Science.gov

Sample records for active thyroid hormone

  1. An improved thyroid hormone reporter assay to determine the thyroid hormone-like activity of amiodarone, bithionol, closantel and rafoxanide.

    PubMed

    Matsubara, Kana; Sanoh, Seigo; Ohta, Shigeru; Kitamura, Shigeyuki; Sugihara, Kazumi; Fujimoto, Nariaki

    2012-01-01

    A number of environmental chemicals have been reported to exhibit thyroid hormone-like activity. Since thyroid hormones play a crucial role in development, it is important to identify chemicals in the environment that are capable of endocrine disruption of thyroid hormone homeostasis. In order to detect thyroid hormone-like activity, the growth of pituitary cell lines has been commonly used as a sensitive marker, albeit with limited specificity to thyroid hormones. Reporter gene assays using the thyroid hormone responsive element (TRE) connected to the luciferase reporter gene have also been developed. Thus far however, this type of assay appears to have limited sensitivity compared to cell growth assays. In the present study, we developed a highly sensitive TRE reporter gene assay by using a pituitary cell line, MtT/E-2, and by culturing cells in a serum-free medium. Our assay was developed in order to detect T3 activity at a concentration of 10(-11)M. This assay identified thyroid hormone-like activity from the antiarrhythmic drug, amiodarone, and from three anti-parasitic drugs, bithionol, closantel and rafoxanide, all commonly used in veterinary medicine. Thyroid hormone-like activity of these compounds was further confirmed by the induction of BCL3 gene expression in MtT/E-2, which is known to be regulated by thyroid hormones. Our improved assay was proved to be a sensitive tool for assessing thyroid hormone-like activity of environmental chemicals. PMID:22015988

  2. Regulation of Seasonal Reproduction by Hypothalamic Activation of Thyroid Hormone

    PubMed Central

    Shinomiya, Ai; Shimmura, Tsuyoshi; Nishiwaki-Ohkawa, Taeko; Yoshimura, Takashi

    2014-01-01

    Organisms living outside the tropics measure the changes in the length of the day to adapt to seasonal changes in the environment. Animals that breed during spring and summer are called long-day breeders, while those that breed during fall are called short-day breeders. Although the influence of thyroid hormone in the regulation of seasonal reproduction has been known for several decades, its precise mechanism remained unknown. Recent studies revealed that the activation of thyroid hormone within the mediobasal hypothalamus plays a key role in this phenomenon. This localized activation of the thyroid hormone is controlled by thyrotropin (thyroid-stimulating hormone) secreted from the pars tuberalis of the pituitary gland. Although seasonal reproduction is a rate-limiting factor in animal production, genes involved in photoperiodic signal transduction pathway could emerge as potential targets to facilitate domestication. PMID:24600435

  3. Reduced active thyroid hormone levels after delivery.

    PubMed

    Banovac, K; Kekić, M; Bzik, L; Skreb, F; Sekso, M

    1981-01-01

    The effect of delivery on the serum concentration of thyroid hormones was studied in 25 euthyroid women. After delivery serum free and total T3 and T4 fell transiently with a simultaneous increase in reverse T3 while serum TSH and thyroxine binding globulin (TBG) concentrations showed no significant variation. These data suggest that i) similar to what happens in other stressful situations, delivery influences peripheral T4 metabolism, and ii) an elevation of TBG in serum in the early puerperium does not prevent these changes. PMID:6798093

  4. The immune system as a regulator of thyroid hormone activity.

    PubMed

    Klein, John R

    2006-03-01

    It has been known for decades that the neuroendocrine system can both directly and indirectly influence the developmental and functional activity of the immune system. In contrast, far less is known about the extent to which the immune system collaborates in the regulation of endocrine activity. This is particularly true for immune-endocrine interactions of the hypothalamus-pituitary-thyroid axis. Although thyroid-stimulating hormone (TSH) can be produced by many types of extra-pituitary cells--including T cells, B cells, splenic dendritic cells, bone marrow hematopoietic cells, intestinal epithelial cells, and lymphocytes--the functional significance of those TSH pathways remains elusive and historically has been largely ignored from a research perspective. There is now, however, evidence linking cells of the immune system to the regulation of thyroid hormone activity in normal physiological conditions as well as during times of immunological stress. Although the mechanisms behind this are poorly understood, they appear to reflect a process of local intrathyroidal synthesis of TSH mediated by a population of bone marrow cells that traffic to the thyroid. This hitherto undescribed cell population has the potential to microregulate thyroid hormone secretion leading to critical alterations in metabolic activity independent of pituitary TSH output, and it has expansive implications for understanding mechanisms by which the immune system may act to modulate neuroendocrine function during times of host stress. In this article, the basic underpinnings of the hematopoietic-thyroid connection are described, and a model is presented in which the immune system participates in the regulation of thyroid hormone activity during acute infection. PMID:16514168

  5. 21 CFR 201.316 - Drugs with thyroid hormone activity for human use; required warning.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 4 2012-04-01 2012-04-01 false Drugs with thyroid hormone activity for human use... Drug Products § 201.316 Drugs with thyroid hormone activity for human use; required warning. (a) Drugs with thyroid hormone activity have been promoted for, and continue to be dispensed and prescribed...

  6. 21 CFR 201.316 - Drugs with thyroid hormone activity for human use; required warning.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 4 2011-04-01 2011-04-01 false Drugs with thyroid hormone activity for human use... Drug Products § 201.316 Drugs with thyroid hormone activity for human use; required warning. (a) Drugs with thyroid hormone activity have been promoted for, and continue to be dispensed and prescribed...

  7. 21 CFR 201.316 - Drugs with thyroid hormone activity for human use; required warning.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 4 2014-04-01 2014-04-01 false Drugs with thyroid hormone activity for human use... Drug Products § 201.316 Drugs with thyroid hormone activity for human use; required warning. (a) Drugs with thyroid hormone activity have been promoted for, and continue to be dispensed and prescribed...

  8. 21 CFR 201.316 - Drugs with thyroid hormone activity for human use; required warning.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Drugs with thyroid hormone activity for human use... Drug Products § 201.316 Drugs with thyroid hormone activity for human use; required warning. (a) Drugs with thyroid hormone activity have been promoted for, and continue to be dispensed and prescribed...

  9. 21 CFR 201.316 - Drugs with thyroid hormone activity for human use; required warning.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 4 2013-04-01 2013-04-01 false Drugs with thyroid hormone activity for human use... Drug Products § 201.316 Drugs with thyroid hormone activity for human use; required warning. (a) Drugs with thyroid hormone activity have been promoted for, and continue to be dispensed and prescribed...

  10. Coupling between Nutrient Availability and Thyroid Hormone Activation.

    PubMed

    Lartey, Lattoya J; Werneck-de-Castro, João Pedro; O-Sullivan, InSug; Unterman, Terry G; Bianco, Antonio C

    2015-12-18

    The activity of the thyroid gland is stimulated by food availability via leptin-induced thyrotropin-releasing hormone/thyroid-stimulating hormone expression. Here we show that food availability also stimulates thyroid hormone activation by accelerating the conversion of thyroxine to triiodothyronine via type 2 deiodinase in mouse skeletal muscle and in a cell model transitioning from 0.1 to 10% FBS. The underlying mechanism is transcriptional derepression of DIO2 through the mTORC2 pathway as defined in rictor knockdown cells. In cells kept in 0.1% FBS, there is DIO2 inhibition via FOXO1 binding to the DIO2 promoter. Repression of DIO2 by FOXO1 was confirmed using its specific inhibitor AS1842856 or adenoviral infection of constitutively active FOXO1. ChIP studies indicate that 4 h after 10% FBS-containing medium, FOXO1 binding markedly decreases, and the DIO2 promoter is activated. Studies in the insulin receptor FOXO1 KO mouse indicate that insulin is a key signaling molecule in this process. We conclude that FOXO1 represses DIO2 during fasting and that derepression occurs via nutritional activation of the PI3K-mTORC2-Akt pathway. PMID:26499800

  11. Active metabolism of thyroid hormone during metamorphosis of amphioxus.

    PubMed

    Paris, Mathilde; Hillenweck, Anne; Bertrand, Stéphanie; Delous, Georges; Escriva, Hector; Zalko, Daniel; Cravedi, Jean-Pierre; Laudet, Vincent

    2010-07-01

    Thyroid hormones (THs), and more precisely the 3,3',5-triiodo-l-thyronine (T(3)) acetic derivative 3,3',5-triiodothyroacetic acid (TRIAC), have been shown to activate metamorphosis in amphioxus. However, it remains unknown whether TRIAC is endogenously synthesized in amphioxus and more generally whether an active TH metabolism is regulating metamorphosis. Here we show that amphioxus naturally produces TRIAC from its precursors T(3) and l-thyroxine (T(4)), supporting its possible role as the active TH in amphioxus larvae. In addition, we show that blocking TH production inhibits metamorphosis and that this effect is compensated by exogenous T(3), suggesting that a peak of TH production is important for advancement of proper metamorphosis. Moreover, several amphioxus genes encoding proteins previously proposed to be involved in the TH signaling pathway display expression profiles correlated with metamorphosis. In particular, thyroid hormone receptor (TR) and deiodinases gene expressions are either up- or down-regulated during metamorphosis and by TH treatments. Overall, these results suggest that an active TH metabolism controls metamorphosis in amphioxus, and that endogenous TH production and metabolism as well as TH-regulated metamorphosis are ancestral in the chordate lineage. PMID:21558188

  12. Thyroid Hormone, Cancer, and Apoptosis.

    PubMed

    Lin, Hung-Yun; Chin, Yu-Tan; Yang, Yu-Chen S H; Lai, Husan-Yu; Wang-Peng, Jacqueline; Liu, Leory F; Tang, Heng-Yuan; Davis, Paul J

    2016-01-01

    Thyroid hormones play important roles in regulating normal metabolism, development, and growth. They also stimulate cancer cell proliferation. Their metabolic and developmental effects and growth effects in normal tissues are mediated primarily by nuclear hormone receptors. A cell surface receptor for the hormone on integrin [alpha]vβ3 is the initiation site for effects on tumor cells. Clinical hypothyroidism may retard cancer growth, and hyperthyroidism was recently linked to the prevalence of certain cancers. Local levels of thyroid hormones are controlled through activation and deactivation of iodothyronine deiodinases in different organs. The relative activities of different deiodinases that exist in tissues or organs also affect the progression and development of specific types of cancers. In this review, the effects of thyroid hormone on signaling pathways in breast, brain, liver, thyroid, and colon cancers are discussed. The importance of nuclear thyroid hormone receptor isoforms and of the hormone receptor on the extracellular domain of integrin [alpha]vβ3 as potential cancer risk factors and therapeutic targets are addressed. We analyze the intracellular signaling pathways activated by thyroid hormones in cancer progression in hyperthyroidism or at physiological concentrations in the euthyroid state. Determining how to utilize the deaminated thyroid hormone analog (tetrac), and its nanoparticulate derivative to reduce risks of cancer progression, enhance therapeutic outcomes, and prevent cancer recurrence is also deliberated. © 2016 American Physiological Society. Compr Physiol 6:1221-1237, 2016. PMID:27347891

  13. Thyroid Hormone Treatment

    MedlinePlus

    ... is to closely replicate normal thyroid functioning. Pure, synthetic thyroxine (T4) works in the same way as ... needing thyroid hormone replacement (see Hypothyroidism brochure ). Pure synthetic thyroxine (T4), taken once daily by mouth, successfully ...

  14. Thyroid Hormones as Renal Cell Cancer Regulators

    PubMed Central

    Matak, Damian; Bartnik, Ewa; Szczylik, Cezary; Czarnecka, Anna M.

    2016-01-01

    It is known that thyroid hormone is an important regulator of cancer development and metastasis. What is more, changes across the genome, as well as alternative splicing, may affect the activity of the thyroid hormone receptors. Mechanism of action of the thyroid hormone is different in every cancer; therefore in this review thyroid hormone and its receptor are presented as a regulator of renal cell carcinoma. PMID:27034829

  15. Autoimmunity against thyroid hormones.

    PubMed

    Sakata, S

    1994-01-01

    The presence of thyroid hormone autoantibodies (THAA) is a common phenomenon. More than 270 cases have been reported by the end of 1993 involving not only thyroidal but also nonthyroidal disorders. Clinically, THAA in a patient's serum produces variation in thyroid hormone metabolism and, in particular, may interfere with the radioimmunoassay (RIA) results of total or free thyroid hormone measurements, which can cause unusually high or low values of the hormones depending on the B/F separation method used. This in vitro interference can give clinicians confusing information about the patient's thyroid state. As a result, the patient may receive inappropriate treatment from physicians who are unaware of this disorder. The presence of THAA has been reported not only in humans but also in dogs, chickens, and rats. In this review article, clinical features of THAA and the mechanism of autoantibody production are discussed. PMID:7535535

  16. Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex.

    PubMed Central

    Fondell, J D; Ge, H; Roeder, R G

    1996-01-01

    Transcriptional regulation by nuclear hormone receptors is thought to involve interactions with putative cofactors that may potentiate receptor function. Here we show that human thyroid hormone receptor alpha purified from HeLa cells grown in the presence of thyroid hormone (T3) is associated with a group of distinct nuclear proteins termed thyroid hormone receptor-associated proteins (TRAPs). In an in vitro system reconstituted with general initiation factors and cofactors (and in the absence of added T3), the "liganded" thyroid hormone receptor (TR)/TRAP complex markedly activates transcription from a promoter template containing T3-response elements. Moreover, whereas the retinoid X receptor is not detected in the TR/TRAP complex, its presence is required for the function of the complex. In contrast, human thyroid hormone receptor alpha purified from cells grown in the absence of T3 lacks the TRAPs and effects only a low level of activation that is dependent on added ligand. These findings demonstrate the ligand-dependent in vivo formation of a transcriptionally active TR-multisubunit protein complex and suggest a role for TRAPs as positive coactivators for gene-specific transcriptional activation. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8710870

  17. Thyroid Hormone and Cardioprotection.

    PubMed

    Gerdes, Anthony Martin; Ojamaa, Kaie

    2016-01-01

    The heart is a major target of thyroid hormones, with maintenance of euthyroid hormone balance critical for proper function. In particular, chronic low thyroid function can eventually lead to dilated heart failure with impaired coronary blood flow. New evidence also suggests that heart diseases trigger a reduction in cardiac tissue thyroid hormone levels, a condition that may not be detectible using serum hormone assays. Many animal and clinical studies have demonstrated a high prevalence of low thyroid function in heart diseases with worse outcomes from this condition. Animal and human studies have also demonstrated many benefits from thyroid hormone treatment of heart diseases, particularly heart failure. Nonetheless, this potential treatment has not yet translated to patients due to a number of important concerns. The most serious concern involves the potential of accidental overdose leading to increased arrhythmias and sudden death. Several important clinical studies, which actually used excessive doses of thyroid hormone analogs, have played a major role in convincing the medical community that thyroid hormones are simply too dangerous to be considered for treatment in cardiac patients. Nonetheless, this issue has not gone away due primarily to overwhelmingly positive evidence for treatment benefits and a new understanding of the cellular and molecular mechanisms underlying those benefits. This review will first discuss the clinical evidence for the use of thyroid hormones as a cardioprotective agent and then provide an overview of the cellular and molecular mechanisms underlying beneficial changes from thyroid hormone treatment of heart diseases. © 2016 American Physiological Society. Compr Physiol 6:1199-1219, 2016. PMID:27347890

  18. In Vitro, Ex Vivo, and In Vivo Determination of Thyroid Hormone Modulating Activity of Benzothiazoles.

    PubMed

    Hornung, Michael W; Kosian, Patricia A; Haselman, Jonathan T; Korte, Joseph J; Challis, Katie; Macherla, Chitralekha; Nevalainen, Erica; Degitz, Sigmund J

    2015-08-01

    As in vitro assays are increasingly used to screen chemicals for their potential to produce endocrine disrupting adverse effects, it is important to understand their predictive capacity. The potential for a set of 6 benzothiazoles to affect endpoints related to thyroid hormone synthesis inhibition were assessed using in vitro, ex vivo, and in vivo assays. Inhibition of thyroid peroxidase (TPO) derived from pig thyroid glands was determined for benzothiazole (BTZ), 2-mercaptobenzothiazole (MBT), 5-chloro-2-mercaptobenzothiazole (CMBT), 2-aminobenzothiazole (ABT), 2-hydroxybenzothiazole (HBT), and 2-methylthiobenzothiazole (MTBT). Their rank order potency for TPO inhibition was MBT=CMBT>ABT>BTZ, whereas HBT and MTBT exhibited no inhibitory activity. The benzothiazoles were tested further in a Xenopus laevis thyroid gland explant culture assay in which inhibition of thyroxine (T4) release was the measured endpoint. In this assay all 6 benzothiazoles inhibited T4 release. The activity of the benzothiazoles for disrupting thyroid hormone activity was verified in vivo using X. laevis tadpoles in a 7-day assay. The 2 most potent chemicals for TPO inhibition, MBT and CMBT, produced responses in vivo indicative of T4 synthesis inhibition including induction of sodium iodide symporter mRNA and decreases in glandular and circulating thyroid hormones. The capability to measure thyroid hormone levels in the glands and blood by ultrahigh performance LC-MS/MS methods optimized for small tissue samples was critical for effects interpretation. These results indicate that inhibition of TPO activity in vitro was a good indicator of a chemical's potential for thyroid hormone disruption in vivo and may be useful for prioritizing chemicals for further investigation. PMID:25953703

  19. Thyroid hormone stimulation in vitro of red blood cell Ca2+-ATPase activity: interspecies variation.

    PubMed

    Davis, F B; Kite, J H; Davis, P J; Blas, S D

    1982-01-01

    In vitro susceptibility to thyroid hormone stimulation of membrane-associated Ca2+-ATPase activity has been examined in red blood cells from rat, rabbit, dog, monkey, and man. Monkey and human red cell Ca2+-ATPase activities responded comparably to 10(-10)M T4 or T3. Basal and thyroid hormone-stimulated Ca2+-ATPase activity in rabbit erythrocytes was four-fold higher than in primate red cells. Rat and dog red cell Ca2+-ATPase did not respond to iodothyronines in vitro. PMID:6459228

  20. Activated Thyroid Hormone Promotes Differentiation and Chemotherapeutic Sensitization of Colorectal Cancer Stem Cells by Regulating Wnt and BMP4 Signaling.

    PubMed

    Catalano, Veronica; Dentice, Monica; Ambrosio, Raffaele; Luongo, Cristina; Carollo, Rosachiara; Benfante, Antonina; Todaro, Matilde; Stassi, Giorgio; Salvatore, Domenico

    2016-03-01

    Thyroid hormone is a pleiotropic factor that controls many cellular processes in multiple cell types such as cancer stem cells (CSC). Thyroid hormone concentrations in the blood are stable, but the action of the deiodinases (D2-D3) provides cell-specific regulation of thyroid hormone activity. Deregulation of deiodinase function and thyroid hormone status has been implicated in tumorigenesis. Therefore, we investigated the role of thyroid hormone metabolism and signaling in colorectal CSCs (CR-CSC), where deiodinases control cell division and chemosensitivity. We found that increased intracellular thyroid hormone concentration through D3 depletion induced cell differentiation and sharply mitigated tumor formation. Upregulated BMP4 expression and concomitantly attenuated Wnt signaling accompanied these effects. Furthermore, we demonstrate that BMP4 is a direct thyroid hormone target and is involved in a positive autoregulatory feedback loop that modulates thyroid hormone signaling. Collectively, our findings highlight a cell-autonomous metabolic mechanism by which CR-CSCs exploit thyroid hormone signaling to facilitate their self-renewal potential and suggest that drug-induced cell differentiation may represent a promising therapy for preventing CSC expansion and tumor progression. PMID:26676745

  1. Activation of the RhoB Signaling Pathway by Thyroid Hormone Receptor β in Thyroid Cancer Cells

    PubMed Central

    Ichijo, Sayaka; Furuya, Fumihiko; Shimura, Hiroki; Hayashi, Yoshitaka; Takahashi, Kazuya; Ohta, Kazuyasu; Kobayashi, Tetsuro; Kitamura, Kenichiro

    2014-01-01

    Thyroid hormone receptor (TR) mediates the crucial effects of the thyroid hormone (T3) on cellular growth, development, and differentiation. Decreased expression or inactivating somatic mutations of TRs have been found in human cancers of the liver, breast, lung, and thyroid. The mechanisms of TR-associated carcinogenesis are still not clear. To establish the function of TRβ in thyroid cancer cell proliferation, we constructed a recombinant adenovirus vector, AdTRβ, which expresses human TRβ1 cDNA. Thyroid cancer cell lines in which TRβ protein levels were significantly decreased as compared to intact thyroid tissues were infected with AdTRβ and the function of TRβ on cell proliferation and migration was analyzed. Ligand-bound TRβ induced HDAC1 and HDAC3 dissociation from, and histone acetylation associated with the RhoB promoter and enhanced the expression of RhoB mRNA and protein. In AdTRβ-infected cells, T3 and farnesyl transferase inhibitor (FTI)-treatment induced the distribution of RhoB on the cell membrane and enhanced the abundance of active GTP-bound RhoB. This RhoB protein led to p21-associated cell-cycle arrest in the G0/G1 phase, following inhibition of cell proliferation and invasion. Conversely, lowering cellular RhoB by small interfering RNA knockdown in AdTRβ-infected cells led to downregulation of p21 and inhibited cell-cycle arrest. The growth of BHP18-21v tumor xenografts in vivo was significantly inhibited by AdTRβ injection with FTIs-treatment, as compared to control virus-injected tumors. This novel signaling pathway triggered by ligand-bound TRβ provides insight into possible mechanisms of proliferation and invasion of thyroid cancer and may provide new therapeutic targets for thyroid cancers. PMID:25548921

  2. Thyroid hormone resistance.

    PubMed

    Olateju, Tolulope O; Vanderpump, Mark P J

    2006-11-01

    Resistance to thyroid hormone (RTH) is a rare autosomal dominant inherited syndrome of reduced end-organ responsiveness to thyroid hormone. Patients with RTH have elevated serum free thyroxine (FT4) and free triiodothyronine (FT3) concentrations and normal or slightly elevated serum thyroid stimulating hormone (TSH) level. Despite a variable clinical presentation, the common characteristic clinical features are goitre but an absence of the usual symptoms and metabolic consequences of thyroid hormone excess. Patients with RTH can be classified on clinical grounds alone into either generalized resistance (GRTH), pituitary resistance (PRTH) or combined. Mutations in the thyroid hormone receptor (TR) beta gene are responsible for RTH and 122 different mutations have now been identified belonging to 300 families. With the exception of one family found to have complete deletion of the TRbeta gene, all others have been demonstrated to have minor alterations at the DNA level. The differential diagnosis includes a TSH-secreting pituitary adenoma and the presence of endogenous antibodies directed against thyroxine (T4) and triiodothyronine (T3). Failure to differentiate RTH from primary thyrotoxicosis has resulted in the inappropriate treatment of nearly one-third of patients. Although occasionally desirable, no specific treatment is available for RTH; however, the diagnosis allows appropriate genetic counselling. PMID:17132274

  3. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  4. Thyroid Hormone and Wound Healing

    PubMed Central

    Safer, Joshua D.

    2013-01-01

    Although thyroid hormone is one of the most potent stimulators of growth and metabolic rate, the potential to use thyroid hormone to treat cutaneous pathology has never been subject to rigorous investigation. A number of investigators have demonstrated intriguing therapeutic potential for topical thyroid hormone. Topical T3 has accelerated wound healing and hair growth in rodents. Topical T4 has been used to treat xerosis in humans. It is clear that the use of thyroid hormone to treat cutaneous pathology may be of large consequence and merits further study. This is a review of the literature regarding thyroid hormone action on skin along with skin manifestations of thyroid disease. The paper is intended to provide a context for recent findings of direct thyroid hormone action on cutaneous cells in vitro and in vivo which may portend the use of thyroid hormone to promote wound healing. PMID:23577275

  5. Alternative complement pathway and factor B activities in rats with altered blood levels of thyroid hormone

    PubMed Central

    Bitencourt, C.S.; Duarte, C.G.; Azzolini, A.E.C.S.; Assis-Pandochi, A.I.

    2012-01-01

    Evaluating the activity of the complement system under conditions of altered thyroid hormone levels might help elucidate the role of complement in triggering autoimmune processes. Here, we investigated alternative pathway (AP) activity in male Wistar rats (180 ± 10 g) after altering their thyroid hormone levels by treatment with triiodothyronine (T3), propylthiouracil (PTU) or thyroidectomy. T3 and thyroxine (T4) levels were determined by chemiluminescence assays. Hemolytic assays were performed to evaluate the lytic activity of the AP. Factor B activity was evaluated using factor B-deficient serum. An anti-human factor B antibody was used to measure factor B levels in serum by radial immunodiffusion. T3 measurements in thyroidectomized animals or animals treated with PTU demonstrated a significant reduction in hormone levels compared to control. The results showed a reduction in AP lytic activity in rats treated with increasing amounts of T3 (1, 10, or 50 µg). Factor B activity was also decreased in the sera of hyperthyroid rats treated with 1 to 50 µg T3. Additionally, treating rats with 25 µg T3 significantly increased factor B levels in their sera (P < 0.01). In contrast, increased factor B concentration and activity (32%) were observed in hypothyroid rats. We conclude that alterations in thyroid hormone levels affect the activity of the AP and factor B, which may in turn affect the roles of AP and factor B in antibody production. PMID:22370704

  6. Thyroid hormone receptors regulate adipogenesis and carcinogenesis via crosstalk signaling with peroxisome proliferator-activated receptors

    PubMed Central

    Lu, Changxue; Cheng, Sheue-Yann

    2012-01-01

    Peroxisome proliferator-activated receptors (PPARs) and thyroid hormone receptors (TRs) are members of the nuclear receptor superfamily. They are ligand-dependent transcription factors that interact with their cognate hormone response elements in the promoters to regulate respective target gene expression to modulate cellular functions. While the transcription activity of each is regulated by their respective ligands, recent studies indicate that via multiple mechanisms PPARs and TRs crosstalk to affect diverse biological functions. Here, we review recent advances in the understanding of the molecular mechanisms and biological impact of crosstalk between these two important nuclear receptors, focusing on their roles in adipogenesis and carcinogenesis. PMID:19741045

  7. Thyroid hormone replacement therapy.

    PubMed

    Wiersinga, W M

    2001-01-01

    Thyroid hormone replacement has been used for more than 100 years in the treatment of hypothyroidism, and there is no doubt about its overall efficacy. Desiccated thyroid contains both thyroxine (T(4)) and triiodothyronine (T(3)); serum T(3) frequently rises to supranormal values in the absorption phase, associated with palpitations. Liothyronine (T(3)) has the same drawback and requires twice-daily administration in view of its short half-life. Synthetic levothyroxine (L-T(4)) has many advantages: in view of its long half-life, once-daily administration suffices, the occasional missing of a tablet causes no harm, and the extrathyroidal conversion of T(4) into T(3) (normally providing 80% of the daily T(3) production rate) remains fully operative, which may have some protective value during illness. Consequently, L-T(4) is nowadays preferred, and its long-term use is not associated with excess mortality. The mean T(4) dose required to normalize serum thyroid stimulating hormone (TSH) is 1.6 microg/kg per day, giving rise to serum free T(4) (fT(4)) concentrations that are slightly elevated or in the upper half of the normal reference range. The higher fT(4) values are probably due to the need to generate from T(4) the 20% of the daily T(3) production rate that otherwise is derived from the thyroid gland itself. The daily maintenance dose of T(4) varies widely between 75 and 250 microg. Assessment of the appropriate T(4) dose is by assay of TSH and fT(4), preferably in a blood sample taken before ingestion of the subsequent T(4) tablet. Dose adjustments can be necessary in pregnancy and when medications are used that are known to interfere with the absorption or metabolism of T(4). A new equilibrium is reached after approximately 6 weeks, implying that laboratory tests should not be done earlier. With a stable maintenance dose, an annual check-up usually suffices. Accumulated experience with L-T(4) replacement has identified some areas of concern. First, the

  8. Transcriptional activation by the thyroid hormone receptor through ligand-dependent receptor recruitment and chromatin remodelling.

    PubMed

    Grøntved, Lars; Waterfall, Joshua J; Kim, Dong Wook; Baek, Songjoon; Sung, Myong-Hee; Zhao, Li; Park, Jeong Won; Nielsen, Ronni; Walker, Robert L; Zhu, Yuelin J; Meltzer, Paul S; Hager, Gordon L; Cheng, Sheue-yann

    2015-01-01

    A bimodal switch model is widely used to describe transcriptional regulation by the thyroid hormone receptor (TR). In this model, the unliganded TR forms stable, chromatin-bound complexes with transcriptional co-repressors to repress transcription. Binding of hormone dissociates co-repressors and facilitates recruitment of co-activators to activate transcription. Here we show that in addition to hormone-independent TR occupancy, ChIP-seq against endogenous TR in mouse liver tissue demonstrates considerable hormone-induced TR recruitment to chromatin associated with chromatin remodelling and activated gene transcription. Genome-wide footprinting analysis using DNase-seq provides little evidence for TR footprints both in the absence and presence of hormone, suggesting that unliganded TR engagement with repressive complexes on chromatin is, similar to activating receptor complexes, a highly dynamic process. This dynamic and ligand-dependent interaction with chromatin is likely shared by all steroid hormone receptors regardless of their capacity to repress transcription in the absence of ligand. PMID:25916672

  9. Thyroid Hormone Regulation of Metabolism

    PubMed Central

    Mullur, Rashmi; Liu, Yan-Yun

    2014-01-01

    Thyroid hormone (TH) is required for normal development as well as regulating metabolism in the adult. The thyroid hormone receptor (TR) isoforms, α and β, are differentially expressed in tissues and have distinct roles in TH signaling. Local activation of thyroxine (T4), to the active form, triiodothyronine (T3), by 5′-deiodinase type 2 (D2) is a key mechanism of TH regulation of metabolism. D2 is expressed in the hypothalamus, white fat, brown adipose tissue (BAT), and skeletal muscle and is required for adaptive thermogenesis. The thyroid gland is regulated by thyrotropin releasing hormone (TRH) and thyroid stimulating hormone (TSH). In addition to TRH/TSH regulation by TH feedback, there is central modulation by nutritional signals, such as leptin, as well as peptides regulating appetite. The nutrient status of the cell provides feedback on TH signaling pathways through epigentic modification of histones. Integration of TH signaling with the adrenergic nervous system occurs peripherally, in liver, white fat, and BAT, but also centrally, in the hypothalamus. TR regulates cholesterol and carbohydrate metabolism through direct actions on gene expression as well as cross-talk with other nuclear receptors, including peroxisome proliferator-activated receptor (PPAR), liver X receptor (LXR), and bile acid signaling pathways. TH modulates hepatic insulin sensitivity, especially important for the suppression of hepatic gluconeogenesis. The role of TH in regulating metabolic pathways has led to several new therapeutic targets for metabolic disorders. Understanding the mechanisms and interactions of the various TH signaling pathways in metabolism will improve our likelihood of identifying effective and selective targets. PMID:24692351

  10. Thyroid hormones increase Na -H exchange activity in renal brush border membranes

    SciTech Connect

    Kinsella, J.; Sacktor, B.

    1985-06-01

    Na -H exchange activity, i.e., amiloride-sensitive Na and H flux, in renal proximal tubule brush border (luminal) membrane vesicles was increased in the hyperthyroid rat and decreased in the hypothyroid rat, relative to the euthyroid animal. A positive correlation was found between Na -H exchange activity and serum concentrations of thyroxine (T4) and triiodothyronine (T3). The thyroid status of the animal did not alter amiloride-insensitive Na uptake. The rate of passive pH gradient dissipation was higher in membrane vesicles from hyperthyroid rats compared to the rate in vesicles from hypothyroid animals, a result which would tend to limit the increase in Na uptake in vesicles from hyperthyroid animals. Na -dependent phosphate uptake was increased in membrane vesicles from hyperthyroid rats; Na -dependent D-glucose and L-proline uptakes were not changed by the thyroid status of the animal. The effect of thyroid hormones in increasing the uptake of Na in the brush border membrane vesicle is consistent with the action of the hormones in enhancing renal Na reabsorption.

  11. [Thyroid hormone and the cardiovascular system].

    PubMed

    Fraczek, Magdalena Maria; Łacka, Katarzyna

    2014-09-01

    It is well established that thyroid hormones affect the cardiovascular system through genomic and nongenomic actions. TRalpha1 is the major thyroid hormone receptor in the heart. T3 suppresses increased mitotic activity of stimulated cardiomyocytes. Hyperthyroidism induces a hyperdynamic cardiovascular state, which is associated with enhanced left ventricular systolic and diastolic function and the chronotropic and inotropic properties of thyroid hormones. Hypothyroidism, however, is characterized by opposite changes. In addition, thyroid hormones decrease peripheral vascular resistance, influence the rennin-angiotensin system (RAS), and increase blood volume and erythropoetin secretion with subsequent increased preload and cardiac output. Thyroid hormones play an important role in cardiac electrophysiology and have both pro- and anti-arrhytmic potential. Thyroid hormone deficiency is associated with a less favorable lipid profile. Selective modulation of the TRbeta1 receptor is considered as a potential therapeutic target to treat dyslipidemia without cardiac side effects. Thyroid hormones have a beneficial effect on limiting myocardial ischemic injury, preventing and reversing cardiac remodeling and improving cardiac hemodynamics in endstage heart failure. This is crucial because a low T3 syndrome accompanies both acute and chronic cardiac diseases. PMID:25345279

  12. Thyroid Hormone Activates Brown Adipose Tissue and Increases Non-Shivering Thermogenesis - A Cohort Study in a Group of Thyroid Carcinoma Patients

    PubMed Central

    Broeders, Evie P. M.; Vijgen, Guy H. E. J.; Havekes, Bas; Bouvy, Nicole D.; Mottaghy, Felix M.; Kars, Marleen; Schaper, Nicolaas C.; Schrauwen, Patrick; Brans, Boudewijn; van Marken Lichtenbelt, Wouter D.

    2016-01-01

    Background/Objectives Thyroid hormone receptors are present on brown adipose tissue (BAT), indicating a role for thyroid hormone in the regulation of BAT activation. The objective of this study was to examine the effect of thyroid hormone withdrawal followed by thyroid hormone in TSH-suppressive dosages, on energy expenditure and brown adipose tissue activity. Subjects/Methods This study was a longitudinal study in an academic center, with a follow-up period of 6 months. Ten patients with well-differentiated thyroid carcinoma eligible for surgical treatment and subsequent radioactive iodine ablation therapy were studied in a hypothyroid state after thyroidectomy and in a subclinical hyperthyroid state (TSH-suppression according to treatment protocol). Paired two-tailed t-tests and linear regression analyses were used. Results Basal metabolic rate (BMR) was significantly higher after treatment with synthetic thyroid hormone (levothyroxine) than in the hypothyroid state (BMR 3.8 ± 0.5 kJ/min versus 4.4 ± 0.6 kJ/min, P = 0.012), and non-shivering thermogenesis (NST) significantly increased from 15 ± 10% to 25 ± 6% (P = 0.009). Mean BAT activity was significantly higher in the subclinical hyperthyroid state than in the hypothyroid state (BAT standard uptake value (SUVMean) 4.0 ± 2.9 versus 2.4 ± 1.8, P = 0.039). Conclusions Our study shows that higher levels of thyroid hormone are associated with a higher level of cold-activated BAT. Trial Registration ClinicalTrials.gov NCT02499471 PMID:26784028

  13. Thyroid Hormone Levels and TSH Activity in Patients with Obstructive Sleep Apnea Syndrome.

    PubMed

    Bielicki, P; Przybyłowski, T; Kumor, M; Barnaś, M; Wiercioch, M; Chazan, R

    2016-01-01

    Obstructive sleep apnea syndrome (OSAS) is characterized by complete cessation of inspiratory flow (apnea) or upper airway airflow limitation (hypopnea) with increased respiratory muscle activity, which is repeatedly observed during sleep. Hypothyroidism has been described as a rare cause of OSAS, but it is considered to be the main cause of breathing disorders during sleep in patients in whom an improvement of OSAS is observed after thyroid hormone replacement therapy. Nevertheless, euthyreosis due to thyroxine replacement in patients with OSAS often does not improve the breathing disorder and treatment with continuous positive airway pressure is usually applied. The aim of this study was to assess thyroid function in patients with OSAS. We studied 813 patients in whom severe OSAS was diagnosed; the mean apnea-hypopnea index was 44.0. Most of the patients were obese (mean BMI 33.1 ± 6.6 kg/m2) and had excessive daytime sleepiness (ESS 12.8 ± 6.6). With the thyroid stimulating hormone (TSH) concentration as the major criterion, hypothyroidism was diagnosed in 38 (4.7%) and hyperthyroidism was diagnosed in 31 (3.8%) patients. Analysis of basic anthropometric data, selected polysomnography results, and TSH, fT3, and fT4 values did not reveal any significant correlations. In conclusion, the incidence of thyroid function disorders seems to be no different in OSAS than that in the general population. We did not find correlations between TSH activity and the severity of breathing disorders during sleep. PMID:26542600

  14. Tissue thyroid hormones and thyronamines.

    PubMed

    Accorroni, Alice; Saponaro, Federica; Zucchi, Riccardo

    2016-07-01

    It has been known for a long time that changes in cardiac function are a major component of the clinical presentation of thyroid disease. Increased heart rate and hyperdynamic circulation are hallmarks of hyperthyroidism, while bradycardia and decreased contractility characterize hypothyroidism. Recent findings have provided novel insights in the physiology and pathophysiology of heart regulation by thyroid hormones. In this review, we summarize the present knowledge on thyroxine (T4) transport and metabolism and on the biochemical pathways leading to genomic and non-genomic effects produced by 3,5,3'-triiodothyronine (T3) and by its active metabolites, particularly 3,5-diiodothyronine (T2) and 3-iodothyronamine (T1AM). On this basis, specific issues of special interest for cardiology are discussed, namely (1) relevance of the regulation of proteins involved in the control of calcium homeostasis and in pacemaker cell activity, due to non-genomic as well as to classical genomic effects; (2) stimulation of fatty acid oxidation by T2 and T1AM, the latter also causing a negative inotropic and chronotropic action at micromolar concentrations; (3) induction of D3 deiodinase in heart failure, potentially causing selective cardiac hypothyroidism, whose clinical implications are still controversial; and (4) cardioprotective effect of T1AM, possibly occurring at physiological concentrations, and relevance of T3 and of thyroid hormone receptor α1 in post-infarction repair. PMID:27115768

  15. Global expression profiling reveals gain-of-function onco-genic activity of a mutated thyroid hormone receptor in thyroid carcinogenesis

    PubMed Central

    Lu, Changxue; Mishra, Alok; Zhu, Yuelin J; Meltzer, Paul; Cheng, Sheue-yann

    2011-01-01

    Thyroid hormone receptors (TRs) are critical in regulating gene expression in normal physiological processes. Decreased expression and/or somatic mutations of TRs have been shown to be associated several types of human cancers including liver, breast, lung, and thyroid. To understand the molecular mechanisms by which mutated TRs promote carcinogenesis, an animal model of follicular thyroid carcinoma (FTC) (Thrbpv/pv mice) was used in the present study. The Thrbpv/pv mouse harbors a knockin dominant negative PV mutation, identified in a patient with resistance to thyroid hormone. To understand whether oncogenic actions of PV involve not only the loss of normal TR functions but also gain-of-function activities, we compared the gene expression profiles of thyroid lesions in Thrbpv/pv mice and Thra1-/- Thrb-/- mice that also spontaneously develop FTC, but with less severe malignancy. Analysis of the cDNA microarray data derived from microdissected thyroid tumor cells of these two mice showed contrasting global gene expression profiles. With stringent selection using 2.5-fold change (p<0.01) in cDNA microarray analysis, 241 genes with altered gene expression were identified. Nearly half of the genes (n=103: 42.7% of total) with altered gene expression in thyroid tumor cells of Thrbpv/pv mice were associated with tumorigenesis and metastasis; some of these genes function as oncogenes in human thyroid cancers. The remaining genes were found to function in transcriptional regulation, RNA processing, cell proliferation, apoptosis, angiogenesis, and cytoskeleton modification. These results indicate that the more aggressive thyroid tumor progression in Thrbpv/pv mice was not due simply to the loss of tumor suppressor functions of TR via mutation but also, importantly, to gain-of-function in the oncogenic activities of PV to drive thyroid carcinogenesis. Thus, the present study identifies a novel mechanism by which a mutated TRβ evolves with an oncogenic advantage to promote

  16. In vitro assessment of thyroid hormone receptor activity of four organophosphate esters.

    PubMed

    Ren, Xiaomin; Cao, Linying; Yang, Yu; Wan, Bin; Wang, Sufang; Guo, Lianghong

    2016-07-01

    Previous animal experiments have implied that organophosphate esters (OPEs) have a disruption effect on the thyroid endocrine system. However, knowledge of the toxicological mechanism remains limited. In this study, the activities of four OPEs have been characterized against the thyroid hormone (TH) nuclear receptor (TR) using two in vitro models, with the aim of evaluating their toxicity mechanisms towards the TR. The results of a TH-dependent cell proliferation assay showed that tris(2-chloro-1-(chloromethyl)ethyl)phosphate (TDCPP) could induce cell growth, while the other three OPEs had no effect. The results of a luciferase reporter gene assay revealed that all four of the OPEs tested in the current study showed agonistic activity towards TRβ, with TDCPP being the most potent one. Moreover, molecular docking revealed that all the tested OPEs could fit into the ligand binding pocket of TRβ, with TDCPP binding more effectively than the other three OPEs. Taken together, these data suggest that OPEs might disrupt the thyroid endocrine system via a mechanism involving the activation of TR. PMID:27372132

  17. Thyroid hormone receptor inhibits hepatoma cell migration through transcriptional activation of Dickkopf 4

    SciTech Connect

    Chi, Hsiang-Cheng; Liao, Chen-Hsin; Huang, Ya-Hui; Wu, Sheng-Ming; Tsai, Chung-Ying; Liao, Chia-Jung; Tseng, Yi-Hsin; Lin, Yang-Hsiang; Chen, Cheng-Yi; Chung, I-Hsiao; Wu, Tzu-I; Chen, Wei-Jan; Lin, Kwang-Huei

    2013-09-13

    Highlights: •T{sub 3} affects DKK4 mRNA and protein expression in HepG2-TR cells. •Regulation of DKK4 by T{sub 3} is at transcriptional level. •DKK4 overexpression suppresses hepatoma cell metastasis. -- Abstract: Triiodothyronine (T{sub 3}) is a potent form of thyroid hormone mediates several physiological processes including cellular growth, development, and differentiation via binding to the nuclear thyroid hormone receptor (TR). Recent studies have demonstrated critical roles of T{sub 3}/TR in tumor progression. Moreover, long-term hypothyroidism appears to be associated with the incidence of human hepatocellular carcinoma (HCC), independent of other major HCC risk factors. Dickkopf (DKK) 4, a secreted protein that antagonizes the canonical Wnt signaling pathway, is induced by T{sub 3} at both mRNA and protein levels in HCC cell lines. However, the mechanism underlying T{sub 3}-mediated regulation of DKK4 remains unknown. In the present study, the 5′ promoter region of DKK4 was serially deleted, and the reporter assay performed to localize the T{sub 3} response element (TRE). Consequently, we identified an atypical direct repeat TRE between nucleotides −1645 and −1629 conferring T{sub 3} responsiveness to the DKK4 gene. This region was further validated using chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assay (EMSA). Stable DKK4 overexpression in SK-Hep-1 cells suppressed cell invasion and metastatic potential, both in vivo andin vitro, via reduction of matrix metalloproteinase-2 (MMP-2) expression. Our findings collectively suggest that DKK4 upregulated by T{sub 3}/TR antagonizes the Wnt signal pathway to suppress tumor cell progression, thus providing new insights into the molecular mechanism underlying thyroid hormone activity in HCC.

  18. Thyroid hormones and heart failure.

    PubMed

    Martinez, Felipe

    2016-07-01

    Heart failure is a major health problem and its relationship to thyroid dysfunction has been increasingly investigated in recent years. Since it has been demonstrated that thyroid hormones (TH) and mainly T3 have cardioprotective effects, it is easy to understand that in the scenario of thyroid disorder, cardiac function may be damaged, and inversely in cardiac dysfunction thyroid dysregulation may be seen. The increase in plasma TH produces a clear neurohormonal activation which impacts negatively on cardiac function. In hypothyroidism, and in addition to extracardiac dysfunction, myocardial and vascular remodelling is altered and they contribute to cardiac failure. Abnormal low plasma TSH has also been shown to be a risk factor for developing HF in several recent studies, and they suggest that TSH is an independent predictor of clinical outcome including death and cardiac hospitalizations. Therefore, physicians should consider all these concepts when managing a patient with heart failure, not only for a clear diagnosis, but also for better and accurate treatment. PMID:27098905

  19. Thyroid Hormone and Vascular Remodeling.

    PubMed

    Ichiki, Toshihiro

    2016-01-01

    Both hyperthyroidism and hypothyroidism affect the cardiovascular system. Hypothyroidism is known to be associated with enhanced atherosclerosis and ischemic heart diseases. The accelerated atherosclerosis in the hypothyroid state has been traditionally ascribed to atherogenic lipid profile, diastolic hypertension, and impaired endothelial function. However, recent studies indicate that thyroid hormone has direct anti-atherosclerotic effects, such as production of nitric oxide and suppression of smooth muscle cell proliferation. These data suggest that thyroid hormone inhibits atherogenesis through direct effects on the vasculature as well as modification of risk factors for atherosclerosis. This review summarizes the basic and clinical studies on the role of thyroid hormone in vascular remodeling. The possible application of thyroid hormone mimetics to the therapy of hypercholesterolemia and atherosclerosis is also discussed. PMID:26558400

  20. Thyroid hormone and vitamin D regulate VGF expression and promoter activity

    PubMed Central

    Lewis, Jo E; Brameld, John M; Hill, Phil; Wilson, Dana; Barrett, Perry; Ebling, Francis J P; Jethwa, Preeti H

    2016-01-01

    The Siberian hamster (Phodopus sungorus) survives winter by decreasing food intake and catabolizing abdominal fat reserves, resulting in a sustained, profound loss of body weight. Hypothalamic tanycytes are pivotal for this process. In these cells, short-winter photoperiods upregulate deiodinase 3, an enzyme that regulates thyroid hormone availability, and downregulate genes encoding components of retinoic acid (RA) uptake and signaling. The aim of the current studies was to identify mechanisms by which seasonal changes in thyroid hormone and RA signaling from tanycytes might ultimately regulate appetite and energy expenditure. proVGF is one of the most abundant peptides in the mammalian brain, and studies have suggested a role for VGF-derived peptides in the photoperiodic regulation of body weight in the Siberian hamster. In silico studies identified possible thyroid and vitamin D response elements in the VGF promoter. Using the human neuroblastoma SH-SY5Y cell line, we demonstrate that RA increases endogenous VGF expression (P<0.05) and VGF promoter activity (P<0.0001). Similarly, treatment with 1,25-dihydroxyvitamin D3 increased endogenous VGF mRNA expression (P<0.05) and VGF promoter activity (P<0.0001), whereas triiodothyronine (T3) decreased both (P<0.01 and P<0.0001). Finally, intra-hypothalamic administration of T3 blocked the short day-induced increase in VGF expression in the dorsomedial posterior arcuate nucleus of Siberian hamsters. Thus, we conclude that VGF expression is a likely target of photoperiod-induced changes in tanycyte-derived signals and is potentially a regulator of seasonal changes in appetite and energy expenditure. PMID:26643910

  1. Thyroid hormone regulates adhesion, migration and matrix metalloproteinase 9 activity via αvβ3 integrin in myeloma cells.

    PubMed

    Cohen, Keren; Flint, Nir; Shalev, Shachar; Erez, Daniel; Baharal, Tal; Davis, Paul J; Hercbergs, Aleck; Ellis, Martin; Ashur-Fabian, Osnat

    2014-08-15

    Thyroid hormone (3,5,3'-triiodothyronine, T3; L-thyroxine, T4) enhances cancer cell proliferation, invasion and angiogenesis via a discrete receptor located near the RGD recognition site on αvβ3 integrin. Tetraiodothyroacetic acid (tetrac) and its nanoparticulate formulation interfere with binding of T3/T4 to the integrin. This integrin is overexpressed in multiple myeloma (MM) and other cancers. MM cells interact with αvβ3 integrin to support growth and invasion. Matrix metalloproteinases (MMPs) are a family of enzymes active in tissue remodeling and cancer. The association between integrins and MMPs secretion and action is well established. In the current study, we examined the effects of thyroid hormone on myeloma cell adhesion, migration and MMP activity. We show that T3 and T4 increased myeloma adhesion to fibronectin and induced αvβ3 clustering. In addition, the hormones induced MMP-9 expression and activation via αvβ3 and MAPK induction. Bortezomib, a standard myeloma treatment, caused a decrease in activity/quantity of MMPs and thyroid hormone opposed this effect. RGD peptide and tetrac impaired the production of MMP-9 in cell lines and in primary BM cells from myeloma patients. In conclusion, thyroid hormone-dependent regulation via αvβ3 of myeloma cell adhesion and MMP-9 production may play a role in myeloma migration and progression. PMID:25071016

  2. Thyroid hormone regulates adhesion, migration and matrix metalloproteinase 9 activity via αvβ3 integrin in myeloma cells

    PubMed Central

    Cohen, Keren; Flint, Nir; Shalev, Shachar; Erez, Daniel; Baharal, Tal; Davis, Paul J.; Hercbergs, Aleck; Ellis, Martin; Ashur-Fabian, Osnat

    2014-01-01

    Thyroid hormone (3,5,3′-triiodothyronine, T3; L-thyroxine, T4) enhances cancer cell proliferation, invasion and angiogenesis via a discrete receptor located near the RGD recognition site on αvβ3 integrin. Tetraiodothyroacetic acid (tetrac) and its nanoparticulate formulation interfere with binding of T3/T4 to the integrin. This integrin is overexpressed in multiple myeloma (MM) and other cancers. MM cells interact with αvβ3 integrin to support growth and invasion. Matrix metalloproteinases (MMPs) are a family of enzymes active in tissue remodeling and cancer. The association between integrins and MMPs secretion and action is well established. In the current study, we examined the effects of thyroid hormone on myeloma cell adhesion, migration and MMP activity. We show that T3 and T4 increased myeloma adhesion to fibronectin and induced αvβ3 clustering. In addition, the hormones induced MMP-9 expression and activation via αvβ3 and MAPK induction. Bortezomib, a standard myeloma treatment, caused a decrease in activity/quantity of MMPs and thyroid hormone opposed this effect. RGD peptide and tetrac impaired the production of MMP-9 in cell lines and in primary BM cells from myeloma patients. In conclusion, thyroid hormone-dependent regulation via αvβ3 of myeloma cell adhesion and MMP-9 production may play a role in myeloma migration and progression. PMID:25071016

  3. Metabolism of thyroid hormones by rat thyroid tissue in vitro.

    PubMed

    Green, W L

    1978-09-01

    Rat thyroid lobes or hemilobes have been incubated in Krebs-Ringer phosphate buffer containing labeled T4 and/or T3, and the products were separated by paper chromatography. Labeled T4 was actively degraded; about half of the T4 metabolized was recovered as T3. Labeled T3 was also metabolized, but less rapidly than T4. Other than T3 produced from T4, the major products from both hormones were inorganic iodide and iodoprotein; the latter was presumably a secondary product of iodide organification because its formation was inhibited by hypoxia and methimazole. Feeding the animals a low iodine diet increased their hormone-metabolizing activity. Incubation under nitrogen did not affect the rate of T4 degradation, but partially inhibited T3 degradation. Degradation of both hormones was unchanged in the presence of methimazole and ascorbate, was markedly inhibited by 1 mM propylthiouracil (PTU), and was partially inhibited by azide and cyanide. Thyroid tissues concentrated both hormones, tissue to medium gradients averaging 5.4 for T4 and 20.7 for T3; none of the conditions affecting hormone degradation (incubation under nitrogen or with azide, cyanide, or PTU) significantly altered these gradients. It is concluded that the thyroid can metabolize both of its major hormones by a system distinct from thyroidal peroxidase. Hormone metabolism, therefore, is a potentially important factor in net hormone secretion. In its resistance to hypoxia, methimazole, and ascorbate and its sensitivity to PTU, the thyroid's system for generating T3 from T4 resembles T3-forming systems of liver and kidney. The thyroid, because T3 formation is its dominant pathway for T4 metabolism, may provide a useful model for study of this reaction. PMID:744119

  4. Combined 3D-QSAR, molecular docking and molecular dynamics study on thyroid hormone activity of hydroxylated polybrominated diphenyl ethers to thyroid receptors β

    SciTech Connect

    Li, Xiaolin; Ye, Li; Wang, Xiaoxiang; Wang, Xinzhou; Liu, Hongling; Zhu, Yongliang; Yu, Hongxia

    2012-12-15

    Several recent reports suggested that hydroxylated polybrominated diphenyl ethers (HO-PBDEs) may disturb thyroid hormone homeostasis. To illuminate the structural features for thyroid hormone activity of HO-PBDEs and the binding mode between HO-PBDEs and thyroid hormone receptor (TR), the hormone activity of a series of HO-PBDEs to thyroid receptors β was studied based on the combination of 3D-QSAR, molecular docking, and molecular dynamics (MD) methods. The ligand- and receptor-based 3D-QSAR models were obtained using Comparative Molecular Similarity Index Analysis (CoMSIA) method. The optimum CoMSIA model with region focusing yielded satisfactory statistical results: leave-one-out cross-validation correlation coefficient (q{sup 2}) was 0.571 and non-cross-validation correlation coefficient (r{sup 2}) was 0.951. Furthermore, the results of internal validation such as bootstrapping, leave-many-out cross-validation, and progressive scrambling as well as external validation indicated the rationality and good predictive ability of the best model. In addition, molecular docking elucidated the conformations of compounds and key amino acid residues at the docking pocket, MD simulation further determined the binding process and validated the rationality of docking results. -- Highlights: ► The thyroid hormone activities of HO-PBDEs were studied by 3D-QSAR. ► The binding modes between HO-PBDEs and TRβ were explored. ► 3D-QSAR, molecular docking, and molecular dynamics (MD) methods were performed.

  5. In vitro, ex vivo, and in vivo determination of thyroid hormone modulating activity of benzothiazoles

    EPA Science Inventory

    As in vitro assays are increasingly used to screen chemicals for their potential to produce endocrine disrupting adverse effects, it is important to understand their predictive capacity. The potential for a set of six benzothiazoles to affect endpoints related to thyroid hormone ...

  6. Identification of Thyroid Hormone Receptor Active Compounds Using a Quantitative High-Throughput Screening Platform

    PubMed Central

    Freitas, Jaime; Miller, Nicole; Mengeling, Brenda J.; Xia, Menghang; Huang, Ruili; Houck, Keith; Rietjens, Ivonne M.C.M.; Furlow, J. David; Murk, Albertinka J.

    2014-01-01

    To adapt the use of GH3.TRE-Luc reporter gene cell line for a quantitative high-throughput screening (qHTS) platform, we miniaturized the reporter gene assay to a 1536-well plate format. 1280 chemicals from the Library of Pharmacologically Active Compounds (LOPAC) and the National Toxicology Program (NTP) 1408 compound collection were analyzed to identify potential thyroid hormone receptor (TR) agonists and antagonists. Of the 2688 compounds tested, eight scored as potential TR agonists when the positive hit cut-off was defined at ≥10% efficacy, relative to maximal triiodothyronine (T3) induction, and with only one of those compounds reaching ≥20% efficacy. One common class of compounds positive in the agonist assays were retinoids such as all-trans retinoic acid, which are likely acting via the retinoid-X receptor, the heterodimer partner with the TR. Five potential TR antagonists were identified, including the antiallergy drug tranilast and the anxiolytic drug SB 205384 but also some cytotoxic compounds like 5-fluorouracil. None of the inactive compounds were structurally related to T3, nor had been reported elsewhere to be thyroid hormone disruptors, so false negatives were not detected. None of the low potency (>100µM) TR agonists resembled T3 or T4, thus these may not bind directly in the ligand-binding pocket of the receptor. For TR agonists, in the qHTS, a hit cut-off of ≥20% efficacy at 100 µM may avoid identification of positives with low or no physiological relevance. The miniaturized GH3.TRE-Luc assay offers a promising addition to the in vitro test battery for endocrine disruption, and given the low percentage of compounds testing positive, its high-throughput nature is an important advantage for future toxicological screening. PMID:24772387

  7. Transport of thyroid hormones via the choroid plexus into the brain: the roles of transthyretin and thyroid hormone transmembrane transporters

    PubMed Central

    Richardson, Samantha J.; Wijayagunaratne, Roshen C.; D'Souza, Damian G.; Darras, Veerle M.; Van Herck, Stijn L. J.

    2015-01-01

    Thyroid hormones are key players in regulating brain development. Thus, transfer of appropriate quantities of thyroid hormones from the blood into the brain at specific stages of development is critical. The choroid plexus forms the blood-cerebrospinal fluid barrier. In reptiles, birds and mammals, the main protein synthesized and secreted by the choroid plexus is a thyroid hormone distributor protein: transthyretin. This transthyretin is secreted into the cerebrospinal fluid and moves thyroid hormones from the blood into the cerebrospinal fluid. Maximal transthyretin synthesis in the choroid plexus occurs just prior to the period of rapid brain growth, suggesting that choroid plexus-derived transthyretin moves thyroid hormones from blood into cerebrospinal fluid just prior to when thyroid hormones are required for rapid brain growth. The structure of transthyretin has been highly conserved, implying strong selection pressure and an important function. In mammals, transthyretin binds T4 (precursor form of thyroid hormone) with higher affinity than T3 (active form of thyroid hormone). In all other vertebrates, transthyretin binds T3 with higher affinity than T4. As mammals are the exception, we should not base our thinking about the role of transthyretin in the choroid plexus solely on mammalian data. Thyroid hormone transmembrane transporters are involved in moving thyroid hormones into and out of cells and have been identified in many tissues, including the choroid plexus. Thyroid hormones enter the choroid plexus via thyroid hormone transmembrane transporters and leave the choroid plexus to enter the cerebrospinal fluid via either thyroid hormone transmembrane transporters or via choroid plexus-derived transthyretin secreted into the cerebrospinal fluid. The quantitative contribution of each route during development remains to be elucidated. This is part of a review series on ontogeny and phylogeny of brain barrier mechanisms. PMID:25784853

  8. Inhibition of thyroid hormone sulfotransferase activity by brominated flame retardants and halogenated phenolics.

    PubMed

    Butt, Craig M; Stapleton, Heather M

    2013-11-18

    Many halogenated organic contaminants (HOCs) are considered endocrine disruptors and affect the hypothalamic-pituitary-thyroid axis, often by interfering with circulating levels of thyroid hormones (THs). We investigated one potential mechanism for TH disruption, inhibition of sulfotransferase activity. One of the primary roles of TH sulfation is to support the regulation of biologically active T3 through the formation of inactive THs. We investigated TH sulfotransferase inhibition by 14 hydroxylated polybrominated diphenyl ethers (OH BDEs), BDE 47, triclosan, and fluorinated, chlorinated, brominated, and iodinated analogues of 2,4,6-trihalogenated phenol and bisphenol A (BPA). A new mass spectrometry-based method was also developed to measure the formation rates of 3,3'-T2 sulfate (3,3'-T2S). Using pooled human liver cytosol, we investigated the influence of these HOCs on the sulfation of 3,3'-T2, a major substrate for TH sulfation. For the formation of 3,3'-T2S, the Michaelis constant (Km) was 1070 ± 120 nM and the Vmax was 153 ± 6.6 pmol min(-1) (mg of protein)(-1). All chemicals investigated inhibited sulfotransferase activity with the exception of BDE 47. The 2,4,6-trihalogenated phenols were the most potent inhibitors followed by the OH BDEs and then halogenated BPAs. The IC50 values for the OH BDEs were primarily in the low nanomolar range, which may be environmentally relevant. In silico molecular modeling techniques were also used to simulate the binding of OH BDE to SULT1A1. This study suggests that some HOCs, including antimicrobial chemicals and metabolites of flame retardants, may interfere with TH regulation through inhibition of sulfotransferase activity. PMID:24089703

  9. Adipose tissues and thyroid hormones

    PubMed Central

    Obregon, Maria-Jesus

    2014-01-01

    The maintenance of energy balance is regulated by complex homeostatic mechanisms, including those emanating from adipose tissue. The main function of the adipose tissue is to store the excess of metabolic energy in the form of fat. The energy stored as fat can be mobilized during periods of energy deprivation (hunger, fasting, diseases). The adipose tissue has also a homeostatic role regulating energy balance and functioning as endocrine organ that secretes substances that control body homeostasis. Two adipose tissues have been identified: white and brown adipose tissues (WAT and BAT) with different phenotype, function and regulation. WAT stores energy, while BAT dissipates energy as heat. Brown and white adipocytes have different ontogenetic origin and lineage and specific markers of WAT and BAT have been identified. “Brite” or beige adipose tissue has been identified in WAT with some properties of BAT. Thyroid hormones exert pleiotropic actions, regulating the differentiation process in many tissues including the adipose tissue. Adipogenesis gives raise to mature adipocytes and is regulated by several transcription factors (c/EBPs, PPARs) that coordinately activate specific genes, resulting in the adipocyte phenotype. T3 regulates several genes involved in lipid mobilization and storage and in thermogenesis. Both WAT and BAT are targets of thyroid hormones, which regulate genes crucial for their proper function: lipogenesis, lipolysis, thermogenesis, mitochondrial function, transcription factors, the availability of nutrients. T3 acts directly through specific TREs in the gene promoters, regulating transcription factors. The deiodinases D3, D2, and D1 regulate the availability of T3. D3 is activated during proliferation, while D2 is linked to the adipocyte differentiation program, providing T3 needed for lipogenesis and thermogenesis. We examine the differences between BAT, WAT and brite/beige adipocytes and the process that lead to activation of UCP1 in WAT

  10. Thyroid Hormone Stimulation of Autophagy Is Essential for Mitochondrial Biogenesis and Activity in Skeletal Muscle.

    PubMed

    Lesmana, Ronny; Sinha, Rohit A; Singh, Brijesh K; Zhou, Jin; Ohba, Kenji; Wu, Yajun; Yau, Winifred W Y; Bay, Boon-Huat; Yen, Paul M

    2016-01-01

    Thyroid hormone (TH) and autophagy share similar functions in regulating skeletal muscle growth, regeneration, and differentiation. Although TH recently has been shown to increase autophagy in liver, the regulation and role of autophagy by this hormone in skeletal muscle is not known. Here, using both in vitro and in vivo models, we demonstrated that TH induces autophagy in a dose- and time-dependent manner in skeletal muscle. TH induction of autophagy involved reactive oxygen species (ROS) stimulation of 5'adenosine monophosphate-activated protein kinase (AMPK)-Mammalian target of rapamycin (mTOR)-Unc-51-like kinase 1 (Ulk1) signaling. TH also increased mRNA and protein expression of key autophagy genes, microtubule-associated protein light chain 3 (LC3), Sequestosome 1 (p62), and Ulk1, as well as genes that modulated autophagy and Forkhead box O (FOXO) 1/3a. TH increased mitochondrial protein synthesis and number as well as basal mitochondrial O2 consumption, ATP turnover, and maximal respiratory capacity. Surprisingly, mitochondrial activity and biogenesis were blunted when autophagy was blocked in muscle cells by Autophagy-related gene (Atg)5 short hairpin RNA (shRNA). Induction of ROS and 5'adenosine monophosphate-activated protein kinase (AMPK) by TH played a significant role in the up-regulation of Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A), the key regulator of mitochondrial synthesis. In summary, our findings showed that TH-mediated autophagy was essential for stimulation of mitochondrial biogenesis and activity in skeletal muscle. Moreover, autophagy and mitochondrial biogenesis were coupled in skeletal muscle via TH induction of mitochondrial activity and ROS generation. PMID:26562261

  11. Effects of thyroid hormones on the heart.

    PubMed

    Vargas-Uricoechea, Hernando; Bonelo-Perdomo, Anilsa; Sierra-Torres, Carlos Hernán

    2014-01-01

    Thyroid hormones have a significant impact on heart function, mediated by genomic and non-genomic effects. Consequently, thyroid hormone deficiencies, as well as excesses, are expected to result in profound changes in cardiac function regulation and cardiovascular hemodynamics. Thyroid hormones upregulate the expression of the sarcoplasmic reticulum calcium-activated ATPase and downregulate the expression of phospholamban. Overall, hyperthyroidism is characterized by an increase in resting heart rate, blood volume, stroke volume, myocardial contractility, and ejection fraction. The development of "high-output heart failure" in hyperthyroidism may be due to "tachycardia-mediated cardiomyopathy". On the other hand, in a hypothyroid state, thyroid hormone deficiency results in lower heart rate and weakening of myocardial contraction and relaxation, with prolonged systolic and early diastolic times. Cardiac preload is decreased due to impaired diastolic function. Cardiac afterload is increased, and chronotropic and inotropic functions are reduced. Subclinical thyroid dysfunction is relatively common in patients over 65 years of age. In general, subclinical hypothyroidism increases the risk of coronary heart disease (CHD) mortality and CHD events, but not of total mortality. The risk of CHD mortality and atrial fibrillation (but not other outcomes) in subclinical hyperthyroidism is higher among patients with very low levels of thyrotropin. Finally, medications such as amiodarone may induce hypothyroidism (mediated by the Wolff-Chaikoff), as well as hyperthyroidism (mediated by the Jod-Basedow effect). In both instances, the underlying cause is the high concentration of iodine in this medication. PMID:25438971

  12. Overlapping nongenomic and genomic actions of thyroid hormone and steroids

    PubMed Central

    Hammes, Stephen R.; Davis, Paul J.

    2016-01-01

    The genomic actions of thyroid hormone and steroids depend upon primary interactions of the hormones with their specific nuclear receptor proteins. Formation of nuclear co-activator or co-repressor complexes involving the liganded receptors subsequently result in transcriptional events—either activation or suppression—at genes that are specific targets of thyroid hormone or steroids. Nongenomic actions of thyroid hormone and steroids are in contrast initiated at binding sites on the plasma membrane or in cytoplasm or organelles and do not primarily require formation of intranuclear receptor protein-hormone complexes. Importantly, hormonal actions that begin nongenomically outside the nucleus often culminate in changes in nuclear transcriptional events that are regulated by both traditional intranuclear receptors as well as other nuclear transcription factors. In the case of thyroid hormone, the extranuclear receptor can be the classical “nuclear” thyroid receptor (TR), a TR isoform, or integrin αvβ3. In the case of steroid hormones, the membrane receptor is usually, but not always, the classical “nuclear” steroid receptor. This concept defines the paradigm of overlapping nongenomic and genomic hormone mechanisms of action. Here we review some examples of how extranuclear signaling by thyroid hormone and by estrogens and androgens modulates intranuclear hormone signaling to regulate a number of vital biological processes both in normal physiology and in cancer progression. We also point out that nongenomic actions of thyroid hormone may mimic effects of estrogen in certain tumors. PMID:26303085

  13. E-NTPDase 3 (ATP diphosphohydrolase) from cardiomyocytes, activity and expression are modulated by thyroid hormone.

    PubMed

    Barreto-Chaves, Maria Luiza M; Carneiro-Ramos, Marcela Sorelli; Cotomacci, Guilherme; Júnior, Marconi Barbosa Coutinho; Sarkis, João José Freitas

    2006-06-01

    Degradation of adenine nucleotides by myocardial cells occurs, in part, by a cascade of surface-located enzymes converting ATP into adenosine that has important implications for the regulation of the nucleotide/nucleoside ratio modulating the cardiac functions. Thyroid hormones have profound effects on cardiovascular system, as observed in hypo- and hyperthyroidism. Combined biochemical parameters and gene expression analysis approaches were used to investigate the influence of tri-iodothyronine (T3) on ATP and ADP hydrolysis by isolated myocytes. Cultures of cardiomyocytes were submitted to increasing doses of T3 for 24h. Enzymatic activity and expression were evaluated. T3 (0.1 nM) caused an increase in ATP and ADP hydrolysis. Experiments with specific inhibitors suggest the involvement of an NTPDase, which was confirmed by an increase in NTPDase 3 messenger RNA (mRNA) levels. Since T3 promotes an increase in the contractile protein, leading to cardiac hypertrophy, it is tempting to postulate that the increase in ATP hydrolysis and the decrease in the extracellular levels signify an important factor for prevention of excessive contractility. PMID:16584835

  14. Thyroid hormones, learning and memory.

    PubMed

    Rivas, M; Naranjo, J R

    2007-06-01

    Thyroid hormones (THs), T3 and T4, have many physiological actions and are essential for normal behavioral, intellectual and neurological development. THs have a broad spectrum of effects on the developing brain and mediate important effects within the CNS throughout life. Insufficient maternal iodine intake during gestation and TH deficiency during human development are associated to pathological alterations such as cretinism and mental retardation. In adulthood, thyroid dysfunction is related to neurological and behavioral abnormalities, including memory impairment. Analysis of different experimental models suggests that most of the effects on cognition as a result of thyroid dysfunction rely on hippocampal modifications. Insufficiency of THs during development thus alters hippocampal synaptic function and impairs behavioral performance of hippocampal-dependent learning and memory tasks that persist in euthyroid adult animals. In the present review, we summarize the current knowledge obtained by clinical observations and experimental models that shows the importance of THs in learning and mnemonic processes. PMID:17543038

  15. IODIDE DEFICIENCY, THYROID HORMONES, AND NEURODEVELOPMENT

    EPA Science Inventory

    ABSTRACT BODY: Iodide is an essential nutrient for thyroid hormone synthesis. Severe iodide insufficiency during early development is associated with cognitive deficits. Environmental contaminants can perturb the thyroid axis and this perturbation may be more acute under conditio...

  16. Thyroid hormone resistance and its management

    PubMed Central

    Lado-Abeal, Joaquin

    2016-01-01

    The syndrome of impaired sensitivity to thyroid hormone, also known as syndrome of thyroid hormone resistance, is an inherited condition that occurs in 1 of 40,000 live births characterized by a reduced responsiveness of target tissues to thyroid hormone due to mutations on the thyroid hormone receptor. Patients can present with symptoms of hyperthyroidism or hypothyroidism. They usually have elevated thyroid hormones and a normal or elevated thyroid-stimulating hormone level. Due to their nonspecific symptomatic presentation, these patients can be misdiagnosed if the primary care physician is not familiar with the condition. This can result in frustration for the patient and sometimes unnecessary invasive treatment such as radioactive iodine ablation, as in the case presented herein. PMID:27034574

  17. Assessing Waste Water Treatment Plant Effluents For Thyroid Hormone Disrupting Activity

    EPA Science Inventory

    Much information has been coming to light on the estrogenic and androgenic activity of chemicals present in the waste water stream and in surface waters, but much less is known about the presence of chemicals with thyroid activity. To address this issue, we have utilized two ass...

  18. Cardioprotection and thyroid hormones.

    PubMed

    Pingitore, Alessandro; Nicolini, Giuseppina; Kusmic, Claudia; Iervasi, Giorgio; Grigolini, Paolo; Forini, Francesca

    2016-07-01

    The evolution of cardiac disease after an acute ischemic event depends on a complex and dynamic network of mechanisms alternating from ischemic damage due to acute coronary occlusion to reperfusion injury due to the adverse effects of coronary revascularization till post-ischemic remodeling. Cardioprotection is a new purpose of the therapeutic interventions in cardiology with the goal to reduce infarct size and thus prevent the progression toward heart failure after an acute ischemic event. In a complex biological system such as the human one, an effective cardioprotective strategy should diachronically target the network of cross-talking pathways underlying the disease progression. Thyroid system is strictly interconnected with heart homeostasis, and recent studies highlighted its role in cardioprotection, in particular through the preservation of mitochondrial function and morphology, the antifibrotic and proangiogenetic effect and also to the potential induction of cell regeneration and growth. The objective of this review was to highlight the cardioprotective role of triiodothyronine in the complexity of post-ischemic disease evolution. PMID:27011011

  19. [Transthyretin-binding activity of hexabromocyclododecanes (HBCDs) and its thyroid hormone disrupting effects after developmental exposure].

    PubMed

    Ji, Xiu-Ling; Liu, Yang; Liu, Fang; Lu, Yue; Zhong, Gao-Ren

    2010-09-01

    In vivo and in vitro research approaches were carried out to survey the potential health risk of environmental exposure by hexabromocyclododecanes (HBCDs). Transthyretin-binding assay was designed to test for the potency of HBCDs to compete with thyroxine (T4) for binding to the transport protein. The results showed that the binding of 25I-T4 and T4 was only slightly inhabited even at the highest competitive concentration of HBCDs (75.08%, 80 micromol x L(-1)), indicating the marginally interfere potency of HBCDs in the transportation of T4. Sprague-Dawley rats of 3-days old were exposed to 0.2 mg/kg and 1 mg/kg HBCDs for 21 d to examine the thyroid hormones (THs) disrupting effects of HBCDs after developmental exposure. Compared with the controls, levels of total 3,3',5-triiodothyronine (TT3), free 3,3',5-triiodothyronine (FT3), increased significantly (p < 0.05, p < 0.05) in low- and high-dose exposures, thyroid stimulating hormone (TSH) also increased slightly while the total thyroxine (TT4), free thyroxine (FT4) had a decline about two-fold inversely. Combined both the in vivo and in vitro results, the possible mode of action of HBCDs on THs disruption may through the synergy or substitution effect of T3. The findings support further investigation of the potential THs disrupting effects of HBCDs on public health, especially on children during brain development. PMID:21072945

  20. THYROID HORMONE DISRUPTION: FROM KINETICS TO DYNAMICS.

    EPA Science Inventory

    A wide range of chemicals with diverse structures act as thyroid disrupting chemicals (TDCs). Broadly defined, TDCs are chemicals that alter the structure or function of the thyroid gland, alter regulatory enzymes associated with thyroid hormones (THs), or change circulating or t...

  1. In vivo activity of the thyroid hormone receptor beta- and α-selective agonists GC-24 and CO23 on rat liver, heart, and brain.

    PubMed

    Grijota-Martínez, Carmen; Samarut, Eric; Scanlan, Thomas S; Morte, Beatriz; Bernal, Juan

    2011-03-01

    Thyroid hormone analogs with selective actions through specific thyroid hormone receptor (TR) subtypes are of great interest. They might offer the possibility of mimicking physiological actions of thyroid hormone with receptor subtype or tissue specificity with therapeutic aims. They are also pharmacological tools to dissect biochemical pathways mediated by specific receptor subtypes, in a complementary way to mouse genetic modifications. In this work, we studied the in vivo activity in developing rats of two thyroid hormone agonists, the TRβ-selective GC-24 and the TRα-selective CO23. Our principal goal was to check whether these compounds were active in the rat brain. Analog activity was assessed by measuring the expression of thyroid hormone target genes in liver, heart, and brain, after administration to hypothyroid rats. GC-24 was very selective for TRβ and lacked activity on the brain. On the other hand, CO23 was active in liver, heart, and brain on genes regulated by either TRα or TRβ. This compound, previously shown to be TRα-selective in tadpoles, displayed no selectivity in the rat in vivo. PMID:21239431

  2. Thyroid hormone resistance: a novel mutation in thyroid hormone receptor beta (THRB) gene - case report.

    PubMed

    Işık, Emregül; Beck Peccoz, Paolo; Campi, Irene; Özön, Alev; Alikaşifoğlu, Ayfer; Gönç, Nazlı; Kandemir, Nurgün

    2013-01-01

    Thyroid hormone resistance (THR) is a dominantly inherited syndrome characterized by reduced sensitivity to thyroid hormones. It is usually caused by mutations in the thyroid hormone receptor beta (THRB) gene. In the present report, we describe the clinical and laboratory characteristics and genetic analysis of patients with a novel THRB gene mutation. The index patient had been misdiagnosed as hyperthyroidism and treated with antithyroid drugs since eight days of age. Thyroid hormone results showed that thyrotropin (thyroid-stimulating hormone, TSH) was never suppressed despite elevated thyroid hormone levels, and there was no symptom suggesting hyperthyroidism. A heterozygous mutation at codon 350 located in exon 9 of the THRB gene was detected in all the affected members of the family. It is important to consider thyroid hormone levels in association with TSH levels to prevent inappropriate treatment and the potential complications, such as clinical hypothyroidism or an increase in goiter size. PMID:24217081

  3. Mild Thyroid Hormone Insufficiency During Development Compromises Activity-Dependent Neuroplasticity in the Hippocampus of Adult Make Rats

    EPA Science Inventory

    Severe thyroid hormone (TH) deficiency during critical phases of brain development results in irreversible neurological and cognitive impairments. The mechanisms accounting for this are likely multifactorial, and are not fully understood. Here we pursue the possibility that one i...

  4. Regulation of Mammary Gland Sensitivity to Thyroid Hormones during the Transition from Pregnancy to Lactation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thyroid hormones are galactopoietic and appear to assist in establishing the mammary gland’s metabolic priority during lactation. Expression patterns for genes that can alter tissue sensitivity to thyroid hormones and thyroid hormone activity were evaluated in the mammary gland and liver of Holstei...

  5. Thyroid hormone effect in human hepatocytes.

    PubMed

    Miler, Eliana A; Ríos de Molina, María Del Carmen; Domínguez, Gabriela; Guerra, Liliana N

    2008-01-01

    We have already demonstrated that a combined treatment of methimazole and an antioxidant mixture improved the condition of hyperthyroid patients both biochemically and clinically. Elevated thyroid hormone levels might trigger signs and symptoms of hyperthyroidism through the increase of free radicals. To study the direct effect of thyroid hormone on cellular markers of oxidative stress, we carried out in vitro assays in which 0.1-20.0 nM T3 (6.5-1300.0 ng/dl) doses were added to culture media of the human hepatocyte cell line Hep G2 for 1-24 h. T3 increased malondialdehyde (MDA) and intracellular oxidized glutathione (GSSG) levels; SOD activity was also higher with hormone treatment, whereas catalase and glutathione peroxidase activities showed no variation at different T3 doses and during all experimental times. When ascorbic acid was added to the culture, the MDA level decreased and SOD activity was increased. With higher doses of T3 (e.g. 200 nM), cell death occurred (69% of apoptotic cells). The increase in SOD activity was not enough to overcome the effect of T3 since MDA and GSSG remained high during a 24-h experiment. We showed a beneficial effect of ascorbic acid when cells were exposed to a T3 dose of 20 nM, a higher level of hormone than that achieved in hyperthyroidism. PMID:18647489

  6. Effect of thyroid hormone-nitric oxide interaction on tumor growth, angiogenesis, and aminopeptidase activity in mice.

    PubMed

    Carmona-Cortés, Javier; Rodríguez-Gómez, Isabel; Wangensteen, Rosemary; Banegas, Inmaculada; García-Lora, Ángel M; Quesada, Andrés; Osuna, Antonio; Vargas, Félix

    2014-06-01

    This study evaluated the effects of thyroid hormone-NO interaction on tumor development, vascularization, vascular endothelial growth factor (VEGF), and aminopeptidase (AP) activity in a murine model of implanted Lewis's carcinoma. Experiments were performed in male CBA-C57 mice. Animals were untreated (controls) or treated with: T4, the antithyroid drug methimazole, the NO inhibitor L-NAME, T4+L-NAME, methimazole+NAME, the αvß3 integrin antagonist tetrac, T4+tetrac, the iNOS inhibitor aminoguanidine (AG), and T4 + AG; all treatments were for 6 weeks except for tetrac, administered for the last 11 days. Mice were subcutaneously inoculated with 1 × 10(6) exponentially growing Lewis carcinoma 3LL cells into the dorsum. Study variables 9 days later were tumor weight (TW), Hb content, an index of tumor vascularization, VEGF, and AP activity. T4 produced parallel increases in TW and angiogenesis. L-NAME reduced TW and angiogenesis in control, hyperthyroid, and hypothyroid mice, whereas AG had no effect on these variables. Tetrac arrested TW in normal and T4-treated mice but did not decrease angiogenesis in T4-treated animals. Negative correlations were found between TW and AP activity in tumors from control hyper- and hypothyroid groups and an inverse relationship was observed between TW and AP activities in tetrac-treated mice. T4 enhances TW and angiogenesis, in which NO participates, but requires activation of integrin αvß3 to promote carcinogenesis. NO blockade reduces TW, regardless of the thyroid status. Thyroid hormone negatively modulates AP activity in the tumor. Accordingly, blockade of the membrane TH receptor αvß3 integrin reduces TW associated with an increase in AP activity. PMID:24549786

  7. Epiphyseal chondrocyte secondary ossification centers require thyroid hormone activation of Indian hedgehog and osterix signaling.

    PubMed

    Xing, Weirong; Cheng, Shaohong; Wergedal, Jon; Mohan, Subburaman

    2014-10-01

    Thyroid hormones (THs) are known to regulate endochondral ossification during skeletal development via acting directly in chondrocytes and osteoblasts. In this study, we focused on TH effects on the secondary ossification center (SOC) because the time of appearance of SOCs in several species coincides with the time when peak levels of TH are attained. Accordingly, micro-computed tomography (µCT) evaluation of femurs and tibias at day 21 in TH-deficient and control mice revealed that endochondral ossification of SOCs is severely compromised owing to TH deficiency and that TH treatment for 10 days completely rescued this phenotype. Staining of cartilage and bone in the epiphysis revealed that whereas all of the cartilage is converted into bone in the prepubertal control mice, this conversion failed to occur in the TH-deficient mice. Immunohistochemistry studies revealed that TH treatment of thyroid stimulating hormone receptor mutant (Tshr(-/-) ) mice induced expression of Indian hedgehog (Ihh) and Osx in type 2 collagen (Col2)-expressing chondrocytes in the SOC at day 7, which subsequently differentiate into type 10 collagen (Col10)/osteocalcin-expressing chondro/osteoblasts at day 10. Consistent with these data, treatment of tibia cultures from 3-day-old mice with 10 ng/mL TH increased expression of Osx, Col10, alkaline phosphatase (ALP), and osteocalcin in the epiphysis by sixfold to 60-fold. Furthermore, knockdown of the TH-induced increase in Osx expression using lentiviral small hairpin RNA (shRNA) significantly blocked TH-induced ALP and osteocalcin expression in chondrocytes. Treatment of chondrogenic cells with an Ihh inhibitor abolished chondro/osteoblast differentiation and SOC formation. Our findings indicate that TH regulates the SOC initiation and progression via differentiating chondrocytes into bone matrix-producing osteoblasts by stimulating Ihh and Osx expression in chondrocytes. PMID:24753031

  8. 21 CFR 862.1690 - Thyroid stimulating hormone test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Thyroid stimulating hormone test system. 862.1690... Systems § 862.1690 Thyroid stimulating hormone test system. (a) Identification. A thyroid stimulating hormone test system is a device intended to measure thyroid stimulating hormone, also known...

  9. 21 CFR 862.1690 - Thyroid stimulating hormone test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Thyroid stimulating hormone test system. 862.1690... Systems § 862.1690 Thyroid stimulating hormone test system. (a) Identification. A thyroid stimulating hormone test system is a device intended to measure thyroid stimulating hormone, also known...

  10. 21 CFR 862.1690 - Thyroid stimulating hormone test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Thyroid stimulating hormone test system. 862.1690... Systems § 862.1690 Thyroid stimulating hormone test system. (a) Identification. A thyroid stimulating hormone test system is a device intended to measure thyroid stimulating hormone, also known...

  11. 21 CFR 862.1690 - Thyroid stimulating hormone test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Thyroid stimulating hormone test system. 862.1690... Systems § 862.1690 Thyroid stimulating hormone test system. (a) Identification. A thyroid stimulating hormone test system is a device intended to measure thyroid stimulating hormone, also known...

  12. 21 CFR 862.1690 - Thyroid stimulating hormone test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Thyroid stimulating hormone test system. 862.1690... Systems § 862.1690 Thyroid stimulating hormone test system. (a) Identification. A thyroid stimulating hormone test system is a device intended to measure thyroid stimulating hormone, also known...

  13. The thyroid gland and thyroid hormones in sheepshead minnow (Cyprinodon variegatus) during early development and metamorphosis.

    PubMed

    Schnitzler, Joseph G; Klaren, Peter H M; Mariavelle, Emeline; Das, Krishna

    2016-04-01

    The sheepshead minnow is widely used in ecotoxicological studies that only recently have begun to focus on disruption of the thyroid axis by xenobiotics and endocrine disrupting compounds. However, reference levels of the thyroid prohormone thyroxine (T4) and biologically active hormone 3,5,3'-triiodothyronine (T3) and their developmental patterns are unknown. This study set out to describe the ontogeny and morphology of the thyroid gland in sheepshead minnow, and to correlate these with whole-body concentrations of thyroid hormones during early development and metamorphosis. Eggs were collected by natural spawning in our laboratory. T4 and T3 were extracted from embryos, larvae and juveniles and an enzyme-linked immunoassay was used to measure whole-body hormone levels. Length and body mass, hatching success, gross morphology, thyroid hormone levels and histology were measured. The onset of metamorphosis at 12-day post-hatching coincided with surges in whole-body T4 and T3 concentrations. Thyroid follicles were first observed in pre-metamorphic larvae at hatching and were detected exclusively in the subpharyngeal region, surrounding the ventral aorta. Follicle size and thyrocyte epithelial cell heights varied during development, indicating fluctuations in thyroid hormone synthesis activity. The increase in the whole-body T3/T4 ratio was indicative of an increase in outer ring deiodination activity. This study establishes a baseline for thyroid hormones in sheepshead minnows, which will be useful for the understanding of thyroid hormone functions and in future studies of thyroid toxicants in this species. PMID:26573854

  14. Role of maternal thyroid hormones in the developing neocortex and during human evolution.

    PubMed

    Stenzel, Denise; Huttner, Wieland B

    2013-01-01

    The importance of thyroid hormones during brain development has been appreciated for many decades. In humans, low levels of circulating maternal thyroid hormones, e.g., caused by maternal hypothyroidism or lack of iodine in diet, results in a wide spectrum of severe neurological defects, including neurological cretinism characterized by profound neurologic impairment and mental retardation, underlining the importance of the maternal thyroid hormone contribution. In fact, iodine intake, which is essential for thyroid hormone production in the thyroid gland, has been related to the expansion of the brain, associated with the increased cognitive capacities during human evolution. Because thyroid hormones regulate transcriptional activity of target genes via their nuclear thyroid hormone receptors (THRs), even mild and transient changes in maternal thyroid hormone levels can directly affect and alter the gene expression profile, and thus disturb fetal brain development. Here we summarize how thyroid hormones may have influenced human brain evolution through the adaptation to new habitats, concomitant with changes in diet and, therefore, iodine intake. Further, we review the current picture we gained from experimental studies in rodents on the function of maternal thyroid hormones during developmental neurogenesis. We aim to evaluate the effects of maternal thyroid hormone deficiency as well as lack of THRs and transporters on brain development and function, shedding light on the cellular behavior conducted by thyroid hormones. PMID:23882187

  15. Role of maternal thyroid hormones in the developing neocortex and during human evolution

    PubMed Central

    Stenzel, Denise; Huttner, Wieland B.

    2013-01-01

    The importance of thyroid hormones during brain development has been appreciated for many decades. In humans, low levels of circulating maternal thyroid hormones, e.g., caused by maternal hypothyroidism or lack of iodine in diet, results in a wide spectrum of severe neurological defects, including neurological cretinism characterized by profound neurologic impairment and mental retardation, underlining the importance of the maternal thyroid hormone contribution. In fact, iodine intake, which is essential for thyroid hormone production in the thyroid gland, has been related to the expansion of the brain, associated with the increased cognitive capacities during human evolution. Because thyroid hormones regulate transcriptional activity of target genes via their nuclear thyroid hormone receptors (THRs), even mild and transient changes in maternal thyroid hormone levels can directly affect and alter the gene expression profile, and thus disturb fetal brain development. Here we summarize how thyroid hormones may have influenced human brain evolution through the adaptation to new habitats, concomitant with changes in diet and, therefore, iodine intake. Further, we review the current picture we gained from experimental studies in rodents on the function of maternal thyroid hormones during developmental neurogenesis. We aim to evaluate the effects of maternal thyroid hormone deficiency as well as lack of THRs and transporters on brain development and function, shedding light on the cellular behavior conducted by thyroid hormones. PMID:23882187

  16. Serum thyroid hormones and tissue 5'-monodeiodinase activity in acutely thyroidectomized newborn lambs

    SciTech Connect

    Polk, D.H.; Wu, S.Y.; Fisher, D.A.

    1986-08-01

    After either total thyroidectomy or sham operation in full-term fetal sheep, fetuses were delivered and serial blood samples were obtained for measurements of thyroxine (T4), triiodothyronine (T3), and catecholamines. Despite comparable serum T4 values, serum T3 values were lower in the thyroidectomized animals. Four hours after birth, the animals were killed with an intravenous overdose of barbiturate. Brain, thyroid, liver, kidney, and brown adipose tissues were dissected and analyzed for thyroxine 5'-monodeiodinase (5'-MDI) activity in vitro. 5'-MDI activity was comparable in all tissues from sham-operated and thyroidectomized lambs. Plasma epinephrine and norepinehprine concentrations, mean arterial pressure, mean pulse, rectal temperature, and arterial blood gas values were similar in the two groups of animals. These data support the hypothesis that the thyroid gland is the major source of T3 for the T3 surge in the immediate newborn period. They also indicate that the neonatal T3 surge has limited immediate metabolic significance in euthyroid newborns.

  17. Thyroid Hormone Replacement in Patients Following Thyroidectomy for Thyroid Cancer

    PubMed Central

    Hannoush, Zeina C.; Weiss, Roy E.

    2016-01-01

    Thyroid hormone replacement therapy in patients following thyroidectomy for thyroid cancer, although a potentially straightforward clinical problem, can present the clinician and patient with a variety of challenges. Most often the problems are related to the dose and preparation of thyroid hormone (TH) to use. Some patients feel less well following thyroidectomy and/or radioiodine ablation than they did before their diagnosis. We present evidence that levothyroxine (L-T4) is the preparation of choice, and keeping the thyroid-stimulating hormone (TSH) between detectable and 0.1 mU/L should be the standard of care in most cases. In unusual circumstances, when the patient remains clinically hypothyroid despite a suppressed TSH, we acknowledge there may be as yet unidentified factors influencing the body’s response to TH, and individualized therapy may be necessary in such patients. PMID:26886951

  18. Thyroid hormone-regulated gene expression in juvenile mouse liver: identification of thyroid response elements using microarray profiling and in silico analyses

    PubMed Central

    2011-01-01

    Background Disruption of thyroid hormone signalling can alter growth, development and energy metabolism. Thyroid hormones exert their effects through interactions with thyroid receptors that directly bind thyroid response elements and can alter transcriptional activity of target genes. The effects of short-term thyroid hormone perturbation on hepatic mRNA transcription in juvenile mice were evaluated, with the goal of identifying genes containing active thyroid response elements. Thyroid hormone disruption was induced from postnatal day 12 to 15 by adding goitrogens to dams' drinking water (hypothyroid). A subgroup of thyroid hormone-disrupted pups received intraperitoneal injections of replacement thyroid hormones four hours prior to sacrifice (replacement). An additional group received only thyroid hormones four hours prior to sacrifice (hyperthyroid). Hepatic mRNA was extracted and hybridized to Agilent mouse microarrays. Results Transcriptional profiling enabled the identification of 28 genes that appeared to be under direct thyroid hormone-regulation. The regulatory regions of the genome adjacent to these genes were examined for half-site sequences that resemble known thyroid response elements. A bioinformatics search identified 33 thyroid response elements in the promoter regions of 13 different genes thought to be directly regulated by thyroid hormones. Thyroid response elements found in the promoter regions of Tor1a, 2310003H01Rik, Hect3d and Slc25a45 were further validated by confirming that the thyroid receptor is associated with these sequences in vivo and that it can bind directly to these sequences in vitro. Three different arrangements of thyroid response elements were identified. Some of these thyroid response elements were located far up-stream (> 7 kb) of the transcription start site of the regulated gene. Conclusions Transcriptional profiling of thyroid hormone disrupted animals coupled with a novel bioinformatics search revealed new thyroid

  19. 2,4,6-Tribromophenol Interferes with the Thyroid Hormone System by Regulating Thyroid Hormones and the Responsible Genes in Mice.

    PubMed

    Lee, Dongoh; Ahn, Changhwan; Hong, Eui-Ju; An, Beum-Soo; Hyun, Sang-Hwan; Choi, Kyung-Chul; Jeung, Eui-Bae

    2016-01-01

    2,4,6-Tribromophenol (TBP) is a brominated flame retardant (BFR). Based on its affinity for transthyretin, TBP could compete with endogenous thyroid hormone. In this study, the effects of TBP on the thyroid hormone system were assessed in mice. Briefly, animals were exposed to 40 and 250 mg/kg TBP. Thyroid hormones were also administered with or without TBP. When mice were treated with TBP, deiodinase 1 (Dio1) and thyroid hormone receptor β isoform 2 (Thrβ2) decreased in the pituitary gland. The levels of deiodinase 2 (Dio2) and growth hormone (Gh) mRNA increased in response to 250 mg/kg of TBP, and the relative mRNA level of thyroid stimulating hormone β (Tshβ) increased in the pituitary gland. Dio1 and Thrβ1 expression in the liver were not altered, while Dio1 decreased in response to co-treatment with thyroid hormones. The thyroid gland activity decreased in response to TBP, as did the levels of free triiodothyronine and free thyroxine in serum. Taken together, these findings indicate that TBP can disrupt thyroid hormone homeostasis and the presence of TBP influenced thyroid actions as regulators of gene expression. These data suggest that TBP interferes with thyroid hormone systems. PMID:27420076

  20. 2,4,6-Tribromophenol Interferes with the Thyroid Hormone System by Regulating Thyroid Hormones and the Responsible Genes in Mice

    PubMed Central

    Lee, Dongoh; Ahn, Changhwan; Hong, Eui-Ju; An, Beum-Soo; Hyun, Sang-Hwan; Choi, Kyung-Chul; Jeung, Eui-Bae

    2016-01-01

    2,4,6-Tribromophenol (TBP) is a brominated flame retardant (BFR). Based on its affinity for transthyretin, TBP could compete with endogenous thyroid hormone. In this study, the effects of TBP on the thyroid hormone system were assessed in mice. Briefly, animals were exposed to 40 and 250 mg/kg TBP. Thyroid hormones were also administered with or without TBP. When mice were treated with TBP, deiodinase 1 (Dio1) and thyroid hormone receptor β isoform 2 (Thrβ2) decreased in the pituitary gland. The levels of deiodinase 2 (Dio2) and growth hormone (Gh) mRNA increased in response to 250 mg/kg of TBP, and the relative mRNA level of thyroid stimulating hormone β (Tshβ) increased in the pituitary gland. Dio1 and Thrβ1 expression in the liver were not altered, while Dio1 decreased in response to co-treatment with thyroid hormones. The thyroid gland activity decreased in response to TBP, as did the levels of free triiodothyronine and free thyroxine in serum. Taken together, these findings indicate that TBP can disrupt thyroid hormone homeostasis and the presence of TBP influenced thyroid actions as regulators of gene expression. These data suggest that TBP interferes with thyroid hormone systems PMID:27420076

  1. Epiphyseal chondrocyte secondary ossification centers require thyroid hormone activation of Indian hedgehog and osterix signaling

    PubMed Central

    Xing, Weirong; Cheng, Shaohong; Wergedal, Jon; Mohan, Subburaman

    2015-01-01

    Thyroid hormones (TH) are known to regulate endochondral ossification during skeletal development via acting directly in chondrocytes and osteoblasts. In this study, we focused on TH effects on the secondary ossification center (SOC), since the time of appearance of SOCs in several species coincides with the time when peak levels of TH are attained. Accordingly, μCT evaluation of femurs and tibias at day 21 in TH-deficient and control mice revealed that endochondral ossification of SOCs is severely compromised due to TH deficiency and that TH treatment for 10 days completely rescued this phenotype. Staining of cartilage and bone in the epiphysis revealed that while all of the cartilage is converted into bone in the prepubertal control mice, this conversion failed to occur in the TH-deficient mice. Immunohistochemistry studies revealed that TH treatment of Tshr−/− mice induced expression of Ihh and Osx in Col2 expressing chondrocytes in the SOC at day 7 which subsequently differentiate into Col10/osteocalcin expressing chondro-osteoblasts at day 10. Consistent with these data, treatment of tibia cultures from 3-day old mice with10 ng/ml TH increased expression of Osx, Col10, ALP and osteocalcin in the epiphysis by 6–60 fold. Furthermore, knockdown of the TH-induced increase in Osx expression using lentiviral shRNA significantly blocked TH-induced ALP and osteocalcin expression in chondrocytes. Treatment of chondrogenic cells with an Ihh inhibitor abolished chondro-osteoblast differentiation and SOC formation. Our findings indicate that TH regulates the SOC initiation and progression via differentiating chondrocytes into bone matrix producing osteoblasts by stimulating Ihh and Osx expression in chondrocytes. PMID:24753031

  2. Control of Pituitary Thyroid-stimulating Hormone Synthesis and Secretion by Thyroid Hormones during Xenopus Metamorphosis

    EPA Science Inventory

    Serum thyroid hormone (TH) concentrations in anuran larvae rise rapidly during metamorphosis. Such a rise in an adult anuran would inevitably trigger a negative feedback response resulting in decreased synthesis and secretion of thyroid-stimulating hormone (TSH) by the pituitary....

  3. Deiodination as an index of chemical disruption of thyroid hormone homeostasis and thyroidal status in fish

    SciTech Connect

    Eales, J.G.; Brown, S.B.; Cyr, D.G.; Adams, B.A.; Finnson, K.R.

    1999-07-01

    Commonly used indices of fish thyroidal status are based on thyroxine (T4) secretion by thyroid tissue under control of the central brain-pituitary-thyroid axis. However, much of the control of the fish thyroid system also occurs in peripheral tissues, such as liver, by regulating T4 prohormone conversion to biologically active 3,5,3{prime}-triiodothyronine (T3) or to biologically inactive 3,3{prime},5{prime}-triiodothyronine and by regulating T3 conversion to inactive 3,3{prime}-diiodothyronine. These extrathyroidal conversions depend on a family of independently-regulated selenocysteine-containing microsomal deiodinases. The authors describe deiodination assays and evaluate their potential as biomarkers for exposure to chemicals that directly or indirectly disrupt thyroid hormone homeostasis or thyroidal status. The authors conclude that deiodination be included in a minimum suite of assays to detect xenobiotic effects on the fish thyroid system.

  4. Emerging role of thyroid hormone metabolites.

    PubMed

    Gnocchi, D; Steffensen, K R; Bruscalupi, G; Parini, P

    2016-07-01

    Thyroid hormones (THs) are essential for the regulation of development and metabolism in key organs. THs produce biological effects both by directly affecting gene expression through the interaction with nuclear receptors (genomic effects) and by activating protein kinases and/or ion channels (short-term effects). Such activations can be either direct, in the case of ion channels, or mediated by membrane or cytoplasmic receptors. Short-term-activated signalling pathways often play a role in the regulation of genomic effects. Several TH intermediate metabolites, which were previously considered without biological activity, have now been associated with a broad range of actions, mostly attributable to short-term effects. Here, we give an overview of the physiological roles and mechanisms of action of THs, focusing on the emerging position that TH metabolites are acquiring as important regulators of physiology and metabolism. PMID:26748938

  5. Thyroid hormone stimulates Na-K-ATPase activity and its plasma membrane insertion in rat alveolar epithelial cells.

    PubMed

    Lei, Jianxun; Nowbar, Sogol; Mariash, Cary N; Ingbar, David H

    2003-09-01

    Na-K-ATPase protein is critical for maintaining cellular ion gradients and volume and for transepithelial ion transport in kidney and lung. Thyroid hormone, 3,3',5-triiodo-l-thyronine (T3), given for 2 days to adult rats, increases alveolar fluid resorption by 65%, but the mechanism is undefined. We tested the hypothesis that T3 stimulates Na-K-ATPase in adult rat alveolar epithelial cells (AEC), including primary rat alveolar type II (ATII) cells, and determined mechanisms of the T3 effect on the Na-KATPase enzyme using two adult rat AEC cell lines (MP48 and RLE-6TN). T3 at 10-8 and 10-5 M increased significantly hydrolytic activity of Na-K-ATPase in primary ATII cells and both AEC cell lines. The increased activity was dose dependent in the cell lines (10-9-10-4 M) and was detected within 30 min and peaked at 6 h. Maximal increases in Na-K-ATPase activity were twofold in MP48 and RLE-6TN cells at pharmacological T3 of 10-5 and 10-4 M, respectively, but increases were statistically significant at physiological T3 as low as 10-9 M. This effect was T3 specific, because reverse T3 (3,3',5'-triiodo-l-thyronine) at 10-9-10-4 M had no effect. The T3-induced increase in Na-K-ATPase hydrolytic activity was not blocked by actinomycin D. No significant change in mRNA and total cell protein levels of Na-K-ATPase were detected with 10-9-10-5 M T3 at 6 h. However, T3 increased cell surface expression of Na-K-ATPase alpha1- or beta1-subunit proteins by 1.7- and 2-fold, respectively, and increases in Na-K-ATPase activity and cell surface expression were abolished by brefeldin A. These data indicate that T3 specifically stimulates Na-K-ATPase activity in adult rat AEC. The upregulation involves translocation of Na-K-ATPase to plasma membrane, not increased gene transcription. These results suggest a novel nontranscriptional mechanism for regulation of Na-K-ATPase by thyroid hormone. PMID:12740220

  6. Tissue specific regulation of lipogenesis by thyroid hormone

    SciTech Connect

    Blennemann, B.; Freake, H. )

    1990-02-26

    Thyroid hormone stimulates long chain fatty acid synthesis in rat liver by increasing the amounts of key lipogenic enzymes. Sparse and conflicting data exist concerning its action on this pathway in other tissues. The authors recently showed that, in contrast to liver, hypothyroidism stimulates lipogenesis in brown adipose tissue and have now systematically examined the effects of thyroid state on fatty acid synthesis in other rat tissues. Lipogenesis was assessed by tritiated water incorporation. Euthyroid hepatic fatty acid synthesis (16.6um H/g/h) was reduced to 30% in hypothyroid rats and increased 3 fold in hyperthyroidism. Lipogenesis was detected in euthyroid kidney and heart and these levels were also stimulated by thyroid hormone treatment. Brown adipose tissue was unique in showing increased lipogenesis in the hypothyroid state. Hyperthyroid levels were not different from euthyroid. Effects in white adipose tissue were small and inconsistent. Brain, skin and lung were all lipogenically active, but did not respond to changes in thyroid state. Low but detectable levels of fatty acid synthesis were measured in muscle, which also were non-responsive. A wide spectrum of responses to thyroid hormone are seen in different rat tissues and thus the pathway of long chain fatty acid synthesis would appear to be an excellent model for examining the tissue specific regulation of gene expression by thyroid hormone.

  7. Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination

    SciTech Connect

    Ren, Xiao-Min Guo, Liang-Hong Gao, Yu Zhang, Bin-Tian Wan, Bin

    2013-05-01

    Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2′-OH-BDE-28, 3′-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3′-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. - Highlights: ► Thyroid hormone (TH) activity of OH-PBDEs with different Br number was evaluated. ► Four different experimental approaches were employed to investigate the mechanism. ► Low-brominated OH-PBDEs were agonists, but high-brominated ones were antagonists.

  8. Coexistence of resistance to thyroid hormone and papillary thyroid carcinoma

    PubMed Central

    Igata, Motoyuki; Tsuruzoe, Kaku; Kawashima, Junji; Kukidome, Daisuke; Kondo, Tatsuya; Motoshima, Hiroyuki; Shimoda, Seiya; Furukawa, Noboru; Nishikawa, Takeshi; Miyamura, Nobuhiro

    2016-01-01

    Summary Resistance to thyroid hormone (RTH) is a syndrome of reduced tissue responsiveness to thyroid hormones. RTH is majorly caused by mutations in the thyroid hormone receptor beta (THRB) gene. Recent studies indicated a close association of THRB mutations with human cancers, but the role of THRB mutation in carcinogenesis is still unclear. Here, we report a rare case of RTH with a papillary thyroid carcinoma (PTC). A 26-year-old woman was referred to our hospital due to a thyroid tumor and hormonal abnormality. She had elevated serum thyroid hormones and non-suppressed TSH levels. Genetic analysis of THRB identified a missense mutation, P452L, leading to a diagnosis of RTH. Ultrasound-guided fine-needle aspiration biopsy of the tumor and lymph nodes enabled the cytological diagnosis of PTC with lymph node metastases. Total thyroidectomy and neck lymph nodes dissection were performed. Following surgery, thyroxine replacement (≥500 μg) was necessary to avoid the symptoms of hypothyroidism and to maintain her TSH levels within the same range as before the operation. During the follow-up, basal thyroglobulin (Tg) levels were around 6 ng/ml and TSH-stimulated Tg levels were between 12 and 20 ng/ml. Up to present, the patient has had no recurrence of PTC. This indicates that these Tg values are consistent with a biochemical incomplete response or an indeterminate response. There is no consensus regarding the management of thyroid carcinoma in patients with RTH, but aggressive treatments such as total thyroidectomy followed by radioiodine (RAI) and TSH suppression therapy are recommended. Learning points There are only a few cases reporting the coexistence of RTH and thyroid carcinoma. Moreover, our case would be the first case presenting one with lymph node metastases. Recent studies indicated a close association of THRB mutations with human cancers, but the role of THRB mutation in carcinogenesis is still unclear. When total thyroidectomy is performed in

  9. Advanced bone formation in mice with a dominant-negative mutation in the thyroid hormone receptor β gene due to activation of Wnt/β-catenin protein signaling.

    PubMed

    O'Shea, Patrick J; Kim, Dong Wook; Logan, John G; Davis, Sean; Walker, Robert L; Meltzer, Paul S; Cheng, Sheue-yann; Williams, Graham R

    2012-05-18

    Thyroid hormone (T(3)) acts in chondrocytes and bone-forming osteoblasts to control bone development and maintenance, but the signaling pathways mediating these effects are poorly understood. Thrb(PV/PV) mice have a severely impaired pituitary-thyroid axis and elevated thyroid hormone levels due to a dominant-negative mutant T(3) receptor (TRβ(PV)) that cannot bind T(3) and interferes with the actions of wild-type TR. Thrb(PV/PV) mice have accelerated skeletal development due to unknown mechanisms. We performed microarray studies in primary osteoblasts from wild-type mice and Thrb(PV/PV) mice. Activation of the canonical Wnt signaling in Thrb(PV/PV) mice was confirmed by in situ hybridization analysis of Wnt target gene expression in bone during postnatal growth. By contrast, T(3) treatment inhibited Wnt signaling in osteoblastic cells, suggesting that T(3) inhibits the Wnt pathway by facilitating proteasomal degradation of β-catenin and preventing its accumulation in the nucleus. Activation of the Wnt pathway in Thrb(PV/PV) mice, however, results from a gain of function for TRβ(PV) that stabilizes β-catenin despite the presence of increased thyroid hormone levels. These studies demonstrate novel interactions between T(3) and Wnt signaling pathways in the regulation of skeletal development and bone formation. PMID:22442145

  10. Effects of phenobarbital on thyroid hormone contabolism in rat hepatocytes

    EPA Science Inventory

    Hepatic enzyme inducers such as phenobarbital (PB) decrease circulating thyroid hormone (TH) concentrations in rodents. PB induction of hepatic xenobiotic metabolizing enzymes increases thyroid hormones catabolism and biliary elimination. This study examines the catabolism and cl...

  11. Tracing thyroid hormone-disrupting compounds: database compilation and structure-activity evaluation for an effect-directed analysis of sediment.

    PubMed

    Weiss, Jana M; Andersson, Patrik L; Zhang, Jin; Simon, Eszter; Leonards, Pim E G; Hamers, Timo; Lamoree, Marja H

    2015-07-01

    A variety of anthropogenic compounds has been found to be capable of disrupting the endocrine systems of organisms, in laboratory studies as well as in wildlife. The most widely described endpoint is estrogenicity, but other hormonal disturbances, e.g., thyroid hormone disruption, are gaining more and more attention. Here, we present a review and chemical characterization, using principal component analysis, of organic compounds that have been tested for their capacity to bind competitively to the thyroid hormone transport protein transthyretin (TTR). The database contains 250 individual compounds and technical mixtures, of which 144 compounds are defined as TTR binders. Almost one third of these compounds (n = 52) were even more potent than the natural hormone thyroxine (T4). The database was used as a tool to assist in the identification of thyroid hormone-disrupting compounds (THDCs) in an effect-directed analysis (EDA) study of a sediment sample. Two compounds could be confirmed to contribute to the detected TTR-binding potency in the sediment sample, i.e., triclosan and nonylphenol technical mixture. They constituted less than 1% of the TTR-binding potency of the unfractionated extract. The low rate of explained activity may be attributed to the challenges related to identification of unknown contaminants in combination with the limited knowledge about THDCs in general. This study demonstrates the need for databases containing compound-specific toxicological properties. In the framework of EDA, such a database could be used to assist in the identification and confirmation of causative compounds focusing on thyroid hormone disruption. PMID:25986900

  12. Thyroid Hormone and Leptin in the Testis

    PubMed Central

    Ramos, Cristiane Fonte; Zamoner, Ariane

    2014-01-01

    Leptin is primarily expressed in white adipose tissue; however, it is expressed in the hypothalamus and reproductive tissues as well. Leptin acts by activating the leptin receptors (Ob-Rs). Additionally, the regulation of several neuroendocrine and reproductive functions, including the inhibition of glucocorticoids and enhancement of thyroxine and sex hormone concentrations in human beings and mice are leptin functions. It has been suggested that thyroid hormones (TH) could directly regulate leptin expression. Additionally, hypothyroidism compromises the intracellular integration of leptin signaling specifically in the arcuate nucleus. Two TH receptor isoforms are expressed in the testis, TRa and TRb, with TRa being the predominant one that is present in all stages of development. The effects of TH involve the proliferation and differentiation of Sertoli and Leydig cells during development, spermatogenesis, and steroidogenesis. In this context, TH disorders are associated with sexual dysfunction. An endocrine and/or direct paracrine effect of leptin on the gonads inhibits testosterone production in Leydig cells. Further studies are necessary to clarify the effects of both hormones in the testis during hypothyroidism. The goal of this review is to highlight the current knowledge regarding leptin and TH in the testis. PMID:25505448

  13. Mild Thyroid Hormone Insufficiency During Development Compromises Activity-Dependent Neuroplasticity in the Hippocampus of Adult Male Rats.

    PubMed

    Gilbert, M E; Sanchez-Huerta, K; Wood, C

    2016-02-01

    Severe thyroid hormone (TH) deficiency during critical phases of brain development results in irreversible neurological and cognitive impairments. The mechanisms accounting for this are likely multifactorial, and are not fully understood. Here we pursue the possibility that one important element is that TH affects basal and activity-dependent neurotrophin expression in brain regions important for neural processing. Graded exposure to propylthiouracil (PTU) during development produced dose-dependent reductions in mRNA expression of nerve growth factor (Ngf) in whole hippocampus of neonates. These changes in basal expression persisted to adulthood despite the return to euthyroid conditions in blood. In contrast to small PTU-induced reductions in basal expression of several genes, developmental PTU treatment dramatically reduced the activity-dependent expression of neurotrophins and related genes (Bdnft, Bdnfiv, Arc, and Klf9) in adulthood and was accompanied by deficits in hippocampal-based learning. These data demonstrate that mild TH insufficiency during development not only reduces expression of important neurotrophins that persists into adulthood but also severely restricts the activity-dependent induction of these genes. Considering the importance of these neurotrophins for sculpting the structural and functional synaptic architecture in the developing and the mature brain, it is likely that TH-mediated deficits in these plasticity mechanisms contribute to the cognitive deficiencies that accompany developmental TH compromise. PMID:26606422

  14. Thyroid-stimulating hormone decreases HMG-CoA reductase phosphorylation via AMP-activated protein kinase in the liver

    PubMed Central

    Zhang, Xiujuan; Song, Yongfeng; Feng, Mei; Zhou, Xinli; Lu, Yingli; Gao, Ling; Yu, Chunxiao; Jiang, Xiuyun; Zhao, Jiajun

    2015-01-01

    Cholesterol homeostasis is strictly regulated through the modulation of HMG-CoA reductase (HMGCR), the rate-limiting enzyme of cholesterol synthesis. Phosphorylation of HMGCR inactivates it and dephosphorylation activates it. AMP-activated protein kinase (AMPK) is the major kinase phosphorylating the enzyme. Our previous study found that thyroid-stimulating hormone (TSH) increased the hepatocytic HMGCR expression, but it was still unclear whether TSH affected hepatic HMGCR phosphorylation associated with AMPK. We used bovine TSH (bTSH) to treat the primary mouse hepatocytes and HepG2 cells with or without constitutively active (CA)-AMPK plasmid or protein kinase A inhibitor (H89), and set up the TSH receptor (Tshr)-KO mouse models. The p-HMGCR, p-AMPK, and related molecular expression were tested. The ratios of p-HMGCR/HMGCR and p-AMPK/AMPK decreased in the hepatocytes in a dose-dependent manner following bTSH stimulation. The changes above were inversed when the cells were treated with CA-AMPK plasmid or H89. In Tshr-KO mice, the ratios of liver p-HMGCR/HMGCR and p-AMPK/AMPK were increased relative to the littermate wild-type mice. Consistently, the phosphorylation of acetyl-CoA carboxylase, a downstream target molecule of AMPK, increased. All results suggested that TSH could regulate the phosphorylation of HMGCR via AMPK, which established a potential mechanism for hypercholesterolemia involved in a direct action of the TSH in the liver. PMID:25713102

  15. Actions of Thyroid Hormone Analogues on Chemokines

    PubMed Central

    Glinsky, Gennadi V.

    2016-01-01

    The extracellular domain of plasma membrane integrin αvβ3 contains a receptor for thyroid hormone (L-thyroxine, T4; 3,5,3′-triiodo-L-thyronine, T3); this receptor also binds tetraiodothyroacetic acid (tetrac), a derivative of T4. Tetrac inhibits the binding of T4 and T3 to the integrin. Fractalkine (CX3CL1) is a chemokine relevant to inflammatory processes in the CNS that are microglia-dependent but also important to normal brain development. Expression of the CX3CL1 gene is downregulated by tetrac, suggesting that T4 and T3 may stimulate fractalkine expression. Independently of its specific receptor (CX3CR1), fractalkine binds to αvβ3 at a site proximal to the thyroid hormone-tetrac receptor and changes the physical state of the integrin. Tetrac also affects expression of the genes for other CNS-relevant chemokines, including CCL20, CCL26, CXCL2, CXCL3, and CXCL10. The chemokine products of these genes are important to vascularity of the brain, particularly of the choroid plexus, to inflammatory processes in the CNS and, in certain cases, to neuroprotection. Thyroid hormones are known to contribute to regulation of each of these CNS functions. We propose that actions of thyroid hormone and hormone analogues on chemokine gene expression contribute to regulation of inflammatory processes in brain and of brain blood vessel formation and maintenance. PMID:27493972

  16. Actions of Thyroid Hormone Analogues on Chemokines.

    PubMed

    Davis, Paul J; Glinsky, Gennadi V; Lin, Hung-Yun; Mousa, Shaker A

    2016-01-01

    The extracellular domain of plasma membrane integrin αvβ3 contains a receptor for thyroid hormone (L-thyroxine, T4; 3,5,3'-triiodo-L-thyronine, T3); this receptor also binds tetraiodothyroacetic acid (tetrac), a derivative of T4. Tetrac inhibits the binding of T4 and T3 to the integrin. Fractalkine (CX3CL1) is a chemokine relevant to inflammatory processes in the CNS that are microglia-dependent but also important to normal brain development. Expression of the CX3CL1 gene is downregulated by tetrac, suggesting that T4 and T3 may stimulate fractalkine expression. Independently of its specific receptor (CX3CR1), fractalkine binds to αvβ3 at a site proximal to the thyroid hormone-tetrac receptor and changes the physical state of the integrin. Tetrac also affects expression of the genes for other CNS-relevant chemokines, including CCL20, CCL26, CXCL2, CXCL3, and CXCL10. The chemokine products of these genes are important to vascularity of the brain, particularly of the choroid plexus, to inflammatory processes in the CNS and, in certain cases, to neuroprotection. Thyroid hormones are known to contribute to regulation of each of these CNS functions. We propose that actions of thyroid hormone and hormone analogues on chemokine gene expression contribute to regulation of inflammatory processes in brain and of brain blood vessel formation and maintenance. PMID:27493972

  17. Activation of Sox3 Gene by Thyroid Hormone in the Developing Adult Intestinal Stem Cell During Xenopus Metamorphosis

    PubMed Central

    Sun, Guihong; Fu, Liezhen; Wen, Luan

    2014-01-01

    The maturation of the intestine into the adult form involves the formation of adult stem cells in a thyroid hormone (T3)-dependent process in vertebrates. In mammals, this takes place during postembryonic development, a period around birth when the T3 level peaks. Due to the difficulty of manipulating late-stage, uterus-enclosed embryos, very little is known about the development of the adult intestinal stem cells. Interestingly, the remodeling of the intestine during the T3-dependent amphibian metamorphosis mimics the maturation of mammalian intestine. Our earlier microarray studies in Xenopus laevis revealed that the transcription factor SRY (sex-determining region Y)-box 3 (Sox3), well known for its involvement in neural development, was upregulated in the intestinal epithelium during metamorphosis. Here, we show that Sox3 is highly and specifically expressed in the developing adult intestinal progenitor/stem cells. We further show that its induction by T3 is independent of new protein synthesis, suggesting that Sox3 is directly activated by liganded T3 receptor. Thus, T3 activates Sox3 as one of the earliest changes in the epithelium, and Sox3 in turn may facilitate the dedifferentiation of the larval epithelial cells into adult stem cells. PMID:25211587

  18. Thyroid hormones in milk: physiological approach--a review.

    PubMed

    Strbák, V; Macho, L; Skultétyová, M; Michalicková, J; Pohlová, G

    1983-10-01

    Reported values of the concentration of thyroid hormones in milk vary substantially. There are some doubts on the specificity of methods used for their estimation. We aimed, therefore, to study the effects of mother milk on thyroid function parameters in sucklings as well as at the effect of milk secretion on maternal thyroid. According to Fukuda et al. [1980] the lactation induces a hypothyroid state in the rat (high TSH, low thyroid hormones in maternal plasma). In our study the weaning of 18-day old rats resulted in gradual decrease of T4 in suckling plasma through 24 h followed with a transient thyroid activation. Thyroidectomy of lactating rats resulted in a transient decrease of T4 in sucklings. The difference in mother milk intake achieved by different litter size also affected the thyroid function of sucklings. The pups from small size litters (more milk consumption) had low thyroid secretion rate and low plasma TSH, while the level of T4 in plasma was high under a higher growth rate and accelerated overall maturation. All these results suggest an exogenous intake of thyroid hormones in suckling rat. We found that lactation in women resulted in lower T4 and higher TSH in plasma as compared to women who had interrupted their lactation. In the next part of our study more than 80 infants were longitudinally followed and sampled at birth (cord blood), at 2, 6 and 10 weeks and at 4, 6, 9 and 12 months. Only moderate differences were found at 4 months (high rT3) in breast fed infants and 9 at months (high T3 in plasma of infants weaned during the first week of life) when the data were evaluated according to the type of feeding. Thyroid activity of human milk was tested by feeding thyroidectomized rats with a diet containing human milk. Although plasma TSH was affected by such a diet, we did not detect any T4 and T3 in plasma of thyroidectomized rats which probably refects low calculated intake of hormones with the diet. We conclude that the lactation affects the

  19. Thyroid hormone and anti-apoptosis in tumor cells.

    PubMed

    Lin, Hung-Yun; Glinsky, Gennadi V; Mousa, Shaker A; Davis, Paul J

    2015-06-20

    The principal secretory product of the thyroid gland, L-thyroxine (T4), is anti-apoptotic at physiological concentrations in a number of cancer cell lines. Among the mechanisms of anti-apoptosis activated by the hormone are interference with the Ser-15 phosphorylation (activation) of p53 and with TNFα/Fas-induced apoptosis. The hormone also decreases cellular abundance and activation of proteolytic caspases and of BAX and causes increased expression of X-linked inhibitor of apoptosis (XIAP). The anti-apoptotic effects of thyroid hormone largely are initiated at a cell surface thyroid hormone receptor on the extracellular domain of integrin αvβ3 that is amply expressed and activated in cancer cells. Tetraiodothyroacetic acid (tetrac) is a T4 derivative that, in a model of resveratrol-induced p53-dependent apoptosis in glioma cells, blocks the anti-apoptotic action of thyroid hormone, permitting specific serine phosphorylation of p53 and apoptosis to proceed. In a nanoparticulate formulation limiting its action to αvβ3, tetrac modulates integrin-dependent effects on gene expression in human cancer cell lines that include increased expression of a panel of pro-apoptotic genes and decreased transcription of defensive anti-apoptotic XIAP and MCL1 genes. By a variety of mechanisms, thyroid hormone (T4) is an endogenous anti-apoptotic factor that may oppose chemotherapy-induced apoptosis in αvβ3-expressing cancer cells. It is possible to decrease this anti-apoptotic activity pharmacologically by reducing circulating levels of T4 or by blocking effects of T4 that are initiated at αvβ3. PMID:26041883

  20. Thyroid hormone and anti-apoptosis in tumor cells

    PubMed Central

    Lin, Hung-Yun; Glinsky, Gennadi V.; Mousa, Shaker A.; Davis, Paul J.

    2015-01-01

    The principal secretory product of the thyroid gland, L-thyroxine (T4), is anti-apoptotic at physiological concentrations in a number of cancer cell lines. Among the mechanisms of anti-apoptosis activated by the hormone are interference with the Ser-15 phosphorylation (activation) of p53 and with TNFα/Fas-induced apoptosis. The hormone also decreases cellular abundance and activation of proteolytic caspases and of BAX and causes increased expression of X-linked inhibitor of apoptosis (XIAP). The anti-apoptotic effects of thyroid hormone largely are initiated at a cell surface thyroid hormone receptor on the extracellular domain of integrin αvβ3 that is amply expressed and activated in cancer cells. Tetraiodothyroacetic acid (tetrac) is a T4 derivative that, in a model of resveratrol-induced p53-dependent apoptosis in glioma cells, blocks the anti-apoptotic action of thyroid hormone, permitting specific serine phosphorylation of p53 and apoptosis to proceed. In a nanoparticulate formulation limiting its action to αvβ3, tetrac modulates integrin-dependent effects on gene expression in human cancer cell lines that include increased expression of a panel of pro-apoptotic genes and decreased transcription of defensive anti-apoptotic XIAP and MCL1 genes. By a variety of mechanisms, thyroid hormone (T4) is an endogenous anti-apoptotic factor that may oppose chemotherapy-induced apoptosis in αvβ3-expressing cancer cells. It is possible to decrease this anti-apoptotic activity pharmacologically by reducing circulating levels of T4 or by blocking effects of T4 that are initiated at αvβ3. PMID:26041883

  1. Biological Functions of Thyroid Hormone in Placenta

    PubMed Central

    Chen, Cheng-Yi; Chen, Chie-Pein; Lin, Kwang-Huei

    2015-01-01

    The thyroid hormone, 3,3,5-triiodo-l-thyronine (T3), modulates several physiological processes, including cellular growth, differentiation, metabolism, inflammation and proliferation, via interactions with thyroid hormone response elements (TREs) in the regulatory regions of target genes. Infection and inflammation are critical processes in placental development and pregnancy-related diseases. In particular, infection is the leading cause of neonatal mortality and morbidity worldwide. However, to date, no successful approach has been developed for the effective diagnosis of infection in preterm infants. Pre-eclampsia (PE) is a serious disorder that adversely affects ~5% of human pregnancies. Recent studies identified a multiprotein complex, the inflammasome, including the Nod-like receptor (NLR) family of cytosolic pattern recognition receptors, the adaptor protein apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and caspase-1, which plays a vital role in the placenta. The thyroid hormone modulates inflammation processes and is additionally implicated in placental development and disease. Therefore, elucidation of thyroid hormone receptor-regulated inflammation-related molecules, and their underlying mechanisms in placenta, should facilitate the identification of novel predictive and therapeutic targets for placental disorders. This review provides a detailed summary of current knowledge with respect to identification of useful biomarkers and their physiological significance in placenta. PMID:25690032

  2. Effect of age and season on the thyroid hormone activity of Mizoram strain female mithun (Bos frontalis)

    PubMed Central

    Lalsangpuii; Ali, M. Ayub; Devi, L. Inaotombi; Behera, Parthasarathi; Ralte, Lalsanglura

    2015-01-01

    Aim: The aim of the present study was to generate baseline data on the normal values of the thyroidhormone (TH) activity as well as their correlation with age and season. Materials and Methods: Blood samples (10 ml) were collected from jugular vein of 30 female mithun’s of three different age groups viz. Calves (6 months to 1 year), heifer (1-3 years) and adult (above 3 years) during the three season’s viz. Monsoon, winter and spring of a year. The serum was analyzed for thyroid stimulating hormone (TSH), triiodothyronine (T3), and thyroxine (T4) activity. Result: The result showed a significantly (p<0.05) a higher T3 level in heifers followed by adults and calves and higher T4 level in adults followed by heifers and calves in all the seasons. The TSH level was higher in heifers in all the seasons. The winter season recorded higher level of T3, T4, and TSH as compared to the other seasons of a year. Conclusion: The TSH and T3 level were the highest for aheifer, whereas T4 level was the highest for adults inall the season. Furthermore, the higher level of TH was observed in winter season. The increased level of the TH during the winter season signifies their calorigenic effect. Similarly in heifers, the increased T3 concentrations show its importance in reproductive physiology and its association with ovarian activity. This indicates that age and season have aprofound effect on TH activity of Mizoram strain female mithun. PMID:27047046

  3. A TNF Variant that Associates with Susceptibility to Musculoskeletal Disease Modulates Thyroid Hormone Receptor Binding to Control Promoter Activation

    PubMed Central

    Kiss-Toth, Endre; Harlock, Edward; Lath, Darren; Quertermous, Thomas; Wilkinson, J. Mark

    2013-01-01

    Tumor necrosis factor (TNF) is a powerful pro-inflammatory cytokine and immuno-regulatory molecule, and modulates susceptibility to musculoskeletal diseases. Several meta-analyses and replicated association studies have implicated the minor ‘A’ variant within the TNF promoter single nucleotide polymorphism (SNP) rs361525 (-238A/G) as a risk allele in joint related disorders, including psoriatic and juvenile idiopathic arthritis, and osteolysis after joint arthroplasty. Here we characterized the effect of this variant on TNF promoter function. A transcriptional reporter, encoding the -238A variant of the TNF promoter, resulted in 2.2 to 2.8 times greater transcriptional activation versus the ‘G’ variant in murine macrophages when stimulated with pro-inflammatory stimuli. Bioinformatic analysis predicted a putative binding site for thyroid hormone receptor (TR) for the -238A but not the -238G allele. Overexpression of TR-α induced promoter expression 1.8-fold in the presence of the ‘A’ allele only. TR-α expression both potentiated and sensitized the -238A response to LPS or a titanium particulate stimulus, whilst siRNA knockdown of either THRA or THRB impaired transcriptional activation for the -238A variant only. This effect was independent of receptor-ligand binding of triiodothyronine. Immunohistochemical analysis of osteolysis interface membranes from patients undergoing revision surgery confirmed expression of TR-α within osteoclast nuclei at the resorption surface. The ‘A’ allele at rs361525 confers increased transcriptional activation of the TNF promoter and influences susceptibility to several arthritic conditions. This effect is modulated, at least in part, by binding of TR, which both sensitizes and potentiates transcriptional activation of the ‘A’ variant independent of its endogenous ligand. PMID:24069456

  4. Effect of triclosan, triclocarban, 2,2',4,4'-tetrabromodiphenyl ether, and bisphenol A on the iodide uptake, thyroid peroxidase activity, and expression of genes involved in thyroid hormone synthesis.

    PubMed

    Wu, Yuanfeng; Beland, Frederick A; Fang, Jia-Long

    2016-04-01

    Triclosan, triclocarban, 2,2',4,4'-tetrabromodiphenyl ether (BDE-47), and bisphenol A (BPA) have been reported to disturb thyroid hormone (TH) homeostasis. We have examined the effects of these chemicals on sodium/iodide symporter (NIS)-mediated iodide uptake and the expression of genes involved in TH synthesis in rat thyroid follicular FRTL-5 cells, and on the activity of thyroid peroxidase (TPO) using rat thyroid microsomes. All four chemicals inhibited NIS-mediated iodide uptake in a concentration-dependent manner. A decrease in the iodide uptake was also observed in the absence of sodium iodide. Kinetic studies showed that all four chemicals were non-competitive inhibitors of NIS, with the order of Ki values being triclosanthyroid transcription factor genes, Pax8, Foxe1, and Nkx2-1, was examined using quantitative real-time PCR. No significant changes in the expression of any genes were observed with triclosan or triclocarban. BDE-47 decreased the level of Tpo, while BPA altered the expression of all six genes. Triclosan and triclocarban inhibited the activity of TPO at 166 and >300 μM, respectively. Neither BDE-47 nor BPA affected TPO activity. In conclusion, triclosan, triclocarban, BDE-47, and BPA inhibited iodide uptake, but had differential effects on the expression of TH synthesis-related genes and the activity of TPO. PMID:26827900

  5. THE THYROID HORMONE TRANSPORTER, MCT8, SELECTIVELY RESPONDS TO THYROID HORMONE INSUFFICIENCY IN THE DEVELOPMENT RAT BRAIN.

    EPA Science Inventory

    Thyroid hormone (TH) is essential for normal brain development. Therefore, it is not surprising that a variety of adaptive mechanisms are activated in response to TH insufficiency. However, not all brain regions respond in the same fashion to TH insufficiency. This observation...

  6. [Sex Specificity in Age-Related Thyroid Hormone Responsiveness].

    PubMed

    Suzuki, Satoru

    2016-01-01

    Similar to other systems, the endocrine system is affected by aging. Thyroid hormone, the action of which is affected by many factors, has been shown to be associated with longevity. The most useful marker for assessment of the thyroid hormone action is the TSH level. Although age and sex are believed to modify the pituitary set point or response to the free thyroid hormone concentration, the precise age- and sex-dependent responses to thyroid hormone have yet to be reported. In this lecture, molecular aspects of resistance to thyroid hormone are initially overviewed. After presentation of the evidence that the TSH-thyroid hormone axis is evolutionarily modified, and that negative feedback mechanisms may start to play roles in homeostatic regulation at the time of delivery, the rationale of age-dependent thyroid hormone resistance is introduced. To assess the age- and sex-dependent resistance to thyroid hormone, the index is provided by the formula based on the relationship between thyroid hormone and TSH levels. The index is calculated by the results of thyroid function tests obtained from the two individual clinical groups. From the results, there were negative relationships between the free T3 resistance index and age in males of both groups, while there were no apparent relationships in females. These findings indicate that there is a male-specific response to thyroid hormone with aging. Furthermore, the specific features of the response may not be affected by environmental factors such as the presence of disorders or medical treatments. PMID:27192800

  7. Thyroid hormone activates Wnt/β-catenin signaling involved in adult epithelial development during intestinal remodeling in Xenopus laevis.

    PubMed

    Hasebe, Takashi; Fujimoto, Kenta; Kajita, Mitsuko; Ishizuya-Oka, Atsuko

    2016-08-01

    During amphibian intestinal remodeling, thyroid hormone (TH) induces some larval epithelial cells to dedifferentiate into adult stem cells, which newly generate the absorptive epithelium analogous to the mammalian epithelium. To clarify molecular mechanisms underlying adult epithelial development, we here focus on TH response genes that are associated with the canonical Wnt pathway. Our quantitative reverse transcription plus polymerase chain reaction and immunohistochemical analyses indicate that all of the genes examined, including β-catenin, c-Myc and secreted frizzle-related protein 2 (SFRP2), are up-regulated in Xenopus laevis intestine during both natural and TH-induced metamorphosis. Moreover, immunoreactivity for nuclear β-catenin becomes detectable in adult stem cells from the start of their appearance and then increases in intensity in adult epithelial primordia derived from the stem cells, which actively proliferate and coexpress Wnt target genes c-Myc and LGR5. These expression profiles strongly suggest the involvement of the canonical Wnt pathway in the maintenance and/or proliferation of adult stem/progenitor cells. More importantly, by using organ cultures of the tadpole intestine, we have experimentally shown that the addition of exogenous SFRP2 protein to the culture medium promotes cell proliferation of the adult epithelial primordia, whereas inhibition of endogenous SFRP2 by its antibody suppresses their proliferation. The inhibition of SFRP2 suppresses larval epithelial changes in shape from simple columnar to stem-cell-like roundish cells, resulting in the failure of epithelial dedifferentiation. Thus, TH-up-regulated SFRP2 in the postembryonic intestine promotes adult stem cell development, possibly by acting as an agonist of both canonical and non-canonical Wnt signaling. PMID:27068920

  8. Futures Challenges in Thyroid Hormone Signaling Research

    PubMed Central

    Flamant, Frédéric

    2016-01-01

    The canonical pathway of thyroid hormone signaling involves its binding to nuclear receptors (TRs) acting directly on the transcription of a number of genes. Recent genome-wide studies revealed that chromatin occupancy by TR is not sufficient for transactivation of gene expression. Reciprocally, in some cases, DNA binding by TR may not be required for cellular response. This leaves many new questions to be addressed in future research. PMID:27445973

  9. Futures Challenges in Thyroid Hormone Signaling Research.

    PubMed

    Flamant, Frédéric

    2016-01-01

    The canonical pathway of thyroid hormone signaling involves its binding to nuclear receptors (TRs) acting directly on the transcription of a number of genes. Recent genome-wide studies revealed that chromatin occupancy by TR is not sufficient for transactivation of gene expression. Reciprocally, in some cases, DNA binding by TR may not be required for cellular response. This leaves many new questions to be addressed in future research. PMID:27445973

  10. Stability of thyroid hormones during continuous infusion.

    PubMed

    Golombek, Sergio G; Alpan, Gad; Frey, Michael; Corbi, Dominick; Lagamma, Edmund F

    2011-07-01

    We investigated the stability of thyroid hormones during a mode of continuous drug infusion via polypropylene tubing using the same conditions that would be applied to treating patients in a hospital setting. The diluted thyroid hormones were prepared using aseptic technique, stored at 2-8°C (36-46°F) and tested within 24 h of preparation for stability and percent recovery from within plastic tubing. Experiments were done in duplicate with triplicate sets of readings for each assay point. Only T(4) prepared with 5% dextrose water (D5W) containing 1 mg/mL albumin remained constant, stable, predictable and accurate over time under various conditions. Other methods of preparation lost drug by adhering to the plastic containers and tubing by as much as 40% of starting concentration. T(3) recovery in the presence of 1 mg/mL of albumin was 107±2% (mean±standard error of the mean) of anticipated drug concentrations. We conclude from this series of experiments that to maintain an accurate and stable dosing of patients receiving intravenous thyroid hormones, 1 mg/mL of albumin must be added to the infusate to prevent lost on the plastic intravenous tubing. PMID:21501101

  11. Thyroid hormones and postembryonic development in amniotes.

    PubMed

    Holzer, Guillaume; Laudet, Vincent

    2013-01-01

    In chordates, metamorphosis is a developmental event well described in amphibians in which thyroid hormone triggers this event. Interestingly, among amphibians, several variations upon the eggs/tadpole/frog developmental sequence are observed such as direct development or neoteny. The fact that TH-regulated metamorphosis is conserved in invertebrate chordates such as amphioxus implies that this event is an ancient feature of all vertebrates. This allows us to propose that TH may play an important role in coordinating the postembryonic development of apparently nonmetamorphosing vertebrates such as mammals or sauropsids. Indeed, the observations of thyroid hormone levels in mammals and sauropsids draw interesting parallels with what is observed during amphibian metamorphosis. At the physiological level, the increase of thyroid hormone signaling is required for the normal development particularly for the intestine and the brain. At the behavioral level, a peak of TH often precedes the autonomy of the young from parental care. At the ecological level, offspring with a TH peak close to birth/hatching tends to be precocial young whereas offspring with a TH peak long after birth/hatching tends to be altricial young. Taken together, these observations in amniotes, which are not considered as undergoing metamorphosis during their development, are consistent with the idea of a late developmental step controlled by TH and allowing the accession to the adult ecological niche. Thus, according to this view, at the molecular level all vertebrates undergo a period of remodeling controlled by TH that is reminiscent of metamorphosis. PMID:23347527

  12. Resistance to thyroid hormone due to defective thyroid receptor alpha

    PubMed Central

    Moran, Carla; Chatterjee, Krishna

    2015-01-01

    Thyroid hormones act via nuclear receptors (TRα1, TRβ1, TRβ2) with differing tissue distribution; the role of α2 protein, derived from the same gene locus as TRα1, is unclear. Resistance to thyroid hormone alpha (RTHα) is characterised by tissue-specific hypothyroidism associated with near-normal thyroid function tests. Clinical features include dysmorphic facies, skeletal dysplasia (macrocephaly, epiphyseal dysgenesis), growth retardation, constipation, dyspraxia and intellectual deficit. Biochemical abnormalities include low/low-normal T4 and high/high-normal T3 concentrations, a subnormal T4/T3 ratio, variably reduced reverse T3, raised muscle creatine kinase and mild anaemia. The disorder is mediated by heterozygous, loss-of-function, mutations involving either TRα1 alone or both TRα1 and α2, with no discernible phenotype attributable to defective α2. Whole exome sequencing and diagnostic biomarkers may enable greater ascertainment of RTHα, which is important as thyroxine therapy reverses some metabolic abnormalities and improves growth, constipation, dyspraxia and wellbeing. The genetic and phenotypic heterogeneity of RTHα and its optimal management remain to be elucidated. PMID:26303090

  13. Resistance to thyroid hormone due to defective thyroid receptor alpha.

    PubMed

    Moran, Carla; Chatterjee, Krishna

    2015-08-01

    Thyroid hormones act via nuclear receptors (TRα1, TRβ1, TRβ2) with differing tissue distribution; the role of α2 protein, derived from the same gene locus as TRα1, is unclear. Resistance to thyroid hormone alpha (RTHα) is characterised by tissue-specific hypothyroidism associated with near-normal thyroid function tests. Clinical features include dysmorphic facies, skeletal dysplasia (macrocephaly, epiphyseal dysgenesis), growth retardation, constipation, dyspraxia and intellectual deficit. Biochemical abnormalities include low/low-normal T4 and high/high-normal T3 concentrations, a subnormal T4/T3 ratio, variably reduced reverse T3, raised muscle creatine kinase and mild anaemia. The disorder is mediated by heterozygous, loss-of-function, mutations involving either TRα1 alone or both TRα1 and α2, with no discernible phenotype attributable to defective α2. Whole exome sequencing and diagnostic biomarkers may enable greater ascertainment of RTHα, which is important as thyroxine therapy reverses some metabolic abnormalities and improves growth, constipation, dyspraxia and wellbeing. The genetic and phenotypic heterogeneity of RTHα and its optimal management remain to be elucidated. PMID:26303090

  14. Thyroid Hormone Response Element Half-Site Organization and Its Effect on Thyroid Hormone Mediated Transcription

    PubMed Central

    Paquette, Martin A.; Atlas, Ella; Wade, Mike G.; Yauk, Carole L.

    2014-01-01

    Thyroid hormone (TH) exerts its effects by binding to the thyroid hormone receptor (TR), which binds to TH response elements (TREs) to regulate target gene expression. We investigated the relative ability of liganded homodimers TR and retinoid X receptor (RXR), and the heterodimer TR/RXR, to regulate gene expression for the TRE half-site organizations: direct repeat 4 (DR4), inverted repeat 0 (IR0) and everted repeat 6 (ER6). Luciferase reporter assays using a DR4 TRE suggest that both the TR homodimer and TR/RXR heterodimer regulate luciferase expression in the presence of their respective ligands. However, in the presence of the IR0 TRE, transfection with TR/RXR and RXR alone increased luciferase activity and there was no effect of TR alone. The presence of 9-cis-retinoic acid was necessary for luciferase expression, whereas TH treatment alone was insufficient. For the ER6 TRE, transfection with TR/RXR, TR alone and RXR alone (in the presence of their respective ligands) all caused a significant increase in luciferase activity. When both ligands were present, transfection with both TR/RXR caused more activation. Finally, we investigated the efficacy of the TR-antagonist 1–850 in inhibiting transcription by TR or TR/RXR at DR4 and ER6 TREs. We found that 1–850 did not suppress luciferase activation in the presence of TR/RXR for the ER6 TRE, suggesting conformational changes of the ligand binding domain of the TR when bound to different TRE half-site organizations. Collectively, the findings indicate that there are fundamental differences between TRE configurations that affect nuclear receptor interactions with the response element and ability to bind ligands and antagonists. PMID:24971931

  15. Clinical implications of thyroid hormones effects on nervous system development.

    PubMed

    Carreón-Rodríguez, Alfonso; Pérez-Martínez, Leonor

    2012-03-01

    Thyroid hormones have an important role throughout prenatal and postnatal nervous system development. They are involved in several processes such as neurogenesis, gliogenesis, myelination, synaptogenesis, etc., as shown in many cases of deficiency like congenital hypothyroidism or hypothyroxinemia. Those pathologies if untreated could lead to severe damages in cognitive, motor, neudoendocrine functions among other effects. Some could be reversed after adequate supplementation of thyroid hormones at birth, however there are other cellular processes highly sensitive to low levels of thyroid hormones and lasting a limited period of time during which if thyroid hormone action is lacking or deficient, the functional and structural damages would produce permanent defects. PMID:22523832

  16. Hypothalamic thyroid hormone feedback in health and disease.

    PubMed

    Fliers, Eric; Alkemade, Anneke; Wiersinga, Wilmar M; Swaab, Dick F

    2006-01-01

    The role of the human hypothalamus in the neuroendocrine response to illness has only recently begun to be explored. Extensive changes in the hypothalamus-pituitary-thyroid (HPT) axis occur within the framework of critical illness. The best-documented change in the HPT axis is a decrease in serum concentrations of the biologically active thyroid hormone triiodothyronine (T3). From studies in post-mortem human hypothalamus it appeared that low serum T3 and thyrotropin (TSH) during illness (nonthyroidal illness, NTI) are paralleled by decreased thyrotropin-releasing hormone (TRH)mRNA expression in the hypothalamic paraventricular nucleus (PVN), pointing to a major alteration in HPT axis setpoint regulation. A strong decrease in TRHmRNA expression is also present in the PVN of patients with major depression as well as in glucocorticoid-treated patients. By inference, hypercortisolism in hospitalized patients with severe depression or in critical illness may induce down-regulation of the HPT axis at the level of the hypothalamus. In order to start defining the determinants and mechanisms of these setpoint changes in various clinical conditions, it is important to note that an increasing number of hypothalamic proteins appears to be involved in central thyroid hormone metabolism. In recent studies, we have investigated the distribution and expression of thyroid hormone receptor (TR) isoforms, type 2 and type 3 deiodinase (D2 and D3), and the thyroid hormone transporter monocarboxylate transporter 8 (MCT8) in the human hypothalamus by a combination of immunocytochemistry, mRNA in situ hybridization and enzyme activity assays. Both D2 and D3 enzyme activities are detectable in the mediobasal hypothalamus. D2 immunoreactivity is prominent in glial cells of the infundibular nucleus/median eminence region and in tanycytes lining the third ventricle. Combined D2, D3, MCT8 or TR immunocytochemistry and TRHmRNA in situ hybridization indicates that D3, MCT8 and TRs are all

  17. Thyroid Hormones, Oxidative Stress, and Inflammation.

    PubMed

    Mancini, Antonio; Di Segni, Chantal; Raimondo, Sebastiano; Olivieri, Giulio; Silvestrini, Andrea; Meucci, Elisabetta; Currò, Diego

    2016-01-01

    Inflammation and oxidative stress (OS) are closely related processes, as well exemplified in obesity and cardiovascular diseases. OS is also related to hormonal derangement in a reciprocal way. Among the various hormonal influences that operate on the antioxidant balance, thyroid hormones play particularly important roles, since both hyperthyroidism and hypothyroidism have been shown to be associated with OS in animals and humans. In this context, the nonthyroidal illness syndrome (NTIS) that typically manifests as reduced conversion of thyroxine (T4) to triiodothyronine (T3) in different acute and chronic systemic conditions is still a debated topic. The pathophysiological mechanisms of this syndrome are reviewed, together with the roles of deiodinases, the enzymes responsible for the conversion of T4 to T3, in both physiological and pathological situations. The presence of OS indexes in NTIS supports the hypothesis that it represents a condition of hypothyroidism at the tissue level and not only an adaptive mechanism to diseases. PMID:27051079

  18. Thyroid Hormones, Oxidative Stress, and Inflammation

    PubMed Central

    Raimondo, Sebastiano; Olivieri, Giulio; Meucci, Elisabetta; Currò, Diego

    2016-01-01

    Inflammation and oxidative stress (OS) are closely related processes, as well exemplified in obesity and cardiovascular diseases. OS is also related to hormonal derangement in a reciprocal way. Among the various hormonal influences that operate on the antioxidant balance, thyroid hormones play particularly important roles, since both hyperthyroidism and hypothyroidism have been shown to be associated with OS in animals and humans. In this context, the nonthyroidal illness syndrome (NTIS) that typically manifests as reduced conversion of thyroxine (T4) to triiodothyronine (T3) in different acute and chronic systemic conditions is still a debated topic. The pathophysiological mechanisms of this syndrome are reviewed, together with the roles of deiodinases, the enzymes responsible for the conversion of T4 to T3, in both physiological and pathological situations. The presence of OS indexes in NTIS supports the hypothesis that it represents a condition of hypothyroidism at the tissue level and not only an adaptive mechanism to diseases. PMID:27051079

  19. Iodotyrosine deiodinase, a novel target of environmental halogenated chemicals for disruption of the thyroid hormone system in mammals.

    PubMed

    Shimizu, Ryo

    2014-01-01

    Many synthetic chemicals have been identified as environmental contaminants with activity to disrupt normal function of the thyroid hormone system. Thyroid hormones play important roles in growth, development, differentiation, and basal metabolic homeostasis, as well as in brain development in human fetus and children, and thyroid dysfunction can have very serious consequences, including mental retardation. Environmental chemicals may affect thyroid hormone action in multiple ways, including reduced thyroid hormone synthesis owing to direct toxicity at the thyroid gland, interaction with thyroid hormone receptors and transporters such as transthyretin, and disturbance of thyroid hormone metabolism (e.g., glucuronidation, sulfation and deiodination). In addition, iodotyrosine deiodinase, which is involved in iodide salvage by catalyzing deiodination of iodinated by-products of thyroid hormone production, was recently identified as a possible new target for disruption of thyroid hormone homeostasis by environmental halogenated chemicals. This topic, after briefly summarizing findings on the thyroid hormone-disrupting action of environmental chemicals in mammals, focuses on the effects of environmental halogenated chemicals on iodotyrosine deiodinase activity. PMID:25177024

  20. Chronic exposure to pentachlorophenol alters thyroid hormones and thyroid hormone pathway mRNAs in zebrafish.

    PubMed

    Yu, Li-Qin; Zhao, Gao-Feng; Feng, Min; Wen, Wu; Li, Kun; Zhang, Pan-Wei; Peng, Xi; Huo, Wei-Jie; Zhou, Huai-Dong

    2014-01-01

    Pentachlorophenol (PCP) is frequently detected in the aquatic environment and has been implicated as an endocrine disruptor in fish. In the present study, 4-month-old zebrafish (Danio rerio) were exposed to 1 of 4 concentrations of PCP (0.1, 1, 9, and 27 µg/L) for 70 d. The effects of PCP exposure on plasma thyroid hormone levels, and the expression levels of selected genes, were measured in the brain and liver. The PCP exposure at 27 µg/L resulted in elevated plasma thyroxine concentrations in male and female zebrafish and depressed 3, 5, 3'-triiodothyronine concentrations in males only. In both sexes, PCP exposure resulted in decreased messenger RNA (mRNA) expression levels of thyroid-stimulating hormone β-subunit (tshβ) and thyroid hormone receptor β (trβ) in the brain, as well as increased liver levels of uridine diphosphoglucuronosyl transferase (ugt1ab) and decreased deiodinase 1 (dio1). The authors also identified several sex-specific effects of PCP exposure, including changes in mRNA levels for deiodinase 2 (dio2), cytosolic sulfotransferase (sult1 st5), and transthyretin (ttr) genes in the liver. Environmental PCP exposure also caused an increased malformation rate in offspring that received maternal exposure to PCP. The present study demonstrates that chronic exposure to environmental levels of PCP alters plasma thyroid hormone levels, as well as the expression of genes associated with thyroid hormone signaling and metabolism in the hypothalamic-pituitary-thyroid (HPT) axis and liver, resulting in abnormal zebrafish development. PMID:24123209

  1. Prevalent Polymorphism in Thyroid Hormone-Activating Enzyme Leaves a Genetic Fingerprint That Underlies Associated Clinical Syndromes

    PubMed Central

    McAninch, Elizabeth A.; Jo, Sungro; Preite, Nailliw Z.; Farkas, Erzsébet; Mohácsik, Petra; Fekete, Csaba; Egri, Péter; Gereben, Balázs; Li, Yan; Deng, Youping; Patti, Mary-Elizabeth; Zevenbergen, Chantal; Peeters, Robin P.; Mash, Deborah C.

    2015-01-01

    Context: A common polymorphism in the gene encoding the activating deiodinase (Thr92Ala-D2) is known to be associated with quality of life in millions of patients with hypothyroidism and with several organ-specific conditions. This polymorphism results in a single amino acid change within the D2 molecule where its susceptibility to ubiquitination and proteasomal degradation is regulated. Objective: To define the molecular mechanisms underlying associated conditions in carriers of the Thr92Ala-D2 polymorphism. Design, Setting, Patients: Microarray analyses of 19 postmortem human cerebral cortex samples were performed to establish a foundation for molecular studies via a cell model of HEK-293 cells stably expressing Thr92 or Ala92 D2. Results: The cerebral cortex of Thr92Ala-D2 carriers exhibits a transcriptional fingerprint that includes sets of genes involved in CNS diseases, ubiquitin, mitochondrial dysfunction (chromosomal genes encoding mitochondrial proteins), inflammation, apoptosis, DNA repair, and growth factor signaling. Similar findings were made in Ala92-D2-expressing HEK-293 cells and in both cases there was no evidence that thyroid hormone signaling was affected ie, the expression level of T3-responsive genes was unchanged, but that several other genes were differentially regulated. The combined microarray analyses (brain/cells) led to the development of an 81-gene classifier that correctly predicts the genotype of homozygous brain samples. In contrast to Thr92-D2, Ala92-D2 exhibits longer half-life and was consistently found in the Golgi. A number of Golgi-related genes were down-regulated in Ala92-D2-expressing cells, but were normalized after 24-h-treatment with the antioxidant N-acetylecysteine. Conclusions: Ala92-D2 accumulates in the Golgi, where its presence and/or ensuing oxidative stress disrupts basic cellular functions and increases pre-apoptosis. These findings are reminiscent to disease mechanisms observed in other neurodegenerative

  2. Thyroid Hormones and the Metabolic Syndrome

    PubMed Central

    Iwen, K. Alexander; Schröder, Erich; Brabant, Georg

    2013-01-01

    Background Clustering of various metabolic parameters including abdominal obesity, hyperglycaemia, low high-density lipoprotein cholesterol, elevated triglycerides and hypertension have been used worldwide as metabolic syndrome to predict cardiometabolic risk. Thyroid dysfunction impacts on various levels of these components. Objectives The purpose of the present review is to summarize available data on thyroid hormone-dependent action on components of the metabolic syndrome. Methods A PubMed search for any combination of hyperthyroidism, thyrotoxicosis or hypothyroidism and metabolic syndrome, blood pressure, hypertension, hyperlipidaemia, cholesterol, high-density lipoprotein cholesterol, glucose, diabetes mellitus, body weight or visceral fat was performed. We included papers and reviews published between 2000 and today but accepted also frequently cited papers before 2000. Results There is convincing evidence for a major impact of thyroid function on all components of the metabolic syndrome, reflecting profound alterations of energy homeostasis at many levels. Conclusion Even though the interactions shown in animal models and man are complex, it is evident that insulin sensitivity is highest and adverse thyroid effects on the metabolic system are lowest in euthyroid conditions. PMID:24783045

  3. Bone loss in thyroid disease: role of low TSH and high thyroid hormone.

    PubMed

    Abe, Etsuko; Sun, Li; Mechanick, Jeffrey; Iqbal, Jameel; Yamoah, Kosj; Baliram, Ramkumarie; Arabi, Ario; Moonga, Baljit S; Davies, Terry F; Zaidi, Mone

    2007-11-01

    More than 10% of postmenopausal women in the United States receive thyroid hormone replacement therapy and up to 20% of these women are over-replaced inducing subclinical hyperthyroidism. Because hyperthyroidism and post menopausal osteoporosis overlap in women of advancing age, it is urgent to understand the effect of thyroid hormone excess on bone. We can now provide results that not thyroid hormones but also TSH itself has an equally important role to play in bone remodeling. PMID:18083940

  4. TSH (Thyroid-Stimulating Hormone) Test

    MedlinePlus

    ... symptoms of a thyroid disorder , including hyperthyroidism or hypothyroidism . TSH is produced by the pituitary gland , a ... thyroid Monitor thyroid replacement therapy in people with hypothyroidism Monitor anti-thyroid treatment in people with hyperthyroidism ...

  5. American Thyroid Association Guide to Investigating Thyroid Hormone Economy and Action in Rodent and Cell Models

    PubMed Central

    Anderson, Grant; Forrest, Douglas; Galton, Valerie Anne; Gereben, Balázs; Kim, Brian W.; Kopp, Peter A.; Liao, Xiao Hui; Obregon, Maria Jesus; Peeters, Robin P.; Refetoff, Samuel; Sharlin, David S.; Simonides, Warner S.; Weiss, Roy E.; Williams, Graham R.

    2014-01-01

    Background: An in-depth understanding of the fundamental principles that regulate thyroid hormone homeostasis is critical for the development of new diagnostic and treatment approaches for patients with thyroid disease. Summary: Important clinical practices in use today for the treatment of patients with hypothyroidism, hyperthyroidism, or thyroid cancer are the result of laboratory discoveries made by scientists investigating the most basic aspects of thyroid structure and molecular biology. In this document, a panel of experts commissioned by the American Thyroid Association makes a series of recommendations related to the study of thyroid hormone economy and action. These recommendations are intended to promote standardization of study design, which should in turn increase the comparability and reproducibility of experimental findings. Conclusions: It is expected that adherence to these recommendations by investigators in the field will facilitate progress towards a better understanding of the thyroid gland and thyroid hormone dependent processes. PMID:24001133

  6. Thyroid hormone accelerates the differentiation of adult hippocampal progenitors.

    PubMed

    Kapoor, R; Desouza, L A; Nanavaty, I N; Kernie, S G; Vaidya, V A

    2012-09-01

    Disrupted thyroid hormone function evokes severe physiological consequences in the immature brain. In adulthood, although clinical reports document an effect of thyroid hormone status on mood and cognition, the molecular and cellular changes underlying these behavioural effects are poorly understood. More recently, the subtle effects of thyroid hormone on structural plasticity in the mature brain, in particular on adult hippocampal neurogenesis, have come to be appreciated. However, the specific stages of adult hippocampal progenitor development that are sensitive to thyroid hormone are not defined. Using nestin-green fluorescent protein reporter mice, we demonstrate that thyroid hormone mediates its effects on hippocampal neurogenesis by influencing Type 2b and Type 3 progenitors, although it does not alter proliferation of either the Type 1 quiescent progenitor or the Type 2a amplifying neural progenitor. Thyroid hormone increases the number of doublecortin (DCX)-positive Type 3 progenitors, and accelerates neuronal differentiation into both DCX-positive immature neurones and neuronal nuclei-positive granule cell neurones. Furthermore, we show that this increase in neuronal differentiation is accompanied by a significant induction of specific transcription factors involved in hippocampal progenitor differentiation. In vitro studies using the neurosphere assay support a direct effect of thyroid hormone on progenitor development because neurospheres treated with thyroid hormone are shifted to a more differentiated state. Taken together, our results indicate that thyroid hormone mediates its neurogenic effects via targeting Type 2b and Type 3 hippocampal progenitors, and suggests a role for proneural transcription factors in contributing to the effects of thyroid hormone on neuronal differentiation of adult hippocampal progenitors. PMID:22497336

  7. The Role of Thyroid Hormone in Testicular Development and Function

    PubMed Central

    Wagner, Márcia Santos; Wajner, Simone Magagnin; Maia, Ana Luiza

    2009-01-01

    Thyroid hormone is a critical regulator of growth, development and metabolism in virtually all tissues, and altered thyroid status affects many organs and systems. Although for many years testis has been regarded as a thyroid hormone unresponsive organ, it is now evident that thyroid hormone plays an important role in testicular development and function. A considerable amount of data shows that thyroid hormone influences steroidogenesis as well as spermatogenesis. The involvement of triiodothyronine (T3) in the control of Sertoli cell proliferation and functional maturation is widely accepted, as well as its role in postnatal Leydig cell differentiation and steroidogenesis. The presence of thyroid hormone receptors in testicular cells throughout development and in adulthood implies that T3 may act directly on these cells to bring about its effects. Several recent studies have employed different methodologies and techniques in an attempt to understand the mechanisms underlying thyroid hormone effects on testicular cells. The current review aims at presenting an updated picture of the recent advances made regarding the role of thyroid hormones in male gonadal function. PMID:18728126

  8. Effects of substitution and high-dose thyroid hormone therapy on deiodination, sulfoconjugation, and tissue thyroid hormone levels in prolonged critically ill rabbits.

    PubMed

    Debaveye, Yves; Ellger, Björn; Mebis, Liese; Visser, Theo J; Darras, Veerle M; Van den Berghe, Greet

    2008-08-01

    To delineate the metabolic fate of thyroid hormone in prolonged critically ill rabbits, we investigated the impact of two dose regimes of thyroid hormone on plasma 3,3'-diiodothyronine (T(2)) and T(4)S, deiodinase type 1 (D1) and D3 activity, and tissue iodothyronine levels in liver and kidney, as compared with saline and TRH. D2-expressing tissues were ignored. The regimens comprised either substitution dose or a 3- to 5- fold higher dose of T(4) and T(3), either alone or combined, targeted to achieve plasma thyroid hormone levels obtained by TRH. Compared with healthy animals, saline-treated ill rabbits revealed lower plasma T(3) (P=0.006), hepatic T(3) (P=0.02), and hepatic D1 activity (P=0.01). Substitution-dosed thyroid hormone therapy did not affect these changes except a further decline in plasma (P=0.0006) and tissue T(4) (P=0.04). High-dosed thyroid hormone therapy elevated plasma and tissue iodothyronine levels and hepatic D1 activity, as did TRH. Changes in iodothyronine tissue levels mimicked changes in plasma. Tissue T(3) and tissue T(3)/reverse T(3) ratio correlated with deiodinase activities. Neither substitution- nor high-dose treatment altered plasma T(2). Plasma T(4)S was increased only by T(4) in high dose. We conclude that in prolonged critically ill rabbits, low plasma T(3) levels were associated with low liver and kidney T(3) levels. Restoration of plasma and liver and kidney tissue iodothyronine levels was not achieved by thyroid hormone in substitution dose but instead required severalfold this dose. This indicates thyroid hormone hypermetabolism, which in this model of critical illness is not entirely explained by deiodination or by sulfoconjugation. PMID:18450965

  9. Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

    PubMed Central

    Muscat, G E; Mynett-Johnson, L; Dowhan, D; Downes, M; Griggs, R

    1994-01-01

    Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the

  10. Low selenium status in the elderly influences thyroid hormones.

    PubMed

    Olivieri, O; Girelli, D; Azzini, M; Stanzial, A M; Russo, C; Ferroni, M; Corrocher, R

    1995-12-01

    1. Iodothyronine 5'-deiodinase, which is mainly responsible for peripheral triiodothyronine (T3) production, has recently been demonstrated to be a selenium-containing enzyme. In the elderly, reduced peripheral conversion of thyroxine (T4) to T3 and overt hypothyroidism are frequently observed. 2. We measured serum selenium and erythrocyte glutathione peroxidase (as indices of selenium status), thyroid hormones and thyroid-stimulating hormone in 109 healthy euthyroid subjects (52 women, 57 men), carefully selected to exclude abnormally low thyroid hormone levels induced by acute or chronic diseases or calorie restriction. The subjects were subdivided into three age groups. To avoid conditions of under-nutrition or malnutrition, dietary records were obtained for a sample of 24 subjects, randomly selected and representative of the whole population for age and sex. 3. In order to properly assess the influence of selenium status on iodothyronine 5'-deiodinase type I activity, a double-blind placebo-controlled trial was also carried out on 36 elderly subjects, resident at a privately owned nursing home. 4. In the free-living population, a progressive reduction of the T3/T4 ratio (due to increased T4 levels) and of selenium and erythrocyte glutathione peroxidase activity was observed with advancing age. A highly significant linear correlation between T4, T3/T4 and selenium was observed in the population as a whole (for T4, R = -0.312, P < 0.002; for T3/T4 ratio, R = 0.32, P < 0.01) and in older subjects (for T4, R = -0.40, P < 0.05; for T3/T4 ratio, R = 0.54, P < 0.002). 5. The main result of the double-blind placebo-controlled trial was a significant improvement of selenium indices and a decrease in the T4 level in selenium-treated subjects; serum selenium, erythrocyte glutathione peroxidase activity and thyroid hormones did not change in placebo-treated subjects. 6. We concluded that selenium status influences thyroid hormones in the elderly, mainly modulating T4

  11. Evidence for impaired retinoic acid receptor-thyroid hormone receptor AF-2 cofactor activity in human lung cancer.

    PubMed Central

    Moghal, N; Neel, B G

    1995-01-01

    Retinoic acid (RA) is required for normal airway epithelial cell growth and differentiation both in vivo and in vitro. One of the earliest events following the exposure of bronchial epithelial cells to RA is the strong induction of RA receptor beta (RAR beta) mRNA. Previous work established that many lung cancer cell lines and primary tumors display abnormal RAR beta mRNA expression, most often absence or weak expression of the RAR beta 2 isoform, even after RA treatment. Restoration of RAR beta 2 into RAR beta-negative lung cancer cell lines has been reported to inhibit tumorigenicity. Since RAR beta 2 inactivation may contribute to lung cancer, we have investigated the molecular mechanism of defective RAR beta 2 expression. Nuclear run-on assays and transient transfections with RAR beta 2 promoter constructs indicate the presence of trans-acting transcriptional defects in most lung cancer cell lines, which map to the RA response element (RARE). These defects cannot be complemented by RAR-retinoid X receptor cotransfection and can be separated into two types: (i) one affecting transcription from direct repeat RAREs, but not palindromic RAREs, and (ii) another affecting transcription from both types of RARE. Studies using chimeras between RAR alpha, TR alpha, and other transcription factors suggest the existence of novel RAR-thyroid hormone receptor AF-2-specific cofactors, which are necessary for high levels of transcription. Furthermore, these factors may be frequently inactivated in human lung cancer. PMID:7791800

  12. Cholinergic and VIPergic effects on thyroid hormone secretion in the mouse

    SciTech Connect

    Ahren, B.

    1985-07-01

    The thyroid gland is known to harbor cholinergic and VIPergic nerves. In the present study, the influences of cholinergic stimulation by carbachol, cholinergic blockade by methylatropine and stimulation with various VIP sequences on basal, TSH-induced and VIP-induced thyroid hormone secretion were investigated in vivo in mice. The mice were pretreated with /sup 125/I and thyroxine; the subsequent release of /sup 125/I is an estimation of thyroid hormone secretion. It was found that basal radioiodine secretion was inhibited by both carbachol and methylatropine. Furthermore, TSH-induced radioiodine secretion was inhibited already by a low dose of carbachol. Moreover, a high dose of carbachol could inhibit VIP-induced radioiodine secretion. Methylatropine did not influence TSH- or VIP-stimulated radioiodine secretion, but counteracted the inhibitory action of carbachol on TSH- and VIP-induced radioiodine release. In addition, contrary to VIP, six various synthesized VIP fragments had no effect on basal or stimulated radioiodine release. It is concluded that basal thyroid hormone secretion is inhibited by both cholinergic activation and blockade. Furthermore, TSH-induced thyroid hormone secretion is more sensitive to inhibition with cholinergic stimulation than is VIP-induced thyroid hormone secretion. In addition, the VIP stimulation of thyroid hormone secretion seems to require the full VIP sequence.

  13. Neurodevelopmental Consequences of Low-Level Thyroid Hormone Disruption Induced by Environmental Contaminants

    EPA Science Inventory

    Inadequate levels of thyroid hormone during critical developmental periods lead to stunted growth, mental retardation, and neurological 'cretinism'. Animal models of developmental thyroid hormone deficiency mirror well the impact of severe insults to the thyroid system. However, ...

  14. Promotion of the induction of cell pluripotency through metabolic remodeling by thyroid hormone triiodothyronine-activated PI3K/AKT signal pathway

    PubMed Central

    Chen, Mengfei; Zhang, He; Wu, Jie; Xu, Liang; Xu, Di; Sun, Jinglan; He, Yixin; Zhou, Xin; Wang, Zhaojing; Wu, Lifang; Xu, Shaokun; Wang, Jinsong; Jiang, Shu; Zhou, Xiangjun; Hoffman, Andrew R.; Hu, Xiang; Hu, Jifan; Li, Tao

    2012-01-01

    Generation of induced pluripotent stem cells (iPSCs) from somatic cells by defined factors is a mechanism-unknown, yet extremely time-consuming process. Inefficient reprogramming leads to prolonged periods of in vitro iPSC selection, resulting in subtle genetic and epigenetic abnormalities. To facilitate pluripotent reprogramming, we have identified the thyroid hormone triiodothyronine (T3) as an endogenous factor that can enhance reprogramming of human dermal fibroblasts (HDF) and umbilical cord mesenchymal stem cells (UCMSC). This potentiation of iPSC induction is associated with metabolic remodeling activity, including up-regulation of key glycolytic genes, an increase in cell proliferation, and the induction of mesenchymal-epithelial transition (MET). We further identify the activation of the PI3K/AKT signal pathway by T3 as an underlying mechanism for the enhanced conversion to cell pluripotency in this model. These studies demonstrate that T3 enhances metabolic remodeling of donor cells in potentiating cell reprogramming. PMID:22575839

  15. New Approaches to Thyroid Hormones and Purinergic Signaling

    PubMed Central

    Silveira, Gabriel Fernandes; Buffon, Andréia; Bruno, Alessandra Nejar

    2013-01-01

    It is known that thyroid hormones influence a wide variety of events at the molecular, cellular, and functional levels. Thyroid hormones (TH) play pivotal roles in growth, cell proliferation, differentiation, apoptosis, development, and metabolic homeostasis via thyroid hormone receptors (TRs) by controlling the expression of TR target genes. Most of these effects result in pathological and physiological events and are already well described in the literature. Even so, many recent studies have been devoted to bringing new information on problems in controlling the synthesis and release of these hormones and to elucidating mechanisms of the action of these hormones unconventionally. The purinergic system was recently linked to thyroid diseases, including enzymes, receptors, and enzyme products related to neurotransmitter release, nociception, behavior, and other vascular systems. Thus, throughout this text we intend to relate the relationship between the TH in physiological and pathological situations with the purinergic signaling. PMID:23956925

  16. New approaches to thyroid hormones and purinergic signaling.

    PubMed

    Silveira, Gabriel Fernandes; Buffon, Andréia; Bruno, Alessandra Nejar

    2013-01-01

    It is known that thyroid hormones influence a wide variety of events at the molecular, cellular, and functional levels. Thyroid hormones (TH) play pivotal roles in growth, cell proliferation, differentiation, apoptosis, development, and metabolic homeostasis via thyroid hormone receptors (TRs) by controlling the expression of TR target genes. Most of these effects result in pathological and physiological events and are already well described in the literature. Even so, many recent studies have been devoted to bringing new information on problems in controlling the synthesis and release of these hormones and to elucidating mechanisms of the action of these hormones unconventionally. The purinergic system was recently linked to thyroid diseases, including enzymes, receptors, and enzyme products related to neurotransmitter release, nociception, behavior, and other vascular systems. Thus, throughout this text we intend to relate the relationship between the TH in physiological and pathological situations with the purinergic signaling. PMID:23956925

  17. Homozygosity for a dominant negative thyroid hormone receptor gene responsible for generalized resistance to thyroid hormone.

    PubMed

    Ono, S; Schwartz, I D; Mueller, O T; Root, A W; Usala, S J; Bercu, B B

    1991-11-01

    Generalized resistance to thyroid hormones (GRTH) commonly results from mutations in the T3-binding domain of the c-erbA beta thyroid hormone receptor gene. We have reported on a novel deletion mutation in c-erbA beta in a kindred, S, with GRTH. One patient from this kindred was the product of a consanguineous union from two affected members and was homozygous for the beta-receptor defect. This patient at 3.5 weeks of age had unprecedented elevations of TSH, free T4, and free T3 (TSH, 389 mU/L; free T4, 330.8 pmol/L; free T3, 82,719 fmol/L). He displayed a complex mixture of tissue-specific hyperthyroidism and hypothyroidism. He had delayed growth (height age, 1 3/12 yr at chronological age 2 9/12 yr) and skeletal maturation (bone age, 4 months), and developmental delay (developmental age, 8 months), but he was quite tachycardic. The homozygous patient of kindred S is markedly different from a recently reported patient with no c-erbA beta-receptor. This difference indicates that a dominant negative form of c-erbA beta in man can inhibit at least some thyroid hormone action mediated by the c-erbA alpha-receptors. PMID:1682340

  18. Tissue-specific response of the human platelet-activating factor receptor gene to retinoic acid and thyroid hormone by alternative promoter usage.

    PubMed Central

    Mutoh, H; Fukuda, T; Kitamaoto, T; Masushige, S; Sasaki, H; Shimizu, T; Kato, S

    1996-01-01

    We have studied the effects of retinoic acid (RA) and thyroid hormone (3,3',5-triiodothyronine; T3) on platelet-activating factor receptor (PAFR) gene expression in intact rats and the ability of two human PAFR gene promoters (PAFR promoters 1 and 2) to generate two transcripts (PAFR transcripts 1 and 2). Northern blotting showed that RA and T3 regulated PAFR gene expression only in rat tissues that express PAFR transcript 2. Functional analysis of the human PAFR promoter 2 revealed that responsiveness to RA and T3 was conferred through a 24-bp element [PAFR-hormone response element (HRE) located from -67 to -44 bp of the transcription start site, whereas PAFR promoter 1 did not respond to these hormones. The PAFR-HRE is composed of three direct repeated TGACCT-like hexamer motifs with 2-and 4-bp spaces, and the two upstream and two downstream motifs were identified as response elements for RA and T3. Thus, the PAF-PAFR pathway is regulated by the PAFR level altered by a tissue-specific response to RA and T3 through the PAFR-HRE of the PAFR promoter 2. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 Fig. 6 PMID:8570633

  19. TRα receptor mutations extend the spectrum of syndromes of reduced sensitivity to thyroid hormone.

    PubMed

    Vlaeminck-Guillem, Virginie; Espiard, Stéphanie; Flamant, Frédéric; Wémeau, Jean-Louis

    2015-11-01

    Since 2012, eight different abnormalities have been described in the THRA gene (encoding the TRα1 thyroid hormone receptor) of 14 patients from 9 families. These mutations induce a clinical phenotype (resistance to thyroid hormone type α) associating symptoms of untreated mild congenital hypothyroidism and a near-normal range of free and total thyroid hormones and TSH (the T4/T3 ratio is nevertheless usually low). The phenotype can diversely include short stature (due to growth retardation), dysmorphic syndrome (face and limb extremities), psychoneuromotor disorders, constipation and bradycardia. The identified genetic abnormalities are located within the ligand-binding domain and result in defective T3 binding, an abnormally strong interaction with corepressors and a dominant negative activity against still functional receptors. The identification of patients with consistent phenotypes and the underlying mutations are warranted to better delineate the spectrum of the syndromes of reduced sensitivity to thyroid hormone. PMID:26585273

  20. Generalized resistance to thyroid hormone associated with a mutation in the ligand-binding domain of the human thyroid hormone receptor. beta

    SciTech Connect

    Sakurai, A.; Takeda, K.; Ain, K.; Ceccarelli, P.; Nakai, A.; Seino, S.; Bell, G.I.; Refetoff, S.; DeGroot, L.J. )

    1989-11-01

    The syndrome of generalized resistance to thyroid hormone is characterized by elevated circulating levels of thyroid hormone in the presence of an overall eumetabolic state and failure to respond normally to triiodothyronine. The authors have evaluated a family with inherited generalized resistance to thyroid hormone for abnormalities in the thyroid hormone nuclear receptors. A single guanine {yields} cytosine replacement in the codon for amino acid 340 resulted in a glycine {yields} arginine substitution in the hormone-binding domain of one of two alleles of the patient's thyroid hormone nuclear receptor {beta} gene. In vitro translation products of this mutant human thyroid hormone nuclear receptor {beta} gene did not bind triiodothyronine. Thus, generalized resistance to thyroid hormone can result from expression of an abnormal thyroid hormone nuclear receptor molecule.

  1. Thyroid Hormone Mediated Modulation of Energy Expenditure.

    PubMed

    Vaitkus, Janina A; Farrar, Jared S; Celi, Francesco S

    2015-01-01

    Thyroid hormone (TH) has diverse effects on mitochondria and energy expenditure (EE), generating great interest and research effort into understanding and harnessing these actions for the amelioration and treatment of metabolic disorders, such as obesity and diabetes. Direct effects on ATP utilization are a result of TH's actions on metabolic cycles and increased cell membrane ion permeability. However, the majority of TH induced EE is thought to be a result of indirect effects, which, in turn, increase capacity for EE. This review discusses the direct actions of TH on EE, and places special emphasis on the indirect actions of TH, which include mitochondrial biogenesis and reduced metabolic efficiency through mitochondrial uncoupling mechanisms. TH analogs and the metabolic actions of T2 are also discussed in the context of targeted modulation of EE. Finally, clinical correlates of TH actions on metabolism are briefly presented. PMID:26193258

  2. Thyroid Hormone Mediated Modulation of Energy Expenditure

    PubMed Central

    Vaitkus, Janina A.; Farrar, Jared S.; Celi, Francesco S.

    2015-01-01

    Thyroid hormone (TH) has diverse effects on mitochondria and energy expenditure (EE), generating great interest and research effort into understanding and harnessing these actions for the amelioration and treatment of metabolic disorders, such as obesity and diabetes. Direct effects on ATP utilization are a result of TH’s actions on metabolic cycles and increased cell membrane ion permeability. However, the majority of TH induced EE is thought to be a result of indirect effects, which, in turn, increase capacity for EE. This review discusses the direct actions of TH on EE, and places special emphasis on the indirect actions of TH, which include mitochondrial biogenesis and reduced metabolic efficiency through mitochondrial uncoupling mechanisms. TH analogs and the metabolic actions of T2 are also discussed in the context of targeted modulation of EE. Finally, clinical correlates of TH actions on metabolism are briefly presented. PMID:26193258

  3. Liganded Thyroid Hormone Receptor Inhibits Phorbol 12-O-Tetradecanoate-13-Acetate-Induced Enhancer Activity via Firefly Luciferase cDNA

    PubMed Central

    Misawa, Hiroko; Sasaki, Shigekazu; Matsushita, Akio; Ohba, Kenji; Iwaki, Hiroyuki; Matsunaga, Hideyuki; Suzuki, Shingo; Ishizuka, Keiko; Oki, Yutaka; Nakamura, Hirotoshi

    2012-01-01

    Thyroid hormone receptor (TR) belongs to the nuclear hormone receptor (NHR) superfamily and regulates the transcription of its target genes in a thyroid hormone (T3)-dependent manner. While the detail of transcriptional activation by T3 (positive regulation) has been clarified, the mechanism of T3-dependent repression (negative regulation) remains to be determined. In addition to naturally occurring negative regulations typically found for the thyrotropin β gene, T3-bound TR (T3/TR) is known to cause artificial negative regulation in reporter assays with cultured cells. For example, T3/TR inhibits the transcriptional activity of the reporter plasmids harboring AP-1 site derived from pUC/pBR322-related plasmid (pUC/AP-1). Artificial negative regulation has also been suggested in the reporter assay with firefly luciferase (FFL) gene. However, identification of the DNA sequence of the FFL gene using deletion analysis was not performed because negative regulation was evaluated by measuring the enzymatic activity of FFL protein. Thus, there remains the possibility that the inhibition by T3 is mediated via a DNA sequence other than FFL cDNA, for instance, pUC/AP-1 site in plasmid backbone. To investigate the function of FFL cDNA as a transcriptional regulatory sequence, we generated pBL-FFL-CAT5 by ligating FFL cDNA in the 5' upstream region to heterologous thymidine kinase promoter in pBL-CAT5, a chloramphenicol acetyl transferase (CAT)-based reporter gene, which lacks pUC/AP-1 site. In kidney-derived CV1 and choriocarcinoma-derived JEG3 cells, pBL-FFL-CAT5, but not pBL-CAT5, was strongly activated by a protein kinase C activator, phorbol 12-O-tetradecanoate-13-acetate (TPA). TPA-induced activity of pBL-FFL-CAT5 was negatively regulated by T3/TR. Mutation of nt. 626/640 in FFL cDNA attenuated the TPA-induced activation and concomitantly abolished the T3-dependent repression. Our data demonstrate that FFL cDNA sequence mediates the TPA-induced transcriptional activity

  4. Molecular characterization of human thyroid hormone receptor β isoform 4.

    PubMed

    Moriyama, Kenji; Yamamoto, Hiroyuki; Futawaka, Kumi; Atake, Asami; Kasahara, Masato; Tagami, Tetsuya

    2016-01-01

    Thyroid hormone exerts a pleiotropic effect on development, differentiation, and metabolism through thyroid hormone receptor (TR). A novel thyroid hormone receptor β isoform (TRβ4) was cloned using PCR from a human pituitary cDNA library as a template. We report here the characterization of TRβ4 from a molecular basis. Temporal expression of TRβ4 during the fetal period is abundant in the brain and kidney, comparable with the adult pattern. Western blot analysis revealed that TRs are ubiquitination labile proteins, while TRβ1 is potentially stable. TRβ1, peroxisome proliferator-activated receptors (PPAR), and vitamin D receptor (VDR), which belong to class II transcription factors that function via the formation of heterodimeric complexes with retinoid X receptor (RXR), were suppressed by TRβ4 in a dose-dependent manner. Thus, TRβ4 exhibits ligand-independent transcriptional silencing, possibly as a substitute for dimerized RXR. In this study, TRβ1 and TRβ4 transcripts were detected in several cell lines. Quantitative RT-PCR assay showed that the expression of TRβ4 in human embryonic carcinoma cells of the testis was suppressed by sex hormone in a reciprocal manner to TRβ1. In contrast, TRβ4 was expressed under a high dose of triiodothyronine (T3) in a reciprocal manner to TRβ1. Finally, in transiently transfected NIH-3T3 cells, green fluorescence protein (GFP)-tagged TRβ4 was mostly nuclear in both the absence and the presence of T3. By mutating defined regions of both TRβs, we found that both TRβ1 and TRβ4 had altered nuclear/cytoplasmic distribution as compared with wild-type, and different to T3 and the nuclear receptor corepressor (NCoR). Thus, site-specific DNA binding is not essential for maintaining TRβs within the nucleus. PMID:26513165

  5. The Relationships between Thyroid Hormones and Thyroid-stimulating Hormone with Lipid Profile in Euthyroid Men

    PubMed Central

    Chin, Kok-Yong; Ima-Nirwana, Soelaiman; Mohamed, Isa Naina; Aminuddin, Amilia; Johari, Mohamad Hanapi; Ngah, Wan Zurinah Wan

    2014-01-01

    Background and Aim: Alteration in lipid profile is a common observation in patients with thyroid dysfunction, but the current knowledge on the relationship between lipids and thyroid hormone levels in euthyroid state is insufficient. The current study aimed to determine the association between thyroid hormones and thyroid-stimulating hormone (TSH) with lipid profile in a euthyroid male population. Methods: A total of 708 Chinese and Malay men aged 20 years and above were recruited in this cross-sectional study. Their blood was collected for the determination of total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG), free thyroxine (FT4), free triiodothyronine (FT3) and TSH levels. The association was analyzed using multiple regression and logistic regression models with adjustment for age, ethnicity, body mass index and FT4/FT3/TSH levels. Results: In multiple regression models, TSH was positively and significantly associated with TG (p<0.05). Free T4 was positively and significantly associated with TC, LDL-C and HDL-C (p<0.05). Free T3 was negatively and significantly associated with HDL-C (p<0.05). In binary logistic models, an increase in TSH was significantly associated with higher prevalence of elevated TG in the subjects (p<0.05), while an increase in FT4 was significantly associated with higher prevalence of elevated TC but a lower prevalence of subnormal HDL in the subjects (p<0.05). Free T3 was not associated with any lipid variables in the logistic regression (p>0.05). Conclusions: In euthyroid Malaysian men, there are positive and significant relationships between TSH level and TG level, and between FT4 level and cholesterol levels. PMID:24578612

  6. Transport of Thyroid Hormone in Brain

    PubMed Central

    Wirth, Eva K.; Schweizer, Ulrich; Köhrle, Josef

    2014-01-01

    Thyroid hormone (TH) transport into the brain is not only pivotal for development and differentiation, but also for maintenance and regulation of adult central nervous system (CNS) function. In this review, we highlight some key factors and structures regulating TH uptake and distribution. Serum TH binding proteins play a major role for the availability of TH since only free hormone concentrations may dictate cellular uptake. One of these proteins, transthyretin is also present in the cerebrospinal fluid (CSF) after being secreted by the choroid plexus. Entry routes into the brain like the blood–brain-barrier (BBB) and the blood–CSF-barrier will be explicated regarding fetal and adult status. Recently identified TH transmembrane transporters (THTT) like monocarboxylate transporter 8 (Mct8) play a major role in uptake of TH across the BBB but as well in transport between cells like astrocytes and neurons within the brain. Species differences in transporter expression will be presented and interference of TH transport by endogenous and exogenous compounds including endocrine disruptors and drugs will be discussed. PMID:25009532

  7. Prenatal exposure to perfluorinated compounds affects thyroid hormone levels in newborn girls.

    PubMed

    Shah-Kulkarni, Surabhi; Kim, Byung-Mi; Hong, Yun-Chul; Kim, Hae Soon; Kwon, Eun Jin; Park, Hyesook; Kim, Young Ju; Ha, Eun-Hee

    2016-09-01

    Perfluorinated compounds (PFCs) are ubiquitous in the environment and have been detected in humans and wildlife. Exposure to PFCs has decreased in the United States recently, while exposure to PFCs continues in Asian countries, which represents a public health concern. Various mechanisms by which PFCs affect fetal growth have been proposed, such as activation of peroxisome proliferators, disruption of thyroid hormones and changes in lipid metabolism. However, the overall evidence for an association with thyroid hormones is not strong. Therefore, we examined the effect of various prenatal PFCs on cord blood thyroid hormones: triiodothyronine (T3), thyroxine (T4), thyroid stimulating hormone (TSH) levels, and explored the endocrine disrupting effect of these PFCs on thyroid hormone levels in children according to gender. Two hundred and seventy-nine study participants were selected from among the enrolled participants in the Ewha Birth & Growth Retrospective Cohort, a retrospective birth cohort study conducted at Ewha Womans University Hospital, Seoul, Korea between 2006 and 2010. A generalized linear model was constructed to explore the association of PFCs and thyroid hormones. Further, an analysis stratified by gender was conducted. Our study shows that cord blood perfluoro n-pentanoic acid (PFPeA) was positively associated with cord blood T4 (p=0.01) level. Gender-specific analysis showed that prenatal PFCs: PFPeA and Perfluorohexane sulfonic acid (PFHxS) exposure significantly increased T4 (p<0.01) and T3 (p=0.03), respectively, while perfluorononanoic acid (PFNA) decreased TSH (p=0.04) concentration in newborn girls. Thus, prenatal PFC exposure may disrupt thyroid hormone homeostasis. Thyroid hormones play a crucial role in fetal development and may have gender specific action. Hence, these results are of utmost importance in high-risk groups, such as pregnant women and children. PMID:27395336

  8. Developmental Thyroid Hormone Disruption: Prevalence, Environmental Contaminants and Neurodevelopmental Consequences

    EPA Science Inventory

    Thyroid hormones (TH) are critical for growth and development and particularly brain development. There are numerous environmental agents that lead to marginal reductions of circulating TH. Although it is clear that severe developmental hypothyroidism is profoundly detrimental to...

  9. Thyroid

    MedlinePlus

    Thyroid is used to treat the symptoms of hypothyroidism (a condition where the thyroid gland does not produce enough thyroid hormone). Symptoms of hypothyroidism include lack of energy, depression, constipation, weight gain, ...

  10. Thyroiditis

    MedlinePlus

    ... Hashimoto’s thyroiditis is the most common cause of hypothyroidism in the United States. Postpartum thyroiditis, which causes ... hormone levels in the blood) followed by temporary hypothyroidism, is a common cause of thyroid problems after ...

  11. Inhibition of the Thyroid Hormone Pathway in Xenopus by Mercaptobenzothiazole

    EPA Science Inventory

    Amphibian metamorphosis is a thyroid hormone-dependent process that provides a potential model system to assess chemicals for their ability to disrupt the hypothalamic-pituitary-thyroid (HPT) axis. Several studies have demonstrated the sensitivity of this system to a variety of ...

  12. Effects of acute microinjections of the thyroid hormone derivative 3-iodothyronamine to the preoptic region of adult male rats on sleep, thermoregulation and motor activity.

    PubMed

    James, Thomas D; Moffett, Steven X; Scanlan, Thomas S; Martin, Joseph V

    2013-06-01

    The decarboxylated thyroid hormone derivative 3-iodothyronamine (T1AM) has been reported as having behavioral and physiological consequences distinct from those of thyroid hormones. Here, we investigate the effects of T1AM on EEG-defined sleep after acute administration to the preoptic region of adult male rats. Our laboratory recently demonstrated a decrease in EEG-defined sleep after administration of 3,3',5-triiodo-l-thyronine (T3) to the same brain region. After injection of T1AM or vehicle solution, EEG, EMG, activity, and core body temperature were recorded for 24h. Sleep parameters were determined from EEG and EMG data. Earlier investigations found contrasting systemic effects of T3 and T1AM, such as decreased heart rate and body temperature after intraperitoneal T1AM injection. However, nREM sleep was decreased in the present study after injections of 1 or 3 μg T1AM, but not after 0.3 or 10 μg, closely mimicking the previously reported effects of T3 administration to the preoptic region. The biphasic dose-response observed after either T1AM or T3 administration seems to indicate shared mechanisms and/or functions of sleep regulation in the preoptic region. Consistent with systemic administration of T1AM, however, microinjection of T1AM decreased body temperature. The current study is the first to show modulation of sleep by T1AM, and suggests that T1AM and T3 have both shared and independent effects in the adult mammalian brain. PMID:23702093

  13. Hypertrophic response of the Association of Thyroid Hormone and Exercise in the Heart of Rats

    PubMed Central

    de Souza, Fernanda Rodrigues; Resende, Elmiro Santos; Lopes, Leandro; Gonçalves, Alexandre; Chagas, Rafaella; Fidale, Thiago; Rodrigues, Poliana

    2014-01-01

    Background Cardiac hypertrophy is a component of cardiac remodeling occurring in response to an increase of the activity or functional overload of the heart. Objective Assess hypertrophic response of the association of thyroid hormone and exercise in the rat heart. Methods We used 37 Wistar rats, male, adults were randomly divided into four groups: control, hormone (TH), exercise (E), thyroid hormone and exercise (H + E); the group received daily hormone levothyroxine sodium by gavage at a dose of 20 μg thyroid hormone/100g body weight, the exercise group took swimming five times a week, with additional weight corresponding to 20% of body weight for six weeks; in group H + E were applied simultaneously TH treatment groups and E. The statistics used was analysis of variance, where appropriate, by Tukey test and Pearson correlation test. Results The T4 was greater in groups TH and H + E. The total weight of the heart was greater in patients who received thyroid hormone and left ventricular weight was greater in the TH group. The transverse diameter of cardiomyocytes increased in groups TH, E and H + E. The percentage of collagen was greater in groups E and H + E Correlation analysis between variables showed distinct responses. Conclusion The association of thyroid hormone with high-intensity exercise produced cardiac hypertrophy, and generated a standard hypertrophy not directly correlated to the degree of fibrosis. PMID:24676374

  14. SIRT1 Regulates Thyroid-Stimulating Hormone Release by Enhancing PIP5Kγ Activity through Deacetylation of Specific Lysine Residues in Mammals

    PubMed Central

    Akieda-Asai, Sayaka; Zaima, Nobuhiro; Ikegami, Koji; Kahyo, Tomoaki; Yao, Ikuko; Hatanaka, Takahiro; Iemura, Shun-ichiro; Sugiyama, Rika; Yokozeki, Takeaki; Eishi, Yoshinobu; Koike, Morio; Ikeda, Kyoji; Chiba, Takuya; Yamaza, Haruyoshi; Shimokawa, Isao; Song, Si-Young; Matsuno, Akira; Mizutani, Akiko; Sawabe, Motoji; Chao, Moses V.; Tanaka, Masashi; Kanaho, Yasunori; Natsume, Tohru; Sugimura, Haruhiko; Date, Yukari; McBurney, Michael W.; Guarente, Leonard; Setou, Mitsutoshi

    2010-01-01

    Background SIRT1, a NAD-dependent deacetylase, has diverse roles in a variety of organs such as regulation of endocrine function and metabolism. However, it remains to be addressed how it regulates hormone release there. Methodology/Principal Findings Here, we report that SIRT1 is abundantly expressed in pituitary thyrotropes and regulates thyroid hormone secretion. Manipulation of SIRT1 level revealed that SIRT1 positively regulated the exocytosis of TSH-containing granules. Using LC/MS-based interactomics, phosphatidylinositol-4-phosphate 5-kinase (PIP5K)γ was identified as a SIRT1 binding partner and deacetylation substrate. SIRT1 deacetylated two specific lysine residues (K265/K268) in PIP5Kγ and enhanced PIP5Kγ enzyme activity. SIRT1-mediated TSH secretion was abolished by PIP5Kγ knockdown. SIRT1 knockdown decreased the levels of deacetylated PIP5Kγ, PI(4,5)P2, and reduced the secretion of TSH from pituitary cells. These results were also observed in SIRT1-knockout mice. Conclusions/Significance Our findings indicated that the control of TSH release by the SIRT1-PIP5Kγ pathway is important for regulating the metabolism of the whole body. PMID:20668706

  15. Prolonged weightlessness effect on postflight plasma thyroid hormones

    NASA Technical Reports Server (NTRS)

    Leach, C. S.; Johnson, P. C.; Driscoll, T. B.

    1977-01-01

    Blood drawn before and after spaceflight from the nine Skylab astronauts showed a statistically significant increase in mean plasma thyroxine (T-4) of 1.4 micro g/dl and in thyroid-stimulating hormone (TSH) of 4 microunits ml. Concurrent triiodothyronine (T-3) levels decreased 27 ng/dl indicating inhibited conversion of T-4 to T-3. The T-3 decrease is postulated to be a result of the increased cortisol levels noted during and following each mission. These results confirm the thyroidal changes noted after the shorter Apollo flights and show that thyroid hormone levels change during spaceflight.

  16. Thyroid-stimulating Hormone (TSH): Measurement of Intracellular, Secreted, and Circulating Hormone in Xenopus laevis and Xenopus tropicalis.

    EPA Science Inventory

    Thyroid Stimulating Hormone (TSH) is a hormone produced in the pituitary that stimulates the thyroid gland to grow and produce thyroid hormone (TH). The concentration of TH controls developmental changes that take place in a wide variety of organisms. Many use the metaphoric ch...

  17. Glucoregulatory function of thyroid hormones: role of pancreatic hormones

    SciTech Connect

    Mueller, M.J.B.; Burger, A.G.; Ferrannini, E.; Jequier, E.; Acheson, K.J.

    1989-01-01

    Glucose metabolism was investigated in humans before and 14 days after 300 micrograms L-thyroxine (T4)/day using a sequential clamp protocol during short-term somatostatin infusion (500 micrograms/h, 0-6 h) at euglycemia (0-2.5 h), at 165 mg/dl (2.5-6 h), and during insulin infusion (1.0 mU.kg-1.min-1, 4.5-6 h). T4 treatment increased plasma T4 (+96%) and 3,5,3'-triiodothyronine (T3, +50%), energy expenditure (+8%), glucose turnover (+32%), and glucose oxidation (Glucox +87%) but decreased thyroid-stimulating hormone (-96%) and nonoxidative glucose metabolism (Glucnonox, -30%) at unchanged lipid oxidation (Lipox). During somatostatin and euglycemia glucose production (Ra, -67%) and disposal (Rd, -28%) both decreased in euthyroid subjects but remained at -22% and -5%, respectively, after T4 treatment. Glucox (control, -20%; +T4, -25%) fell and Lipox increased (control, +42%; +T4, +45%) in both groups, whereas Glucnonox decreased before (-36%) but increased after T4 (+57%). During somatostatin infusion and hyperglycemia Rd (control, +144%; +T4, +84%) and Glucnonox (control, +326%; +T4, +233%) increased, whereas Glucox and Lipox remained unchanged. Insulin further increased Rd (+76%), Glucox (+155%), and Glucnonox (+50%) but decreased Ra (-43%) and Lipox (-43%). All these effects were enhanced by T4 (Rd, +38%; Glucox, +45%; Glucnonox, +35%; Ra, +40%; Lipox, +11%). Our data provide evidence that, in humans, T3 stimulates Ra and Rd, which is in part independent of pancreatic hormones.

  18. Thyroid hormone action: astrocyte-neuron communication.

    PubMed

    Morte, Beatriz; Bernal, Juan

    2014-01-01

    Thyroid hormone (TH) action is exerted mainly through regulation of gene expression by binding of T3 to the nuclear receptors. T4 plays an important role as a source of intracellular T3 in the central nervous system via the action of the type 2 deiodinase (D2), expressed in the astrocytes. A model of T3 availability to neural cells has been proposed and validated. The model contemplates that brain T3 has a double origin: a fraction is available directly from the circulation, and another is produced locally from T4 in the astrocytes by D2. The fetal brain depends almost entirely on the T3 generated locally. The contribution of systemic T3 increases subsequently during development to account for approximately 50% of total brain T3 in the late postnatal and adult stages. In this article, we review the experimental data in support of this model, and how the factors affecting T3 availability in the brain, such as deiodinases and transporters, play a decisive role in modulating local TH action during development. PMID:24910631

  19. Thyroid Hormone Action: Astrocyte–Neuron Communication

    PubMed Central

    Morte, Beatriz; Bernal, Juan

    2014-01-01

    Thyroid hormone (TH) action is exerted mainly through regulation of gene expression by binding of T3 to the nuclear receptors. T4 plays an important role as a source of intracellular T3 in the central nervous system via the action of the type 2 deiodinase (D2), expressed in the astrocytes. A model of T3 availability to neural cells has been proposed and validated. The model contemplates that brain T3 has a double origin: a fraction is available directly from the circulation, and another is produced locally from T4 in the astrocytes by D2. The fetal brain depends almost entirely on the T3 generated locally. The contribution of systemic T3 increases subsequently during development to account for approximately 50% of total brain T3 in the late postnatal and adult stages. In this article, we review the experimental data in support of this model, and how the factors affecting T3 availability in the brain, such as deiodinases and transporters, play a decisive role in modulating local TH action during development. PMID:24910631

  20. Thyroid hormones upregulate apolipoprotein E gene expression in astrocytes.

    PubMed

    Roman, Corina; Fuior, Elena V; Trusca, Violeta G; Kardassis, Dimitris; Simionescu, Maya; Gafencu, Anca V

    Apolipoprotein E (apoE), a protein mainly involved in lipid metabolism, is associated with several neurodegenerative disorders including Alzheimer's disease. Despite numerous attempts to elucidate apoE gene regulation in the brain, the exact mechanism is still uncovered. The mechanism of apoE gene regulation in the brain involves the proximal promoter and multienhancers ME.1 and ME.2, which evolved by gene duplication. Herein we questioned whether thyroid hormones and their nuclear receptors have a role in apoE gene regulation in astrocytes. Our data showed that thyroid hormones increase apoE gene expression in HTB14 astrocytes in a dose-dependent manner. This effect can be intermediated by the thyroid receptor β (TRβ) which is expressed in these cells. In the presence of triiodothyronine (T3) and 9-cis retinoic acid, in astrocytes transfected to overexpress TRβ and retinoid X receptor α (RXRα), apoE promoter was indirectly activated through the interaction with ME.2. To determine the location of TRβ/RXRα binding site on ME.2, we performed DNA pull down assays and found that TRβ/RXRα complex bound to the region 341-488 of ME.2. This result was confirmed by transient transfection experiments in which a series of 5'- and 3'-deletion mutants of ME.2 were used. These data support the existence of a biologically active TRβ binding site starting at 409 in ME.2. In conclusion, our data revealed that ligand-activated TRβ/RXRα heterodimers bind with high efficiency on tissue-specific distal regulatory element ME.2 and thus modulate apoE gene expression in the brain. PMID:26519880

  1. Subacute Microcystin-LR Exposure Alters the Metabolism of Thyroid Hormones in Juvenile Zebrafish (Danio Rerio)

    PubMed Central

    Liu, Zidong; Tang, Rong; Li, Dapeng; Hu, Qing; Wang, Ying

    2015-01-01

    Microcystin-LR (MC-LR) has been detected extensively in the aquatic environment and has the potential to disturb the thyroid endocrine system. However, limited information is available on the effects of subacute MC-LR exposure on fish thyroid hormone (TH) metabolism. In the present study, juvenile zebrafish (Danio rerio) were exposed to MC-LR at environmentally relevant concentrations (0, 1, 5, and 25 μg/L) for 28 days. Whole-body TH content and thyroid follicle histology were used as direct endpoints to assess thyroid disruption. The activities of iodothyronine deiodinases (IDs) and the transcription of selected genes associated with TH synthesis were also investigated to study the underlying mechanisms of endocrine disruption. Exposure of zebrafish to MC-LR significantly increased whole-body thyroxine (T4) content but decreased whole-body triiodothyronine (T3) content. We also observed hypertrophy and hyperplasia of the thyroid follicle epithelial cells, as well as up-regulation of corticotropin-releasing hormone (CRH), thyroid-stimulating hormone (TSH), thyroid peroxidase (TPO), and transthyretin (TTR) genes. The decreases in ID1 and ID2 activities coupled with an increase in ID3 activity were observed in MC-LR treatment groups. These results demonstrate that exposure to MC-LR at environmental concentrations results in the disturbance of TH homeostasis by disrupting the synthesis and conversion of THs. PMID:25647779

  2. Subacute microcystin-LR exposure alters the metabolism of thyroid hormones in juvenile zebrafish (Danio Rerio).

    PubMed

    Liu, Zidong; Tang, Rong; Li, Dapeng; Hu, Qing; Wang, Ying

    2015-02-01

    Microcystin-LR (MC-LR) has been detected extensively in the aquatic environment and has the potential to disturb the thyroid endocrine system. However, limited information is available on the effects of subacute MC-LR exposure on fish thyroid hormone (TH) metabolism. In the present study, juvenile zebrafish (Danio rerio) were exposed to MC-LR at environmentally relevant concentrations (0, 1, 5, and 25 μg/L) for 28 days. Whole-body TH content and thyroid follicle histology were used as direct endpoints to assess thyroid disruption. The activities of iodothyronine deiodinases (IDs) and the transcription of selected genes associated with TH synthesis were also investigated to study the underlying mechanisms of endocrine disruption. Exposure of zebrafish to MC-LR significantly increased whole-body thyroxine (T4) content but decreased whole-body triiodothyronine (T3) content. We also observed hypertrophy and hyperplasia of the thyroid follicle epithelial cells, as well as up-regulation of corticotropin-releasing hormone (CRH), thyroid-stimulating hormone (TSH), thyroid peroxidase (TPO), and transthyretin (TTR) genes. The decreases in ID1 and ID2 activities coupled with an increase in ID3 activity were observed in MC-LR treatment groups. These results demonstrate that exposure to MC-LR at environmental concentrations results in the disturbance of TH homeostasis by disrupting the synthesis and conversion of THs. PMID:25647779

  3. BRAIN, LIVER AND THYROID BIOMARKERS REFLECT ENHANCED SENSITIVITY OF THE DEVELOPING RAT TO THYROID HORMONE DEPLETION.

    EPA Science Inventory

    Many developmental events are regulated at least in part by thyroid hormones. It was hypothesized that tissue biomarkers of thyroid status would be more accurate predictors of neurotoxicity than serum biomarkers in rats treated with the goitrogen propylthiouracil (PTU). Over seve...

  4. Thyroid hormone stimulation of plasma protein synthesis in cultured hepatocytes.

    PubMed

    Hertzberg, K M; Pindyck, J; Mosesson, M W; Grieninger, G

    1981-01-25

    The direct effect of thyroid hormones on hepatocellular plasma protein synthesis has been studied in primary monolayer cultures derived from chick embryo liver. The chemically defined medium used for plating and maintaining the cultures contained no other hormones, protein, or serum supplement. Addition of physiological concentrations (10 nM) of triiodothyronine or thyroxine produced 3-fold or greater increases in the rates of synthesis of fibrinogen and three other major secreted proteins. By comparison albumin, transferrin, and total protein synthesis were not substantially increased. The enhanced synthesis of selected plasma proteins could be detected 6 h after initial addition of triiodothyronine. Exposure of the cells to the hormone for only 30 min was nearly as effective as continuous exposure in eliciting the ultimate response. Triiodothyronine exerted its half-maximal effect at a concentration of 1 nM. Diminished potency was associated with less iodination of the hormone; a marked reduction was noted with di-iodinated thyronine and no stimulatory activity at all with either mono- or non-iodinated thyronine. PMID:7451459

  5. Effects of thyroid hormones on human breast cancer cell proliferation.

    PubMed

    Hall, Linda C; Salazar, Eddie P; Kane, Staci R; Liu, Nan

    2008-03-01

    The involvement of estrogens in breast cancer development and growth has been well established. However, the effects of thyroid hormones and their combined effects with estrogens are not well studied. We investigated the response of human breast cancer cells to thyroid hormone, particularly the role of T3 in mediating cell proliferation and gene expression. We demonstrated that 17beta-estradiol (E2) or triiodothyronine (T3) promoted cell proliferation in a dose-dependent manner in both MCF-7 and T47-D cell lines. The E2- or T3-dependent cell proliferation was suppressed by co-administration of the ER antagonist ICI. We also demonstrated that T3 could enhance the effect of E2 on cell proliferation in T47-D cells. Using an estrogen response element (ERE)-mediated luciferase assay, we determined that T3 was able to induce the activation of ERE-mediated gene expression in MCF-7 cells, although the effects were much weaker than that induced by E2. These results suggest that T3 can promote breast cancer cell proliferation and increase the effect of E2 on cell proliferation in some breast cancer cell lines and thus that T3 may play a role in breast cancer development and progression. PMID:18328691

  6. [Modification of endocrine function of trophoblasts by thyroid hormone].

    PubMed

    Matsuo, H; Maruo, T; Hayashi, M; Mochizuki, M

    1991-11-01

    Direct effects of L-triiodothyronine(T3) on placental endocrine function were investigated in vitro with an organ culture system for human placental tissues. Explants of trophoblastic tissues obtained from early and term placentas were cultured with or without graded doses of T3 in a serum-free condition. The addition of an optimal concentration of T3(10(-3) M T3) stimulated daily secretion of progesterone and estradiol from cultured early placental tissues by acting at the level of 3 beta-hydroxysteroid dehydrogenase and aromatase enzyme activity, together with the enhancement of hCG(alpha, beta) and hPL secretion. The addition of higher or lower concentrations of T3 gave attenuated effects and the addition of an excessive concentration of T3(10(-3) M T3) resulted in remarkable inhibition of progesterone and estradiol secretion by cultured early placental tissues. These results suggest that the optimal concentration of thyroid hormone acts as a biological amplifier of endocrine function of cultured trophoblasts obtained from early placentas. Unlike the early placental tissues, cultured term placental tissues did not respond to the addition of graded doses of T3 with increased endocrine function. Thus, the frequent occurrence of spontaneous abortion in early pregnancy during the state of hypothyroidism or hyperthyroidism may represent a direct consequence of inadequate thyroid hormone availability at the level of the trophoblast, followed by diminished endocrine function of early placental trophoblasts. PMID:1940550

  7. Effects of acute microinjections of thyroid hormone to the preoptic region of hypothyroid adult male rats on sleep, motor activity and body temperature.

    PubMed

    Moffett, Steven X; Giannopoulos, Phillip F; James, Thomas D; Martin, Joseph V

    2013-06-21

    Thyroid hormones induce short-latency nongenomic effects in adult brain tissue, suggesting that their acute administration would affect brain activity in intact animals. The influence on EEG-defined sleep of acute restoration of l-3,3'5-triiodothyronine (T3) to a sleep-regulatory brain region, the preoptic region, was examined in hypothyroid rats. Sleep parameters were monitored for 48 h weekly: for 24 h immediately following a control microinjection and for an additional 24h after a second microinjection including a T3 dose to the preoptic region or lateral ventricle. Male albino rats were implanted with EEG and EMG electrodes, abdominal temperature/activity transponders and unilateral lateral ventricle cannulae or bilateral preoptic region cannulae, and were given 0.02% n-propythiouracil (PTU) in their drinking water for 4 weeks. For histologically-confirmed bilateral preoptic region cannula placements (N=7), effects of T3 (especially a 3 μg dose) were apparent within 10h of injection as decreases in REM, NREM and total sleep and increases in waking and activity. Minimal effects of lateral ventricle T3 microinjection were demonstrated (N=5). Significant effects due to the time of day on the experimental measures were seen in both lateral ventricle and preoptic region groups, but these effects did not interact with the effect of administered hormone dose. These effects of T3 microinjection to the preoptic region were demonstrated after acute injections and within hours of injection rather than after chronic administration over days. PMID:23603414

  8. Embryonic exposure to excess thyroid hormone causes thyrotrope cell death

    PubMed Central

    Tonyushkina, Ksenia N.; Shen, Meng-Chieh; Ortiz-Toro, Theresa; Karlstrom, Rolf O.

    2013-01-01

    Central congenital hypothyroidism (CCH) is more prevalent in children born to women with hyperthyroidism during pregnancy, suggesting a role for thyroid hormone (TH) in the development of central thyroid regulation. Using the zebrafish embryo as a model for thyroid axis development, we have characterized the ontogeny of negative feedback regulation of thyrotrope function and examined the effect of excess TH on thyrotrope development. We found that thyroid-stimulating hormone β subunit (tshb) and type 2 deiodinase (dio2) are coexpressed in zebrafish thyrotropes by 48 hours after fertilization and that TH-driven negative feedback regulation of tshb transcription appears in the thyroid axis by 96 hours after fertilization. Negative feedback regulation correlated with increased systemic TH levels from the developing thyroid follicles. We used a transgenic zebrafish that expresses GFP under the control of the tshb promoter to follow thyrotrope fates in vivo. Time-lapse imaging revealed that early exposure to elevated TH leads to thyrotrope cell death. Thyrotrope numbers slowly recovered following the removal of excess TH. These data demonstrate that transient TH exposure profoundly impacts the thyrotrope population during a critical period of pituitary development and may have long-term implications for the functional reserve of thyroid-stimulating hormone (TSH) production and the TSH set point later in life. PMID:24316972

  9. Effects of acute microinjections of thyroid hormone to the preoptic region of euthyroid adult male rats on sleep and motor activity.

    PubMed

    Martin, Joseph V; Giannopoulos, Phillip F; Moffett, Steven X; James, Thomas D

    2013-06-21

    In adult brain tissue, thyroid hormones are known to have multiple effects which are not mediated by chronic influences of the hormones on heterodimeric thyroid hormone nuclear receptors. Previous work has shown that acute microinjections of l-triiodothyronine (T3) to the preoptic region significantly influence EEG-defined sleep in hypothyroid rats. The current study examined the effects of similar microinjections in euthyroid rats. In 7 rats with histologically confirmed microinjection sites bilaterally placed in the preoptic region, slow-wave sleep time was significantly decreased, but REM and waking were increased as compared to vehicle-injected controls. The EEG-defined parameters were significantly influenced by the microinjections in a biphasic dose-response relationship; the lowest (0.3μg) and highest (10μg) doses tested were without significant effect while intermediate doses (1 and 3μg) induced significant differences from controls. There were significant diurnal variations in the measures, yet no significant interactions between the effect of hormone and time of day were demonstrated. Core body temperature was not significantly altered in the current study. The demonstration of effects of T3 within hours instead of days is consistent with a rapid mechanism of action such as a direct influence on neurotransmission. Since the T3-mediated effects were robust in the current work, euthyroid rats retain thyroid hormone sensitivity which would be needed if sleep-regulatory mechanisms in the preoptic region are continuously modulated by the hormones. This article is part of a Special Issue entitled LInked: BRES-D-12-01552 & BRES-D-12-01363R2. PMID:23348377

  10. Thyroid hormone transporters--functions and clinical implications.

    PubMed

    Bernal, Juan; Guadaño-Ferraz, Ana; Morte, Beatriz

    2015-07-01

    The cellular influx and efflux of thyroid hormones are facilitated by transmembrane protein transporters. Of these transporters, monocarboxylate transporter 8 (MCT8) is the only one specific for the transport of thyroid hormones and some of their derivatives. Mutations in SLC16A2, the gene that encodes MCT8, lead to an X-linked syndrome with severe neurological impairment and altered concentrations of thyroid hormones. Histopathological analysis of brain tissue from patients who have impaired MCT8 function indicates that brain lesions start prenatally, and are most probably the result of cerebral hypothyroidism. A Slc16a2 knockout mouse model has revealed that Mct8 is an important mediator of thyroid hormone transport, especially T3, through the blood-brain barrier. However, unlike humans with an MCT8 deficiency, these mice do not have neurological impairment. One explanation for this discrepancy could be differences in expression of the T4 transporter OATP1C1 in the blood-brain barrier; OATP1C1 is more abundant in rodents than in primates and permits the passage of T4 in the absence of T3 transport, thus preventing full cerebral hypothyroidism. In this Review, we discuss the relevance of thyroid hormone transporters in health and disease, with a particular focus on the pathophysiology of MCT8 mutations. PMID:25942657

  11. Influence of thyroid hormones on maturation of rat cerebellar astrocytes.

    PubMed

    Manzano, Jimena; Bernal, Juan; Morte, Beatriz

    2007-05-01

    Thyroid hormone influences brain maturation through interaction with nuclear receptors and regulation of gene expression. Their role on astrocyte maturation remains unclear. We have analyzed the role of thyroid hormone in rat cerebellar astrocyte maturation by comparing the sequential patterns of intermediate filament expression in normal and hypothyroid animals. During normal development astroglial cells sequentially express nestin, vimentin, and glial fibrillary acidic protein. Differentiated astrocytes appeared in the superior medullary vellum by postnatal day 2 and reached the white mater and internal granular layer by postnatal day 4. Intermediate filament marker expression was transiently lost from postnatal days 6 to 8 in anterior lobes, without an increased apoptosis. Vimentin expression was replaced by glial fibrillary acidic protein between postnatal days 10 and 32. The differentiated astrocytes were evenly distributed throughout the cerebellar slices, including the internal granular layer. Differences between normal and hypothyroid rats were observed starting from postnatal day 4, with lack of differentiated astrocytes in the internal granular layer. The transient decrease of astrocyte markers immunoreactivity in the anterior lobe did not take place in hypothyroid rats. The vimentin-glial fibrillary acidic protein transition was delayed and most differentiated astrocytes remained confined to the white matter. The results indicate that thyroid hormone deficiency induces a delay and a partial arrest of astrocyte differentiation. Astrocytes express thyroid hormone receptor alpha and beta subtypes suggesting that astrocytes are direct target cells of thyroid hormones. PMID:17408906

  12. Early Temporal Effects of Three Thyroid Hormone Synthesis Inhibitors in Xenopus laevis

    EPA Science Inventory

    Thyroid axis disruption is an important consideration when evaluating the risks associated with chemicals. Bioassay methods that include thyroid-related endpoints have been developed in a variety of species, including amphibians, whose metamorphic development is thyroid hormone ...

  13. Liver X receptor β: new player in the regulatory network of thyroid hormone and 'browning' of white fat.

    PubMed

    Miao, Yifei; Warner, Margaret; Gustafsson, Jan-Ke

    2016-01-01

    The recent discovery of browning of white adipose tissue (WAT) has raised great research interest because of its significant potential in counteracting obesity and type II diabetes. However, the mechanisms underlying browning are still poorly understood. Liver X receptors (LXRs) are one class of nuclear receptors, which play a vital role in regulating cholesterol, triglyceride and glucose metabolism. Following our previous finding that LXRs serve as repressors of UCP1 in classic brown adipose tissue in female mice, we found that LXRs, especially LXRβ, also repress the browning process of subcutaneous adipose tissue (SAT) in male rodents fed a normal diet. Depletion of LXRs activated thyrotropin releasing hormone positive neurons in the paraventricular area of the hypothalamus, and thus stimulated secretion of thyroid-stimulating hormone from the pituitary. Consequently production of thyroid hormones in the thyroid gland and circulating thyroid hormone level were increased. Moreover, the activity of thyroid signaling in SAT was markedly increased. One unexpected finding of our study is that LXRs are indispensable in the thyroid hormone negative feedback loop at the level of the hypothalamus. LXRs maintain expression of thyroid receptors in the brain and when they are inactivated there is no negative feedback of thyroid hormone in the hypothalamus. Together, our findings have uncovered the basis of increased energy expenditure in male LXR knock-out mice and provided support for targeting LXRs in treatment of obesity. PMID:27386163

  14. Establishing Adverse Outcome Pathways of Thyroid Hormone Disruption in an Amphibian Model

    EPA Science Inventory

    The Adverse Outcome Pathway (AOP) provides a framework for understanding the relevance of toxicology data in ecotoxicological hazard assessments. The AOP concept can be applied to many toxicological pathways including thyroid hormone disruption. Thyroid hormones play a critical r...

  15. Thyroid hormone regulation of heme oxidation in the liver.

    PubMed Central

    Smith, T J; Drummond, G S; Kourides, I A; Kappas, A

    1982-01-01

    The effects of 3,5,3'-triiodothyronine (T3) on heme oxygenase (EC 1.14.99.3) activity and cytochrome P-450 content in liver were examined in thyroidectomized rats. T3, when administered for 5 days at a dose of 6 micrograms/100 g of body weight, stimulated basal heme oxygenase activity approximately equal to 2-fold compared to diluent-treated animals. The induction of heme oxygenase by cobalt heme also was enhanced approximately equal to 3-fold in T3-treated animals. T3 treatment lowered cytochrome P-450 content by approximately equal to 50% and potentiated the depletion of this heme protein after cobalt heme administration. Reverse T3 had no effect either on cytochrome P-450 content or on heme oxygenase activity in liver. The time course of response to a single dose of T3 (50 micrograms/100 g of body weight) revealed that both basal and cobalt heme-induced heme oxygenase activity peaked at 48 hr and that cytochrome P-450 content declined to approximately equal to 40% of controls at 96 hr. Examination of microsomal proteins by polyacrylamide gel electrophoresis after T3 treatment disclosed that major bands in the Mr approximately equal to 50,000-55,000 region were diminished. The administration of T3 together with SKF-525A, a compound known to complex with the heme prosthetic group of cytochrome P-450, resulted in partial preservation of these proteins. These data indicate that thyroid hormone can regulate heme oxygenase activity and concomitantly can lower cytochrome P-450 content in liver. The hormone also can act in a synergistic fashion to enhance the response of hepatic heme oxygenase to a chemical inducer of the enzyme. Thyroid status thus may be a potentially significant determinant of the rate of heme oxidation in the liver. Images PMID:6961431

  16. Thyroid Hormone-disrupting Effects and the Amphibian Metamorphosis Assay

    PubMed Central

    Miyata, Kaori; Ose, Keiko

    2012-01-01

    There are continued concerns about endocrine-disrupting chemical effects, and appropriate vertebrate models for assessment of risk are a high priority. Frog tadpoles are very sensitive to environmental substances because of their habitat and the complex processes of metamorphosis regulated by the endocrine system, mainly thyroid hormones. During metamorphosis, marked alteration in hormonal factors occurs, as well as dramatic structural and functional changes in larval tissues. There are a variety of mechanisms determining thyroid hormone balance or disruption directly or indirectly. Direct-acting agents can cause changes in thyroxine synthesis and/or secretion in thyroid through effects on peroxidases, thyroidal iodide uptake, deiodinase, and proteolysis. At the same time, indirect action may result from biochemical processes such as sulfation, deiodination and glucuronidation. Because their potential to disrupt thyroid hormones has been identified as an important consideration for the regulation of chemicals, the OECD and the EPA have each established guidelines that make use of larval African clawed frogs (Xenopus laevis) and frog metamorphosis for screening and testing of potential endocrine disrupters. The guidelines are based on evaluation of alteration in the hypothalamic-pituitary-thyroid axis. One of the primary endpoints is thyroid gland histopathology. Others are mortality, developmental stage, hind limb length, snout-vent length and wet body weight. Regarding histopathological features, the guidelines include core criteria and additional qualitative parameters along with grading. Taking into account the difficulties in evaluating amphibian thyroid glands, which change continuously throughout metamorphosis, histopathological examination has been shown to be a very sensitive approach. PMID:22481853

  17. Energy regulation in context: Free-living female arctic ground squirrels modulate the relationship between thyroid hormones and activity among life history stages.

    PubMed

    Wilsterman, Kathryn; Buck, C Loren; Barnes, Brian M; Williams, Cory T

    2015-09-01

    Thyroid hormones (THs), key regulators of lipid and carbohydrate metabolism, are likely modulators of energy allocation within and among animal life history stages. Despite their role in modulating metabolism, few studies have investigated whether THs vary among life history stages in free-living animals or if they exhibit stage-specific relationships to total energy expenditure and activity levels. We measured plasma total triiodothyronine (tT3) and thyroxine (tT4) at four, discrete life history stages of female arctic ground squirrels from two different populations in northern Alaska to test whether plasma THs correlate with life history stage-specific changes in metabolic rate and energy demand. We also tested whether THs explained individual variation in aboveground activity levels within life history stages. T3 peaked during lactation and was lowest during pre-hibernation fattening, consistent with known changes in basal metabolism and core body temperature. In contrast, T4 was elevated shortly after terminating hibernation but remained low and stable across other life-history stages in the active season. THs were consistently higher in the population that spent more time above-ground but the relationship between THs and activity varied among life history stages. T3 was positively correlated with activity only during lactation (r(2)=0.50) whereas T4 was positively correlated with activity immediately following lactation (r(2)=0.48) and during fattening (r(2)=0.53). Our results support the hypothesis that THs are an important modulator of basal metabolism but also suggest that the relationship between THs and activity varies among life history stages. PMID:26416501

  18. The role of thyroid hormone and brown adipose tissue in energy homoeostasis

    PubMed Central

    Bianco, Antonio C; McAninch, Elizabeth A

    2016-01-01

    The presence of brown adipose tissue (BAT) in adults has become increasingly well defined as a result of functional imaging studies of thermogenically active BAT. Findings from these studies have created a surge of scientific interest in BAT, because it represents a potential therapeutic target for obesity—a condition with profound health consequences and few successful therapies. BAT contributes to overall energy expenditure in small mammals and neonates through adaptive thermogenesis. Thyroid-hormone signalling, particularly through induction of type II deiodinase, has a central role in brown adipogenesis in vitro and BAT development in mouse embryos. Additionally, because of high intracellular expression of type II deiodinase, adult BAT has enhanced thyroid-hormone signalling with several thyroid-hormone-dependent thermogenic pathways, including expression of the genes Ppargc1a and Ucp1. BAT thermogenesis explains the essential part played by thyroid hormone in energy homoeostasis and adaptation to cold. Stimulation of BAT in adults, specifically through thyroid-hormone-mediated pathways, is a promising therapeutic target for obesity. PMID:24622373

  19. Neonatal detection of generalized resistance to thyroid hormone

    SciTech Connect

    Weiss, R.E.; Balzano, S.; Scherberg, N.H.; Refetoff, S. )

    1990-11-07

    Generalized resistance to thyroid hormone (GRTH) is an inherited disease that is usually suspected when elevated serum thyroid hormone levels are associated with nonsuppressed thyrotropin. Often these test results are obtained because of short stature, decreased intelligence, and/or hyperactivity with learning disability noted in childhood and adolescence, or because of goiter in adulthood. The authors detected GRTH at birth by analysis of blood obtained during routine neonatal screening. The proposita, born to a mother with GRTH, had a thyrotropin level of 26 mU/L and a corresponding thyroxine concentration of 656 nmol/L. Administration of thyroid hormone in doses eightfold to 10-fold above replacement levels were required to reduce serum thyrotropin to normal levels without induction of hypermetabolism. This case, and the retrospective finding of high thyroxine levels in five newborns subsequently diagnosed as having GRTH, suggest that measurement of thyroxine at birth, in conjunction with thyrotropin, could allow the early detection of GRTH.

  20. Multiple genetic factors in the heterogeneity of thyroid hormone resistance

    SciTech Connect

    Weiss, R.E.; Refetoff, S. ); Marcocci, C.; Bruno-Bossio, G. )

    1993-01-01

    Generalized resistance to thyroid hormone (GRTH), a syndrome of inherited tissue hyposensitivity to thyroid hormone, is linked to thyroid hormone receptor (TR) mutations. A typical feature of GRTH is variable severity of organ involvement among families that, surprisingly, does not correlate with the degree of T[sub 3]-binding impairment of the corresponding in vitro synthesized mutant TRs. Furthermore, variations in the clinical severity among family members harboring identical TR[beta] mutations have been reported. The authors compared serum levels of thyroid hormones that maintained a normal TSH in members of a large family with GRTH divided in three groups: Group A, 8 affected subjects with a mutation replacing arginine-320 with a histidine in the T[sub 3]-binding domain of TR[beta]; Group B, 11 first degree relatives (sibs and children of affected subjects) with no TR[beta] mutation; Group C, 16 controls related by marriage. TSH values were not different among the three groups. As expected, total and free T[sub 4] and T[sub 3], and rT[sub 3] levels were significantly higher in Group A vs Groups B and C. However, with the exception of T[sub 3], the same tests were also significantly higher in Group B vs Group C. The latter differences are not due to thyroid hormone transport in serum since TBG concentrations were not different. It is postulated that genetic variability of factors that contribute to the action of thyroid hormone modulate the phenotype of GRTH associated with TR[beta] mutations. 23 refs., 2 figs., 1 tab.

  1. Thyroid hormones and deiodinase activity in plasma and tissues in relation to high levels of organohalogen contaminants in East Greenland polar bears (Ursus maritimus).

    PubMed

    Gabrielsen, Kristin Møller; Krokstad, Julie Stene; Villanger, Gro Dehli; Blair, David A D; Obregon, Maria-Jesus; Sonne, Christian; Dietz, Rune; Letcher, Robert J; Jenssen, Bjørn Munro

    2015-01-01

    Previous studies have shown relationships between organohalogen contaminants (OHCs) and circulating levels of thyroid hormones (THs) in arctic wildlife. However, there is a lack of knowledge concerning the possible functional effects of OHCs on TH status in target tissues for TH-dependent activity. The relationships between circulating (plasma) levels of OHCs and various TH variables in plasma as well as in liver, muscle and kidney tissues from East Greenland sub-adult polar bears (Ursus maritimus) sampled in 2011 (n=7) were therefore investigated. The TH variables included 3.3',5.5'-tetraiodothyronine or thyroxine (T4), 3.3',5-triiodothyronine (T3) and type 1 (D1) and type 2 (D2) deiodinase activities. Principal component analysis (PCA) combined with correlation analyses demonstrated negative relationships between individual polychlorinated biphenyls (PCBs) and their hydroxylated (OH-) metabolites and T4 in both plasma and muscle. There were both positive and negative relationships between individual OHCs and D1 and D2 activities in muscle, liver and kidney tissues. In general, PCBs, OH-PCBs and polybrominated dipehenyl ethers (PBDEs) were positively correlated to D1 and D2 activities, whereas organochlorine pesticides and byproducts (OCPs) were negatively associated with D1 and D2 activities. These results support the hypothesis that OHCs can affect TH status and action in the target tissues of polar bears. TH levels and deiodinase activities in target tissues can be sensitive endpoints for exposure of TH-disrupting compounds in arctic wildlife, and thus, tissue-specific responses in target organs should be further considered when assessing TH disruption in wildlife studies. PMID:25460663

  2. Iodine and thyroid hormones during pregnancy and postpartum.

    PubMed

    Pérez-López, Faustino R

    2007-07-01

    Iodine is a trace element essential for synthesis of the thyroid hormones, triiodothyronine and thyroxine. These hormones play a vital role in the early growth and development stages of most organs, especially the brain. The World Health Organization (WHO) has declared that, after famine, iodine deficiency is the most avoidable cause of cerebral lesions including different degrees of mental retardation and cerebral paralysis. The main function of iodine in vertebrates is to interact with the thyroid hormones. During pregnancy sufficient quantities of iodine are required to prevent the appearance of hypothyroidism, trophoblastic and embryonic or fetal disorders, neonatal and maternal hypothyroidism, and permanent sequelae in infants. Thyroid hormone receptors and iodothyronine deiodinases are present in placenta and central nervous tissue of the fetus. A number of environmental factors influence the epidemiology of thyroid disorders, and even relatively small abnormalities and differences in the level of iodine intake in a population have profound effects on the occurrence of thyroid abnormalities. The prevalence of disorders related to iodine deficit during pregnancy and postpartum has increased. Iodine supplementation is an effective measure in the case of pregnant and lactating women. However, it is not implemented and the problem is still present even in societies with theoretically advanced health systems. During pregnancy and postpartum, the WHO recommends iodine intake be increased to at least 200 microg/day. Side-effects provoked by iodine supplementation are rare during pregnancy at the recommended doses. PMID:17701774

  3. Role of Thyroid Hormones in Skeletal Development and Bone Maintenance

    PubMed Central

    Bassett, J. H. Duncan

    2016-01-01

    The skeleton is an exquisitely sensitive and archetypal T3-target tissue that demonstrates the critical role for thyroid hormones during development, linear growth, and adult bone turnover and maintenance. Thyrotoxicosis is an established cause of secondary osteoporosis, and abnormal thyroid hormone signaling has recently been identified as a novel risk factor for osteoarthritis. Skeletal phenotypes in genetically modified mice have faithfully reproduced genetic disorders in humans, revealing the complex physiological relationship between centrally regulated thyroid status and the peripheral actions of thyroid hormones. Studies in mutant mice also established the paradigm that T3 exerts anabolic actions during growth and catabolic effects on adult bone. Thus, the skeleton represents an ideal physiological system in which to characterize thyroid hormone transport, metabolism, and action during development and adulthood and in response to injury. Future analysis of T3 action in individual skeletal cell lineages will provide new insights into cell-specific molecular mechanisms and may ultimately identify novel therapeutic targets for chronic degenerative diseases such as osteoporosis and osteoarthritis. This review provides a comprehensive analysis of the current state of the art. PMID:26862888

  4. Role of Thyroid Hormones in Skeletal Development and Bone Maintenance.

    PubMed

    Bassett, J H Duncan; Williams, Graham R

    2016-04-01

    The skeleton is an exquisitely sensitive and archetypal T3-target tissue that demonstrates the critical role for thyroid hormones during development, linear growth, and adult bone turnover and maintenance. Thyrotoxicosis is an established cause of secondary osteoporosis, and abnormal thyroid hormone signaling has recently been identified as a novel risk factor for osteoarthritis. Skeletal phenotypes in genetically modified mice have faithfully reproduced genetic disorders in humans, revealing the complex physiological relationship between centrally regulated thyroid status and the peripheral actions of thyroid hormones. Studies in mutant mice also established the paradigm that T3 exerts anabolic actions during growth and catabolic effects on adult bone. Thus, the skeleton represents an ideal physiological system in which to characterize thyroid hormone transport, metabolism, and action during development and adulthood and in response to injury. Future analysis of T3 action in individual skeletal cell lineages will provide new insights into cell-specific molecular mechanisms and may ultimately identify novel therapeutic targets for chronic degenerative diseases such as osteoporosis and osteoarthritis. This review provides a comprehensive analysis of the current state of the art. PMID:26862888

  5. [Thyroid hormones and their precursors. II. Species-specific properties].

    PubMed

    Tóth, Gergo; Noszál, Béla

    2014-01-01

    This paper surveys the species-specific physico-chemical parameters (basicity and lipophilicity) and related biological functions of thyroid hormones (thyroxine, liothyronine and reverse liothyronine) and their biological precursors (tyrosine, monoiodotyrosine and diiodotyrosine). The protonation macroconstants were determined by 1H NMR-pH titrations while the microconstants were determined by a multimodal spectroscopic-deductive methodology using auxiliary derivatives of reduced complexity. Our results show that the different number and/or position of iodine are the key factors to influence the phenolate basicity. The ionization state of the phenolate site is crucial in the biosynthesis and protein binding of thyroid hormones. The role of the protonation state in the receptor binding was investigated by an in silico docking method. Microspecies of thyroid hormones were docked to the thyroid hormone receptor isoforms. Our results quantitate at the molecular level how the ionization stage and the charge distribution influence the protein binding. The anionic form of the carboxyl group is essential for the protein binding, whereas the protonated form of the amino group loosens it. The protonation state of the phenolate plays a role of secondary importance in the receptor binding. The combined results of docking and microspeciation studies show that microspecies of the highest concentration at the pH of blood are not the strongest binding ones. The site-specific lipophilicity of our investigated molecules was determined with the measurement of distribution coefficients at different pH using carboxymethyl- and O-methyl-derivatives to mimic the partition of some of the individual microspecies. Correction factors were determined and introduced. Our data show that the iodinated aromatic ring system is the definitive structural element that fundamentally determines the lipophilicity of thyroid hormones, whereas the protonation state of the aliphatic part is essential in

  6. Thyroid Hormone Receptor Binds to a Site in the Rat Growth Hormone Promoter Required for Induction by Thyroid Hormone

    NASA Astrophysics Data System (ADS)

    Koenig, Ronald J.; Brent, Gregory A.; Warne, Robert L.; Reed Larsen, P.; Moore, David D.

    1987-08-01

    Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. We have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. We show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor.

  7. Imbalance between thyroid hormones and the dopaminergic system might be central to the pathophysiology of restless legs syndrome: a hypothesis.

    PubMed

    Pereira, Jose Carlos; Pradella-Hallinan, Marcia; Lins Pessoa, Hugo de

    2010-05-01

    Data collected from medical literature indicate that dopaminergic agonists alleviate Restless Legs Syndrome symptoms while dopaminergic agonists antagonists aggravate them. Dopaminergic agonists is a physiological regulator of thyroid-stimulating hormone. Dopaminergic agonists infusion diminishes the levels of thyroid hormones, which have the ability to provoke restlessness, hyperkinetic states, tremors, and insomnia. Conditions associated with higher levels of thyroid hormones, such as pregnancy or hyperthyroidism, have a higher prevalence of Restless Legs Syndrome symptoms. Low iron levels can cause secondary Restless Legs Syndrome or aggravate symptoms of primary disease as well as diminish enzymatic activities that are involved in dopaminergic agonists production and the degradation of thyroid hormones. Moreover, as a result of low iron levels, dopaminergic agonists diminishes and thyroid hormones increase. Iron therapy improves Restless Legs Syndrome symptoms in iron deprived patients. Medical hypothesis. To discuss the theory that thyroid hormones, when not counterbalanced by dopaminergic agonists, may precipitate the signs and symptoms underpinning Restless Legs Syndrome. The main cause of Restless Legs Syndrome might be an imbalance between the dopaminergic agonists system and thyroid hormones. PMID:20535374

  8. Inappropriate heat dissipation ignites brown fat thermogenesis in mice with a mutant thyroid hormone receptor α1

    PubMed Central

    Warner, Amy; Rahman, Awahan; Solsjö, Peter; Gottschling, Kristina; Davis, Benjamin; Vennström, Björn; Arner, Anders; Mittag, Jens

    2013-01-01

    Thyroid hormone is a major regulator of thermogenesis, acting both in peripheral organs and on central autonomic pathways. Mice heterozygous for a point mutation in thyroid hormone receptor α1 display increased thermogenesis as a consequence of high sympathetic brown fat stimulation. Surprisingly, despite the hypermetabolism, their body temperature is not elevated. Here we show, using isolated tail arteries, that defective thyroid hormone receptor α1 signaling impairs acetylcholine-mediated vascular relaxation as well as phenylephrine-induced vasoconstriction. Using infrared thermography on conscious animals, we demonstrate that these defects severely interfere with appropriate peripheral heat conservation and dissipation, which in turn leads to compensatory alterations in brown fat activity. Consequently, when the vasoconstrictive defect in mice heterozygous for a point mutation in thyroid hormone receptor α1 was reversed with the selective α1-adrenergic agonist midodrine, the inappropriate heat loss over their tail surface was reduced, normalizing brown fat activity and energy expenditure. Our analyses demonstrate that thyroid hormone plays a key role in vascular heat conservation and dissipation processes, adding a unique aspect to its well-documented functions in thermoregulation. The data thus facilitate understanding of temperature hypersensitivity in patients with thyroid disorders. Moreover, the previously unrecognized connection between cardiovascular regulation and metabolic activity revealed in this study challenges the interpretation of several experimental paradigms and questions some of the currently derived hypotheses on the role of thyroid hormone in thermogenesis. PMID:24046370

  9. Identification of Thyroid Hormones and Functional Characterization of Thyroid Hormone Receptor in the Pacific Oyster Crassostrea gigas Provide Insight into Evolution of the Thyroid Hormone System

    PubMed Central

    Huang, Wen; Xu, Fei; Qu, Tao; Zhang, Rui; Li, Li; Que, Huayong; Zhang, Guofan

    2015-01-01

    Thyroid hormones (THs) play important roles in development, metamorphosis, and metabolism in vertebrates. During the past century, TH functions were regarded as a synapomorphy of vertebrates. More recently, accumulating evidence has gradually convinced us that TH functions also occur in invertebrate chordates. To date, however, TH-related studies in non-chordate invertebrates have been limited. In this study, THs were qualitatively detected by two reliable methods (HPLC and LC/MS) in a well-studied molluscan species, the Pacific oyster Crassostrea gigas. Quantitative measurement of THs during the development of C. gigas showed high TH contents during embryogenesis and that oyster embryos may synthesize THs endogenously. As a first step in elucidating the TH signaling cascade, an ortholog of vertebrate TH receptor (TR), the most critical gene mediating TH effects, was cloned in C. gigas. The sequence of CgTR has conserved DNA-binding and ligand-binding domains that normally characterize these receptors. Experimental results demonstrated that CgTR can repress gene expression through binding to promoters of target genes and can interact with oyster retinoid X receptor. Moreover, CgTR mRNA expression was activated by T4 and the transcriptional activity of CgTR promoter was repressed by unliganded CgTR protein. An atypical thyroid hormone response element (CgDR5) was found in the promoter of CgTR, which was verified by electrophoretic mobility shift assay (EMSA). These results indicated that some of the CgTR function is conserved. However, the EMSA assay showed that DNA binding specificity of CgTR was different from that of the vertebrate TR and experiments with two dual-luciferase reporter systems indicated that l-thyroxine, 3,3′,5-triiodothyronine, and triiodothyroacetic acid failed to activate the transcriptional activity of CgTR. This is the first study to functionally characterize TR in mollusks. The presence of THs and the functions of CgTR in mollusks

  10. Identification of Thyroid Hormones and Functional Characterization of Thyroid Hormone Receptor in the Pacific Oyster Crassostrea gigas Provide Insight into Evolution of the Thyroid Hormone System.

    PubMed

    Huang, Wen; Xu, Fei; Qu, Tao; Zhang, Rui; Li, Li; Que, Huayong; Zhang, Guofan

    2015-01-01

    Thyroid hormones (THs) play important roles in development, metamorphosis, and metabolism in vertebrates. During the past century, TH functions were regarded as a synapomorphy of vertebrates. More recently, accumulating evidence has gradually convinced us that TH functions also occur in invertebrate chordates. To date, however, TH-related studies in non-chordate invertebrates have been limited. In this study, THs were qualitatively detected by two reliable methods (HPLC and LC/MS) in a well-studied molluscan species, the Pacific oyster Crassostrea gigas. Quantitative measurement of THs during the development of C. gigas showed high TH contents during embryogenesis and that oyster embryos may synthesize THs endogenously. As a first step in elucidating the TH signaling cascade, an ortholog of vertebrate TH receptor (TR), the most critical gene mediating TH effects, was cloned in C. gigas. The sequence of CgTR has conserved DNA-binding and ligand-binding domains that normally characterize these receptors. Experimental results demonstrated that CgTR can repress gene expression through binding to promoters of target genes and can interact with oyster retinoid X receptor. Moreover, CgTR mRNA expression was activated by T4 and the transcriptional activity of CgTR promoter was repressed by unliganded CgTR protein. An atypical thyroid hormone response element (CgDR5) was found in the promoter of CgTR, which was verified by electrophoretic mobility shift assay (EMSA). These results indicated that some of the CgTR function is conserved. However, the EMSA assay showed that DNA binding specificity of CgTR was different from that of the vertebrate TR and experiments with two dual-luciferase reporter systems indicated that l-thyroxine, 3,3',5-triiodothyronine, and triiodothyroacetic acid failed to activate the transcriptional activity of CgTR. This is the first study to functionally characterize TR in mollusks. The presence of THs and the functions of CgTR in mollusks contribute

  11. A new point mutation (C446R) in the thyroid hormone receptor-{beta} gene of a family with resistance to thyroid hormone

    SciTech Connect

    Weiss, R.E.; Chyna, B.; Hayashi, Yoshitaka; Sunthornthepvarakul, T.; Refetoff, S.; Duell, P.B.

    1994-05-01

    Resistance to thyroid hormone (RTH) is a condition of impaired end-organ responsiveness to thyroid hormone characterized by goiter and elevated thyroid hormone levels with an appropriately normal TSH. RTH has been associated with mutations in the thyroid hormone receptor-{beta} (TR{beta}) gene. The authors report studies carried out in 21 members of a family (F119), 12 of whom exhibited the RTH phenotype. A point mutation was detected in the T{sub 3}-binding domain of the TR{beta} gene. It resulted in replacement of the normal cysteine-446 with an arginine (C446R) that has not been previously reported. The clinical characteristics of this family are similar to those reported in other families with RTH, namely goiter, tachycardia, and learning disabilities. Thyroid function tests are also typical of other subjects with RTH. The mean values ({+-}SD) in untreated affected subjects compared to those in unaffected family members were: free T{sub 4} index, 250 {+-} 21 vs. 108 {+-} 13; total T{sub 3}, 4.3 {+-} 0.4 vs. 2.4 {+-} 0.4 nmol/L; and TSH, 4.5 {+-} 1.1 vs. 2.4 {+-} 1.1 mU/L. DNA samples from 18 family members were screened for the TR{beta} mutation, which results in the loss of a BsmI restriction site, and each of the 11 subjects with abnormal thyroid function tests were heterozygous for the mutant allele. The mutant TR{beta} expressed in Cos-I cells did not bind T{sub 3} (K{sub a} of C446R/wild-type, <0.05). T{sub 3} at a concentration up to 100 nmol/L failed to enhance the transactivation of a reporter gene, and the mutant receptor inhibited the T{sub 3}-mediated transcriptional activation of the wild-type TR{beta}. 17 refs., 3 figs., 1 tab.

  12. DEHP reduces thyroid hormones via interacting with hormone synthesis-related proteins, deiodinases, transthyretin, receptors, and hepatic enzymes in rats.

    PubMed

    Liu, Changjiang; Zhao, Letian; Wei, Li; Li, Lianbing

    2015-08-01

    Di-(2-ethylhexyl) phthalate (DEHP) is used extensively in many personal care and consumer products, resulting in widespread nonoccupational human exposure through multiple routes and media. Limited studies suggest that exposure to DEHP may be associated with altered thyroid function, but detailed mechanisms are unclear. In order to elucidate potential mechanisms by which DEHP disturbs thyroid hormone homeostasis, Sprague-Dawley (SD) rats were dosed with DEHP by gavage at 0, 250, 500, and 750 mg/kg/day for 30 days and sacrificed within 24 h after the last dose. Gene expressions of thyroid hormone receptors, deiodinases, transthyretin, and hepatic enzymes were measured by RT-PCR; protein levels of transthyretin were also analyzed by Western blot. Results showed that DEHP caused histological changes in the thyroid and follicular epithelial cell hypertrophy and hyperplasia were observed. DEHP significantly reduced thyroid hormones (T3, T4) and thyrotropin releasing hormone (TRH) levels, whereas thyroid stimulating hormone (TSH) was not affected. After exposure to DEHP, biosynthesis of thyroid hormones was suppressed, and sodium iodide symporter (NIS) and thyroid peroxidase (TPO) levels were significantly reduced. Additionally, levels of deiodinases and transthyretin were also affected. TSH receptor (TSHr) level was downregulated, while TRH receptor (TRHr) level was upregulated. Metabolism of thyroid hormones was accelerated due to elevated gene expression of hepatic enzymes (UDPGTs and CYP2B1) by DEHP. Taken together, observed findings indicate that DEHP could reduce thyroid hormones through influencing biosynthesis, biotransformation, biotransport, receptor levels, and metabolism of thyroid hormones. PMID:25913319

  13. (-) Arctigenin and (+) pinoresinol are antagonists of the human thyroid hormone receptor β.

    PubMed

    Ogungbe, Ifedayo Victor; Crouch, Rebecca A; Demeritte, Teresa

    2014-11-24

    Lignans are important biologically active dietary polyphenolic compounds. Consumption of foods that are rich in lignans is associated with positive health effects. Using modeling tools to probe the ligand-binding pockets of molecular receptors, we found that lignans have high docking affinity for the human thyroid hormone receptor β. Follow-up experimental results show that lignans (-) arctigenin and (+) pinoresinol are antagonists of the human thyroid hormone receptor β. The modeled complexes show key plausible interactions between the two ligands and important amino acid residues of the receptor. PMID:25383984

  14. (−) Arctigenin and (+) Pinoresinol Are Antagonists of the Human Thyroid Hormone Receptor β

    PubMed Central

    2015-01-01

    Lignans are important biologically active dietary polyphenolic compounds. Consumption of foods that are rich in lignans is associated with positive health effects. Using modeling tools to probe the ligand-binding pockets of molecular receptors, we found that lignans have high docking affinity for the human thyroid hormone receptor β. Follow-up experimental results show that lignans (−) arctigenin and (+) pinoresinol are antagonists of the human thyroid hormone receptor β. The modeled complexes show key plausible interactions between the two ligands and important amino acid residues of the receptor. PMID:25383984

  15. CORAL: prediction of binding affinity and efficacy of thyroid hormone receptor ligands.

    PubMed

    Toropova, A P; Toropov, A A; Benfenati, E

    2015-08-28

    Quantitative structure - activity relationships (QSARs) for binding affinity of thyroid hormone receptors based on attributes of molecular structure extracted from simplified molecular input-line entry systems (SMILES) are established using the CORAL software (http://www.insilico.eu/coral). The half maximal inhibitory concentration (IC50) is used as the measure of the binding affinity of thyroid hormone receptors. Molecular features which are statistically reliable promoters of increase and decrease for IC50 are suggested. The examples of modifications of molecular structure which lead to the increase or to the decrease of the endpoint are represented. PMID:26188619

  16. Thyroid hormone testing in the 21st century.

    PubMed

    Singh, Ravinder J; Kaur, Parmpreet

    2016-08-01

    Thyroid dysfunction and treatment follow up require accurate measurement of thyroid hormones. Most thyroid disease is treated on an outpatient basis; thus, assays have to be rapid and cost effective for optimal patient care. There are no rapid or point-of-care thyroid tests yet available, which could replace centralized automated thyroid testing. With the high population of thyroid dysfunction, it is important for thyroid assays to be available widely and locally. Immunoassays are most commonly used due to their ease and availability, but are limited in their accuracy. MS assays are much more specific, but are laborious with a high machine cost. Many hospitals may not be able to afford the machines and lack technical expertise. Sensitivity, specificity and standardization issues still result in substantial differences between various tests currently used for this population. To address these issues, new performance standards are being established by the professional organizations and technological advancements are being undertaken by instrument manufacturers. Automation solution is provided by various manufacturers and offers a choice for the hospital labs to select a platform which helps in their workflow and other chemistry testing. This has also resulted in decentralization and easy access to the thyroid testing. Even with these advancements, it is understandably confusing for clinicians to choose an assay for various clinical scenarios (20). As it becomes more available and standardized, LC-MS will continue to demonstrate its superiority to immunoassay. PMID:27329994

  17. Enhancer/Promoter Activities of the Long/Middle Wavelength-Sensitive Opsins of Vertebrates Mediated by Thyroid Hormone Receptor β2 and COUP-TFII

    PubMed Central

    Iida, Atsumi; Itoh, Toshio; Watanabe, Sumiko

    2013-01-01

    Cone photopigments (opsins) are crucial elements of, and the first detection module in, color vision. Individual opsins have different wavelength sensitivity patterns, and the temporal and spatial expression patterns of opsins are unique and stringently regulated. Long and middle wavelength-sensitive (L/M) opsins are of the same phylogenetic type. Although the roles of thyroid hormone/TRß2 and COUP-TFs in the transcriptional regulation of L/M opsins have been explored, the detailed mechanisms, including the target sequence in the enhancer of L/M opsins, have not been revealed. We aimed to reveal molecular mechanisms of L/M opsins in vertebrates. Using several human red opsin enhancer/promoter-luciferase reporter constructs, we found that TRß2 increased luciferase activities through the 5′-UTR and intron 3–4 region, whereas the presence of T3 affected only the intron 3–4 region-dependent luciferase activity. Furthermore, COUP-TFII suppressed intron 3–4 region-dependent luciferase activities. However, luciferase expression driven by the mouse M opsin intron 3–4 region was only slightly increased by TRß2, and rather enhanced by COUP-TFII. To determine whether these differential responses reflect differences between primates and rodents, we examined the enhancer/promoter region of the red opsin of the common marmoset. Interestingly, while TRß2 increased 5′-UTR- or intron 3–4 region-driven luciferase expression, as observed for the human red opsin, expression of the latter luciferase was not suppressed by COUP-TFII. In fact, immunostaining of common marmoset retinal sections revealed expression of COUP-TFII and red opsin in the cone cells. PMID:24058409

  18. Thyroid hormone receptor can modulate retinoic acid-mediated axis formation in frog embryogenesis.

    PubMed Central

    Banker, D E; Eisenman, R N

    1993-01-01

    Thyroid hormone receptor acts as a hormone-dependent transcriptional transactivator and as a transcriptional repressor in the absence of thyroid hormone. Specifically, thyroid hormone receptor can repress retinoic acid-induced gene expression through interactions with retinoic acid receptor. (Retinoic acid is a potent teratogen in the frog Xenopus laevis, acting at early embryonic stages to interfere with the formation of anterior structures. Endogenous retinoic acid is thought to act in normal anterior-posterior axis formation.) We have previously shown that thyroid hormone receptor RNA (alpha isotype) is expressed and polysome-associated during Xenopus embryogenesis preceding thyroid gland maturation and endogenous thyroid hormone production (D. E. Banker, J. Bigler, and R. N. Eisenman, Mol. Cell. Biol. 11:5079-5089, 1991). To determine whether thyroid hormone receptor might influence the effects of retinoic acid in early frog development, we have examined the results of ectopic thyroid hormone receptor expression on retinoic acid teratogenesis. We demonstrate that microinjections of full-length thyroid hormone receptor RNA protect injected embryos from retinoic acid teratogenesis. DNA binding is apparently essential to this protective function, as truncated thyroid hormone receptors, lacking DNA-binding domains but including hormone-binding and dimerization domains, do not protect from retinoic acid. We have shown that microinjections of these dominant-interfering thyroid hormone receptors, as well as anti-thyroid hormone receptor antibodies, increase retinoic acid teratogenesis in injected embryos, presumably by inactivating endogenous thyroid hormone receptor. This finding suggests that endogenous thyroid hormone receptors may act to limit retinoic acid sensitivity. On the other hand, after thyroid hormone treatment, ectopic thyroid hormone receptor mediates teratogenesis that is indistinguishable from the dorsoanterior deficiencies produced in retinoic acid

  19. Thyroid hormones in chronic heat exposed men

    NASA Astrophysics Data System (ADS)

    Gertner, A.; Israeli, R.; Lev, A.; Cassuto, Y.

    1983-03-01

    Previous reports have indicated that thyroid gland activity, is depressed in the heat. Total thyroxine (T4) and triiodothyronine (T3) serum levels in 17 workers of the metal work shop at a plant near the Dead Sea and 8 workers in Beer Sheva, Israel were examined. The metal workshop of the plant near the Dead Sea is part of a large chemical plant. The one in Beer Sheva is part of a large construction company. Maintenance work, as well as metal work projects are performed in both workshops. During the work shifts, the workers of the Dead Sea plant were exposed to temperatures ranging from 30 36°C (May Oct.) and 14 21°C (Dec. Feb). In Beer Sheva the range was 25 32°C (June Sept.) and 10 17°C (Dec. Feb.). Total T4 was measured by competitive protein binding and total T3 by radioimmunoassay in blood drawn before work (0700) in July and January. In summer. T4 was higher and T3 was lower for both groups than in winter. The observed summer T3 decrease may result from depressed extrathyroidal conversion of T4 to T3. We conclude that the regulation of energy metabolism in hot climates may be related to extrathyroidal conversion of T4 to T3.

  20. Effects of inorganic iodide, epidermal growth factor and phorbol ester on hormone synthesis by porcine thyroid follicles cultured in suspension

    SciTech Connect

    Kasai, Kikuo; Ichimura, Kenichi; Banba, Nobuyuki; Emoto, Tatsushi; Hiraiwa, Masaki; Hishinuma, Akira; Hattori, Yoshiyuki; Shimoda, Shinichi ); Yamaguchi, Fumihiko; Hosoya, Toichiro )

    1992-01-01

    Porcine thyroid follicles cultured in suspension for 96 h synthesized and secreted thyroid hormones in the presence of thyrotropin (TSH). The secretion of newly synthesized hormones was assessed by determining in the contents of thyroxine (T{sub 4}) and triiodothyronine (T{sub 3}) in the media and by paperchromatographic analysis of {sup 125}I-labeled hormones in the media where the follicles were cultured in the presence and absence of inhibitors of hormone synthesis. The hormone synthesis and secretion was modified by exogenously added NaI. The maximal response was obtained at 1 {mu}M. Thyroid peroxidase (TPO) activity in the cultured follicles with TSH for 96 h was dose-dependently inhibited by NaI. One hundred {mu}M and NaI completely inhibited TSH-induced TPO activity. Moreover, both epidermal growth factor and phorbol 12-myristate 13-acetate inhibited de novo hormone synthesis. An induction of TPO activity by TSH was also inhibited by either agent. These data provide direct evidences that thyroid hormone synthesis is regulated by NaI as well as TSH at least in part via regulation of TPO activity and also that both EGF and PMA are inhibitory on thyroid hormone formation.

  1. Low level exposure to the flame retardant BDE-209 reduces thyroid hormone levels and disrupts thyroid signaling in fathead minnows

    PubMed Central

    Noyes, Pamela D.; Lema, Sean C.; Macaulay, Laura J.; Douglas, Nora K.; Stapleton, Heather M.

    2013-01-01

    Polybrominated diphenyl ether (PBDE) flame retardants have been shown to disrupt thyroid hormone regulation, neurodevelopment, and reproduction in some animals. However, effects of the most heavily used PBDE, decabromodiphenyl ether (BDE-209), on thyroid functioning remain unclear. This study examined low-dose effects of BDE-209 on thyroid hormone levels and signaling in fathead minnows. Adult males received dietary exposures of BDE-209 at a low dose (~3 ng/g bw-day) and high dose (~300 ng/g bw-day) for 28 days followed by a 14-day depuration to evaluate recovery. Compared to controls, fish exposed to the low dose for 28 days experienced a 53% and 46% decline in circulating total thyroxine (TT4) and 3,5,3'-triiodothyronine (TT3), respectively, while TT4 and TT3 deficits at the high dose were 59% and 62%. Brain deiodinase activity (T4-ORD) was reduced by ~65% at both doses. BDE-209 elevated the relative mRNA expression of genes encoding deiodinases, nuclear thyroid receptors, and membrane transporters in the brain and liver in patterns that varied with time and dose, likely in compensation to hypothyroidism. Declines in the gonadal-somatic index (GSI) and increased mortality were also measured. Effects at the low dose were consistent with the high dose, suggesting non-linear relationships between BDE-209 exposures and thyroid dysfunction. PMID:23899252

  2. μ-Crystallin controls muscle function through thyroid hormone action.

    PubMed

    Seko, Daiki; Ogawa, Shizuka; Li, Tao-Sheng; Taimura, Akihiro; Ono, Yusuke

    2016-05-01

    μ-Crystallin (Crym), a thyroid hormone-binding protein, is abnormally up-regulated in the muscles of patients with facioscapulohumeral muscular dystrophy, a dominantly inherited progressive myopathy. However, the physiologic function of Crym in skeletal muscle remains to be elucidated. In this study, Crym was preferentially expressed in skeletal muscle throughout the body. Crym-knockout mice exhibited a significant hypertrophy of fast-twitch glycolytic type IIb fibers, causing an increase in grip strength and high intensity running ability in Crym-null mice. Genetic inactivation of Crym or blockade of Crym by siRNA-mediated knockdown up-regulated the gene expression of fast-glycolytic contractile fibers in satellite cell-derived myotubes in vitro These alterations in Crym-inactivated muscle were rescued by inhibition of thyroid hormone, even though Crym is a positive regulator of thyroid hormone action in nonmuscle cells. The results demonstrated that Crym is a crucial regulator of muscle plasticity, controlling metabolic and contractile properties of myofibers, and thus the selective inactivation of Crym may be a potential therapeutic target for muscle-wasting diseases, such as muscular dystrophies and age-related sarcopenia.-Seko, D., Ogawa, S., Li, T.-S., Taimura, A., Ono, Y. μ-Crystallin controls muscle function through thyroid hormone action. PMID:26718889

  3. Thyroid hormone effects on lactase expression by rat enterocytes.

    PubMed Central

    Hewitt, J E; Smith, M W

    1986-01-01

    Thyroxine (T4) and triiodothyronine (T3) injected into adult rats causes first an increase and then a decrease in lactase activity measured subsequently in intestinal homogenates of rat jejunum. These changes are not associated with any alteration in intestinal structure or enterocyte migration rate. Quantitative cytochemistry shows T4 stimulation and inhibition of lactase activity to take place in upper villus and crypt cells respectively (O- and C-enterocytes). T3 injected into thyroidectomized rats produces identical stimulatory effects on lactase development to T4 injected into control animals. Radioactive T3 is distributed in all cell types following intraperitoneal injection into thyroidectomized rats. Highest amounts of recovered T3 are found in C- rather than O- enterocytes. Quantitative autoradiography shows intracellular T3 to be located in nuclear and cytoplasmic compartments following intraperitoneal injection. Simultaneous injection of non-radioactive hormone displaces 50-75% of radioactive T3. These results are discussed in relation to what is already known concerning the ability of thyroid hormones to affect intestinal development. The future need to study the physiological effects of T3 at the cellular level in the intestine is also emphasized. Images Fig. 3 PMID:3098965

  4. Profile of thyroid hormones in breast cancer patients.

    PubMed

    Saraiva, P P; Figueiredo, N B; Padovani, C R; Brentani, M M; Nogueira, C R

    2005-05-01

    Estrogen involvement in breast cancer has been established; however, the association between breast cancer and thyroid diseases is controversial. Estrogen-like effects of thyroid hormone on breast cancer cell growth in culture have been reported. The objective of the present study was to determine the profile of thyroid hormones in breast cancer patients. Serum aliquots from 26 patients with breast cancer ranging in age from 30 to 85 years and age-matched normal controls (N = 22) were analyzed for free triiodothyronine (T3F), free thyroxine (T4F), thyroid-stimulating hormone (TSH), antiperoxidase antibody (TPO), and estradiol (E2). Estrogen receptor ss (ERss) was determined in tumor tissues by immunohistochemistry. Thyroid disease incidence was higher in patients than in controls (58 vs 18%, P < 0.05). Subclinical hyperthyroidism was the most frequent disorder in patients (31%); hypothyroidism (8%) and positive anti-TPO antibodies (19%) were also found. Subclinical hypothyroidism was the only dysfunction (18%) found in controls. Hyperthyroidism was associated with postmenopausal patients, as shown by significantly higher mean T3 and T4 values and lower TSH levels in this group of breast cancer patients than in controls. The majority of positive ERss tumors were clustered in the postmenopausal patients and all cases presenting subclinical hyperthyroidism in this subgroup concomitantly exhibited Erss-positive tumors. Subclinical hyperthyroidism was present in only one of 6 premenopausal patients. We show here that postmenopausal breast cancer patients have a significantly increased thyroid hormone/E2 ratio (P < 0.05), suggesting a possible tumor growth-promoting effect caused by this misbalance. PMID:15917958

  5. TRICLOSAN ALTERS THYROID HORMONES HOMEOSTASIS VIA UP-REGULATION OF HEPATIC CATABOLISM.

    EPA Science Inventory

    Triclosan (5-chloro-2-(2,4-dichlorophenoxy)phenol) is a chlorinated phenolic antibacterial compound used in household and hygiene products. The structural similarity of triclosan to thyroid hormones, in vitro studies demonstrating activation of the human pregnane X receptor (PXR)...

  6. TRICLOSAN AND ENDOCRINE DISRUPTION: EVIDENCE FOR ALTERATIONS IN THYROID HORMONE HOMEOSTASIS.

    EPA Science Inventory

    Impact Statement: Triclosan (5-chloro-2-(2,4-dichlorophenoxy)phenol) is a chlorinated phenolic antibacterial compound found as an active ingredient in many personal care and household products. Recent studies suggest that triclosan may alter thyroid hormone (TH) homeostasis via ...

  7. Thyroid Hormone Receptor-β (TRβ) Mediates Runt-Related Transcription Factor 2 (Runx2) Expression in Thyroid Cancer Cells: A Novel Signaling Pathway in Thyroid Cancer.

    PubMed

    Carr, Frances E; Tai, Phillip W L; Barnum, Michael S; Gillis, Noelle E; Evans, Katherine G; Taber, Thomas H; White, Jeffrey H; Tomczak, Jennifer A; Jaworski, Diane M; Zaidi, Sayyed K; Lian, Jane B; Stein, Janet L; Stein, Gary S

    2016-08-01

    Dysregulation of the thyroid hormone receptor (TR)β is common in human cancers. Restoration of functional TRβ delays tumor progression in models of thyroid and breast cancers implicating TRβ as a tumor suppressor. Conversely, aberrant expression of the runt-related transcription factor 2 (Runx2) is established in the progression and metastasis of thyroid, breast, and other cancers. Silencing of Runx2 diminishes tumor invasive characteristics. With TRβ as a tumor suppressor and Runx2 as a tumor promoter, a compelling question is whether there is a functional relationship between these regulatory factors in thyroid tumorigenesis. Here, we demonstrated that these proteins are reciprocally expressed in normal and malignant thyroid cells; TRβ is high in normal cells, and Runx2 is high in malignant cells. T3 induced a time- and concentration-dependent decrease in Runx2 expression. Silencing of TRβ by small interfering RNA knockdown resulted in a corresponding increase in Runx2 and Runx2-regulated genes, indicating that TRβ levels directly impact Runx2 expression and associated epithelial to mesenchymal transition molecules. TRβ specifically bound to 3 putative thyroid hormone-response element motifs within the Runx2-P1 promoter ((-)105/(+)133) as detected by EMSA and chromatin immunoprecipitation. TRβ suppressed Runx2 transcriptional activities, thus confirming TRβ regulation of Runx2 at functional thyroid hormone-response elements. Significantly, these findings indicate that a ratio of the tumor-suppressor TRβ and tumor-promoting Runx2 may reflect tumor aggression and serve as biomarkers in biopsy tissues. The discovery of this TRβ-Runx2 signaling supports the emerging role of TRβ as a tumor suppressor and reveals a novel pathway for intervention. PMID:27253998

  8. Thyroid hormones inhibit TGF-β signaling and attenuate fibrotic responses.

    PubMed

    Alonso-Merino, Elvira; Martín Orozco, Rosa; Ruíz-Llorente, Lidia; Martínez-Iglesias, Olaia A; Velasco-Martín, Juan Pedro; Montero-Pedrazuela, Ana; Fanjul-Rodríguez, Luisa; Contreras-Jurado, Constanza; Regadera, Javier; Aranda, Ana

    2016-06-14

    TGF-β, the most potent profibrogenic factor, acts by activating SMAD (mothers against decapentaplegic) transcription factors, which bind to SMAD-binding elements in target genes. Here, we show that the thyroid hormone triiodothyronine (T3), through binding to its nuclear receptors (TRs), is able to antagonize transcriptional activation by TGF-β/SMAD. This antagonism involves reduced phosphorylation of SMADs and a direct interaction of the receptors with SMAD3 and SMAD4 that is independent of T3-mediated transcriptional activity but requires residues in the receptor DNA binding domain. T3 reduces occupancy of SMAD-binding elements in response to TGF-β, reducing histone acetylation and inhibiting transcription. In agreement with this transcriptional cross-talk, T3 is able to antagonize fibrotic processes in vivo. Liver fibrosis induced by carbon tetrachloride is attenuated by thyroid hormone administration to mice, whereas aged TR knockout mice spontaneously accumulate collagen. Furthermore, skin fibrosis induced by bleomycin administration is also reduced by the thyroid hormones. These findings define an important function of the thyroid hormone receptors and suggest TR ligands could have beneficial effects to block the progression of fibrotic diseases. PMID:27247403

  9. Thyroid Hormone and Estrogen Regulate Exercise-Induced Growth Hormone Release

    PubMed Central

    Ignacio, Daniele Leão; da S. Silvestre, Diego H.; Cavalcanti-de-Albuquerque, João Paulo Albuquerque; Louzada, Ruy Andrade

    2015-01-01

    Growth hormone (GH) regulates whole body metabolism, and physical exercise is the most potent stimulus to induce its secretion in humans. The mechanisms underlying GH secretion after exercise remain to be defined. The aim of this study was to elucidate the role of estrogen and pituitary type 1 deiodinase (D1) activation on exercise-induced GH secretion. Ten days after bilateral ovariectomy, animals were submitted to 20 min of treadmill exercise at 75% of maximum aerobic capacity and tissues were harvested immediately or 30 min after exercise. Non-exercised animals were used as controls. A significant increase in D1 activity occurred immediately after exercise (~60%) in sham-operated animals and GH was higher (~6-fold) 30 min after exercise. Estrogen deficient rats exhibited basal levels of GH and D1 activity comparable to those found in control rats. However, after exercise both D1 activity and serum GH levels were blunted compared to sedentary rats. To understand the potential cause-effect of D1 activation in exercise-induced GH release, we pharmacologically blocked D1 activity by propylthiouracil (PTU) injection into intact rats and submitted them to the acute exercise session. D1 inhibition blocked exercise-induced GH secretion, although basal levels were unaltered. In conclusion, estrogen deficiency impairs the induction of thyroid hormone activating enzyme D1 in the pituitary, and GH release by acute exercise. Also, acute D1 activation is essential for exercise-induced GH response. PMID:25874614

  10. Thyroid hormone and estrogen regulate exercise-induced growth hormone release.

    PubMed

    Ignacio, Daniele Leão; da S Silvestre, Diego H; Cavalcanti-de-Albuquerque, João Paulo Albuquerque; Louzada, Ruy Andrade; Carvalho, Denise P; Werneck-de-Castro, João Pedro

    2015-01-01

    Growth hormone (GH) regulates whole body metabolism, and physical exercise is the most potent stimulus to induce its secretion in humans. The mechanisms underlying GH secretion after exercise remain to be defined. The aim of this study was to elucidate the role of estrogen and pituitary type 1 deiodinase (D1) activation on exercise-induced GH secretion. Ten days after bilateral ovariectomy, animals were submitted to 20 min of treadmill exercise at 75% of maximum aerobic capacity and tissues were harvested immediately or 30 min after exercise. Non-exercised animals were used as controls. A significant increase in D1 activity occurred immediately after exercise (~60%) in sham-operated animals and GH was higher (~6-fold) 30 min after exercise. Estrogen deficient rats exhibited basal levels of GH and D1 activity comparable to those found in control rats. However, after exercise both D1 activity and serum GH levels were blunted compared to sedentary rats. To understand the potential cause-effect of D1 activation in exercise-induced GH release, we pharmacologically blocked D1 activity by propylthiouracil (PTU) injection into intact rats and submitted them to the acute exercise session. D1 inhibition blocked exercise-induced GH secretion, although basal levels were unaltered. In conclusion, estrogen deficiency impairs the induction of thyroid hormone activating enzyme D1 in the pituitary, and GH release by acute exercise. Also, acute D1 activation is essential for exercise-induced GH response. PMID:25874614

  11. Maternal-fetal thyroid hormone relationships and the fetal brain.

    PubMed

    Morreale de Escobar, G; Obregon, M J; Escobar del Rey, F

    1988-01-01

    Thyroid hormones are transferred from the mother to the fetus. Thus, despite the deiodinating enzymes of the placenta (26), some T4 and T3 is transferred, both before and after onset of fetal thyroid function, at least in those cases where fetal thyroid function is impaired. It is also possible that transfer occurs under normal conditions. Maternal to fetal transfer of T3 and T4 is partially limited. But it might be enough to mitigate severe fetal T4 and T3 deficiencies. However, the mitigating effects of both hormones are not equivalent for all fetal tissues. 1) Maternal T4 mitigates T4 and T3 deficiency of most fetal tissues, the brain included. 2) Maternal T3 mitigates T3 deficiency only in some fetal tissues, the brain being excluded. It does not mitigate cerebral T3 deficiency even at doses which are toxic for the mother, and it does not depress fetal plasma TSH. 3) Normal maternal thyroid function is important for fetal development. Maternal hypothyroxinemia is damaging to the developing fetal brain early in gestation. It might also later have adverse effects in gestation, if the fetal thyroid is impaired. Normal maternal T3 levels might avoid overt hypothyroidism of some fetal tissues, but is of no benefit to the brain. PMID:3176827

  12. The Thyroid Hormone Receptors Inhibit Hepatic Interleukin-6 Signaling During Endotoxemia

    PubMed Central

    Contreras-Jurado, Constanza; Alonso-Merino, Elvira; Saiz-Ladera, Cristina; Valiño, Arturo José; Regadera, Javier; Alemany, Susana; Aranda, Ana

    2016-01-01

    Decreased thyroidal hormone production is found during lipopolysaccharide (LPS)-induced endotoxic shock in animals as well as in critically ill patients. Here we studied the role of the thyroid hormone receptors (TRs) in activation of STAT3, NF-κB and ERK, which play a key role in the response to inflammatory cytokines during sepsis. TR knockout mice showed down-regulation of hepatic inflammatory mediators, including interleukin 6 (IL-6) in response to LPS. Paradoxically, STAT3 and ERK activity were higher, suggesting that TRs could act as endogenous repressors of these pathways. Furthermore, hyperthyroidism increased cytokine production and mortality in response to LPS, despite decreasing hepatic STAT3 and ERK activity. This suggested that TRs could directly repress the response of the cells to inflammatory mediators. Indeed, we found that the thyroid hormone T3 suppresses IL-6 signalling in macrophages and hepatocarcinoma cells, inhibiting STAT3 activation. Consequently, the hormone strongly antagonizes IL-6-stimulated gene transcription, reducing STAT3 recruitment and histone acetylation at IL-6 target promoters. In conclusion, TRs are potent regulators of inflammatory responses and immune homeostasis during sepsis. Reduced responses to IL-6 should serve as a negative feedback mechanism for preventing deleterious effects of excessive hormone signaling during infections. PMID:27484112

  13. The Thyroid Hormone Receptors Inhibit Hepatic Interleukin-6 Signaling During Endotoxemia.

    PubMed

    Contreras-Jurado, Constanza; Alonso-Merino, Elvira; Saiz-Ladera, Cristina; Valiño, Arturo José; Regadera, Javier; Alemany, Susana; Aranda, Ana

    2016-01-01

    Decreased thyroidal hormone production is found during lipopolysaccharide (LPS)-induced endotoxic shock in animals as well as in critically ill patients. Here we studied the role of the thyroid hormone receptors (TRs) in activation of STAT3, NF-κB and ERK, which play a key role in the response to inflammatory cytokines during sepsis. TR knockout mice showed down-regulation of hepatic inflammatory mediators, including interleukin 6 (IL-6) in response to LPS. Paradoxically, STAT3 and ERK activity were higher, suggesting that TRs could act as endogenous repressors of these pathways. Furthermore, hyperthyroidism increased cytokine production and mortality in response to LPS, despite decreasing hepatic STAT3 and ERK activity. This suggested that TRs could directly repress the response of the cells to inflammatory mediators. Indeed, we found that the thyroid hormone T3 suppresses IL-6 signalling in macrophages and hepatocarcinoma cells, inhibiting STAT3 activation. Consequently, the hormone strongly antagonizes IL-6-stimulated gene transcription, reducing STAT3 recruitment and histone acetylation at IL-6 target promoters. In conclusion, TRs are potent regulators of inflammatory responses and immune homeostasis during sepsis. Reduced responses to IL-6 should serve as a negative feedback mechanism for preventing deleterious effects of excessive hormone signaling during infections. PMID:27484112

  14. Thyroid Hormones, Autoantibodies, Ultrasonography, and Clinical Parameters for Predicting Thyroid Cancer

    PubMed Central

    He, Lin-zheng; Zeng, Tian-shu; Pu, Lin; Pan, Shi-xiu; Xia, Wen-fang; Chen, Lu-lu

    2016-01-01

    Our objective was to evaluate thyroid nodule malignancy prediction using thyroid function tests, autoantibodies, ultrasonographic imaging, and clinical data. We conducted a retrospective cohort study in 1400 patients with nodular thyroid disease (NTD). The thyroid stimulating hormone (TSH) concentration was significantly higher in patients with differentiated thyroid cancer (DTC) versus benign thyroid nodular disease (BTND) (p = 0.004). The receiver operating characteristic curve of TSH showed an AUC of 0.58 (95% CI 0.53–0.62, p = 0.001), sensitivity of 74%, and specificity of 57% at a cut-off of 1.59 mIU/L. There was an incremental increase in TSH concentration along with the increasing tumor size (p < 0.001). Thyroglobulin antibody (TgAb) concentration was associated with an increased risk of malignancy (p = 0.029), but this association was lost when the effect of TSH was taken into account (p = 0.11). Thyroid ultrasonographic characteristics, including fewer than three nodules, hypoechoic appearance, solid component, poorly defined margin, intranodular or peripheral-intranodular flow, and punctate calcification, can be used to predict the risk of thyroid cancer. In conclusion, our study suggests that preoperative serum TSH concentration, age, and ultrasonographic features can be used to predict the risk of malignancy in patients with NTD. PMID:27313612

  15. Disruption of thyroid hormone functions by low dose exposure of tributyltin: an in vitro and in vivo approach.

    PubMed

    Sharan, Shruti; Nikhil, Kumar; Roy, Partha

    2014-09-15

    Triorganotins, such as tributyltin chloride (TBTCl), are environmental contaminants that are commonly found in the antifouling paints used in ships and other vessels. The importance of TBTCl as an endocrine-disrupting chemical (EDC) in different animal models is well known; however, its adverse effects on the thyroid gland are less understood. Hence, in the present study, we aimed to evaluate the thyroid-disrupting effects of this chemical using both in vitro and in vivo approaches. We used HepG2 hepatocarcinoma cells for the in vitro studies, as they are a thyroid hormone receptor (TR)-positive and thyroid responsive cell line. For the in vivo studies, Swiss albino male mice were exposed to three doses of TBTCl (0.5, 5 and 50μg/kg/day) for 45days. TBTCl showed a hypo-thyroidal effect in vivo. Low-dose treatment of TBTCl exposure markedly decreased the serum thyroid hormone levels via the down-regulation of the thyroid peroxidase (TPO) and thyroglobulin (Tg) genes by 40% and 25%, respectively, while augmenting the thyroid stimulating hormone (TSH) levels. Thyroid-stimulating hormone receptor (TSHR) expression was up-regulated in the thyroid glands of treated mice by 6.6-fold relative to vehicle-treated mice (p<0.05). In the transient transactivation assays, TBTCl suppressed T3 mediated transcriptional activity in a dose-dependent manner. In addition, TBTCl was found to decrease the expression of TR. The present study thus indicates that low concentrations of TBTCl suppress TR transcription by disrupting the physiological concentrations of T3/T4, followed by the recruitment of NCoR to TR, providing a novel insight into the thyroid hormone-disrupting effects of this chemical. PMID:25101840

  16. Free and total thyroid hormones in humans at extreme altitude

    NASA Astrophysics Data System (ADS)

    Basu, Minakshi; Pal, K.; Malhotra, A. S.; Prasad, R.; Sawhney, R. C.

    1995-03-01

    Alterations in circulatory levels of total T4 (TT4), total T3 (TT3), free T4 (FT4), free T3 (FT3), thyrotropin (TSH) and T3 uptake (T3U) were studied in male and female sea-level residents (SLR) at sea level, in Armed forces personnel staying at high altitude (3750 m) for prolonged duration (acclimatized lowlanders, ALL) and in high-altitude natives (HAN). Identical studies were also performed on male ALL who trekked to an extreme altitude of 5080 m and stayed at an altitude of more than 6300 m for about 6 months. The total as well as free thyroid hormones were found to be significantly higher in ALL and HAN as compared to SLR values. Both male as well as female HAN had higher levels of thyroid hormones. The rise in hormone levels in different ALL ethnic groups drawn from amongst the southern and northern parts of the country was more or less identical. In both HAN and ALL a decline in FT3 and FT4 occurred when these subjects trekked at subzero temperatures to extreme altitude of 5080 m but the levels were found to be higher in ALL who stayed at 6300 m for a prolonged duration. Plasma TSH did not show any appreciable change at lower altitudes but was found to be decreased at extreme altitude. The increase in thyroid hormones at high altitude was not due to an increase in hormone binding proteins, since T3U was found to be higher at high altitudes. A decline in TSH and hormone binding proteins and an increase in the free moiety of the hormones is indicative of a subtle degree of tissue hyperthyroidism which may be playing an important role in combating the extreme cold and hypoxic environment of high altitudes.

  17. Thyroid hormone is required for hypothalamic neurons regulating cardiovascular functions

    PubMed Central

    Mittag, Jens; Lyons, David J.; Sällström, Johan; Vujovic, Milica; Dudazy-Gralla, Susi; Warner, Amy; Wallis, Karin; Alkemade, Anneke; Nordström, Kristina; Monyer, Hannah; Broberger, Christian; Arner, Anders; Vennström, Björn

    2012-01-01

    Thyroid hormone is well known for its profound direct effects on cardiovascular function and metabolism. Recent evidence, however, suggests that the hormone also regulates these systems indirectly through the central nervous system. While some of the molecular mechanisms underlying the hormone’s central control of metabolism have been identified, its actions in the central cardiovascular control have remained enigmatic. Here, we describe a previously unknown population of parvalbuminergic neurons in the anterior hypothalamus that requires thyroid hormone receptor signaling for proper development. Specific stereotaxic ablation of these cells in the mouse resulted in hypertension and temperature-dependent tachycardia, indicating a role in the central autonomic control of blood pressure and heart rate. Moreover, the neurons exhibited intrinsic temperature sensitivity in patch-clamping experiments, providing a new connection between cardiovascular function and core temperature. Thus, the data identify what we believe to be a novel hypothalamic cell population potentially important for understanding hypertension and indicate developmental hypothyroidism as an epigenetic risk factor for cardiovascular disorders. Furthermore, the findings may be beneficial for treatment of the recently identified patients that have a mutation in thyroid hormone receptor α1. PMID:23257356

  18. Thyroid hormones and thyroid disease in relation to perchlorate dose and residence near a superfund site.

    PubMed

    Gold, Ellen B; Blount, Benjamin C; O'Neill Rasor, Marianne; Lee, Jennifer S; Alwis, Udeni; Srivastav, Anup; Kim, Kyoungmi

    2013-07-01

    Perchlorate is a widely occurring contaminant, which can competitively inhibit iodide uptake and thus thyroid hormone production. The health effects of chronic low dose perchlorate exposure are largely unknown. In a community-based study, we compared thyroid function and disease in women with differing likelihoods of prior and current perchlorate exposure. Residential blocks were randomly selected from areas: (1) with potential perchlorate exposure via drinking water; (2) with potential exposure to environmental contaminants; and (3) neighboring but without such exposures. Eligibility included having lived in the area for ≥6 months and aged 20-50 years during 1988-1996 (during documented drinking water well contamination). We interviewed 814 women and collected blood samples (assayed for thyroid stimulating hormone and free thyroxine) from 431 interviewed women. Daily urine samples were assayed for perchlorate and iodide for 178 premenopausal women with blood samples. We performed multivariable regression analyses comparing thyroid function and disease by residential area and by urinary perchlorate dose adjusted for urinary iodide levels. Residential location and current perchlorate dose were not associated with thyroid function or disease. No persistent effect of perchlorate on thyroid function or disease was found several years after contaminated wells were capped. PMID:22968349

  19. Thyroid Hormones and Thyroid Disease in Relation to Perchlorate Dose and Residence Near a Superfund Site

    PubMed Central

    Gold, Ellen B.; Blount, Benjamin C.; Rasor, Marianne O’Neill; Lee, Jennifer S.; Alwis, Udeni; Srivastav, Anup; Kim, Kyoungmi

    2013-01-01

    Background Perchlorate is a widely occurring contaminant, which can competitively inhibit iodide uptake and thus thyroid hormone production. The health effects of chronic low dose perchlorate exposure are largely unknown. Objectives In a community-based study, we compared thyroid function and disease in women with differing likelihoods of prior and current perchlorate exposure. Methods Residential blocks were randomly selected from areas: 1) with potential perchlorate exposure via drinking water; 2) with potential exposure to environmental contaminants; and 3) neighboring but without such exposures. Eligibility included having lived in the area for ≥6 months and aged 20–50 years during 1988–1996 (during documented drinking water well contamination). We interviewed 814 women and collected blood samples (assayed for thyroid stimulating hormone [TSH] and free thyroxine [fT4]) from 431 interviewed women. Daily urine samples were assayed for perchlorate and iodide for 178 premenopausal women with blood samples. We performed multivariable regression analyses comparing thyroid function and disease by residential area and by urinary perchlorate dose adjusted for urinary iodide levels. Results Residential location and current perchlorate dose were not associated with thyroid function or disease. Conclusions No persistent effect of perchlorate on thyroid function or disease was found several years after contaminated wells were capped. PMID:22968349

  20. A Pathway Approach to Predicting Thyroid Hormone Disrupting Activity of Chemicals Using in vitro, ex vivo and in vivo Assays

    EPA Science Inventory

    The potential for commercial and industrial chemicals that may be released into the environment to have endocrine disrupting activity is of concern for human health and wildlife. Most initial endocrine disruptor research has focused on estrogen- or androgen-mediated pathways. In ...

  1. Visualisation of thyroid hormone synthesis by ion imaging

    NASA Astrophysics Data System (ADS)

    Audinot, J. N.; Senou, M.; Migeon, H.-N.; Many, M.-C.

    2008-12-01

    The main function of the thyroid gland is to make hormones, T4 and T3, which are essential for the regulation of metabolic processes throughout the body. Caveolae harbour is the key enzymes involved in this iodide organification. The analyses of thyroids from normal mice and caveolin-1 Knockout mice (mice deficient in caveolin) have been performed using the SIMS imaging. In the thyroid of control mice, the epithelium is homogeneous and iodine ( 127I) is observed in the follicle lumen. In Knockout mice, we observe an accumulation of intracellular vesicles and apoptotic nuclei resulting from oxidative stress due to H 2O 2 overproduction also inducing apical lesions of the thyrocytes, at the site of iodine organification and H 2O 2 generation. We also observe in the Knockout mice an accumulation of 127I in the cellular cytoplasm and an absence of the iodine in some follicular lumina, indicating a problem at the level of iodine organification.

  2. Thyroid hormones according to gestational age in pregnant Spanish women

    PubMed Central

    2009-01-01

    Background Thyroid function changes during pregnancy and maternal thyroid dysfunction have been associated with adverse outcomes. Our aim was to evaluate thyroid hormones levels in pregnant women resident in Aragon, Spain. Findings Samples for 1198 pregnant women with no apparent thyroid disorders were analyzed, using paramagnetic microparticle and chemiluminescent detection technologies, in order to determine levels of thyroid stimulating hormone (TSH), free triiodothyronine (FT3), free thyroxine (FT4), thyroid peroxidase antibodies (TPO-Ab), and thyroglobulin antibodies (Tg-Ab). Of the women in our sample, 85.22% had normal values for TPO-Ab and Tg-Ab and 14.77% had results revealing the presence of autoimmune diseases of the thyroid. The thyroid hormone reference values obtained according to gestational age (in brackets) were as follows: for free T3, values were 3.38 ± 0.52 pg/mL (<11 weeks), 3.45 ± 0.54 pg/mL (11-20 weeks), 3.32 ± 0.43 pg/mL (21-30 weeks), 3.21 ± 0.53 pg/mL (31-36 weeks), and 3.23 ± 0.41 pg/mL (>36 weeks); for free T4, values were 1.10 ± 0.14 ng/dL (<10 weeks), 1.04 ± 0.14 ng/dL (11-20 weeks), 0.93 ± 0.12 ng/dL (21-30 weeks), 0.90 ± 0.13 ng/dL (31-36 weeks), and 0.80 ± 0.21 ng/dL (>36 weeks); and for TSH, values were (μIU/mL): 1.12 ± 0.69 (<10 weeks), 1.05 ± 0.67 (11-20 weeks), 1.19 ± 0.60 (21-30 weeks), 1.38 ± 0.76 (31-36 weeks), and 1.46 ± 0.72 (>36 weeks). Conclusion Pregnant women with normal antibody values according to gestational age had values for FT4 and TSH, but not for FT3, that differed to a statistically significant degree. The values we describe can be used as reference values for the Aragon region of Spain. PMID:19939287

  3. Effect of selenium deficiency on hepatic type I 5-iodothyronine deiodinase activity and hepatic thyroid hormone levels in the rat.

    PubMed Central

    Beckett, G J; Russell, A; Nicol, F; Sahu, P; Wolf, C R; Arthur, J R

    1992-01-01

    Selenium deficiency in rats for a period of up to 6 weeks inhibited both the production of 3,3',5-tri-iodothyronine (T3) from thyroxine (T4) (5'-deiodination) and also the catabolism of T3 to 3,3'-di-iodothyronine (5-deiodination) in liver homogenates. The hepatic stores of T3 were decreased by only 8% in selenium deficiency, despite the T3 production rate from T4 being only 7% of the rate found in selenium-supplemented rats. Hepatic glutathione S-transferase (GST) activity was increased in both hypothyroidism and selenium deficiency, but apparently by different mechanisms, since mRNA expression for this family of enzymes was lowered by hypothyroidism and increased in selenium deficiency. It is concluded that, since both T3 production and catabolism are inhibited by selenium deficiency, there is little change in hepatic T3 stores, and therefore the changes in the activity of certain hepatic enzymes, such as GST, that are found in selenium deficiency are not the result of tissue hypothyroidism. Images Fig. 1. PMID:1546962

  4. Developmental thyroid hormone insufficiency and brain development: A role for brain-derived neurotrophic factor (BDNF)?*

    EPA Science Inventory

    Thyroid hormones (TH) are essential for normal brain development. Even subclinical hypothyroidism experienced in utero can result in neuropsychological deficits in children despite normal thyroid status at birth. Neurotrophins have been implicated in a host of brain cellular func...

  5. Thyroid hormone status and pituitary function in adult rats given oral doses of perfluorooctanesulfonate (PFOS)

    EPA Science Inventory

    Perfluorooctanesulfonate (PFOS) is widely distributed and persistent in humans and wildlife. Prior toxicological studies have reported decreased total and free thyroid hormones in serum without a major compensatory rise in thyrotropin (TSH) or altered thyroid gland histology. Alt...

  6. Thyroid hormone increases bulk histones expression by enhancing translational efficiency.

    PubMed

    Zambrano, Alberto; García-Carpizo, Verónica; Villamuera, Raquel; Aranda, Ana

    2015-01-01

    The expression of canonical histones is normally coupled to DNA synthesis during the S phase of the cell cycle. Replication-dependent histone mRNAs do not contain a poly(A) tail at their 3' terminus, but instead possess a stem-loop motif, the binding site for the stem-loop binding protein (SLBP), which regulates mRNA processing, stability, and relocation to polysomes. Here we show that the thyroid hormone can increase the levels of canonical histones independent of DNA replication. Incubation of mouse embryonic fibroblasts with T3 increases the total levels of histones, and expression of the thyroid hormone receptor β induces a further increase. This is not restricted to mouse embryonic fibroblasts, because T3 also raises histone expression in other cell lines. T3 does not increase histone mRNA or SLBP levels, suggesting that T3 regulates histone expression by a posttranscriptional mechanism. Indeed, T3 enhanced translational efficiency, inducing relocation of histone mRNA to heavy polysomes. Increased translation was associated with augmented transcription of the eukaryotic translation initiation factor 4 γ2 (EIF4G2). T3 induced EIF4G2 protein and mRNA levels and the thyroid hormone receptor bound to the promoter region of the Eif4g2 gene. Induction of EIF4G2 was essential for T3-dependent histone induction, because depletion of this factor abolished histone increase. These results point out the importance of the thyroid hormones on the posttranscriptional regulation of histone biosynthesis in a cell cycle-independent manner and also suggest the potential regulation of eukaryotic translation by the modulation of the initiation factor EIF4G2, which also operates in the translation of canonical mRNAs. PMID:25422881

  7. Neither bST nor Growth Hormone Releasing Factor Alter Expression of Thyroid Hormone Receptors in Liver and Mammary Tissues

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Physiological effects of thyroid hormones are mediated primarily by binding of triiodothyronine, to specific nuclear receptors. It has been hypothesized that organ-specific changes in production of triiodothyronine from its prohormone, thyroxine, target the action of thyroid hormones to the mammary...

  8. The Content of Thyroid Hormone Receptor α in Ewe Kisspeptin Neurones is not Season-Dependent.

    PubMed

    Dufourny, L; Gennetay, D; Martinet, S; Lomet, D; Caraty, A

    2016-02-01

    Seasonal reproduction is grounded in several mechanisms, among which are plasticity in both hormone synthesis and neuronal networks. Increased daylength on long days (LD) translates into local tri-iodothyronin (T3) production in the mediobasal hypothalamus that will enable the transition to the anoestrus season in sheep. The photoperiod also strongly affects the content of kisspeptin (Kiss), a hypothalamic neuropeptide exerting a potent stimulatory effect on gonadotrophin-releasing hormone release. Our hypothesis was that T3 directly inhibits Kiss release during LD. Using double immunocytochemistry, we first searched for coexpression of thyroid hormone receptor (THR)α in Kiss neurones in ewes with an active or inactive gonadotrophic axis. In both the preoptic area and the arcuate nucleus, most Kiss neurones were labelled by THR antibody under both physiological/photoperiodic conditions. These results suggest thyroid hormones may affect Kiss synthesis and release all through the year. We then attempted to assess the influence of T3 on Kiss content in hypothalamic explants sampled from ewes with an active gonadotrophic axis. Kiss produced by hypothalamic explants cultured with different doses of T3 (300 or 600 pg) and subjected to different times of incubation (2 or 24 h) was measured. No significant effects of T3 on Kiss tissular content were observed for the two doses of T3 and for the two incubation times. In light of these findings, potential reasons for the divergent effects of thyroid hormones on Kiss content are discussed. Our data emphasise that the effects of thyroid hormone on Kiss synthesis are not one-sided and may affect a wide range of functions. PMID:26644229

  9. [Alteration of thyroid hormone secretion after long-term exposure to low doses of endocrine disruptor DDT].

    PubMed

    Iaglova, N V; Iaglov, V V

    2014-01-01

    Endocrine disruptors are exogenous substances that exhibit hormone-like action and consequently disrupt homeostatic action of endogenous hormones. DDT is the most common disruptor. The objective was to evaluate changes in thyroid hormone secretion after long-term exposure to low doses of DDT. The experiment was performed on male Wistar rats. The rats were given DDT at doses of 1.89±0.86 мg/kg/day and 7.77±0.17 мg/kg/day for 6 and 10 weeks. Dose dependent increase of serum total thyroxine, total triiodthyronine, and thyroid peroxidase was revealed after 6 weeks exposure. After 10 weeks free thyroxine secretion was reduced. Such alterations of the thyroid status are typical for iodine deficient goiter. The data obtained indicate that the main mechanism of DDT action includes disruption of thyroxine secretion by thyrocytes, but not inhibition of deiodinase activity and decrease of blood thyroid binding proteins. PMID:25552505

  10. Degradation of thyroid hormones by phagocytosing human leukocytes.

    PubMed

    Klebanoff, S J; Green, W L

    1973-01-01

    untreated normal or MPO-deficient leukocytes and by normal leukocytes treated with azide or methimazole. These data suggest that both MPO-dependent and MPO-independent systems are involved in the degradation of T(4) and T(3) by phagocytosing leukocytes. The role of leukocytic degradation of T(4) and T(3) in thyroid hormone economy and in leukocytic microbicidal activity is considered. PMID:4629909

  11. On the thyroid hormone-induced increase in respiratory capacity of isolated rat hepatocytes.

    PubMed

    Gregory, R B; Berry, M N

    1991-12-01

    The respiratory capacities of hepatocytes, derived from hypothyroid, euthyroid and hyperthyroid rats, have been compared by measuring rates of oxygen uptake and by titrating components of the respiratory chain with specific inhibitors. Thyroid hormone increased the maximal rate of substrate-stimulated respiration and also increased the degree of ionophore-stimulated oxygen uptake. In titration experiments, similar concentrations of oligomycin or antimycin were required for maximal inhibition of respiration regardless of thyroid state, suggesting that the changes in respiratory capacity were not the result of variation in the amounts of ATP synthase or cytochrome b. However, less rotenone was required for maximal inhibition of respiration in the hypothyroid state than in cells from euthyroid or hyperthyroid rats, implying that hepatocytes from hypothyroid animals contain less NADH dehydrogenase. The concentration of carboxyatractyloside necessary for maximal inhibition of respiration was 100 microM in hepatocytes from hypothyroid rats, but 200 microM and 300 microM in hepatocytes from euthyroid and hyperthyroid rats, respectively, indicating a possible correlation between levels of thyroid hormone and the amount or activity of adenine nucleotide translocase. The increased capacity for coupled respiration in response to thyroid hormone is not associated with an increase in the components of the electron transport chain or ATP synthase, but correlates with an increased activity of adenine nucleotide translocase. PMID:1751550

  12. THYROID HORMONE INSUFFICIENCY AND BRAIN DEVELOPMENT -- DETERMINATION OF NEUROTOXICITY AT LOW LEVELS OF HORMONE DISRUPTION.

    EPA Science Inventory

    Thyroid hormone (TH) deficiencies during development produce deleterious effects on brain structure and function. The degree to which TH must be perturbed to induce neurotoxicity remains unclear. The present study was conducted as part of a Cooperative Agreement between US EPA, U...

  13. Effects of thyroid hormones on the antioxidative status in the uterus of young adult rats

    PubMed Central

    KONG, Lingfa; WEI, Quanwei; FEDAIL, Jaafar Sulieman; SHI, Fangxiong; NAGAOKA, Kentaro; WATANABE, Gen

    2015-01-01

    Thyroid hormones and oxidative stress play significant roles in the normal functioning of the female reproductive system. Nitric oxide (NO), a free radical synthesized by nitric oxide synthases (NOS), participates in the regulation of thyroid function and is also a good biomarker for assessment of the oxidative stress status. Therefore, the purpose of this study was to investigate effects of thyroid hormones on uterine antioxidative status in young adult rats. Thirty immature female Sprague-Dawley rats were randomly divided into three groups: control, hypothyroid (hypo-T) and hyperthyroid (hyper-T). The results showed the body weights decreased significantly in both the hypo-T and hyper-T groups and that uterine weights were decreased significantly in the hypo-T group. The serum concentrations of total triiodothyronine (T3) and thyroxine (T4), as well as estradiol (E2), were significantly decreased in the hypo-T group, but increased in the hyper-T group. The progesterone (P4) concentrations in the hypo- and hyperthyroid rats markedly decreased. Immunohistochemistry results provided evidence that thyroid hormone nuclear receptor α/β (TRα/β) and three NOS isoforms were located in different cell types of rat uteri. The NO content and total NOS and inducible NOS (iNOS) activities were markedly diminished in the hypo-T group but increased in the hyper-T group. Moreover, the activities of both glutathione peroxidase (GSH-Px) and catalase (CAT) exhibited significant decreases and increases in the hypo-T and hyper-T groups, respectively. The malondialdehyde (MDA) contents in both the hypo-T and hyper-T groups showed a significant increase. Total superoxide dismutase (T-SOD) activity in the hypo- and hyper-T rats markedly decreased. In conclusion, these results indicated that thyroid hormones have an important influence on the modulation of uterine antioxidative status. PMID:25797533

  14. Abnormal thyroid hormone metabolism in mice lacking the monocarboxylate transporter 8.

    PubMed

    Trajkovic, Marija; Visser, Theo J; Mittag, Jens; Horn, Sigrun; Lukas, Jan; Darras, Veerle M; Raivich, Genadij; Bauer, Karl; Heuer, Heike

    2007-03-01

    In humans, inactivating mutations in the gene of the thyroid hormone transporter monocarboxylate transporter 8 (MCT8; SLC16A2) lead to severe forms of psychomotor retardation combined with imbalanced thyroid hormone serum levels. The MCT8-null mice described here, however, developed without overt deficits but also exhibited distorted 3,5,3'-triiodothyronine (T3) and thyroxine (T4) serum levels, resulting in increased hepatic activity of type 1 deiodinase (D1). In the mutants' brains, entry of T4 was not affected, but uptake of T3 was diminished. Moreover, the T4 and T3 content in the brain of MCT8-null mice was decreased, the activity of D2 was increased, and D3 activity was decreased, indicating the hypothyroid state of this tissue. In the CNS, analysis of T3 target genes revealed that in the mutants, the neuronal T3 uptake was impaired in an area-specific manner, with strongly elevated thyrotropin-releasing hormone transcript levels in the hypothalamic paraventricular nucleus and slightly decreased RC3 mRNA expression in striatal neurons; however, cerebellar Purkinje cells appeared unaffected, since they did not exhibit dendritic outgrowth defects and responded normally to T3 treatment in vitro. In conclusion, the circulating thyroid hormone levels of MCT8-null mice closely resemble those of humans with MCT8 mutations, yet in the mice, CNS development is only partially affected. PMID:17318265

  15. Arsenic impacted the development, thyroid hormone and gene transcription of thyroid hormone receptors in bighead carp larvae (Hypophthalmichthys nobilis).

    PubMed

    Sun, Hong-Jie; Xiang, Ping; Tang, Ming-Hu; Sun, Li; Ma, Lena Q

    2016-02-13

    Arsenic (As) contamination in aquatic environment adversely impacts aquatic organisms. The present study assessed the toxicity of different As species and concentrations on bighead carp (Hypophthalmichthys nobilis) at early life stage, a major fish in Yangtze River, China. We measured the changes in embryo and larvae survival rate, larvae aberration, concentrations of thyroid hormone thyroxine, and transcription levels of thyroid hormone receptors (TRs) in fish larvae after exposing to arsenite (AsIII) or arsenate (AsV) at 0, 10, 30, 50, 100, or 150 μg L(-1) for 78 h. As concentrations ≤ 150 μg L(-1) had limited effect on embryo survival rate (6-8% inhibition), but larvae survival rate decreased to 53-57% and larvae aberration rate increased to 20-24% after As exposure. Moreover, thyroxine levels elevated by 23% and 50% at 100 μg L(-1) AsIII and 150 μg L(-1) AsV. Besides, AsIII and AsV decreased the transcriptional levels of TRα by 72 and 53%, and TRβ by 91 and 81% at 150 μg L(-1) As. Our data showed that AsIII and AsV had limited effect on carp embryo survival, but they were both toxic to carp larvae, with AsIII showing more effect than AsV. As concentrations <150μg L(-1) adversely influenced the development of bighead carp larvae and disturbed their thyroid hormone homeostasis. PMID:26513566

  16. Structure and Function of Thyroid Hormone Plasma Membrane Transporters

    PubMed Central

    Schweizer, Ulrich; Johannes, Jörg; Bayer, Dorothea; Braun, Doreen

    2014-01-01

    Thyroid hormones (TH) cross the plasma membrane with the help of transporter proteins. As charged amino acid derivatives, TH cannot simply diffuse across a lipid bilayer membrane, despite their notorious hydrophobicity. The identification of monocarboxylate transporter 8 (MCT8, SLC16A2) as a specific and very active TH transporter paved the way to the finding that mutations in the MCT8 gene cause a syndrome of psychomotor retardation in humans. The purpose of this review is to introduce the current model of transmembrane transport and highlight the diversity of TH transmembrane transporters. The interactions of TH with plasma transfer proteins, T3 receptors, and deiodinase are summarized. It is shown that proteins may bind TH owing to their hydrophobic character in hydrophobic cavities and/or by specific polar interaction with the phenolic hydroxyl, the aminopropionic acid moiety, and by weak polar interactions with the iodine atoms. These findings are compared with our understanding of how TH transporters interact with substrate. The presumed effects of mutations in MCT8 on protein folding and transport function are explained in light of the available homology model. PMID:25538896

  17. Thyroid Hormone T3 Counteracts STZ Induced Diabetes in Mouse

    PubMed Central

    Madaro, Luca; Ranieri, Danilo; Lupoi, Lorenzo; Stigliano, Antonio; Torrisi, Maria Rosaria; Bouchè, Marina; Toscano, Vincenzo; Misiti, Silvia

    2011-01-01

    This study intended to demonstrate that the thyroid hormone T3 counteracts the onset of a Streptozotocin (STZ) induced diabetes in wild type mice. To test our hypothesis diabetes has been induced in Balb/c male mice by multiple low dose Streptozotocin injection; and a group of mice was contemporaneously injected with T3. After 48 h mice were tested for glucose tolerance test, insulin serum levels and then sacrified. Whole pancreata were utilized for morphological and biochemical analyses, while protein extracts and RNA were utilized for expression analyses of specific molecules. The results showed that islets from T3 treated mice were comparable to age- and sex-matched control, untreated mice in number, shape, dimension, consistency, ultrastructure, insulin and glucagon levels, Tunel positivity and caspases activation, while all the cited parameters and molecules were altered by STZ alone. The T3-induced pro survival effect was associated with a strong increase in phosphorylated Akt. Moreover, T3 administration prevented the STZ-dependent alterations in glucose blood level, both during fasting and after glucose challenge, as well as in insulin serum level. In conclusion we demonstrated that T3 could act as a protective factor against STZ induced diabetes. PMID:21637761

  18. Thyroid Hormone Potentially Benefits Multiple Sclerosis via Facilitating Remyelination.

    PubMed

    Zhang, Mao; Ma, Ziyi; Qin, Haochen; Yao, Zhongxiang

    2016-09-01

    Myelin destruction due to inflammatory damage of oligodendrocytes (OLs) in conjunction with axonal degeneration is one of the major histopathological hallmarks of multiple sclerosis (MS), a common autoimmune disorder affecting the central nervous system (CNS). Therapies over the last 20 years mainly focus on the immune system and, more specifically, on the modulation of immune cell behavior. It seems to be effective in MS with relapse, while it is of little benefit to progressive MS in which neurodegeneration following demyelination outweighs inflammation. Otherwise, remyelination, as a result of oligodendrocyte production from oligodendrocyte precursor cells (OPCs), is considered to be a potential target for the treatment of progressive MS. In this review, positive effects of remyelination on MS will be discussed in view of the critical role played by thyroid hormone (TH), focusing on the following points: (1) promising treatment of TH on MS that potentially targets to remyelination; (2) the active role of TH that is able to promote remyelination; (3) the regulative role of TH that works on endogenous stem and precursor cells; (4) the effect of TH on gene transcription; and (5) a working hypothesis which is developed that TH can alleviate MS by promoting remyelination, and the mechanism of which is its regulative role in gene transcription of OPCs. PMID:26243185

  19. Developmental thyroid hormone disruption: prevalence, environmental contaminants and neurodevelopmental consequences.

    PubMed

    Gilbert, Mary E; Rovet, Joanne; Chen, Zupei; Koibuchi, Noriyuki

    2012-08-01

    Thyroid hormones (TH) are critical for growth and development and particularly brain development. There are numerous environmental agents that lead to marginal reductions of circulating TH. Although it is clear that severe developmental hypothyroidism is profoundly detrimental to neurodevelopment, there is less information regarding the consequences of modest degrees of thyroid. The impact of low level TH disruptions induced by environmental contaminants has not been defined. This paper is a synopsis from four invited speakers who presented at the 13th International Neurotoxicology Association meeting held in Xi'an, China during the summer of 2011. An overview of the role of TH in brain development and a review of human and animal data on the neurological sequelae of disruption of the thyroid axis in the pre- and early post-natal periods were presented by Mary Gilbert and Joanne Rovet. Iodine deficiency, a common cause of TH insufficiency and mental retardation in many countries, including China, was addressed by Zupei Chen. In this presentation the current incidence of iodine deficiency and neurological outcome in China and the efficacy of recently implemented iodinization programs to eliminate this cause of mental retardation were reviewed. Joanne Rovet described the impact of TH disruption during pregnancy and under conditions of congenital hypothyroidism. Children born with normal thyroid function, but who experienced TH insufficiency in the womb, display subtle cognitive impairments and abnormalities in brain imaging. Despite early detection and treatment, deficiencies also exist in children born with thyroid disorders. Different patterns of cognitive effects result from prenatal versus postnatal TH insufficiency. Mary Gilbert reported on the effects of environmental contaminants with thyroid disrupting action on brain development in animals. Results of neurophysiological, behavioral, structural and molecular alterations that accompany modest perturbations of

  20. Liver X receptor β controls thyroid hormone feedback in the brain and regulates browning of subcutaneous white adipose tissue.

    PubMed

    Miao, Yifei; Wu, Wanfu; Dai, Yubing; Maneix, Laure; Huang, Bo; Warner, Margaret; Gustafsson, Jan-Åke

    2015-11-10

    The recent discovery of browning of white adipose tissue (WAT) has raised great research interest because of its significant potential in counteracting obesity and type 2 diabetes. Browning is the result of the induction in WAT of a newly discovered type of adipocyte, the beige cell. When mice are exposed to cold or several kinds of hormones or treatments with chemicals, specific depots of WAT undergo a browning process, characterized by highly activated mitochondria and increased heat production and energy expenditure. However, the mechanisms underlying browning are still poorly understood. Liver X receptors (LXRs) are one class of nuclear receptors, which play a vital role in regulating cholesterol, triglyceride, and glucose metabolism. Following our previous finding that LXRs serve as repressors of uncoupling protein-1 (UCP1) in classic brown adipose tissue in female mice, we found that LXRs, especially LXRβ, also repress the browning process of subcutaneous adipose tissue (SAT) in male rodents fed a normal diet. Depletion of LXRs activated thyroid-stimulating hormone (TSH)-releasing hormone (TRH)-positive neurons in the paraventricular nucleus area of the hypothalamus and thus stimulated secretion of TSH from the pituitary. Consequently, production of thyroid hormones in the thyroid gland and circulating thyroid hormone level were increased. Moreover, the activity of thyroid signaling in SAT was markedly increased. Together, our findings have uncovered the basis of increased energy expenditure in male LXR knockout mice and provided support for targeting LXRs in treatment of obesity. PMID:26504234

  1. Liver X receptor β controls thyroid hormone feedback in the brain and regulates browning of subcutaneous white adipose tissue

    PubMed Central

    Miao, Yifei; Wu, Wanfu; Dai, Yubing; Maneix, Laure; Huang, Bo; Warner, Margaret; Gustafsson, Jan-Åke

    2015-01-01

    The recent discovery of browning of white adipose tissue (WAT) has raised great research interest because of its significant potential in counteracting obesity and type 2 diabetes. Browning is the result of the induction in WAT of a newly discovered type of adipocyte, the beige cell. When mice are exposed to cold or several kinds of hormones or treatments with chemicals, specific depots of WAT undergo a browning process, characterized by highly activated mitochondria and increased heat production and energy expenditure. However, the mechanisms underlying browning are still poorly understood. Liver X receptors (LXRs) are one class of nuclear receptors, which play a vital role in regulating cholesterol, triglyceride, and glucose metabolism. Following our previous finding that LXRs serve as repressors of uncoupling protein-1 (UCP1) in classic brown adipose tissue in female mice, we found that LXRs, especially LXRβ, also repress the browning process of subcutaneous adipose tissue (SAT) in male rodents fed a normal diet. Depletion of LXRs activated thyroid-stimulating hormone (TSH)-releasing hormone (TRH)-positive neurons in the paraventricular nucleus area of the hypothalamus and thus stimulated secretion of TSH from the pituitary. Consequently, production of thyroid hormones in the thyroid gland and circulating thyroid hormone level were increased. Moreover, the activity of thyroid signaling in SAT was markedly increased. Together, our findings have uncovered the basis of increased energy expenditure in male LXR knockout mice and provided support for targeting LXRs in treatment of obesity. PMID:26504234

  2. Effects of thyroid hormone and thyroid dysfunction on the cardiovascular system.

    PubMed

    Kienle, R D; Bruyette, D; Pion, P D

    1994-05-01

    Thyroid disease is common in veterinary practice. The heart, especially the myocardium, is sensitive to thyroid hormone, and deficiencies or excesses can alter cardiovascular function. Observed changes result from direct effects upon the myocardium and indirect effects that result from effects upon the vasculature and peripheral tissues. Clinically significant cardiovascular abnormalities related to hypothyroidism are rare. If present, they are primarily manifest as reduced left ventricular pump function, as apparent echocardiographically, or arrhythmias. Hyperthyroidism is common in the cat and infrequently encountered in dogs. Clinically significant cardiovascular manifestations are common and often dramatic. Hyperdynamic systolic function and mild myocardial hypertrophy are common manifestations which may lead to overt congestive and high output heart failure. If signs of congestive heart failure or significant arrhythmias are not evident, specific therapy need only be directed toward restoration of the euthyroid state. In most cases the cardiovascular changes associated with thyroid dysfunction are completely reversible. PMID:8053109

  3. IN VITRO METABOLISM OF THYROID HORMONES BY RECOMBINANT HUMAN UDP-GLUCORONOSYLTRANSFERASES AND SULFOTRANSFERASES

    EPA Science Inventory

    Endocrine disruptors can decrease thyroid hormone levels via the induction of hepatic uridinediphosphate-glucoronosyltransferases (UGTs) and sulfotransferases (SULTs). Due to their ability to catalyze glucuronidation and sulfation of hormones and xenobiotics, UGTs and SULTs play ...

  4. Thyroid hormone replacement one day before 131I therapy in patients with well-differentiated thyroid cancer

    PubMed Central

    Kayano, Daiki; Taki, Junichi; Inaki, Anri; Wakabayashi, Hiroshi; Nakamura, Ayane; Fukuoka, Makoto; Kinuya, Seigo

    2013-01-01

    Objective: The current study aimed to determine the efficacy of radioiodine-131 (131I) ablation therapy with thyroid hormone replacement one day before 131I administration in patients with well-differentiated thyroid cancer (DTC). Methods: This retrospective study included 29 patients who underwent 131I therapies twice for DTC during 6-12 months. Since all the patients obviously had residual lesions by their serum thyroglobulin levels or their scintigrams at the first therapies, they underwent the second 131I therapies without diagnostic scintigraphy after the first therapies. After confirming the sufficient elevation of TSH concentration, thyroid hormone replacement was resumed one day before 131I administration (3.7-7.4GBq). The ablation rate of thyroid remnant at the first 131I therapy was evaluated by comparing 131I post-therapeutic images of the two treatments. Results: Three patients were administrated thyroid hormone after 131I therapy because of insufficient TSH concentration under thyroid hormone withdrawal. In the remaining 26 patients, 41 thyroid remnant accumulations were detected in all 26 patients at the first 131I therapy. Based on the second 131I post-therapeutic images, successful ablation was confirmed in 24 of 26 patients (92.3%) and 38 of 41 sites (92.7%), which was comparable with historically reported ablation rates. Conclusion: Thyroid hormone replacement one day before 131I therapy could provide a sufficiently high ablation rate in patients with DTC.

  5. Placental angiogenic and hormonal factors are affected by thyroid hormones in rats.

    PubMed

    Silva, Juneo Freitas; Ocarino, Natália Melo; Serakides, Rogéria

    2015-03-01

    The objective of the present study was to evaluate the effect of the thyroid hormones in the gene transcription and immunohistochemical expression of hormonal and angiogenic factors in the placenta of rats. Seventy-two adult female rats were divided equally into propylthiouracil (PTU)-treated, thyroxine (T4)-treated, and control groups. The animals were sacrificed at 10, 14, and 19 days of gestation. We evaluated the immunohistochemical expression of VEGF and its receptor Flk-1. The gene transcription of VEGF, Flk-1, PGF, sFlt1, PL-1, and rPlf was evaluated in placental discs by real-time RT-PCR. The data were analyzed using a Student-Newman-Keuls (SNK) test. At day 10, T4-treated rats presented increased VEGF and PGF gene expression, while PTU-treated rats showed increased rPlf gene expression. Both groups showed reduced Flk-1 and PL-1 gene expression at day 10. At day 14, PTU-treated rats showed reduced VEGF, PGF, and rPlf gene expression. PTU-treated group showed reduced VEGF immunostaining in the placental labyrinth at 14 and 19 days of gestation but it showed increased VEGF immunostaining in the spongiotrophoblast layer at day 14. PTU-treated rats showed increased Flk-1 expression at 14 days of gestation. At days 14 and 19, T4-treated group showed increased PL-1 gene expression and reduced VEGF immunostaining. T4-treated rats also showed reduced Flk-1 and sFlt-1 expression at day 19. Both groups showed increased rPlf gene expression at day 19. In conclusion, rats treated with PTU and T4 have differential effects on the expression of factors involved in placental angiogenic and hormonal activity, and these effects are dependent on the gestational period. PMID:25499719

  6. Recombinant Human Thyroid Stimulating Hormone versus Thyroid Hormone Withdrawal for Radioactive Iodine Treatment of Differentiated Thyroid Cancer with Nodal Metastatic Disease

    PubMed Central

    Wolfson, Robert M.; Rachinsky, Irina; Morrison, Deric; Driedger, Al; Spaic, Tamara; Van Uum, Stan H. M.

    2016-01-01

    Introduction. Recombinant human thyroid stimulating hormone (rhTSH) is approved for preparation of thyroid remnant ablation with radioactive iodine (RAI) in low risk patients with well differentiated thyroid cancer (DTC). We studied the safety and efficacy of rhTSH preparation for RAI treatment of thyroid cancer patients with nodal metastatic disease. Methods. A retrospective analysis was performed on 108 patients with histopathologically confirmed nodal metastatic DTC, treated with initial RAI between January 1, 2000, and December 31, 2007. Within this selected group, 31 and 42 patients were prepared for initial and all subsequent RAI treatments by either thyroid hormone withdrawal (THW) or rhTSH protocols and were followed up for at least 3 years. Results. The response to initial treatment, classified as excellent, acceptable, or incomplete, was not different between the rhTSH group (57%, 21%, and 21%, resp.) and the THW group (39%, 13%, and 48%, resp.; P = 0.052). There was no significant difference in the final clinical outcome between the groups. The rhTSH group received significantly fewer additional doses of RAI than the THW group (P = 0.03). Conclusion. In patients with nodal-positive DTC, preparation for RAI with rhTSH is a safe and efficacious alternative to THW protocol. PMID:26977148

  7. Structure-based approach for the study of thyroid hormone receptor binding affinity and subtype selectivity.

    PubMed

    Wang, Fang-Fang; Yang, Wei; Shi, Yong-Hui; Cheng, Xiang-Rong; Le, Guo-Wei

    2016-10-01

    Thyroid hormone (TH) possesses the ability to lower cholesterol and improve cardiac performance, which have prompted the efforts to design analogs that can utilize the cholesterol-lowering property without adversely affecting heart function. In order to gain insights into the interaction mechanism for agonists at the active site of thyroid hormone receptor β (TRβ), quantitative structure-activity relationship (QSAR) models have been developed on TRβ agonists, significant statistical coefficients were obtained (CoMFA, R(2)cv, .732), (CoMSIA, R(2)cv, .853), indicating the internal consistency of the models, the obtained models were further validated using the test set, the acquired R(2)pred values .7054 and .7129 were in good agreement with the experimental results. The key amino acids affecting ligand binding were identified by molecular docking, and the detailed binding modes of the compounds with different activities were also determined. Furthermore, molecular dynamics (MD) simulations were conducted to assess the reliability of the derived models and the docking results. Moreover, TH exerts significant physiological effects through modulation of the two human thyroid hormone receptor subtypes. Because TRβ and TRα locate in different target cells, selective TR ligands would target specific tissues regulated by one receptor without affecting the other. Thus, the 3D information was analyzed to reveal the most relevant structural features involved in selectivity. The findings serve as the basis for further investigation into selective TRβ/TRα agonists. PMID:26510472

  8. A mechanistic model of effects of dioxin on thyroid hormones in the rat.

    PubMed

    Kohn, M C; Sewall, C H; Lucier, G W; Portier, C J

    1996-01-01

    A physiological dosimetric model of the disposition of TCDD in the rat (Kohn et al., Toxicol. Appl. Pharmacol. 120, 138-154, 1993) was extended to include effects of dioxin on serum concentrations of thyroid hormones in the rat. The extended model included distribution of blood among major vessels and tissue capillary beds and resorption of TCDD released into the gut lumen from the liver by cell lysis consequent to cytotoxicity. TCDD metabolism was represented by Hill kinetics. Parameter values were estimated by fitting time-course data for a single oral subcutaneous injection of TCDD and dose-response data for biweekly oral dosing. The extended model included new compartments for the thyroid and thyroxine-sensitive tissues (e.g., pituitary, kidney, and brown fat), secretion and tissue uptake of thyroid hormones, binding of 3,5,3'-triiodothyronine (T3) and 3,5,3',5'-tetraiodothyronine (thyroxine, T4) to proteins in blood and tissues, deiodination of iodothyronines, and glucuronidation of T4 by the hepatic UDP-glucuronosyltransferase (UGT) activity induced by TCDD. Secretion of thyroid hormones was modeled as regulated by thyrotropin (TSH), whose secretion was modeled as regulated by the hypothalamic factors thyrotropin releasing hormone and somatostatin. Release of the hypothalamic factors was modeled as under feedback control by the blood T4 level. Induction of UGT was modeled as stimulated by the Ah receptor-TCDD complex. The extended model fit the observed dose-response of P450 isozymes and Ah and estrogen receptors following repeated oral doses with comparable accuracy as the earlier model. The fit to liver and fat TCDD levels following single and repeated oral and subcutaneous doses was improved over the earlier model. The revised model's predicted liver TCDD concentrations at very low doses were verified experimentally. The model reproduced the responses observed for blood T3, T4, and TSH after 31 weeks of biweekly oral dosing of rats with TCDD. The model

  9. β1-Adrenergic and M2 Muscarinic Autoantibodies and Thyroid Hormone Facilitate Induction of Atrial Fibrillation in Male Rabbits.

    PubMed

    Li, Hongliang; Murphy, Taylor; Zhang, Ling; Huang, Bing; Veitla, Vineet; Scherlag, Benjamin J; Kem, David C; Yu, Xichun

    2016-01-01

    Activating autoantibodies to the β1-adrenergic and M2 muscarinic receptors are present in a very high percentage of patients with Graves' disease and atrial fibrillation (AF). The objective of this study was to develop a reproducible animal model and thereby to examine the impact of these endocrine-like autoantibodies alone and with thyroid hormone on induction of thyroid-associated atrial tachyarrhythmias. Five New Zealand white rabbits were coimmunized with peptides from the second extracellular loops of the β1-adrenergic and M2 muscarinic receptors to produce both sympathomimetic and parasympathomimetic antibodies. A catheter-based electrophysiological study was performed on anesthetized rabbits before and after immunization and subsequent treatment with thyroid hormone. Antibody expression facilitated the induction of sustained sinus, junctional and atrial tachycardias, but not AF. Addition of excessive thyroid hormone resulted in induced sustained AF in all animals. AF induction was blocked acutely by the neutralization of these antibodies with immunogenic peptides despite continued hyperthyroidism. The measured atrial effective refractory period as one parameter of AF propensity shortened significantly after immunization and was acutely reversed by peptide neutralization. No further decrease in the effective refractory period was observed after the addition of thyroid hormone, suggesting other cardiac effects of thyroid hormone may contribute to its role in AF induction. This study demonstrates autonomic autoantibodies and thyroid hormone potentiate the vulnerability of the heart to AF, which can be reversed by decoy peptide therapy. These data help fulfill Witebsky's postulates for an increased autoimmune/endocrine basis for Graves' hyperthyroidism and AF. PMID:26517045

  10. Thyroid organotypic rat and human cultures used to investigate drug effects on thyroid function, hormone synthesis and release pathways

    SciTech Connect

    Vickers, Alison E.M.; Heale, Jason; Sinclair, John R.; Morris, Stephen; Rowe, Josh M.; Fisher, Robyn L.

    2012-04-01

    Drug induced thyroid effects were evaluated in organotypic models utilizing either a rat thyroid lobe or human thyroid slices to compare rodent and human response. An inhibition of thyroid peroxidase (TPO) function led to a perturbation in the expression of key genes in thyroid hormone synthesis and release pathways. The clinically used thiourea drugs, methimazole (MMI) and 6-n-propyl-2-thioruacil (PTU), were used to evaluate thyroid drug response in these models. Inhibition of TPO occurred early as shown in rat thyroid lobes (2 h) and was sustained in both rat (24–48 h) and human (24 h) with ≥ 10 μM MMI. Thyroid from rats treated with single doses of MMI (30–1000 mg/kg) exhibited sustained TPO inhibition at 48 h. The MMI in vivo thyroid concentrations were comparable to the culture concentrations (∼ 15–84 μM), thus demonstrating a close correlation between in vivo and ex vivo thyroid effects. A compensatory response to TPO inhibition was demonstrated in the rat thyroid lobe with significant up-regulation of genes involved in the pathway of thyroid hormone synthesis (Tpo, Dio1, Slc5a5, Tg, Tshr) and the megalin release pathway (Lrp2) by 24 h with MMI (≥ 10 μM) and PTU (100 μM). Similarly, thyroid from the rat in vivo study exhibited an up-regulation of Dio1, Slc5a5, Lrp2, and Tshr. In human thyroid slices, there were few gene expression changes (Slc5a5, ∼ 2-fold) and only at higher MMI concentrations (≥ 1500 μM, 24 h). Extended exposure (48 h) resulted in up-regulation of Tpo, Dio1 and Lrp2, along with Slc5a5 and Tshr. In summary, TPO was inhibited by similar MMI concentrations in rat and human tissue, however an increased sensitivity to drug treatment in rat is indicated by the up-regulation of thyroid hormone synthesis and release gene pathways at concentrations found not to affect human tissue. -- Highlights: ► Novel model of rat thyroid or human thyroid slices to evaluate pathways of injury. ► TPO inhibition by MMI or PTU altered

  11. Prenatal and Neonatal Thyroid Stimulating Hormone Levels and Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Yau, Vincent M.; Lutsky, Marta; Yoshida, Cathleen K.; Lasley, Bill; Kharrazi, Martin; Windham, Gayle; Gee, Nancy; Croen, Lisa A.

    2015-01-01

    Thyroid hormones are critical for normal brain development. This study examined autism spectrum disorders (ASD) and thyroid stimulating hormone (TSH) levels measured in mid-pregnancy maternal serum and infant blood after birth. Three groups of children born in Orange County, CA in 2000-2001 were identified: ASD (n = 78), developmental delay…

  12. Evaluation of oxidative stress and thyroid hormone status in hemodialysis patients in Gorgan

    PubMed Central

    Velayeti, Javad; Mansourian, Azad Reza; Mojerloo, Mohammad; Marjani, Abdoljalal

    2016-01-01

    Aims: The aim of this study focused on serum malondialdehyde (MDA) levels and erythrocyte superoxide dismutase (SOD) and catalase (CAT) activities in hemodialysis patients and compared with control groups. Materials and Methods: Forty-five hemodialyzed patients and 45 control groups recruited in this study. Serum creatinine and urea, thyroid hormones (THs) levels and erythrocyte antioxidant enzyme activities were determined. Results: Hemodialysis (HD) patients showed higher levels of MDA than control groups (P < 0.01), but the levels of thyroxin (T3), free triiodothyronine (fT3), and free thyroxin (fT4), SOD and CAT were low in HD patients (P < 0.01). Serum T3, fT3, and fT4 levels were significantly negative correlated with MDA (P < 0.01). Conclusion: It is concluded that serum lipid peroxidation is markedly increased in HD patients. This means that elevated reactive oxygen species may interact with the lipid molecules in HD patients. HD may cause significant changes in TH levels. Thyroid-stimulating hormone level in HD patients is slightly similar to that of control groups. This suggests that thyroid is able to resynthesize for hormonal urinary losses. PMID:27186552

  13. Polybrominated Diphenyl Ether (DE-71)Interferes with Thyroid Hormone Action Independent Of Effects On Circulating Levels of Thyroid Hormone in Male Rats

    EPA Science Inventory

    Polybrominated diphenyl ethers (PBDEs) are routinely found in human tissues including cord blood and breast milk. PBDEs may interfere with thyroid hormone (TH) during development, which could produce neurobehavioral deficits. An assumption in experimental and epidemiological stud...

  14. Thyroid-pituitary interaction: Feedback regulation of thyrotropin secretion by thyroid hormones

    SciTech Connect

    Larsen, P.R.; Bleich, H.L.; Moore, M.J.

    1982-01-07

    Thyroid-hormone regulation of TSH production involves a response to plasma concentrations of T4 and T3. A substantial fraction of intracellular T3 in the pituitary derives from the conversion of T4 to T3, and recent studies indicate that this process is physiologically regulated. Changes in pituitary conversion of T4 to T3 are often the opposite of those that occur in the liver and kidney under similar circumstances. The presence of this pathway for T3 production indicates that the pituitary can respond independently to changes in plasma levels of T4 and T3; in contrast, many tissues appear to be sensitive mainly to the plasma T3 concentration. Recent studies suggest that conversion of T4 to T3 in the cerebral cortex and cerebellum is also important in providing intracellular T3 to these particular tissues. Given these results, it is not suprising that a complete definition of thyroid status requires more than the measurement of the serum concentrations of thyroid hormones. For some tissues, among them the brain and pituitary, the intracellular T3 concentrations may only partly reflect those in the serum. Recognition that the intracellular T3 concentration in each tissue may be subject to local regulation and an understanding of the importance of this process to the regulation of TSH production shoul permit a better appreciation of the limitations of radioimmunoassay serum thyroid hormone and TSH levels. These concepts also provide a physiologic rationale for the use of thyroxine for replacement in hypothyroid patients or for TSH suppression.

  15. Assessing Waste Water Treatment Plant Effluent for Thyroid Hormone Disruption

    EPA Science Inventory

    Much information has been coming to light on the estrogenic and androgenic activity of chemicals present in the waste water stream and in surface waters, but much less is known about the presence of chemicals with thyroid activity. To address this issue, we have utilized two assa...

  16. A model for chronic, intrahypothalamic thyroid hormone administration in rats.

    PubMed

    Zhang, Z; Bisschop, P H; Foppen, E; van Beeren, H C; Kalsbeek, A; Boelen, A; Fliers, E

    2016-04-01

    In addition to the direct effects of thyroid hormone (TH) on peripheral organs, recent work showed metabolic effects of TH on the liver and brown adipose tissue via neural pathways originating in the hypothalamic paraventricular and ventromedial nucleus (PVN and VMH). So far, these experiments focused on short-term administration of TH. The aim of this study is to develop a technique for chronic and nucleus-specific intrahypothalamic administration of the biologically active TH tri-iodothyronine (T3). We used beeswax pellets loaded with an amount of T3 based on in vitro experiments showing stable T3 release (∼5 nmol l(-1)) for 32 days. Upon stereotactic bilateral implantation, T3 concentrations were increased 90-fold in the PVN region and 50-fold in the VMH region after placing T3-containing pellets in the rat PVN or VMH for 28 days respectively. Increased local T3 concentrations were reflected by selectively increased mRNA expression of the T3-responsive genes Dio3 and Hr in the PVN or in the VMH. After placement of T3-containing pellets in the PVN, Tshb mRNA was significantly decreased in the pituitary, without altered Trh mRNA in the PVN region. Plasma T3 and T4 concentrations decreased without altered plasma TSH. We observed no changes in pituitary Tshb mRNA, plasma TSH, or plasma TH in rats after placement of T3-containing pellets in the VMH. We developed a method to selectively and chronically deliver T3 to specific hypothalamic nuclei. This will enable future studies on the chronic effects of intrahypothalamic T3 on energy metabolism via the PVN or VMH. PMID:26865639

  17. Thyroid hormones regulate levels of thyrotropin-releasing-hormone mRNA in the paraventricular nucleus

    SciTech Connect

    Koller, K.J.; Wolff, R.S.; Warden, M.K.; Zoeller, R.T.

    1987-10-01

    Cellular levels of messenger RNA encoding thyrotropin-releasing hormone (TRH) were measured in the paraventricular nucleus of the hypothalamus and the reticular nucleus of the thalamus in male rats after chemical thyroidectomy and thyroid hormone, replacement. TRH mRNA levels were measured by quantitative in situ hybridization histochemistry using a /sup 35/S-labeled synthetic 48-base oligodeoxynucleotide probe and quantitative autoradiography. Chemical thyroidectomy, produced by the administration of 6-(n-propyl)-2-thiouracil (PrSur), reduced plasma thyroxine below detection limits and significantly increased TRH mRNA in the paraventricular nucleus. Treatments with exogenous L-triiodothyronine (T/sub 3/) reduced TRH mRNA to the same level in both hypothyroid and euthyroid animals. Neither PrSur treatment nor T/sub 3/ replacement influenced TRH mRNA levels in the reticular nucleus of the thalamus. Blot hybridization analysis of electrophoretically fractionated total RNA from pituitaries of these animals indicated that thyrotropin-..beta.. mRNA levels were elevated after thyroidectomy and reduced by T/sub 3/ treatment, showing that the pituitary-thyroid axis was indeed stimulated by PrSur treatment. These results suggest that thyroid hormones are involved, either directly or indirectly, in regulating the biosynthesis of TRH in the thyrotropic center of the hypothalamus.

  18. Thyroid Hormone Signaling In Vivo Requires a Balance between Coactivators and Corepressors

    PubMed Central

    Vella, Kristen R.; Ramadoss, Preeti; Costa-e-Sousa, Ricardo H.; Astapova, Inna; Ye, Felix D.; Holtz, Kaila A.; Harris, Jamie C.

    2014-01-01

    Resistance to thyroid hormone (RTH), a human syndrome, is characterized by high thyroid hormone (TH) and thyroid-stimulating hormone (TSH) levels. Mice with mutations in the thyroid hormone receptor beta (TRβ) gene that cannot bind steroid receptor coactivator 1 (SRC-1) and Src-1−/− mice both have phenotypes similar to that of RTH. Conversely, mice expressing a mutant nuclear corepressor 1 (Ncor1) allele that cannot interact with TRβ, termed NCoRΔID, have low TH levels and normal TSH. We hypothesized that Src-1−/− mice have RTH due to unopposed corepressor action. To test this, we crossed NCoRΔID and Src-1−/− mice to create mice deficient for coregulator action in all cell types. Remarkably, NCoRΔID/ΔID Src-1−/− mice have normal TH and TSH levels and are triiodothryonine (T3) sensitive at the level of the pituitary. Although absence of SRC-1 prevented T3 activation of key hepatic gene targets, NCoRΔID/ΔID Src-1−/− mice reacquired hepatic T3 sensitivity. Using in vivo chromatin immunoprecipitation assays (ChIP) for the related coactivator SRC-2, we found enhanced SRC-2 recruitment to TR-binding regions of genes in NCoRΔID/ΔID Src-1−/− mice, suggesting that SRC-2 is responsible for T3 sensitivity in the absence of NCoR1 and SRC-1. Thus, T3 targets require a critical balance between NCoR1 and SRC-1. Furthermore, replacement of NCoR1 with NCoRΔID corrects RTH in Src-1−/− mice through increased SRC-2 recruitment to T3 target genes. PMID:24550004

  19. Thyroid Storm Caused by a Chinese Herb Contaminated with Thyroid Hormones

    PubMed Central

    St-Onge, Maude; Vandenberghe, Hilde; Thompson, Margaret

    2015-01-01

    Patient: Male, 70 Final Diagnosis: Thyroid storm Symptoms: Atrial fibrillation • confusion • hyperthermia • tachycardia Medication: — Clinical Procedure: Intubation • cardioversion Specialty: Critical Care Medicine Objective: Adverse events of drug therapy Background: We report a case of thyroid storm caused by consuming a Chinese herb contaminated with thyroid hormones. Case Report: A 70-year-old man presented to an emergency department after 2 days of nausea, vomiting, and weakness. Three days previously, he had started taking Cordyceps powder and “Flower Man Sang Hung” as recommended by his Chinese physician. Following admission, the patient deteriorated and was eventually diagnosed with thyroid storm complicated by rapid atrial fibrillation requiring cardioversion, intubation, and intensive care admission. The analysis of the Chinese herb “Flower Man Sang Hung” was positive for levothyroxine. The patient was extubated 11 days after admission and discharged to a rehabilitation centre after 17 days of hospitalization. The Chinese medicine physician was informed of the events. Conclusions: Herbal products can be the source of illness, medication interactions, and contamination. Awareness should be raised among Chinese medicine physicians, allopathic physicians, and their patients. Clinicians should also have a low threshold of suspicion to seek laboratory analysis of suspect substances when the cause of the clinical presentation is unclear. PMID:25644333

  20. Gene Expression as a Biomarker of Effect of Thyroid Hormone Action in Developing Brain: Relation to Serum Hormones.

    EPA Science Inventory

    Disruption of thyroid hormone (TH) homeostasis is a known effect of environmental contaminants. Although animal models of developmental TH deficiency can predict the impact of severe insults to the thyroid system, the effects of moderate TH insufficiencies have proved more diffic...

  1. Patterns of thyroid hormone receptor expression in zebrafish and generation of a novel model of resistance to thyroid hormone action.

    PubMed

    Marelli, Federica; Carra, Silvia; Agostini, Maura; Cotelli, Franco; Peeters, Robin; Chatterjee, Krishna; Persani, Luca

    2016-03-15

    Resistance to thyroid hormone can be due to heterozygous, dominant negative (DN) THRA (RTHα) or THRB (RTHβ) mutations, but the underlying mechanisms are incompletely understood. Here, we delineate the spatiotemporal expression of TH receptors (TRs) in zebrafish and generated morphants expressing equivalent amounts of wild-type and DN TRαs (thraa_MOs) and TRβs (thrb_MOs) in vivo. Both morphants show severe developmental abnormalities. The phenotype of thraa_MOs includes brain and cardiac defects, but normal thyroid volume and tshba expression. A combined modification of dio2 and dio3 expression can explain the high T3/T4 ratio seen in thraa_MOs, as in RTHα. Thrb_MOs show abnormal eyes and otoliths, with a typical RTHβ pattern of thyroid axis. The coexpression of wild-type, but not mutant, human TRs can rescue the phenotype in both morphants. High T3 doses can partially revert the dominant negative action of mutant TRs in morphant fish. Therefore, our morphants recapitulate the RTHα and RTHβ key manifestations representing new models in which the functional consequences of human TR mutations can be rapidly and faithfully evaluated. PMID:26802880

  2. In Vivo Interaction of Steroid Receptor Coactivator (SRC)-1 and the Activation Function-2 Domain of the Thyroid Hormone Receptor (TR) β in TRβ E457A Knock-In and SRC-1 Knockout mice

    PubMed Central

    Alonso, Manuela; Goodwin, Charles; Liao, XiaoHui; Ortiga-Carvalho, Tania; Machado, Danielle S.; Wondisford, Fredric E.; Refetoff, Samuel; Weiss, Roy E.

    2009-01-01

    The activation function-2 (AF-2) domain of the thyroid hormone (TH) receptor (TR)-β is a TH-dependent binding site for nuclear coactivators (NCoA), which modulate TH-dependent gene transcription. In contrast, the putative AF-1 domain is a TH-independent region interacting with NCoA. We determined the specificity of the AF-2 domain and NCoA interaction by evaluating thyroid function in mice with combined disruption of the AF-2 domain in TRβ, due to a point mutation (E457A), and deletion of one of the NCoAs, steroid receptor coactivator (SRC)-1. The E457A mutation was chosen because it abolishes NCoA recruitment in vitro while preserving normal TH binding and corepressor interactions resulting in resistance to TH. At baseline, disruption of SRC-1 in the homozygous knock-in (TRβE457A/E457A) mice worsened the degree of resistance to TH, resulting in increased serum T4 and TSH. During TH deprivation, disruption of AF-2 and SRC-1 resulted in a TSH rise 50% of what was seen when AF-2 alone was removed, suggesting that SRC-1 was interacting outside of the AF-2 domain. Therefore, 1) during TH deprivation, SRC-1 is necessary for activating the hypothalamic-pituitary-thyroid axis; 2) ligand-dependent repression of TSH requires an intact AF-2; and 3) SRC-1 may interact with the another region of the TRβ or the TRα to regulate TH action in the pituitary. This report demonstrates the dual interaction of NCoA in vivo: the TH-independent up-regulation possibly through another domain and TH-dependent down-regulation through the AF-2 domain. PMID:19406944

  3. In vivo interaction of steroid receptor coactivator (SRC)-1 and the activation function-2 domain of the thyroid hormone receptor (TR) beta in TRbeta E457A knock-in and SRC-1 knockout mice.

    PubMed

    Alonso, Manuela; Goodwin, Charles; Liao, Xiaohui; Ortiga-Carvalho, Tania; Machado, Danielle S; Wondisford, Fredric E; Refetoff, Samuel; Weiss, Roy E

    2009-08-01

    The activation function-2 (AF-2) domain of the thyroid hormone (TH) receptor (TR)-beta is a TH-dependent binding site for nuclear coactivators (NCoA), which modulate TH-dependent gene transcription. In contrast, the putative AF-1 domain is a TH-independent region interacting with NCoA. We determined the specificity of the AF-2 domain and NCoA interaction by evaluating thyroid function in mice with combined disruption of the AF-2 domain in TRbeta, due to a point mutation (E457A), and deletion of one of the NCoAs, steroid receptor coactivator (SRC)-1. The E457A mutation was chosen because it abolishes NCoA recruitment in vitro while preserving normal TH binding and corepressor interactions resulting in resistance to TH. At baseline, disruption of SRC-1 in the homozygous knock-in (TRbeta(E457A/E457A)) mice worsened the degree of resistance to TH, resulting in increased serum T(4) and TSH. During TH deprivation, disruption of AF-2 and SRC-1 resulted in a TSH rise 50% of what was seen when AF-2 alone was removed, suggesting that SRC-1 was interacting outside of the AF-2 domain. Therefore, 1) during TH deprivation, SRC-1 is necessary for activating the hypothalamic-pituitary-thyroid axis; 2) ligand-dependent repression of TSH requires an intact AF-2; and 3) SRC-1 may interact with the another region of the TRbeta or the TRalpha to regulate TH action in the pituitary. This report demonstrates the dual interaction of NCoA in vivo: the TH-independent up-regulation possibly through another domain and TH-dependent down-regulation through the AF-2 domain. PMID:19406944

  4. Identification of thyroid hormone response elements in vivo using mice expressing a tagged thyroid hormone receptor α1

    PubMed Central

    Dudazy-Gralla, Susi; Nordström, Kristina; Hofmann, Peter Josef; Meseh, Dina Abdul; Schomburg, Lutz; Vennström, Björn; Mittag, Jens

    2013-01-01

    TRα1 (thyroid hormone receptor α1) is well recognized for its importance in brain development. However, due to the difficulties in predicting TREs (thyroid hormone response elements) in silico and the lack of suitable antibodies against TRα1 for ChIP (chromatin immunoprecipitation), only a few direct TRα1 target genes have been identified in the brain. Here we demonstrate that mice expressing a TRα1–GFP (green fluorescent protein) fusion protein from the endogenous TRα locus provide a valuable animal model to identify TRα1 target genes. To this end, we analysed DNA–TRα1 interactions in vivo using ChIP with an anti-GFP antibody. We validated our system using established TREs from neurogranin and hairless, and by verifying additional TREs from known TRα1 target genes in brain and heart. Moreover, our model system enabled the identification of novel TRα1 target genes such as RNF166 (ring finger protein 166). Our results demonstrate that transgenic mice expressing a tagged nuclear receptor constitute a feasible approach to study receptor–DNA interactions in vivo, circumventing the need for specific antibodies. Models like the TRα1–GFP mice may thus pave the way for genome-wide mapping of nuclear receptor-binding sites, and advance the identification of novel target genes in vivo. PMID:23398480

  5. Association between organophosphate pesticides exposure and thyroid hormones in floriculture workers.

    PubMed

    Lacasaña, Marina; López-Flores, Inmaculada; Rodríguez-Barranco, Miguel; Aguilar-Garduño, Clemente; Blanco-Muñoz, Julia; Pérez-Méndez, Oscar; Gamboa, Ricardo; Bassol, Susana; Cebrian, Mariano E

    2010-02-15

    The ability of organophosphate pesticides to disturb thyroid gland function has been demonstrated by experimental studies on animal, but evidence of such effects on human remains scarce. The aim of this study was to assess the association between exposure to organophosphate compounds and serum levels of thyroid hormones in floriculture workers. A longitudinal study was conducted on 136 male subjects from the State of Mexico and Morelos, Mexico, occupationally exposed to organophosphate pesticides, during agricultural periods of high (rainy season) and low (dry season) levels of pesticide application. Using a structured questionnaire, a survey was carried out on sociodemographic characteristics, anthropometry, clinical history, alcohol and tobacco consumption, residential chemical exposure, and occupational history. Urine and blood samples were taken the day after pesticide application to determine urine dialkylphosphate (DAP) levels, serum levels of TSH, total T(3), total T(4), serum PON1 activity, and serum p,p'-DEE levels. The analysis of the association between DAP levels and thyroid hormonal profile was carried out using multivariate generalized estimating equation (GEE) models. Our results showed an increase in both TSH and T(4) hormones in serum associated with a increase in total dimethylphosphate levels (SigmaDMP) in urine (p-trend<0.001) and a decrease in total T(3) serum levels with an increase of SigmaDMP levels in the urine (p-trend=0.053). These results suggest that exposure to organophosphate pesticides may be responsible of increasing TSH and T(4) serum hormone levels and decreasing T(3) serum hormone levels, therefore supporting the hypothesis that organophosphate pesticides act as endocrine disruptors in humans. PMID:19914268

  6. Association between organophosphate pesticides exposure and thyroid hormones in floriculture workers

    SciTech Connect

    Lacasana, Marina; Lopez-Flores, Inmaculada; Rodriguez-Barranco, Miguel; Aguilar-Garduno, Clemente; Blanco-Munoz, Julia; Perez-Mendez, Oscar; Gamboa, Ricardo; Bassol, Susana; Cebrian, Mariano E.

    2010-02-15

    The ability of organophosphate pesticides to disturb thyroid gland function has been demonstrated by experimental studies on animal, but evidence of such effects on human remains scarce. The aim of this study was to assess the association between exposure to organophosphate compounds and serum levels of thyroid hormones in floriculture workers. A longitudinal study was conducted on 136 male subjects from the State of Mexico and Morelos, Mexico, occupationally exposed to organophosphate pesticides, during agricultural periods of high (rainy season) and low (dry season) levels of pesticide application. Using a structured questionnaire, a survey was carried out on sociodemographic characteristics, anthropometry, clinical history, alcohol and tobacco consumption, residential chemical exposure, and occupational history. Urine and blood samples were taken the day after pesticide application to determine urine dialkylphosphate (DAP) levels, serum levels of TSH, total T{sub 3}, total T{sub 4}, serum PON1 activity, and serum p,p'-DEE levels. The analysis of the association between DAP levels and thyroid hormonal profile was carried out using multivariate generalized estimating equation (GEE) models. Our results showed an increase in both TSH and T{sub 4} hormones in serum associated with a increase in total dimethylphosphate levels (SIGMADMP) in urine (p-trend < 0.001) and a decrease in total T{sub 3} serum levels with an increase of SIGMADMP levels in the urine (p-trend = 0.053). These results suggest that exposure to organophosphate pesticides may be responsible of increasing TSH and T{sub 4} serum hormone levels and decreasing T{sub 3} serum hormone levels, therefore supporting the hypothesis that organophosphate pesticides act as endocrine disruptors in humans.

  7. Recessive resistance to thyroid hormone in mice lacking thyroid hormone receptor beta: evidence for tissue-specific modulation of receptor function.

    PubMed Central

    Forrest, D; Hanebuth, E; Smeyne, R J; Everds, N; Stewart, C L; Wehner, J M; Curran, T

    1996-01-01

    The diverse functions of thyroid hormone (T3) are presumed to be mediated by two genes encoding the related receptors, TRalpha and TRbeta. However, the in vivo functions of TRalpha and TRbeta are undefined. Here, we report that targeted inactivation of the mouse TRbeta gene results in goitre and elevated levels of thyroid hormone. Also, thyroid-stimulating hormone (TSH), which is released by pituitary thyrotropes and which is normally suppressed by increased levels of thyroid hormone, was present at elevated levels in homozygous mutant (Thrb-/-) mice. These findings suggest a unique role for TRbeta that cannot be substituted by TRalpha in the T3-dependent feedback regulation of TSH transcription. Thrb-/- mice provide a recessive model for the human syndrome of resistance to thyroid hormone (RTH) that exhibits a similar endocrine disorder but which is typically caused by dominant TRbeta mutants that are transcriptional inhibitors. It is unknown whether TRalpha, TRbeta or other receptors are targets for inhibition in dominant RTH; however, the analysis of Thrb-/- mice suggests that antagonism of TRbeta-mediated pathways underlies the disorder of the pituitary-thyroid axis. Interestingly, in the brain, the absence of TRbeta may not mimic the defects often associated with dominant RTH, since no overt behavioural or neuroanatomical abnormalities were detected in Thrb-/- mice. These data define in vivo functions for TRbeta and indicate that specificity in T3 signalling is conferred by distinct receptor genes. Images PMID:8670802

  8. Chemistry and Biology in the Biosynthesis and Action of Thyroid Hormones.

    PubMed

    Mondal, Santanu; Raja, Karuppusamy; Schweizer, Ulrich; Mugesh, Govindasamy

    2016-06-27

    Thyroid hormones (THs) are secreted by the thyroid gland. They control lipid, carbohydrate, and protein metabolism, heart rate, neural development, as well as cardiovascular, renal, and brain functions. The thyroid gland mainly produces l-thyroxine (T4) as a prohormone, and 5'-deiodination of T4 by iodothyronine deiodinases generates the nuclear receptor binding hormone T3. In this Review, we discuss the basic aspects of the chemistry and biology as well as recent advances in the biosynthesis of THs in the thyroid gland, plasma transport, and internalization of THs in their target organs, in addition to the deiodination and various other enzyme-mediated metabolic pathways of THs. We also discuss thyroid hormone receptors and their mechanism of action to regulate gene expression, as well as various thyroid-related disorders and the available treatments. PMID:27226395

  9. Characterization of a thyroid hormone receptor expressed in human kidney and other tissues

    SciTech Connect

    Nakai, A.; Seino, S.; Sakurai, A.; Szilak, I.; Bell, G.I.; DeGroot, L.J.

    1988-04-01

    A cDNA encoding a specific form of thyroid hormone receptor expressed in human liver, kidney, placenta, and brain was isolated from a human kidney library. Identical clones were found in human placenta and HepG2 cDNA libraries. The cDNA encodes a 490-amino acid protein. When expressed and translated in vitro, the protein products binds triiodothyronine with K/sub a/ of 2.3 /times/ 10/sup 9/ M/sup /minus/1/. This protein, designated human thyroid hormone receptor type ..cap alpha..2 (hTR..cap alpha..2), has the same domain structure as other members of the v-erbA-related superfamily of receptor genes. It is similar to thyroid hormone receptor type ..cap alpha.. described in chicken and rat and less similar to human thyroid hormone receptor type ..beta.. (formerly referred to as c-erbA..beta..) from placenta. However, it is distinguished from these receptors by an extension of the C-terminal hormone binding domain making it 80 amino acids longer than rat thyroid hormone receptor type ..cap alpha..1. Different sizes of mRNA found in liver and kidney suggest that there may be tissue-specific processing of the primary transcript of this gene. Identification of human thyroid hormone receptor type ..cap alpha..2 indicates that two or more forms of thyroid hormone receptor exist in human tissues and may explain the normal variation in thyroid hormone responsiveness of various organs and the selective tissue abnormalities found in the thyroid hormone resistance syndromes.

  10. Hypothalamic-pituitary-thyroid axis hormones stimulate mitochondrial function and biogenesis in human hair follicles.

    PubMed

    Vidali, Silvia; Knuever, Jana; Lerchner, Johannes; Giesen, Melanie; Bíró, Tamás; Klinger, Matthias; Kofler, Barbara; Funk, Wolfgang; Poeggeler, Burkhard; Paus, Ralf

    2014-01-01

    Thyroid hormones regulate mitochondrial function. As other hypothalamic-pituitary-thyroid (HPT) axis hormones, i.e., thyrotropin-releasing hormone (TRH) and thyrotropin (TSH), are expressed in human hair follicles (HFs) and regulate mitochondrial function in human epidermis, we investigated in organ-cultured human scalp HFs whether TRH (30 nM), TSH (10 mU ml(-1)), thyroxine (T4) (100 nM), and triiodothyronine (T3) (100 pM) alter intrafollicular mitochondrial energy metabolism. All HPT-axis members increased gene and protein expression of mitochondrial-encoded subunit 1 of cytochrome c oxidase (MTCO1), a subunit of respiratory chain complex IV, mitochondrial transcription factor A (TFAM), and Porin. All hormones also stimulated intrafollicular complex I/IV activity and mitochondrial biogenesis. The TSH effects on MTCO1, TFAM, and porin could be abolished by K1-70, a TSH-receptor antagonist, suggesting a TSH receptor-mediated action. Notably, as measured by calorimetry, T3 and TSH increased follicular heat production, whereas T3/T4 and TRH stimulated ATP production in cultured HF keratinocytes. HPT-axis hormones did not increase reactive oxygen species (ROS) production. Rather, T3 and T4 reduced ROS formation, and all tested HPT-axis hormones increased the transcription of ROS scavengers (catalase, superoxide dismutase 2) in HF keratinocytes. Thus, mitochondrial biology, energy metabolism, and redox state of human HFs are subject to profound (neuro-)endocrine regulation by HPT-axis hormones. The neuroendocrine control of mitochondrial biology in a complex human mini-organ revealed here may be therapeutically exploitable. PMID:23949722

  11. Effect of thyroid stimulating hormone on adaptive behaviour in Down's syndrome.

    PubMed

    Bhaumik, S; Collacott, R A; Garrick, P; Mitchell, C

    1991-12-01

    Patients with Down's syndrome are particularly vulnerable to the development of both hypothyroidism and Alzheimer's disease. Both hypothyroidism and Alzheimer's disease may be associated with elevated serum concentrations of thyroid stimulating hormone. In a group of institutionalized Down's syndrome patients with normal thyroid function, global scores of ability were higher than in a group of patients with elevated thyroid stimulating hormone levels in the presence of normal T3 and T4. The actual concentrations of thyroid stimulating hormone were shown to be significantly and inversely correlated with scores of global abilities. If these findings are reproducible, the authors believe that thyroid stimulating hormone estimation may provide confirmatory evidence of clinical dementia in this group of mentally handicapped individuals. PMID:1839315

  12. Epidermal growth factor (EGF) inhibits stimulated thyroid hormone secretion in the mouse

    SciTech Connect

    Ahren, B.

    1987-07-01

    It is known that epidermal growth factor (EGF) inhibits iodide uptake in the thyroid follicular cells and lowers plasma levels of thyroid hormones upon infusion into sheep and ewes. In this study, the effects of EGF on basal and stimulated thyroid hormone secretion were investigated in the mouse. Mice were pretreated with /sup 125/I and thyroxine; the subsequent release of /sup 125/I is an estimation of thyroid hormone secretion. It was found that basal radioiodine secretion was not altered by intravenous injection of EGF (5 micrograms/animal). However, the radioiodine secretion stimulated by both TSH (120 microU/animal) and vasoactive intestinal peptide (VIP; 5 micrograms/animal) were inhibited by EGF (5 micrograms/animal). At a lower dose level (0.5 microgram/animal), EGF had no influence on stimulated radioiodine secretion. In conclusion, EGF inhibits stimulated thyroid hormone secretion in the mouse.

  13. Changes of thyroid hormone levels and related gene expression in zebrafish on early life stage exposure to triadimefon.

    PubMed

    Liu, Shaoying; Chang, Juhua; Zhao, Ying; Zhu, Guonian

    2011-11-01

    In this study, zebrafish was exposed to triadimefon. Thyroid hormones levels and the expression of related genes in the hypothalamic-pituitary-thyroid (HPT) axis, including thyroid-stimulating hormone (TSH-beta), deiodinases (dio1 and dio2) and the thyroid hormone receptor (thraa and thrb) were evaluated. After triadimefon exposure, increased T4 can be explained by increased thyroid-stimulating hormone (TSH-beta). The conversion of T4 to T3 (deiodinase type I-dio1) was decreased, which reduced the T3 level. Thyroid hormone receptor beta (thrb) mRNA levels were significantly down-regulated, possibly as a response to the decreased T3 levels. The overall results indicated that triadimefon exposure could alter gene expression in the HPT axis and that mechanisms of disruption of thyroid status by triadimefon could occur at several steps in the synthesis, regulation, and action of thyroid hormones. PMID:22004968

  14. Regulation of five tubulin isotypes by thyroid hormone during brain development.

    PubMed

    Aniello, F; Couchie, D; Gripois, D; Nunez, J

    1991-11-01

    Nucleic acid probes derived from the 3' noncoding region of five tubulin cDNAs were used to study the effects of thyroid hormone deficiency on the expression of the mRNAs encoding two alpha (alpha 1 and alpha 2)- and three beta (beta 2, beta 4, and beta 5)-tubulin isotypes in the developing cerebral hemispheres and cerebellum. The content of alpha 1, which markedly declines during development in both brain regions, is maintained at high levels in the hypothyroid cerebellum, whereas it is decreased in the cerebral hemispheres. The alpha 2 level also declines during development and is decreased in both regions by thyroid hormone deficiency, but only during the two first postnatal weeks. Thyroid hormone deficiency slightly increases at all stages the beta 2 level in the cerebellum, whereas a decrease is observed at early stages in the cerebral hemispheres. The beta 5 level seems to be independent of thyroid hormone in the cerebral hemispheres, whereas it decreases at early stages in the hypothyroid cerebellum. Finally, the expression of the brain-specific beta 4 isotype is markedly depressed by thyroid hormone deficiency, particularly in the cerebellum. These data suggest that the genes encoding the tubulin isotypes are, directly or not, differently regulated by thyroid hormone during brain development. This might contribute to abnormal neurite outgrowth seen in the hypothyroid brain and therefore to impairment in brain functions produced by thyroid hormone deficiency. PMID:1717658

  15. Evidence against benefit from replacement doses of thyroid hormones in nonthyroidal illness (NTI): studies using turpentine oil-injected rat.

    PubMed

    Chopra, I J; Huang, T S; Boado, R; Solomon, D H; Chua Teco, G N

    1987-12-01

    Sprague-Dawley rats were treated with saline or turpentine oil (5 mu 1/g bw sc at 3-day intervals x3) with or without replacement doses of T4 (0.8 g/100 g bw/day ip) or T3(0.3 microgram/100 g bw/day ip). Injection of turpentine oil to the rat consistently caused a significant reduction in serum total T4, total T3, free T4 index and TSH. Despite marked changes in thyroidal economy in experimental rat, iodothyronine 5'-monodeiodinating activity (MA) in the liver, the kidney and the hearth and the hepatic alpha-glycerophosphate dehydrogenase activity were decreased inconsistently and when decreased, the various enzyme activities were not influenced appreciably by treatment with replacement doses of T4 or T3. Cerebral cortical T4 5-MA was normal or increased in the turpentine oil-injected rat. Dermal T4 5-MA was decreased in the turpentine oil-injected rat and replacement doses of thyroid hormones did not normalize it. Urinary excretion of urea nitrogen was normal in the turpentine oil-injected rat and did not change appreciably after treatment with thyroid hormones. Our data suggest that replacement doses of thyroid hormones are not beneficial to a host with altered thyroid economy during a systemic illness. PMID:3440823

  16. The Effect of Thyroid-Stimulating Hormone on Tumor Size in Differentiated Thyroid Carcinoma.

    PubMed

    Ozemir, I A; Gurbuz, B; Bayraktar, B; Aslan, S; Başkent, A; Yalman, H; Yigitbasi, R; Alimoglu, O

    2015-12-01

    We evaluated the correlation between serum thyroid-stimulating hormone (TSH) levels and tumor size and other invasiveness parameters of tumor in patients with differentiated thyroid carcinoma (DTC). Several clinical studies have reported that TSH may also have a role as a regulator of the development and function of the thyroid gland. It is currently not clear whether TSH is involved in the existence of thyroid cancer or progression of thyroid cancer or both. Patients with DTC who underwent thyroid surgery between 2003 and 2008 were included this study. Preoperative serum T3, T4, and TSH levels were compared with the size and invasiveness of cancer, retrospectively. DTC was observed in 110 patients over the 5-year period. Seventy-seven (70 %) of them were euthyroid and classified as the "normal-TSH group" (NTG), and 33 (30 %) have an overt or subclinical hyperthyroidism, classified as the "low-TSH group" (LTG). The mean tumor diameter in the LTG was found to be 8.91 ± 8.03 mm; however, it was found to be 18.19 ± 16.24 mm in the NTG. There were significantly differences among the groups related to the diameter of tumor (p = 0.001). Microcarcinoma was determined in 36 patients (46.8 %) in the NTG and 23 patients (69.7 %) in the LTG (p = 0.027). Although there were no significant differences, tumor capsule invasion (33.8 vs. 18.2 %, p = 0.099) and lymphovascular invasion (16.9 vs. 6.1 %, p = 0.130) rates were higher in the NTG. These findings suggest that TSH has effects on growing and proliferation of not only normal thyroid cells but also cancer cells in DTC. This study revealed that serum TSH level can be explored as an important factor that affects the size and invasiveness of tumor in DTC. PMID:27011492

  17. Barhl1 is directly regulated by thyroid hormone in the developing cerebellum of mice

    SciTech Connect

    Dong, Hongyan; Yauk, Carole L.; Wade, Michael G.

    2011-11-11

    Highlights: Black-Right-Pointing-Pointer Thyroid hormone receptor binds to the promoter region of Barhl1. Black-Right-Pointing-Pointer Barhl1 expression in cerebellum is negatively regulated by thyroid hormone. Black-Right-Pointing-Pointer Negative regulation of Barhl1 by thyroid hormone was confirmed in vitro. Black-Right-Pointing-Pointer Thyroid hormone may play a role in normal brain development through transcriptional control of Barhl1. -- Abstract: Thyroid hormones (THs) are essential for the brain development. Despite considerable effort, few genes directly regulated by THs have been identified. In this study, we investigate the effects of THs on the regulation of Barhl1, a transcription factor that regulates sensorineural development. Using DNA microarray combined with chromatin immunoprecipitation (ChIP-chip), we identified a TR{beta} binding site in the promoter of Barhl1. The binding was further confirmed by ChIP-PCR. The site is located approximately 755 bp upstream of the transcription start site. Reporter vectors containing the binding site or mutated fragments were transfected into GH3 cells. T3 treatment decreased the transcriptional activity of the wild fragment but not the mutant. Two 28 bp oligonucleotides containing sequences that resemble known TH response elements (TREs) were derived from this binding site and DNA-protein interaction was performed using electrophoretic mobility shift assays (EMSA). Binding analysis in a nuclear extract containing TR{beta} revealed that one of these fragments bound TR{beta}. This complex was shifted with the addition of anti-TR{beta} antibody. We investigated Barhl1 expression in animal models and TH-treated cultured cells. Both long term treatment with 6-propyl-2-thiouracil and short-term treatment with 0.05% methimazole/1% sodium perchlorate (both treatments render mice hypothyroid) resulted in up-regulation of Barhl1. TH supplementation of hypothyroid mice caused a decrease in the expression of Barhl1

  18. The Thyroid Hormone Analog DITPA Ameliorates Metabolic Parameters of Male Mice With Mct8 Deficiency.

    PubMed

    Ferrara, Alfonso Massimiliano; Liao, Xiao-Hui; Ye, Honggang; Weiss, Roy E; Dumitrescu, Alexandra M; Refetoff, Samuel

    2015-11-01

    Mutations in the gene encoding the thyroid hormone (TH) transporter, monocarboxylate transporter 8 (MCT8), cause mental retardation in humans associated with a specific thyroid hormone phenotype manifesting high serum T3 and low T4 and rT3 levels. Moreover, these patients have failure to thrive, and physiological changes compatible with thyrotoxicosis. Recent studies in Mct8-deficient (Mct8KO) mice revealed that the high serum T3 causes increased energy expenditure. The TH analog, diiodothyropropionic acid (DITPA), enters cells independently of Mct8 transport and shows thyromimetic action but with a lower metabolic activity than TH. In this study DITPA was given daily ip to adult Mct8KO mice to determine its effect on thyroid tests in serum and metabolism (total energy expenditure, respiratory exchange rate, and food and water intake). In addition, we measured the expression of TH-responsive genes in the brain, liver, and muscles to assess the thyromimetic effects of DITPA. Administration of 0.3 mg DITPA per 100 g body weight to Mct8KO mice brought serum T3 levels and the metabolic parameters studied to levels observed in untreated Wt animals. Analysis of TH target genes revealed amelioration of the thyrotoxic state in liver, somewhat in the soleus, but there was no amelioration of the brain hypothyroidism. In conclusion, at the dose used, DITPA mainly ameliorated the hypermetabolism of Mct8KO mice. This thyroid hormone analog is suitable for the treatment of the hypermetabolism in patients with MCT8 deficiency, as suggested in limited preliminary human trials. PMID:26322373

  19. Transient neonatal hyperthyrotrophinaemia: a serum abnormality due to transplacentally acquired antibody to thyroid stimulating hormone.

    PubMed Central

    Lazarus, J H; John, R; Ginsberg, J; Hughes, I A; Shewring, G; Smith, B R; Woodhead, J S; Hall, R

    1983-01-01

    In a screening programme for neonatal hypothyroidism an otherwise healthy female infant was found to have a high concentration of thyroid stimulating hormone in a filter paper blood spot and in serum. A high concentration was also found in the maternal serum. Mother and baby were both biochemically euthyroid with normal serum thyroxine concentrations. The apparently high concentration of thyroid stimulating hormone in the mother was due to the presence of an IgG antibody that bound to human but not bovine thyroid stimulating hormone. Maternal serum inhibited the action of human thyroid stimulating hormone in an in vitro bioassay for the hormone. It is suggested that the baby acquired the antibody transplacentally, especially as the concentration of thyroid stimulating hormone subsequently fell. It is concluded that maternal serum should be assayed for thyroid stimulating hormone when a neonate is found to have a high concentration of the hormone and a normal concentration of thyroxine to establish the incidence of this finding and to avoid inappropriate replacement treatment. PMID:6402161

  20. Thyroid Hormone Regulates the mRNA Expression of Small Heterodimer Partner through Liver Receptor Homolog-1

    PubMed Central

    Ahn, Hwa Young; Kim, Hwan Hee; Kim, Ye An; Kim, Min; Ohn, Jung Hun; Chung, Sung Soo; Lee, Yoon-Kwang; Park, Do Joon; Park, Kyong Soo

    2015-01-01

    Background Expression of hepatic cholesterol 7α-hydroxylase (CYP7A1) is negatively regulated by orphan nuclear receptor small heterodimer partner (SHP). In this study, we aimed to find whether thyroid hormone regulates SHP expression by modulating the transcriptional activities of liver receptor homolog-1 (LRH-1). Methods We injected thyroid hormone (triiodothyronine, T3) to C57BL/6J wild type. RNA was isolated from mouse liver and used for microarray analysis and quantitative real-time polymerase chain reaction (PCR). Human hepatoma cell and primary hepatocytes from mouse liver were used to confirm the effect of T3 in vitro. Promoter assay and electrophoretic mobility-shift assay (EMSA) were also performed using human hepatoma cell line Results Initial microarray results indicated that SHP expression is markedly decreased in livers of T3 treated mice. We confirmed that T3 repressed SHP expression in the liver of mice as well as in mouse primary hepatocytes and human hepatoma cells by real-time PCR analysis. LRH-1 increased the promoter activity of SHP; however, this increased activity was markedly decreased after thyroid hormone receptor β/retinoid X receptor α/T3 administration. EMSA revealed that T3 inhibits specific LRH-1 DNA binding. Conclusion We found that thyroid hormone regulates the expression of SHP mRNA through interference with the transcription factor, LRH-1. PMID:26485468

  1. Thyroid hormone-mediated autophagy and mitochondrial turnover in NAFLD.

    PubMed

    Sinha, Rohit Anthony; Yen, Paul M

    2016-01-01

    Non-alcoholic fatty liver disease (NAFLD) is a fast-growing silent epidemic that is present in both developed and developing countries. Initially thought as a benign deposition of lipids in the liver, it now has been shown to be a major risk factor for type II diabetes and one of the leading causes of cirrhosis. Recent findings suggest that dysregulation of mitochondrial homeostasis and autophagy play critical roles in the hepatocyte injury and insulin resistance of NAFLD. Thyroid hormone (TH) is a major stimulator of hepatic autophagy and mitochondrial function. Decreased TH action has been associated with NAFLD in man. In this review, we highlight some of the new discoveries that demonstrate the roles of TH in hepatic mitochondrial homeostasis via mitophagy and their implications for NAFLD. PMID:27437098

  2. Effects of thyroid hormones on inner mitochondrial membrane fluidity.

    PubMed

    Chimenti, R; Covello, C; De Cicco, T; Bruno, R; Martino, G

    2001-01-01

    Authors studied the effects of thyroid hormones and their diasteroisomers and 3,5-diiodothyronine (LT2) on the fluidity properties of inner mitochondrial membrane (IMM) by specifical fluorescent probe for the internal zone of biological membranes, the 1,6-diphenyl-1,3,5-hexatriene (DPH). The studied parameters are Arrhenius and Perrin plots. The DPH shows a decreased fluorescence quenching in the presence of both T3 and T4. The maximum effect is observed with 2 nM LT2. LT2 is more effective than LT3 in the central zone. The data confirm the selective action of LT3 and LT4 on IMM fluidity. PMID:11822198

  3. Thyroid hormones regulate skeletal muscle regeneration after acute injury.

    PubMed

    Leal, Anna Lúcia R C; Albuquerque, João Paulo C; Matos, Marina S; Fortunato, Rodrigo S; Carvalho, Denise P; Rosenthal, Doris; da Costa, Vânia Maria Corrêa

    2015-02-01

    We evaluated the effects of hypo- and hyperthyroid statuses during the initial phase of skeletal muscle regeneration in rats. To induce hypo- or hyperthyroidism, adult male Wistar rats were treated with methimazole (0.03%) or T4 (10 μg/100 g), respectively, for 10 days. Three days before sacrifice, a crush injury was produced in the solear muscles of one half of the animals, while the other half remained intact. T3, T4, TSH, and leptin serum levels were not affected by the injury. Serum T3 and T4 levels were significantly increased in hyperthyroid and hyper-injury animals. Hypothyroidism was confirmed by the significant increase in serum TSH levels in hypothyroid and hypo-injury animals. Injury increased cell infiltration and macrophage accumulation especially in hyperthyroid animals. Both type 2 and type 3 deiodinases were induced by lesion, and the opposite occurred with the type 1 isoform, at least in the control and hyperthyroid groups. Injury increased both MyoD and myogenin expression in all the studied groups, but only MyoD expression was increased by thyroidal status only at the protein level. We conclude that thyroid hormones modulate skeletal muscle regeneration possibly by regulating the inflammatory process, as well as MyoD and myogenin expression in the injured tissue. PMID:24798447

  4. Exhaustive exercise and vitamins C and E modulate thyroid hormone levels at low and high altitudes

    PubMed Central

    Al-Hashem, Fahaid; Alkhateeb, Mahmoud; Al-Ani, Bahjat; Sakr, Hussein; Khalil, Mohammad

    2012-01-01

    Thyroid hormones play an important role in cell growth and differentiation and regulation of oxygen consumption and thermogenesis. The effect of altitude and vitamin supplementation on thyroid hormone levels in animals or humans performing acute exhaustive exercise have not been investigated before. Therefore, we thought to test whether exhaustive exercise-induced stress with antioxidant supplementation was capable of modulating the level of thyroid hormones at different altitudes. Serum levels of T4 (Thyroxin), T3 (Triiodothyronine), and TSH (Thyroid Stimulating Hormone) were measured in rats (N=36) born and bred in low altitude (600 m above sea level) and high altitude (2200 m above sea level) following forced swimming with or without vitamins C and E (25 mg/kg) pre-treatments. Thyroid levels were significantly decreased in resting rats at high altitude compared to low altitude, and swimming exercise moderately increased T3 and TSH at both high and low altitudes, whereas T4 was markedly increased (62 %) at low altitude compared to a moderate high altitude increase (28 %). Co-administration of vitamins C and E augmented the observed forced swimming-induced thyroid release. However, the conversion of T4 to T3 was reduced in both altitude areas following swimming exercise and vitamin pre-treatment had no effect. We conclude that acute stress induced thyroidal hormones in rats, which was augmented by antioxidant drugs in both high and low altitude areas. These findings may play an important role in the human pathophysiology of thyroid gland at different altitudes.

  5. Thyroid hormones concentrations and ECG picture in the dog.

    PubMed

    Pasławska, U; Noszczyk-Nowak, A; Kungl, K; Bioły, K; Popiel, J; Nicpoń, J

    2006-01-01

    Disorders of the thyroid gland activity are the most commonly encountered disturbances of endocrine origin in the dog. Hypo- or hyperthyroidism may disturb the function of the cardiovascular system and cause arrhythmias. The aim of this study was to evaluate the influence of thyroid gland activity on electrocardiogram (ECG) picture in the dog by comparing ECG curves of healthy dogs, dogs with hypothyroidism and dogs with cardiac insufficiency caused by endocardiosis of the mitral valve. The study was performed on 38 dogs, patients of the Department of Internal and Parasitic Diseases with Clinic for Horses, Dogs and Cats in Wrocław. The animals were assigned to 3 groups: Group I--control group, 13 clinically healthy dogs; Group II--14 dogs with diagnosed cardiac insufficiency caused by endocardiosis of the mitral valve; Group III--11 dogs with hypothyroidism. Clinical examination of the animals was conducted according to the following pattern: anamnesis, general clinical examination, cardiological examination (ECG, USG of the heart) and laboratory analysis (triacylglycerydes, cholesterol, T3, T4, FT4). In this study, the significant influence of thyroid gland activity on ECG picture of the evaluated dogs was found. In the dogs with hypothyroidism a decrease in the sino-atrial node activity was observed, which led to decreased heart rate. In dogs with hypothyroidism, the innerheart conduction was reduced, which was demonstrated by prolongation of the P wave, QRS complex and the QT interval. PMID:17203744

  6. Soy isoflavones interfere with thyroid hormone homeostasis in orchidectomized middle-aged rats

    SciTech Connect

    Šošić-Jurjević, Branka; Filipović, Branko; Wirth, Eva Katrin; Živanović, Jasmina; Radulović, Niko; Janković, Snežana; Milošević, Verica; Köhrle, Josef

    2014-07-15

    We previously reported that genistein (G) and daidzein (D) administered subcutaneously (10 mg/kg) induce changes in the angio-follicular units of the thyroid gland, reduce concentration of total thyroid hormones (TH) and increase thyrotropin (TSH) in serum of orchidectomized middle-aged (16-month-old) rats. To further investigate these effects, we now examined expression levels of the thyroglobulin (Tg), thyroperoxidase (Tpo), vascular endothelial growth factor A (Vegfa) and deiodinase type 1 (Dio 1) genes in the thyroid; in the pituitary, genes involved in TH feedback control (Tsh β, Dio 1, Dio 2, Trh receptor); and in the liver and kidney, expression of T{sub 3}-activated genes Dio 1 and Spot 14, as well as transthyretin (Ttr), by quantitative real-time PCR. We also analyzed TPO-immunopositivity and immunofluorescence of T{sub 4} bound to Tg, determined thyroid T{sub 4} levels and measured deiodinase enzyme activities in examined organs. Decreased expression of Tg and Tpo genes (p < 0.05) correlated with immunohistochemical staining results, and together with decreased serum total T{sub 4} levels, indicates decreased Tg and TH synthesis following treatments with both isoflavones. However, expression of Spot 14 (p < 0.05) gene in liver and kidney was up-regulated, and liver Dio 1 expression and activity (p < 0.05) increased. At the level of pituitary, no significant change in gene expression levels, or Dio 1 and 2 enzyme activities was observed. In conclusion, both G and D impaired Tg and TH synthesis, but at the same time increased tissue availability of TH in peripheral tissues of Orx middle-aged rats. - Highlights: • We tested how genistein and daidzein interfere with thyroid hormone homeostasis. • Thyroid: decreased expression of Tg and TPO genes correlated with IHC results. • Serum: total T{sub 4} reduced and TSH increased. • Liver and kidney: expression of Spot 14 and liver Dio 1 activity increased. • Pituitary: expression of T{sub 3}-regulated

  7. Influence of thyroid hormone and thyroid hormone receptors in the generation of cerebellar gamma-aminobutyric acid-ergic interneurons from precursor cells.

    PubMed

    Manzano, Jimena; Cuadrado, Maria; Morte, Beatriz; Bernal, Juan

    2007-12-01

    Thyroid hormones have important actions in the developing central nervous system. We describe here a novel action of thyroid hormone and its nuclear receptors on maturation of cerebellar gamma-aminobutyric acid (GABA)-ergic interneurons from their precursor cells. In rats, the density of GABAergic terminals in the cerebellum was decreased by hypothyroidism, as shown by immunohistochemistry for the GABA transporter GAT-1. This was due, at least partially, to a decreased number of GABAergic cells, because the number of Golgi II cells in the internal granular layer was decreased. GABAergic interneurons in the cerebellum differentiate from precursors expressing the Pax-2 transcription factor, generated in the subventricular zone of the embryonic fourth ventricle from where they migrate to the cerebellum. Hypothyroidism caused both decreased proliferation and delayed differentiation of precursors, with the net effect being an accumulation of immature cells during the neonatal period. The contribution of thyroid hormone receptors was studied by treating hypothyroid rats with T(3) or with the thyroid hormone receptor (TR) beta-selective agonist GC-1. Whereas treatment with T(3) reduced the number of precursors to control levels, GC-1 had only a partial effect, indicating that both TRalpha1 and TRbeta mediate the actions of T(3). Deletion of TRalpha1 in mice decreased cerebellar GAT-1 expression and Pax-2 precursor cell proliferation. It is concluded that thyroid hormone, acting through the nuclear receptors, has a major role in the proliferation and further differentiation of the Pax-2 precursors of cerebellar GABAergic cells. PMID:17761765

  8. Increased FOG-2 in failing myocardium disrupts thyroid hormone-dependent SERCA2 gene transcription

    PubMed Central

    Rouf, Rosanne; Greytak, Sarah; Wooten, Eric C.; Wu, Jing; Boltax, Jay; Picard, Michael H.; Svensson, Eric C.; Dillmann, Wolfgang H.; Patten, Richard D.; Huggins, Gordon S.

    2009-01-01

    Reduced expression of sarcoplasmic reticulum calcium ATPase-2 (SERCA2) and other genes in the adult cardiac gene program has raised consideration of an impaired responsiveness to thyroid hormone (T3) that develops in the advanced failing heart. Here we show that human and murine cardiomyopathy hearts have increased expression of Friend of GATA-2 (FOG-2), a cardiac nuclear hormone receptor co-repressor protein. Cardiac-specific overexpression of FOG-2 in transgenic mice led to depressed cardiac function, activation of the fetal gene program, congestive heart failure, and early death. SERCA2 transcript and protein levels were reduced in FOG-2 transgenic hearts, and FOG-2 overexpression impaired T3-mediated SERCA2 expression in cultured cardiomyocytes. FOG-2 physically interacts with thyroid hormone receptor-α1 and abrogated even high levels of T3-mediated SERCA2 promoter activity. These results demonstrate that SERCA2 is an important target of FOG-2 and that increased FOG-2 expression may contribute to a decline in cardiac function in end-stage heart failure by impaired T3 signaling. PMID:18658259

  9. Making the gradient: Thyroid hormone regulates cone opsin expression in the developing mouse retina

    PubMed Central

    Roberts, Melanie R.; Srinivas, Maya; Forrest, Douglas; Morreale de Escobar, Gabriella; Reh, Thomas A.

    2006-01-01

    Most mammals have two types of cone photoreceptors, which contain either medium wavelength (M) or short wavelength (S) opsin. The number and spatial organization of cone types varies dramatically among species, presumably to fine-tune the retina for different visual environments. In the mouse, S- and M-opsin are expressed in an opposing dorsal–ventral gradient. We previously reported that cone opsin patterning requires thyroid hormone β2, a nuclear hormone receptor that regulates transcription in conjunction with its ligand, thyroid hormone (TH). Here we show that exogenous TH inhibits S-opsin expression, but activates M-opsin expression. Binding of endogenous TH to TRβ2 is required to inhibit S-opsin and to activate M-opsin. TH is symmetrically distributed in the retina at birth as S-opsin expression begins, but becomes elevated in the dorsal retina at the time of M-opsin onset (postnatal day 10). Our results show that TH is a critical regulator of both S-opsin and M-opsin, and suggest that a TH gradient may play a role in establishing the gradient of M-opsin. These results also suggest that the ratio and patterning of cone types may be determined by TH availability during retinal development. PMID:16606843

  10. Role of thyroid hormone in postnatal circulatory and metabolic adjustments.

    PubMed Central

    Breall, J A; Rudolph, A M; Heymann, M A

    1984-01-01

    To assess the role of the early postnatal surge in plasma thyroid hormone concentrations on cardiovascular and metabolic adaptations, we measured cardiac output, total oxygen consumption, and plasma triiodothyronine (T3) concentrations in three groups of lambs in the first 6 h after delivery. 15 fetal lambs were prepared at gestational ages of 128-129 d by placing catheters in the brachiocephalic artery, descending aorta, distal inferior vena cava, left atrium, and pulmonary artery so that measurements could be made soon after delivery. They were divided into three groups: Group I comprised five control animals; Group II consisted of five fetuses in which thyroidectomy was performed at surgery at 129 d gestation; and Group III consisted of five animals in which thyroidectomy was performed at term gestation during delivery by caesarian section, prior to severing the umbilical cord. The lambs in Group I exhibited a rapid postnatal rise in T3 concentrations, similar to that described previously, reaching a peak value of about 5 ng/ml. Although the postnatal surge in T3 concentration was arrested in Group II and III animals, Group II had no detectable plasma T3, while the Group III animals had T3 concentrations of about 0.8 ng/ml, which were within the range previously reported for term lamb fetuses. The lambs in group II showed 40-50% lower left ventricular outputs (190 vs. 297 ml/kg per min), systemic blood flows (155 vs. 286 ml/kg per min), and oxygen consumptions (9.8 vs. 20.2 ml/kg per min) as compared with Group I animals over the entire 6-h period. The lambs in Group II also had significantly lower heart rates (131 vs. 192 beats/min) and mean systemic arterial pressures (56 vs. 72 torr). However, there were no significant differences for any of these measurements between the Group III and Group I lambs. The reduction in cardiac output in the Group II animals were reflected in a significantly lower blood flow to the peripheral circulation, but there were no

  11. Postpartum Thyroiditis

    MedlinePlus

    ... high thyroid hormone levels in the blood) and hypothyroidism (low thyroid hormone levels in the blood). In postpartum thyroiditis, thyrotoxicosis occurs first followed by hypothyroidism. What causes postpartum thyroiditis? The exact cause is ...

  12. Kcne2 deletion uncovers its crucial role in thyroid hormone biosynthesis

    PubMed Central

    Roepke, Torsten K.; King, Elizabeth C.; Reyna-Neyra, Andrea; Paroder, Monika; Purtell, Kerry; Koba, Wade; Fine, Eugene; Lerner, Daniel J.; Carrasco, Nancy; Abbott, Geoffrey W.

    2009-01-01

    Thyroid dysfunction affects 1–4% of the population worldwide, causing defects including neurodevelopmental disorders, dwarfism and cardiac arrhythmia. Here, we show that KCNQ1 and KCNE2 form a TSH-stimulated, constitutively-active, thyrocyte K+ channel required for normal thyroid hormone biosynthesis. Targeted disruption of Kcne2 impaired thyroid iodide accumulation up to 8-fold, impaired maternal milk ejection and halved milk T4 content, causing hypothyroidism, 50% reduced litter size, dwarfism, alopecia, goiter, and cardiac abnormalities including hypertrophy, fibrosis, and reduced fractional shortening. The alopecia, dwarfism and cardiac abnormalities were alleviated by T3/T4 administration to pups, by supplementing dams with T4 pre- and postpartum, or by pre-weaning surrogacy with Kcne2+/+ dams; conversely these symptoms were elicited in Kcne2+/+ pups by surrogacy with Kcne2−/− dams. The data identify a critical thyrocyte K+ channel, provide a possible novel therapeutic avenue for thyroid disorders, and predict an endocrine component to some previously-identified KCNE2- and KCNQ1-linked human cardiac arrhythmias. PMID:19767733

  13. Thyroid hormone is required for growth adaptation to pressure load in the ovine fetal heart.

    PubMed

    Segar, Jeffrey L; Volk, Ken A; Lipman, Michael H B; Scholz, Thomas D

    2013-03-01

    Thyroid hormone exerts broad effects on the adult heart, but little is known regarding the role of thyroid hormone in the regulation of cardiac growth early in development and in response to pathophysiological conditions. To address this issue, we determined the effects of fetal thyroidectomy on cardiac growth and growth-related gene expression in control and pulmonary-artery-banded fetal sheep. Fetal thyroidectomy (THX) and/or placement of a restrictive pulmonary artery band (PAB) were performed at 126 ± 1 days of gestation (term, 145 days). Four groups of animals [n = 5-6 in each group; (i) control; (ii) fetal THX; (iii) fetal PAB; and (iv) fetal PAB + THX] were monitored for 1 week prior to being killed. Fetal heart rate was significantly lower in the two THX groups compared with the non-THX groups, while mean arterial blood pressure was similar among groups. Combined left and right ventricle free wall + septum weight, expressed per kilogram of fetal weight, was significantly increased in PAB (6.27 ± 0.85 g kg(-1)) compared with control animals (4.72 ± 0.12 g kg(-1)). Thyroidectomy significantly attenuated the increase in cardiac mass associated with PAB (4.94 ± 0.13 g kg(-1)), while THX alone had no detectable effect on heart mass (4.95 ± 0.27 g kg(-1)). The percentage of binucleated cardiomyocytes was significantly decreased in THX and PAB +THX groups (∼16%) compared with the non-THX groups (∼27%). No differences in levels of activated Akt, extracellular signal-regulated kinase or c-Jun N-terminal kinase were detected among the groups. Markers of cellular proliferation but not apoptosis or expression of growth-related genes were lower in the THX and THX+ PAB groups relative to thyroid-intact animals. These findings suggest that in the late-gestation fetal heart, thyroid hormone has important cellular growth functions in both physiological and pathophysiological states. Specifically, thyroid hormone is required for adaptive fetal cardiac growth in

  14. An Evo-Devo Approach to Thyroid Hormones in Cerebral and Cerebellar Cortical Development: Etiological Implications for Autism

    PubMed Central

    Berbel, Pere; Navarro, Daniela; Román, Gustavo C.

    2014-01-01

    The morphological alterations of cortical lamination observed in mouse models of developmental hypothyroidism prompted the recognition that these experimental changes resembled the brain lesions of children with autism; this led to recent studies showing that maternal thyroid hormone deficiency increases fourfold the risk of autism spectrum disorders (ASD), offering for the first time the possibility of prevention of some forms of ASD. For ethical reasons, the role of thyroid hormones on brain development is currently studied using animal models, usually mice and rats. Although mammals have in common many basic developmental principles regulating brain development, as well as fundamental basic mechanisms that are controlled by similar metabolic pathway activated genes, there are also important differences. For instance, the rodent cerebral cortex is basically a primary cortex, whereas the primary sensory areas in humans account for a very small surface in the cerebral cortex when compared to the associative and frontal areas that are more extensive. Associative and frontal areas in humans are involved in many neurological disorders, including ASD, attention deficit-hyperactive disorder, and dyslexia, among others. Therefore, an evo-devo approach to neocortical evolution among species is fundamental to understand not only the role of thyroid hormones and environmental thyroid disruptors on evolution, development, and organization of the cerebral cortex in mammals but also their role in neurological diseases associated to thyroid dysfunction. PMID:25250016

  15. The response of thyroid hormones, biochemical and enzymological biomarkers to pyrene exposure in common carp (Cyprinus carpio).

    PubMed

    Shirdel, Iman; Kalbassi, Mohammad Reza; Shokri, Milad; Olyaei, Roya; Sharifpour, Issa

    2016-08-01

    Polycyclic Aromatic Hydrocarbons (PAHs) are discharged into aquatic environments through anthropogenic activities mainly industrial and municipal effluents. There is little information on the adverse effects of pyrene, a member of the PAH family which is classified as a priority pollutant by the USEPA, on fish biochemical and physiological endpoints, particularly thyroid hormones. The present study investigated the effects of subacute semi-static pyrene exposure on biochemical, enzymological and ionoregulatory responses as well as thyroid hormones in common carp (Cyprinus carpio). The fish (140±10g, 1(+) year) were exposed to 10, 50 and 100µg/l nominal concentrations of pyrene for 35 days. The results revealed that pyrene at these concentrations significantly altered plasma levels of glucose, cholesterol, triglyceride, total protein, albumin, alanine aminotransferase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP). Moreover, plasma thyroid hormones (T3 and T4) were significantly decreased in fish exposed to pyrene. In contrast, plasma electrolytes (sodium, potassium and calcium) levels remained statistically unchanged after exposure to the various pyrene concentrations. In conclusion, the studied biomarkers may be used as monitoring tools to evaluate pyrene toxicity. Pyrene induced diverse effects on the physiological endpoints of common carp, thus this chemical should be considered in toxicity studies concerning PAHs. Furthermore, this study confirmed that there was an interaction between pyrene and the thyroid system in fish. Therefore, the thyroid system may be used to assess the impact of pyrene on fish. PMID:27123973

  16. Hatching the Cleidoic Egg: The Role of Thyroid Hormones

    PubMed Central

    De Groef, Bert; Grommen, Sylvia V.H.; Darras, Veerle M.

    2013-01-01

    A major life stage transition in birds and other oviparous sauropsids is the hatching of the cleidoic egg. Not unlike amphibian metamorphosis, hatching in these species can be regarded as a transition from a relatively well-protected “aqueous” environment to a more hazardous and terrestrial life outside the egg, a transition in which thyroid hormones (THs) (often in concert with glucocorticoids) play an important role. In precocial birds such as the chicken, the perihatch period is characterized by peak values of THs. THs are implicated in the control of muscle development, lung maturation and the switch from chorioallantoic to pulmonary respiration, yolk sac retraction, gut development and induction of hepatic genes to accommodate the change in dietary energy source, initiation of thermoregulation, and the final stages of brain maturation as well as early post-hatch imprinting behavior. There is evidence that, at least for some of these processes, THs may have similar roles in non-avian sauropsids. In altricial birds such as passerines on the other hand, THs do not rise significantly until well after hatching and peak values coincide with the development of endothermy. It is not known how hatching-associated processes are regulated by hormones in these animals or how this developmental mode evolved from TH-dependent precocial hatching. PMID:23755041

  17. MODEST THYROID HORMONE INSUFFICIENCY DURING DEVELOPMENT INDUCES A CELLULAR MALFORMATION IN THE CORPUS CALLOSUM: A MODEL OF CORTICAL DYSPLASIA.

    EPA Science Inventory

    There is a growing body of evidence that subtle decreases in maternal thyroid hormone during gestation can impact fetal brain development. The present study examined the impact of graded levels of thyroid hormone insufficiency on brain development in rodents. Maternal thyroid ho...

  18. Effects of high selenium and fat supplementation on growth performance and thyroid hormones concentration of broilers.

    PubMed

    Chadio, Stella E; Pappas, Athanasios C; Papanastasatos, Anastasios; Pantelia, Dionysia; Dardamani, Aikaterini; Fegeros, Konstantinos; Zervas, George

    2015-01-01

    A total of 400, as hatched, broilers were used to investigate the effect of increase of selenium and energy intake on thyroid hormone metabolism, growth and liver fatty acid profile. There were 5 replicates of 4 dietary treatments namely, TA (0.289mg Se per kg diet and adequate energy content), TB (0.583mg Se per kg diet and adequate energy content), TC (0.267mg Se per kg diet and 9% increase of energy content) and TD (0.576mg Se per kg diet and 9% increase of energy content). Diets were isonitrogenous. Zinc L-selenomethionine complex was used to increase Se content and corn oil was used to increase the energy content. The experiment lasted 42 days. Broiler growth performance was not significantly affected by dietary treatments. Liver glutathione peroxidase (GPx) activity increased (P<0.05) in broilers fed high Se and energy diets compared to other ones. Whole blood GPx activity was higher in Se supplemented groups however, it was reduced by age. Thyroid hormone concentrations were unaffected by dietary treatments. A significant increase of linoleic and arachidonic acid concentration (P<0.001) was observed in the liver of broilers fed diets with moderately increased energy content and supplemented with Se compared to those fed diets with moderately increased energy content alone. In conclusion, zinc L-selenomethionine complex and moderate increase of energy content did not affect growth rate or thyroid hormone metabolism but led to increased liver fatty acid content and hepatic GPx activity. PMID:25447588

  19. Thyroid hormone regulation of gene expression in the developing rat fetal cerebral cortex: prominent role of the Ca2+/calmodulin-dependent protein kinase IV pathway.

    PubMed

    Morte, Beatriz; Díez, Diego; Ausó, Eva; Belinchón, Mónica M; Gil-Ibáñez, Pilar; Grijota-Martínez, Carmen; Navarro, Daniela; de Escobar, Gabriella Morreale; Berbel, Pere; Bernal, Juan

    2010-02-01

    Thyroid hormones influence brain development through regulation of gene expression mediated by nuclear receptors. Nuclear receptor concentration increases rapidly in the human fetus during the second trimester, a period of high sensitivity of the brain to thyroid hormones. In the rat, the equivalent period is the last quarter of pregnancy. However, little is known about thyroid hormone action in the fetal brain, and in rodents, most thyroid hormone-regulated genes have been identified during the postnatal period. To identify potential targets of thyroid hormone in the fetal brain, we induced maternal and fetal hypothyroidism by maternal thyroidectomy followed by antithyroid drug (2-mercapto-1-methylimidazole) treatment. Microarray analysis identified differentially expressed genes in the cerebral cortex of hypothyroid fetuses on d 21 after conception. Gene function analysis revealed genes involved in the biogenesis of the cytoskeleton, neuronal migration and growth, and branching of neurites. Twenty percent of the differentially expressed genes were related to each other centered on the Ca(2+) and calmodulin-activated kinase (Camk4) pathway. Camk4 was regulated directly by T(3) in primary cultured neurons from fetal cortex, and the Camk4 protein was also induced by thyroid hormone. No differentially expressed genes were recovered when euthyroid fetuses from hypothyroid mothers were compared with fetuses from normal mothers. Although the results do not rule out a specific contribution from the mother, especially at earlier stages of pregnancy, they indicate that the main regulators of thyroid hormone-dependent, fetal brain gene expression near term are the fetal thyroid hormones. PMID:20056827

  20. Effects of a Model Inducer, Phenobarbital, on Thyroid Hormone Glucuronidation in Rat Hepatocytes

    EPA Science Inventory

    In vivo, hepatic enzyme inducers such as phenobarbital (PB) decrease circulating thyroid hormone (TH) concentrations. This decrease in circulating TH occurs in part through extrathyroidal mechanisms. Specifically, through the induction of hepatic xenobiotic metabolizing enzymes...

  1. Impact of Low-Level Thyroid Hormone Disruption Induced by Propylthiouracil on Brain Development and Function.*

    EPA Science Inventory

    The critical role of thyroid hormone (TH) in brain development is well established, severe deficiencies leading to significant neurological dysfunction. Much less information is available on more modest perturbations of TH on brain function. The present study induced varying degr...

  2. Developmental Thyroid Hormone Insufficiency Impairs Visual Contrast Sensitivity in Adult Male Offspring.

    EPA Science Inventory

    Severe thyroid hormone (TH) insufficiency during early development results in alterations in brain structure and function. Many environmental agents produce subtle alterations in TH status, but the dose-response relationships for such effects are unclear. We have previously demon...

  3. DEVELOPMENTAL THYROID HORMONE INSUFFICIENCY ALTERS THE AMPLITUDE OF THE ACOUSTIC STARTLE RESPONSE IN RATS

    EPA Science Inventory

    Purpose: The thyroid hormone (TH) system is one of the targets of endocrine disrupting chemicals. Since TH is essential for proper brain development, disruption by exposure to chemicals during development can result in adverse neurological outcomes. Previous studies revealed th...

  4. EFFECTS OF BDE-47 ON NUCLEAR RECEPTOR REGULATED GENES AND IMPLICATIONS FOR THYROID HORMONE DISRUPTION.

    EPA Science Inventory

    Previous studies have shown that exposure to polybrominated diphenyl ethers (PBDEs) can decrease thyroid hormone levels via the induction of hepatic uridinediphosphate-glucoronosyltransferase, (UGTs) which catalyze glucuronidation of T4 resulting in T4-glucuronide excretion. Bas...

  5. Computational Modeling of Thyroid Hormone Regulated Neurodevelopment for Chemical Prioritization (SOT)

    EPA Science Inventory

    Thyroid hormones (TH) are critical for normal brain development. Environmental chemicals may disrupt TH homeostasis through a variety of physiological systems including membrane transporters, serum transporters, synthesis and catabolic enzymes, and nuclear receptors. Current comp...

  6. Mechanism-based testing strategy using in vitro approaches for identification of thyroid hormone disrupting chemicals

    EPA Science Inventory

    The thyroid hormone (TH) system is involved in several important physiological processes, including regulation of energy metabolism, growth and differentiation, development and maintenance of brain function, thermo-regulation, osmo-regulation, and axis of regulation of other endo...

  7. RISK ASSESSMENT OF THYROID HORMONE DISRUPTION AND MIXTURES IN MARINE BIOTA

    EPA Science Inventory

    Varieties of chemicals alter thyroid hormones (THs) in vertabrates. The importance of THs during neurodevelopment, suggest that these chemicals would likely be developmental neurotoxicants. A number of epidemiological studies have demonstrated associations between exposure to p...

  8. MEASUREMENT OF THYROID HORMONES IN THE RAT SERA CONTAINING PERFLUOROOCTANESULFONATE (PFOS)

    EPA Science Inventory

    Perfluorooctanesulfonate (PFOS), a persistent and bioaccumulative acid, is widely distributed in humans and wildlife. Prior studies with PFOS (rats and monkeys) have observed decreased total and free thyroid hormones (TH) in serum without a rise in thyrotropin (TSH). Measuremen...

  9. Characterization of Thyroid Hormone Transporter Protein Expression during Tissue-specific Metamorphic Events in Xenopus tropicalis

    EPA Science Inventory

    Thyroid hormone (TH) induces the dramatic morphological and physiological changes that together comprise amphibian metamorphosis. TH-responsive tissues vary widely with developmental timing of TH-induced changes. How larval tadpole tissues are able to employ distinct metamorphi...

  10. THYROID HORMONE INSUFFICIENCY DURING BRAIN DEVELOPMENT REDUCES PARVALBUMIN IMMUNOREACTIVITY AND INHIBITORY FUNCTION IN THE HIPPOCAMPUS.

    EPA Science Inventory

    The EPA must evaluate the risk of exposure of the developing brain to chemicals with the potential to disrupt thyroid hormone homeostasis. The existing literature identifies morphological and neurochemical indices of severe neonatal hypothyroidism in the early postnatal period i...

  11. Thyroid Hormone Receptor α Plays an Essential Role in Male Skeletal Muscle Myoblast Proliferation, Differentiation, and Response to Injury.

    PubMed

    Milanesi, Anna; Lee, Jang-Won; Kim, Nam-Ho; Liu, Yan-Yun; Yang, An; Sedrakyan, Sargis; Kahng, Andrew; Cervantes, Vanessa; Tripuraneni, Nikita; Cheng, Sheue-yann; Perin, Laura; Brent, Gregory A

    2016-01-01

    Thyroid hormone plays an essential role in myogenesis, the process required for skeletal muscle development and repair, although the mechanisms have not been established. Skeletal muscle develops from the fusion of precursor myoblasts into myofibers. We have used the C2C12 skeletal muscle myoblast cell line, primary myoblasts, and mouse models of resistance to thyroid hormone (RTH) α and β, to determine the role of thyroid hormone in the regulation of myoblast differentiation. T3, which activates thyroid hormone receptor (TR) α and β, increased myoblast differentiation whereas GC1, a selective TRβ agonist, was minimally effective. Genetic approaches confirmed that TRα plays an important role in normal myoblast proliferation and differentiation and acts through the Wnt/β-catenin signaling pathway. Myoblasts with TRα knockdown, or derived from RTH-TRα PV (a frame-shift mutation) mice, displayed reduced proliferation and myogenic differentiation. Moreover, skeletal muscle from the TRα1PV mutant mouse had impaired in vivo regeneration after injury. RTH-TRβ PV mutant mouse model skeletal muscle and derived primary myoblasts did not have altered proliferation, myogenic differentiation, or response to injury when compared with control. In conclusion, TRα plays an essential role in myoblast homeostasis and provides a potential therapeutic target to enhance skeletal muscle regeneration. PMID:26451739

  12. Thyroid hormone-regulated brain mitochondrial genes revealed by differential cDNA cloning.

    PubMed Central

    Vega-Núñez, E; Menéndez-Hurtado, A; Garesse, R; Santos, A; Perez-Castillo, A

    1995-01-01

    Thyroid hormone (T3) plays a critical role in the development of the central nervous system and its deficiency during the early neonatal period results in severe brain damage. However the mechanisms involved and the genes specifically regulated by T3 during brain development are largely unknown. By using a subtractive hybridization technique we have isolated a number of cDNAs that represented mitochondrial genes (12S and 16S rRNAs and cytochrome c oxidase subunit III). The steady state level of all three RNAs was reduced in hypothyroid animals during the postnatal period and T3 administration restored control levels. During fetal life the level of 16S rRNA was decreased in the brain of hypothyroid animals, suggesting a prenatal effect of thyroid hormone on brain development. Since T3 does not affect the amount of mitochondrial DNA, the results suggest that the effect of T3 is at transcriptional and/or postranscriptional level. In addition, the transcript levels for two nuclear-encoded mitochondrial cytochrome c oxidase subunits: subunits IV and VIc were also decreased in the brains of hypothyroid animals. Hypothyroidism-induced changes in mitochondrial RNAs were followed by a concomitant 40% decrease in cytochrome c oxidase activity. This study shows that T3 is an important regulator of mitochondrial function in the neonatal brain and, more importantly, provides a molecular basis for the specific action of this hormone in the developing brain. Images PMID:7635984

  13. The synthetic thyroid hormone, levothyroxine, protects cholinergic neurons in the hippocampus of naturally aged mice.

    PubMed

    Fu, Ailing; Zhou, Rumei; Xu, Xingran

    2014-04-15

    The thyroid hormones, triiodothyronine and thyroxine, play important roles in cognitive function during the mammalian lifespan. However, thyroid hormones have not yet been used as a therapeutic agent for normal age-related cognitive deficits. In this study, CD-1 mice (aged 24 months) were intraperitoneally injected with levothyroxine (L-T4; 1.6 μg/kg per day) for 3 consecutive months. Our findings revealed a significant improvement in hippocampal cytoskeletal rearrangement of actin and an increase in serum hormone levels of L-T4-treated aged mice. Furthermore, the survival rate of these mice was dramatically increased from 60% to 93.3%. The Morris water maze task indicated that L-T4 restored impaired spatial memory in aged mice. Furthermore, level of choline acetyltransferase, acetylcholine, and superoxide dismutase were increased in these mice, thus suggesting that a possible mechanism by which L-T4 reversed cognitive impairment was caused by increased activity of these markers. Overall, supplement of low-dosage L-T4 may be a potential therapeutic strategy for normal age-related cognitive deficits. PMID:25206902

  14. Analysis of thyroid hormones in gland and serum using liquid chromatography-tandem mass spectrometry

    EPA Science Inventory

    Thyroid hormones (THs), which are critical for growth and development in all vertebrates, can be impacted through chemical perturbation of the hypothalamic-pituitary-thyroid (HPT)-axis. Amphibian and mammalian models are being used to address this research priority within US EPA...

  15. Gene Expression in Developing Brain is Altered by Modest Reductions in Circulating Levels of Thyroid Hormone.

    EPA Science Inventory

    Disruption of thyroid hormone (TH) homeostasis is a known effect of environmental contaminants. Although animal models of developmental TH deficiency can predict the impact of severe insults to the thyroid system, the effects of moderate TH insufficiencies have not been adequatel...

  16. HPLC-ICP/MS Analysis of Thyroid Hormone and Related Iodinated Compounds in Tissues and Media

    EPA Science Inventory

    Quantifying thyroid hormone (TH) and the synthetic precursors and metabolic products of TH is important for developing models of the hypothalamic-pituitary-thyroid (HPT) axis as well as for understanding the effects of xenobiotics on HPT axis function. In this study, the developm...

  17. Essential role of UCP1 modulating the central effects of thyroid hormones on energy balance

    PubMed Central

    Alvarez-Crespo, Mayte; Csikasz, Robert I.; Martínez-Sánchez, Noelia; Diéguez, Carlos; Cannon, Barbara; Nedergaard, Jan; López, Miguel

    2016-01-01

    Objective Classically, metabolic effects of thyroid hormones (THs) have been considered to be peripherally mediated, i.e. different tissues in the body respond directly to thyroid hormones with an increased metabolism. An alternative view is that the metabolic effects are centrally regulated. We have examined here the degree to which prolonged, centrally infused triiodothyronine (T3) could in itself induce total body metabolic effects and the degree to which brown adipose tissue (BAT) thermogenesis was essential for such effects, by examining uncoupling protein 1 (UCP1) KO mice. Methods Wildtype and UPC1 KO mice were centrally-treated with T3 by using minipumps. Metabolic measurements were analyzed by indirect calorimetry and expression analysis by RT-PCR or western blot. BAT morphology and histology were studied by immunohistochemistry. Results We found that central T3-treatment led to reduced levels of hypothalamic AMP-activated protein kinase (AMPK) and elevated body temperature (0.7 °C). UCP1 was essential for the T3-induced increased rate of energy expenditure, which was only observable at thermoneutrality and notably only during the active phase, for the increased body weight loss, for the increased hypothalamic levels of neuropeptide Y (NPY) and agouti-related peptide (AgRP) and for the increased food intake induced by central T3-treatment. Prolonged central T3-treatment also led to recruitment of BAT and britening/beiging (“browning”) of inguinal white adipose tissue (iWAT). Conclusions We conclude that UCP1 is essential for mediation of the central effects of thyroid hormones on energy balance, and we suggest that similar UCP1-dependent effects may underlie central energy balance effects of other agents. PMID:27069867

  18. Molecular mechanisms of corticosteroid synergy with thyroid hormone during tadpole metamorphosis.

    PubMed

    Bonett, Ronald M; Hoopfer, Eric D; Denver, Robert J

    2010-09-01

    Corticosteroids (CS) act synergistically with thyroid hormone (TH) to accelerate amphibian metamorphosis. Earlier studies showed that CS increase nuclear 3,5,3'-triiodothyronine (T(3)) binding capacity in tadpole tail, and 5' deiodinase activity in tadpole tissues, increasing the generation of T(3) from thyroxine (T(4)). In the present study we investigated CS synergy with TH by analyzing expression of key genes involved in TH and CS signaling using tadpole tail explant cultures, prometamorphic tadpoles, and frog tissue culture cells (XTC-2 and XLT-15). Treatment of tail explants with T(3) at 100 nM, but not at 10 nM caused tail regression. Corticosterone (CORT) at three doses (100, 500 and 3400 nM) had no effect or increased tail size. T(3) at 10 nM plus CORT caused tails to regress similar to 100 nM T(3). Thyroid hormone receptor beta (TRbeta) mRNA was synergistically upregulated by T(3) plus CORT in tail explants, tail and brain in vivo, and tissue culture cells. The activating 5' deiodinase type 2 (D2) mRNA was induced by T(3) and CORT in tail explants and tail in vivo. Thyroid hormone increased expression of glucocorticoid (GR) and mineralocorticoid receptor (MR) mRNAs. Our findings support that the synergistic actions of TH and CS in metamorphosis occur at the level of expression of genes for TRbeta and D2, enhancing tissue sensitivity to TH. Concurrently, TH enhances tissue sensitivity to CS by upregulating GR and MR. Environmental stressors can modulate the timing of tadpole metamorphosis in part by CS enhancing the response of tadpole tissues to the actions of TH. PMID:20338173

  19. Comparison of the in vitro effects of TCDD, PCB 126 and PCB 153 on thyroid-restricted gene expression and thyroid hormone secretion by the chicken thyroid gland.

    PubMed

    Katarzyńska, Dorota; Hrabia, Anna; Kowalik, Kinga; Sechman, Andrzej

    2015-03-01

    The aim of this study was to compare the in vitro effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), 3,3',4,4',5-pentachlorobiphenyl (PCB 126; a coplanar PCB congener) and 2,2'4,4',5,5'-hexachlorobiphenyl (PCB153; non-coplanar PCB) on mRNA expression of thyroid-restricted genes, i.e. sodium iodide symporter (NIS), thyroid peroxidase (TPO) and thyroglobulin (TG), and thyroid hormone secretion from the thyroid gland of the laying chicken. Relative expression levels of NIS, TG and TPO genes and thyroxine (T4) and triiodothyronine (T3) secretion from the thyroidal explants were quantified by the real-time qPCR and RIA methods, respectively. In comparison with the control group, TCDD and PCB 126 significantly increased mRNA expression of TPO and TG genes. TCDD did not affect NIS mRNA levels, but PCB 126 decreased its expression. No effect of PCB 153 on the expression of these genes was observed. TCDD and PCB 126 significantly decreased T4 and T3 secretion. There was no significant effect of PCB 153 on these hormone secretions. In conclusion, the results obtained show that in comparison with non-coplanar PCB 153, TCDD and coplanar PCB 126 can directly affect thyroid hormone synthesis and secretion, and in consequence, they may disrupt the endocrine function of the thyroid gland of the laying chicken. PMID:25682001

  20. Role of the type 2 iodothyronine deiodinase (D2) in the control of thyroid hormone signaling☆

    PubMed Central

    Drigo, Rafael Arrojo; Fonseca, Tatiana L.; Werneck-de-Castro, Joao Pedro Saar; Bianco, Antonio C.

    2016-01-01

    Scope of the review This review covers the recent advances in D2 biology, a member of the iodothyronine deiodinase family, thioredoxin fold-containing selenoenzymes that modify thyroid hormone signaling in a time- and cell-specific manner. The type II (D2) deiodinase catalyzes T4-to-T3 conversion as opposed to the type III (D3) deiodinase that terminates thyroid hormone action. Major conclusions D2-catalyzed T3 production increases thyroid hormone signaling whereas blocking D2 activity or disruption of the Dio2 gene leads to a state of localized hypothyroidism. D2 expression is regulated by different developmental, metabolic or environmental cues such as the hedgehog pathway, the adrenergic-and the TGR5-activated cAMP pathway, by xenobiotic molecules such as flavonols and by stress in the endoplasmic reticulum, which specifically reduces de novo synthesis of D2 via an eIF2a-mediated mechanism. Thus, D2 plays a central role in important physiological processes such as determining T3 content in developing tissues and in the adult brain, and promoting adaptive thermogenesis in brown adipose tissue. Notably, D2 is critical in the T4-mediated negative feed-back at the pituitary and hypothalamic levels, whereby T4 inhibits TSH and TRH expression, respectively. Notably, ubiquitination is a major step in the control of D2 activity, whereby T4 binding to and/or T4 catalysis triggers D2 inactivation by ubiquitination that is mediated by the E3 ubiquitin ligases WSB-1 and/or TEB4. Ubiquitinated D2 can be either targeted to proteasomal degradation or reactivated by deubiquitination, a process that is mediated by the deubiquitinases USP20/33 and is important in adaptive thermogenesis. General significance Here we review the recent advances in the understanding of D2 biology focusing on the mechanisms that regulate its expression and their biological significance in metabolically relevant tissues. This article is part of a Special Issue entitled Thyroid hormone signalling. PMID

  1. Thyroid hormone-regulated mouse cerebral cortex genes are differentially dependent on the source of the hormone: a study in monocarboxylate transporter-8- and deiodinase-2-deficient mice.

    PubMed

    Morte, Beatriz; Ceballos, Ainhoa; Diez, Diego; Grijota-Martínez, Carmen; Dumitrescu, Alexandra M; Di Cosmo, Caterina; Galton, Valerie Anne; Refetoff, Samuel; Bernal, Juan

    2010-05-01

    Thyroid hormones influence brain development through the control of gene expression. The concentration of the active hormone T(3) in the brain depends on T(3) transport through the blood-brain barrier, mediated in part by the monocarboxylate transporter 8 (Mct8/MCT8) and the activity of type 2 deiodinase (D2) generating T(3) from T(4). The relative roles of each of these pathways in the regulation of brain gene expression is not known. To shed light on this question, we analyzed thyroid hormone-dependent gene expression in the cerebral cortex of mice with inactivated Mct8 (Slc16a2) and Dio2 genes, alone or in combination. We used 34 target genes identified to be controlled by thyroid hormone in microarray comparisons of cerebral cortex from wild-type control and hypothyroid mice on postnatal d 21. Inactivation of the Mct8 gene (Mct8KO) was without effect on the expression of 31 of these genes. Normal gene expression in the absence of the transporter was mostly due to D2 activity because the combined disruption of Mct8 and Dio2 led to similar effects as hypothyroidism on the expression of 24 genes. Dio2 disruption alone did not affect the expression of positively regulated genes, but, as in hypothyroidism, it increased that of negatively regulated genes. We conclude that gene expression in the Mct8KO cerebral cortex is compensated in part by D2-dependent mechanisms. Intriguingly, positive or negative regulation of genes by thyroid hormone is sensitive to the source of T(3) because Dio2 inactivation selectively affects the expression of negatively regulated genes. PMID:20211971

  2. Dose-Response Analysis of Developmental Iodide Deficiency: Reductions in Thyroid Hormones and Impaired Hippocampal Synaptic Transmission

    EPA Science Inventory

    Iodide is an essential nutrient for thyroid hormone synthesis and severe iodide deficiency (ID) during early development is associated with neurological impairments. Several environmental contaminants can perturb the thyroid axis and this perturbation may be more acute under cond...

  3. Predictive Modeling of a Mixture of Thyroid Hormone Disrupting Chemicals that Affect Production and Clearance of Thyroxine

    EPA Science Inventory

    Thyroid hormone (TH) disrupting compounds interfere with both thyroidal and extrathyroidal mechanisms to decrease circulating thyroxine (T4). This research tested the hypothesis that serum T4 concentrations of rodents exposed to a mixture of both TH synthesis inhibitors (pesticid...

  4. Tissue-Specific Suppression of Thyroid Hormone Signaling in Various Mouse Models of Aging.

    PubMed

    Visser, W Edward; Bombardieri, Cíntia R; Zevenbergen, Chantal; Barnhoorn, Sander; Ottaviani, Alexandre; van der Pluijm, Ingrid; Brandt, Renata; Kaptein, Ellen; van Heerebeek, Ramona; van Toor, Hans; Garinis, George A; Peeters, Robin P; Medici, Marco; van Ham, Willy; Vermeij, Wilbert P; de Waard, Monique C; de Krijger, Ronald R; Boelen, Anita; Kwakkel, Joan; Kopchick, John J; List, Edward O; Melis, Joost P M; Darras, Veerle M; Dollé, Martijn E T; van der Horst, Gijsbertus T J; Hoeijmakers, Jan H J; Visser, Theo J

    2016-01-01

    DNA damage contributes to the process of aging, as underscored by premature aging syndromes caused by defective DNA repair. Thyroid state changes during aging, but underlying mechanisms remain elusive. Since thyroid hormone (TH) is a key regulator of metabolism, changes in TH signaling have widespread effects. Here, we reveal a significant common transcriptomic signature in livers from hypothyroid mice, DNA repair-deficient mice with severe (Csbm/m/Xpa-/-) or intermediate (Ercc1-/Δ-7) progeria and naturally aged mice. A strong induction of TH-inactivating deiodinase D3 and decrease of TH-activating D1 activities are observed in Csbm/m/Xpa-/- livers. Similar findings are noticed in Ercc1-/Δ-7, in naturally aged animals and in wild-type mice exposed to a chronic subtoxic dose of DNA-damaging agents. In contrast, TH signaling in muscle, heart and brain appears unaltered. These data show a strong suppression of TH signaling in specific peripheral organs in premature and normal aging, probably lowering metabolism, while other tissues appear to preserve metabolism. D3-mediated TH inactivation is unexpected, given its expression mainly in fetal tissues. Our studies highlight the importance of DNA damage as the underlying mechanism of changes in thyroid state. Tissue-specific regulation of deiodinase activities, ensuring diminished TH signaling, may contribute importantly to the protective metabolic response in aging. PMID:26953569

  5. Tissue-Specific Suppression of Thyroid Hormone Signaling in Various Mouse Models of Aging

    PubMed Central

    Visser, W. Edward; Barnhoorn, Sander; Ottaviani, Alexandre; van der Pluijm, Ingrid; Brandt, Renata; Kaptein, Ellen; van Heerebeek, Ramona; van Toor, Hans; Garinis, George A.; Peeters, Robin P.; Medici, Marco; van Ham, Willy; Vermeij, Wilbert P.; de Waard, Monique C.; de Krijger, Ronald R.; Boelen, Anita; Kwakkel, Joan; Kopchick, John J.; List, Edward O.; Melis, Joost P. M.; Darras, Veerle M.; Dollé, Martijn E. T.; van der Horst, Gijsbertus T. J.; Hoeijmakers, Jan H. J.; Visser, Theo J.

    2016-01-01

    DNA damage contributes to the process of aging, as underscored by premature aging syndromes caused by defective DNA repair. Thyroid state changes during aging, but underlying mechanisms remain elusive. Since thyroid hormone (TH) is a key regulator of metabolism, changes in TH signaling have widespread effects. Here, we reveal a significant common transcriptomic signature in livers from hypothyroid mice, DNA repair-deficient mice with severe (Csbm/m/Xpa-/-) or intermediate (Ercc1-/Δ-7) progeria and naturally aged mice. A strong induction of TH-inactivating deiodinase D3 and decrease of TH-activating D1 activities are observed in Csbm/m/Xpa-/- livers. Similar findings are noticed in Ercc1-/Δ-7, in naturally aged animals and in wild-type mice exposed to a chronic subtoxic dose of DNA-damaging agents. In contrast, TH signaling in muscle, heart and brain appears unaltered. These data show a strong suppression of TH signaling in specific peripheral organs in premature and normal aging, probably lowering metabolism, while other tissues appear to preserve metabolism. D3-mediated TH inactivation is unexpected, given its expression mainly in fetal tissues. Our studies highlight the importance of DNA damage as the underlying mechanism of changes in thyroid state. Tissue-specific regulation of deiodinase activities, ensuring diminished TH signaling, may contribute importantly to the protective metabolic response in aging. PMID:26953569

  6. Association Between Autoantibodies Against Thyroid Stimulating Hormone Receptor and Thyroid Diseases

    PubMed Central

    Latifi-Pupovci, Hatixhe

    2014-01-01

    Aim: The aim of this study is to determine the relationship between TRAb and different diseases. The highest percentage of increased TRAb levels can be found at patients with Graves’ diseases. Material and methods: Study was performed in 70 patients, grouped in three groups, and 14 persons who based on the clinical status and the levels of thyroid hormones do not have any thyroid disease. The TRAb levels has been determined in patients with Graves’ disease (N=40), Hashimoto’s disease (N=15), Plummer’s disease (N=15) and the control group (N=14). Results: The highest mean TRAb levels exist in patients with Graves’ disease. There exists a positive correlation between TRAb levels and T3, and T4, while there is no correlation between TSH and TRAb levels in patients with Graves’ disease,. On the other hand, the correlation between TRAb and T3 and T4 in patients with Hashimoto’s diseases and Plummers disease was shown to be positive, but of a low levels.

  7. [Studies of the morphology of the thyroid gland and thyroid hormone levels in the blood of rats in experiments on "Kosmos-1667" and "Kosmos-1887"].

    PubMed

    Plakhuta-Plakutina, G I; Kabitskiĭ, E N; Dmitrieva, N P; Amirkhanian, E A

    1990-01-01

    Using histological, electron microscopic, and biochemical (measurement of total thyroxine, free thyroxine and triiodothyronine in plasma) method, thyroid glands of 17 male rats of the Wistar SPF strain flown for 7 days on Cosmos-1667 and for 13 days on Cosmos-1887 were investigated. It was found that a longer exposure to space flight effects (for 13 days) led to a thyroid activity decline (significant reduction of thyrocyte size and nuclear area, accumulation of colloid drops in the cytoplasm, decrease of iodinated thyroglobulins in the colloid, etc.) together with a substantial decrease of T4 and T3 in plasma. The above structural and functional changes in the thyroid gland and hormonal status are characteristic of a moderate stress-reaction and reflect variations of the early and intermediate stages of adaptation to microgravity during 7- and 13-day space flights. PMID:2214661

  8. New avenues for regulation of lipid metabolism by thyroid hormones and analogs.

    PubMed

    Senese, Rosalba; Lasala, Pasquale; Leanza, Cristina; de Lange, Pieter

    2014-01-01

    Weight loss due to negative energy balance is a goal in counteracting obesity and type 2 diabetes mellitus. The thyroid is known to be an important regulator of energy metabolism through the action of thyroid hormones (THs). The classic, active TH, 3,5,3'-triiodo-L-thyronine (T3) acts predominantly by binding to nuclear receptors termed TH receptors (TRs), that recognize TH response elements (TREs) on the DNA, and so regulate transcription. T3 also acts through "non-genomic" pathways that do not necessarily involve TRs. Lipid-lowering therapies have been suggested to have potential benefits, however, the establishment of comprehensive therapeutic strategies is still awaited. One drawback of using T3 in counteracting obesity has been the occurrence of heart rhythm disturbances. These are mediated through one TR, termed TRα. The end of the previous century saw the exploration of TH mimetics that specifically bind to TR beta in order to prevent cardiac disturbances, and TH derivatives such as 3,5-diiodo-L-thyronine (T2), that possess interesting biological activities. Several TH derivatives and functional analogs have low affinity for the TRs, and are suggested to act predominantly through non-genomic pathways. All this has opened new perspectives in thyroid physiology and TH derivative usage as anti-obesity therapies. This review addresses the pros and cons of these compounds, in light of their effects on energy balance regulation and on lipid/cholesterol metabolism. PMID:25538628

  9. New avenues for regulation of lipid metabolism by thyroid hormones and analogs

    PubMed Central

    Senese, Rosalba; Lasala, Pasquale; Leanza, Cristina; de Lange, Pieter

    2014-01-01

    Weight loss due to negative energy balance is a goal in counteracting obesity and type 2 diabetes mellitus. The thyroid is known to be an important regulator of energy metabolism through the action of thyroid hormones (THs). The classic, active TH, 3,5,3′-triiodo-L-thyronine (T3) acts predominantly by binding to nuclear receptors termed TH receptors (TRs), that recognize TH response elements (TREs) on the DNA, and so regulate transcription. T3 also acts through “non-genomic” pathways that do not necessarily involve TRs. Lipid-lowering therapies have been suggested to have potential benefits, however, the establishment of comprehensive therapeutic strategies is still awaited. One drawback of using T3 in counteracting obesity has been the occurrence of heart rhythm disturbances. These are mediated through one TR, termed TRα. The end of the previous century saw the exploration of TH mimetics that specifically bind to TR beta in order to prevent cardiac disturbances, and TH derivatives such as 3,5-diiodo-L-thyronine (T2), that possess interesting biological activities. Several TH derivatives and functional analogs have low affinity for the TRs, and are suggested to act predominantly through non-genomic pathways. All this has opened new perspectives in thyroid physiology and TH derivative usage as anti-obesity therapies. This review addresses the pros and cons of these compounds, in light of their effects on energy balance regulation and on lipid/cholesterol metabolism. PMID:25538628

  10. Targeting the thyroid-stimulating hormone receptor with small molecule ligands and antibodies

    PubMed Central

    Davies, Terry F; Latif, Rauf

    2015-01-01

    Introduction The thyroid-stimulating hormone receptor (TSHR) is the essential molecule for thyroid growth and thyroid hormone production. Since it is also a key autoantigen in Graves’ disease and is involved in thyroid cancer pathophysiology, the targeting of the TSHR offers a logical model for disease control. Areas covered We review the structure and function of the TSHR and the progress in both small molecule ligands and TSHR antibodies for their therapeutic potential. Expert opinion Stabilization of a preferential conformation for the TSHR by allosteric ligands and TSHR antibodies with selective modulation of the signaling pathways is now possible. These tools may be the next generation of therapeutics for controlling the pathophysiological consequences mediated by the effects of the TSHR in the thyroid and other extrathyroidal tissues. PMID:25768836

  11. Guidelines for the Treatment of Hypothyroidism: Prepared by the American Thyroid Association Task Force on Thyroid Hormone Replacement

    PubMed Central

    Bianco, Antonio C.; Bauer, Andrew J.; Burman, Kenneth D.; Cappola, Anne R.; Celi, Francesco S.; Cooper, David S.; Kim, Brian W.; Peeters, Robin P.; Rosenthal, M. Sara; Sawka, Anna M.

    2014-01-01

    Background: A number of recent advances in our understanding of thyroid physiology may shed light on why some patients feel unwell while taking levothyroxine monotherapy. The purpose of this task force was to review the goals of levothyroxine therapy, the optimal prescription of conventional levothyroxine therapy, the sources of dissatisfaction with levothyroxine therapy, the evidence on treatment alternatives, and the relevant knowledge gaps. We wished to determine whether there are sufficient new data generated by well-designed studies to provide reason to pursue such therapies and change the current standard of care. This document is intended to inform clinical decision-making on thyroid hormone replacement therapy; it is not a replacement for individualized clinical judgment. Methods: Task force members identified 24 questions relevant to the treatment of hypothyroidism. The clinical literature relating to each question was then reviewed. Clinical reviews were supplemented, when relevant, with related mechanistic and bench research literature reviews, performed by our team of translational scientists. Ethics reviews were provided, when relevant, by a bioethicist. The responses to questions were formatted, when possible, in the form of a formal clinical recommendation statement. When responses were not suitable for a formal clinical recommendation, a summary response statement without a formal clinical recommendation was developed. For clinical recommendations, the supporting evidence was appraised, and the strength of each clinical recommendation was assessed, using the American College of Physicians system. The final document was organized so that each topic is introduced with a question, followed by a formal clinical recommendation. Stakeholder input was received at a national meeting, with some subsequent refinement of the clinical questions addressed in the document. Consensus was achieved for all recommendations by the task force. Results: We reviewed the

  12. Increased risk of papillary thyroid cancer related to hormonal factors in women.

    PubMed

    Wang, Ping; Lv, Long; Qi, Feng; Qiu, Feng

    2015-07-01

    Strikingly higher rates of papillary thyroid cancer in women compared with men suggest that hormonal factors may be involved in the development of this cancer. A number of independent studies have investigated the association between hormonal factors and papillary thyroid cancer risk in women but yielded conflicting and inconclusive findings. We performed a meta-analysis of all currently published studies to provide better estimates for the risk of papillary thyroid cancer related to menstrual, reproductive, and other hormonal factors in women. Six cohort studies and three case-control ones were included into our study after a comprehensive literature search. The pooled relative risk (RR) with 95 % confidence interval (95 % CI) implicated that late age at menopause was associated with an increased risk of papillary thyroid cancer (RR = 1.39, 95 % CI 1.03-1.89, P = 0.032). No significant association was demonstrated between papillary thyroid cancer risk and other hormone-related factors, including oral contraceptive, hormone replacement therapy, age at menarche, parity, age at first birth, menopausal status, and breast feeding. Subgroup analysis by study design confirmed those associations. Sensitivity analysis did not materially alter the pooled results. The meta-analysis firstly suggests that late age at menopause is a risk factor for papillary thyroid cancer. PMID:25669169

  13. Thyroid hormone receptor alpha1 follows a cooperative CRM1/calreticulin-mediated nuclear export pathway.

    PubMed

    Grespin, Matthew E; Bonamy, Ghislain M C; Roggero, Vincent R; Cameron, Nicole G; Adam, Lindsay E; Atchison, Andrew P; Fratto, Victoria M; Allison, Lizabeth A

    2008-09-12

    The thyroid hormone receptor alpha1 (TRalpha) exhibits a dual role as an activator or repressor of its target genes in response to thyroid hormone (T(3)). Previously, we have shown that TRalpha, formerly thought to reside solely in the nucleus bound to DNA, actually shuttles rapidly between the nucleus and cytoplasm. An important aspect of the shuttling activity of TRalpha is its ability to exit the nucleus through the nuclear pore complex. TRalpha export is not sensitive to treatment with the CRM1-specific inhibitor leptomycin B (LMB) in heterokaryon assays, suggesting a role for an export receptor other than CRM1. Here, we have used a combined approach of in vivo fluorescence recovery after photobleaching experiments, in vitro permeabilized cell nuclear export assays, and glutathione S-transferase pull-down assays to investigate the export pathway used by TRalpha. We show that, in addition to shuttling in heterokaryons, TRalpha shuttles rapidly in an unfused monokaryon system as well. Furthermore, our data show that TRalpha directly interacts with calreticulin, and point to the intriguing possibility that TRalpha follows a cooperative export pathway in which both calreticulin and CRM1 play a role in facilitating efficient translocation of TRalpha from the nucleus to cytoplasm. PMID:18641393

  14. Influence of Thyroid Hormone Disruption on the Incidence of Shingles

    PubMed Central

    Ajavon, Amakoe; Killian, Dennis; Odom, Randy; Figliozzi, Robert W.; Chen, Feng; Balish, Matthew; Parmar, Jayesh; Freeman, Robert; Snitzer, Jack; Hsia, S. Victor

    2015-01-01

    SUMMARY The reactivation of dormant alpha-Human Herpes Virus (αHHV) has been attributed to various causes often referred to as stressors. However, no clinical study investigating the relationship between stressors and reactivation exists in humans at this time. Herpes Simplex Virus Type-1 (HSV-1), an important αHHV, was shown to have its gene expression and replication regulated by Thyroid hormone (TH) using molecular biology approaches. Varicella Zoster Virus (VZV) is categorized in αHHV superfamily and shares similar homology with HSV-1. We hypothesize that a history of TH imbalance may be associated with the incidence of shingles (VZV reactivation). This current pilot study, based on a hospital medical claim database, was conducted as a retrospective case-controlled investigation to determine if a putative link between TH imbalance and incidence of shingles is present. An OR of 2.95 with a Chi-square of 51.74 was calculated for the total population diagnosed with TH disruption and shingles. Further analyses indicated that African American males exhibited much higher chance of simultaneous diagnoses. These results showed that a TH imbalance history may affect VZV reactivation at different incidence rates in different races and age groups. PMID:26189668

  15. Influence of thyroid hormone disruption on the incidence of shingles.

    PubMed

    Ajavon, A; Killian, D; Odom, R; Figliozzi, R W; Chen, F; Balish, M; Parmar, J; Freeman, R; Snitzer, J; Hsia, S V

    2015-12-01

    The reactivation of dormant alpha-human herpesvirus (αHHV) has been attributed to various causes often referred to as stressors. However, no clinical study investigating the relationship between stressors and reactivation exists in humans at this time. Herpes simplex virus type-1 (HSV-1), an important αHHV, was shown to have its gene expression and replication regulated by thyroid hormone (TH) using molecular biology approaches. Varicella zoster virus (VZV) is categorized in αHHV superfamily and shares similar homology with HSV-1. We hypothesize that a history of TH imbalance may be associated with the incidence of shingles (VZV reactivation). This current pilot study, based on a hospital medical claims database, was conducted as a retrospective case-controlled investigation to determine if a putative link between TH imbalance and incidence of shingles is present. An odds ratio of 2·95 with a χ 2 value of 51·74 was calculated for the total population diagnosed with TH disruption and shingles. Further analyses indicated that African American males exhibited a much higher chance of simultaneous diagnoses. These results show that a TH imbalance history may affect VZV reactivation at different incidence rates in different races and age groups. PMID:26189668

  16. Thyroid Hormones and Moderate Exposure to Perchlorate during Pregnancy in Women in Southern California

    PubMed Central

    Steinmaus, Craig; Pearl, Michelle; Kharrazi, Martin; Blount, Benjamin C.; Miller, Mark D.; Pearce, Elizabeth N.; Valentin-Blasini, Liza; DeLorenze, Gerald; Hoofnagle, Andrew N.; Liaw, Jane

    2015-01-01

    Background: Findings from national surveys suggest that everyone in the United States is exposed to perchlorate. At high doses, perchlorate, thiocyanate, and nitrate inhibit iodide uptake into the thyroid and decrease thyroid hormone production. Small changes in thyroid hormones during pregnancy, including changes within normal reference ranges, have been linked to cognitive function declines in the offspring. Objectives: We evaluated the potential effects of low environmental exposures to perchlorate on thyroid function. Methods: Serum thyroid hormones and anti-thyroid antibodies and urinary perchlorate, thiocyanate, nitrate, and iodide concentrations were measured in 1,880 pregnant women from San Diego County, California, during 2000–2003, a period when much of the area’s water supply was contaminated from an industrial plant with perchlorate at levels near the 2007 California regulatory standard of 6 μg/L. Linear regression was used to evaluate associations between urinary perchlorate and serum thyroid hormone concentrations in models adjusted for urinary creatinine and thiocyanate, maternal age and education, ethnicity, and gestational age at serum collection. Results: The median urinary perchlorate concentration was 6.5 μg/L, about two times higher than in the general U.S. population. Adjusted associations were identified between increasing log10 perchlorate and decreasing total thyroxine (T4) [regression coefficient (β) = –0.70; 95% CI: –1.06, –0.34], decreasing free thyroxine (fT4) (β = –0.053; 95% CI: –0.092, –0.013), and increasing log10 thyroid-stimulating hormone (β = 0.071; 95% CI: 0.008, 0.133). Conclusions: These results suggest that environmental perchlorate exposures may affect thyroid hormone production during pregnancy. This could have implications for public health given widespread perchlorate exposure and the importance of thyroid hormone in fetal neurodevelopment. Citation: Steinmaus C, Pearl M, Kharrazi M, Blount BC

  17. Thyroid hormone level is associated with motor symptoms in de novo Parkinson's disease.

    PubMed

    Umehara, Tadashi; Matsuno, Hiromasa; Toyoda, Chizuko; Oka, Hisayoshi

    2015-07-01

    Sympathetic denervation has been observed not only in the myocardium but also in the thyroid of patients with Parkinson's disease (PD). We investigated whether sympathetic denervation as indicated by decreased cardiac (123)I-meta-iodobenzylguanidine uptake is associated with the levels of thyroid hormones and whether the levels of thyroid hormones affect clinical manifestations in patients with PD. The subjects were 75 patients with de novo PD and 20 age-matched healthy controls. We examined the levels of thyroid-stimulating hormone, free triiodothyronine, and free thyroxine, and evaluated the associations of these levels with cardiac (123)I-meta-iodobenzylguanidine uptake and motor symptoms. The results showed that the free triiodothyronine level was below the normal range in 29 patients (approximately 40 %) and was significantly lower in the patients with PD than in the controls. The decreased free triiodothyronine level was associated with akinetic-rigid motor subtype and washout ratio of cardiac (123)I-meta-iodobenzylguanidine scintigraphy. The free triiodothyronine level negatively correlated with disease severity. Thyroid-stimulating hormone level was within normal range. However, its level was lower in patients with tremor-dominant type or mixed type than in those with akinetic-rigid type. All correlations of these variables with the levels of thyroid hormones remained statistically significant on multiple regression analysis. Our results suggest that the thyroid hormone level, especially the free triiodothyronine level, is closely related to motor symptoms in patients with de novo PD. Further studies are needed to clarify whether the decreased hormone levels have functional roles in motor and non-motor symptoms. PMID:25987207

  18. Effects of oral chlortetracycline and dietary protein level on plasma concentrations of growth hormone and thyroid hormones in beef steers before and after challenge with a combination of thyrotropin-releasing hormone and growth hormone-releasing hormone.

    PubMed

    Rumsey, T S; McLeod, K; Elsasser, T H; Kahl, S; Baldwin, R L

    1999-08-01

    The objective of this study was to determine the effect of a subtherapeutic level of chlortetracycline (CTC) fed to growing beef steers under conditions of limited and adequate dietary protein on plasma concentrations of GH, thyroid-stimulating hormone (TSH), and thyroid hormones before and after an injection of thyrotropin-releasing hormone (TRH) + GHRH. Young beef steers (n = 32; average BW = 285 kg) were assigned to a 2x2 factorial arrangement of treatments of either a 10 or 13% crude protein diet (70% concentrate, 15% wheat straw, and 15% cottonseed hulls) and either a corn meal carrier or carrier + 350 mg of CTC daily top dressed on the diet. Steers were fed ad libitum amounts of diet for 56 d, and a jugular catheter was then placed in each steer in four groups (two steers from each treatment combination per group) during four consecutive days (one group per day). Each steer was injected via the jugular catheter with 1.0 microg/kg BW TRH + .1 microg/kg BW GHRH in 10 mL of saline at 0800. Blood samples were collected at -30, -15, 0, 5, 10, 15, 20, 30, 45, 60, 120, 240, and 360 min after releasing hormone injection. Plasma samples were analyzed for GH, TSH, thyroxine (T4), and triiodothyronine (T3). After 84 d on trial, the steers were slaughtered and the pituitary and samples of liver were collected and analyzed for 5'-deiodinase activity. Feeding CTC attenuated the GH response to releasing hormone challenge by 26% for both area under the response curve (P<.03) and peak response (P<.10). Likewise, CTC attenuated the TSH response to releasing hormone challenge for area under the response curve by 16% (P<.10) and peak response by 33% (P<.02), and attenuated the T4 response for area under the curve by 12% (P<.08) and peak response by 14% (P<.04). Type II deiodinase activity in the pituitary was 36% less (P<.02) in CTC-fed steers than in steers not fed CTC. The results of this study are interpreted to suggest that feeding subtherapeutic levels of CTC to young

  19. NCoR1 and SMRT Play Unique Roles in Thyroid Hormone Action In Vivo

    PubMed Central

    Shimizu, Hiroaki; Astapova, Inna; Ye, Felix; Bilban, Martin

    2014-01-01

    NCoR1 (nuclear receptor corepressor) and SMRT (silencing mediator of retinoid and thyroid hormone receptors; NCoR2) are well-recognized coregulators of nuclear receptor (NR) action. However, their unique roles in the regulation of thyroid hormone (TH) signaling in specific cell types have not been determined. To accomplish this we generated mice that lacked function of either NCoR1, SMRT, or both in the liver only and additionally a global SMRT knockout model. Despite both corepressors being present in the liver, deletion of SMRT in either euthyroid or hypothyroid animals had little effect on TH signaling. In contrast, disruption of NCoR1 action confirmed that NCoR1 is the principal mediator of TH sensitivity in vivo. Similarly, global disruption of SMRT, unlike the global disruption of NCoR1, did not affect TH levels. While SMRT played little role in TH-regulated pathways, when disrupted in combination with NCoR1, it greatly accentuated the synthesis and storage of hepatic lipid. Taken together, these data demonstrate that corepressor specificity exists in vivo and that NCoR1 is the principal regulator of TH action. However, both corepressors collaborate to control hepatic lipid content, which likely reflects their cooperative activity in regulating the action of multiple NRs including the TH receptor (TR). PMID:25421714

  20. Thyroid Hormone Regulates Hepatic Expression of Fibroblast Growth Factor 21 in a PPARα-dependent Manner*

    PubMed Central

    Adams, Andrew C.; Astapova, Inna; Fisher, ffolliott M.; Badman, Michael K.; Kurgansky, Katherine E.; Flier, Jeffrey S.; Hollenberg, Anthony N.; Maratos-Flier, Eleftheria

    2010-01-01

    Thyroid hormone has profound and diverse effects on liver metabolism. Here we show that tri-iodothyronine (T3) treatment in mice acutely and specifically induces hepatic expression of the metabolic regulator fibroblast growth factor 21 (FGF21). Mice treated with T3 showed a dose-dependent increase in hepatic FGF21 expression with significant induction at doses as low as 100 μg/kg. Time course studies determined that induction is seen as early as 4 h after treatment with a further increase in expression at 6 h after injection. As FGF21 expression is downstream of the nuclear receptor peroxisome proliferator-activated receptor α (PPARα), we treated PPARα knock-out mice with T3 and found no increase in expression, indicating that hepatic regulation of FGF21 by T3 in liver is via a PPARα-dependent mechanism. In contrast, in white adipose tissue, FGF21 expression was suppressed by T3 treatment, with other T3 targets unaffected. In cell culture studies with an FGF21 reporter construct, we determined that three transcription factors are required for induction of FGF21 expression: thyroid hormone receptor β (TRβ), retinoid X receptor (RXR), and PPARα. These findings indicate a novel regulatory pathway whereby T3 positively regulates hepatic FGF21 expression, presenting a novel therapeutic target for diseases such as non-alcoholic fatty liver disease. PMID:20236931

  1. Nexus between epidermolysis bullosa and transcriptional regulation by thyroid hormone in epidermal keratinocytes

    PubMed Central

    Tomic-Canic, Marjana; Stojadinovic, Olivera; Lee, Brian; Walsh, Rebecca; Blumenberg, Miroslav

    2014-01-01

    Thyroid hormone, T3, through the interaction of its receptor with the recognition sequences in the DNA, regulates gene expression. This regulation includes the promoter activity of keratin genes. The receptor shares co-regulators with other members of the nuclear receptor family, including RXR. Intending to define the transcriptional effects of thyroid hormones in keratinocytes, we used Affymetrix microarrays to comprehensively compare the genes expressed in T3 treated and untreated human epidermal keratinocytes. The transcriptomes were compared at 1, 4, 24, 48 and 72 hrs. Surprisingly, T3 induced only 9 and suppressed 28 genes, much fewer than expected. Significantly, genes associated with Epidermolysis bullosa, a set of inherited blistering skin diseases, were found statistically highly over-represented among the suppressed genes. These genes include Integrin β4, Plectin, Collagen XVII, MMP1, MMP3 and MMP14. The data imply that in keratinocytes T3 could suppresses the remodeling by, attachment to, and production of extracellular matrix. The results suggest that topical treatment with T3 may be effective for alleviation of symptoms in patients with Epidermolysis bullosa. PMID:20443817

  2. Roles of thyroid hormones in follicular development in the ovary of neonatal and immature rats.

    PubMed

    Fedail, Jaafar Sulieman; Zheng, Kaizhi; Wei, Quanwei; Kong, Lingfa; Shi, Fangxiong

    2014-08-01

    Thyroid hormones (TH) play a critical role in ovarian follicular development, maturation and the maintenance of various endocrine functions. However, whether TH can affect ovarian follicular development in neonatal and immature rats remains unclear. Therefore, the aim of the present study was to elucidate the effect of TH on ovarian follicular development in neonatal and immature rats. Thirty female post-lactation mothers of Sprague-Dawley rat pups were randomly divided into three groups: control, hyperthyroid (hyper), and hypothyroid (hypo). On postnatal days (PND) 10 and 21, body weights, serum hormones, ovarian histologic changes, and immunohistochemistry of thyroid hormone receptor alpha 1 (TRα1) and nitric oxide synthase types (NOS), and NOS activities, were determined. The data showed that body weights significantly decreased in both hyper and hypo groups compared with the control group (P < 0.05). In addition, the hyper group had increased serum concentrations of T3, T4, and E2; whereas the hypo group manifested reduced serum concentrations of T3, T4, and E2 on PND 10 and 21. The hyper and hypo groups showed significantly reduced total number of primordial, primary and secondary follicles on PND 10 and 21 compared with the control group (P < 0.05). Similarly, antral follicle numbers in the hyper and hypo groups were significantly decreased on PND 21 compared with the control group (P < 0.05). Immunostaining indicated that TRα1 and NOS were expressed in ovarian surface epithelium and oocytes of growing and antral follicles, with strong staining of the granulosa and theca cells of follicles. NOS activities were significantly augmented in the hyper, but diminished in the hypo groups on PND 10 and 21. In summary, our findings suggest that TH play important roles in ovarian functions and in the regulation of NOS activity. Our results also indicate that a relationship exists between the TH and NO signaling pathways during the process of ovarian follicular

  3. The thyrotropin-releasing hormone gene is regulated by thyroid hormone at the level of transcription in vivo.

    PubMed

    Sugrue, Michelle L; Vella, Kristen R; Morales, Crystal; Lopez, Marisol E; Hollenberg, Anthony N

    2010-02-01

    The expression of the TRH gene in the paraventricular nucleus (PVH) of the hypothalamus is required for the normal production of thyroid hormone (TH) in rodents and humans. In addition, the regulation of TRH mRNA expression by TH, specifically in the PVH, ensures tight control of the set point of the hypothalamic-pituitary-thyroid axis. Although many studies have assumed that the regulation of TRH expression by TH is at the level of transcription, there is little data available to demonstrate this. We used two in vivo model systems to show this. In the first model system, we developed an in situ hybridization (ISH) assay directed against TRH heteronuclear RNA to measure TRH transcription directly in vivo. We show that in the euthyroid state, TRH transcription is present both in the PVH and anterior/lateral hypothalamus. In the hypothyroid state, transcription is activated in the PVH only and can be shut off within 5 h by TH. In the second model system, we employed transgenic mice that express the Cre recombinase under the control of the genomic region containing the TRH gene. Remarkably, TH regulates Cre expression in these mice in the PVH only. Taken together, these data affirm that TH regulates TRH at the level of transcription in the PVH only and that genomic elements surrounding the TRH gene mediate its regulation by T(3). Thus, it should be possible to identify the elements within the TRH locus that mediate its regulation by T(3) using in vivo approaches. PMID:20032051

  4. Thyroid-Stimulating Hormone Suppression for Protection Against Hypothyroidism Due to Craniospinal Irradiation for Childhood Medulloblastoma/Primitive Neuroectodermal Tumor

    SciTech Connect

    Massimino, Maura Gandola, Lorenza; Collini, Paola; Seregni, Ettore; Marchiano, Alfonso; Serra, Annalisa; Pignoli, Emanuele Ph.D.; Spreafico, Filippo; Pallotti, Federica; Terenziani, Monica; Biassoni, Veronica; Bombardieri, Emilio; Fossati-Bellani, Franca

    2007-10-01

    Purpose: Hypothyroidism is one of the earliest endocrine effects of craniospinal irradiation (CSI). The effects of radiation also depend on circulating thyroid-stimulating hormone (TSH), which acts as an indicator of thyrocyte function and is the most sensitive marker of thyroid damage. Hence, our study was launched in 1998 to evaluate the protective effect of TSH suppression during CSI for medulloblastoma/primitive neuroectodermal tumor. Patients and Methods: From Jan 1998 to Feb 2001, a total of 37 euthyroid children scheduled for CSI for medulloblastoma/primitive neuroectodermal tumor underwent thyroid ultrasound and free triiodothyronine (FT3), free thyroxine (FT4), and TSH evaluation at the beginning and end of CSI. From 14 days before and up to the end of CSI, patients were administered L-thyroxine at suppressive doses; every 3 days, TSH suppression was checked to ensure a value <0.3 {mu}M/ml. During follow-up, blood tests and ultrasound were repeated after 1 year; primary hypothyroidism was considered an increased TSH level greater than normal range. CSI was done using a hyperfractionated accelerated technique with total doses ranging from 20.8-39 Gy; models were used to evaluate doses received by the thyroid bed. Results: Of 37 patients, 25 were alive a median 7 years after CSI. They were well matched for all clinical features, except that eight children underwent adequate TSH suppression during CSI, whereas 17 did not. Hypothyroidism-free survival rates were 70% for the 'adequately TSH-suppressed' group and 20% for the 'inadequately TSH-suppressed' group (p = 0.02). Conclusions: Thyroid-stimulating hormone suppression with L-thyroxine had a protective effect on thyroid function at long-term follow-up. This is the first demonstration that transient endocrine suppression of thyroid activity may protect against radiation-induced functional damage.

  5. Polychlorinated biphenyls as hormonally active structural analogues

    SciTech Connect

    McKinney, J.D. ); Waller, C.L. )

    1994-03-01

    Among the environmental chemicals that may be able to disrupt the endocrine systems of animals and humans, the polychlorinated biphenyls (PCBs) are a chemical class of considerable concern. One possible mechanism by which PCBs may interfere with endocrine function is their ability to mimic natural hormones. These actions reflect a close relationship between the physicochemical properties encoded in the PCB molecular structure and the responses they evoke in biological systems. These physiocochemical properties determine the molecular reactivities of PCBs and are responsible for their recognition as biological acceptors and receptors, as well as for triggering molecular mechanisms that lead to tissue response. [open quotes]Coplanarity[close quotes] of PCB phenyl rings and [open quotes]laterality[close quotes] of chlorine atoms are important structural features determining specific binding behavior with proteins and certain toxic responses in biological systems. We compare qualitative structure-activity relationships for PCBs with the limited information on the related non-coplanar chlorinated diphenyl ethers, providing further insights into the nature of the molecular recognition processes and support for the structural relationship of PCBs to thyroid hormones. Steriodlike activity requires conformational restriction and possibility hydroxylation. We offer some simple molecular recognition models to account for the importance of these different structural features in the structure-activity relationships that permit one to express PCB reactivities in terms of dioxin, thyroxine, and estradiol equivalents. The available data support the involvement of PCBs as mimics of thyroid and other steroidal hormones. The potential for reproductive and developmental toxicity associated with human exposure to PCBs is of particular concern. 53 refs., 6 figs.

  6. SEX-STEROID AND THYROID HORMONE CONCENTRATIONS IN JUVENILE ALLIGATORS (ALLIGATOR MISSISSIPPIENSIS) FROM CONTAMINATED AND REFERENCE LAKES IN FLORIDA, USA

    EPA Science Inventory

    Sex-steroid and thyroid hormones are critical regulators of growth and reproduction in all vertebrates, and several recent studies suggest that environmental chemicals can alter circulating concentrations of these hormones. This study examines plasma concentrations of estradiol-...

  7. The Immediate and Late Effects of Thyroid Hormone (Triiodothyronine) on Murine Coagulation Gene Transcription

    PubMed Central

    Salloum-Asfar, Salam; Boelen, Anita; Reitsma, Pieter H.; van Vlijmen, Bart J. M.

    2015-01-01

    Thyroid dysfunction is associated with changes in coagulation. The aim of our study was to gain more insight into the role of thyroid hormone in coagulation control. C57Black/6J mice received a low-iodine diet and drinking water supplemented with perchlorate to suppress endogenous triiodothyronine (T3) and thyroxine (T4) production. Under these conditions, the impact of exogenous T3 on plasma coagulation, and hepatic and vessel-wall-associated coagulation gene transcription was studied in a short- (4 hours) and long-term (14 days) setting. Comparing euthyroid conditions (normal mice), with hypothyroidism (conditions of a shortage of thyroid hormone) and those with replacement by incremental doses of T3, dosages of 0 and 0.5 μg T3/mouse/day were selected to study the impact of T3 on coagulation gene transcription. Under these conditions, a single injection of T3 injection increased strongly hepatic transcript levels of the well-characterized T3-responsive genes deiodinase type 1 (Dio1) and Spot14 within 4 hours. This coincided with significantly reduced mRNA levels of Fgg, Serpinc1, Proc, Proz, and Serpin10, and the reduction of the latter three persisted upon daily treatment with T3 for 14 days. Prolonged T3 treatment induced a significant down-regulation in factor (F) 2, F9 and F10 transcript levels, while F11 and F12 levels increased. Activity levels in plasma largely paralleled these mRNA changes. Thbd transcript levels in the lung (vessel-wall-associated coagulation) were significantly up-regulated after a single T3 injection, and persisted upon prolonged T3 exposure. Two-week T3 administration also resulted in increased Vwf and Tfpi mRNA levels, whereas Tf levels decreased. These data showed that T3 has specific effects on coagulation, with Fgg, Serpinc1, Proc, Proz, Serpin10 and Thbd responding rapidly, making these likely direct thyroid hormone receptor targets. F2, F9, F10, F11, F12, Vwf, Tf and Tfpi are late responding genes and probably indirectly

  8. Identification of thyroid hormone receptor binding sites in developing mouse cerebellum

    PubMed Central

    2013-01-01

    Background Thyroid hormones play an essential role in early vertebrate development as well as other key processes. One of its modes of action is to bind to the thyroid hormone receptor (TR) which, in turn, binds to thyroid response elements (TREs) in promoter regions of target genes. The sequence motif for TREs remains largely undefined as does the precise chromosomal location of the TR binding sites. A chromatin immunoprecipitation on microarray (ChIP-chip) experiment was conducted using mouse cerebellum post natal day (PND) 4 and PND15 for the thyroid hormone receptor (TR) beta 1 to map its binding sites on over 5000 gene promoter regions. We have performed a detailed computational analysis of these data. Results By analysing a recent spike-in study, the optimal normalization and peak identification approaches were determined for our dataset. Application of these techniques led to the identification of 211 ChIP-chip peaks enriched for TR binding in cerebellum samples. ChIP-PCR validation of 25 peaks led to the identification of 16 true positive TREs. Following a detailed literature review to identify all known mouse TREs, a position weight matrix (PWM) was created representing the classic TRE sequence motif. Various classes of promoter regions were investigated for the presence of this PWM, including permuted sequences, randomly selected promoter sequences, and genes known to be regulated by TH. We found that while the occurrence of the TRE motif is strongly correlated with gene regulation by TH for some genes, other TH-regulated genes do not exhibit an increased density of TRE half-site motifs. Furthermore, we demonstrate that an increase in the rate of occurrence of the half-site motifs does not always indicate the specific location of the TRE within the promoter region. To account for the fact that TR often operates as a dimer, we introduce a novel dual-threshold PWM scanning approach for identifying TREs with a true positive rate of 0.73 and a false positive

  9. Hypothyroidism in Pancreatic Cancer: Role of Exogenous Thyroid Hormone in Tumor Invasion—Preliminary Observations

    PubMed Central

    Sarosiek, Konrad; Gandhi, Ankit V.; Saxena, Shivam; Kang, Christopher Y.; Chipitsyna, Galina I.; Yeo, Charles J.; Arafat, Hwyda A.

    2016-01-01

    According to the epidemiological studies, about 4.4% of American general elderly population has a pronounced hypothyroidism and relies on thyroid hormone supplements daily. The prevalence of hypothyroidism in our patients with pancreatic cancer was much higher, 14.1%. A retrospective analysis was performed on patients who underwent pancreaticoduodenectomy (Whipple procedure) or distal pancreatectomy and splenectomy (DPS) at Thomas Jefferson University Hospital, Philadelphia, from 2005 to 2012. The diagnosis of hypothyroidism was correlated with clinicopathologic parameters including tumor stage, grade, and survival. To further understand how thyroid hormone affects pancreatic cancer behavior, functional studies including wound-induced cell migration, proliferation, and invasion were performed on pancreatic cancer cell lines, MiaPaCa-2 and AsPC-1. We found that hypothyroid patients taking exogenous thyroid hormone were more than three times likely to have perineural invasion, and about twice as likely to have higher T stage, nodal spread, and overall poorer prognostic stage (P < 0.05). Pancreatic cancer cell line studies demonstrated that exogenous thyroid hormone treatment increased cell proliferation, migration, and invasion (P < 0.05). We conclude that exogenous thyroid hormone may contribute to the progression of pancreatic cancer. PMID:27123358

  10. Targeting Thyroid Hormone Receptor Beta in Triple Negative Breast Cancer

    PubMed Central

    Gu, Guowei; Gelsomino, Luca; Covington, Kyle R.; Beyer, Amanda R.; Wang, John; Rechoum, Yassine; Huffman, Kenneth; Carstens, Ryan; Ando, Sebastiano; Fuqua, Suzanne A.W.

    2015-01-01

    Purpose Discover novel nuclear receptor targets in triple negative breast cancer Methods Expression microarray, western blot, qRT-PCR, MTT growth assay, soft agar anchorage-independent growth assay, TRE reporter transactivation assay, statistical analysis. Results We performed microarray analysis using 227 triple negative breast tumors, and clustered the tumors into five groups according to their nuclear receptor expression. Thyroid hormone receptor beta (TRβ) was one of the most differentially expressed nuclear receptors in group 5 compared to other groups. TRβ low expressing patients were associated with poor outcome. We evaluated the role of TRβ in triple negative breast cancer cell lines representing group 5 tumors. Knockdown of TRβ increased soft agar colony and reduced sensitivity to docetaxel and doxorubicin treatment. Docetaxel or doxorubicin long-term cultured cell lines also expressed decreased TRβ protein. Microarray analysis revealed cAMP/PKA signaling was the only KEGG pathways upregulated in TRβ knockdown cells. Inhibitors of cAMP or PKA, in combination with doxorubicin further enhanced cell apoptosis and restored sensitivity to chemotherapy. TRβ-specific agonists enhanced TRβ expression, and further sensitized cells to both docetaxel and doxorubicin. Sensitization was mediated by increased apoptosis with elevated cleaved PARP and caspase 3. Conclusions TRβ represents a novel nuclear receptor target in triple negative breast cancer; low TRβ levels were associated with enhanced resistance to both docetaxel and doxorubicin treatment. TRβ-specific agonists enhance chemosensitivity to these two agents. Mechanistically enhanced cAMP/PKA signaling was associated with TRβ’s effects on response to chemotherapy. PMID:25820519

  11. Hormones

    MedlinePlus

    ... the foods you eat Sexual function Reproduction Mood Endocrine glands, which are special groups of cells, make hormones. The major endocrine glands are the pituitary, pineal, thymus, thyroid, adrenal ...

  12. Thyroid disease

    SciTech Connect

    Falk, S.

    1990-01-01

    Presenting a multidisciplinary approach to the diagnosis and treatment of thyroid disease, this volume provides a comprehensive picture of current thyroid medicine and surgery. The book integrates the perspectives of the many disciplines that deal with the clinical manifestations of thyroid disorders. Adding to the clinical usefulness of the book is the state-of-the-art coverage of many recent developments in thyroidology, including the use of highly sensitive two-site TSH immunoradionetric measurements to diagnose thyroid activity; thyroglobulin assays in thyroid cancer and other diseases; new diagnostic applications of MRI and CT; treatment with radionuclides and chemotherapy; new developments in thyroid immunology, pathology, and management of hyperthyroidism; suppressive treatment with thyroid hormone; and management of Graves' ophthalmopathy. The book also covers all aspects of thyroid surgery, including surgical treatment of hyperthyroidism; papillary, follicular, and other carcinomas; thyroidectomy; and prevention and management of complications.

  13. Low intelligence but not attention deficit hyperactivity disorder is associated with resistance to thyroid hormone caused by mutation R316H in the thyroid hormone receptor {beta} gene

    SciTech Connect

    Weiss, R.E.; Stein, M.A.; Chyna, B.; Phillips, W.; O`Brien, T.; Gutermuth, L.; Refetoff, S.; Duck, S.C.

    1994-06-01

    Resistance to thyroid hormone (RTH) is a syndrome of reduced responsiveness of tissues to thyroid hormone. The clinical manifestations are variable and 46-50% of children with RTH have attention deficit hyperactivity disorder (ADD). The authors present a new family with RTH (F120) found to have a mutation R316H in the thyroid hormone receptor {beta} (TR{beta}) gene identical for that reported in an unrelated family. Assignment of the mutant allele and haplotyping based on CA repeat polymorphism were done on 16 family members. Semistructured diagnostic interviews and psychometric testing were used to determine the psychiatric diagnosis of 12 family members by examiners blinded to the genotype. Three subjects were identified to have the R316H allele as well as mildly elevated free T{sub 4} index (168 {+-} 12; normal range 77-135) and nonsuppressed TSH (4.1 {+-} 1.7 mU/L). Only 2 of the subjects with RTH were found to have ADD, while one family member homozygous for the wild type TR{beta} and normal thyroid function tests also had ADD. Unaffected family members had higher full scale intelligence quotients ({vert_bar}Q) (93 {+-} 7) than any of the 3 family members with RTH (77 {+-} 5, p = 0.006). These data do not support the genetic linkage of ADD and RTH, but do suggest that RTH is associated with lower IQ scores that may confer a high likelihood of exhibiting ADD symptoms. 20 refs., 2 figs., 2 tabs.

  14. Anti-edema action of thyroid hormone in MCAO model of ischemic brain stroke: Possible association with AQP4 modulation.

    PubMed

    Sadana, Prabodh; Coughlin, Lucy; Burke, Jamie; Woods, Robert; Mdzinarishvili, Alexander

    2015-07-15

    The use of neuroprotective strategies to mitigate the fatal consequences of ischemic brain stroke is a focus of robust research activity. We have previously demonstrated that thyroid hormone (T3; 3,3',5-triiodo-l-thyronine) possesses neuroprotective and anti-edema activity in pre-stroke treatment regimens when administered as a solution or as a nanoparticle formulation. In this study we have extended our evaluation of thyroid hormone use in animal models of brain stroke. We have used both transient middle cerebral artery occlusion (t-MCAO) and permanent (p-MCAO) models of ischemic brain stroke. A significant reduction of tissue infarction and a concurrent decrease in edema were observed in the t-MCAO model of brain stroke. However, no benefit of T3 was observed in p-MCAO stroke setting. Significant improvement of neurological outcomes was observed upon T3 treatment in t-MCAO mice. Further, we tested T2 (3,5-diiodo-l-thyronine) a natural deiodination metabolite of T3 in MCAO model of brain stroke. T2 potently decreased infarct size as well as edema formation. Additionally, we report here that T3 suppresses the expression of aquaporin-4 (AQP4) water channels which could be a likely mechanism of its anti-edema activity. Our studies provide evidence to stimulate clinical development of thyroid hormones for use in ischemic brain stroke. PMID:25963308

  15. Effects of perinatal exposure to low-dose cadmium on thyroid hormone-related and sex hormone receptor gene expressions in brain of offspring.

    PubMed

    Ishitobi, Hiromi; Mori, Kohki; Yoshida, Katsumi; Watanabe, Chiho

    2007-07-01

    Perinatal cadmium (Cd) exposure has been shown to alter behaviors and reduce learning ability of offspring. A few studies have shown that Cd reduced serum thyroid hormones (THs), which are important for brain development during the perinatal period. Brain specific genes, neurogranin (RC3) and myelin basic protein (BMP), are known to be regulated by TH through TH receptors (TR). It has been suggested that RC3 may play roles in memory and learning. In addition, Cd has been suggested to have estrogen-like activity. To evaluate the effects of perinatal low-dose exposure to Cd on thyroid hormone-related gene (RC3, TR-beta1, MBP, RAR-beta) and sex hormone receptor gene (ER-alpha, ER-beta and PgR) expressions in the brain and on behaviors of offspring, mice were administered with 10ppm Cd (from gestational day 1 to postnatal day 10) and/or 0.025% methimazole (MMI; anti-thyroid drug) (from gestational day 12 to postnatal day 10) in drinking water. Also, 0.1% MMI was administered as a positive control (high MMI group). RC3 mRNA expression was reduced in the female brain of combined exposure and high MMI groups and was negatively correlated with the activity in the open-field. ER-alpha, ER-beta and PgR mRNA expressions were decreased in male and female Cd, and female Cd+MMI groups, respectively; among these changes the reduced expression of PgR was opposite to estrogenic action. These results suggested that perinatal exposure to Cd disrupted the gene expressions of sex hormone receptors, which could not be considered to be a result of estrogenic action. Our study indicates that alteration in the gene expressions of RC3 and sex hormone receptors in the brain induced by perinatal Cd and MMI exposure might be one mechanism of developmental toxicity of Cd. PMID:17408746

  16. Effects of chronic treatment with several halogenated bephenyl isomers on thyroid and adrenal hormone secretion

    SciTech Connect

    Carbone, J.P.

    1982-01-01

    This investigation was undertaken to assess the consequences of chronic ingestion of several halogenated biphenyl mixtures with variable chlorine content and isomeric composition on rat thyroid and adrenal physiological parameters. Chronic ingestion of the PCB Aroclor 1016, 1242 and 1254 and the PBB hexabromobiphenyl and octabromobiphenyl induced reductions of circulating thyroid hormones. The PCB or PBB containing the highest halogenation and the highest concentration of highly halogenated isomers within the mixture proved to be most toxic. However, the chlorinated compounds were more toxic than the borminated compounds. A series of experiments were designed to address the question of whether the responsiveness of the thyroid gland to thyroid stimulating hormone (TSH) was altered following chronic exposure to Aroclor 1254 or hexabromobiphenyl. The effects of chronically ingested halogenated biphenyls, PCB, 1016, 1242 and 1254 and PBB hexabromobiphenyl and octabromobiphenyl on serum 17-keto steroids of adrenal origin were assessed.

  17. FoxO1 Deacetylation Regulates Thyroid Hormone-induced Transcription of Key Hepatic Gluconeogenic Genes*

    PubMed Central

    Singh, Brijesh Kumar; Sinha, Rohit Anthony; Zhou, Jin; Xie, Sherwin Ying; You, Seo-Hee; Gauthier, Karine; Yen, Paul Michael

    2013-01-01

    Hepatic gluconeogenesis is a concerted process that integrates transcriptional regulation with hormonal signals. A major regulator is thyroid hormone (TH), which acts through its nuclear receptor (TR) to induce the expression of the hepatic gluconeogenic genes, phosphoenolpyruvate carboxykinase (PCK1) and glucose-6-phosphatase (G6PC). Forkhead transcription factor FoxO1 also is an important regulator of these genes; however, its functional interactions with TR are not known. Here, we report that TR-mediated transcriptional activation of PCK1 and G6PC in human hepatic cells and mouse liver was FoxO1-dependent and furthermore required FoxO1 deacetylation by the NAD+-dependent deacetylase, SirT1. siRNA knockdown of FoxO1 decreased, whereas overexpression of FoxO1 increased, TH-dependent transcriptional activation of PCK1 and G6PC in cultured hepatic cells. FoxO1 siRNA knockdown also decreased TH-mediated transcription in vivo. Additionally, TH was unable to induce FoxO1 deacetylation or hepatic PCK1 gene expression in TH receptor β-null (TRβ−/−) mice. Moreover, TH stimulated FoxO1 recruitment to the PCK1 and G6PC gene promoters in a SirT1-dependent manner. In summary, our results show that TH-dependent deacetylation of a second metabolically regulated transcription factor represents a novel mechanism for transcriptional integration of nuclear hormone action with cellular energy status. PMID:23995837

  18. Fetal and neonatal iron deficiency exacerbates mild thyroid hormone insufficiency effects on male thyroid hormone levels and brain thyroid hormone-responsive gene expression.

    PubMed

    Bastian, Thomas W; Prohaska, Joseph R; Georgieff, Michael K; Anderson, Grant W

    2014-03-01

    Fetal/neonatal iron (Fe) and iodine/TH deficiencies lead to similar brain developmental abnormalities and often coexist in developing countries. We recently demonstrated that fetal/neonatal Fe deficiency results in a mild neonatal thyroidal impairment, suggesting that TH insufficiency contributes to the neurodevelopmental abnormalities associated with Fe deficiency. We hypothesized that combining Fe deficiency with an additional mild thyroidal perturbation (6-propyl-2-thiouracil [PTU]) during development would more severely impair neonatal thyroidal status and brain TH-responsive gene expression than either deficiency alone. Early gestation pregnant rats were assigned to 7 different treatment groups: control, Fe deficient (FeD), mild TH deficient (1 ppm PTU), moderate TH deficient (3 ppm PTU), severe TH deficient (10 ppm PTU), FeD/1 ppm PTU, or FeD/3 ppm PTU. FeD or 1 ppm PTU treatment alone reduced postnatal day 15 serum total T4 concentrations by 64% and 74%, respectively, without significantly altering serum total T3 concentrations. Neither treatment alone significantly altered postnatal day 16 cortical or hippocampal T3 concentrations. FeD combined with 1 ppm PTU treatment produced a more severe effect, reducing serum total T4 by 95%, and lowering hippocampal and cortical T3 concentrations by 24% and 31%, respectively. Combined FeD/PTU had a more severe effect on brain TH-responsive gene expression than either treatment alone, significantly altering Pvalb, Dio2, Mbp, and Hairless hippocampal and/or cortical mRNA levels. FeD/PTU treatment more severely impacted cortical and hippocampal parvalbumin protein expression compared with either individual treatment. These data suggest that combining 2 mild thyroidal insults during development significantly disrupts thyroid function and impairs TH-regulated brain gene expression. PMID:24424046

  19. Sex-specific changes in thyroid gland function and circulating thyroid hormones in nestling American kestrels (Falco sparverius) following embryonic exposure to polybrominated diphenyl ethers by maternal transfer.

    PubMed

    Fernie, Kim J; Marteinson, Sarah C

    2016-08-01

    High concentrations of polybrominated diphenyl ethers (PBDEs) accumulate in predatory birds. Several PBDE congeners are considered thyroid disruptors; however, avian studies are limited. The authors examined circulating thyroid hormones and thyroid gland function of nestling American kestrels (Falco sparverius) at 17 d to 20 d of age, following embryonic exposure by maternal transfer only to environmentally relevant levels of PBDEs (DE-71 technical mixture). Nestlings were exposed to in ovo sum (Σ) PBDE concentrations of 11 301 ± 95 ng/g wet weight (high exposure), 289 ± 33 ng/g wet weight (low exposure), or 3.0 ± 0.5 ng/g wet weight (controls, background exposure). Statistical comparisons are made to controls of the respective sexes and account for the relatedness of siblings within broods. Circulating concentrations of plasma total thyroxine (TT4 ) and total triiodothyronine (TT3 ) in female nestlings were significantly influenced overall by the exposure to DE-71. Following intramuscular administration of thyroid-stimulating hormone, the temporal response of the thyroid gland in producing and/or releasing TT4 was also significantly affected by the females' exposure to DE-71. The altered availability of T4 for conversion to T3 outside of the gland and/or changes in thyroid-related enzymatic activity may explain the lower TT3 concentrations (baseline, overall) and moderately altered temporal TT3 patterns (p = 0.06) of the treatment females. Controlling for the significant effect on TT3 levels of the delayed hatching of treatment females, baseline TT3 levels were significantly and positively correlated with body mass (10 d, 15 d, 20 d), with PBDE-exposed females generally being smaller and having lower TT3 concentrations. Given that exposure concentrations were environmentally relevant, similar thyroidal changes and associated thyroid-mediated processes relating to growth may also occur in wild female nestlings. Environ Toxicol Chem 2016

  20. The Relationship between Perchlorate in Drinking Water and Cord Blood Thyroid Hormones: First Experience from Iran

    PubMed Central

    Javidi, Ashraf; Rafiei, Nasim; Amin, Mohammad Mehdi; Hovsepian, Silva; Hashemipour, Mahin; Kelishadi, Roya; Taghian, Zahra; Mofateh, Samaneh; Poursafa, Parinaz

    2015-01-01

    Background: Considering the controversial information regarding the effects of perchlorate on thyroid function of high risk population as neonates, and given the high prevalence rate of thyroid disorders specially congenital hypothyroidism in our region, this study aims to investigate for the first time in Iran, the relationship between drinking groundwater perchlorate and cord blood thyroid hormones level in an industrial region. Methods: In this cross-sectional study, drinking groundwater perchlorate level of rural areas of Zarinshahr, Isfahan was measured. Simultaneously, cord blood level of thyroid hormones of neonates born in the studied region was measured. Thyroid function test of neonates in regions with low and high perchlorate level were compared. Results: In this study, 25 tap water samples were obtained for perchlorate measurement. Level of cord blood thyroid stimulating hormone (TSH), T4 and T3 of 25 neonates were measured. Mean (standard deviation) of perchlorate, TSH, T4 and T3 was 3.59 (5.10) μg/l, 7.81 (4.14) mIU/m, 6.06 (0.85) mg/dl, and 63.46 (17.53) mg/dl, respectively. Mean levels of thyroid function tests were not different in low (<5 μg/l) and high level of drinking ground water perchlorate (P > 0.05). Conclusions: Perchlorate did not appear to be related to thyroid function of neonates in the studied industrial region. It seems that iodine status of the regions, as well as other environmental contaminants and genetic background, could impact on its relation with thyroid function of neonates. PMID:25789149

  1. 60 YEARS OF NEUROENDOCRINOLOGY: TRH, the first hypophysiotropic releasing hormone isolated: control of the pituitary-thyroid axis.

    PubMed

    Joseph-Bravo, Patricia; Jaimes-Hoy, Lorraine; Uribe, Rosa-María; Charli, Jean-Louis

    2015-08-01

    This review presents the findings that led to the discovery of TRH and the understanding of the central mechanisms which control hypothalamus-pituitary-thyroid axis (HPT) activity. The earliest studies on thyroid physiology are now dated a century ago when basal metabolic rate was associated with thyroid status. It took over 50 years to identify the key elements involved in the HPT axis. Thyroid hormones (TH: T4 and T3) were characterized first, followed by the semi-purification of TSH whose later characterization paralleled that of TRH. Studies on the effects of TH became possible with the availability of synthetic hormones. DNA recombinant techniques facilitated the identification of all the elements involved in the HPT axis, including their mode of regulation. Hypophysiotropic TRH neurons, which control the pituitary-thyroid axis, were identified among other hypothalamic neurons which express TRH. Three different deiodinases were recognized in various tissues, as well as their involvement in cell-specific modulation of T3 concentration. The role of tanycytes in setting TRH levels due to the activity of deiodinase type 2 and the TRH-degrading ectoenzyme was unraveled. TH-feedback effects occur at different levels, including TRH and TSH synthesis and release, deiodinase activity, pituitary TRH-receptor and TRH degradation. The activity of TRH neurons is regulated by nutritional status through neurons of the arcuate nucleus, which sense metabolic signals such as circulating leptin levels. Trh expression and the HPT axis are activated by energy demanding situations, such as cold and exercise, whereas it is inhibited by negative energy balance situations such as fasting, inflammation or chronic stress. New approaches are being used to understand the activity of TRHergic neurons within metabolic circuits. PMID:26101376

  2. Positive correlation of thyroid hormones and serum copper in children with congenital hypothyroidism.

    PubMed

    Blasig, Sarah; Kühnen, Peter; Schuette, Andrea; Blankenstein, Oliver; Mittag, Jens; Schomburg, Lutz

    2016-09-01

    Thyroid hormones are of central relevance for growth and development. However, the underlying molecular mechanisms are still not fully understood. Recent studies in humans and mice have demonstrated that serum levels of selenium (Se) and copper (Cu) are positively affected by thyroid hormones. Given the importance of these trace elements for many biochemical processes, we tested whether this interaction is found in children at risk for hypothyroidism, potentially providing a novel factor contributing to the disturbed development observed in congenital hypothyroidism (CH). We conducted a cross-sectional analysis of 84 children diagnosed with CH displaying a wide range of thyroid hormone concentrations. Serum Se and Cu concentrations were measured by total reflection X-ray fluorescence. Data for thyrotropin (TSH) were available in all, thyroxine (T4) and free thyroxine (fT4) in the majority and triiodothyronine (T3) in 29 of the children. Spearman rank analyzes were performed. Cu and thyroid hormones showed a strong positive correlation (Cu/T4, rho=0.5241, P=0.0003; Cu/T3, rho=0.6003, P=0.0006). Unlike in adults, no associations were found between Se and any of the thyroid hormones. Our data highlight that serum Cu and thyroid hormones are strongly associated already in early postnatal life. Severely hypothyroid children are thus at risk of developing a Cu deficiency if not adequately nourished or supplemented. This finding needs to be verified in larger groups of children in order not to miss an easily-avoidable risk factor for poor development. PMID:27267969

  3. Exposure to polychlorinated biphenyls and levels of thyroid hormones in children.

    PubMed Central

    Osius, N; Karmaus, W; Kruse, H; Witten, J

    1999-01-01

    As part of an epidemiologic study on exposure to a toxic waste incineration plant we investigated whether blood concentrations of polychlorinated biphenyls (PCBs), lead, and cadmium, as well as concentration of mercury in 24-hr urine samples were associated with thyroid hormone status. As an indication of status, we determined levels of thyroid-stimulating hormone (TSH), free thyroxine (FT(4)), and free triiodothyronine (FT(3)) in children living in households where [less than/equal to] 10 cigarettes were smoked per day. Eight PCB congeners (PCBs 101, 118, 138, 153, 170, 180, 183, and 187) were measured in whole blood samples. Of these, seven congeners (PCB 101 was not detected in any sample) and the sum of all PCB congeners were analyzed as predictors for thyroid hormone status in separate linear regression models adjusted for potential confounders. In addition, the possible effects of cadmium, lead, and mercury on levels of thyroid hormones were examined. Blood concentrations and information on questionnaire data were available for 320 children 7-10 years of age. We found a statistically significant positive association between the mono-ortho congener PCB 118 and TSH as well as statistically significant negative relationships of PCBs 138, 153, 180, 183, and 187 to FT(3). There was no association for the PCB congeners and FT(4). Blood cadmium concentration was associated with increasing TSH and diminishing FT(4). Blood lead and urine concentration of mercury were of no importance to thyroid hormone levels. The results stress the need for future studies on the possible influences of PCB and cadmium exposure on thyroid hormones, particularly in children. These studies should also take neurologic development into account. PMID:10504153

  4. Thyroid Hormone Signalling Genes Are Regulated by Photoperiod in the Hypothalamus of F344 Rats

    PubMed Central

    Russell, Laura; Darras, Veerle M.; Morgan, Peter J.

    2011-01-01

    Seasonal animals adapt their physiology and behaviour in anticipation of climate change to optimise survival of their offspring. Intra-hypothalamic thyroid hormone signalling plays an important role in seasonal responses in mammals and birds. In the F344 rat, photoperiod stimulates profound changes in food intake, body weight and reproductive status. Previous investigations of the F344 rat have suggested a role for thyroid hormone metabolism, but have only considered Dio2 expression, which was elevated in long day photoperiods. Microarray analysis was used to identify time-dependent changes in photoperiod responsive genes, which may underlie the photoperiod-dependent phenotypes of the juvenile F344 rat. The most significant changes are those related to thyroid hormone metabolism and transport. Using photoperiod manipulations and melatonin injections into long day photoperiod (LD) rats to mimic short day (SD), we show photoinduction and photosuppression gene expression profiles and melatonin responsiveness of genes by in situ hybridization; TSHβ, CGA, Dio2 and Oatp1c1 genes were all elevated in LD whilst in SD, Dio3 and MCT-8 mRNA were increased. NPY was elevated in SD whilst GALP increased in LD. The photoinduction and photosuppression profiles for GALP were compared to that of GHRH with GALP expression following GHRH temporally. We also reveal gene sets involved in photoperiodic responses, including retinoic acid and Wnt/ß-catenin signalling. This study extends our knowledge of hypothalamic regulation by photoperiod, by revealing large temporal changes in expression of thyroid hormone signalling genes following photoperiod switch. Surprisingly, large changes in hypothalamic thyroid hormone levels or TRH expression were not detected. Expression of NPY and GALP, two genes known to regulate GHRH, were also changed by photoperiod. Whether these genes could provide links between thyroid hormone signalling and the regulation of the growth axis remains to be

  5. The bactericidal agent triclosan modulates thyroid hormone-associated gene expression and disrupts postembryonic anuran development.

    PubMed

    Veldhoen, Nik; Skirrow, Rachel C; Osachoff, Heather; Wigmore, Heidi; Clapson, David J; Gunderson, Mark P; Van Aggelen, Graham; Helbing, Caren C

    2006-12-01

    We investigated whether exposure to environmentally relevant concentrations of the bactericidal agent, triclosan, induces changes in the thyroid hormone-mediated process of metamorphosis of the North American bullfrog, Rana catesbeiana and alters the expression profile of thyroid hormone receptor (TR) alpha and beta, basic transcription element binding protein (BTEB) and proliferating nuclear cell antigen (PCNA) gene transcripts. Premetamorphic tadpoles were immersed in environmentally relevant concentrations of triclosan and injected with 1 x 10(-11)mol/g body weight 3,5,3'-triiodothyronine (T3) or vehicle control. Morphometric measurements and steady-state mRNA levels obtained by quantitative polymerase chain reaction were determined. mRNA abundance was also examined in Xenopus laevis XTC-2 cells treated with triclosan and/or 10nM T3. Tadpoles pretreated with triclosan concentrations as low as 0.15+/-0.03 microg/L for 4 days showed increased hindlimb development and a decrease in total body weight following T3 administration. Triclosan exposure also resulted in decreased T3-mediated TRbeta mRNA expression in the tadpole tail fin and increased levels of PCNA transcript in the brain within 48 h of T3 treatment whereas TRalpha was unaffected [corrected] Triclosan alone altered thyroid hormone receptor alpha transcript levels in the brain of premetamorphic tadpoles and induced a transient weight loss. In XTC-2 cells, exposure to T3 plus nominal concentrations of triclosan as low as 0.03 microg/L for 24h resulted in altered thyroid hormone receptor mRNA expression. Exposure to low levels of triclosan disrupts thyroid hormone-associated gene expression and can alter the rate of thyroid hormone-mediated postembryonic anuran development. PMID:17011055

  6. The thyroid hormone receptor β induces DNA damage and premature senescence

    PubMed Central

    Zambrano, Alberto; García-Carpizo, Verónica; Gallardo, María Esther; Villamuera, Raquel; Gómez-Ferrería, Maria Ana; Pascual, Angel; Buisine, Nicolas; Sachs, Laurent M.; Garesse, Rafael

    2014-01-01

    There is increasing evidence that the thyroid hormone (TH) receptors (THRs) can play a role in aging, cancer and degenerative diseases. In this paper, we demonstrate that binding of TH T3 (triiodothyronine) to THRB induces senescence and deoxyribonucleic acid (DNA) damage in cultured cells and in tissues of young hyperthyroid mice. T3 induces a rapid activation of ATM (ataxia telangiectasia mutated)/PRKAA (adenosine monophosphate–activated protein kinase) signal transduction and recruitment of the NRF1 (nuclear respiratory factor 1) and THRB to the promoters of genes with a key role on mitochondrial respiration. Increased respiration leads to production of mitochondrial reactive oxygen species, which in turn causes oxidative stress and DNA double-strand breaks and triggers a DNA damage response that ultimately leads to premature senescence of susceptible cells. Our findings provide a mechanism for integrating metabolic effects of THs with the tumor suppressor activity of THRB, the effect of thyroidal status on longevity, and the occurrence of tissue damage in hyperthyroidism. PMID:24395638

  7. Effects of plasticizers and their mixtures on estrogen receptor and thyroid hormone functions.

    PubMed

    Ghisari, Mandana; Bonefeld-Jorgensen, Eva Cecilie

    2009-08-25

    Plasticizers are additives used to increase the flexibility or plasticity of the material to which they are added, normally rigid plastic and as additives in paint and adhesives. They are suspected to interfere with the endocrine system, including the estrogen and the thyroid hormone (TH) systems. We investigated in vitro the thyroid hormone-like and estrogenic activities of a range of widely used plasticizers and phenols including benzyl butyl phthalate (BBP), dibutyl phthalate (DBP), dioctyl phthalate (DOP), diisodecyl phthalate (DIDP), diisononyl phthalate (DINP), di(2-ethylhexyl) phthalate (DEHP), bis(2-ethylhexyl) adipate (DEHA), 4-tert-octylphenol (tOP), 4-chloro-3-methylphenol (CMP), 2,4-dichlorophenol (2,4-DCP), 2-phenylphenol (2-PP) and resorcinol. The TH disrupting potential was determined by the effect on the TH-dependent rat pituitary GH3 cell proliferation (T-screen). The estrogenic activities of the compounds were assessed in MVLN cells, stably transfected with an estrogen receptor (ER) luciferase reporter vector. Furthermore, the combined effect of a multi-components mixture of six plasticizers was evaluated for its estrogenic and TH-like activities. All the tested compounds, but 2-PP, significantly affected the GH3 cell proliferation. tOP, BBP and DBP activated ER transactivity, whereas DEHP antagonized the 17beta-estradiol induced ER function. The mixture significantly induced ER transactivity in an additive manner, whereas in the T-screen, the observed mixture effect was lower than predicted, suggesting a potential antagonizing effect of the mixture. In conclusion, the tested plasticizers and phenols elicited endocrine-disrupting potential that can be mediated via interference with the estrogen and TH systems. Moreover, the observed mixture effect stresses the importance of considering the combined effect of the compounds for risk assessment of human health. PMID:19463926

  8. Do thyroid hormones mediate the effects of starvation on mood in adolescent girls with eating disorders?

    PubMed

    Swenne, Ingemar; Rosling, Agneta

    2010-11-01

    In the eating disorders (ED) comorbid depression is common and clinical experience suggests that it is partly related to starvation. Starvation affects thyroid hormone status and thyroid hypofunction is in turn associated with depressed mood. We have therefore investigated the possibility that thyroid hormones and starvation are associated with mood in ED. Two-hundred and thirty-nine adolescent girls were examined at presentation of an ED. Analyses of thyroid hormones, documentation of weight and weight changes, self-reports of depressive symptomatology and clinical diagnoses of ED and depression were used in the analyses. Of the 239 girls 100 were diagnosed with depression. The girls with and without depression did not differ in age, weight, height, body mass index (BMI), weight loss or duration of disease. Plasma free thyroxine concentrations were lower in depressed girls (11.9±1.7 versus 12.8±1.9 pmol/L; p<0.01). Plasma triodothyronine and thyroid-stimulating hormone concentrations did not differ between groups. In a logistic regression analysis the odds ratio for depression was 41.1 (95% confidence interval 4.18-405; p=0.001) for a 10 pmol/L change of plasma free thyroxine after correction for BMI, weight loss, duration of disease, rate of weight loss, plasma triodothyronine and an interaction between BMI and plasma free thyroxine. BMI did not predict depression. Low circulating thyroxine concentrations may provide a link between starvation and depression in adolescent girls with ED. PMID:20576362

  9. Insulin-like growth factor binding protein-6 interacts with the thyroid hormone receptor α1 and modulates the thyroid hormone-response in osteoblastic differentiation.

    PubMed

    Qiu, Jia; Ma, Xiao-Li; Wang, Xin; Chen, Hong; Huang, Bing-Ren

    2012-02-01

    Insulin-like growth factor binding protein-6 (IGFBP-6) is a member of the insulin-like growth factor binding protein family, which has both Insulin-like growth factor-dependent and independent effects on cell growth. In previous studies, we have shown that recombinant IGFBP-6 could be translocated into the cell nucleus. But the effect in the nucleus of IGFBP-6 is not clear. In the present study, we use multiple methodologies including Glutathione S-transferase pull-down assay, co-immunoprecipitation, fluorescence resonance energy transfer to demonstrate that IGFBP-6 can directly interact with thyroid hormone receptor alpha 1 (TRα1) in vitro and in vivo. We also demonstrate that the DNA-binding domains and Ligand-binding domains of TRα1 and N-terminal domains and C-terminal domains of IGFBP-6 are involved in the interaction. This interaction also can block the formation of TR: retinoid X receptor heterodimers. Furthermore, immunofluorescence co-localization studies show IGFBP-6 and TRα1 could co-localize in the nucleus of the cells. Reporter gene experiment shows that IGFBP-6 negatively regulates the growth hormone promoter activity induced by ligand activated TRα1. Moreover, real-time RT-PCR demonstrates that IGFBP-6 could inhibit the osteocalcin mRNA transcription induced by Triiodothyronine (3,3',5-Triiodo-L-thyronine, T3) in osteoblastic cells. Finally, alkaline phosphatase activity was significantly decreased in osteoblastic cells when the cells were transfected with IGFBP-6 in the presence of T3. In conclusion, these studies provide evidence that overexpression of IGFBP-6 suppresses osteoblastic differentiation regulated by TR in the present of T3. PMID:21997736

  10. The Thyroid Hormone-Inactivating Type III Deiodinase Is Expressed in Mouse and Human β-Cells and Its Targeted Inactivation Impairs Insulin Secretion

    PubMed Central

    Medina, Mayrin C.; Molina, Judith; Gadea, Yelena; Fachado, Alberto; Murillo, Monika; Simovic, Gordana; Pileggi, Antonello; Hernández, Arturo; Edlund, Helena

    2011-01-01

    Deiodinases are selenoproteins that activate or inactivate thyroid hormone. During vertebrate development, these pathways control thyroid hormone action in a cell-specific fashion explaining how systemic thyroid hormone can affect local control of tissue embryogenesis. Here we investigated the role of the thyroid hormone-inactivating deiodinase (D3) in pancreatic islet function and glucose homeostasis. D3 expression was determined by real-time PCR, immunofluorescence, and enzyme activity. Embryonic and adult wild-type mice and Mice with targeted disruption of Dio3 gene (D3KO) as well as human fetal pancreas and adult islets were studied. Insulin secretion was evaluated in adult mouse isolated islets. We found Dio3 gene expression and protein highly expressed in embryonic and adult pancreatic islets, predominantly in β-cells in both humans and mice. However, mRNA levels were barely detectable for both the thyroid hormone-activating deiodinases types 1 and 2. D3KO animals were found to be glucose intolerant due to in vitro and in vivo impaired glucose-stimulated insulin secretion, without changes in peripheral sensitivity to insulin. D3KO neonatal (postnatal day 0) and adult pancreas exhibited reduced total islet area due to reduced β-cell mass, insulin content, and impaired expression of key β-cells genes. D3 expression in perinatal pancreatic β-cells prevents untimely exposure to thyroid hormone, the absence of which leads to impaired β-cell function and subsequently insulin secretion and glucose homeostasis. An analogous role is likely in humans, given the similar D3 expression pattern. PMID:21828183

  11. Negative Feedback Control of Pituitary Thyroid-stimulating Hormone Synthesis and Secretion by Thyroid Hormones during Metamorphosis in Xenopus laevis

    EPA Science Inventory

    A basic understanding of the endocrinology of the hypothalamic-pituitary-thyroid (HPT) axis of anuran larvae is necessary for predicting the consequences of HPT perturbation by thyroid-disrupting chemicals (TDCs) on the whole organism. This project examined negative feedback con...

  12. 3,5-T2 is an alternative ligand for the thyroid hormone receptor β1.

    PubMed

    Mendoza, A; Navarrete-Ramírez, P; Hernández-Puga, G; Villalobos, P; Holzer, G; Renaud, J P; Laudet, V; Orozco, A

    2013-08-01

    Several liganded nuclear receptors have alternative ligands acting in a tissue-specific fashion and playing important biological roles. We present evidence that 3,5-diiodothyronine (T(2)), a naturally occurring iodothyronine that results from T(3) outer-ring deiodination, is an alternative ligand for thyroid hormone receptor β1 (TRβ1). In tilapia, 2 TRβ isoforms differing by 9 amino acids in the ligand-binding domain were cloned. Binding and transactivation studies showed that T(2) activates the human and the long tilapia TRβ1 isoform, but not the short one. A chimeric human TRβ1 (hTRβ1) that contained the 9-amino-acid insert showed no response to T(2), suggesting that the conformation of the hTRβ1 naturally allows T(2) binding and that other regions of the receptor are implicated in TR activation by T(2). Indeed, further analysis showed that the N terminus is essential for T(2)-mediated transactivation but not for that by T(3) in the long and hTRβ1, suggesting a functional interaction between the N-terminal domain and the insertion in the ligand-binding domain. To establish the functional relevance of T(2)-mediated TRβ1 binding and activation, mRNA expression and its regulation by T(2) and T(3) was evaluated for both isoforms. Our data show that long TRβ1expression is 10(6)-fold higher than that of the short isoform, and T(3) and T(2) differentially regulate the expression of these 2 TRβ1 isoforms in vivo. Taken together, our results prompted a reevaluation of the role and mechanism of action of thyroid hormone metabolites previously believed to be inactive. More generally, we propose that classical liganded receptors are only partially locked to very specific ligands and that alternative ligands may play a role in the tissue-specific action of receptors. PMID:23736295

  13. Extrathyroidal release of thyroid hormones from thyroglobulin by J774 mouse macrophages.

    PubMed Central

    Brix, K; Herzog, V

    1994-01-01

    Thyroglobulin appears in the circulation of vertebrates at species-specific concentrations. We have observed that the clearance of thyroglobulin from the circulation occurs in the liver by macrophages. Here we show that the thyroid hormones T3 and T4 were released by incubation of mouse macrophages (J774) with thyroglobulin. Thyroid hormone release was a fast process, with an initial rate of approximately 20 pmol T4/mg per min and approximately 0.6 pmol T3/mg per min, indicating that macrophages preferentially release T4. The bulk of released thyroid hormones appeared after 5 min of incubation of macrophages with thyroglobulin, whereas degradation of the protein was detectable only after several hours. During internalization of thyroglobulin, endocytic vesicles and endosomes were reached at 5 min and lysosomes at 60 min. T4 release started extracellularly by secreted proteases and continued along the endocytic pathway of thyroglobulin, whereas T3 release occurred mainly intracellularly when thyroglobulin had reached the lysosomes. This shows that the release of both hormones occurred at distinct cellular sites. Our in vitro observations suggest that macrophages in situ represent an extrathyroidal source for thyroid hormones from circulating thyroglobulin. Images PMID:8163643

  14. Posttranscriptional regulation of rat growth hormone gene expression: increased message stability and nuclear polyadenylation accompany thyroid hormone depletion.

    PubMed Central

    Murphy, D; Pardy, K; Seah, V; Carter, D

    1992-01-01

    In thyroid hormone-depleted rats, the rate of transcription of the growth hormone (GH) gene in the anterior pituitary gland is lower than the rate in euthyroid controls, and there is a corresponding reduction in the abundance of the GH mRNA. Concomitantly, the poly(A) tail of the GH mRNA increases in length. Examination of nuclear RNA from anterior pituitary glands of control and thyroid hormone-depleted rats revealed no difference in the length of pre-mRNAs containing the first and last introns of the GH gene. However, mature nuclear GH RNA is differentially polyadenylated in euthyroid and hypothyroid animals. We suggest that the extent of polyadenylation of the GH transcript is regulated in the cell nucleus concomitant with or subsequent to the splicing of the pre-mRNA. Experiments with anterior pituitary gland explant cultures demonstrated that the GH mRNA from thyroid hormone-depleted rats is more stable than its euthyroid counterpart and that the poly(A) tail may contribute to the differential stability of free GH ribonucleoproteins. Images PMID:1588960

  15. Exposure to2,2',4,4'-tetrabromodiphenyl ether (BDE-47) alters thyroid hormone levels and thyroid hormone-regulated gene transcription in manila clam Ruditapes philippinarum.

    PubMed

    Song, Ying; Miao, Jingjing; Pan, Luqing; Wang, Xin

    2016-06-01

    Polybrominated diphenyl ethers (PBDEs) have the potential to disturb the thyroid endocrine system in vertebrates, but little is known about the disruptive effects of PBDEs on marine bivalves. In this study, we first examined the effects of BDE-47 exposure on growth of juvenile manila clams Ruditapes philippinarum. The result showed that 1.0 and 10 μg L(-1) BDE-47 had adverse effects on 14-d shell-length growth of juvenile clams. Then, one-year-old adult clams were exposed to 0, 0.1 and 1 μg L(-1) BDE-47 for 15 d. BDE-47 (1 μg L(-1)) exposure caused significant decreases of total T4 (thyroxine) by 40% and T3 (3,5,3'-triiodothyronine) by 75% concentrations in haemolymph of the clams. Transcription of genes involved in thyroid hormone synthesis and metabolism were also studied by quantitative RT-PCR. Gene expression levels of sodium iodide symporter (rp-NIS), iodothyronine deiodinase (rp-Deio) and thyroid peroxidase (rp-TPO) were increased in a dose-dependent manner at day 5 and day 10, while monocarboxylate transporter 8 (rp-Mct8) was downregulated at day 5, day 10 and day 15. The effect and preliminary mechanism observed in the present study were consistent with the results from previous studies on rodent and fish, implying that exposure to BDE-47 may pose threat to thyroid hormone homeostasis in bivalves through thyroid synthesis and metabolism pathways. This study may provide a first step towards understanding of the thyroid function disruptive effects of PBDEs on marine bivalves and the underlying mechanism across taxonomic groups and phyla. PMID:26943874

  16. Blood biochemistry, thyroid hormones, and oxidant/antioxidant status of guinea pigs challenged with sodium arsenite or arsenic trioxide.

    PubMed

    Mohanta, Ranjan Kumar; Garg, Anil Kumar; Dass, Ram Sharan; Behera, Suvendu Kumar

    2014-08-01

    The present experiment aimed to compare the two most commonly used compounds of arsenic (sodium arsenite and arsenic trioxide) for their effect on blood metabolites, thyroid hormones, and oxidant/antioxidant status in guinea pigs. Twenty-one adult guinea pigs were randomly divided into three equal groups. Animals in group T1 (control) were fed a basal diet, whereas 50 ppm arsenic was added in the basal diet either as sodium arsenite (T2) or arsenic trioxide (T3) and fed for 11 weeks. Serum aspartate aminotransferase and alanine aminotransferase activities were significantly increased along with a decrease in blood hemoglobin level in both the arsenic-administered groups. The level of erythrocytic antioxidants (catalase, superoxide dismutase, reduced glutathione, glutathione-S-transferase, and glutathione reductase) was decreased and lipid peroxidation was elevated upon arsenic exposure. Serum thyroid hormone levels were reduced and arsenic levels in tissues increased in both the arsenic-exposed groups, irrespective of the arsenic compound. Thus, sodium arsenite and arsenic trioxide exerted similar adverse effects on blood metabolic profile, antioxidant status, and thyroid hormones in guinea pigs. PMID:24948398

  17. Thyroid hormone regulation of gene expression in primary cerebrocortical cells: role of thyroid hormone receptor subtypes and interactions with retinoic acid and glucocorticoids.

    PubMed

    Gil-Ibáñez, Pilar; Bernal, Juan; Morte, Beatriz

    2014-01-01

    The effects of thyroid hormone on brain development and function are largely mediated by the binding of 3,5,3'-triiodo-L-thyronine (T3) to its nuclear receptors (TR) to regulate positively or negatively gene expression. We have analyzed by quantitative polymerase chain reaction the effect of T3 on primary cultured cells from the embryonic mouse cerebral cortex, on the expression of Hr, Klf9, Shh, Dio3, Aldh1a1, and Aldh1a3. In particular we focused on T3 receptor specificity, and on the crosstalk between T3, retinoic acid and dexamethasone. To check for receptor subtype specificity we used cerebrocortical cells derived from wild type mice and from mice deficient in thyroid hormone receptor subtypes. Receptor subtype specificity was found for Dio3 and Aldh1a1, which were induced by T3 only in cells expressing the T3 receptor alpha 1 subtype. Interactions of T3 with retinoic acid signaling through the control of retinoic acid metabolism are likely to be important during development. T3 had opposing influences on retinoic acid synthesizing enzymes, increasing the expression of Aldh1a1, and decreasing Aldh1a3, while increasing the retinoic acid degrading enzyme Cyp26b1. Dexamethasone increased Klf9 and Aldh1a1 expression. The effects of T3 and dexamethasone on Aldh1a1 were highly synergistic, with mRNA increments of up to 20 fold. The results provide new data on thyroid hormone regulation of gene expression and underscore the importance of thyroid hormone interactions with retinoic acid and glucocorticoids during neural development. PMID:24618783

  18. Thyroid Hormone Regulation of Gene Expression in Primary Cerebrocortical Cells: Role of Thyroid Hormone Receptor Subtypes and Interactions with Retinoic Acid and Glucocorticoids

    PubMed Central

    Gil-Ibáñez, Pilar; Bernal, Juan; Morte, Beatriz

    2014-01-01

    The effects of thyroid hormone on brain development and function are largely mediated by the binding of 3,5,3′-triiodo-L-thyronine (T3) to its nuclear receptors (TR) to regulate positively or negatively gene expression. We have analyzed by quantitative polymerase chain reaction the effect of T3 on primary cultured cells from the embryonic mouse cerebral cortex, on the expression of Hr, Klf9, Shh, Dio3, Aldh1a1, and Aldh1a3. In particular we focused on T3 receptor specificity, and on the crosstalk between T3, retinoic acid and dexamethasone. To check for receptor subtype specificity we used cerebrocortical cells derived from wild type mice and from mice deficient in thyroid hormone receptor subtypes. Receptor subtype specificity was found for Dio3 and Aldh1a1, which were induced by T3 only in cells expressing the T3 receptor alpha 1 subtype. Interactions of T3 with retinoic acid signaling through the control of retinoic acid metabolism are likely to be important during development. T3 had opposing influences on retinoic acid synthesizing enzymes, increasing the expression of Aldh1a1, and decreasing Aldh1a3, while increasing the retinoic acid degrading enzyme Cyp26b1. Dexamethasone increased Klf9 and Aldh1a1 expression. The effects of T3 and dexamethasone on Aldh1a1 were highly synergistic, with mRNA increments of up to 20 fold. The results provide new data on thyroid hormone regulation of gene expression and underscore the importance of thyroid hormone interactions with retinoic acid and glucocorticoids during neural development. PMID:24618783

  19. Early Phthalates Exposure in Pregnant Women Is Associated with Alteration of Thyroid Hormones

    PubMed Central

    Tsai, Chih-Hsin; Liang, Wei-Yen; Li, Sih-Syuan; Huang, Han-Bin

    2016-01-01

    Introduction Previous studies revealed that phthalate exposure could alter thyroid hormones during the last trimester of pregnancy. However, thyroid hormones are crucial for fetal development during the first trimester. We aimed to clarify the effect of phthalate exposure on thyroid hormones during early pregnancy. Method We recruited 97 pregnant women who were offered an amniocentesis during the early trimester from an obstetrics clinic in southern Taiwan from 2013 to 2014. After signing an informed consent form, we collected amniotic fluid and urine samples from pregnant women to analyze 11 metabolites, including mono-ethyl phthalate (MEP), mono-(2-ethyl-5-carboxypentyl) phthalate (MECPP), mono-(2-ethylhexyl) phthalate (MEHP), mono-butyl phthalate (MnBP), of 9 phthalates using liquid chromatography/ tandem mass spectrometry. We collected blood samples from each subject to analyze serum thyroid hormones including thyroxine (T4), free T4, and thyroid-binding globulin (TBG). Results Three phthalate metabolites were discovered to be >80% in the urine samples of the pregnant women: MEP (88%), MnBP (81%) and MECPP (86%). Median MnBP and MECPP levels in pregnant Taiwanese women were 21.5 and 17.6 μg/g-creatinine, respectively, that decreased after the 2011 Taiwan DEHP scandal. Results of principal component analysis suggested two major sources (DEHP and other phthalates) of phthalates exposure in pregnant women. After adjusting for age, gestational age, TBG, urinary creatinine, and other phthalate metabolites, we found a significantly negative association between urinary MnBP levels and serum T4 (β = –5.41; p-value = 0.012; n = 97) in pregnant women using Bonferroni correction. Conclusion We observed a potential change in the thyroid hormones of pregnant women during early pregnancy after DnBP exposure. Additional study is necessitated to clarify these associations. PMID:27455052

  20. A screening assay for thyroid hormone signaling disruption based on thyroid hormone-response gene expression analysis in the frog Pelophylax nigromaculatus.

    PubMed

    Zhang, Yinfeng; Li, Yuanyuan; Qin, Zhanfen; Wang, Huili; Li, Jianzhong

    2015-08-01

    Amphibian metamorphosis provides a wonderful model to study the thyroid hormone (TH) signaling disrupting activity of environmental chemicals, with Xenopus laevis as the most commonly used species. This study aimed to establish a rapid and sensitive screening assay based on TH-response gene expression analysis using Pelophylax nigromaculatus, a native frog species distributed widely in East Asia, especially in China. To achieve this, five candidate TH-response genes that were sensitive to T3 induction were chosen as molecular markers, and T3 induction was determined as 0.2 nmol/L T3 exposure for 48 hr. The developed assay can detect the agonistic activity of T3 with a lowest observed effective concentration of 0.001 nmol/L and EC50 at around 0.118-1.229 nmol/L, exhibiting comparable or higher sensitivity than previously reported assays. We further validated the efficiency of the developed assay by detecting the TH signaling disrupting activity of tetrabromobisphenol A (TBBPA), a known TH signaling disruptor. In accordance with previous reports, we found a weak TH agonistic activity for TBBPA in the absence of T3, whereas a TH antagonistic activity was found for TBBPA at higher concentrations in the presence of T3, showing that the P. nigromaculatus assay is effective for detecting TH signaling disrupting activity. Importantly, we observed non-monotonic dose-dependent disrupting activity of TBBPA in the presence of T3, which is difficult to detect with in vitro reporter gene assays. Overall, the developed P. nigromaculatus assay can be used to screen TH signaling disrupting activity of environmental chemicals with high sensitivity. PMID:26257357

  1. Adaptive Divergence in the Thyroid Hormone Signaling Pathway in the Stickleback Radiation

    PubMed Central

    Kitano, Jun; Lema, Sean C.; Luckenbach, J. Adam; Mori, Seiichi; Kawagishi, Yui; Kusakabe, Makoto; Swanson, Penny; Peichel, Catherine L.

    2010-01-01

    Summary During adaptive radiations, animals colonize diverse environments, which requires adaptation in multiple phenotypic traits [1]. Because hormones mediate the dynamic regulation of suites of phenotypic traits [2–4], evolutionary changes in hormonal signaling pathways might contribute to adaptation to new environments. Here, we report changes in the thyroid hormone signaling pathway in stream-resident ecotypes of threespine stickleback fish (Gasterosteus aculeatus), which have repeatedly evolved from ancestral marine ecotypes [5–8]. Stream-resident fish exhibit a lower plasma concentration of thyroid hormone and a lower metabolic rate, which is likely adaptive for permanent residency in small streams. The thyroid stimulating hormone-β2 (TSHβ2) gene exhibited significantly lower mRNA expression in pituitary glands of stream-resident sticklebacks relative to marine sticklebacks. Some of the difference in TSHβ2 transcript levels can be explained by cis-regulatory differences at the TSHβ2 gene locus. Consistent with these expression differences, a strong signature of divergent natural selection was found at the TSHβ2 genomic locus. By contrast, there were no differences between the marine and stream-resident ecotypes in mRNA levels or genomic sequence in the paralogous TSHβ1 gene. Our data indicate that evolutionary changes in hormonal signaling have played an important role in the postglacial adaptive radiation of sticklebacks. PMID:21093265

  2. Changes in thyroid peroxidase activity in response to various chemicals.

    PubMed

    Song, Mee; Kim, Youn-Jung; Park, Yong-Keun; Ryu, Jae-Chun

    2012-08-01

    Thyroperoxidase (TPO) is a large heme-containing glycoprotein that catalyzes the transfer of iodine to thyroglobulin during thyroid hormone (TH) synthesis. Previously, we established an in vitro assay for TPO activity based on human recombinant TPO (hrTPO) stably transfected into human follicular thyroid carcinoma (FTC-238) cells. It is important to determine whether environmental chemicals can disrupt TPO activity because it is an important factor in the TH axis. In this study, we used our assay to examine the changes in TPO activity in response to various chemicals, including benzophenones (BPs), polycyclic aromatic hydrocarbons (PAHs), and persistent organic pollutants (POPs). Overall, BPs, PAHs, and POPs slightly altered TPO activity at low doses, as compared with the positive controls methimazole (MMI), genistein, and 2,2',4,4'-tetrahydroxy BP. Benzophenone, benzhydrol, 3-methylchloranthracene, pyrene, benzo(k)fluoranthene, benzo(e)pyrene, perfluorooctane sulfonate (PFOS), perfluorooctanoic acid (PFOA), and heptachlor decreased TPO activity, while 2,4-dihydroxy BP, 2,2'-dihydroxy-4-methoxy BP, and dibenzo(a,h)anthracene increased TPO activity. From these data, we can predict the disruption of TPO activity by various chemicals as a sensitive TH end point. TPO activity should be considered when enacting measures to regulate environmental exposure to thyroid-disrupting chemicals. PMID:22699773

  3. Molecular mechanisms of regulation of growth hormone gene expression in cultured rat pituitary cells by thyroid and glucocorticoid hormones

    SciTech Connect

    Yaffe, B.M.

    1989-01-01

    In cultured GC cells, a rat pituitary tumor cell line, growth hormone (GH) is induced in a synergistic fashion by physiologic concentrations of thyroid and glucocorticoid hormones. Abundant evidence indicates that these hormones mediate this response via their specific receptors. The purpose of this thesis is to explore the mechanisms by which these hormones affect GH production. When poly (A){sup +} RNA was isolated from cells grown both with and without hormones and translated in a cell-free wheat germ system, the preGH translation products were shown to be proportional to immunoassayable GH production under all combinations of hormonal milieux, indicating that changes in GH production is modulated at a pretranslational level. A cDNA library was constructed from poly (A){sup +}RNA and one clone containing GH cDNA sequences was isolated. This was used to confirm the above results by Northern dot blot analysis. This probe was also used to assess hormonal effects on GH mRNA half-life and synthetic rates as well as GH gene transcription rates in isolated nuclei. Using a pulse-chase protocol in which cellular RNA was labeled in vivo with ({sup 3}H)uridine, and quantitating ({sup 3}H)GHmRNA directly by hybridization to GH cDNA bound to nitrocellulose filters, GHmRNA was found to have a half-life of approximately 50 hours, and was not significantly altered by the presence of inducing hormones.

  4. Mechanisms of crosstalk between endocrine systems: regulation of sex steroid hormone synthesis and action by thyroid hormones.

    PubMed

    Duarte-Guterman, Paula; Navarro-Martín, Laia; Trudeau, Vance L

    2014-07-01

    Thyroid hormones (THs) are well-known regulators of development and metabolism in vertebrates. There is increasing evidence that THs are also involved in gonadal differentiation and reproductive function. Changes in TH status affect sex ratios in developing fish and frogs and reproduction (e.g., fertility), hormone levels, and gonad morphology in adults of species of different vertebrates. In this review, we have summarized and compared the evidence for cross-talk between the steroid hormone and thyroid axes and present a comparative model. We gave special attention to TH regulation of sex steroid synthesis and action in both the brain and gonad, since these are important for gonad development and brain sexual differentiation and have been studied in many species. We also reviewed research showing that there is a TH system, including receptors and enzymes, in the brains and gonads in developing and adult vertebrates. Our analysis shows that THs influences sex steroid hormone synthesis in vertebrates, ranging from fish to pigs. This concept of crosstalk and conserved hormone interaction has implications for our understanding of the role of THs in reproduction, and how these processes may be dysregulated by environmental endocrine disruptors. PMID:24685768

  5. Excess iodine and high-fat diet combination modulates lipid profile, thyroid hormone, and hepatic LDLr expression values in mice.

    PubMed

    Han, Hao; Xin, Peng; Zhao, Lina; Xu, Jian; Xia, Yun; Yang, Xuefeng; Sun, Xiufa; Hao, Liping

    2012-06-01

    The aim of this study was to illustrate the combined effect of excess iodine and high-fat diet on lipid metabolism and its potential molecular mechanism. Sixty Balb/c mice were randomly allocated to three control groups or three excess iodine groups and fed with a high-fat diet in the absence or presence of 1,200 μg/L iodine for 1, 3, or 6 months, respectively. Serum lipid parameters and serum thyroid hormones were measured. Expressions of scavenger receptor class B type-I (SR-BI) and low density lipoproteins receptor (LDLr) mRNA and protein in liver were detected. Thyroid histology and liver type 1 iodothyronine deiodinase activity were analyzed. At the end of 3 and 6 months, compared with control, serum TC, TG, and LDL-C in excess iodine group were significantly lower (p < 0.05). LDLr expression in liver was increased significantly (p < 0.05) and parallel to the change of serum TC and TG. TT3 and TT4 levels in serum were elevated and TSH decreased significantly (p < 0.05). Liver type I iodothyronine deiodinase activity was significantly higher (p < 0.05) than control at the end of 6 months. Moreover, a time course damage effect of excess iodine combined with high-fat diet on thyroid glands was observed. The present findings demonstrated that excess iodine combined with high-fat diet could cause damage to thyroid glands and lead to thyroid hormone disorder. Those in turn caused the upregulation of hepatic LDLr gene, which resulted in the disorder in serum lipids. PMID:22222482

  6. Thyroid hormones correlate with resting metabolic rate, not daily energy expenditure, in two charadriiform seabirds

    PubMed Central

    Elliott, Kyle H.; Welcker, Jorg; Gaston, Anthony J.; Hatch, Scott A.; Palace, Vince; Hare, James F.; Speakman, John R.; Anderson, W. Gary

    2013-01-01

    Summary Thyroid hormones affect in vitro metabolic intensity, increase basal metabolic rate (BMR) in the lab, and are sometimes correlated with basal and/or resting metabolic rate (RMR) in a field environment. Given the difficulty of measuring metabolic rate in the field—and the likelihood that capture and long-term restraint necessary to measure metabolic rate in the field jeopardizes other measurements—we examined the possibility that circulating thyroid hormone levels were correlated with RMR in two free-ranging bird species with high levels of energy expenditure (the black-legged kittiwake, Rissa tridactyla, and thick-billed murre, Uria lomvia). Because BMR and daily energy expenditure (DEE) are purported to be linked, we also tested for a correlation between thyroid hormones and DEE. We examined the relationships between free and bound levels of the thyroid hormones thyroxine (T4) and triiodothyronine (T3) with DEE and with 4-hour long measurements of post-absorptive and thermoneutral resting metabolism (resting metabolic rate; RMR). RMR but not DEE increased with T3 in both species; both metabolic rates were independent of T4. T3 and T4 were not correlated with one another. DEE correlated with body mass in kittiwakes but not in murres, presumably owing to the larger coefficient of variation in body mass during chick rearing for the more sexually dimorphic kittiwakes. We suggest T3 provides a good proxy for resting metabolism but not DEE in these seabird species. PMID:23789108

  7. Invited commentary: Maternal plasma polybrominated diphenyl ethers and thyroid hormones--challenges and opportunities.

    PubMed

    Chevrier, Jonathan

    2013-09-01

    Thyroid hormones play a fundamental role in fetal and child development. While iodine deficiency-related maternal and child hypothyroidism may cause severe mental retardation, recent evidence suggests that milder forms of maternal hypothyroidism and hypothyroxinemia during pregnancy are also associated with altered neurodevelopment. On the other hand, hyperthyroidism during pregnancy has been associated with adverse fetal outcomes. Findings published by Abdelouahab et al. in the American Journal of Epidemiology (Am J Epidemiol. 2013;178(5):701-713) suggest that plasma concentrations of maternal polybrominated diphenyl ethers (PBDEs), which were used as flame retardants until recently and are detected in the tissues of virtually every North American, are associated with umbilical cord and maternal thyroid hormone levels during pregnancy. Although PBDEs have been consistently shown to reduce levels of free and total thyroxine in experimental animal studies, the direction of associations in human studies has been inconsistent. In this commentary, I discuss challenges beyond the factors often cited in the epidemiologic literature to explain inconsistent findings which more specifically apply to the study of PBDEs and thyroid hormones. These include the determination of iodine intake status, the method used to adjust for blood lipid concentrations, the measurement of free thyroid hormone levels, the possible effect of PBDE metabolites, and the potential for reverse causality. PMID:23924577

  8. Placental Transfer of Perfluoroalkyl Substances and Associations with Thyroid Hormones: Beijing Prenatal Exposure Study

    NASA Astrophysics Data System (ADS)

    Yang, Lin; Li, Jingguang; Lai, Jianqiang; Luan, Hemi; Cai, Zongwei; Wang, Yibaina; Zhao, Yunfeng; Wu, Yongning

    2016-02-01

    Perfluoroalkyl substances (PFASs) have been detected in wildlife and human samples worldwide. Toxicology research showed that PFASs could interfere with thyroid hormone homeostasis. In this study, eight PFASs, fifteen PFAS precursors and five thyroid hormones were analyzed in 157 paired maternal and cord serum samples collected in Beijing around delivery. Seven PFASs and two precursors were detected in both maternal and cord sera with significant maternal-fetal correlations (r = 0.336 to 0.806, all P < 0.001). The median ratios of major PFASs concentrations in fetal versus maternal serum were from 0.25:1 (perfluorodecanoic acid, PFDA) to 0.65:1 (perfluorooctanoic acid, PFOA). Spearman partial correlation test showed that maternal thyroid stimulating hormone (TSH) was negatively correlated with most maternal PFASs (r = -0.261 to -0.170, all P < 0.05). Maternal triiodothyronin (T3) and free T3 (FT3) showed negative correlations with most fetal PFASs (r = -0.229 to -0.165 for T3; r = -0.293 to -0.169 for FT3, all P < 0.05). Our results suggest prenatal exposure of fetus to PFASs and potential associations between PFASs and thyroid hormone homeostasis in humans.

  9. EFFECTS OF PERFLUOROOCTANE SULFONATE (PFOS) ON THYROID HORMONE STATUS IN ADULT AND NEONATAL RATS

    EPA Science Inventory

    EFFECTS OF PERFLUOROOCTANE SULFONATE (PFOS) ON THYROID HORMONE STATUS IN ADULT AND NEONATAL RATS. M.N. Logan1, J.R. Thibodeaux2, R.G. Hanson2, C. Lau2. 1North Carolina Central University, Durham, NC, 2Reprod. Tox. Div. NHEERL, US EPA, Research Triangle Park, NC.

    Perfluor...

  10. Thyroid Hormone Levels and Psychological Symptoms in Sexually Abused Adolescent Girls

    ERIC Educational Resources Information Center

    Haviland, Mark G.; Sonne, Janet L.; Anderson, Donald L.; Nelson, Jerald C.; Sheridan-Matney, Clare; Nichols, Joy G.; Carlton, Esther I.; Murdoch, William G. C.

    2006-01-01

    Objective: To explore the relationships between psychological symptoms and thyroid hormone levels in adolescent girls who had experienced the traumatic stress of sexual abuse. Method: The study design was cross-sectional/correlational. Subjects ("N"=22; age range=12-18 years) had their blood drawn, and they completed 2 psychological tests…

  11. THE EFFECTS OF LOW DOSE PTU ON ENDPOINTS OF THYROID HORMONE ACTION IN THE DEVELOPING BRAIN.

    EPA Science Inventory

    Thyroid hormone (TH) is essential for normal brain development. Therefore, there is concern that any factor that reduces TH levels may permanently alter brain development. As part of an EPA Cooperative Agreement, the goal of this work was to characterize the degree to which cir...

  12. Thyroid hormones: a triple-edged sword for life history transitions.

    PubMed

    Holzer, Guillaume; Laudet, Vincent

    2015-04-20

    Thyroid hormones have long been known for their metabolic role in humans and for triggering amphibian metamorphosis. More recently they have been uncovered as an important effector mechanism in seasonality. A recent study of salmon smoltification relates these various biological roles. PMID:25898108

  13. Thyroid Hormone Indices in Computer Workers with Emphasis on the Role of Zinc Supplementation

    PubMed Central

    Amin, Ahmed Ibrahim; Hegazy, Noha Mohamed; Ibrahim, Khadiga Salah; Mahdy-Abdallah, Heba; Hammouda, Hamdy A. A.; Shaban, Eman Essam

    2016-01-01

    AIM: This study aimed to investigate the effects of computer monitor-emitted radiation on thyroid hormones and the possible protective role of zinc supplementation. MATERIAL AND METHODS: The study included three groups. The first group (group B) consisted of 42 computer workers. This group was given Zinc supplementation in the form of one tablet daily for eight weeks. The second group (group A) comprised the same 42 computer workers after zinc supplementation. A group of 63 subjects whose job does not entail computer use was recruited as a control Group (Group C). All participants filled a questionnaire including detailed medical and occupational histories. They were subjected to full clinical examination. Thyroid stimulating hormone (TSH), free triiodothyronine (FT3), free thyroxine (FT4) and zinc levels were measured in all participants. RESULTS: TSH, FT3, FT4 and zinc concentrations were decreased significantly in group B relative to group C. In group A, all tested parameters were improved when compared with group B. The obtained results revealed that radiation emitted from computers led to changes in TSH and thyroid hormones (FT3 and FT4) in the workers. CONCLUSION: Improvement after supplementation suggests that zinc can ameliorate hazards of such radiation on thyroid hormone indices. PMID:27335605

  14. Thyroid stimulating hormone microadenoma as a rare cause of thyrotoxicosis amenable to surgical cure.

    PubMed

    Turel, Mazda K; Asha, Hesarghatta S; Rajaratnam, Simon; Chacko, Geeta; Chacko, Ari G

    2012-06-01

    Hyperthyroidism due to a thyroid stimulating hormone (TSH) pituitary adenoma is rare. We report a 29-year-old woman with thyrotoxicosis and elevated serum 3,5,3',5'-tetraiodothyronine and TSH levels that resolved after a transsphenoidal excision of the detected TSH pituitary adenoma. The diagnosis and management options in such patients are reviewed. PMID:22153796

  15. Placental Transfer of Perfluoroalkyl Substances and Associations with Thyroid Hormones: Beijing Prenatal Exposure Study

    PubMed Central

    Yang, Lin; Li, Jingguang; Lai, Jianqiang; Luan, Hemi; Cai, Zongwei; Wang, Yibaina; Zhao, Yunfeng; Wu, Yongning

    2016-01-01

    Perfluoroalkyl substances (PFASs) have been detected in wildlife and human samples worldwide. Toxicology research showed that PFASs could interfere with thyroid hormone homeostasis. In this study, eight PFASs, fifteen PFAS precursors and five thyroid hormones were analyzed in 157 paired maternal and cord serum samples collected in Beijing around delivery. Seven PFASs and two precursors were detected in both maternal and cord sera with significant maternal-fetal correlations (r = 0.336 to 0.806, all P < 0.001). The median ratios of major PFASs concentrations in fetal versus maternal serum were from 0.25:1 (perfluorodecanoic acid, PFDA) to 0.65:1 (perfluorooctanoic acid, PFOA). Spearman partial correlation test showed that maternal thyroid stimulating hormone (TSH) was negatively correlated with most maternal PFASs (r = −0.261 to −0.170, all P < 0.05). Maternal triiodothyronin (T3) and free T3 (FT3) showed negative correlations with most fetal PFASs (r = −0.229 to −0.165 for T3; r = −0.293 to −0.169 for FT3, all P < 0.05). Our results suggest prenatal exposure of fetus to PFASs and potential associations between PFASs and thyroid hormone homeostasis in humans. PMID:26898235

  16. Effects of Selenomethionine Supplementation on Selenium Status and Thyroid Hormone Concentrations in Healthy Adults

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Selenium (Se) is a component of the iodothyronine 5'-deiodinases that convert tetraiodothyronine (T4) to thyroid hormone (T3). One study has suggested that six Se-adequate American males responded to short-term (120 d) Se-supplementation with decreased serum T3 followed by increased th...

  17. The Nature of Compensatory Response to Low Thyroid Hormone in Developing Brain.

    EPA Science Inventory

    Abstract Thyroid hormone is essential for normal brain development, but the degree to which the developing brain is sensitive to small perturbations in serum thyroxin is not clear. An important concept related to this is that the developing brain possesses potent mechanisms to co...

  18. ABILITY OF THE MALE RAT PUBERTAL ASSAY TO DETECT ENVIRONMENTAL CHEMICALS THAT ALTER THYROID HORMONE HOMEOSTASIS

    EPA Science Inventory

    ABILITY OF THE MALE RAT PUBERTAL ASSAY TO DETECT ENVIRONMENTAL CHEMICALS THAT ALTER THYROID HORMONE HOMEOSTASIS

    Stoker, Tammy E.1; Laws, Susan C.1; Ferrell, Janet M.1; Cooper, Ralph L.1.

    Endocrinology Branch, RTD, NHEERL, ORD, U.S. EPA, RTP, NC, 27711.

    The...

  19. METABOLISM OF BROMINATED FLAME RETARDANTS IN HUMAN ASTROCYTES AND EFFECTS ON THYROID HORMONE HOMEOSTASIS

    EPA Science Inventory

    In this proposed study, hydroxylated PBDEs and brominated phenols likely will be formed in astrocytes as a result of cytochrome p450-mediated metabolism. Previous studies have shown that polychlorinated biphenyls (PCBs) affect the regulation of thyroid hormones at the bloo...

  20. A case with hyperthyroidism who had been treated with thyroid hormone because of congenital hypothyroidism.

    PubMed

    Otsubo, Kiyoko; Mizota, Michiyo; Hizukuri, Kazuko; Tamada, Izumi; Arima, Shiu; Ono, Seigo; Kawano, Yoshifumi

    2005-01-01

    We encountered a case with hyperthyroidism at the age of 14 who had been diagnosed with congenital hypothyroidism (CH) and had received thyroid hormone replacement therapy. At the age of 16 d, the patient was referred to our hospital because of positive results at neonatal screening for CH. Serum level of TSH was 91.0 μU/ml and serum level of T4 was 6.9 μg/dl. The patient was diagnosed as having hypothyroidism, and hormone replacement therapy was started. Thereafter the dosage of thyroid hormone was adjusted and increased gradually as he grew to a maximum dose of 110 μg/day at the age of 11. Until the age of 13, the patient's serum levels of TSH were within the normal range; then, at the age of 13 yr and 4 mo, his serum level of TSH dropped to a level below the detectable range. The dosage of administered thyroid hormone was tapered off and eventually eliminated at the age of 14. A thyroid scan and a radioactive iodine uptake test demonstrated a diffuse goiter with homogeneous uptake of radioactive iodine; the uptake rate was 60% at 24 h, and the serum level of TSH receptor antibody (TRAb) was 62.5% at that time. Administration of an antithyroid drug was started after confirmation that our patient had developed hyperthyroidism. There have been no case reports similar to our case. PMID:24790312

  1. Placental Transfer of Perfluoroalkyl Substances and Associations with Thyroid Hormones: Beijing Prenatal Exposure Study.

    PubMed

    Yang, Lin; Li, Jingguang; Lai, Jianqiang; Luan, Hemi; Cai, Zongwei; Wang, Yibaina; Zhao, Yunfeng; Wu, Yongning

    2016-01-01

    Perfluoroalkyl substances (PFASs) have been detected in wildlife and human samples worldwide. Toxicology research showed that PFASs could interfere with thyroid hormone homeostasis. In this study, eight PFASs, fifteen PFAS precursors and five thyroid hormones were analyzed in 157 paired maternal and cord serum samples collected in Beijing around delivery. Seven PFASs and two precursors were detected in both maternal and cord sera with significant maternal-fetal correlations (r = 0.336 to 0.806, all P < 0.001). The median ratios of major PFASs concentrations in fetal versus maternal serum were from 0.25:1 (perfluorodecanoic acid, PFDA) to 0.65:1 (perfluorooctanoic acid, PFOA). Spearman partial correlation test showed that maternal thyroid stimulating hormone (TSH) was negatively correlated with most maternal PFASs (r = -0.261 to -0.170, all P < 0.05). Maternal triiodothyronin (T3) and free T3 (FT3) showed negative correlations with most fetal PFASs (r = -0.229 to -0.165 for T3; r = -0.293 to -0.169 for FT3, all P < 0.05). Our results suggest prenatal exposure of fetus to PFASs and potential associations between PFASs and thyroid hormone homeostasis in humans. PMID:26898235

  2. Cathepsin H regulated by the thyroid hormone receptors associate with tumor invasion in human hepatoma cells.

    PubMed

    Wu, S-M; Huang, Y-H; Yeh, C-T; Tsai, M-M; Liao, C-H; Cheng, W-L; Chen, W-J; Lin, K-H

    2011-04-28

    Thyroid hormone, 3, 3', 5-triiodo-L-thyronine (T(3)), mediates cell growth, development and differentiation by binding to its nuclear receptors (TRs). The role of TRs in cancer is still undefined. Notably, hyperthyroxinemia has been reported to influence the rate of colon cancer in an experimental model of carcinogenesis in rats. Previous microarray analysis revealed that cathepsin H (CTSH) is upregulated by T(3) in HepG2-TR cells. We verified that mRNA and protein expression of CTSH are induced by T(3) in HepG2-TR cells and in thyroidectomized rats following administration of T(3). The possible thyroid hormone-responsive elements of the CTSH promoter localized to the nucleotides -2038 to -1966 and -1565 to -1501 regions. An in vitro functional assay showed that CTSH can increase metastasis. J7 cells overexpressing CTSH were inoculated into severe combined immune-deficient mice and these J7-CTSH mice displayed a greater metastatic potential than did J7-control mice. The clinicopathologic significance of CTSH expression in hepatocellular carcinoma (HCC) was also investigated. The CTSH overexpressing in HCC was associated with the presence of microvascular invasion (P=0.037). The microvascular invasion characteristic is closely related to our in vitro characterization of CTSH function. Our results show that T(3)-mediated upregulation of CTSH led to matrix metallopeptidase or extracellular signal-regulated kinase activation and increased cell migration. This study demonstrated that CTSH overexpression in a subset hepatoma may be TR dependent and suggests that this overexpression has an important role in hepatoma progression. PMID:21217776

  3. Thyroid Hormone Receptor Sumoylation Is Required for Preadipocyte Differentiation and Proliferation*

    PubMed Central

    Liu, Yan-Yun; Ayers, Stephen; Milanesi, Anna; Teng, Xiaochun; Rabi, Sina; Akiba, Ysutada; Brent, Gregory A.

    2015-01-01

    Thyroid hormone and thyroid hormone receptor (TR) play an essential role in metabolic regulation. However, the role of TR in adipogenesis has not been established. We reported previously that TR sumoylation is essential for TR-mediated gene regulation and that mutation of either of the two sites in TRα or any of the three sites in TRβ reduces TR sumoylation. Here, we transfected TR sumoylation site mutants into human primary preadiocytes and the mouse 3T3L1 preadipocyte cell line to determine the role of TR sumoylation in adipogenesis. Reduced sumoylation of TRα or TRβ resulted in fewer and smaller lipid droplets and reduced proliferation of preadipocytes. TR sumoylation mutations, compared with wild-type TR, results in reduced C/EBP expression and reduced PPARγ2 mRNA and protein levels. TR sumoylation mutants recruited NCoR and disrupted PPARγ-mediated perilipin1 (Plin1) gene expression, associated with impaired lipid droplet formation. Expression of NCoRΔID, a mutant NCoR lacking the TR interaction domain, partially “rescued” the delayed adipogenesis and restored Plin1 gene expression and adipogenesis. TR sumoylation site mutants impaired Wnt/β-catenin signaling pathways and the proliferation of primary human preadipocytes. Expression of the TRβ K146Q sumoylation site mutant down-regulated the essential genes required for canonical Wnt signal-mediated proliferation, including Wnt ligands, Fzds, β-catenin, LEF1, and CCND1. Additionally, the TRβ K146Q mutant enhanced the canonical Wnt signaling inhibitor Dickkopf-related protein 1 (DKK1). Our data demonstrate that TR sumoylation is required for activation of the Wnt canonical signaling pathway during preadipocyte proliferation and enhances the PPARγ signaling that promotes differentiation. PMID:25572392

  4. Thyroid hormone receptor sumoylation is required for preadipocyte differentiation and proliferation.

    PubMed

    Liu, Yan-Yun; Ayers, Stephen; Milanesi, Anna; Teng, Xiaochun; Rabi, Sina; Akiba, Ysutada; Brent, Gregory A

    2015-03-20

    Thyroid hormone and thyroid hormone receptor (TR) play an essential role in metabolic regulation. However, the role of TR in adipogenesis has not been established. We reported previously that TR sumoylation is essential for TR-mediated gene regulation and that mutation of either of the two sites in TRα or any of the three sites in TRβ reduces TR sumoylation. Here, we transfected TR sumoylation site mutants into human primary preadiocytes and the mouse 3T3L1 preadipocyte cell line to determine the role of TR sumoylation in adipogenesis. Reduced sumoylation of TRα or TRβ resulted in fewer and smaller lipid droplets and reduced proliferation of preadipocytes. TR sumoylation mutations, compared with wild-type TR, results in reduced C/EBP expression and reduced PPARγ2 mRNA and protein levels. TR sumoylation mutants recruited NCoR and disrupted PPARγ-mediated perilipin1 (Plin1) gene expression, associated with impaired lipid droplet formation. Expression of NCoRΔID, a mutant NCoR lacking the TR interaction domain, partially "rescued" the delayed adipogenesis and restored Plin1 gene expression and adipogenesis. TR sumoylation site mutants impaired Wnt/β-catenin signaling pathways and the proliferation of primary human preadipocytes. Expression of the TRβ K146Q sumoylation site mutant down-regulated the essential genes required for canonical Wnt signal-mediated proliferation, including Wnt ligands, Fzds, β-catenin, LEF1, and CCND1. Additionally, the TRβ K146Q mutant enhanced the canonical Wnt signaling inhibitor Dickkopf-related protein 1 (DKK1). Our data demonstrate that TR sumoylation is required for activation of the Wnt canonical signaling pathway during preadipocyte proliferation and enhances the PPARγ signaling that promotes differentiation. PMID:25572392

  5. Human longevity is characterised by high thyroid stimulating hormone secretion without altered energy metabolism

    PubMed Central

    Jansen, S. W.; Akintola, A. A.; Roelfsema, F.; van der Spoel, E.; Cobbaert, C. M.; Ballieux, B. E.; Egri, P.; Kvarta-Papp, Z.; Gereben, B.; Fekete, C.; Slagboom, P. E.; van der Grond, J.; Demeneix, B. A.; Pijl, H.; Westendorp, R. G. J.; van Heemst, D.

    2015-01-01

    Few studies have included subjects with the propensity to reach old age in good health, with the aim to disentangle mechanisms contributing to staying healthier for longer. The hypothalamic-pituitary-thyroid (HPT) axis maintains circulating levels of thyroid stimulating hormone (TSH) and thyroid hormone (TH) in an inverse relationship. Greater longevity has been associated with higher TSH and lower TH levels, but mechanisms underlying TSH/TH differences and longevity remain unknown. The HPT axis plays a pivotal role in growth, development and energy metabolism. We report that offspring of nonagenarians with at least one nonagenarian sibling have increased TSH secretion but similar bioactivity of TSH and similar TH levels compared to controls. Healthy offspring and spousal controls had similar resting metabolic rate and core body temperature. We propose that pleiotropic effects of the HPT axis may favour longevity without altering energy metabolism. PMID:26089239

  6. Atrial natriuretic factor (ANF) inhibits thyroid hormone secretion in the mouse

    SciTech Connect

    Ahren, B. )

    1990-01-01

    Recently, thyroid follicular cells were shown to exhibit atrial natriuretic factor (ANF)-like immunoreactivity and high affinity ANF receptors. In this study, we therefore examined the effects of synthetic rat ANF{sub 1-28} on basal and stimulated thyroid hormone secretion in the mouse, according to the McKenzie technique. Iodine deficient mice were pretreated with {sup 125}I and thyroxine. ANF (3 nmol/animal) was found to inhibit the increase in blood radioiodine levels that was induced by TSH or vasoactive intestinal polypeptide (VIP). Furthermore, ANF and norepinephrine additively inhibited the TSH-induced increase in blood radioiodine levels. It is concluded that ANF inhibits thyroid hormone secretion, which, therefore, might be locally regulated by intrathyroidal ANF.

  7. Different causes of reduced sensitivity to thyroid hormone: diagnosis and clinical management.

    PubMed

    Visser, W Edward; van Mullem, Alies A A; Visser, Theo J; Peeters, Robin P

    2013-11-01

    Normal thyroid hormone (TH) metabolism and action require adequate cellular TH signalling. This entails proper function of TH transporters in the plasma membrane, intracellular deiodination of TH and action of the bioactive hormone T3 at its nuclear receptors (TRs). The present review summarizes the discoveries of different syndromes with reduced sensitivity at the cellular level. Mutations in the TH transporter MCT8 cause psychomotor retardation and abnormal thyroid parameters. Mutations in the SBP2 protein, which is required for normal deiodination, give rise to a multisystem disorder including abnormal thyroid function tests. Mutations in TRβ1 are a well-known cause of resistance to TH with mostly a mild phenotype, while only recently, patients with mutations in TRα1 were identified. The latter patients have slightly abnormal TH levels, growth retardation and cognitive defects. This review will describe the mechanisms of disease, clinical phenotype, diagnostic testing and suggestions for treatment strategies for each of these syndromes. PMID:23834164

  8. Cystic ovarian follicles and thyroid activity in the dairy cow.

    PubMed

    Mutinati, M; Rizzo, A; Sciorsci, R L

    2013-05-01

    Thyroid activity affects the functionality of the reproductive axis and thyroid dysfunction has been associated with ovarian hyperstimulation syndrome and polycystic ovarian syndrome, in human medicine. This study investigates serum17- estradiol, progesterone, thyrotropic and thyroid hormone levels, in cyclic dairy cows on heat (Group H) and in dairy cows with ovarian follicular cysts (Group FC). Both 17- estradiol and progesterone serum concentrations were statistically higher in cystic than in cyclic cows (estradiol: 8.51±1.91 vs 6.32±1pg/mL) (progesterone: 0.49±0.17 vs 0.13±0.03ng/mL), whereas TSH and fT4 serum concentrations were statistically lower in cows with cystic ovarian follicles (COF), compared to cyclic ones (TSH: 2.48±1.31 vs 3.56±1.03ng/mL) (fT4: 5.86±1.69 vs 8.63±1.08). fT3 serum levels were similar, in both cystic and cyclic subjects (2.94±0.65 vs 3.02±0.9, respectively). Based on these results it was decided to examine the function of the thyrothropic axis of dairy cows in a similar manner to that conducted on humans. If severe hypothyroidism should be found, a hormone replacement therapy could be attempted in cystic cows refractory to "ordinary" therapies. PMID:23567219

  9. [Effect of space flight aboard "Kosmos-1129" on thyroid hormone content of the blood and thyroid gland of rats].

    PubMed

    Tigranian, R A; Kalita, N F; Makho, L; Langer, P; Knopp, Ia

    1985-01-01

    Thyrotrophin, thyroxine, triiodothyronine, and reverse triiodothyronine were measured in plasma and thyroxine and triiodothyronine in the thyroid gland of the rats flown for 18.5 days onboard Cosmos-1129. Postflight the plasma content of thyrotrophin and triiodothyronine increased and that of thyroxine decreased and the gland content of thyroxine and triiodothyronine diminished. It is postulated that in the flight animals the functional activity of the thyroid gland declined. PMID:3974186

  10. Thyroid hormone signaling: Contribution to neural function, cognition, and relationship to nicotine.

    PubMed

    Leach, Prescott T; Gould, Thomas J

    2015-10-01

    Cigarette smoking is common despite its adverse effects on health, such as cardiovascular disease and stroke. Understanding the mechanisms that contribute to the addictive properties of nicotine makes it possible to target them to prevent the initiation of smoking behavior and/or increase the chance of successful quit attempts. While highly addictive, nicotine is not generally considered to be as reinforcing as other drugs of abuse. There are likely other mechanisms at work that contribute to the addictive liability of nicotine. Nicotine modulates aspects of the endocrine system, including the thyroid, which is critical for normal cognitive functioning. It is possible that nicotine's effects on thyroid function may alter learning and memory, and this may underlie some of its addictive potential. Here, we review the literature on thyroid function and cognition, with a focus on how nicotine alters thyroid hormone signaling and the potential impact on cognition. Changes in cognition are a major symptom of nicotine addiction. Current anti-smoking therapies have modest success at best. If some of the cognitive effects of nicotine are mediated through the thyroid hormone system, then thyroid hormone agonists may be novel treatments for smoking cessation therapies. The content of this review is important because it clarifies the relationship between smoking and thyroid function, which has been ill-defined in the past. This review is timely because the reduction in smoking rates we have seen in recent decades, due to public awareness campaigns and public smoking bans, has leveled off in recent years. Therefore, novel treatment approaches are needed to help reduce smoking rates further. PMID:26344666

  11. Preservation of renal function by thyroid hormone replacement in elderly persons with subclinical hypothyroidism

    PubMed Central

    Guo, Hong; Liu, Dongmei; Zhao, Zhen

    2016-01-01

    Introduction The treatment of subclinical hypothyroidism in elderly persons is controversial. Previous studies have shown that there are interactions between kidney and thyroid function, but data regarding interventions that target thyroid function in elderly patients are scarce. We aimed to investigate the impact of thyroid hormone therapy on the estimated glomerular filtration rate (eGFR) in elderly patients. Material and methods Ninety elderly patients aged ≥ 65 years with subclinical hypothyroidism were followed for 36 months in our case-control study. The changes in the eGFR in patients with and without thyroid hormone replacement therapy were compared. The adverse effects during the treatment period were noted. Results The eGFR of both groups was similar at the beginning of the study (43.4 ±6.1 vs. 42.8 ±5.9 ml/min/1.73 m2; p = 0.62). With the decline in thyroid stimulating hormone levels after treatment, the eGFR of the treatment group significantly improved compared with the control group (45.8 ±4.8 vs. 35.8 ±5.3 ml/min/1.73 m2; p < 0.001); the eGFR increased rapidly over the first 6 months and then plateaued. No patients withdrew from the study, but the therapeutic dose was decreased in two patients due to angina pectoris. Conclusions Thyroid hormone therapy preserved renal function in elderly patients. Appropriate individual treatment should be considered in elderly patients with subclinical hypothyroidism. PMID:27478458

  12. Endoplasmic reticulum stress decreases intracellular thyroid hormone activation via an eIF2a-mediated decrease in type 2 deiodinase synthesis.

    PubMed

    Arrojo E Drigo, Rafael; Fonseca, Tatiana L; Castillo, Melany; Salathe, Matthias; Simovic, Gordana; Mohácsik, Petra; Gereben, Balazs; Bianco, Antonio C

    2011-12-01

    Cells respond rapidly to endoplasmic reticulum (ER) stress by blocking protein translation, increasing protein folding capacity, and accelerating degradation of unfolded proteins via ubiquitination and ER-associated degradation pathways. The ER resident type 2 deiodinase (D2) is normally ubiquitinated and degraded in the proteasome, a pathway that is accelerated by enzyme catalysis of T(4) to T(3). To test whether D2 is normally processed through ER-associated degradation, ER stress was induced in cells that endogenously express D2 by exposure to thapsigargin or tunicamycin. In all cell models, D2 activity was rapidly lost, to as low as of 30% of control activity, without affecting D2 mRNA levels; loss of about 40% of D2 activity and protein was also seen in human embryonic kidney 293 cells transiently expressing D2. In primary human airway cells with ER stress resulting from cystic fibrosis, D2 activity was absent. The rapid ER stress-induced loss of D2 resulted in decreased intracellular D2-mediated T(3) production. ER stress-induced loss of D2 was prevented in the absence of T(4), by blocking the proteasome with MG-132 or by treatment with chemical chaperones. Notably, ER stress did not alter D2 activity half-life but rather decreased D2 synthesis as assessed by induction of D2 mRNA and by [(35)S]methionine labeling. Remarkably, ER-stress-induced loss in D2 activity is prevented in cells transiently expressing an inactive eukaryotic initiation factor 2, indicating that this pathway mediates the loss of D2 activity. In conclusion, D2 is selectively lost during ER stress due to an eukaryotic initiation factor 2-mediated decrease in D2 synthesis and sustained proteasomal degradation. This explains the lack of D2 activity in primary human airway cells with ER stress resulting from cystic fibrosis. PMID:22053000

  13. The Gαi AND Gαq Proteins Mediate the Effects of Melatonin on Steroid/Thyroid Hormone Receptor Transcriptional Activity and Breast Cancer Cell Proliferation

    PubMed Central

    Lai, Ling; Yuan, Lin; Chen, Qi; Dong, Chunmin; Mao, Lulu; Rowan, Brian; Frasch, Tripp; Hill, Steven M.

    2016-01-01

    Melatonin, via its MT1 receptor, but not the MT2 receptor, can modulate the transcriptional activity of various nuclear receptors (ERα and RARα, but not ERβ) in MCF-7, T47D and ZR-75-1 human breast cancer cell lines. The anti-proliferative and nuclear receptor modulatory actions of melatonin are mediated via the MT1 G protein-coupled receptor expressed in human breast cancer cells. However, the specific G proteins and associated pathways involved in nuclear receptor transcriptional regulation by melatonin are not yet clear. Upon activation, the MT1 receptor specifically couples to the Gαi2, Gαi3, Gαq and Gαll proteins, and via activation of Gαi2 proteins, melatonin suppresses forskolin-induced cyclic AMP (cAMP) production, while melatonin activation of Gαq, is able to inhibit phospholipid hydrolysis and ATP’s induction of inositol triphosphate (IP3) production in MCF-7 breast cancer cells. Employing dominant-negative (DN) and dominant-positive (DP) forms of these G proteins we demonstrate that Gαi2 proteins mediate the suppression of estrogen-induced ERα transcriptional activity by melatonin, while the Gq protein mediates the enhancement of retinoid-induced RARα transcriptional activity by melatonin. However, the growth-inhibitory actions of melatonin are mediated via both Gαi2 and Gαq proteins. PMID:18705646

  14. Ovine thyroid stimulating hormone (TSH) heterologously stimulates production of thyroid hormones from Chinese soft-shell turtle (Pelodiscus sinensis) and bullfrog (Rana catesbeiana and Rana rugulosa) thyroids in vitro.

    PubMed

    Huang, Wei-Tung; Chien, Jung-Tsun; Weng, Ching-Feng; Jeng, Yung-Yue; Lu, Li-Chia; Yu, John Yuh-Lin

    2009-06-01

    Thyroid hormones are important for regulating a variety of developmental processes in vertebrates, including growth, differentiation, metamorphosis, and oxidative metabolism. In particular, this study focused on the in vitro production of thyroxine (T(4)) and triiodothyronine (T(3)) from thyroids in American bullfrogs (Rana catesbeiana), Chinese bullfrogs (Rana rugulosa Wiegmann), and Chinese soft-shell turtles (Pelodiscus sinensis) treated with ovine thyroid stimulating hormone (TSH) at different culture intervals (2, 4, 8, and 12 h) and dosages (1, 10, 50 or 100 ng). The levels of T(4) and T(3) in the tested animals were elevated upon stimulation in a time- and dose-dependent manner, indicating de novo synthesis of T(4) and T(3). Significantly higher hormone levels were observed in the Chinese bullfrog compared to the other two species, for both the time-course and dose-response experiments. Although the bullfrog secreted significantly higher levels of T(4) and T(3), a higher T(4)-conversion capacity was found in the Chinese soft-shell turtle. The highest ratios of T(3) to T(4) were observed in the American bullfrog and Chinese soft-shell turtle for the time-course and dose-response experiments, respectively. These findings suggest that the Chinese soft-shell turtle and bullfrog thyroids can accept ovine TSH for T(4)- and T(3)-formation in a time- and dose-dependent manner, supporting the hypothesis that the binding interactions between TSHs and thyroidal receptors are conserved in vertebrates. PMID:19535032

  15. Mutations of the Thyroid Hormone Transporter MCT8 Cause Prenatal Brain Damage and Persistent Hypomyelination

    PubMed Central

    López-Espíndola, Daniela; Morales-Bastos, Carmen; Grijota-Martínez, Carmen; Liao, Xiao-Hui; Lev, Dorit; Sugo, Ella; Verge, Charles F.; Refetoff, Samuel

    2014-01-01

    Context: Mutations in the MCT8 (SLC16A2) gene, encoding a specific thyroid hormone transporter, cause an X-linked disease with profound psychomotor retardation, neurological impairment, and abnormal serum thyroid hormone levels. The nature of the central nervous system damage is unknown. Objective: The objective of the study was to define the neuropathology of the syndrome by analyzing brain tissue sections from MCT8-deficient subjects. Design: We analyzed brain sections from a 30th gestational week male fetus and an 11-year-old boy and as controls, brain tissue from a 30th and 28th gestational week male and female fetuses, respectively, and a 10-year-old girl and a 12-year-old boy. Methods: Staining with hematoxylin-eosin and immunostaining for myelin basic protein, 70-kDa neurofilament, parvalbumin, calbindin-D28k, and synaptophysin were performed. Thyroid hormone determinations and quantitative PCR for deiodinases were also performed. Results: The MCT8-deficient fetus showed a delay in cortical and cerebellar development and myelination, loss of parvalbumin expression, abnormal calbindin-D28k content, impaired axonal maturation, and diminished biochemical differentiation of Purkinje cells. The 11-year-old boy showed altered cerebellar structure, deficient myelination, deficient synaptophysin and parvalbumin expression, and abnormal calbindin-D28k expression. The MCT8-deficient fetal cerebral cortex showed 50% reduction of thyroid hormones and increased type 2 deiodinase and decreased type 3 deiodinase mRNAs. Conclusions: The following conclusions were reached: 1) brain damage in MCT8 deficiency is diffuse, without evidence of focal lesions, and present from fetal stages despite apparent normality at birth; 2) deficient hypomyelination persists up to 11 years of age; and 3) the findings are compatible with the deficient action of thyroid hormones in the developing brain caused by impaired transport to the target neural cells. PMID:25222753

  16. Molecular basis of thyroid hormone regulation of myelin basic protein gene expression in rodent brain.

    PubMed

    Farsetti, A; Mitsuhashi, T; Desvergne, B; Robbins, J; Nikodem, V M

    1991-12-01

    Regulation of myelin basic protein (MBP) gene expression by thyroid hormone has been investigated in rodent brain. Quantitation of the 4 major alternatively spliced transcripts by RNase protection assay showed that the individual mRNAs, corresponding to MBP isoforms 21.5, 18.5, 17, and 14 kDa, were decreased from 2- to 17-fold at all ages studied (4-60 days) in hypothyroid animals when compared to euthyroid, but the timing of onset of expression was not altered. MBP mRNA was also reduced in young adult rats thyroidectomized at the age of 5-6 weeks and was restored to normal by thyroxine administration. Nuclear run-off assays showed that the rate of MBP gene transcription is dependent on thyroid state. Co-transfection of MBP (-256/+1)-chloramphenicol acetyltransferase chimeric gene with a plasmid expressing thyroid hormone receptor alpha, and in the presence of 3,5,3'-triiodothyronine, into NIH3T3 or NG108-15, increased chloramphenicol acetyltransferase expression 4-fold. Using a footprinting technique and Spodoptera frugiperda 9 (Sf9) nuclear extract infected with baculovirus expressing TR alpha, we have identified a single DNA-binding site (-186/-163) for the receptor. A part of this region contains the AGGACA sequence found in thyroid hormone-responsive elements of other 3,5,3'-triiodothyronine-regulated genes. Our finding of a specific hormone-receptor interaction with the MBP promoter region is the first direct demonstration of a thyroid hormone-responsive element in a brain-specific gene. PMID:1720778

  17. Helodermin-like peptides in thyroid C cells: stimulation of thyroid hormone secretion and suppression of calcium incorporation into bone.

    PubMed Central

    Grunditz, T; Persson, P; Håkanson, R; Absood, A; Böttcher, G; Rerup, C; Sundler, F

    1989-01-01

    Helodermin is a vasoactive intestinal peptide-like peptide in the salivary gland venom of the lizard Heloderma suspectum. Helodermin-like immunofluorescence was observed in the parafollicular (C) cells in several mammals and in the C cell homologues of the chicken ultimobranchial gland. Thus, helodermin-like peptides coexist with calcitonin. The results of radioimmunoassay agreed with the immunocytochemical findings. HPLC of rat thyroid extracts revealed one major peak of helodermin-like immunoreactivity, which eluted in a position close to that of lizard helodermin. Helodermin stimulated basal thyroid hormone secretion and colloid droplet formation in conscious mice. The effect of large doses of helodermin was quite long-lasting and the maximal response occurred after 2-6 hr. In addition, helodermin suppressed the incorporation of calcium into bone in conscious rats. The findings suggest that helodermin-like peptides in C cells may be involved in the local regulation of thyroid hormone secretion and in the maintenance of calcium homeostasis. Images PMID:2645580

  18. [Therapeutic possibilities in patients with selective pituitary resistance to thyroid hormones].

    PubMed

    Iglesias, Pedro; Díez, Juan José

    2008-03-15

    Selective pituitary resistance to thyroid hormones (SPRTH) is a non-neoplastic form of inappropriate secretion of thyrotropin (TSH). The etiology of this hormonal resistance is linked to inactivating mutations in the thyroid hormone receptor beta (TR-beta) gene. These mutations affect critical portions of the receptor's triiodothyronine (T3)-binding domain. Clinically, SPRTH is characterized by hyperthyroidism with goiter and absence of pituitary mass in the morphologic study. Laboratory data show an elevation of free T3 and free thyroxine concentrations without suppression of TSH, with normal molar subunit alpha/TSH ratio. At this time, there is no specific therapy for SPRHT. Beta blockers, such as atenolol, and benzodiazepines have been used as a symptomatic therapy. Among the drugs with the capacity for reducing TSH secretion are TR agonists, such as triiodothyroacetic acid, D-thyroxine, triiodothyropropionic acid, and L-T3. PMID:18373914

  19. EVALUATION OF THYROID HORMONES AND AS INFLUENCED BY TREATMENT WITH DESLORELIN IN PALLAS' CATS (OTOCOLOBUS (FELIS) MANUL).

    PubMed

    Delaski, Kristina M; Gamble, Kathryn C

    2015-12-01

    Thyroid hormones regulate a variety of physiologic functions including metabolism, growth, and reproductive cycling, and these other hormones can impact the thyroid function via the hypothalamic-pituitary axis. For instance, the gonadotropin-releasing hormone agonist, deslorelin, used in nondomestic carnivores for contraception and behavioral control, down-regulates reproductive hormones through this mechanism and so may impact thyroid function. Due to clinical concerns of hypothyroidism in a bachelor group of adult male Pallas' cats (Otocolobus (Felis) manul) which also had deslorelin implants, serum samples from treated captive (n = 8) individuals, untreated captive (n = 25), and free-ranging (n = 9) individuals were analyzed for thyroid hormone concentrations. Total and free thyroxine (TT4 and FT4), total and free tri-iodothyronine (TT3 and FT3), and thyroid stimulating hormone (TSH) were measured although, due to sample volume limitations, not every hormone could be analyzed for every sample. Of these hormones, only FT4 was found statistically different between the deslorelin-treated and untreated groups. As samples were unevenly distributed across season, true comparison between seasons could not be made. The values reported for the untreated captive and free-ranging group, while representing a small sample size, can serve as a baseline assessment when evaluating the thyroid status of captive Pallas' cats. PMID:26667522

  20. Correlation between serum leptin level and thyroid hormones in children with major beta-thalassemia 

    PubMed Central

    Shahramian, I; Noori, NM; Ramezani, AA; Sharafi, E; Akhlaghi, E

    2013-01-01

    Background Beta-thalassemia is the most common hematology disease in human and leptin is one of the hormone that produce by adiposities cells. The purpose of this study was to investigate the relationship between serum leptin level and thyroid hormones in children with major beta-thalassemia. Materials and Methods This descriptive-cross sectional study was performed on 90 children aged 6-16 years old with beta-thalassemia. Body Mass Index (BMI ) were meuseurd in all patients and then, after collecting the samples, leptin and thyroid hormones levels of the serum were measured in the patients with thalassemia via ELISA method. Then, all data was analyzed by Pearson correlation test, and x2 statistical tests and P < 0.05 was considered as a significant difference. Results The mean of body mass index and serum leptin level in the patients group was 16.58±2.43 and 1.521 ±2. 49, respectively. The mean serum levels of thyroxin (T4), triiodothyronine (T3), and thyroid- stimulating hormone (TSH) in patient's groups were7.94 ±3.56, 1.28 ± 0.46, and 2.85 ±3. 44, respectively. There was significant correlation between serum leptin levels and T4 in patients with major thalassemia; also there was no significant correlation between serum leptin level and T3and TSH. There was a significant correlation was between the leptin serum level and BMI in patients (P value=0.008). Conclusion The results of this study demonstrated that in patients with major thalassemia, there was significant correlation between serum leptin level and thyroxin hormone. Leptin level has more relationship with thyroxin than thyroid- stimulating hormone. PMID:24575288

  1. Prenatal Thyroxine Treatment Disparately Affects Peripheral and Amygdala Thyroid Hormone Levels

    PubMed Central

    Shukla, Pradeep K.; Sittig, Laura J.; Andrus, Brian M.; Schaffer, Daniel J.; Batra, Kanchi K.; Redei, Eva E.

    2009-01-01

    Summary A prenatal hypothyroid state is associated with behavioral abnormalities in adulthood. Wistar–Kyoto (WKY) rats exhibit hypothyroidism and increased depressive and anxiety-like behaviors. Thus, the WKY could illuminate the mechanisms by which the reversal of developmental hypothyroidism in humans and animals results in adult behavioral improvement. We examined the outcome of maternal thyroxine (T4) treatment on thyroid hormone-regulated functions and adult behavior of the WKY offspring. Pregnant WKY dams completed gestation with and without T4 administration and their adult male offspring were tested. Measures included depressive and anxiety-like behaviors, and thyroid hormone (TH) concentrations in both plasma and specific brain regions. In addition, the expression of two proteins affecting thyroid hormone trafficking and metabolism, monocarboxylate transporter 8 (MCT-8) and iodothyronine deiodinase type III (Dio3), and of several behavior-altering molecules, glucocorticoid receptor (GR), prepro-thyrotropin releasing hormone (prepro-TRH) and corticotrophin releasing hormone (CRH), were determined in the hippocampus and amygdala of the offspring. Prenatal T4 treatment of WKYs did not affect adult depressive behavior but increased anxiety-like behavior and decreased plasma levels of THs. In the hippocampus of males treated with T4 in utero, Dio3 and MCT-8 protein levels were increased, while in the amygdala, there were increases of free T4, MCT-8, GR, prepro-TRH protein and CRH mRNA levels. These results show that T4 administration in utero programs adult peripheral and amygdalar thyroid hormone levels divergently, and that the resulting upregulation of anxiety-related genes in the amygdala could be responsible for the exacerbated anxiety-like behavior seen in WKYs after prenatal T4 treatment. PMID:20005050

  2. Thyrotropin-releasing hormone accelerates fetal mouse lung ultrastructural maturation via stimulation of extra thyroidal pathway.

    PubMed

    Ansari, M A; Demello, D E; Polk, D H; Devaskar, U P

    1997-11-01

    Maternal administration of TSH-releasing hormone (TRH) in the euthyroid mouse accelerates fetal lung ultrastructural maturation. However, the mechanism(s) of TRH in fetal lung development remains unclear; it could be due to its neuroendocrine and/or neurotransmitter effects. Although the neuroendocrine effect of TRH is mediated via stimulation of the fetal pituitary-thyroid axis, the neurotransmitter effect is mediated via stimulation of fetal autonomic nervous system activity. In the hyt/hyt mouse there is a point mutation in the beta subunit of the TSH receptor in the thyroid gland of the Balb-c mouse. In these mice TSH does not bind to its receptors, leading ultimately to the development of primary hypothyroidism, which is transmitted as an autosomal recessive trait. A maturational delay in the lung ultrastructure of the hyt/hyt mouse fetus has been observed. This investigation was undertaken to study the effect of maternal TRH treatment on lung ultrastructural maturation in the hyt/hyt mouse fetus. If the effect of TRH is mediated via stimulation of fetal pituitary-thyroid axis, TRH treatment should not enhance lung maturity in the hyt/hyt fetus and vice versa. Adult hyt/hyt mice made euthyroid by triiodothyronine supplementation were mated to carry hyt/hyt pups. Saline or TRH (0.4 or 0.6 mg/kg/dose) was administered to the mother (i.p.) on d 16 and 17 (b.i.d.) and on d 18 of pregnancy 1 h before killing (term, approximately 20 d). The fetal lung electron micrographs were subjected to ultrastructural morphometric analysis of the number of lamellar bodies and glycogen/nuclear ratio in type II cells, and the alveolar/parenchymal ratio by Chalkley point counting with an interactive computerized image analyzer (Optimas, Bioscan). Fetal lungs exposed to the lower dose of TRH (n = 7) showed no significant difference in their ultrastructural maturation when compared with saline-treated controls (n = 5). However, fetal lungs exposed to a higher dose of TRH (n = 6

  3. The role of polyhalogenated aromatic hydrocarbons on thyroid hormone disruption and cognitive function: a review.

    PubMed

    Builee, T L; Hatherill, J R

    2004-11-01

    Thyroid hormones (TH) are essential to normal brain development, influencing behavior and cognitive function in both adult and children. It is suggested that conditions found in TH abnormalities such as hypothyroidism, hyperthyroidism and generalized resistance to thyroid hormone (GRTH) share symptomatic behavioral impulses found in cases of attention deficit hyperactivity disorder (ADHD) and other cognitive disorders. Disrupters of TH are various and prevalent in the environment. This paper reviews the mechanisms of TH disruption caused by the general class of polyhalogenated aromatic hydrocarbons (PHAH)'s acting as thyroid disrupters (TD). PHAHs influence the hypothalamus-pituitary-thyroid (HPT) axis, as mimicry agents affecting synthesis and secretion of TH. Exposure to PHAH induces liver microsomal enzymes UDP-glucuronosyltransferase (UGT) resulting in accelerated clearance of TH. PHAHs can compromise function of transport and receptor binding proteins such as transthyretin and aryl hydrocarbon receptors (Ahr). Glucose metabolism and catecholamine synthesis are disrupted in the brain by the presence of PHAH. Further, PHAH can alter brain growth and development by perturbing cytoskeletal formation, thereby affecting neuronal migration, elongation and branching. The complex relationships between PHAH and cognitive function are examined in regard to the disruption of T4 regulation in the hypothalamus-pituitary-thyroid axis, blood, brain, neurons, liver and pre and postnatal development. PMID:15573475

  4. Culture of hormone-dependent functional epithelial cells from rat thyroids.

    PubMed Central

    Ambesi-Impiombato, F S; Parks, L A; Coon, H G

    1980-01-01

    Primary cultures of rat thyroid cells were made in medium supplemented with 0.1--0.5% calf serum and containing six hormones or growth factors: insulin, thyrotropin, transferrin, hydrocortisone, somatostatin, and glycyl-L-histidyl-L-lysine acetate. The FRTL strain was purified by successive colonial isolations and was found to maintain highly differentiated features (secretion into the culture medium of physiological amounts of thyroglobulin and concentration of iodide by 100-fold). The FRTL strain has been observed for more than 3 years in continuous culture. It has maintained the same biochemical and morphological characteristics that typified the primary cultures of thyroid follicular cells immediately after their enzymatic release from the rat thyroid. Thyroid epithelial cells that were grown under more conventional cell culture conditions failed to retain these specialized characteristics. We show that maintenance in vitro of these specialized functions of rat thyroid follicular cells is dependent on low serum concentrations and supplementation with hormones in the primary cultures. Our observations indicate that this culture strategem may be aplicable to the general problem of maintenance of differentiated characteristics in cultures of other epithelial cells. Images PMID:6106191

  5. Thyroid hormone-dependent epigenetic suppression of herpes simplex virus-1 gene expression and viral replication in differentiated neuroendocrine cells.

    PubMed

    Figliozzi, Robert W; Chen, Feng; Balish, Matthew; Ajavon, Amakoe; Hsia, S Victor

    2014-11-15

    A global HSV-1 gene repression occurs during latency in sensory neurons where most viral gene transcriptions are suppressed. The molecular mechanisms of gene silencing and how stress factors trigger the reactivation are not well understood. Thyroid hormones are known to be altered due to stress, and with its nuclear receptor impart transcriptional repression or activation depending upon the hormone level. Therefore we hypothesized that triiodothyronine (T3) treatment of infected differentiated neuron like cells would reduce the ability of HSV-1 to produce viral progeny compared to untreated infected cells. Previously we identified putative thyroid hormone receptor elements (TREs) within the promoter regions of HSV-1 thymidine kinase (TK) and other key genes. Searching for a human cell line that can model neuronal HSV-1 infection, we performed HSV-1 infection experiments on differentiated human neuroendocrine cells, LNCaP. Upon androgen deprivation these cells undergo complete differentiation and exhibit neuronal-like morphology and physiology. These cells were readily infected by our HSV-1 recombinant virus, expressing GFP and maintaining many processes iconic of dendritic morphology. Our results demonstrated that differentiated LNCaP cells produced suppressive effects on HSV-1 gene expression and replication compared to its undifferentiated counterpart and T3 treatment has further decreased the viral plaque counts compared to untreated cells. Upon washout of the T3 viral plaque counts were restored, indicating an increase of viral replication. The qRT-PCR experiments using primers for TK showed reduced expression under T3 treatment. ChIP assays using a panel of antibodies for H3 lysine 9 epigenetic marks showed increased repressive marks on the promoter regions of TK. In conclusion we have demonstrated a T3 mediated quiescent infection in differentiated LNCaP cells that has potential to mimic latent infection. In this HSV-1 infection model thyroid hormone

  6. Thyroid Hormone-dependent Epigenetic Suppression of Herpes Simplex Virus-1 Gene Expression and Viral Replication in Differentiated Neuroendocrine Cells

    PubMed Central

    Figliozzi, Robert W.; Chen, Feng; Balish, Matthew; Ajavon, Amakoe; Hsia, S. Victor

    2014-01-01

    A global HSV-1 gene repression occurs during latency in sensory neurons where most viral gene transcriptions are suppressed. The molecular mechanisms of gene silencing and how stress factors trigger the reactivation are not well understood. Thyroid hormones are known to be altered due to stress, and with its nuclear receptor impart transcriptional repression or activation depending upon the hormone level. Therefore we hypothesized that triiodothyronine (T3) treatment of infected differentiated neuron like cells would reduce the ability of HSV-1 to produce viral progeny compared to untreated infected cells. Previously we identified putative thyroid hormone receptor elements (TREs) within the promoter regions of HSV-1 thymidine kinase (TK) and other key genes. Searching for a human cell line that can model neuronal HSV-1 infection, we performed HSV-1 infection experiments on differentiated human neuroendocrine cells, LNCaP. Upon androgen deprivation these cells undergo complete differentiation and exhibit neuronal-like morphology and physiology. These cells were readily infected by our HSV-1 recombinant virus, expressing GFP and maintaining many processes iconic of dendritic morphology. Our results demonstrated that differentiated LNCaP cells produced suppressive effects on HSV-1 gene expression and replication compared to its undifferentiated counterpart and T3 treatment have further decreased the viral plaque counts compared to untreated cells. Upon washout of the T3 viral plaque counts were restored, indicating an increase of viral replication. The qRT-PCR experiments using primers for TK showed reduced expression under T3 treatment. ChIP assays using a panel of antibodies for H3 lysine 9 epigenetic marks showed increased repressive marks on the promoter regions of TK. In conclusion we have demonstrated a T3 mediated quiescent infection in differentiated LNCaP cells that has potential to mimic latent infection. In this HSV-1 infection model thyroid hormone

  7. A review of the peripheral levels of regulation by thyroid hormone.

    PubMed

    Little, Alexander G

    2016-08-01

    Thyroid hormone (TH) regulates many physiological processes that differ between tissues, developmental stages and in response to specific environmental cues. It can therefore play very different signaling roles depending on specific physiological contexts. Much progress has been made in resolving mechanisms for TH signaling over the past 2 decades, and there has been increasing emphasis on the role of peripheral levels of regulation in determining ultimate TH action. This progress has revealed a complex regulatory network, where TH bioavailability and bioactivity are peripherally regulated by sometimes subtle mechanisms at various levels of organization, including membrane receptors and transporters on the cell surface, intracellular deiodinase enzymes, thyroid receptor isoforms and cytosolic thyroid hormone binding proteins, and via accessibility and subtypes of thyroid hormone response elements in the promoters of target genes. The majority of this research comes from disease models, and so the biological relevance of each of these regulatory levels has not been comprehensively explored. This review synthesizes what is known of these local levels of TH regulation, with particular focus on their functional roles in regulating animal response to environmental cues. While thorough analysis for all of these regulatory levels in any one study is currently unrealistic, an appreciation for their collective importance is necessary to frame comparative analyses in a relevant context. This is important because common biomarkers for TH action can have very different meanings, not only for different tissues, but also for individuals, populations and species from different developmental or environmental backgrounds. PMID:27062031

  8. Thyroid hormones in conditions of chronic malnutrition. A study with special reference to cancer cachexia.

    PubMed Central

    Persson, H; Bennegård, K; Lundberg, P A; Svaninger, G; Lundholm, K

    1985-01-01

    Circulating levels of thyroid hormones (T4, free T4, T3) and reverse tri-iodo thyronine (rT3) and thyroid-hormone binding globulin were related to the nutritional state of patients with cancer cachexia, patients with malnutrition due to other reasons and to well-nourished patients with acute illness. Hospitalized weight-stable and well-nourished patients served as controls. Malnourished patients with or without cancer and acutely ill patients had a low T3 syndrome involving both peripheral metabolism of thyroid hormones and the hypothalamus-pituitary-thyroid gland axis. T3 levels were correlated to altered protein metabolism and protein nutritional state. There were pronounced elevations of circulating rT3 concentrations in patients with serum albumin concentration less than 35 g/l irrespective of diagnosis. The results indicate that the low T3 syndrome in our patients is secondary to insufficient caloric intake. It seems to be maintained by the abnormal nutritional state and is related closely to protein metabolism. The authors found no differences between the low T3 syndrome in cancer patients suffering from cachexia compared with that of patients with malnutrition caused by other factors. PMID:3917657

  9. Halogenated organic contaminants and their correlations with circulating thyroid hormones in developing Arctic seabirds.

    PubMed

    Nøst, Therese Haugdahl; Helgason, Lisa Bjørnsdatter; Harju, Mikael; Heimstad, Eldbjørg S; Gabrielsen, Geir Wing; Jenssen, Bjørn Munro

    2012-01-01

    Thyroid hormones are essential for normal growth and development and disruption of thyroid homeostasis can be critical to young developing individuals. The aim of the present study was to assess plasma concentrations of halogenated organic contaminants (HOCs) in chicks of two seabird species and to investigate possible correlations of HOCs with circulating thyroid hormone (TH) concentrations. Plasma from black-legged kittiwake (Rissa tridactyla) and northern fulmar (Fulmarus glacialis) chicks were sampled in Kongsfjorden, Svalbard in 2006. The samples were analyzed for thyroid hormones and a wide range of HOCs (polychlorinated biphenyls (PCBs), hydroxylated (OH-) and methylsulphoned (MeSO-) PCB metabolites, organochlorine pesticides (OCPs), brominated flame retardants (BFRs), and perfluorinated compounds (PFCs)). Concentrations of HOCs were generally low in kittiwake and fulmar chicks compared to previous reports. HOC concentrations were five times higher in fulmar chicks compared to in kittiwake chicks. PFCs dominated the summed HOCs concentrations in both species (77% in kittiwakes and 69% in fulmars). Positive associations between total thyroxin (TT4) and PFCs (PFHpS, PFOS, PFNA) were found in both species. Although correlations do not implicate causal relationships per se, the correlations are of concern as disruption of TH homeostasis may cause developmental effects in young birds. PMID:22154184

  10. Intracellular Inactivation of Thyroid Hormone Is a Survival Mechanism for Muscle Stem Cell Proliferation and Lineage Progression

    PubMed Central

    Dentice, Monica; Ambrosio, Raffaele; Damiano, Valentina; Sibilio, Annarita; Luongo, Cristina; Guardiola, Ombretta; Yennek, Siham; Zordan, Paola; Minchiotti, Gabriella; Colao, Annamaria; Marsili, Alessandro; Brunelli, Silvia; Del Vecchio, Luigi; Larsen, P. Reed; Tajbakhsh, Shahragim; Salvatore, Domenico

    2014-01-01

    Summary Precise control of the thyroid hormone (T3)-dependent transcriptional program is required by multiple cell systems, including muscle stem cells. Deciphering how this is achieved and how the T3 signal is controlled in stem cell niches is essentially unknown. We report that in response to proliferative stimuli such as acute skeletal muscle injury, type 3 deiodinase (D3), the thyroid hormone-inactivating enzyme, is induced in satellite cells where it reduces intracellular thyroid signaling. Satellite cell-specific genetic ablation of dio3 severely impairs skeletal muscle regeneration. This impairment is due to massive satellite cell apoptosis caused by exposure of activated satellite cells to the circulating TH. The execution of this proapoptotic program requires an intact FoxO3/MyoD axis, both genes positively regulated by intracellular TH. Thus, D3 is dynamically exploited in vivo to chronically attenuate TH signaling under basal conditions while also being available to acutely increase gene programs required for satellite cell lineage progression. PMID:25456740

  11. In Silico Approach To Identify Potential Thyroid Hormone Disruptors among Currently Known Dust Contaminants and Their Metabolites.

    PubMed

    Zhang, Jin; Kamstra, Jorke H; Ghorbanzadeh, Mehdi; Weiss, Jana M; Hamers, Timo; Andersson, Patrik L

    2015-08-18

    Thyroid hormone disrupting chemicals (THDCs) interfere with the thyroid hormone system and may induce multiple severe physiological disorders. Indoor dust ingestion is a major route of THDCs exposure in humans, and one of the molecular targets of these chemicals is the hormone transporter transthyretin (TTR). To virtually screen indoor dust contaminants and their metabolites for THDCs targeting TTR, we developed a quantitative structure-activity relationship (QSAR) classification model. The QSAR model was applied to an in-house database including 485 organic dust contaminants reported from literature data and their 433 in silico derived metabolites. The model predicted 37 (7.6%) dust contaminants and 230 (53.1%) metabolites as potential TTR binders. Four new THDCs were identified after testing 23 selected parent dust contaminants in a radio-ligand TTR binding assay; 2,2',4,4'-tetrahydroxybenzophenone, perfluoroheptanesulfonic acid, 3,5,6-trichloro-2-pyridinol, and 2,4,5-trichlorophenoxyacetic acid. These chemicals competitively bind to TTR with 50% inhibition (IC50) values at or below 10 μM. Molecular docking studies suggested that these THDCs interacted similarly with TTR via the residue Ser117A, but their binding poses were dissimilar to the endogenous ligand T4. This study identified new THDCs using an in silico approach in combination with bioassay testing and highlighted the importance of metabolic activation for TTR binding. PMID:26207645

  12. Site-specific basicities regulate molecular recognition in receptor binding: in silico docking of thyroid hormones.

    PubMed

    Tóth, Gergő; Baska, Ferenc; Schretner, András; Rácz, Akos; Noszál, Béla

    2013-09-01

    Interactions between thyroid hormone α and β receptors and the eight protonation microspecies of each of the main thyroid hormones (thyroxine, liothyronine, and reverse liothyronine) were investigated and quantitated by molecular modeling. Flexible docking of the various protonation forms of thyroid hormones and high-affinity thyromimetics to the two thyroid receptors was carried out. In this method the role of the ionization state of each basic site could be studied in the composite process of molecular recognition. Our results quantitate at the molecular level how the ionization state and the charge distribution influence the protein binding. The anionic form of the carboxyl group (i.e., carboxylate site) is essential for protein binding, whereas the protonated form of amino group worsens the binding. The protonation state of the phenolate plays a less important role in the receptor affinity; its protonation, however, alters the electron density and the concomitant stacking propensity of the aromatic rings, resulting in a different binding score. The combined results of docking and microspeciation studies show that microspecies with the highest concentration at the pH of blood are not the strongest binding ones. The calculated binding free energy values can be well interpreted in terms of the interactions between the actual sites of the microspecies and the receptor amino acids. Our docking results were validated and compared with biological data from the literature. Since the thyroid hormone receptors influence several physiologic functions, such as metabolic rate, cholesterol and triglyceride levels, and heart frequency, our binding results provide a molecular basis for drug design and development in related therapeutic indications. PMID:23907234

  13. Associations between brominated flame retardants in human milk and Thyroid-Stimulating Hormone (TSH) in neonates

    PubMed Central

    Eggesbø, Merete; Thomsen, Cathrine; Jørgensen, Jens V.; Becher, Georg; Odland, Jon Øyvind; Longnecker, Matthew P.

    2011-01-01

    Background Brominated flame retardants (BFRs) have been in widespread use in a vast array of consumer products since the 1970s. The metabolites of some BFRs show a structural similarity to thyroid hormones and experimental animal studies have confirmed that they may interfere with thyroid hormone homeostasis. A major concern has been whether intrauterine exposure to BFRs may disturb thyroid homeostasis since the fetal brain is particularly susceptible to alterations in thyroid hormones. However, few reports on newborns have been published to date. Objectives To evaluate the association between BFRs and neonatal thyroid-stimulating hormone (TSH). Methods We studied six polybrominated diphenyl ethers (PBDEs) measured in milk samples from 239 women who were part of the “Norwegian Human Milk Study” (HUMIS), 2003–2006. Hexabromocyclododecane (HBCD) and BDE-209 were measured in a subset of the women (193 and 46 milk samples, respectively). The milk was sampled at a median of 33 days after delivery. TSH was measured in babies three days after delivery as part of the routine national screening program for early detection of congenital hypothyroidism. Additional information was obtained through the Medical Birth Registry and questionnaires to the mothers. Results The PBDE concentrations in human milk in Norway were comparable to concentrations reported from other European countries and Asia, but not the US and Canada where levels are approximately one order of magnitude higher. We observed no statistically significant associations between BDE-47, 99, 153, 154, 209 and HBCD in human milk and TSH in models adjusted for possible confounders and other environmental toxicants including polychlorinated biphenyls (PCBs). Conclusions We did not observe an association between TSH and exposure to HBCD and PBDEs within the exposure levels observed. PMID:21601188

  14. Molecular cloning and properties of a full-length putative thyroid hormone receptor coactivator.

    PubMed

    Takeshita, A; Yen, P M; Misiti, S; Cardona, G R; Liu, Y; Chin, W W

    1996-08-01

    Thyroid hormone receptors (TRs) are ligand-dependent transcription factors that regulate target gene transcription. The conserved carboxy-terminal region of the ligand-binding domain (AF-2) has been thought to play a critical role in mediating ligand-dependent transactivation by the interaction with coactivator(s). Using bacterially-expressed TR as a probe, far-Western-based expression cDNA library screening identified cDNAs that encode, in part, the recently reported partial steroid receptor coactivator-1 (SRC-1) sequence. Additional work, including 5' RACE, has characterized a full-length cDNA that encodes a approximately 160 kD protein as a putative thyroid hormone receptor coactivator (F-SRC-1). In vitro binding studies show that F-SRC-1 binds to a variety of nuclear hormone receptors in a ligand-dependent manner, along with TBP and TFIIB, suggesting that F-SRC-1 may play a role as a bridging molecule between nuclear hormone receptors and general transcription factors. Interestingly, AF-2 mutants also retain ligand-dependent interaction with F-SRC-1. Although F-SRC-1 recognizes the ligand-induced conformational changes of nuclear hormone receptors, our observations suggest that F-SRC-1 may bind directly with subregion(s) in nuclear hormone receptors other than the AF-2 region. PMID:8754792

  15. Measurement of free thyroid hormones in serum by column adsorption chromatography and radioimmunoassay.

    PubMed

    Romelli, P B; Pennisi, F; Vancheri, L

    1979-01-01

    A new method for the assay of free thyroid hormones in human serum is described. This method is based on a chromatographic adsorption process of thyroid hormones onto a Sephadex LH-20 resin column. Protein fractions are eliminated by washing columns, adsorbed hormones are eluted with methanol and determined by radioimmunoassay. It was demonstrated that under the experimental conditions adopted the presence of the resin R does not significantly change the free hormone level in the serum, and the amount of hormone adsorbed onto the resin HR is exclusively in function of the free hormone concentration [H], according to a linear relationship: HR = phi [H], where phi is the resin adsorption constant K ads multiplied by the number of resin binding sites nR. The phi value, experimentally determined, was 32 ml for T3 and 58 ml for T4, when 150 mg resin were used. The method sensitivity was 0.3 pg/ml for FT3 and 0.6 pg/ml for FT4. The within-assay reproducibility was about 5% (CV) and the between-assay reproducibility was about 6% (CV), both for FT3 and FT4. FT3 and FT4 levels, in 96 normal subjects, were 3.9 +/- 0.7 pg/ml (mean +/- SD) and 11.1 +/- 1.9 pg/ml (mean +/- SD) respectively. PMID:489914

  16. Effects on thyroid hormone metabolism and depletion of lung vitamin A in rats by airborne particulate matter

    SciTech Connect

    Heussen, G.A.; Schefferlie, G.J.; Talsma, M.J.; van Til, H.; Dohmen, M.J.; Brouwer, A.; Alink, G.M. )

    1993-04-01

    Thyroxine (T4) and vitamin A are important regulators of normal epithelial differentiation and proliferation and might act in the promotion phase of carcinogenesis. Thyroid hormone and vitamin A metabolism are linked by a common plasma carrier protein, transthyretin (TTR). Polychlorinated biphenyls (PCBs) and related organochlorine compounds deplete vitamin A and thyroxine by interaction with TTR and alteration of their metabolism in hepatic and other organs. In the present report an outdoor airborne particulate matter (APM) extract was tested for both interaction with thyroid hormone and vitamin A metabolism, in order to address the question of whether APM has the potency to deplete vitamin A and thyroid hormones. Furthermore, studies were performed to characterize compounds present in APM that interact with TTR. A third aim was to compare the interaction of APM extracts with TTR and thyroxine-binding globulin (TBG), the major carrier protein for thyroxine in humans. Results showed that a single treatment of rats with an outdoor APM extract depleted plasma thyroxine and triiodothyronine levels and increased plasma retinol levels gradually over the time period studied, while liver retinol, lung retinol, and retinyl palmitate levels were depleted by 30-50%. As outdoor APM was able to inhibit T4-TTR binding in vitro, this suggests that the reduction in thyroxine levels in vivo is caused by the same phenomenon. Experiments showed that the neutral fraction of the APM extract accounted for most of the inhibitory activity on T4-TTR binding. Polycyclic aromatic hydrocarbons and nitrated derivatives are not likely to be responsible for the activity of the neutral fraction, because several representatives of these compounds showed no or very little interaction with TTR. Pentachlorophenol, a compound with known inhibitory activity on T4-TTR binding, was detected in the organic acid fraction of both a cigarette smoke sample and an outdoor APM sample.

  17. Effects of experimentally manipulated yolk thyroid hormone levels on offspring development in a wild bird species.

    PubMed

    Ruuskanen, Suvi; Darras, Veerle M; Visser, Marcel E; Groothuis, Ton G G

    2016-05-01

    Maternal effects are a crucial mechanism in a wide array of taxa to generate phenotypic variation, thereby affecting offspring development and fitness. Maternally derived thyroid hormones (THs) are known to be essential for offspring development in mammalian and fish models, but have been largely neglected in avian studies, especially in respect to natural variation and an ecological context. We studied, for the first time in a wild species and population, the effects of maternally derived THs on offspring development, behavior, physiology and fitness-related traits by experimental elevation of thyroxine and triiodothyronine in ovo within the physiological range in great tits (Parus major). We found that elevated yolk TH levels had a sex-specific effect on growth, increasing male and decreasing female growth, relative to controls, and this effect was similar throughout the nestling period. Hatching or fledging success, motor coordination behavior, stress reactivity and resting metabolic rate were not affected by the TH treatment. We conclude that natural variation in maternally derived THs may affect some offspring traits in a wild species. As this is the first study on yolk thyroid hormones in a wild species and population, more such studies are needed to investigate its effects on pre-hatching development, and juvenile and adult fitness before generalizations on the importance of maternally derived yolk thyroid hormones can be made. However, this opens a new, interesting avenue for further research in the field of hormone mediated maternal effects. PMID:27056104

  18. Age-related changes in thyroid hormone levels of bonobos and chimpanzees indicate heterochrony in development.

    PubMed

    Behringer, Verena; Deschner, Tobias; Murtagh, Róisín; Stevens, Jeroen M G; Hohmann, Gottfried

    2014-01-01

    We present information on age related changes of thyroid hormone levels in bonobos (N = 96) and chimpanzees (N = 100) ranging between one and 56 years of age. Fresh urine samples were used for hormone measurements with a commercial competitive total triiodothyronine (T3) ELISA. In both species, immature individuals had higher TT3 levels than adults and there was a marked decrease in TT3 levels between age classes. The two species differed in terms of the timing of TT3 level changes, with chimpanzees experiencing a significant decline in TT3 levels after 10 years of age and bonobos after 20 years of age. The decline of TT3 in chimpanzees appears to coincide with the time when somatic growth terminates while TT3 values in bonobos decrease much later. This temporal asymmetry in urinary thyroid hormone levels indicates heterochrony in the ontogenetic changes of the two sister species and developmental delay in bonobos. The prolongation of high TT3 levels in bonobos, which is characteristic of immatures of both Pan species may affect the behavior of bonobos; namely, the low intensity of aggression they display. Given that developmental studies are often based on post-mortem analyses of skeletons, measures of urinary thyroid hormones offer a non-invasive tool for exploring ontogenetic changes in living wild and captive hominoids. PMID:24275194

  19. Serum Vitamin B12 and thyroid hormone levels in Saudi patients with multiple sclerosis

    PubMed Central

    Al-Khamis, Fahd A.

    2016-01-01

    Objectives: To determine the relationship between Vitamin B12 levels and thyroid hormones in patients with multiple sclerosis (MS). Materials and Methods: One hundred and ten patients with MS were recruited for this study after Institutional Review Board approval. All patients signed a written informed consent form and donated a single blood sample. Plasma Vitamin B12 levels, triiodothyronine (T3), and thyroxine (T4) hormone levels were measured. Data were analyzed using the Statistical Package for Social Sciences (SPSS) software. Results: Analysis of Vitamin B12 levels in 110 patients with MS revealed that 65% had normal levels of Vitamin B12 (200–900 pg/ml), 30% had low levels of Vitamin B12 (<200 pg/ml), and 5% high levels of Vitamin B12 (higher than 900 pg/ml). Further analysis of patients with low levels of Vitamin B12 revealed that this cohort exhibited a significantly high number of patients with low levels of the thyroid hormones triiodothyronine (T3) and thyroxine (T4) (P < 0.005). Conclusion: This study suggests a relationship between Vitamin B12 levels and thyroid hormones. This opens the possibility that the use of therapies that increase triiodothyronine (T3) and thyroxine (T4) levels might be beneficial to patients with MS. PMID:27625581

  20. POSSIBLE MECHANISMS OF THYROID HORMONE DISRUPTION IN MICE BY BDE 47, A MAJOR POLYBROMINATED DIPHENYL ETHER CONGENER

    EPA Science Inventory

    ABSTRACT Polybromindated diphenyl ethers (PBDEs) are a class of polyhalogenated aromatic compounds commercially used as fire retardants in consumer products. These compounds have been shown to decrease thyroid hormone concentrations in rodents after acute exposures. Based on t...

  1. Thyroid hormones correlate with field metabolic rate in ponies, Equus ferus caballus.

    PubMed

    Brinkmann, Lea; Gerken, Martina; Hambly, Catherine; Speakman, John R; Riek, Alexander

    2016-08-15

    During winter, free-living herbivores are often exposed to reduced energy supply at the same time that energy needs for thermoregulation increase. Several wild herbivores as well as robust horse breeds reduce their metabolism during times of low ambient temperature and food shortage. Thyroid hormones (THs) affect metabolic intensity and a positive effect of THs on basal metabolic rate (BMR) has been demonstrated in mammals and birds. As BMR and field metabolic rate (FMR) are often assumed to be intrinsically linked, THs may represent a reliable indicator for FMR. To test this hypothesis, 10 Shetland pony mares were kept under semi-extensive central European conditions. During the winter season, one group was fed 60% and one group 100% of their maintenance energy requirements. We measured FMR, locomotor activity, resting heart rate and TH levels in summer and winter. FMR, locomotor activity, resting heart rate and total T3 concentrations decreased substantially in winter compared with summer, whereas total T4 increased. Food restriction led to a reduced FMR and resting heart rate, while THs and locomotor activity were not affected. Across both seasons, FMR, resting heart rate and locomotor activity were positively correlated with total T3 but negatively and more weakly correlated with total T4. PMID:27312472

  2. Thyroid function tests

    MedlinePlus

    ... free T4 (the main thyroid hormone in your blood) TSH (the hormone from the pituitary gland that stimulates the thyroid to produce T4) T3 (also included sometimes) Other thyroid tests include: T3 resin uptake Thyroid scan

  3. The Role of the Multiple Hormonal Dysregulation in the Onset of “Anemia of Aging”: Focus on Testosterone, IGF-1, and Thyroid Hormones

    PubMed Central

    Maggio, Marcello; De Vita, Francesca; Fisichella, Alberto; Lauretani, Fulvio; Ticinesi, Andrea; Ceresini, Graziano; Cappola, Anne; Ferrucci, Luigi; Ceda, Gian Paolo

    2015-01-01

    Anemia is a multifactorial condition whose prevalence increases in both sexes after the fifth decade of life. It is a highly represented phenomenon in older adults and in one-third of cases is “unexplained.” Ageing process is also characterized by a “multiple hormonal dysregulation” with disruption in gonadal, adrenal, and somatotropic axes. Experimental studies suggest that anabolic hormones such as testosterone, IGF-1, and thyroid hormones are able to increase erythroid mass, erythropoietin synthesis, and iron bioavailability, underlining a potential role of multiple hormonal changes in the anemia of aging. Epidemiological data more consistently support an association between lower testosterone and anemia in adult-older individuals. Low IGF-1 has been especially associated with anemia in the pediatric population and in a wide range of disorders. There is also evidence of an association between thyroid hormones and abnormalities in hematological parameters under overt thyroid and euthyroid conditions, with limited data on subclinical statuses. Although RCTs have shown beneficial effects, stronger for testosterone and the GH-IGF-1 axis and less evident for thyroid hormones, in improving different hematological parameters, there is no clear evidence for the usefulness of hormonal treatment in improving anemia in older subjects. Thus, more clinical and research efforts are needed to investigate the hormonal contribution to anemia in the older individuals. PMID:26779261

  4. Thyroid hormones and their membrane receptors as therapeutic targets for T cell lymphomas.

    PubMed

    Cremaschi, Graciela A; Cayrol, Florencia; Sterle, Helena Andrea; Díaz Flaqué, María Celeste; Barreiro Arcos, María Laura

    2016-07-01

    Thyroid hormones (THs) are important regulators of metabolism, differentiation and cell proliferation. They can modify the physiology of human and murine T cell lymphomas (TCL). These effects involve genomic mechanisms, mediated by specific nuclear receptors (TR), as well as nongenomic mechanisms, that lead to the activation of different signaling pathways through the activation of a membrane receptor, the integrin αvβ3. Therefore, THs are able to induce the survival and growth of TCL. Specifically, the signaling induced by THs through the integrin αvβ3 activates proliferative and angiogenic programs, mediated by the regulation of the vascular endothelial growth factor (VEGF). The genomic or pharmacologic inhibition of integrin αvβ3 reduces the production of VEGF and induces cell death both in vitro and in xenograft models of human TCL. Here we review the mechanisms involved in the modulation of the physiology of TCL induced by THs, the analysis of the interaction between genomic and nongenomic actions of THs and their contribution to T cell lymphomagenesis. These actions of THs suggest a novel mechanism for the endocrine modulation of the physiopathology of TCL and they provide a potential molecular target for its treatment. PMID:26855318

  5. Inherited defects in thyroid hormone cell-membrane transport and metabolism

    PubMed Central

    Fu, Jiao

    2013-01-01

    The description of two novel human defects in the last ten years has uncovered new aspects of thyroid hormone physiology with regard to cellular-membrane transport and intracellular metabolism. Mutations in the X-linked monocarboxylate transporter 8 (MCT8) gene result in an invalidating neurodevelopmental phenotype in males and pathognomonic thyroid functions tests with high T3, low rT3, low or low normal T4, and normal or slightly high TSH. Recessive mutations in the selenocysteine insertion sequence binding protein 2 (SBP2) gene present a variable clinical phenotype depending on the severity of the defect and its consequences on the selenoprotein hierarchy. Most characteristic is the thyroid phenotype of low serum T3, high T4, high rT3, and slightly elevated TSH levels. Herein we review all known cases of MCT8 and SBP2 deficiency and describe each disease in terms of the clinical, biochemical, genetic, and therapeutic aspects. PMID:24629861

  6. Urinary iodine and stable isotope analysis to examine habitat influences on thyroid hormones among coastal dwelling American alligators.

    PubMed

    Boggs, Ashley S P; Hamlin, Heather J; Nifong, James C; Kassim, Brittany L; Lowers, Russell H; Galligan, Thomas M; Long, Stephen E; Guillette, Louis J

    2016-01-15

    The American alligator, generally a freshwater species, is known to forage in marine environments despite the lack of a salt secreting gland found in other crocodylids. Estuarine and marine foraging could lead to increased dietary uptake of iodine, a nutrient necessary for the production of thyroid hormones. To explore the influence of dietary iodine on thyroid hormone health of coastal dwelling alligators, we described the seasonal plasma thyroxine and triiodothyronine concentrations measured by radioimmunoassay and urinary iodine (UI) concentrations measured by inductively coupled plasma mass spectrometry. We also analyzed long-term dietary patterns through stable isotope analysis of scute tissue. Snout-to-vent length (SVL) was a significant factor among UI and stable isotope analyses. Large adult males greater than 135cm SVL had the highest UI concentrations but did not display seasonality of thyroid hormones. Alligators under 135 SVL exhibited seasonality in thyroid hormones and a positive relationship between UI and triiodothyronine concentrations. Isotopic signatures provided supporting evidence that large males predominantly feed on marine/estuarine prey whereas females showed reliance on freshwater/terrestrial prey supplemented by marine/estuarine prey. UI measurement provided immediate information that correlated to thyroid hormone concentrations whereas stable isotope analysis described long-term dietary patterns. Both techniques demonstrate that adult alligators in coastal environments are utilizing estuarine/marine habitats, which could alter thyroid hormone physiology. PMID:26684734

  7. Magnetic resonance imaging of cerebral anomalies in subjects with resistance to thyroid hormone

    SciTech Connect

    Leonard, C.M.; Hauser, P.; Weintraub, B.D. |

    1995-06-19

    Resistance to thyroid hormone (RTH) is an autosomal dominant disease caused by mutations in the human thyroid receptor beta gene on chromosome 3. Individuals with RTH have an increased incidence of attention deficit hyperactivity disorder (ADHD). The purpose of this study was to search for developmental brain malformations associated with RTH. Forty-three subjects (20 affected males [AM], 23 affected females [AF]) with resistance to thyroid hormone and 32 unaffected first degree relatives (18 unaffected males [UM], 14 unaffected females [UF]) underwent MRI brain scans with a volumetric acquisition that provided 90 contiguous 2 mm thick sagittal images. Films of six contiguous images beginning at a standard sagittal position lateral to the insula were analyzed by an investigator who was blind with respect to subject characteristics. The presence of extra or missing gyri in the parietal bank of the Sylvian fissure (multimodal association cortex) and multiple Heschl`s transverse gyri (primary auditory cortex) were noted. There was a significantly increased frequency of anomalous Sylvian fissures in the left hemisphere in males with RTH (AM: 70%; AF: 30%; UM: 28% UF: 28%). Also, there was an increased frequency of anomalous Sylvian fissures on the left combined with multiple Heschl`s gyri in either hemisphere in males with RTH (AM: 50%; AF: 9%; UM: 6%; UF: 0%). However, RTH subjects with anomalies did not have an increased frequency of ADHD as compared with RTH subjects with no anomalies. Abnormal thyroid hormone action in the male fetus early during brain development may be associated with grossly observable cerebral anomalies of the left hemisphere. The effects of mutations in the thyroid receptor beta gene provide a model system for studying the complex interaction of genetic and non-genetic factors on brain and behavioral development. 19 refs., 2 figs., 2 tabs.

  8. Photoperiod-dependent negative feedback effects of thyroid hormones in Fundulus heteroclitus

    SciTech Connect

    Brown, C.L.; Stetson, M.H.

    1985-05-01

    In Fundulus heteroclitus, an annual cycle in the response of the thyroid to ovine thyroid-stimulating hormone (oTSH) is characterized by maximal thyroxin (T4) secretion in mid-winter and minimal T4 secretion in summer. Four daily injections of oTSH, given in winter caused serum T4 to plateau at elevated levels for several days, while in summer fish similar treatment resulted in far more fluctuating titers of serum T4; maximum levels were similar in both groups. The difference in sustenance rather than magnitude of Peak T4 led to an examination of the negative feedback effects of thyroid hormones as they might relate to these seasonal changes. Radioiodine uptake by thyroid follicles served as a simple, but effective bioassay for endogenous TSH. Fish collected in summer were more sensitive to negative feedback of T3 than those collected in winter; feedback effects of T4 in the two groups were not significantly different. The effects of specific photoperiods on negative feedback sensitivity to T3 and T4 were also tested. Exposure of winter fish for one month to long days (LD 14:10) enhanced the degree of reduction of iodine uptake caused by T4 in the aquarium water (10 micrograms/100 ml). Negative feedback in short-day (LD 8:16) winter fish was not demonstrated. It is concluded that long days increase and short days diminish the negative feedback sensitivity of the hypothalamus-pituitary axis to thyroid hormones in F. heteroclitus. Such photoperiodically induced changes may act to aid in the year-round maintenance of T4 levels necessary for seasonal adaptation and survival.

  9. Gestational urinary bisphenol A and maternal and newborn thyroid hormone concentrations: The HOME Study

    SciTech Connect

    Romano, Megan E.; Webster, Glenys M.; Vuong, Ann M.; Thomas Zoeller, R.; Chen, Aimin; Hoofnagle, Andrew N.; Calafat, Antonia M.; Karagas, Margaret R.; Yolton, Kimberly; Lanphear, Bruce P.; Braun, Joseph M.

    2015-04-15

    Bisphenol A (BPA), an endocrine disruptor used in consumer products, may perturb thyroid function. Prenatal BPA exposure may have sex-specific effects on thyroid hormones (THs). Our objectives were to investigate whether maternal urinary BPA concentrations during pregnancy were associated with THs in maternal or cord serum, and whether these associations differed by newborn sex or maternal iodine status. We measured urinary BPA concentrations at 16 and 26 weeks gestation among pregnant women in the HOME Study (2003–2006, Cincinnati, Ohio). Thyroid stimulating hormone (TSH) and free and total thyroxine (T{sub 4}) and triiodothyronine (T{sub 3}) were measured in maternal serum at 16 weeks (n=181) and cord serum at delivery (n=249). Associations between BPA concentrations and maternal or cord serum TH levels were estimated by multivariable linear regression. Mean maternal urinary BPA was not associated with cord THs in all newborns, but a 10-fold increase in mean BPA was associated with lower cord TSH in girls (percent change=−36.0%; 95% confidence interval (CI): −58.4, −1.7%), but not boys (7.8%; 95% CI: −28.5, 62.7%; p-for-effect modification=0.09). We observed no significant associations between 16-week BPA and THs in maternal or cord serum, but 26-week maternal BPA was inversely associated with TSH in girls (−42.9%; 95% CI: −59.9, −18.5%), but not boys (7.6%; 95% CI: −17.3, 40.2%; p-for-effect modification=0.005) at birth. The inverse BPA–TSH relation among girls was stronger, but less precise, among iodine deficient versus sufficient mothers. Prenatal BPA exposure may reduce TSH among newborn girls, particularly when exposure occurs later in gestation. - Highlights: • Examined associations of BPA with thyroid hormones in pregnant women and newborns. • Assessed effect modification of BPA–thyroid hormone associations by newborn sex. • Greater BPA related to decreased thyroid stimulating hormone in girls' cord serum. • Results may

  10. What Is Thyroid Cancer?

    MedlinePlus

    ... Having too much thyroid hormone (a condition called hyperthyroidism ) can cause a rapid or irregular heartbeat, trouble ... nodules make too much thyroid hormone and cause hyperthyroidism. Nodules that produce increased thyroid hormone are almost ...

  11. Thyroid-stimulating hormone (TSH): measurement of intracellular, secreted, and circulating hormone in Xenopus laevis and Xenopus tropicalis.

    PubMed

    Korte, Joseph J; Sternberg, Robin M; Serrano, Jose A; Thoemke, Kara R; Moen, Scott M; Lillegard, Kathryn E; Hornung, Michael W; Tietge, Joseph E; Degitz, Sigmund J

    2011-05-01

    Thyroid-stimulating hormone (TSH) is an important regulator of the hypothalamic-pituitary-thyroid (HPT) axis in Xenopus laevis. To evaluate the role of this hormone on developing tadpoles, immunologically-based Western blots and sandwich ELISAs were developed for measuring intracellular (within pituitaries), secreted (ex vivo pituitary culture), and circulating (serum) amounts. Despite the small size of the tadpoles, these methods were able to easily measure intracellular and secreted TSH, and circulating TSH was measurable in situations where high levels were induced. The method was validated after obtaining a highly purified and enriched TSH sample using anti-TSH-β antibodies conjugated to magnetic beads. Subsequent mass-spectrometric analysis of the bands from SDS-PAGE and Western procedures identified the presence of amino acid sequences corresponding to TSH subunits. The purified sample was also used to prepare standard curves for quantitative analysis. The Western and ELISA methods had limits of detection in the low nanogram range. While the majority of the developmental work for these methods was done with X. laevis, the methods also detected TSH in Xenopus tropicalis. To our knowledge this is the first report of a specific detection method for TSH in these species, and the first to measure circulating TSH in amphibians. Examples of the utility of the methods include measuring a gradual increase in pituitary TSH at key stages of development, peaking at stages 58-62; the suppression of TSH secretion from cultured pituitaries in the presence of thyroid hormone (T4); and increases in serum TSH following thyroidectomy. PMID:21354158

  12. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    SciTech Connect

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh; Godbole, Madan M.

    2010-07-02

    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  13. Pancreatic and Islet Development and Function: The Role of Thyroid Hormone

    PubMed Central

    Mastracci, Teresa L; Evans-Molina, Carmella

    2014-01-01

    A gradually expanding body of literature suggests that Thyroid Hormone (TH) and Thyroid Hormone Receptors (TRs) play a contributing role in pancreatic and islet cell development, maturation, and function. Studies using a variety of model systems capable of exploiting species-specific developmental paradigms have revealed the contribution of TH to cellular differentiation, lineage decisions, and endocrine cell specification. Moreover, in vitro and in vivo evidence suggests that TH is involved in islet β cell proliferation and maturation; however, the signaling pathway(s) connected with this function of TH/TR are not well understood. The purpose of this review is to discuss the current literature that has defined the effects of TH and TRs on pancreatic and islet cell development and function, describe the impact of hyper- and hypothyroidism on whole body metabolism, and highlight future and potential applications of TH in novel therapeutic strategies for diabetes. PMID:25506600

  14. Adrenal, thyroid, and testicular hormone rhythms in male golden hamsters on long and short days

    SciTech Connect

    Ottenweller, J.E.; Tapp, W.N.; Pitman, D.L.; Natelson, B.H. New Jersey Medical School, Newark )

    1987-08-01

    Plasma concentrations of adrenal, thyroid, and testicular hormones were measured at 4-h intervals around the clock in male hamsters on long (14:10-h light-dark cycle) and short (10:14-h light-dark cycle) days. Plasma corticosterone, cortisol, thyroxine (T{sub 4}), triiodothyronine (T{sub 3}), and testosterone rhythms were present on long days. The only one of these hormones to have a significant rhythm on short days was cortisol, but even its amplitude was suppressed compared with the cortisol rhythm on long days. Short days also lowered mean plasma levels of cortisol, T{sub 4}, T{sub 3}, and testosterone. Finally, short days raised the ratio of corticosterone to cortisol and lowered the ratio of T{sub 4} to T{sub 3}. Both ratios had significant rhythms on long days but not on short days. Because of the many interactions among adrenal, thyroid, and testicular hormone axes, it is unclear whether the primary effect of short days is on one of these endocrine systems or on another factor that has separate effects on each of the hormone rhythms that was measured. Nonetheless, it is clear that a major effect of short day lengths in hamsters is to suppress hormone rhythms. Explanations of photoperiodic effects that depend on endocrine mediation should take this into account.

  15. Inhibition of Thyroid Hormone Release from Cultured Amphibian Thyroid Glands by Methimazole, 6-Propylthiouracil, and Perchlorate

    EPA Science Inventory

    The research presented here is the development of an in vitro thyroid gland culture system to test the effect of chemicals directly on the gland without influence of other parts of the HPT axis. . . This information can then be used to select chemicals for further evaluation in v...

  16. The Role of Thyroid Hormones as Inductors of Oxidative Stre