evaluating their on-target and off-target activities in biochemical DNA cleavage assays and cell-based assays. Our results show that a chemical modification (2′-O-methyl-3′-phosphonoacetate, or ‘MP’) incorporated at select sites in the ribose-phosphate backbone of gRNAs can dramatically reduce off-target cleavage activities while maintaining high on-target performance, as demonstrated in clinically relevant genes. These findings reveal a unique method for enhancing specificity by chemically modifying the guide sequence in gRNAs. Our approach introduces a versatile tool for augmenting the performance of CRISPR systems for research, industrial and therapeutic applications. PMID:29216382
Robertson, G R; Whalley, J M
1988-01-01
We have identified the equine herpesvirus 1 (EHV-1) thymidine kinase gene (TK) by DNA-mediated transformation and by DNA sequencing. Alignment of the amino acid sequence of the EHV-1 TK with the TKs from 3 other herpesviruses revealed regions of homology, some of which correspond to the previously identified substrate binding sites, while others have as yet, no assigned function. In particular, the strict conservation of an aspartate within the proposed nucleoside binding site suggests a role in ATP binding for this residue. Comparison of 5 herpes TKs with the thymidylate kinase of yeast revealed significant similarity which was strongest in those regions important to catalytic activity of the herpes TKs, and, therefore we propose that the herpes TK may be derived from a cellular thymidylate kinase. The implications for the evolution of enzyme activities within a pathway of nucleotide metabolism are discussed. PMID:2849761
Theta oscillations promote temporal sequence learning.
Crivelli-Decker, Jordan; Hsieh, Liang-Tien; Clarke, Alex; Ranganath, Charan
2018-05-17
Many theoretical models suggest that neural oscillations play a role in learning or retrieval of temporal sequences, but the extent to which oscillations support sequence representation remains unclear. To address this question, we used scalp electroencephalography (EEG) to examine oscillatory activity over learning of different object sequences. Participants made semantic decisions on each object as they were presented in a continuous stream. For three "Consistent" sequences, the order of the objects was always fixed. Activity during Consistent sequences was compared to "Random" sequences that consisted of the same objects presented in a different order on each repetition. Over the course of learning, participants made faster semantic decisions to objects in Consistent, as compared to objects in Random sequences. Thus, participants were able to use sequence knowledge to predict upcoming items in Consistent sequences. EEG analyses revealed decreased oscillatory power in the theta (4-7 Hz) band at frontal sites following decisions about objects in Consistent sequences, as compared with objects in Random sequences. The theta power difference between Consistent and Random only emerged in the second half of the task, as participants were more effectively able to predict items in Consistent sequences. Moreover, we found increases in parieto-occipital alpha (10-13 Hz) and beta (14-28 Hz) power during the pre-response period for objects in Consistent sequences, relative to objects in Random sequences. Linear mixed effects modeling revealed that single trial theta oscillations were related to reaction time for future objects in a sequence, whereas beta and alpha oscillations were only predictive of reaction time on the current trial. These results indicate that theta and alpha/beta activity preferentially relate to future and current events, respectively. More generally our findings highlight the importance of band-specific neural oscillations in the learning of temporal order information. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
GUIDEseq: a bioconductor package to analyze GUIDE-Seq datasets for CRISPR-Cas nucleases.
Zhu, Lihua Julie; Lawrence, Michael; Gupta, Ankit; Pagès, Hervé; Kucukural, Alper; Garber, Manuel; Wolfe, Scot A
2017-05-15
Genome editing technologies developed around the CRISPR-Cas9 nuclease system have facilitated the investigation of a broad range of biological questions. These nucleases also hold tremendous promise for treating a variety of genetic disorders. In the context of their therapeutic application, it is important to identify the spectrum of genomic sequences that are cleaved by a candidate nuclease when programmed with a particular guide RNA, as well as the cleavage efficiency of these sites. Powerful new experimental approaches, such as GUIDE-seq, facilitate the sensitive, unbiased genome-wide detection of nuclease cleavage sites within the genome. Flexible bioinformatics analysis tools for processing GUIDE-seq data are needed. Here, we describe an open source, open development software suite, GUIDEseq, for GUIDE-seq data analysis and annotation as a Bioconductor package in R. The GUIDEseq package provides a flexible platform with more than 60 adjustable parameters for the analysis of datasets associated with custom nuclease applications. These parameters allow data analysis to be tailored to different nuclease platforms with different length and complexity in their guide and PAM recognition sequences or their DNA cleavage position. They also enable users to customize sequence aggregation criteria, and vary peak calling thresholds that can influence the number of potential off-target sites recovered. GUIDEseq also annotates potential off-target sites that overlap with genes based on genome annotation information, as these may be the most important off-target sites for further characterization. In addition, GUIDEseq enables the comparison and visualization of off-target site overlap between different datasets for a rapid comparison of different nuclease configurations or experimental conditions. For each identified off-target, the GUIDEseq package outputs mapped GUIDE-Seq read count as well as cleavage score from a user specified off-target cleavage score prediction algorithm permitting the identification of genomic sequences with unexpected cleavage activity. The GUIDEseq package enables analysis of GUIDE-data from various nuclease platforms for any species with a defined genomic sequence. This software package has been used successfully to analyze several GUIDE-seq datasets. The software, source code and documentation are freely available at http://www.bioconductor.org/packages/release/bioc/html/GUIDEseq.html .
ssrA (tmRNA) Plays a Role in Salmonella enterica Serovar Typhimurium Pathogenesis
Julio, Steven M.; Heithoff, Douglas M.; Mahan, Michael J.
2000-01-01
Escherichia coli ssrA encodes a small stable RNA molecule, tmRNA, that has many diverse functions, including tagging abnormal proteins for degradation, supporting phage growth, and modulating the activity of DNA binding proteins. Here we show that ssrA plays a role in Salmonella enterica serovar Typhimurium pathogenesis and in the expression of several genes known to be induced during infection. Moreover, the phage-like attachment site, attL, encoded within ssrA, serves as the site of integration of a region of Salmonella-specific sequence; adjacent to the 5′ end of ssrA is another region of Salmonella-specific sequence with extensive homology to predicted proteins encoded within the unlinked Salmonella pathogenicity island SPI4. S. enterica serovar Typhimurium ssrA mutants fail to support the growth of phage P22 and are delayed in their ability to form viable phage particles following induction of a phage P22 lysogen. These data indicate that ssrA plays a role in the pathogenesis of Salmonella, serves as an attachment site for Salmonella-specific sequences, and is required for the growth of phage P22. PMID:10692360
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.
Mavrothalassitis, G J; Watson, D K; Papas, T S
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393
NASA Astrophysics Data System (ADS)
Koyama, A.; Webb, C. T.; Johnson, N. G.; Brewer, P. E.; von Fischer, J. C.
2015-12-01
Methane uptake rates are known to have temporal variation in response to changing soil moisture levels. However, the relative importance of soil diffusivity vs. methanotroph physiology has not been disentangled to date. Testing methanotroph physiology in the laboratory can lead to misleading results due to changes in the fine-scale habitat where methanotrophs reside. To assay the soil moisture sensitivity of methanotrophs under field conditions, we studied 22 field plots scattered across eight Great Plains grassland sites that differed in precipitation regime and soil moisture, making ca. bi-weekly measures during the growing seasons over three years. Quantification of methanotroph activity was achieved from chamber-based measures of methane uptake coincident with SF6-derived soil diffusivity, and interpretation in a reaction-diffusion model. At each plot, we also measured soil water content (SWC), soil temperature and inorganic nitrogen (N) contents. We also assessed methanotroph community composition via 454 sequencing of the pmoA gene. Statistical analyses showed that methanotroph activity had a parabolic response with SWC (concave down), and significant differences in the shape of this response among sites. Moreover, we found that the SWC at peak methanotroph activity was strongly correlated with mean annual precipitation (MAP) of the site. The sequence data revealed distinct composition patterns, with structure that was associated with variation in MAP and soil texture. These results suggest that local precipitation regime shapes methanotroph community composition, which in turn lead to unique sensitivity of methane uptake rates with soil moisture. Our findings suggest that methanotroph activity may be more accurately modeled when the biological and environmental responses are explicitly described.
DOE Office of Scientific and Technical Information (OSTI.GOV)
D Critton; L Tautz; R Page
2011-12-31
Phosphotyrosine hydrolysis by protein tyrosine phosphatases (PTPs) involves substrate binding by the PTP loop and closure over the active site by the WPD loop. The E loop, located immediately adjacent to the PTP and WPD loops, is conserved among human PTPs in both sequence and structure, yet the role of this loop in substrate binding and catalysis is comparatively unexplored. Hematopoietic PTP (HePTP) is a member of the kinase interaction motif (KIM) PTP family. Compared to other PTPs, KIM-PTPs have E loops that are unique in both sequence and structure. In order to understand the role of the E loopmore » in the transition between the closed state and the open state of HePTP, we identified a novel crystal form of HePTP that allowed the closed-state-to-open-state transition to be observed within a single crystal form. These structures, which include the first structure of the HePTP open state, show that the WPD loop adopts an 'atypically open' conformation and, importantly, that ligands can be exchanged at the active site, which is critical for HePTP inhibitor development. These structures also show that tetrahedral oxyanions bind at a novel secondary site and function to coordinate the PTP, WPD, and E loops. Finally, using both structural and kinetic data, we reveal a novel role for E-loop residue Lys182 in enhancing HePTP catalytic activity through its interaction with Asp236 of the WPD loop, providing the first evidence for the coordinated dynamics of the WPD and E loops in the catalytic cycle, which, as we show, is relevant to multiple PTP families.« less
Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.
2015-01-01
CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lohman, Jeremy R.; Bingman, Craig A.; George N. Phillips Jr.
The β-branched C3 unit in leinamycin biosynthesis is installed by a set of four proteins, LnmFKLM. In vitro biochemical investigation confirmed that LnmK is a bifunctional acyltransferase/decarboxylase (AT/DC) that catalyzes first self-acylation using methylmalonyl-CoA as a substrate and subsequently transacylation of the methylmalonyl group to the phosphopantetheinyl group of the LnmL acyl carrier protein [Liu, T., Huang, Y., and Shen, B. (2009) J. Am. Chem. Soc. 131, 6900–6901]. LnmK shows no sequence homology to proteins of known function, representing a new family of AT/DC enzymes. Here we report the X-ray structure of LnmK. LnmK is homodimer with each of themore » monomers adopting a double-hot-dog fold. Cocrystallization of LnmK with methylmalonyl-CoA revealed an active site tunnel terminated by residues from the dimer interface. But, to canonical AT and ketosynthase enzymes that employ Ser or Cys as an active site residue, none of these residues are found in the vicinity of the LnmK active site. Instead, three tyrosines were identified, one of which, Tyr62, was established, by site-directed mutagenesis, to be the most likely active site residue for the AT activity of LnmK. Moreover, LnmK represents the first AT enzyme that employs a Tyr as an active site residue and the first member of the family of double-hot-dog fold enzymes that displays an AT activity known to date. The LnmK structure sets the stage for probing of the DC activity of LnmK through site-directed mutagenesis. These findings highlight natural product biosynthetic machinery as a rich source of novel enzyme activities, mechanisms, and structures.« less
Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert
2016-01-01
A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189
Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C
2017-09-01
Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).
Jin, Hong; Stojnic, Robert; Adryan, Boris; Ozdemir, Anil; Stathopoulos, Angelike; Frasch, Manfred
2013-01-01
The NK homeodomain factor Tinman is a crucial regulator of early mesoderm patterning and, together with the GATA factor Pannier and the Dorsocross T-box factors, serves as one of the key cardiogenic factors during specification and differentiation of heart cells. Although the basic framework of regulatory interactions driving heart development has been worked out, only about a dozen genes involved in heart development have been designated as direct Tinman target genes to date, and detailed information about the functional architectures of their cardiac enhancers is lacking. We have used immunoprecipitation of chromatin (ChIP) from embryos at two different stages of early cardiogenesis to obtain a global overview of the sequences bound by Tinman in vivo and their linked genes. Our data from the analysis of ∼50 sequences with high Tinman occupancy show that the majority of such sequences act as enhancers in various mesodermal tissues in which Tinman is active. All of the dorsal mesodermal and cardiac enhancers, but not some of the others, require tinman function. The cardiac enhancers feature diverse arrangements of binding motifs for Tinman, Pannier, and Dorsocross. By employing these cardiac and non-cardiac enhancers in machine learning approaches, we identify a novel motif, termed CEE, as a classifier for cardiac enhancers. In vivo assays for the requirement of the binding motifs of Tinman, Pannier, and Dorsocross, as well as the CEE motifs in a set of cardiac enhancers, show that the Tinman sites are essential in all but one of the tested enhancers; although on occasion they can be functionally redundant with Dorsocross sites. The enhancers differ widely with respect to their requirement for Pannier, Dorsocross, and CEE sites, which we ascribe to their different position in the regulatory circuitry, their distinct temporal and spatial activities during cardiogenesis, and functional redundancies among different factor binding sites. PMID:23326246
Anderson, Carl W.; Connelly, Margery A.
2004-10-12
The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.
NASA Astrophysics Data System (ADS)
Loukomies, Anni; Pnevmatikos, Dimitris; Lavonen, Jari; Spyrtou, Anna; Byman, Reijo; Kariotoglou, Petros; Juuti, Kalle
2013-12-01
This study aimed to design a teaching sequence for science education that enabled lower secondary school students to enhance their motivation towards science. Further, it looked to examine the way the designed teaching sequence affected students with different motivational profiles. Industry site visits, with embodied theory-based motivational features were included as part of the designed teaching sequence. The sequence was implemented in Finland and Greece with 54 participants, 27 from each country. Quantitative data was collected using the Evaluation of Science Inquiry Activities Questionnaire, based on the Intrinsic Motivation Inventory but did not map the expected outcomes. Interviews, however, showed that students with different motivational profiles found aspects within the module that met their psychological needs as explained by Self-Determination Theory. The results offer a perspective to adolescents' psychological needs along with some insights into how students mediate the way they value an activity in the context of science education.
Jiang, Jiming
2015-04-01
Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Chan, Yvonne H.; Venev, Sergey V.; Zeldovich, Konstantin B.; Matthews, C. Robert
2017-01-01
Sequence divergence of orthologous proteins enables adaptation to environmental stresses and promotes evolution of novel functions. Limits on evolution imposed by constraints on sequence and structure were explored using a model TIM barrel protein, indole-3-glycerol phosphate synthase (IGPS). Fitness effects of point mutations in three phylogenetically divergent IGPS proteins during adaptation to temperature stress were probed by auxotrophic complementation of yeast with prokaryotic, thermophilic IGPS. Analysis of beneficial mutations pointed to an unexpected, long-range allosteric pathway towards the active site of the protein. Significant correlations between the fitness landscapes of distant orthologues implicate both sequence and structure as primary forces in defining the TIM barrel fitness landscape and suggest that fitness landscapes can be translocated in sequence space. Exploration of fitness landscapes in the context of a protein fold provides a strategy for elucidating the sequence-structure-fitness relationships in other common motifs. PMID:28262665
Thule AB, Greenland, Mosquito Survey and Arbovirus Surveillance, 2012
2013-11-21
July 2012. One species of mosquitoes, Aedes impiger, was collected and more than 3000 were processed for virus testing. Active mosquito breeding...of mosquitoes, Aedes impiger, was collected and more than 3000 were processed for virus testing. Active mosquito breeding sites were located...were characterized by DNA sequencing. 4. FINDINGS: a. One species of mosquito, Aedes impiger, was found throughout the Thule area
Coughlin, Jane M; Kundu, Rituparna; Cooper, Julian C; Ball, Zachary T
2014-11-15
A small molecule containing a rhodium(II) tetracarboxylate fragment is shown to be a potent inhibitor of the prolyl isomerase FKBP12. The use of small molecules conjugates of rhodium(II) is presented as a general strategy for developing new protein inhibitors based on distinct structural and sequence features of the enzyme active site. Copyright © 2014 Elsevier Ltd. All rights reserved.
Jeong, Yongsu; Epstein, Douglas J
2003-08-01
The establishment of the floor plate at the ventral midline of the CNS is dependent on an inductive signaling process mediated by the secreted protein Sonic hedgehog (Shh). To understand molecularly how floor plate induction proceeds we identified a Shh-responsive regulatory element that directs transgene reporter expression to the ventral midline of the CNS and notochord in a Shh-like manner and characterized critical cis-acting sequences regulating this element. Cross-species comparisons narrowed the activity of the Shh floor plate enhancer to an 88-bp sequence within intron 2 of Shh that included highly conserved binding sites matching the consensus for homeodomain, Tbx and Foxa transcription factors. Mutational analysis revealed that the homeodomain and Foxa binding sites are each required for activation of the Shh floor plate enhancer, whereas the Tbx site was required for repression in regions of the CNS where Shh is not normally expressed. We further show that Shh enhancer activity was detected in the mouse node from where the floor plate and notochord precursors derive. Shh reporter expression was restricted to the ventral (mesodermal) layer of the node in a pattern similar to endogenous Shh. X-gal-positive cells emerging from the node were only detected in the notochord lineage, suggesting that the floor plate and notochord arise from distinct precursors in the mouse node.
Daubas, Philippe; Buckingham, Margaret E
2013-04-15
The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.
Will, Manuel; Parkington, John E; Kandel, Andrew W; Conard, Nicholas J
2013-06-01
New excavations at the Middle Stone Age (MSA) open-air site of Hoedjiespunt 1 (HDP1) on the west coast of South Africa advance our understanding of the evolution of coastal adaptations in Homo sapiens. The archaeological site of HDP1 dates to the last interglacial and consists of three phases of occupation, each containing abundant lithic artifacts, shellfish, terrestrial fauna, ostrich eggshell and pieces of ground ocher. The site provides an excellent case study to analyze human behavioral adaptations linked to early exploitation of marine resources. Here we reconstruct human activities through a detailed study of the lithic assemblages, combining analyses of the reduction sequences, artifact attributes and quartz fracturing. These methods provide insights into raw material procurement, lithic reduction sequences, site use and mobility patterns, and foster comparison with other MSA coastal sites. The main characteristics of the lithic assemblages remain constant throughout the use of the site. Quartz dominates silcrete and other raw materials by almost four to one. Knappers at HDP1 produced different forms of flakes using multiple core reduction methods. Denticulates represent the most frequent tool type. The assemblages document complete, bipolar and hard hammer reduction sequences for the locally available quartz, but highly truncated reduction sequences with many isolated end products for silcrete, a material with a minimum transport distance of 10-30km. This observation suggests that well provisioned individuals executed planned movements to the shoreline to exploit shellfish. Our excavations at HDP1 furthermore demonstrate the simultaneous occurrence of flexible raw material use, anticipated long-distance transport, systematic gathering of shellfish and use of ground ocher. The HDP1 lithic assemblages document a robust pattern of land-use that we interpret as a stable adaptation of modern humans to coastal landscapes as early as MIS 5e. Copyright © 2013 Elsevier Ltd. All rights reserved.
Xu, Wei; Shao, Rong; Wang, Zupeng; Yan, Xiuhua
2015-03-01
Neutral phytase is used as a feed additive for degradation of anti-nutritional phytate in aquatic feed industry. Site-directed mutagenesis of Bacillus amyloliquefaciens DSM 1061 phytase was performed with an aim to increase its activity. Mutation residues were chosen based on multiple sequence alignments and structure analysis of neutral phytsaes from different microorganisms. The mutation sites on surface (D148E, S197E and N156E) and around the active site (D52E) of phytase were selected. Analysis of the phytase variants showed that the specific activities of mutants D148E and S197E remarkably increased by about 35 and 13% over a temperature range of 40-75 °C at pH 7.0, respectively. The k cat of mutants D148E and S197E were 1.50 and 1.25 times than that of the wild-type phytase, respectively. Both D148E and S197E showed much higher thermostability than that of the wild-type phytase. However, mutants N156E and D52E led to significant loss of specific activity of the enzyme. Structural analysis revealed that these mutations may affect conformation of the active site of phytase. The present mutant phytases D148E and S197E with increased activities and thermostabilities have application potential as additives in aquaculture feed.
Nirasawa, Satoru; Nakahara, Kazuhiko; Takahashi, Saori
2018-02-27
Paenidase is the first microorganism-derived D-aspartyl endopeptidase that specifically recognizes an internal D-Asp residue to cleave [D-Asp]-X peptide bonds. Using peptide sequences obtained from the protein, we performed PCR with degenerate primers to amplify the paenidase I-encoding gene. Nucleotide sequencing revealed that mature paenidase I consists of 322 amino acid residues and that the protein is encoded as a pro-protein with a 197-amino-acid N-terminal extension compared to the mature protein. Paenidase I exhibits amino acid sequence similarity to several penicillin-binding proteins. In addition, paenidase I was classified into peptidase family S12 based on a MEROPS database search. Family S12 contains serine-type D-Ala-D-Ala carboxypeptidases that have three active site residues (Ser, Lys, and Tyr) in the conserved motifs Ser-Xaa-Thr-Lys and Tyr-Xaa-Asn. These motifs were conserved in the primary structure of paenidase I, and the role of these residues was confirmed by site-directed mutagenesis.
Deep intronic GPR143 mutation in a Japanese family with ocular albinism
Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei
2015-01-01
Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease. PMID:26061757
Deep intronic GPR143 mutation in a Japanese family with ocular albinism.
Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei
2015-06-10
Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease.
OSIRIS-REx Touch-And-Go (TAG) Navigation Performance
NASA Technical Reports Server (NTRS)
Berry, Kevin; Antreasian, Peter; Moreau, Michael C.; May, Alex; Sutter, Brian
2015-01-01
The Origins Spectral Interpretation Resource identification Security Regolith Explorer (OSIRIS-REx) mission is a NASA New Frontiers mission launching in 2016 to rendezvous with the near-Earth asteroid (101955) Bennu in late 2018. Following an extensive campaign of proximity operations activities to characterize the properties of Bennu and select a suitable sample site, OSIRIES-REx will fly a Touch-And-Go (TAG) trajectory to the asteroid's surface to obtain a regolith sample. The paper summarizes the mission design of the TAG sequence, the propulsive required to achieve the trajectory, and the sequence of events leading up to the TAG event. The paper will summarize the Monte-Carlo simulation of the TAG sequence and present analysis results that demonstrate the ability to conduct the TAG within 25 meters of the selected sample site and +-2 cms of the targeted contact velocity. The paper will describe some of the challenges associated with conducting precision navigation operations and ultimately contacting a very small asteroid.
OSIRI-REx Touch and Go (TAG) Navigation Performance
NASA Technical Reports Server (NTRS)
Berry, Kevin; Antreasian, Peter; Moreau, Michael C.; May, Alex; Sutter, Brian
2015-01-01
The Origins Spectral Interpretation Resource Identification Security Regolith Explorer (OSIRIS-REx) mission is a NASA New Frontiers mission launching in 2016 to rendezvous with the near-Earth asteroid (101955) Bennu in late 2018. Following an extensive campaign of proximity operations activities to characterize the properties of Bennu and select a suitable sample site, OSIRIS-REx will fly a Touch-And-Go (TAG) trajectory to the asteroid's surface to obtain a regolith sample. The paper summarizes the mission design of the TAG sequence, the propulsive maneuvers required to achieve the trajectory, and the sequence of events leading up to the TAG event. The paper also summarizes the Monte-Carlo simulation of the TAG sequence and presents analysis results that demonstrate the ability to conduct the TAG within 25 meters of the selected sample site and 2 cm/s of the targeted contact velocity. The paper describes some of the challenges associated with conducting precision navigation operations and ultimately contacting a very small asteroid.
A novel protocol for the production of recombinant LL-37 expressed as a thioredoxin fusion protein.
Li, Yifeng
2012-02-01
LL-37 is the only cathelicidin-derived antimicrobial peptide found in humans and it has a multifunctional role in host defense. The peptide has been shown to possess immunomodulatory functions in addition to antimicrobial activity. To provide sufficient material for biological and structural characterization of this important peptide, various systems were developed to produce recombinant LL-37 in Escherichia coli. In one previous approach, LL-37 coding sequence was cloned into vector pET-32a, allowing the peptide to be expressed as a thioredoxin fusion. The fusion protein contains two thrombin cleavage sites: a vector-encoded one that is 30-residue upstream of the insert and an engineered one that is immediately adjacent to LL-37. Cleavage at these two sites shall generate three fragments, one of which is the target peptide. However, when the fusion protein was treated with thrombin, cleavage only occurred at the remote upstream site. A plausible explanation is that the thrombin site adjacent to LL-37 is less accessible due to the peptide's aggregation tendency and cleavage at the remote site generates a fragment, which forms a large aggregate that buries the intended site. In this study, I deleted the vector-encoded thrombin site and S tag in pET-32a, and then inserted the coding sequence for LL-37 plus a thrombin site into the modified vector. Although removing the S tag did not change the oligomeric state of the fusion protein, deletion of the vector-encoded thrombin site allowed the fusion to be cleaved at the engineered site to release LL-37. The released peptide was separated from the carrier and cleavage enzyme by size-exclusion chromatography. This new approach enables a quick production of high quality active LL-37 with a decent amount. Copyright © 2011 Elsevier Inc. All rights reserved.
Arthur, A K; Höss, A; Fanning, E
1988-01-01
The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505
Viviani, Vadim R; Silva Neto, Antonio J; Arnoldi, Frederico G C; Barbosa, João A R G; Ohmiya, Yoshihiro
2008-01-01
Beetle luciferases emit a wide range of bioluminescence colors, ranging from green to red. Firefly luciferases can shift the spectrum to red in response to pH and temperature changes, whereas click beetle and railroadworm luciferases do not. Despite many studies on firefly luciferases, the origin of pH-sensitivity is far from being understood. Through comparative site-directed mutagenesis and modeling studies, using the pH-sensitive luciferases (Macrolampis and Cratomorphus distinctus fireflies) and the pH-insensitive luciferases (Pyrearinus termitilluminans, Phrixotrix viviani and Phrixotrix hirtus) cloned by our group, here we show that substitutions dramatically affecting bioluminescence colors in both groups of luciferases are clustered in the loop between residues 223-235 (Photinus pyralis sequence). The substitutions at positions 227, 228 and 229 (P. pyralis sequence) cause dramatic redshift and temporal shift in both groups of luciferases, indicating their involvement in labile interactions. Modeling studies showed that the residues Y227 and N229 are buried in the protein core, fixing the loop to other structural elements participating at the bottom of the luciferin binding site. Changes in pH and temperature (in firefly luciferases), as well as point mutations in this loop, may disrupt the interactions of these structural elements exposing the active site and modulating bioluminescence colors.
Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin
2003-12-19
SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.
Characterization of a novel ADAM protease expressed by Pneumocystis carinii.
Kennedy, Cassie C; Kottom, Theodore J; Limper, Andrew H
2009-08-01
Pneumocystis species are opportunistic fungal pathogens that cause severe pneumonia in immunocompromised hosts. Recent evidence has suggested that unidentified proteases are involved in Pneumocystis life cycle regulation. Proteolytically active ADAM (named for "a disintegrin and metalloprotease") family molecules have been identified in some fungal organisms, such as Aspergillus fumigatus and Schizosaccharomyces pombe, and some have been shown to participate in life cycle regulation. Accordingly, we sought to characterize ADAM-like molecules in the fungal opportunistic pathogen, Pneumocystis carinii (PcADAM). After an in silico search of the P. carinii genomic sequencing project identified a 329-bp partial sequence with homology to known ADAM proteins, the full-length PcADAM sequence was obtained by PCR extension cloning, yielding a final coding sequence of 1,650 bp. Sequence analysis detected the presence of a typical ADAM catalytic active site (HEXXHXXGXXHD). Expression of PcADAM over the Pneumocystis life cycle was analyzed by Northern blot. Southern and contour-clamped homogenous electronic field blot analysis demonstrated its presence in the P. carinii genome. Expression of PcADAM was observed to be increased in Pneumocystis cysts compared to trophic forms. The full-length gene was subsequently cloned and heterologously expressed in Saccharomyces cerevisiae. Purified PcADAMp protein was proteolytically active in casein zymography, requiring divalent zinc. Furthermore, native PcADAMp extracted directly from freshly isolated Pneumocystis organisms also exhibited protease activity. This is the first report of protease activity attributable to a specific, characterized protein in the clinically important opportunistic fungal pathogen Pneumocystis.
Bomati, Erin K.; Noel, Joseph P.
2005-01-01
We describe the three-dimensional structure of sinapyl alcohol dehydrogenase (SAD) from Populus tremuloides (aspen), a member of the NADP(H)-dependent dehydrogenase family that catalyzes the last reductive step in the formation of monolignols. The active site topology revealed by the crystal structure substantiates kinetic results indicating that SAD maintains highest specificity for the substrate sinapaldehyde. We also report substantial substrate inhibition kinetics for the SAD-catalyzed reduction of hydroxycinnamaldehydes. Although SAD and classical cinnamyl alcohol dehydrogenases (CADs) catalyze the same reaction and share some sequence identity, the active site topology of SAD is strikingly different from that predicted for classical CADs. Kinetic analyses of wild-type SAD and several active site mutants demonstrate the complexity of defining determinants of substrate specificity in these enzymes. These results, along with a phylogenetic analysis, support the inclusion of SAD in a plant alcohol dehydrogenase subfamily that includes cinnamaldehyde and benzaldehyde dehydrogenases. We used the SAD three-dimensional structure to model several of these SAD-like enzymes, and although their active site topologies largely mirror that of SAD, we describe a correlation between substrate specificity and amino acid substitution patterns in their active sites. The SAD structure thus provides a framework for understanding substrate specificity in this family of enzymes and for engineering new enzyme specificities. PMID:15829607
Bomati, Erin K; Noel, Joseph P
2005-05-01
We describe the three-dimensional structure of sinapyl alcohol dehydrogenase (SAD) from Populus tremuloides (aspen), a member of the NADP(H)-dependent dehydrogenase family that catalyzes the last reductive step in the formation of monolignols. The active site topology revealed by the crystal structure substantiates kinetic results indicating that SAD maintains highest specificity for the substrate sinapaldehyde. We also report substantial substrate inhibition kinetics for the SAD-catalyzed reduction of hydroxycinnamaldehydes. Although SAD and classical cinnamyl alcohol dehydrogenases (CADs) catalyze the same reaction and share some sequence identity, the active site topology of SAD is strikingly different from that predicted for classical CADs. Kinetic analyses of wild-type SAD and several active site mutants demonstrate the complexity of defining determinants of substrate specificity in these enzymes. These results, along with a phylogenetic analysis, support the inclusion of SAD in a plant alcohol dehydrogenase subfamily that includes cinnamaldehyde and benzaldehyde dehydrogenases. We used the SAD three-dimensional structure to model several of these SAD-like enzymes, and although their active site topologies largely mirror that of SAD, we describe a correlation between substrate specificity and amino acid substitution patterns in their active sites. The SAD structure thus provides a framework for understanding substrate specificity in this family of enzymes and for engineering new enzyme specificities.
Integrative Clinical Genomics of Metastatic Cancer
Robinson, Dan R.; Wu, Yi-Mi; Lonigro, Robert J.; Vats, Pankaj; Cobain, Erin; Everett, Jessica; Cao, Xuhong; Rabban, Erica; Kumar-Sinha, Chandan; Raymond, Victoria; Schuetze, Scott; Alva, Ajjai; Siddiqui, Javed; Chugh, Rashmi; Worden, Francis; Zalupski, Mark M.; Innis, Jeffrey; Mody, Rajen J.; Tomlins, Scott A.; Lucas, David; Baker, Laurence H.; Ramnath, Nithya; Schott, Ann F.; Hayes, Daniel F.; Vijai, Joseph; Offit, Kenneth; Stoffel, Elena M.; Roberts, J. Scott; Smith, David C.; Kunju, Lakshmi P.; Talpaz, Moshe; Cieslik, Marcin; Chinnaiyan, Arul M.
2017-01-01
SUMMARY Metastasis is the primary cause of cancer-related deaths. While The Cancer Genome Atlas (TCGA) has sequenced primary tumor types obtained from surgical resections, much less comprehensive molecular analysis is available from clinically acquired metastatic cancers. Here, we perform whole exome and transcriptome sequencing of 500 adult patients with metastatic solid tumors of diverse lineage and biopsy site. The most prevalent genes somatically altered in metastatic cancer included TP53, CDKN2A, PTEN, PIK3CA, and RB1. Putative pathogenic germline variants were present in 12.2% of cases of which 75% were related to defects in DNA repair. RNA sequencing complemented DNA sequencing for the identification of gene fusions, pathway activation, and immune profiling. Integrative sequence analysis provides a clinically relevant, multi-dimensional view of the complex molecular landscape and microenvironment of metastatic cancers. PMID:28783718
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2 O; thereby avoiding oxidative stress by H 2 O 2 . Results of our structural and functional analyses provide a reasonable explanation of mechanisms involved in DHPA synthase-mediated reactions. Based on the key active site residue Asn192, identified in Drosophila DHPA synthase, we were able to distinguish all available insect DHPA synthases from DDC sequences primarily. Copyright © 2017. Published by Elsevier Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Yuchun; Beckham, Gregg T.; Himmel, Michael E.
We examine how the catalytic domain of a glycoside hydrolase family 7 endoglucanase catalytic domain (Cel7B CD) facilitates complexation of cellulose chains from a crystal surface. With direct relevance to the science of biofuel production, this problem also represents a model system of biopolymer processing by proteins in Nature. Interactions of Cel7B CD with a cellulose microfibril along different paths of complexation are characterized by mapping the atomistic fluctuations recorded in free-energy simulations onto the parameters of a coarse-grain model. The resulting patterns of protein-biopolymer couplings also uncover the sequence signatures of the enzyme in peeling off glucan chains frommore » the microfibril substrate. We show that the semiopen active site of Cel7B CD exhibits similar barriers and free energies of complexation over two distinct routes; namely, scooping of a chain into the active-site cleft and threading from the chain end into the channel. On the other hand, the complexation energetics strongly depends on the surface packing of the targeted chain and the resulting interaction sites with the enzyme. A revealed principle is that Cel7B CD facilitates cellulose deconstruction via adaptive coupling to the emergent substrate. The flexible, peripheral segments of the protein outside of the active-site cleft are able to accommodate the varying features of cellulose along the simulated paths of complexation. The general strategy of linking physics-based molecular interactions to protein sequence could also be helpful in elucidating how other protein machines process biopolymers.« less
Jayasena, S D; Johnston, B H
1992-01-01
tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648
Relocating the Active-Site Lysine in Rhodopsin: 2. Evolutionary Intermediates.
Devine, Erin L; Theobald, Douglas L; Oprian, Daniel D
2016-08-30
The visual pigment rhodopsin is a G protein-coupled receptor that covalently binds its retinal chromophore via a Schiff base linkage to an active-site Lys residue in the seventh transmembrane helix. Although this residue is strictly conserved among all type II retinylidene proteins, we found previously that the active-site Lys in bovine rhodopsin (Lys296) can be moved to three other locations (G90K, T94K, S186K) while retaining the ability to form a pigment with retinal and to activate transducin in a light-dependent manner [ Devine et al. ( 2013 ) Proc. Natl. Acad. Sci. USA 110 , 13351 - 13355 ]. Because the active-site Lys is not functionally constrained to be in helix seven, it is possible that it could relocate within the protein, most likely via an evolutionary intermediate with two active-site Lys. Therefore, in this study we characterized potential evolutionary intermediates with two Lys in the active site. Four mutant rhodopsins were prepared in which the original Lys296 was left untouched and a second Lys residue was substituted for G90K, T94K, S186K, or F293K. All four constructs covalently bind 11-cis-retinal, form a pigment, and activate transducin in a light-dependent manner. These results demonstrate that rhodopsin can tolerate a second Lys in the retinal binding pocket and suggest that an evolutionary intermediate with two Lys could allow migration of the Schiff base Lys to a position other than the observed, highly conserved location in the seventh TM helix. From sequence-based searches, we identified two groups of natural opsins, insect UV cones and neuropsins, that contain Lys residues at two positions in their active sites and also have intriguing spectral similarities to the mutant rhodopsins studied here.
Genome-wide analysis of Tol2 transposon reintegration in zebrafish.
Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir
2009-09-08
Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.
Glew, Michelle D.; Marenda, Marc; Rosengarten, Renate; Citti, Christine
2002-01-01
The ruminant pathogen Mycoplasma agalactiae possesses a family of abundantly expressed variable surface lipoproteins called Vpmas. Phenotypic switches between Vpma members have previously been correlated with DNA rearrangements within a locus of vpma genes and are proposed to play an important role in disease pathogenesis. In this study, six vpma genes were characterized in the M. agalactiae type strain PG2. All vpma genes clustered within an 8-kb region and shared highly conserved 5′ untranslated regions, lipoprotein signal sequences, and short N-terminal sequences. Analyses of the vpma loci from consecutive clonal isolates showed that vpma DNA rearrangements were site specific and that cleavage and strand exchange occurred within a minimal region of 21 bp located within the 5′ untranslated region of all vpma genes. This process controlled expression of vpma genes by effectively linking the open reading frame (ORF) of a silent gene to a unique active promoter sequence within the locus. An ORF (xer1) immediately adjacent to one end of the vpma locus did not undergo rearrangement and had significant homology to a distinct subset of genes belonging to the λ integrase family of site-specific xer recombinases. It is proposed that xer1 codes for a site-specific recombinase that is not involved in chromosome dimer resolution but rather is responsible for the observed vpma-specific recombination in M. agalactiae. PMID:12374833
Hypoxia induces mucin expression and secretion in human bronchial epithelial cells.
Zhou, Xiangdong; Tu, Jing; Li, Qi; Kolosov, Victor P; Perelman, Juliy M
2012-12-01
The study objective was to investigate the role of hypoxia-inducible factor 1 (HIF-1) in the transcriptional activation of MUC5AC in human bronchial epithelial (HBE) 16 cells under hypoxia conditions and the effect of hypoxia on expression and secretion of MUC5AC. Cells were incubated in hypoxia medium. Serial deletions or mutations of the MUC5AC promoter were cloned in the reporter pGL3-basic plasmid (Promega Biotech Co, Ltd, Beijing, China). These reporter plasmids were cotransfected with HIF-1α small interfering RNA. Hypoxia markedly increased the level of MUC5AC secretion and the transcriptional activity of MUC5AC promoters. Western blot analysis showed that HIF-1α and MUC5AC proteins were strongly increased after HBE16 cells were exposed to hypoxic conditions. Treatment of HBE16 cells with HIF-1α inhibitor (YC-1) or HIF-1α small interfering RNA significantly inhibited the expression of HIF-1α and MUC5AC, and the secretion of MUC5AC. Depletion of the promoter sequence did not reduce the MUC5AC promoter activity to hypoxia. Luciferase assay indicated that HRE in the MUC5AC promoter was in the region from -120 to +54. Promoter sequence analysis showed that 1 HRE site at -65 plays an important role in hypoxia activation of the MUC5AC. The inactivation of the HRE site using site-directed mutagenesis led to the complete loss of induction by hypoxia, which further confirmed the key role of the HRE site. MUC5AC expression and secretion are upregulated in response to hypoxia. The HRE site at -65 in the MUC5AC promoter and the HIF-1α are the major regulators for the cellular response against hypoxia in human bronchial epithelial cells. Copyright © 2012 Mosby, Inc. All rights reserved.
Karayiannis, Nicolaos B; Sami, Abdul; Frost, James D; Wise, Merrill S; Mizrahi, Eli M
2005-04-01
This paper presents an automated procedure developed to extract quantitative information from video recordings of neonatal seizures in the form of motor activity signals. This procedure relies on optical flow computation to select anatomical sites located on the infants' body parts. Motor activity signals are extracted by tracking selected anatomical sites during the seizure using adaptive block matching. A block of pixels is tracked throughout a sequence of frames by searching for the most similar block of pixels in subsequent frames; this search is facilitated by employing various update strategies to account for the changing appearance of the block. The proposed procedure is used to extract temporal motor activity signals from video recordings of neonatal seizures and other events not associated with seizures.
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Perera, N C N; Godahewa, G I; Lee, Jehee
2016-10-01
Copper-zinc-superoxide dismutase (CuZnSOD) from Hippocampus abdominalis (HaCuZnSOD) is a metalloenzyme which belongs to the ubiquitous family of SODs. Here, we determined the characteristic structural features of HaCuZnSOD, analyzed its evolutionary relationships, and identified its potential immune responses and biological functions in relation to antioxidant defense mechanisms in the seahorse. The gene had a 5' untranslated region (UTR) of 67 bp, a coding sequence of 465 bp and a 3' UTR of 313 bp. The putative peptide consists of 154 amino acids. HaCuZnSOD had a predicted molecular mass of 15.94 kDa and a theoretical pI value of 5.73, which is favorable for copper binding activity. In silico analysis revealed that HaCuZnSOD had a prominent Cu-Zn_superoxide_dismutase domain, two Cu/Zn signature sequences, a putative N-glycosylation site, and several active sites including Cu(2+) and Zn(2+) binding sites. The three dimensional structure indicated a β-sheet barrel with 8 β-sheets and two short α-helical regions. Multiple alignment analyses revealed many conserved regions and active sites among its orthologs. The highest amino acid identity to HaCuZnSOD was found in Siniperca chuatsi (87.4%), while Maylandia zebra shared a close relationship in the phylogenetic analysis. Functional assays were performed to assess the antioxidant, biophysical and biochemical properties of overexpressed recombinant (r) HaCuZnSOD. A xanthine/XOD assay gave optimum results at pH 9 and 25 °C indicating these may be the best conditions for its antioxidant action in the seahorse. An MTT assay and flow cytometry confirmed that rHaCuZnSOD showed peroxidase activity in the presence of HCO3(-). In all the functional assays, the level of antioxidant activity of rHaCuZnSOD was concentration dependent; metal ion supplementation also increased its activity. The highest mRNA expressional level of HaCuZnSOD was found in blood. Temporal assessment under pathological stress showed a delay response by HaCuZnSOD. Our findings demonstrated that HaCuZnSOD is an important antioxidant, which might be involved in the host antioxidant defense mechanism against oxidative stress. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C
1996-03-01
Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.
The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome.
González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred; Llosa, Matxalen
2017-06-15
Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. Copyright © 2017 American Society for Microbiology.
The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome
González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred
2017-01-01
ABSTRACT Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. PMID:28411218
Reis, Marta I R; do Vale, Ana; Pinto, Cristina; Nascimento, Diana S; Costa-Ramos, Carolina; Silva, Daniela S P; Silva, Manuel T; Dos Santos, Nuno M S
2007-03-01
Caspase-9 is an initiator caspase in the apoptotic process whose function is to activate effector caspases that are downstream in the mitochondrial pathway of apoptosis. This work reports for the first time the complete sequencing and characterisation of caspase-9 in fish. A 1924bp cDNA of sea bass caspase-9 was obtained, consisting of 1308bp open reading frame coding for 435 amino acids, 199bp of the 5'-UTR and 417bp of the 3'-UTR including a canonical polyadenilation signal 10 nucleotides upstream the polyadenilation tail. The sequence retains the pentapeptide active-site motif (QACGG) and the putative cleavage sites at Asp(121), Asp(325) and Asp(343). The sequence of sea bass caspase-9 exhibits a very close homology to the sequences of caspase-9 from other vertebrates, particularly with the putative caspases-9 of Danio rerio and Tetraodon nigroviridis (77.5 and 75.4% similarity, respectively), justifying the fact that the phylogenetic analysis groups these species together with sea bass. The sea bass caspase-9 gene exists as a single copy gene and is organised in 9 introns and 10 exons. The sea bass caspase-9 showed a basal expression in all the organs analysed, although weaker in spleen. The expression of sea bass caspase-9 in the head kidney of sea bass infected with the Photobacterium damselae ssp. piscicida (Phdp) strain PP3, showed increased expression from 0 to 12h returning to control levels at 24h. Caspase-9 activity was detected in Phdp infected sea bass head kidney from 18 to 48h post-infection, when the fish were with advanced septicaemia.
Chang, Yongkai; Fan, Jingfeng; Su, Jie; Ming, Hongxia; Zhao, Wen; Shi, Yan; Ji, Fengyun; Guo, Limei; Zan, Shuaijun; Li, Bochao; Guo, Hao; Guan, Daoming
2017-05-01
Ammonia-oxidizing bacteria (AOB) play an important role in nitrification in estuaries. The aim of this study was to examine the spatial abundance, diversity, and activity of AOB in coastal sediments of the Liaohe Estuary using quantitative PCR, high-throughput sequencing of the amoA gene coding the ammonia monooxygenase enzyme active subunit, and sediment slurry incubation experiments. AOB abundance ranged from 8.54 × 10 4 to 5.85 × 10 6 copies g -1 of wet sediment weight and exhibited an increasing trend from the Liaohe Estuary to the open coastal zone. Potential nitrification rates (PNRs) ranged from 0.1 to 336.8 nmol N g -1 day -1 along the estuary to the coastal zone. Log AOB abundance and PNRs were significantly positively correlated. AOB richness decreased from the estuary to the coastal zone. High-throughput sequencing analysis indicated that the majority of amoA gene sequences fell within the Nitrosomonas and Nitrosomonas-like clade, and only a few sequences were clustered within the Nitrosospira clade. This finding indicates that the Nitrosomonas-related lineage may be more adaptable to the specific conditions in this estuary than the Nitrosospira lineage. Sites with high nitrification rates were located in the southern open region and were dominated by the Nitrosomonas-like lineage, whereas the Nitrosospira lineage was found primarily in the northern estuary mouth sites with low nitrification rates. Thus, nitrification potentials in Liaohe estuarine sediments in the southern open region were greater than those in the northern estuary mouth, and the Nitrosomonas-related lineage might play a more important role than the Nitrosospira lineage in nitrification in this estuary.
Wu, A M; Lin, S R; Chin, L K; Chow, L P; Lin, J Y
1992-09-25
The combining site of the nontoxic carbohydrate binding protein (Abrus precatorius agglutinin, APA) purified from the needs of Abrus precatorius (Jequirity bean), was studied by quantitative precipitin and precipitin-inhibition assays. Of 26 glycoproteins and polysaccharides tested, all, except sialic acid-containing glycoproteins and desialized ovine salivary glycoproteins, reacted strongly with the lectin, and precipitated over 70% of the lectin added, indicating that APA has a broad range of affinity and recognizes (internal) Gal beta 1----sequences of carbohydrate chains. The strong reaction with desialized porcine and rat salivary glycoproteins as well as pneumococcus type XIV polysaccharide suggests that APA has affinity for one or more of the following carbohydrate sequences: Thomsen-Friedenreich (T, Gal beta 1----3GalNAc), blood group precursor type I and/or type II (Gal beta 1----3/4GlcNAc) disaccharide determinants of complex carbohydrates. Among the oligosaccharides tested, the T structure was the best inhibitor; it was 2.4 and 3.2 times more active than type II and type I sequences, respectively. The blood group I Ma-active trisaccharide, Gal beta 1----4GlcNAc beta 1----6Gal, was about as active as the corresponding disaccharide (II). From the above results, we conclude that the size of the combining site of the A. precatorius agglutinin is probably as large as a disaccharide and most strongly complementary to the Gal beta 1----3GalNAc (T determinant) sequence. The carbohydrate specificities of this lectin will be further investigated once the related oligosaccharide structures become available.
NASA Astrophysics Data System (ADS)
Smith, Jarrod Anson
2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.
Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie
2010-01-01
Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262
Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie
2010-06-01
Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.
Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.
2003-01-01
Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006
Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H
1987-01-01
To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536
Olson, J C
1993-01-01
Diphtheria toxin (DT) and Pseudomonas aeruginosa exotoxin A have the same molecular mechanism of toxicity; both toxins ADP-ribosylate a modified histidine residue in elongation factor 2. To help identify amino acids involved in this reaction, sequences in DT that share homology with P. aeruginosa exotoxin A were synthesized and examined for a role in the ADP-ribosyltransferase reaction. By using this approach, residues 32 to 54 of DT were found to define an epitope associated with antibody-mediated inhibition of DT enzyme activity. This lends further support to the notion that residues in this region of DT are involved in the enzymatic reaction. PMID:8423159
Nerys-Junior, Arildo; Costa, Lendel C; Braga-Dias, Luciene P; Oliveira, Márcia; Rossi, Atila D; da Cunha, Rodrigo Delvecchio; Gonçalves, Gabriel S; Tanuri, Amilcar
2014-03-01
Engineered nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) are one of the most promising tools for modifying genomes. These site-specific enzymes cause double-strand breaks that allow gene disruption or gene insertion, thereby facilitating genetic manipulation. The major problem associated with this approach is the labor-intensive procedures required to screen and confirm the cellular modification by nucleases. In this work, we produced a TALEN that targets the human CCR5 gene and developed a heteroduplex mobility assay for HEK 293T cells to select positive colonies for sequencing. This approach provides a useful tool for the quick detection and easy assessment of nuclease activity.
Rand, Tim A.; Ginalski, Krzysztof; Grishin, Nick V.; Wang, Xiaodong
2004-01-01
RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2. PMID:15452342
Rand, Tim A; Ginalski, Krzysztof; Grishin, Nick V; Wang, Xiaodong
2004-10-05
RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2.
Beta-globin locus activation regions: conservation of organization, structure, and function.
Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G
1990-01-01
The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034
Evolutionary divergence of chloroplast FAD synthetase proteins
2010-01-01
Background Flavin adenine dinucleotide synthetases (FADSs) - a group of bifunctional enzymes that carry out the dual functions of riboflavin phosphorylation to produce flavin mononucleotide (FMN) and its subsequent adenylation to generate FAD in most prokaryotes - were studied in plants in terms of sequence, structure and evolutionary history. Results Using a variety of bioinformatics methods we have found that FADS enzymes localized to the chloroplasts, which we term as plant-like FADS proteins, are distributed across a variety of green plant lineages and constitute a divergent protein family clearly of cyanobacterial origin. The C-terminal module of these enzymes does not contain the typical riboflavin kinase active site sequence, while the N-terminal module is broadly conserved. These results agree with a previous work reported by Sandoval et al. in 2008. Furthermore, our observations and preliminary experimental results indicate that the C-terminus of plant-like FADS proteins may contain a catalytic activity, but different to that of their prokaryotic counterparts. In fact, homology models predict that plant-specific conserved residues constitute a distinct active site in the C-terminus. Conclusions A structure-based sequence alignment and an in-depth evolutionary survey of FADS proteins, thought to be crucial in plant metabolism, are reported, which will be essential for the correct annotation of plant genomes and further structural and functional studies. This work is a contribution to our understanding of the evolutionary history of plant-like FADS enzymes, which constitute a new family of FADS proteins whose C-terminal module might be involved in a distinct catalytic activity. PMID:20955574
Steiner, Walter W; Recor, Chelsea L; Zakrzewski, Bethany M
2016-11-15
The M26 hotspot of the fission yeast Schizosaccharomyces pombe is one of the best-characterized eukaryotic hotspots of recombination. The hotspot requires a seven bp sequence, ATGACGT, that serves as a binding site for the Atf1-Pcr1 transcription factor, which is also required for activity. The M26 hotspot is active in meiosis but not mitosis and is active in some but not all chromosomal contexts and not on a plasmid. A longer palindromic version of M26, ATGACGTCAT, shows significantly greater activity than the seven bp sequence. Here, we tested whether the properties of the seven bp sequence were also true of the longer sequence by placing one, two, or three copies of the sequence into the ade6 gene, where M26 was originally discovered. These constructs were tested for activity when located on a plasmid or on a chromosome in mitosis and meiosis. We found that two copies of the 10bp M26 motif on a chromosome were significantly more active for meiotic recombination than one, but no further increase was observed with three copies. However, three copies of M26 on a chromosome created an Atf1-dependent mitotic recombination hotspot. When located on a plasmid, M26 also appears to behave as a mitotic recombination hotspot; however, this behavior most likely results from Atf1-dependent inter-allelic complementation between the plasmid and chromosomal ade6 alleles. Copyright © 2016 Elsevier B.V. All rights reserved.
Discovery and characterization of a new family of lytic polysaccharide mono-oxygenases
Hemsworth, Glyn R.; Henrissat, Bernard; Davies, Gideon J.; Walton, Paul H.
2014-01-01
Lytic polysaccharide mono-oxygenases (LPMOs) are a recently discovered class of enzymes capable of oxidizing recalcitrant polysaccharides. They currently attract much attention due to their potential use in biomass conversion, notably in the production of biofuels. Past work has identified two discrete sequence-based families of these enzymes termed AA9 (formerly GH61) and AA10 (formerly CBM33). Here we report the discovery of a third family of LPMOs. Using a chitin-degrading exemplar from Aspergillus oryzae, we show that the 3-D structure of the enzyme shares some features of the previous two classes of LPMOs, including a copper active centre featuring the histidine brace active site, but is distinct in terms of its active site details and its EPR spectroscopy. The new AA11 family expands the LPMO clan with the potential to broaden both the range of potential substrates and the types of reactive copper-oxygen species formed at the active site of LPMOs. PMID:24362702
Retrotransposon Tf1 is targeted to pol II promoters by transcription activators
Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.
2008-01-01
SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330
Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.
Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L
2008-04-11
The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less
Simon, Mariella T.; Ng, Bobby G.; Friederich, Marisa W.; Wang, Raymond Y.; Boyer, Monica; Kircher, Martin; Collard, Renata; Buckingham, Kati J.; Chang, Richard; Shendure, Jay; Nickerson, Deborah A.; Bamshad, Michael J.; Van Hove, Johan L.K.; Freeze, Hudson H.; Abdenur, Jose E.
2017-01-01
We report the clinical, biochemical, and molecular findings in two brothers with encephalopathy and multi-systemic disease. Abnormal transferrin glycoforms were suggestive of a type I congenital disorder of glycosylation (CDG). While exome sequencing was negative for CDG related candidate genes, the testing revealed compound heterozygous mutations in the mitochondrial elongation factor G gene (GFM1). One of the mutations had been reported previously while the second, novel variant was found deep in intron 6, activating a cryptic splice site. Functional studies demonstrated decreased GFM1 protein levels, suggested disrupted assembly of mitochondrial complexes III and V and decreased activities of mitochondrial complexes I and IV, all indicating combined OXPHOS deficiency. PMID:28216230
Suplatov, D A; Arzhanik, V K; Svedas, V K
2011-01-01
Comparative bioinformatic analysis is the cornerstone of the study of enzymes' structure-function relationship. However, numerous enzymes that derive from a common ancestor and have undergone substantial functional alterations during natural selection appear not to have a sequence similarity acceptable for a statistically reliable comparative analysis. At the same time, their active site structures, in general, can be conserved, while other parts may largely differ. Therefore, it sounds both plausible and appealing to implement a comparative analysis of the most functionally important structural elements - the active site structures; that is, the amino acid residues involved in substrate binding and the catalytic mechanism. A computer algorithm has been developed to create a library of enzyme active site structures based on the use of the PDB database, together with programs of structural analysis and identification of functionally important amino acid residues and cavities in the enzyme structure. The proposed methodology has been used to compare some α,β-hydrolase superfamily enzymes. The insight has revealed a high structural similarity of catalytic site areas, including the conservative organization of a catalytic triad and oxyanion hole residues, despite the wide functional diversity among the remote homologues compared. The methodology can be used to compare the structural organization of the catalytic and substrate binding sites of various classes of enzymes, as well as study enzymes' evolution and to create of a databank of enzyme active site structures.
Hendrickson, Edwin R.; Payne, Jo Ann; Young, Roslyn M.; Starr, Mark G.; Perry, Michael P.; Fahnestock, Stephen; Ellis, David E.; Ebersole, Richard C.
2002-01-01
The environmental distribution of Dehalococcoides group organisms and their association with chloroethene-contaminated sites were examined. Samples from 24 chloroethene-dechlorinating sites scattered throughout North America and Europe were tested for the presence of members of the Dehalococcoides group by using a PCR assay developed to detect Dehalococcoides 16S rRNA gene (rDNA) sequences. Sequences identified by sequence analysis as sequences of members of the Dehalococcoides group were detected at 21 sites. Full dechlorination of chloroethenes to ethene occurred at these sites. Dehalococcoides sequences were not detected in samples from three sites at which partial dechlorination of chloroethenes occurred, where dechlorination appeared to stop at 1,2-cis-dichloroethene. Phylogenetic analysis of the 16S rDNA amplicons confirmed that Dehalococcoides sequences formed a unique 16S rDNA group. These 16S rDNA sequences were divided into three subgroups based on specific base substitution patterns in variable regions 2 and 6 of the Dehalococcoides 16S rDNA sequence. Analyses also demonstrated that specific base substitution patterns were signature patterns. The specific base substitutions distinguished the three sequence subgroups phylogenetically. These results demonstrated that members of the Dehalococcoides group are widely distributed in nature and can be found in a variety of geological formations and in different climatic zones. Furthermore, the association of these organisms with full dechlorination of chloroethenes suggests that they are promising candidates for engineered bioremediation and may be important contributors to natural attenuation of chloroethenes. PMID:11823182
De Novo Genome Project for the Aromatic Degrader Rhodococcus pyridinivorans Strain AK37
Kriszt, Balázs; Táncsics, András; Cserháti, Mátyás; Tóth, Ákos; Nagy, István; Horváth, Balázs; Nagy, István; Tamura, Tomohiro; Szoboszlay, Sándor
2012-01-01
Here, we present the complete genome sequence of Rhodococcus pyridinivorans AK37 strain NCAIM PB1376, which was isolated from an oil-polluted site in Hungary. R. pyridinivorans AK37 is an aerobic, nonsporulating, nonmotile, Gram-positive bacterium with remarkable aromatic-decomposing activity. PMID:22328750
Chakraborty, Sandeep; Minda, Renu; Salaye, Lipika; Bhattacharjee, Swapan K.; Rao, Basuthkar J.
2011-01-01
Computational methods are increasingly gaining importance as an aid in identifying active sites. Mostly these methods tend to have structural information that supplement sequence conservation based analyses. Development of tools that compute electrostatic potentials has further improved our ability to better characterize the active site residues in proteins. We have described a computational methodology for detecting active sites based on structural and electrostatic conformity - C ata L ytic A ctive S ite P rediction (CLASP). In our pipelined model, physical 3D signature of any particular enzymatic function as defined by its active sites is used to obtain spatially congruent matches. While previous work has revealed that catalytic residues have large pKa deviations from standard values, we show that for a given enzymatic activity, electrostatic potential difference (PD) between analogous residue pairs in an active site taken from different proteins of the same family are similar. False positives in spatially congruent matches are further pruned by PD analysis where cognate pairs with large deviations are rejected. We first present the results of active site prediction by CLASP for two enzymatic activities - β-lactamases and serine proteases, two of the most extensively investigated enzymes. The results of CLASP analysis on motifs extracted from Catalytic Site Atlas (CSA) are also presented in order to demonstrate its ability to accurately classify any protein, putative or otherwise, with known structure. The source code and database is made available at www.sanchak.com/clasp/. Subsequently, we probed alkaline phosphatases (AP), one of the well known promiscuous enzymes, for additional activities. Such a search has led us to predict a hitherto unknown function of shrimp alkaline phosphatase (SAP), where the protein acts as a protease. Finally, we present experimental evidence of the prediction by CLASP by showing that SAP indeed has protease activity in vitro. PMID:22174814
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bahl, C.; Morisseau, C; Bomberger, J
Cystic fibrosis transmembrane conductance regulator (CFTR) inhibitory factor (Cif) is a virulence factor secreted by Pseudomonas aeruginosa that reduces the quantity of CFTR in the apical membrane of human airway epithelial cells. Initial sequence analysis suggested that Cif is an epoxide hydrolase (EH), but its sequence violates two strictly conserved EH motifs and also is compatible with other {alpha}/{beta} hydrolase family members with diverse substrate specificities. To investigate the mechanistic basis of Cif activity, we have determined its structure at 1.8-{angstrom} resolution by X-ray crystallography. The catalytic triad consists of residues Asp129, His297, and Glu153, which are conserved across themore » family of EHs. At other positions, sequence deviations from canonical EH active-site motifs are stereochemically conservative. Furthermore, detailed enzymatic analysis confirms that Cif catalyzes the hydrolysis of epoxide compounds, with specific activity against both epibromohydrin and cis-stilbene oxide, but with a relatively narrow range of substrate selectivity. Although closely related to two other classes of {alpha}/{beta} hydrolase in both sequence and structure, Cif does not exhibit activity as either a haloacetate dehalogenase or a haloalkane dehalogenase. A reassessment of the structural and functional consequences of the H269A mutation suggests that Cif's effect on host-cell CFTR expression requires the hydrolysis of an extended endogenous epoxide substrate.« less
Dissecting enzyme function with microfluidic-based deep mutational scanning.
Romero, Philip A; Tran, Tuan M; Abate, Adam R
2015-06-09
Natural enzymes are incredibly proficient catalysts, but engineering them to have new or improved functions is challenging due to the complexity of how an enzyme's sequence relates to its biochemical properties. Here, we present an ultrahigh-throughput method for mapping enzyme sequence-function relationships that combines droplet microfluidic screening with next-generation DNA sequencing. We apply our method to map the activity of millions of glycosidase sequence variants. Microfluidic-based deep mutational scanning provides a comprehensive and unbiased view of the enzyme function landscape. The mapping displays expected patterns of mutational tolerance and a strong correspondence to sequence variation within the enzyme family, but also reveals previously unreported sites that are crucial for glycosidase function. We modified the screening protocol to include a high-temperature incubation step, and the resulting thermotolerance landscape allowed the discovery of mutations that enhance enzyme thermostability. Droplet microfluidics provides a general platform for enzyme screening that, when combined with DNA-sequencing technologies, enables high-throughput mapping of enzyme sequence space.
'2A-Like' Signal Sequences Mediating Translational Recoding: A Novel Form of Dual Protein Targeting.
Roulston, Claire; Luke, Garry A; de Felipe, Pablo; Ruan, Lin; Cope, Jonathan; Nicholson, John; Sukhodub, Andriy; Tilsner, Jens; Ryan, Martin D
2016-08-01
We report the initial characterization of an N-terminal oligopeptide '2A-like' sequence that is able to function both as a signal sequence and as a translational recoding element. Owing to this translational recoding activity, two forms of nascent polypeptide are synthesized: (i) when 2A-mediated translational recoding has not occurred: the nascent polypeptide is fused to the 2A-like N-terminal signal sequence and the fusion translation product is targeted to the exocytic pathway, and, (ii) a translation product where 2A-mediated translational recoding has occurred: the 2A-like signal sequence is synthesized as a separate translation product and, therefore, the nascent (downstream) polypeptide lacks the 2A-like signal sequence and is localized to the cytoplasm. This type of dual-functional signal sequence results, therefore, in the partitioning of the translation products between the two sub-cellular sites and represents a newly described form of dual protein targeting. © 2016 The Authors. Traffic published by John Wiley & Sons Ltd.
Swaney, Danielle L.; Wenger, Craig D.; Thomson, James A.; Coon, Joshua J.
2009-01-01
Protein phosphorylation is central to the understanding of cellular signaling, and cellular signaling is suggested to play a major role in the regulation of human embryonic stem (ES) cell pluripotency. Here, we describe the use of conventional tandem mass spectrometry-based sequencing technology—collision-activated dissociation (CAD)—and the more recently developed method electron transfer dissociation (ETD) to characterize the human ES cell phosphoproteome. In total, these experiments resulted in the identification of 11,995 unique phosphopeptides, corresponding to 10,844 nonredundant phosphorylation sites, at a 1% false discovery rate (FDR). Among these phosphorylation sites are 5 localized to 2 pluripotency critical transcription factors—OCT4 and SOX2. From these experiments, we conclude that ETD identifies a larger number of unique phosphopeptides than CAD (8,087 to 3,868), more frequently localizes the phosphorylation site to a specific residue (49.8% compared with 29.6%), and sequences whole classes of phosphopeptides previously unobserved. PMID:19144917
A role for cysteine 3635 of RYR1 in redox modulation and calmodulin binding
NASA Technical Reports Server (NTRS)
Porter Moore, C.; Zhang, J. Z.; Hamilton, S. L.
1999-01-01
Oxidation of the skeletal muscle Ca(2+) release channel (RYR1) increases its activity, produces intersubunit disulfide bonds, and blocks its interaction with calmodulin. Conversely, bound calmodulin protects RYR1 from the effects of oxidants (Zhang, J.-Z., Wu, Y., Williams, B. Y., Rodney, G., Mandel, F., Strasburg, G. M., and Hamilton, S. L. (1999) Am. J. Physiol. 276, Cell Physiol. C46-C53). In addition, calmodulin protects RYR1 from trypsin cleavage at amino acids 3630 and 3637 (Moore, C. P., Rodney, G., Zhang, J.-Z., Santacruz-Toloza, L., Strasburg, G. M., and Hamilton, S. L. (1999) Biochemistry 38, 8532-8537). The sequence between these two tryptic sites is AVVACFR. Alkylation of RYR1 with N-ethylmaleimide (NEM) blocks both (35)S-apocalmodulin binding and oxidation-induced intersubunit cross-linking. In the current work, we demonstrate that both cysteines needed for the oxidation-induced intersubunit cross-link are protected from alkylation with N-ethylmaleimide by bound calmodulin. We also show, using N-terminal amino acid sequencing together with analysis of the distribution of [(3)H]NEM labeling with each sequencing cycle, that cysteine 3635 of RYR1 is rapidly labeled by NEM and that this labeling is blocked by bound calmodulin. We propose that cysteine 3635 is located at an intersubunit contact site that is close to or within a calmodulin binding site. These findings suggest that calmodulin and oxidation modulate RYR1 activity by regulating intersubunit interactions in a mutually exclusive manner and that these interactions involve cysteine 3635.
Molecular identification and transcriptional regulation of porcine IFIT2 gene.
Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di
2018-04-06
IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.
Rojo, Liliana; Muhlia-Almazan, Adriana; Saborowski, Reinhard; García-Carreño, Fernando
2010-11-01
Acid digestive proteinases were studied in the gastric fluids of two species of clawed lobster (Homarus americanus and Homarus gammarus). An active protein was identified in both species as aspartic proteinase by specific inhibition with pepstatin A. It was confirmed as cathepsin D by mass mapping, N-terminal, and full-length cDNA sequencing. Both lobster species transcribed two cathepsin D mRNAs: cathepsin D1 and cathepsin D2. Cathepsin D1 mRNA was detected only in the midgut gland, suggesting its function as a digestive enzyme. Cathepsin D2 mRNA was found in the midgut gland, gonads, and muscle. The deduced amino acid sequence of cathepsin D1 and cathepsin D2 possesses two catalytic DTG active-site motifs, the hallmark of aspartic proteinases. The putatively active cathepsin D1 has a molecular mass of 36.4 kDa and a calculated pI of 4.14 and possesses three potential glycosylation sites. The sequences showed highest similarities with cathepsin D from insects but also with another crustacean cathepsin D. Cathepsin D1 transcripts were quantified during a starvation period using real-time qPCR. In H. americanus, 15 days of starvation did not cause significant changes, but subsequent feeding caused a 2.5-fold increase. In H. gammarus, starvation caused a 40% reduction in cathepsin D1 mRNA, and no effect was observed with subsequent feeding.
Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J
2000-11-01
Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Morellet, Nelly; Li, Xianghong; Wieninger, Silke A; Taylor, Jennifer L; Bischerour, Julien; Moriau, Séverine; Lescop, Ewen; Bardiaux, Benjamin; Mathy, Nathalie; Assrir, Nadine; Bétermier, Mireille; Nilges, Michael; Hickman, Alison B; Dyda, Fred; Craig, Nancy L; Guittet, Eric
2018-01-01
Abstract The piggyBac transposase (PB) is distinguished by its activity and utility in genome engineering, especially in humans where it has highly promising therapeutic potential. Little is known, however, about the structure–function relationships of the different domains of PB. Here, we demonstrate in vitro and in vivo that its C-terminal Cysteine-Rich Domain (CRD) is essential for DNA breakage, joining and transposition and that it binds to specific DNA sequences in the left and right transposon ends, and to an additional unexpectedly internal site at the left end. Using NMR, we show that the CRD adopts the specific fold of the cross-brace zinc finger protein family. We determine the interaction interfaces between the CRD and its target, the 5′-TGCGT-3′/3′-ACGCA-5′ motifs found in the left, left internal and right transposon ends, and use NMR results to propose docking models for the complex, which are consistent with our site-directed mutagenesis data. Our results provide support for a model of the PB/DNA interactions in the context of the transpososome, which will be useful for the rational design of PB mutants with increased activity. PMID:29385532
Collins, Richard A; Stajich, Jason E; Field, Deborah J; Olive, Joan E; DeAbreu, Diane M
2015-05-01
When we expressed a small (0.9 kb) nonprotein-coding transcript derived from the mitochondrial VS plasmid in the nucleus of Neurospora we found that it was efficiently spliced at one or more of eight 5' splice sites and ten 3' splice sites, which are present apparently by chance in the sequence. Further experimental and bioinformatic analyses of other mitochondrial plasmids, random sequences, and natural nuclear genes in Neurospora and other fungi indicate that fungal spliceosomes recognize a wide range of 5' splice site and branchpoint sequences and predict introns to be present at high frequency in random sequence. In contrast, analysis of intronless fungal nuclear genes indicates that branchpoint, 5' splice site and 3' splice site consensus sequences are underrepresented compared with random sequences. This underrepresentation of splicing signals is sufficient to deplete the nuclear genome of splice sites at locations that do not comprise biologically relevant introns. Thus, the splicing machinery can recognize a wide range of splicing signal sequences, but splicing still occurs with great accuracy, not because the splicing machinery distinguishes correct from incorrect introns, but because incorrect introns are substantially depleted from the genome. © 2015 Collins et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak
2016-01-01
Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102
Ribeiro, António J M; Holliday, Gemma L; Furnham, Nicholas; Tyzack, Jonathan D; Ferris, Katherine; Thornton, Janet M
2018-01-04
M-CSA (Mechanism and Catalytic Site Atlas) is a database of enzyme active sites and reaction mechanisms that can be accessed at www.ebi.ac.uk/thornton-srv/m-csa. Our objectives with M-CSA are to provide an open data resource for the community to browse known enzyme reaction mechanisms and catalytic sites, and to use the dataset to understand enzyme function and evolution. M-CSA results from the merging of two existing databases, MACiE (Mechanism, Annotation and Classification in Enzymes), a database of enzyme mechanisms, and CSA (Catalytic Site Atlas), a database of catalytic sites of enzymes. We are releasing M-CSA as a new website and underlying database architecture. At the moment, M-CSA contains 961 entries, 423 of these with detailed mechanism information, and 538 with information on the catalytic site residues only. In total, these cover 81% (195/241) of third level EC numbers with a PDB structure, and 30% (840/2793) of fourth level EC numbers with a PDB structure, out of 6028 in total. By searching for close homologues, we are able to extend M-CSA coverage of PDB and UniProtKB to 51 993 structures and to over five million sequences, respectively, of which about 40% and 30% have a conserved active site. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Mass Spectrometry to Identify New Biomarkers of Nerve Agent Exposure
2010-04-01
target for oganophosphorus agent (OP) binding to enzymes is the active site serine in the consensus sequence GlyXSerXGly of acetylcholinesterase. By...human plasma. Task 6. Use a second method, for example enzyme activity assays or immunoprecipitation, to confirm the identity of soman-labeled proteins...spectrometry identifies covalent binding of soman, sarin, chlorpyrifos oxon, diisopropyl fluorophosphate, and FP-biotin to tyrosines on tubulin: a potential
Godfrey, Rita E.; Lee, David J.; Busby, Stephen J. W.
2017-01-01
Summary The Escherichia coli K‐12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR‐dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter −10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K‐12 counterpart, exhibits substantial FNR‐independent activity and is insensitive to nutrient quality, due to an improved −10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K‐12 and Salmonella nrf operons. PMID:28211111
Lednicky, J; Folk, W R
1992-01-01
The 21-bp repeat region of simian virus 40 (SV40) activates viral transcription and DNA replication and contains binding sites for many cellular proteins, including Sp1, LSF, ETF, Ap2, Ap4, GT-1B, H16, and p53, and for the SV40 large tumor antigen. We have attempted to reduce the complexity of this region while maintaining its growth-promoting capacity. Deletion of the 21-bp repeat region from the SV40 genome delays the expression of viral early proteins and DNA replication and reduces virus production in CV-1 cells. Replacement of the 21-bp repeat region with two copies of DNA sequence motifs bound with high affinities by Sp1 promotes SV40 growth in CV-1 cells to nearly wild-type levels, but substitution by motifs bound less avidly by Sp1 or bound by other activator proteins does not restore growth. This indicates that Sp1 or a protein with similar sequence specificity is primarily responsible for the function of the 21-bp repeat region. We speculate about how Sp1 activates both SV40 transcription and DNA replication. Images PMID:1328672
Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C
2007-05-01
The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.
Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A
1995-04-11
SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.
Novel Immune Modulating Cellular Vaccine for Prostate Cancer
2014-10-01
restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal
Agúndez, Leticia; González-Prieto, Coral; Machón, Cristina; Llosa, Matxalen
2012-01-01
Background Bacterial conjugation is a mechanism for horizontal DNA transfer between bacteria which requires cell to cell contact, usually mediated by self-transmissible plasmids. A protein known as relaxase is responsible for the processing of DNA during bacterial conjugation. TrwC, the relaxase of conjugative plasmid R388, is also able to catalyze site-specific integration of the transferred DNA into a copy of its target, the origin of transfer (oriT), present in a recipient plasmid. This reaction confers TrwC a high biotechnological potential as a tool for genomic engineering. Methodology/Principal Findings We have characterized this reaction by conjugal mobilization of a suicide plasmid to a recipient cell with an oriT-containing plasmid, selecting for the cointegrates. Proteins TrwA and IHF enhanced integration frequency. TrwC could also catalyze integration when it is expressed from the recipient cell. Both Y18 and Y26 catalytic tyrosil residues were essential to perform the reaction, while TrwC DNA helicase activity was dispensable. The target DNA could be reduced to 17 bp encompassing TrwC nicking and binding sites. Two human genomic sequences resembling the 17 bp segment were accepted as targets for TrwC-mediated site-specific integration. TrwC could also integrate the incoming DNA molecule into an oriT copy present in the recipient chromosome. Conclusions/Significance The results support a model for TrwC-mediated site-specific integration. This reaction may allow R388 to integrate into the genome of non-permissive hosts upon conjugative transfer. Also, the ability to act on target sequences present in the human genome underscores the biotechnological potential of conjugative relaxase TrwC as a site-specific integrase for genomic modification of human cells. PMID:22292089
Chang, D D; Clayton, D A
1986-01-01
Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226
Coordination sequences and information spreading in small-world networks
NASA Astrophysics Data System (ADS)
Herrero, Carlos P.
2002-10-01
We study the spread of information in small-world networks generated from different d-dimensional regular lattices, with d=1, 2, and 3. With this purpose, we analyze by numerical simulations the behavior of the coordination sequence, e.g., the average number of sites C(n) that can be reached from a given node of the network in n steps along its bonds. For sufficiently large networks, we find an asymptotic behavior C(n)~ρn, with a constant ρ that depends on the network dimension d and on the rewiring probability p (which measures the disorder strength of a given network). A simple model of information spreading in these networks is studied, assuming that only a fraction q of the network sites are active. The number of active nodes reached in n steps has an asymptotic form λn, λ being a constant that depends on p and q, as well as on the dimension d of the underlying lattice. The information spreading presents two different regimes depending on the value of λ: For λ>1 the information propagates along the whole system, and for λ<1 the spreading is damped and the information remains confined in a limited region of the network. We discuss the connection of these results with site percolation in small-world networks.
Anaerobic carboxydotrophic bacteria in geothermal springs identified using stable isotope probing
Brady, Allyson L.; Sharp, Christine E.; Grasby, Stephen E.; Dunfield, Peter F.
2015-01-01
Carbon monoxide (CO) is a potential energy and carbon source for thermophilic bacteria in geothermal environments. Geothermal sites ranging in temperature from 45 to 65°C were investigated for the presence and activity of anaerobic CO-oxidizing bacteria. Anaerobic CO oxidation potentials were measured at up to 48.9 μmoles CO g−1 (wet weight) day−1 within five selected sites. Active anaerobic carboxydotrophic bacteria were identified using 13CO DNA stable isotope probing (SIP) combined with pyrosequencing of 16S rRNA genes amplified from labeled DNA. Bacterial communities identified in heavy DNA fractions were predominated by Firmicutes, which comprised up to 95% of all sequences in 13CO incubations. The predominant bacteria that assimilated 13C derived from CO were closely related (>98% 16S rRNA gene sequence identity) to genera of known carboxydotrophs including Thermincola, Desulfotomaculum, Thermolithobacter, and Carboxydocella, although a few species with lower similarity to known bacteria were also found that may represent previously unconfirmed CO-oxidizers. While the distribution was variable, many of the same OTUs were identified across sample sites from different temperature regimes. These results show that bacteria capable of using CO as a carbon source are common in geothermal springs, and that thermophilic carboxydotrophs are probably already quite well known from cultivation studies. PMID:26388850
Bloom, Kristie; Ely, Abdullah; Mussolino, Claudio; Cathomen, Toni; Arbuthnot, Patrick
2013-01-01
Chronic hepatitis B virus (HBV) infection remains an important global health problem. Stability of the episomal covalently closed circular HBV DNA (cccDNA) is largely responsible for the modest curative efficacy of available therapy. Since licensed anti-HBV drugs have a post-transcriptional mechanism of action, disabling cccDNA is potentially of therapeutic benefit. To develop this approach, we engineered mutagenic transcription activator-like effector nucleases (TALENs) that target four HBV-specific sites within the viral genome. TALENs with cognate sequences in the S or C open-reading frames (ORFs) efficiently disrupted sequences at the intended sites and suppressed markers of viral replication. Following triple transfection of cultured HepG2.2.15 cells under mildly hypothermic conditions, the S TALEN caused targeted mutation in ~35% of cccDNA molecules. Markers of viral replication were also inhibited in vivo in a murine hydrodynamic injection model of HBV replication. HBV target sites within S and C ORFs of the injected HBV DNA were mutated without evidence of toxicity. These findings are the first to demonstrate a targeted nuclease-mediated disruption of HBV cccDNA. Efficacy in vivo also indicates that these engineered nucleases have potential for use in treatment of chronic HBV infection. PMID:23883864
Anaerobic carboxydotrophic bacteria in geothermal springs identified using stable isotope probing.
Brady, Allyson L; Sharp, Christine E; Grasby, Stephen E; Dunfield, Peter F
2015-01-01
Carbon monoxide (CO) is a potential energy and carbon source for thermophilic bacteria in geothermal environments. Geothermal sites ranging in temperature from 45 to 65°C were investigated for the presence and activity of anaerobic CO-oxidizing bacteria. Anaerobic CO oxidation potentials were measured at up to 48.9 μmoles CO g(-1) (wet weight) day(-1) within five selected sites. Active anaerobic carboxydotrophic bacteria were identified using (13)CO DNA stable isotope probing (SIP) combined with pyrosequencing of 16S rRNA genes amplified from labeled DNA. Bacterial communities identified in heavy DNA fractions were predominated by Firmicutes, which comprised up to 95% of all sequences in (13)CO incubations. The predominant bacteria that assimilated (13)C derived from CO were closely related (>98% 16S rRNA gene sequence identity) to genera of known carboxydotrophs including Thermincola, Desulfotomaculum, Thermolithobacter, and Carboxydocella, although a few species with lower similarity to known bacteria were also found that may represent previously unconfirmed CO-oxidizers. While the distribution was variable, many of the same OTUs were identified across sample sites from different temperature regimes. These results show that bacteria capable of using CO as a carbon source are common in geothermal springs, and that thermophilic carboxydotrophs are probably already quite well known from cultivation studies.
Glutamine 89 is a key residue in the allosteric modulation of human serine racemase activity by ATP.
Canosa, Andrea V; Faggiano, Serena; Marchetti, Marialaura; Armao, Stefano; Bettati, Stefano; Bruno, Stefano; Percudani, Riccardo; Campanini, Barbara; Mozzarelli, Andrea
2018-06-13
Serine racemase (SR) catalyses two reactions: the reversible racemisation of L-serine and the irreversible dehydration of L- and D-serine to pyruvate and ammonia. SRs are evolutionarily related to serine dehydratases (SDH) and degradative threonine deaminases (TdcB). Most SRs and TdcBs - but not SDHs - are regulated by nucleotides. SR binds ATP cooperatively and the nucleotide allosterically stimulates the serine dehydratase activity of the enzyme. A H-bond network comprising five residues (T52, N86, Q89, E283 and N316) and water molecules connects the active site with the ATP-binding site. Conservation analysis points to Q89 as a key residue for the allosteric communication, since its mutation to either Met or Ala is linked to the loss of control of activity by nucleotides. We verified this hypothesis by introducing the Q89M and Q89A point mutations in the human SR sequence. The allosteric communication between the active site and the allosteric site in both mutants is almost completely abolished. Indeed, the stimulation of the dehydratase activity by ATP is severely diminished and the binding of the nucleotide is no more cooperative. Ancestral state reconstruction suggests that the allosteric control by nucleotides established early in SR evolution and has been maintained in most eukaryotic lineages.
Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo
2013-11-01
Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC 3 (NM_003786.3:c.1783-1G>A), KLHDC 1 (NM_172193.1:c.568-2A>G), HOOK 1 (NM_015888.4:c.1662-1G>A), SMAD 9 (NM_001127217.2:c.1004-1C>T), and DNAH 9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC 3, HOOK 1. In ABCC 3 and HOOK 1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK 1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4-6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis.
Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites
Chen, Yue; Sanchez, Ana M.; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N.; Busch, Michael P.; Gao, Feng
2016-01-01
HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs. PMID:27314585
Genetic Characterization of a Panel of Diverse HIV-1 Isolates at Seven International Sites.
Hora, Bhavna; Keating, Sheila M; Chen, Yue; Sanchez, Ana M; Sabino, Ester; Hunt, Gillian; Ledwaba, Johanna; Hackett, John; Swanson, Priscilla; Hewlett, Indira; Ragupathy, Viswanath; Vikram Vemula, Sai; Zeng, Peibin; Tee, Kok-Keng; Chow, Wei Zhen; Ji, Hezhao; Sandstrom, Paul; Denny, Thomas N; Busch, Michael P; Gao, Feng
2016-01-01
HIV-1 subtypes and drug resistance are routinely tested by many international surveillance groups. However, results from different sites often vary. A systematic comparison of results from multiple sites is needed to determine whether a standardized protocol is required for consistent and accurate data analysis. A panel of well-characterized HIV-1 isolates (N = 50) from the External Quality Assurance Program Oversight Laboratory (EQAPOL) was assembled for evaluation at seven international sites. This virus panel included seven subtypes, six circulating recombinant forms (CRFs), nine unique recombinant forms (URFs) and three group O viruses. Seven viruses contained 10 major drug resistance mutations (DRMs). HIV-1 isolates were prepared at a concentration of 107 copies/ml and compiled into blinded panels. Subtypes and DRMs were determined with partial or full pol gene sequences by conventional Sanger sequencing and/or Next Generation Sequencing (NGS). Subtype and DRM results were reported and decoded for comparison with full-length genome sequences generated by EQAPOL. The partial pol gene was amplified by RT-PCR and sequenced for 89.4%-100% of group M viruses at six sites. Subtyping results of majority of the viruses (83%-97.9%) were correctly determined for the partial pol sequences. All 10 major DRMs in seven isolates were detected at these six sites. The complete pol gene sequence was also obtained by NGS at one site. However, this method missed six group M viruses and sequences contained host chromosome fragments. Three group O viruses were only characterized with additional group O-specific RT-PCR primers employed by one site. These results indicate that PCR protocols and subtyping tools should be standardized to efficiently amplify diverse viruses and more consistently assign virus genotypes, which is critical for accurate global subtype and drug resistance surveillance. Targeted NGS analysis of partial pol sequences can serve as an alternative approach, especially for detection of low-abundance DRMs.
Kanhayuwa, Lakkhana; Coutts, Robert H. A.
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4–14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140–493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3’-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50–65% and 60–75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259–343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity. PMID:27736869
Kanhayuwa, Lakkhana; Coutts, Robert H A
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U
1984-01-01
A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198
Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi
2018-05-17
Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.
Tokuda, Gaku; Miyagi, Mio; Makiya, Hiromi; Watanabe, Hirofumi; Arakawa, Gaku
2009-12-01
beta-Glucosidase [EC 3.2.1.21] hydrolyzes cellobiose or cello-oligosaccharides into glucose during cellulose digestion in termites. SDS-PAGE and zymogram analyses of the digestive system in the higher termite Nasutitermes takasagoensis revealed that beta-glucosidase activity is localized in the salivary glands and midgut as dimeric glycoproteins. Degenerate PCR using primers based on the N-terminal amino acid sequences of the salivary beta-glucosidase resulted in cDNA fragments of 1.7 kb, encoding 489 amino acids with a sequence similar to glycosyl hydrolase family 1. Moreover, these primers amplified cDNA fragments from the midgut, and the deduced amino acid sequences are 87-91% identical to those of the salivary beta-glucosidases. Successful expression of the cDNAs in Escherichia coli implies that these sequences also encode functional beta-glucosidases. These results indicate that beta-glucosidases that primarily contribute to the digestive process of N. takasagoensis are produced in the midgut. Reverse transcription-PCR analysis indicated the site-specific expression of beta-glucosidase mRNAs in the salivary glands and midgut. These results suggest that termites have developed the ability to produce beta-glucosidases in the midgut, as is the case for endo-beta-1,4-glucanase, in which the site of expression has shifted from the salivary glands of lower termites to the midgut of higher termites. Copyright 2009 Elsevier Ltd. All rights reserved.
Taylor, James; Tyekucheva, Svitlana; King, David C; Hardison, Ross C; Miller, Webb; Chiaromonte, Francesca
2006-12-01
Genomic sequence signals - such as base composition, presence of particular motifs, or evolutionary constraint - have been used effectively to identify functional elements. However, approaches based only on specific signals known to correlate with function can be quite limiting. When training data are available, application of computational learning algorithms to multispecies alignments has the potential to capture broader and more informative sequence and evolutionary patterns that better characterize a class of elements. However, effective exploitation of patterns in multispecies alignments is impeded by the vast number of possible alignment columns and by a limited understanding of which particular strings of columns may characterize a given class. We have developed a computational method, called ESPERR (evolutionary and sequence pattern extraction through reduced representations), which uses training examples to learn encodings of multispecies alignments into reduced forms tailored for the prediction of chosen classes of functional elements. ESPERR produces a greatly improved Regulatory Potential score, which can discriminate regulatory regions from neutral sites with excellent accuracy ( approximately 94%). This score captures strong signals (GC content and conservation), as well as subtler signals (with small contributions from many different alignment patterns) that characterize the regulatory elements in our training set. ESPERR is also effective for predicting other classes of functional elements, as we show for DNaseI hypersensitive sites and highly conserved regions with developmental enhancer activity. Our software, training data, and genome-wide predictions are available from our Web site (http://www.bx.psu.edu/projects/esperr).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pratt, M.L.; Hsu, P.Y.; DeMoss, J.A.
1986-05-01
Tryptophan synthase (TS), which catalyzes the final step of tryptophan biosynthesis, is a multifunctional protein requiring pyridoxal phosphate (B6P) for two of its three distinct enzyme activities. TS from Neurospora has a blocked N-terminal, is a homodimer of 150 KDa and binds one mole of B6P per mole of subunit. The authors shown the N-terminal residue to be acyl-serine. The B6P-active site of holoenzyme was labelled by reduction of the B6P-Schiff base with (/sup 3/H)-NaBH/sub 4/, and resulted in a proportionate loss of activity in the two B6P-requiring reactions. SDS-polyacrylamide gel electrophoresis of CNBr-generated peptides showed the labelled, active sitemore » peptide to be 6 KDa. The sequence of this peptide, purified to apparent homogeneity by a combination of C-18 reversed phase and TSK gel filtration HPLC is: gly-arg-pro-gly-gln-leu-his-lys-ala-glu-arg-leu-thr-glu-tyr-ala-gly-gly-ala-gln-ile-xxx-leu-lys-arg-glu-asp-leu-asn-his-xxx-gly-xxx-his-/sub ***/-ile-asn-asn-ala-leu. Although four residues (xxx, /sub ***/) are unidentified, this peptide is minimally 78% homologous with the corresponding peptide from yeast TS, in which residue (/sub ***/) is the lysine that binds B6P.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi, Dashuang; Li, Yongdong; Cabrera-Luque, Juan
2012-05-24
Novel bifunctional N-acetylglutamate synthase/kinases (NAGS/K) that catalyze the first two steps of arginine biosynthesis and are homologous to vertebrate N-acetylglutamate synthase (NAGS), an essential cofactor-producing enzyme in the urea cycle, were identified in Maricaulis maris and several other bacteria. Arginine is an allosteric inhibitor of NAGS but not NAGK activity. The crystal structure of M. maris NAGS/K (mmNAGS/K) at 2.7 {angstrom} resolution indicates that it is a tetramer, in contrast to the hexameric structure of Neisseria gonorrhoeae NAGS. The quaternary structure of crystalline NAGS/K from Xanthomonas campestris (xcNAGS/K) is similar, and cross-linking experiments indicate that both mmNAGS/K and xcNAGS aremore » tetramers in solution. Each subunit has an amino acid kinase (AAK) domain, which is likely responsible for N-acetylglutamate kinase (NAGK) activity and has a putative arginine binding site, and an N-acetyltransferase (NAT) domain that contains the putative NAGS active site. These structures and sequence comparisons suggest that the linker residue 291 may determine whether arginine acts as an allosteric inhibitor or activator in homologous enzymes in microorganisms and vertebrates. In addition, the angle of rotation between AAK and NAT domains varies among crystal forms and subunits within the tetramer. A rotation of 26{sup o} is sufficient to close the predicted AcCoA binding site, thus reducing enzymatic activity. Since mmNAGS/K has the highest degree of sequence homology to vertebrate NAGS of NAGS and NAGK enzymes whose structures have been determined, the mmNAGS/K structure was used to develop a structural model of human NAGS that is fully consistent with the functional effects of the 14 missense mutations that were identified in NAGS-deficient patients.« less
The γ Class of Carbonic Anhydrases
Ferry, James G.
2009-01-01
Homologs of the γ class of carbonic anhydrases, one of five independently evolved classes, are found in the genomic sequences of diverse species from all three domains of life. The archetype (Cam) from the Archaea domain is a homotrimer of which the crystal structure reveals monomers with a distinctive left-handed parallel β-helix fold. Histidines from adjacent monomers ligate the three active site metals surrounded by residues in a hydrogen bond network essential for activity. Cam is most active with iron, the physiologically relevant metal. Although the active site residues bear little resemblance to the other classes, kinetic analyses indicate a two-step mechanism analogous to all carbonic anhydrases investigated. Phylogenetic analyses of Cam homologs derived from the databases show that Cam is representative of a minor subclass with the great majority belonging to a subclass (CamH) with significant differences in active site residues and apparent mechanism from Cam. A physiological function for any of the Cam and CamH homologs is unknown, although roles in transport of carbon dioxide and bicarbonate across membranes has been proposed. PMID:19747990
Immormino, Robert M; Silversmith, Ruth E; Bourret, Robert B
2016-10-04
Two-component regulatory systems, minimally composed of a sensor kinase and a response regulator protein, are common mediators of signal transduction in microorganisms. All response regulators contain a receiver domain with conserved active site residues that catalyze the signal activating and deactivating phosphorylation and dephosphorylation reactions. We explored the impact of variable active site position T+1 (one residue C-terminal to the conserved Thr/Ser) on reaction kinetics and signaling fidelity, using wild type and mutant Escherichia coli CheY, CheB, and NarL to represent the three major sequence classes observed across response regulators: Ala/Gly, Ser/Thr, and Val/Ile/Met, respectively, at T+1. Biochemical and structural data together suggested that different amino acids at T+1 impacted reaction kinetics by altering access to the active site while not perturbing overall protein structure. A given amino acid at position T+1 had similar effects on autodephosphorylation in each protein background tested, likely by modulating access of the attacking water molecule to the active site. Similarly, rate constants for CheY autophosphorylation with three different small molecule phosphodonors were consistent with the steric constraints on access to the phosphorylation site arising from combination of specific phosphodonors with particular amino acids at T+1. Because other variable active site residues also influence response regulator phosphorylation biochemistry, we began to explore how context (here, the amino acid at T+2) affected the influence of position T+1 on CheY autocatalytic reactions. Finally, position T+1 affected the fidelity and kinetics of phosphotransfer between sensor kinases and response regulators but was not a primary determinant of their interaction.