Mohamad, Saharuddin Bin; Nagasawa, Hideko; Sasaki, Hideyuki; Uto, Yoshihiro; Nakagawa, Yoshinori; Kawashima, Ken; Hori, Hitoshi
2003-01-01
Gc protein is the precursor for Gc protein-derived macrophage activating factor (GcMAF), with three phenotypes: Gc1f, Gc1s and Gc2, based on its electrophoretic mobility. The difference in electrophoretic mobility is because of the difference in its posttranslational sugar moiety composition. We compared the difference between Gc protein and GcMAF electrophoretic mobility using the isoelectric focusing (IEF) method. The tumoricidal activity of GcMAF-treated macrophage was evaluated after coculture with L-929 cell. The tumoricidal mechanism was investigated using TNF bioassay and nitric oxide (NO) release. The difference in Gc protein and GcMAF electrophoretic mobility was detected. The tumoricidal activity of GcMAF-treated macrophage was detected, but no release of TNF and NO was detected. The difference of isoelectric focusing mobility in Gc protein and GcMAF would be useful to develop a GcMAF detection method. GcMAF increased macrophage tumoricidal activity but TNF and NO release were not involved in the mechanism.
Controlled method of reducing electrophoretic mobility of macromolecules, particles, or cells
NASA Technical Reports Server (NTRS)
Vanalstine, James M. (Inventor)
1992-01-01
A method of reducing electrophoretic mobility of macromolecules, particles, cells, and other substances is provided which comprises interacting in a conventional electrophoretic separating procedure, the substances with a polymer-linked affinity compound comprised of a hydrophilic neutral polymer such as polyethylene glycol bound to a second component such as a hydrophobic compound, an immunocompound such as an antibody or antibody active fragment, or a ligand such as a hormone, drug, antigen, or a hapten. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and such reduction can comprise up to 100 percent for particular particles and cells. The present invention is advantageous in that electrophoretic separation can now be achieved for substances whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of the specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions.
Controlled method of reducing electrophoretic mobility of various substances
NASA Technical Reports Server (NTRS)
Vanalstine, James M. (Inventor)
1989-01-01
A method of reducing electrophoretic mobility of macromolecules, particles, cells, and the like is provided. The method comprises interacting the particles or cells with a polymer-linked affinity compound composed of: a hydrophilic neutral polymer such as polyethylene glycol, and an affinity component consisting of a hydrophobic compound such as a fatty acid ester, an immunocompound such as an antibody or active fragment thereof or simular macromolecule, or other ligands. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and the mobility reduction obtainable is up to 100 percent for particular particles and cells. The present invention is advantageous in that analytical electrophoretic separation can not be achieved for macromolecules, particles, and cells whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions. The present method is also advantageous in that it can be used in a variety of standard laboratory electrophoresis equipment.
Kerékgyártó, Márta; Járvás, Gábor; Novák, Levente; Guttman, András
2016-02-01
The activation energy related to the electromigration of oligosaccharides can be determined from their measured electrophoretic mobilities at different temperatures. The effects of a viscosity modifier (ethylene glycol) and a polymeric additive (linear polyacrylamide) on the electrophoretic mobility of linear sugar oligomers with α1-4 linked glucose units (maltooligosaccharides) were studied in CE using the activation energy concept. The electrophoretic separations of 8-aminopyrene-1,3,6-trisulfonate-labeled maltooligosaccharides were monitored by LIF detection in the temperature range of 20-50°C, using either 0-60% ethylene glycol (viscosity modifier) or 0-3% linear polyacrylamide (polymeric additive) containing BGEs. Activation energy curves were constructed based on the slopes of the Arrhenius plots. With the use of linear polyacrylamide additive, solute size-dependent activation energy variations were found for the maltooligosaccharides with polymerization degrees below and above maltoheptaose (DP 7), probably due to molecular conformation changes and possible matrix interaction effects. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Electrophoretic mobilities of erythrocytes in various buffers
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Todd, P. W.
1985-01-01
The calibration of space flight equipment depends on a source of standard test particles, this test particle of choice is the fixed erythrocyte. Erythrocytes from different species have different electrophoretic mobilities. Electrophoretic mobility depends upon zeta potential, which, in turn depends upon ionic strength. Zeta potential decreases with increasing ionic strength, so cells have high electrophoretic mobility in space electrophoresis buffers than in typical physiological buffers. The electrophoretic mobilities of fixed human, rat, and rabbit erythrocytes in 0.145 M salt and buffers of varying ionic strength, temperature, and composition, to assess the effects of some of the unique combinations used in space buffers were characterized. Several effects were assessed: glycerol or DMSO (dimethylsulfoxide) were considered for use as cryoprotectants. The effect of these substances on erythrocyte electrophoretic mobility was examined. The choice of buffer depended upon cell mobility. Primary experiments with kidney cells established the choice of buffer and cryoprotectant. A nonstandard temperature of EPM in the suitable buffer was determined. A loss of ionic strength control occurs in the course of preparing columns for flight, the effects of small increases in ionic strength over the expected low values need to be evaluated.
NASA Astrophysics Data System (ADS)
Shaparenko, N. O.; Beketova, D. I.; Demidova, M. G.; Bulavchenko, A. I.
2018-05-01
The hydrodynamic diameter and electrophoretic mobility of titania nanoparticles in AOT microemulsions are studied depending on their water content (from 0 to 1.5 vol %), chloroform content in n-decane-chloroform mixture (from 0 to 30 vol %) and temperature (from 0 to 60°C). Considerable changes in diameter (from 20 to 400 nm) are detected upon adding water to the microemulsion. The electrophoretic mobility grows by 2-3 times upon adding chloroform, or as the temperature falls. The observed features allow us to halve the time of electrophoretic concentration for 140 nm TiO2 nanoparticles, and to concentrate 14 nm nanoparticles that do not exhibit electrophoretic mobility in the absence of chloroform.
Electrophoretic cell separation by means of microspheres
NASA Technical Reports Server (NTRS)
Smolka, A. J. K.; Nerren, B. H.; Margel, S.; Rembaum, A.
1979-01-01
The electrophoretic mobility of fixed human erythrocytes immunologically labeled with poly(vinylpyridine) or poly(glutaraldehyde) microspheres was reduced by approximately 40%. This observation was utilized in preparative scale electrophoretic separations of fixed human and turkey erythrocytes, the mobilities of which under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. We suggest that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immunospecific labeling of target populations using microspheres.
Wangsa-Wirawan, N D; O'Neill, B K; Middelberg, A P
2001-01-01
A knowledge of the physicochemical properties of inclusion bodies is important for the rational design of potential recovery processes such as flotation and precipitation. In this study, measurement of the size and electrophoretic mobility of protein inclusion bodies and cell debris was undertaken. SDS-PAGE analysis of protein inclusion bodies subjected to different cleaning regimes suggested that electrophoretic mobility provides a qualitative measure of protein inclusion body purity. Electrophoretic mobility as a function of electrolyte type and ionic strength was investigated. The presence of divalent ions produced a stronger effect on electrophoretic mobility compared with monovalent ions. The isoelectric point of cell debris was significantly lower than that for the inclusion bodies. Hence, the contaminating cell debris may be separated from inclusion bodies using flotation by exploiting this difference in isoelectric points. Separation by this method is simple, convenient, and a possible alternative to the conventional route of centrifugation.
Affinity Electrophoresis Using Ligands Attached To Polymers
NASA Technical Reports Server (NTRS)
Van Alstine, James M.; Snyder, Robert S.; Harris, J. M.; Brooks, D. E.
1990-01-01
In new technique, reduction of electrophoretic mobilities by addition of polyethylene glycol to ligands increases electrophoretic separabilities. In immuno-affinity electrophoresis, modification of ligands extends specificity of electrophoretic separation to particles having surface electric-charge structures otherwise making them electrophoretically inseparable. Modification of antibodies by polyethylene glycol greatly reduces ability to aggregate while enhancing ability to affect electrophoretic mobilities of cells. In hydrophobic-affinity electrophoresis, addition of polyethylene glycol reduces tendency toward aggregation of cells or macromolecules.
Electrophoretic cell separation by means of immunomicrospheres
NASA Technical Reports Server (NTRS)
Rembaum, A.; Smolka, A. J. K.
1980-01-01
The electrophoretic mobility of fixed human red blood cells immunologically labeled with polymeric (4-vinyl)pyridine or polyglutaraldehyde microspheres was altered to a considerable extent. This observation was utilized in the preparative scale electrophoretic separation of human and turkey fixed red blood cells, whose mobilities under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. It is suggested that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immuno-specific labeling of target populations using microspheres.
Density gradient electrophoresis of cultured human embryonic kidney cells
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Giranda, V.; Todd, P. W.
1985-01-01
Ground based confirmation of the electrophoretic heterogeneity of human embryonic kidney cell cultures, the general characterization of their electrophoretic migration, and observations on the general properties of cultures derived from electrophoretic subpopulations were studied. Cell migration in a density gradient electrophoresis column and cell electrophoretic mobility was determined. The mobility and heterogeneity of cultured human embryonic kidney cells with those of fixed rat erythrocytes as model test particle was compared. Electrophoretically separated cell subpopulations with respect to size, viability, and culture characteristics were examined.
Electrophoretic mobilities of cultured human embryonic kidney cells in various buffers
NASA Technical Reports Server (NTRS)
1985-01-01
Data on the electrophoretic mobility distributions of cells in the new D-1 buffer and the interlaboratory standardization of urokinase assay methods are presented. A table of cell strains and recent data on cell dispersal methods are also included. It was decided that glycerol in A-1 electrophoretic mobility data on cultured human embryonic kidney cells subjected to electrophoresis in this buffer. The buffer composition is presented.
NASA Technical Reports Server (NTRS)
Pevzner, L. Z.; Venkov, L.; Cheresharov, L.
1980-01-01
Albino rats were kept for a year under conditions of daily motor load or constant hypokinesia. An increase in motor activity results in a rise in the acetylcholinesterase activity determined in the synaptosomal and purified mitochondrial fractions while hypokinesia induces a pronounced decrease in this enzyme activity. The butyrylcholinesterase activity somewhat decreases in the synaptosomal fraction after hypokinesia but does not change under the motor load pattern. Motor load causes an increase in the amount of synaptosomal water-soluble proteins possessing an intermediate electrophoretic mobility and seem to correspond to the brain-specific protein 14-3-2. In the synaptosomal fraction the amount of membrane proteins with a low electrophoretic mobility and with the cholinesterase activity rises. Hypokinesia, on the contrary, decreases the amount of these membrane proteins.
NASA Technical Reports Server (NTRS)
Todd, P.; Morrison, Dennis R.; Barlow, Grant H.; Lewis, Marian L.; Lanham, J. W.; Cleveland, C.; Williams, K.; Kunze, M. E.; Goolsby, C. L.
1988-01-01
Cultures of human embryonic kidney cells consistently contain an electrophoretically separable subpopulation of cells that produce high levels of urokinase and have an electrophoretic mobility about 85 percent as high as that of the most mobile human embryonic kidney cells. This subpopulation is rich in large epithelioid cells that have relatively little internal structure. When resolution and throughput are adequate, free fluid electrophoresis can be used to isolate a broad band of low mobility cells which also produces high levels of plasminogen activators (PAs). In the course of performing this, it was discovered that all electrophoretic subpopulations of cultured human embryonic kidney cells produce some PAs and that separate subpopulations produce high quantities of different types of PA's. This information and the development of sensitive assays for this project have provided new insights into cell secretion mechanisms related to fibrinolysis. These advances would probably not have been made without the NASA program to explore fundamental questions of free fluid electrophoresis in space.
NASA Astrophysics Data System (ADS)
Karam, Pascal; Pennathur, Sumita
2016-11-01
Characterization of the electrophoretic mobility and zeta potential of micro and nanoparticles is important for assessing properties such as stability, charge and size. In electrophoretic techniques for such characterization, the bulk fluid motion due to the interaction between the fluid and the charged surface must be accounted for. Unlike current industrial systems which rely on DLS and oscillating potentials to mitigate electroosmotic flow (EOF), we propose a simple alternative electrophoretic method for optically determining electrophoretic mobility using a DC electric fields. Specifically, we create a system where an adverse pressure gradient counters EOF, and design the geometry of the channel so that the flow profile of the pressure driven flow matches that of the EOF in large regions of the channel (ie. where we observe particle flow). Our specific COMSOL-optimized geometry is two large cross sectional areas adjacent to a central, high aspect ratio channel. We show that this effectively removes EOF from a large region of the channel and allows for the accurate optical characterization of electrophoretic particle mobility, no matter the wall charge or particle size.
Electrophoretic kinetics of concentrated TiO2 nanoparticle suspensions in aprotic solvent
NASA Astrophysics Data System (ADS)
Lee, So-Yeon; Yim, Jung-Ryoul; Lee, Se-Hee; Choi, In-Suk; Nam, Ki Tae; Joo, Young-Chang
2018-01-01
We studied the dependences of the concentration of additive and particle size on the electrophoretic mobility of TiO2 nanoparticles. A high concentration of TiO2 nanoparticles was dispersed in aprotic solvent, which is similar to the operating conditions of electrophoretic applications. Because spectroscopy has limits to measuring the electrophoretic mobility of concentrated suspensions in aprotic solvents, we developed a new measurement to determine the electrophoretic mobility of particles using the reflectance change according to the motion of the particles. TiO2 nanoparticles with sizes of 31 nm to 164 nm were synthesized by hydrolysis and were dispersed in cyclohexanone with a dye (Sudan Black B) for use in the new measurement method. In a concentrated suspension in aprotic solvent, the mobility of the particles was proportional to the dye concentration and was inversely proportional to the size of the particles. This infers that the particle size influences the drag force rather than the surface charge, and therefore, to increase the mobility by changing the surface charge, an additive is effective. [Figure not available: see fulltext.
Kidney cell electrophoresis, continuing task
NASA Technical Reports Server (NTRS)
Todd, P. W.
1985-01-01
Materials and procedures for microgravity electrophoresis of living human embryonic kidney cells were evaluated to provide ground support in the form of analytical cell electrophoresis and flow cytometry. Preflight culture media, electrophoresis buffer, fraction collection media, temperature profiles, and urokinase assay procedures were tested prior to flight. Electrophoretic mobility distributions of aliquots of the cell population to be fractionated in flight were obtained. Cells were prepared in suspension prior to flight in electrophoresis buffer and 10% calf serum. Electrophoretic separation proceeded in electrophoresis buffer without serum in the Continuous Flow Electrophoretic Separator, and fractions were collected into sample bags containing culture medium and concentrated serum. Fractions that yielded enough progeny cells were analyzed for morphology and electrophoretic mobility distributions. It is noted that the lowest mobility fraction studied produced higher mobility progeny while the other fractions produced progeny cells with mobilities related to the fractions from which they were collected.
NASA Technical Reports Server (NTRS)
Kunze, M. E.
1985-01-01
A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.
The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregati...
Bayoumi, R A; Nur-E-Kamal, M S; Tadayyon, M; Mohamed, K K; Mahboob, B H; Qureshi, M M; Lakhani, M S; Awaad, M O; Kaeda, J; Vulliamy, T J; Luzzatto, L
1996-01-01
In a cross-sectional study, the activity, electrophoretic mobility and genotypes of glucose-6-phosphate dehydrogenase (G6PD) were determined among healthy, UAE national school boys from Al-Ain District in the United Arab Emirates, The prevalence of G6PD deficiency in this population sample was 11%. The majority of G6PD-deficient subjects were descendants of Omani, Baluchi or Yemeni migrants. Of 18 deficient subjects, 16 had an enzyme activity of < 10% of normal while 2 had an activity of just above 10%. Electrophoresis was performed on 166 samples and showed that, apart from deficient samples, all had the normal mobility of G6PD type B. Of the 18 deficient subjects, 14 had the B type mobility of G6PD Mediterranean and 4 had the A type mobility of G6PD A-. Genotyping demonstrated that 10 had the Mediterranean mutation while 3 had the A- mutation, consistent with their electrophoretic mobility. Another 3 had the G6PD Aures mutation, recently described as polymorphic in Algeria and Spain. The mutations in the remaining 2 subjects have not yet been identified.
Oddy, M H; Santiago, J G
2004-01-01
We have developed a method for measuring the electrophoretic mobility of submicrometer, fluorescently labeled particles and the electroosmotic mobility of a microchannel. We derive explicit expressions for the unknown electrophoretic and the electroosmotic mobilities as a function of particle displacements resulting from alternating current (AC) and direct current (DC) applied electric fields. Images of particle displacements are captured using an epifluorescent microscope and a CCD camera. A custom image-processing code was developed to determine image streak lengths associated with AC measurements, and a custom particle tracking velocimetry (PTV) code was devised to determine DC particle displacements. Statistical analysis was applied to relate mobility estimates to measured particle displacement distributions.
Solvent-mediated nonelectrostatic ion-ion interactions predicting anomalies in electrophoresis.
Goswami, Prakash; Dhar, Jayabrata; Ghosh, Uddipta; Chakraborty, Suman
2017-03-01
We study the effects of solvent-mediated nonelectrostatic ion-ion interactions on electrophoretic mobility of a charged spherical particle. To this end, we consider the case of low surface electrostatic potential resulting in the linearization of the governing equations, which enables us to deduce a closed-form analytical solution to the electrophoretic mobility. We subsequently compare our results to the standard model using Henry's approach and report the changes brought about by the nonelectrostatic potential. The classical approach to determine the electrophoretic mobility underpredicts the particle velocity when compared with experiments. We show that this issue can be resolved by taking into account nonelectrostatic interactions. Our analysis further reveals the phenomenon of electrophoretic mobility reversal that has been experimentally observed in numerous previous studies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Technical Reports Server (NTRS)
Williams, K. B.; Kunze, M. E.; Todd, P. W.
1985-01-01
Four major cell types were identified by phase microscopy in early passage human embryonic kidney cell cultures. They are small and large epithelioid, domed, and fenestrated cells. Fibroblasts are also present in some explants. The percent of each cell type changes with passage number as any given culture grows. As a general rule, the fraction of small epithelioid cells increases, while the fraction of fenestrated cells, always small, decreases further. When fibroblasts are present, they always increase in percentage of the total cell population. Electrophoretic separation of early passage cells showed that the domed cells have the highest electrophoretic mobility, fibroblasts have an intermediate high mobility, small epithelioid cells have a low mobility, broadly distributed, and fenestrated cells have the lowest mobility. All cell types were broadly distributed among electrophoretic subfractions, which were never pure but only enriched with respect to a given cell type.
Huhn, Carolin; Pyell, Ute
2008-07-11
It is investigated whether those relationships derived within an optimization scheme developed previously to optimize separations in micellar electrokinetic chromatography can be used to model effective electrophoretic mobilities of analytes strongly differing in their properties (polarity and type of interaction with the pseudostationary phase). The modeling is based on two parameter sets: (i) carbon number equivalents or octanol-water partition coefficients as analyte descriptors and (ii) four coefficients describing properties of the separation electrolyte (based on retention data for a homologous series of alkyl phenyl ketones used as reference analytes). The applicability of the proposed model is validated comparing experimental and calculated effective electrophoretic mobilities. The results demonstrate that the model can effectively be used to predict effective electrophoretic mobilities of neutral analytes from the determined carbon number equivalents or from octanol-water partition coefficients provided that the solvation parameters of the analytes of interest are similar to those of the reference analytes.
Application of partition technology to particle electrophoresis
NASA Technical Reports Server (NTRS)
Van Alstine, James M.; Harris, J. Milton; Karr, Laurel J.; Bamberger, Stephan; Matsos, Helen C.; Snyder, Robert S.
1989-01-01
The effects of polymer-ligand concentration on particle electrophoretic mobility and partition in aqueous polymer two-phase systems are investigated. Polymer coating chemistry and affinity ligand synthesis, purification, and analysis are conducted. It is observed that poly (ethylene glycol)-ligands are effective for controlling particle electrophoretic mobility.
NASA Technical Reports Server (NTRS)
Morrison, D. R.; Lewis, M. L.; Barlow, G. H.; Todd, P. W.; Kunze, M. E.; Sarnoff, B. E.; Li, Z. K.
1985-01-01
Suspensions of cultured primary human embryonic kidney cells were subjected to continuous flow electrophoresis on Space Shuttle flight STS-8. The objectives of the experiments were to obtain electrophoretically separated fractions of the original cell populations and to test these fractions for the amount and kind of urokinase (a kidney plasminogen activator that is used medically for digesting blood clots), the morphologies of cells in the individual fractions, and their cellular electrophoretic mobilities after separation and subsequent proliferation. Individual fractions were successfully cultured after return from orbit, and they were found to differ substantially from one another and from the starting sample with respect to all of these properties.
ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS
The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms isolated from clinical and environmental sources were measured in 9.15 mM KH2PO4 buffered water. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1 ...
ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS
The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms were measured. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1s-1, and the EPMs of fifteen environmental isolates ranged from -1...
ELECTROPHORETIC MOBILITIES OF ESCHERICHIA COLI 0157:H7 AND WILD-TYPE ESCHERICHIA COLI STRAINS
The electrophoretic mobility (EPM) of a number of human-virulent and "wild-type" Escherichia coli strains in phosphate buffered water was measured. The impact of pH, ionic strength, cation type (valence) and concentration, and bacterial strain on the EPM was investigated. Resul...
Molecular-sieve chromatography and electrophoresis in polyacrylamide gels
Morris, C. J. O. R.; Morris, Peggy
1971-01-01
1. The absolute electrophoretic mobilities of eight proteins have been measured at pH8.76, I 0.05, in polyacrylamide gels of 20 different compositions at 10°C. 2. The partition coefficients of these proteins have been determined chromatographically under the same conditions by using columns of granulated polyacrylamide gel prepared simultaneously. 3. The electrophoretic mobilities are an exponential function of the gel concentrations when the latter are corrected for water uptake. The constants of this function have been determined by curvefitting methods. They have been shown to be related to the free solution mobility and to the mean molecular radius respectively. 4. The reduced mobilities have been shown to be a linear function of the partition coefficients by statistical analyses. 5. The physical significance of the relation between electrophoretic mobility and chromatographic phase distribution in gel media is discussed in the context of these results. PMID:5135238
Saha, N; Hong, S H; Wong, H A; Jeyaseelan, K; Tay, J S
1991-12-01
Biochemical characteristics of one non-deficient fast G6PD variant (GdSingapore) and six different deficient variants (three new, two Mahidol, one each of Indonesian and Mediterranean) were studied among the Malays of Singapore. The GdSingapore variant had normal enzyme activity (82%) and fast electrophoretic mobilities (140% in TEB buffer, 160% in phosphate and 140% in Tris-HCl buffer systems respectively). This variant is further characterized by normal Km for G6P; utilization of analogues (Gal6P, 2dG6P; dAmNADP), heat stability and pH optimum. The other six deficient G6PD variants had normal electrophoretic mobility in TEB buffer with enzyme activities ranging from 1 to 12% of GdB+. The biochemical characteristics identity them to be 2 Mahidol, 1 Indonesian and 1 Mediterranean variants and three new deficient variants.
Free-Flow Open-Chamber Electrophoresis
NASA Technical Reports Server (NTRS)
Sharnez, Rizwan; Sammons, David W.
1994-01-01
Free-flow open-chamber electrophoresis variant of free-flow electrophoresis performed in chamber with open ends and in which velocity of electro-osmotic flow adjusted equal to and opposite mean electrophoretic velocity of sample. Particles having electrophoretic mobilities greater than mean mobility of sample particles move toward cathode, those with mobilities less move toward anode. Technique applied to separation of components of mixtures of biologically important substances. Sensitivity enhanced by use of tapered chamber.
Electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates were measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here prov...
Principles of Micellar Electrokinetic Capillary Chromatography Applied in Pharmaceutical Analysis
Hancu, Gabriel; Simon, Brigitta; Rusu, Aura; Mircia, Eleonora; Gyéresi, Árpád
2013-01-01
Since its introduction capillary electrophoresis has shown great potential in areas where electrophoretic techniques have rarely been used before, including here the analysis of pharmaceutical substances. The large majority of pharmaceutical substances are neutral from electrophoretic point of view, consequently separations by the classic capillary zone electrophoresis; where separation is based on the differences between the own electrophoretic mobilities of the analytes; are hard to achieve. Micellar electrokinetic capillary chromatography, a hybrid method that combines chromatographic and electrophoretic separation principles, extends the applicability of capillary electrophoretic methods to neutral analytes. In micellar electrokinetic capillary chromatography, surfactants are added to the buffer solution in concentration above their critical micellar concentrations, consequently micelles are formed; micelles that undergo electrophoretic migration like any other charged particle. The separation is based on the differential partitioning of an analyte between the two-phase system: the mobile aqueous phase and micellar pseudostationary phase. The present paper aims to summarize the basic aspects regarding separation principles and practical applications of micellar electrokinetic capillary chromatography, with particular attention to those relevant in pharmaceutical analysis. PMID:24312804
ERIC Educational Resources Information Center
Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.
2012-01-01
An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…
Palanisami, Akilan; Miller, John H.
2011-01-01
The size and surface chemistry of micron scale particles are of fundamental importance in studies of biology and air particulate pollution. However, typical electrophoretic measurements of these and other sub-micron scale particles (300 nm – 1 μm) cannot resolve size information within heterogeneous mixtures unambiguously. Using optical microscopy, we monitor electrophoretic motion together with the Brownian velocity fluctuations—using the latter to measure size by either the Green-Kubo relation or by calibration from known size standards. Particle diameters are resolved to ±12% with 95% confidence. Strikingly, the size resolution improves as particle size decreases due to the increased Brownian motion. The sizing ability of the Brownian assessed electrophoresis method described here complements the electrophoretic mobility resolution of traditional capillary electrophoresis. PMID:20882556
Cobalt ferrite nanoparticles with improved aqueous colloidal stability and electrophoretic mobility
DOE Office of Scientific and Technical Information (OSTI.GOV)
Munjal, Sandeep, E-mail: drsandeepmunjal@gmail.com; Khare, Neeraj, E-mail: nkhare@physics.iitd.ernet.in
We have synthesized CoFe{sub 2}O{sub 4} (CFO) nanoparticles of size ∼ 12.2 nm by hydrothermal synthesis method. To control the size of these CFO nanoparticles, oleic acid was used as a surfactant. The inverse spinel phase of the synthesized nanoparticles was confirmed by X-ray diffraction method. As synthesized oleic acid coated CFO (OA@CFO) nanoparticles has very less electrophoretic mobility in the water and are not water dispersible. These OA@CFO nanoparticles were successfully turned into water soluble phase with a better colloidal aqueous stability, through a chemical treatment using citric acid. The modified citric acid coated CFO (CA@CFO) nanoparticles were dispersible inmore » water and form a stable aqueous solution with high electrophoretic mobility.« less
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2007-10-01
Effective electrophoretic mobility data of 20 amino acids reported in the literature are analyzed and interpreted through simple physicochemical models, which are able to provide estimates of coupled quantities like hydrodynamic shape factor, equivalent hydrodynamic radius (size), net charge, actual pK values of ionizing groups, partial charges of ionizing groups, hydration number, and pH near molecule (microenvironment-pH of the BGE). It is concluded that the modeling of the electrophoretic mobility of these analytes requires a careful consideration of hydrodynamic shape coupled to hydration. In the low range of pH studied here, distinctive hydrodynamic behaviors of amino acids are found. For instance, amino acids with basic polar and ionizing side chain remain with prolate shape for pH values varying from 1.99 to 3.2. It is evident that as the pH increases from low values, amino acids get higher hydrations as a consequence each analyte total charge also increases. This result is consistent with the monotonic increase of the hydrodynamic radius, which accounts for both the analyte and the quite immobilized water molecules defining the electrophoretic kinematical unit. It is also found that the actual or effective pK value of the alpha-carboxylic ionizing group of amino acids increases when the pH is changed from 1.99 to 3.2. Several limitations concerning the simple modeling of the electrophoretic mobility of amino acids are presented for further research.
Electrophoretic manipulation of multiple-emulsion droplets
NASA Astrophysics Data System (ADS)
Schoeler, Andreas M.; Josephides, Dimitris N.; Chaurasia, Ankur S.; Sajjadi, Shahriar; Mesquida, Patrick
2014-02-01
Electrophoretic manipulation of multiple-emulsion oil-in-water-in-oil (O/W)/O and water-in-oil-in-water-in-oil (W/O/W)/O core-shell droplets is shown. It was found that the electrophoretic mobility of the droplets is determined solely by the outer water shell, regardless of size or composition of the inner droplets. It was observed that the surface charge of the outer water shell can be changed and the polarity can be reversed through contact with a biased electrode in a similar way as with simple W/O droplets. Furthermore, addition of the anionic surfactant, sodium dodecyl sulfate to the outer water shell reverses the initial polarity and hence, electrophoretic mobility of the core-shell droplets before contact with an electrode. The results have practical implications for the manipulation of oil droplets in a continuous oil phase.
Mammalian transcription factor LSF is a target of ERK signaling
Pagon, Zrinka; Volker, Janet; Cooper, Geoffrey M.; Hansen, Ulla
2012-01-01
LSF is a mammalian transcription factor that is rapidly and quantitatively phosphorylated upon growth induction of resting, peripheral human T cells, as assayed by a reduction in its electrophoretic mobility. The DNA-binding activity of LSF in primary T cells is greatly increased after this phosphorylation event [Volker et al., 1997]. We demonstrate here that LSF is also rapidly and quantitatively phosphorylated upon growth induction in NIH 3T3 cells, although its DNA-binding activity is not significantly altered. Three lines of experimentation established that ERK is responsible for phosphorylating LSF upon growth induction in both cell types. First, phosphorylation of LSF by ERK is sufficient to cause the reduced electrophoretic mobility of LSF. Second, the amount of ERK activity correlates with the extent of LSF phosphorylation in both primary human T cells and NIH 3T3 cells. Finally, specific inhibitors of the Ras/Raf/MEK/ERK pathway inhibit LSF modification in vivo. This phosphorylation by ERK is not sufficient for activation of LSF DNA-binding activity, as evidenced both in vitro and in mouse fibroblasts. Nonetheless, activation of ERK is a prerequisite for the substantial increase in LSF DNA-binding activity upon activation of resting T cells, indicating that ERK phosphorylation is necessary but not sufficient for activation of LSF in this cell type. PMID:12858339
Neu, T R; Verkerke, G J; Herrmann, I F; Schutte, H K; Van der Mei, H C; Busscher, H J
1994-05-01
Silicone rubber voice prostheses are implants which are inserted in a non-sterile environment and therefore become quickly colonized by micro-organisms. The micro-organisms exist on the medical grade silicone rubber as mixed biofilms of bacteria and yeasts. A total of 79 bacterial and 39 yeast strains were isolated from these biofilms by soft ultrasonic treatment. Gram-positive/catalase-negative and Gram-positive/catalase-positive cocci represented the dominant bacterial strains. The yeasts were mainly Candida species. Further characterization of cell surface properties such as hydrophobicity by microbial adhesion to hexadecane and electrophoretic mobility showed a distinct difference when the bacterial strains were compared with the yeasts. The bacterial hydrophobicities ranged from 0 to 100% adhesion to hexadecane, whereas the yeast strains, especially the Candida albicans strains, all had markedly hydrophilic cell surfaces. A comparison of the electrophoretic mobilities showed also differences between bacteria and yeast. The values for the bacteria were found to be between -2.5 to -0.5 (10(-8) m2 V-1 s-1), whereas for the yeasts electrophoretic mobilities were more positive. Based on the adhesive properties of the isolated micro-organisms, strategies can now be developed to modify the properties of the silicone rubber to reduce biofilm formation on such prostheses.
Vega, Juan F.; Vicente-Alique, Ernesto; Núñez-Ramírez, Rafael; Wang, Yang; Martínez-Salazar, Javier
2016-01-01
The stabilization of human papillomavirus type 16 virus-like particles has been examined by means of different techniques including dynamic and static light scattering, transmission electron microscopy and electrophoretic mobility. All these techniques provide different and often complementary perspectives about the aggregation process and generation of stabilized virus-like particles after a period of time of 48 hours at a temperature of 298 K. Interestingly, static light scattering results point towards a clear colloidal instability in the initial systems, as suggested by a negative value of the second virial coefficient. This is likely related to small repulsive electrostatic interactions among the particles, and in agreement with relatively small absolute values of the electrophoretic mobility and, hence, of the net surface charges. At this initial stage the small repulsive interactions are not able to compensate binding interactions, which tend to aggregate the particles. As time proceeds, an increase of the size of the particles is accompanied by strong increases, in absolute values, of the electrophoretic mobility and net surface charge, suggesting enhanced repulsive electrostatic interactions and, consequently, a stabilized colloidal system. These results show that electrophoretic mobility is a useful methodology that can be applied to screen the stabilization factors for virus-like particles during vaccine development. PMID:26885635
Sursyakova, Viktoria V; Burmakina, Galina V; Rubaylo, Anatoly I
2016-08-01
The influence of analyte concentration when compared with the concentration of a charged ligand in background electrolyte (BGE) on the measured values of electrophoretic mobilities and stability constants (association, binding or formation constants) is studied using capillary electrophoresis (CE) and a dynamic mathematical simulator of CE. The study is performed using labile complexes (with fast kinetics) of iron (III) and 5-sulfosalicylate ions (ISC) as an example. It is shown that because the ligand concentration in the analyte zone is not equal to that in BGE, considerable changes in the migration times and electrophoretic mobilities are observed, resulting in systematic errors in the stability constant values. Of crucial significance is the slope of the dependence of the electrophoretic mobility decrease on the ligand equilibrium concentration. Without prior information on this dependence to accurately evaluate the stability constants for similar systems, the total ligand concentration must be at least >50-100 times higher than the total concentration of analyte. Experimental ISC peak fronting and the difference between the direction of the experimental pH dependence of the electrophoretic mobility decrease and the mathematical simulation allow assuming the presence of capillary wall interaction. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Methods for separating particles and/or nucleic acids using isotachophoresis
Jung, Byoungsok; Ness, Kevin; Rose, Klint A.
2016-03-15
According to one embodiment, a method includes co-feeding fluids comprising a leading electrolyte, a trailing electrolyte, and at least one of DNA and RNA to a channel, and applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. In another embodiment, a method includes co-feeding fluids to a channel. The fluids include a leading electrolyte, a trailing electrolyte, biological objects, at least one of DNA and RNA, and a spacer electrolyte having an electrophoretic mobility that is between an electrophoretic mobility of at least some of the biological objects and an electrophoretic mobility of the at least one of the DNA and the RNA. The method also includes applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. Other methods of isotachophoresis are disclosed in addition to these.
Nano-colloid electrophoretic transport: Fully explicit modelling via dissipative particle dynamics
NASA Astrophysics Data System (ADS)
Hassanzadeh Afrouzi, Hamid; Farhadi, Mousa; Sedighi, Kurosh; Moshfegh, Abouzar
2018-02-01
In present study, a novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced for modelling electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Moreover, capability of different thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field in nano scale application (0.072 < E < 0.361 v / nm) covering non-linear response regime, and ionic salt concentration (0.049 < SC < 0.69 [M]) covering weak to strong Debye screening of the colloid. The effect of different colloidal repulsions are then studied on temperature, reduced mobility and zeta potential which is computed based on charge distribution within the spherical colloidal EDL. System temperature and electrophoretic mobility both show a direct and inverse relationship respectively with electric field and colloidal repulsion. Mobility declining with colloidal repulsion reaches a plateau which is a relatively constant value at each electrolyte salinity for Aii > 600 in DPD units regardless of electric field intensity. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0.145 [ v / nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the radial distribution function with available electrolyte structure modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.
Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F
1997-07-01
The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.
Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.
Foley, Joe P; Blackney, Donna M; Ennis, Erin J
2017-11-10
The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum peak capacity per unit time is a simple function of the upper bound, but its direct application is limited to samples with analytes whose electrophoretic mobilities can be varied independently of electroosmotic flow. For samples containing both co- and counter-electroosmotic ions whose electrophoretic mobilities cannot be easily manipulated, comparable levels of peak capacity and peak capacity per unit time for all ions can be obtained by adjusting the EOF to devote the same amount of time to the separation of each class of ions; this corresponds to μ r,Z =-0.5. Copyright © 2017 Elsevier B.V. All rights reserved.
Discrimination between closed and open forms of lipases using electrophoretic techniques.
Miled, N; Riviere, M; Cavalier, J F; Buono, G; Berti, L; Verger, R
2005-03-15
The enhanced catalytic activity of lipases is often associated with structural changes. The three-dimensional (3D) structures showed that the covalently inhibited lipases exist under their open conformations, in contrast to their native closed forms. We studied the inhibition of various lipases--human and dog gastric lipases, human pancreatic lipase, and Humicola lanuginosa lipase--by the octyl-undecyl phosphonate inhibitor, and we measured the subsequent modifications of their respective electrophoretic mobility. Furthermore, the experimental values of the isoelectric points found for the native (closed) and inhibited (open) lipases are in agreement with theoretical calculations based on the electrostatic potential. We concluded that there is a significant difference in the isoelectric points between the closed (native) and open (inhibited) conformations of the four lipases investigated. Thus, analysis of the electrophoretic pattern is proposed as an easy experimental tool to differentiate between a closed and an open form of a given lipase.
NASA Astrophysics Data System (ADS)
Pandey, Harsh; Underhill, Patrick T.
2015-11-01
The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.
Wahl, Joachim; Furuishi, Takayuki; Yonemochi, Etsuo; Meinel, Lorenz; Holzgrabe, Ulrike
2017-04-01
To optimize chiral separation conditions and to improve the knowledge of enantioseparation, it is important to know the binding constants K between analytes and cyclodextrins and the electrophoretic mobilities of the temporarily formed analyte-cyclodextrin-complexes. K values for complexes between eight phenethylamine enantiomers, namely ephedrine, pseudoephedrine, methylephedrine and norephedrine, and four different β-cyclodextrin derivatives were determined by affinity capillary electrophoresis. The binding constants were calculated from the electrophoretic mobility values of the phenethylamine enantiomers at increasing concentrations of cyclodextrins in running buffer. Three different linear plotting methods (x-reciprocal, y-reciprocal, double reciprocal) and nonlinear regression were used for the determination of binding constants with β-cyclodextrin, (2-hydroxypropyl)-β-cyclodextrin, methyl-β-cyclodextrin and 6-O-α-maltosyl-β-cyclodextrin. The cyclodextrin concentration in a 50 mM phosphate buffer pH 3.0 was varied from 0 to 12 mM. To investigate the influence of the binding constant values on the enantioseparation the observed electrophoretic selectivities were compared with the obtained K values and the calculated enantiomer-cyclodextrin-complex mobilities. The different electrophoretic mobilities of the temporarily formed complexes were crucial factors for the migration order and enantioseparation of ephedrine derivatives. To verify the apparent binding constants determined by capillary electrophoresis, a titration process using ephedrine enantiomers and β-cyclodextrin was carried out. Furthermore, the isothermal titration calorimetry measurements gave information about the thermal properties of the complexes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Eichmann, Klaus; Braun, Dietmar G.; Feizi, Ten; Krause, Richard M.
1970-01-01
Electrophoretically monodisperse antibody components in rabbit antisera to the carbohydrates of the Groups A and C streptococci have been examined for their individual antigenic specificity. In these antibody components which were isolated by preparative electrophoresis, individual antigenic specificity was confined to the specific antibody and was absent in the nonantibody γ-globulin. Radioprecipitation experiments and the use of immune absorbent columns constructed from goat anti-antisera, which had been absorbed with fraction II, revealed that all the specific antibody in an electrophoretically monodisperse component was reactive with the homologous anti-antibody. Antibodies with either identical or distinct individual antigenic specificities may occur in the same rabbit with repeated immunizations. Antibodies with identical antigenic specificity had identical electrophoretic mobility, whereas antibodies with unrelated antigenic specificities had distinct electrophoretic mobilities. In the interval between immunizations, if antibody to the carbohydrate antigen was absent, there was no detectable antibody with individual antigenic specificity. PMID:4192569
Leach, S D; Modlin, I M; Scheele, G A; Gorelick, F S
1991-01-01
The mechanism by which digestive zymogens become activated during acute pancreatitis remains poorly understood. Given the ability for cholecystokinin (CCK) to induce pancreatitis in vivo, the effects of high dose CCK on preparations of isolated pancreatic acini were examined. Using an immunologic technique for the detection of zymogen activation, CCK was found to stimulate the conversion of procarboxypeptidase A1 to a 35-kD form having the same net charge and electrophoretic mobility as purified recombinant carboxypeptidase A1. This enhanced conversion was proportional to the dose of CCK (maximal at 100 nM), and time dependent. CCK also produced changes in the electrophoretic mobility of procarboxypeptidase B and chymotrypsinogen 2 immunoreactivity, consistent with activation of these zymogens. These events were detectable only within acinar cell pellets and not in the incubation medium, suggesting an intracellular site of conversion. The conversion of procarboxypeptidase A1 to its active form was inhibited by pretreatment with the weak base chloroquine (40 microM) and the protonophore monensin (10 microM). This conversion was also inhibited by pretreatment with the serine protease inhibitor benzamidine (10 mM) but not the cysteine protease inhibitor E64 (100 microM). The results suggest that high dose CCK stimulates the intracellular activation of digestive zymogens within isolated pancreatic acini. This event appears to require an acidic subcellular compartment and serine protease activity. Images PMID:1985109
The influence of tetrahydroxyborate ions on the electrophoretic mobility of humic acids was evaluated by capillary electrophoresis (CE). Depending on the molarity of borate ions in the separation buffer, the humic acids exhibit electropherograms with sharp peaks consistently exte...
Electrophoretic purification of cells in space - Evaluation of results from STS-3
NASA Technical Reports Server (NTRS)
Sarnoff, B. E.; Kunze, M. E.; Todd, P.
1983-01-01
The procedure and results of Electrophoresis Equipment Verification Test, designed to examine electrophoretic behavior of animal cells is suspension more concentrated than possible on earth and flown on the Shuttle flight STS-3, were discussed. Ground-based laboratory values of electrophoretic mobilities of a mixture of human and rabbit aldehyde-fixed red blood cells (RBC) were compared with those recorded at 11 minute intervals on the Shuttle STS-3. RBC migration and separation observed through photographic records were not as expected. However, cell mobilities and migrating band profiles were consistent with the results of laboratory simulation experiments. It was concluded that zero G electrophoresis of very high concentrations (1 x 10 to the 9th) is possible and similar to electrophoresis of normal cell concentrations on earth.
Time-dependent electrophoresis of a dielectric spherical particle embedded in Brinkman medium
NASA Astrophysics Data System (ADS)
Saad, E. I.; Faltas, M. S.
2018-04-01
An expression for electrophoretic apparent velocity slip in the time-dependent flow of an electrolyte solution saturated in a charged porous medium within an electric double layer adjacent to a dielectric plate under the influence of a tangential uniform electric field is derived. The velocity slip is used as a boundary condition to solve the electrophoretic motion of an impermeable dielectric spherical particle embedded in an electrolyte solution saturated in porous medium under the unsteady Darcy-Brinkman model. Throughout the system, a uniform electric field is applied and maintains with constant strength. Two cases are considered, when the electric double layer enclosing the particle is thin, but finite and when of a particle with a thick double layer. Expressions for the electrophoretic mobility of the particle as functions of the relevant parameters are found. Our results indicate that the time scale for the growth of mobility is significant and small for high permeability. Generally, the effect of the relaxation time for starting electrophoresis is negligible, irrespective of the thickness of the double layer and permeability of the medium. The effects of the elapsed time, permeability, mass density and Debye length parameters on the fluid velocity, the electrophoretic mobility and the acceleration are shown graphically.
LABELING WITH 14C AMINO ACIDS OF ALBUMIN-LIKE PROTEIN BY RAT LIVER RIBONUCLEOPROTEIN PARTICLES
von der Decken, Alexandra
1963-01-01
Ribonucleoprotein particles were prepared by treatment of rat liver microsomes with detergents and high concentrations of KCl. They were active in incorporating 14C amino acids into protein when incubated with cell sap together with ATP, GTP, and a system to regenerate the triphosphates. The albumin of the incubation mixture, soluble at 105,000 g, and that of the fraction released by ultrasonication of the particles were studied by immunoelectrophoresis in agar gel. When the ribonucleoprotein particles were incubated with cell sap the immunological precipitation lines formed with antiserum to rat serum albumin were highly radioactive as tested by autoradiography. After zone electrophoresis on cellulose acetate, two immunologically reactive albumins were obtained which differed in their electrophoretic mobility from rat serum albumin. Labeled albumin, when purified on DEAE-cellulose columns, retained its radioactivity as tested by autoradiography following immunoelectrophoresis. On cellulose acetate this purified albumin showed an electrophoretic mobility higher than that of rat serum albumin. PMID:14026307
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Orlye, Fanny; Reiller, Pascal E.
2014-02-15
The physicochemical properties of three different humic substances (HS) are probed using capillary zone electrophoresis in alkaline carbonate buffers, pH 10. Special attention is drawn to the impact of the electrolyte ionic strength and counter-ion nature, chosen within the alkali-metal series, on HS electrophoretic mobility. Taylor-Aris dispersion analysis provides insights into the hydrodynamic radius (R-H) distributions of HS. The smallest characterized entities are of nano-metric dimensions, showing neither ionic strength- nor alkali-metal-induced aggregation. These results are compared with the entities evidenced in dynamic light scattering measurements, the size of which is two order of magnitude higher, ca. 100 nm. Themore » extended Onsager model provides a reasonable description of measured electrophoretic mobilities in the ionic strength range 1-50 mM, thus allowing the estimation of limiting mobilities and ionic charge numbers for the different HS samples. An unexpected HS electrophoretic mobility increase (in absolute value) is observed in the order Li{sup +} ≤ Na{sup +} ≤ K{sup +} ≤ Cs{sup +} and discussed either in terms of retarding forces or in terms of ion-ion interactions. (authors)« less
Rosner, A; Maslenin, L; Spiegel, S
1998-09-01
A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.
Importance of pH-regulated charge density on the electrophoresis of soft particles
NASA Astrophysics Data System (ADS)
Gopmandal, Partha P.; Ohshima, H.
2017-02-01
The present study deals with the electrophoresis of spherical soft particles consisting of an ion and liquid-penetrable but liquid-flow-impenetrable inner core surrounded by an ion and fluid-penetrable polyelectrolyte layer. The inner core is considered to be dielectric and bearing basic functional group coated with polyelectrolyte layer containing acidic functional group. An approximate expression for the electrophoretic mobility of such a particle is obtained under a low potential limit. The electrophoretic behaviour of the undertaken particle is investigated for a wide range of bulk pH values and electrolyte concentrations. Our study also indicates some remarkable features of the electrophoresis e.g., occurrence of zero mobility, mobility reversal etc.
Apparent electric charge of protein molecules. Human thyroxine - binding proteins.
Hocman, G; Sadlon, J
1977-01-01
1. By comparison of electrophoretic mobilities of two different charged particles under the same conditions the net elementary electrostatic charge of one particle could be calculated when the charge of the other is known. 2. The electrophoretic mobility of human thyroxine - binding globulin does not depend upon the concentration of Tris - HCl buffer in the range 0.05 to 0.20 molar. The value of this mobility is 0.078 and 0.083 cm2 vol(-1) hour(-1) at pH 7.0 and 8.6, respectively. 3. The net elementary electrostatic charge of the human thyroxine - binding globulin appears to be approximately 22 negative elementary electrostatic units in mild alkaline solutions.
Urokinase production by electrophoretically separated cultured human embryonic kidney cells
NASA Technical Reports Server (NTRS)
Kunze, M. E.; Plank, L. D.; Giranda, V.; Sedor, K.; Todd, P. W.
1985-01-01
Urokinase is a plasminogen activator found in urine. Relatively pure preparations have been tested in Europe, Japan and the United States for the treatment of deep vein thrombosis and other dangerous blood clots. Human embryonic kidney cell cultures have been found to produce urokinase at much higher concentrations, but less than 5% of the cells in typical cultures are producers. Since human diploid cells become senescent in culture the selection of clones derived from single cells will not provide enough material to be useful, so a bulk purification method is needed for the isolation of urokinase producing cell populations. Preparative cell electrophoresis was chosen as the method, since evidence exists that human embryonic cell cultures are richly heterogeneous with respect to electrophoretic mobility, and preliminary electrophoretic separations on the Apollo-Soyuz space flight produced cell populations that were rich in urokinase production. Similarly, erythropoietin is useful in the treatment of certain anemias and is a kidney cell duct, and electrophoretically enriched cell populations producing this product have been reported. Thus, there is a clear need for diploid human cells that produce these products, and there is evidence that such cells should be separable by free-flow cell electrophoresis.
Electrophoretic properties of BSA-coated quantum dots.
Bücking, Wendelin; Massadeh, Salam; Merkulov, Alexei; Xu, Shu; Nann, Thomas
2010-02-01
Low toxic InP/ZnS quantum dots (QDs), ZnS:Mn(2+)/ZnS nanocrystals and CdSe/ZnS nanoparticles were rendered water-dispersible by different ligand-exchange methods. Eventually, they were coated with bovine serum albumin (BSA) as a model protein. All particles were characterised by isotachophoresis (ITP), laser Doppler velocimetry (LDV) and agarose gel electrophoresis. It was found that the electrophoretic mobility and colloidal stability of ZnS:Mn(2+)/ZnS and CdSe/ZnS nanoparticles, which bore short-chain surface ligands, was primarily governed by charges on the nanoparticles, whereas InP/ZnS nanocrystals were not charged per se. BSA-coated nanoparticles showed lower electrophoretic mobility, which was attributed to their larger size and smaller overall charge. However, these particles were colloidally stable. This stability was probably caused by steric stabilisation of the BSA coating.
2013-01-01
Background Sex presents evolutionary costs and benefits, leading to the expectation that the amount of genetic exchange should vary in conditions with contrasting cost-benefit equations. Like eukaryotes, viruses also engage in sex, but the rate of genetic exchange is often assumed to be a relatively invariant property of a particular virus. However, the rates of genetic exchange can vary within one type of virus according to geography, as highlighted by phylogeographic studies of cystoviruses. Here we merge environmental microbiology with experimental evolution to examine sex in a diverse set of cystoviruses, consisting of the bacteriophage ϕ6 and its relatives. To quantify reassortment we manipulated – by experimental evolution – electrophoretic mobility of intact virus particles for use as a phenotypic marker to estimate genetic exchange. Results We generated descendants of ϕ6 that exhibited fast and slow mobility during gel electrophoresis. We identified mutations associated with slow and fast phenotypes using whole genome sequencing and used crosses to establish the production of hybrids of intermediate mobility. We documented natural variation in electrophoretic mobility among environmental isolates of cystoviruses and used crosses against a common fast mobility ϕ6 strain to monitor the production of hybrids with intermediate mobility, thus estimating the amount of genetic exchange. Cystoviruses from different geographic locations have very different reassortment rates when measured against ϕ6, with viruses isolated from California showing higher reassortment rates than those from the Northeastern US. Conclusions The results confirm that cystoviruses from different geographic locations have remarkably different reassortment rates –despite similar genome structure and replication mechanisms– and that these differences are in large part due to sexual reproduction. This suggests that particular viruses may indeed exhibit diverse sexual behavior, but wide geographic sampling, across varying environmental conditions may be necessary to characterize the full repertoire. Variation in reassortment rates can assist in the delineation of viral populations and is likely to provide insight into important viral evolutionary dynamics including the rate of coinfection, virulence, and host range shifts. Electrophoretic mobility may be an indicator of important determinants of fitness and the techniques herein can be applied to the study of other viruses. PMID:24059872
Usrey, Monica L; Nair, Nitish; Agnew, Daniel E; Pina, Cesar F; Strano, Michael S
2007-07-03
The electrophoretic mobilities of single-walled carbon nanotubes (SWNTs) in agarose gels subjected to negatively charged covalent functionalization and noncovalent anionic surfactant adsorption are compared using a simplified hydrodynamic model. Net charges are calculated on the basis of estimated friction coefficients for cylindrical rodlike particles. The effects of functionalization with negatively charged 4-hydroxybenzene diazonium and anionic sodium cholate are quantified and compared with model predictions. The adsorption of Na+ counterions into the nonionic surfactant layer adsorbed on SWNTs (Triton-X-405) is shown to induce a positive charge and reverse the mobility under select conditions. This effect has not been identified or quantified for nanoparticle systems and may be important in the processing of these systems.
A study of cell electrophoresis as a means of purifying growth hormone secreting cells
NASA Technical Reports Server (NTRS)
Plank, Lindsay D.; Hymer, W. C.; Kunze, M. Elaine; Marks, Gary M.; Lanham, J. Wayne
1983-01-01
Growth hormone secreting cells of the rat anterior pituitary are heavily laden with granules of growth hormone and can be partialy purified on the basis of their resulting high density. Two methods of preparative cell electrophoresis were investigated as methods of enhancing the purification of growth hormone producing cells: density gradient electrophoresis and continuous flow electrophoresis. Both methods provided a two- to four-fold enrichment in growth hormone production per cell relative to that achieved by previous methods. Measurements of electrophoretic mobilities by two analytical methods, microscopic electrophoresis and laser-tracking electrophoresis, revealed very little distinction between unpurified anterior pituitary cell suspensions and somatotroph-enriched cell suspensions. Predictions calculated on the basis of analytical electrophoretic data are consistent with the hypothesis that sedimentation plays a significant role in both types of preparative electrophoresis and the electrophoretic mobility of the growth hormone secreting subpopulation of cells remains unknown.
Hsieh, Yi-Wen; Alqadah, Amel; Chuang, Chiou-Fen
2016-11-29
Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2 G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2 G73E proteins) as a biological example.
Kim, Jong-Yeob; Kim, Hyung-Bae; Jang, Du-Jeon
2013-03-01
Gold nanospheres modified with bifunctional molecules have been separated and characterized by using agarose gel electrophoresis as well as optical spectroscopy and electron microscopy. The electrophoretic mobility of a gold nanosphere capped with 11-mercaptoundecanoic acid (MUA) has been found to depend on the number of MUA molecules per gold nanosphere, indicating that it increases with the surface charge of the nanoparticle. The extinction spectrum of gold nanospheres capped with MUA at an MUA molecules per gold nanosphere value of 1000 and connected via 1,6-hexanedithiol (HDT) decreases by 33% in magnitude and shifts to the red as largely as 22 nm with the increase of the molar ratio of HDT to MUA (R(HM)). Gold nanospheres capped with MUA and connected via HDT have been separated successfully using gel electrophoresis and characterized by measuring reflectance spectra of discrete electrophoretic bands directly in the gel and by monitoring transmission electron microscope images of gold nanoparticles collected from the discrete bands. Electrophoretic mobility has been found to decrease substantially with the increment of HDT to MUA, indicating that the size of aggregated gold nanoparticles increases with the concentration of HDT. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
1998-06-29
Curcumin DFX Desferrioxamine DNA Deoxyribonucleic Acid DPI Diphenyliodinium DPPD Diphenylphenylenediamine DTH Dithionite EMSA Electrophoretic mobility shift... neuroprotective effects (Fern et al., 1996, Morishita et al., 1 1997). The identification of a hypoxia inducible transcription factor known as HIF-1 (Semenza...derived EPO in the eNS neuroprotective response to hypoxia. Cloning of the human and murine EPO gene, the availability of a convenient EPa producing
Electrophoretic mobilities of counterions and a polymer in cylindrical pores
Singh, Sunil P.; Muthukumar, M.
2014-01-01
We have simulated the transport properties of a uniformly charged flexible polymer chain and its counterions confined inside cylindrical nanopores under an external electric field. The hydrodynamic interaction is treated by describing the solvent molecules explicitly with the multiparticle collision dynamics method. The chain consisting of charged monomers and the counterions interact electrostatically with themselves and with the external electric field. We find rich behavior of the counterions around the polymer under confinement in the presence of the external electric field. The mobility of the counterions is heterogeneous depending on their location relative to the polymer. The adsorption isotherm of the counterions on the polymer depends nonlinearly on the electric field. As a result, the effective charge of the polymer exhibits a sigmoidal dependence on the electric field. This in turn leads to a nascent nonlinearity in the chain stretching and electrophoretic mobility of the polymer in terms of their dependence on the electric field. The product of the electric field and the effective polymer charge is found to be the key variable to unify our simulation data for various polymer lengths. Chain extension and the electrophoretic mobility show sigmoidal dependence on the electric field, with crossovers from the linear response regime to the nonlinear regime and then to the saturation regime. The mobility of adsorbed counterions is nonmonotonic with the electric field. For weaker and moderate fields, the adsorbed counterions move with the polymer and at higher fields they move opposite to the polymer's direction. We find that the effective charge and the mobility of the polymer decrease with a decrease in the pore radius. PMID:25240366
Probing size-dependent electrokinetics of hematite aggregates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kedra-Królik, Karolina; Rosso, Kevin M.; Zarzycki, Piotr
Aqueous particle suspensions of many kinds are stabilized by the electrostatic potential developed at their surfaces from reaction with water and ions. An important and less well understood aspect of this stabilization is the dependence of the electrostatic surface potential on particle size. Surface electrostatics are typically probed by measuring particle electrophoretic mobilities and quantified in the electrokinetic potential (f), using commercially available Zeta Potential Analyzers (ZPA). Even though ZPAs provide frequency-spectra (histograms) of electrophoretic mobility and hydrodynamic diameter, typically only the maximal-intensity values are reported, despite the information in the remainder of the spectra. Here we propose a mappingmore » procedure that inter-correlates these histograms to extract additional insight, in this case to probe particle size-dependent electrokinetics. Our method is illustrated for a suspension of prototypical iron (III) oxide (hematite, a-Fe2O3). We found that the electrophoretic mobility and f-potential are a linear function of the aggregate size. By analyzing the distribution of surface site types as a function of aggregate size we show that site coordination increases with increasing aggregate diameter. This observation explains why the acidity of the iron oxide particles decreases with increasing particle size.« less
Siderosomal ferritin. The missing link between ferritin and haemosiderin?
Andrews, S C; Treffry, A; Harrison, P M
1987-01-01
A minor electrophoretically fast component was found in ferritin from iron-loaded rat liver in addition to a major electrophoretically slow ferritin similar to that observed in control rats. The electrophoretically fast ferritin showed immunological identity with the slow component, but on electrophoresis in SDS it gave a peptide of 17.3 kDa, in contrast with the electrophoretically slow ferritin, which gave a major band corresponding to the L-subunit (20.7 kDa). Thus the electrophoretically fast ferritin resembles that reported by Massover [(1985) Biochim. Biophys. Acta 829, 377-386] in livers of mice with short-term parenteral iron overload. The electrophoretically fast ferritin had a lower iron content (2000 Fe atoms/molecule) than the electrophoretically slow ferritin (3000 Fe atoms/molecule). Removal and re-incorporation of iron was possible without effect on the electrophoretic mobility of either ferritin species. On subcellular fractionation the electrophoretically fast ferritin was enriched in pellet fractions and was the sole soluble ferritin isolated from iron-laden secondary lysosomes (siderosomes). The amount and relative proportion of the electrophoretically fast species increased with iron loading. Haemosiderin isolated from siderosomes was found to contain a peptide reactive to anti-ferritin serum and corresponding to the 17.3 kDa peptide of the electrophoretically fast ferritin species. Unlike the electrophoretically slow ferritin, the electrophoretically fast ferritin did not become significantly radioactive in a 1 h biosynthetic labelling experiment. We conclude that the minor ferritin is not, as has been suggested for mouse liver ferritin, 'a completely new species of smaller holoferritin that represents a shift in the ferritin phenotype' in response to siderosis, but a precursor of haemosiderin, in agreement with the proposal by Richter [(1984) Lab. Invest. 50, 26-35] concerning siderosomal ferritin. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3663170
Makino, K
1997-01-01
The electrical surface properties of biological cells have been studied, which provided us with the fundamental knowledge about the cell surface. The change in shape or biological functions of cells may affect the surface properties and can be detected by electrokinetic measurements. Biological cell surfaces are covered with polysaccharide chains, some are charged and some are not. Some polysaccharides produce a hydrogel matrixes under a proper condition. We thus consider it reasonable that cell surface is approximated by a hydrogel surface. Electrophoretic mobility measurements are useful for studying the surface properties of biological cells suspended as colloidal particles in an electrolyte solution. The electro-osmotic velocity measurements on the other hand are advantageous to the study of the surface properties of slab-shaped biological systems such as membranes. This work was started with a hydrogel, as a model material. As a hydrogel, poly(N-isopropylacrylamide) poly(NIPAAm), abbreviated as hereafter, was chosen, because this hydrogel changes its volume depending on temperature. The dependence of the electrophoretic mobility of latex particles covered with poly(NIPAAm) hydrogel layer or of the electro-osmotic mobility on poly(NIPAAm) plate upon temperature and ionic strength of the dispersing medium was well explained with an electrophoretic mobility formula for "soft particles" developed by Ohshima. The electrokinetic measurements and the explanation of data with an electrophoretic mobility formula for "soft particles" give us information about the surface charge density and the "softness" of soft surfaces. On the basis of the findings with hydrogels, we have discussed the relationship between the changes in shape or function of the biological cells and the change in physicochemical surface properties using these measurements. To study the change in physicochemical properties of the cell surface caused by apoptosis, we have measured the electrophoretic mobilities of intact and apoptotic human promyelocytic leukemia cell lines, HL-60RG cells. We have also studied the differences observed in surface properties of malignant lymphosarcoma cell line, RAW117-P, and its variant, RAW117-H10, with a high metastatic property to the liver. In both cases, the cell surfaces became softer by the changes of biological functions. We have applied electrophoresis and electro-osmosis measurements to the study of the electrokinetic surface properties of rat basophilic leukemia cells, RBL cells. It was also found that the surface of Human umbilical vein endothelial cells, HUVEC, is considerably soft as compared with those of other biological cells we have studied before.
Potential of capillary zone electrophoresis for estimation of humate acid-base properties.
Vanifatova, Natalia G; Zavarzina, Anna G; Spivakov, Boris Ya
2008-03-07
Capillary zone electrophoresis (CZE) has been applied for fractionation and characterization of soil-derived humic acids (HAs). Humic acids from soddy-podzolic (HA(s)) and chernozem (HA(ch)) soils were studied as well as hydrophobic high-molecular-weight (HMW) and hydrophilic low-molecular-weight (LMW) HA(s) fractions obtained by salting-out with ammonium sulfate at a saturation of 0-40% and >70%, respectively. The possibility of CZE partial fractionation of HAs has been demonstrated. The shape of "humic hump" was shown to depend on the pH of running electrolyte. Almost the whole peak overlapping occurred if alkaline solutions were used for fractionation, but the peak resolution was improved at pH 5-7. Under appropriate fractionation conditions (pH 7), at least three humic acid subfractions with different electrophoretic mobilities were distinguished in the electropherograms of initial HA and HA(s) fractions. Such a high peak resolution has never been achieved for humic acids before. The presence of three subfractions in the HA is in agreement with gel-filtration analysis and was confirmed by comparison of the electrophoretic behavior of HA(s) with those of its HMW (hydrophobic) and the LMW (hydrophilic) fractions. The potentiometric titration of HA and its fractions was performed and the pK(a) of the functional groups were calculated. An attempt was made for the first time to relate the variation of electrophoretic mobility values with acid-base properties of humic acids. It was shown that changes in the humate charge resulting from the variation of the ionization degree of its functional groups as a function of pH can be estimated on the basis of electrophoretic mobility values. Potential of CZE in estimation of HA isoelectric point was demonstrated. The pH value corresponding to the lowest absolute electrophoretic mobility value of about 20 x 10(-5) cm(2) V(-1) s(-1) can be used for approximate estimation of HA isoelectric point. The data were discussed and agreement with the random coil structural model has been shown.
Optimal MEMS device for mobility and zeta potential measurements using DC electrophoresis.
Karam, Pascal R; Dukhin, Andrei; Pennathur, Sumita
2017-05-01
We have developed a novel microchannel geometry that allows us to perform simple DC electrophoresis to measure the electrophoretic mobility and zeta potential of analytes and particles. In standard capillary geometries, mobility measurements using DC fields are difficult to perform. Specifically, measurements in open capillaries require knowledge of the hard to measure and often dynamic wall surface potential. Although measurements in closed capillaries eliminate this requirement, the measurements must be performed at infinitesimally small regions of zero flow where the pressure driven-flow completely cancels the electroosmotic flow (Komagata Planes). Furthermore, applied DC fields lead to electrode polarization, further questioning the reliability and accuracy of the measurement. In contrast, our geometry expands and moves the Komagata planes to where velocity gradients are at a minimum, and thus knowledge of the precise location of a Komagata plane is not necessary. Additionally, our microfluidic device prevents electrode polarization because of fluid recirculation around the electrodes. We fabricated our device using standard MEMS fabrication techniques and performed electrophoretic mobility measurements on 500 nm fluorescently tagged polystyrene particles at various buffer concentrations. Results are comparable to two different commercial dynamic light scattering based particle sizing instruments. We conclude with guidelines to further develop this robust electrophoretic tool that allows for facile and efficient particle characterization. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Free-zone electrophoresis of animal cells. 1: Experiments on cell-cell interactions
NASA Technical Reports Server (NTRS)
Todd, P. W.; Hjerten, S.
1985-01-01
The electrophoretically migrating zones wasa monitored. The absence of fluid flows in the direction of migration permits direct measurement of electrophoretic velocities of any material. Sedimentation is orthogonal to electrokinetic motion and the effects of particle-particle interaction on electrophoretic mobility is studied by free zone electrophoresis. Fixed erythrocytes at high concentrations, mixtures of fixed erythrocytes from different animal species, and mixtures of cultured human cells were studied in low ionic strength buffers. The electrophoretic velocity of fixed erythrocytes was not altered by increasing cell concentration or by the mixing of erythrocytes from different species. When zones containing cultured human glial cells and neuroblastoma cells are permitted to interact during electrophoresis, altered migration patterns occur. It is found that cell-cell interactions depends upon cell type.
The influence of hydrodynamic slip on the electrophoretic mobility of a spherical colloidal particle
NASA Astrophysics Data System (ADS)
Khair, Aditya S.; Squires, Todd M.
2009-04-01
Recent theoretical studies have suggested a significant enhancement in electro-osmotic flows over hydrodynamically slipping surfaces, and experiments have indeed measured O(1) enhancements. In this paper, we investigate whether an equivalent effect occurs in the electrophoretic motion of a colloidal particle whose surface exhibits hydrodynamic slip. To this end, we compute the electrophoretic mobility of a uniformly charged spherical particle with slip length λ as a function of the zeta (or surface) potential of the particle ζ and diffuse-layer thickness κ-1. In the case of a thick diffuse layer, κa ≪1 (where a is the particle size), simple arguments show that slip does lead to an O(1) enhancement in the mobility, owing to the reduced viscous drag on the particle. On the other hand, for a thin-diffuse layer κa ≫1, the situation is more complicated. A detailed asymptotic analysis, following the method of O'Brien [J. Colloid Interface Sci. 92, 204 (1983)], reveals that an O(κλ) increase in the mobility occurs at low-to-moderate zeta potentials (with ζ measured on the scale of thermal voltage kBT /e≈25 mV). However, as ζ is further increased, the mobility decreases and ultimately becomes independent of the slip length—the enhancement is lost—which is due to the importance of nonuniform surface conduction within the thin-diffuse layer, at large ζ and large, but finite, κa. Our asymptotic calculations for thick and thin-diffuse layers are corroborated and bridged by computation of the mobility from the numerical solution of the full electrokinetic equations (using the method of O'Brien and White [J. Chem. Soc., Faraday Trans. 2 74, 1607 (1978)]). In summary, then, we demonstrate that hydrodynamic slip can indeed produce an enhancement in the electrophoretic mobility; however, such enhancements will not be as dramatic as the previously studied κa →∞ limit would suggest. Importantly, this conclusion applies not only to electrophoresis but also to electro-osmosis over highly charged surfaces, wherein any inhomogeneities (e.g., due to curvature, roughness, charge patterning, or a variation in slip length) will drive nonuniform surface conduction, which prevents the significant slip-driven flow enhancements predicted for a uniform highly charged surface.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neumann, H.; Moran, E.M.; Russell, R.M.
1974-10-11
A distinct alkaline phosphatase (phosphatase N) was demonstrated in the serum of patients with acute lymphatic leukemia, chronic lymphatic leukemia, and infectious mononucleosis. This enzyme closely resembles that extracted from the thymus of mice with lymphoma or lymphatic leukemia, both in its electrophoretic mobility and its substrate specificity. The phosphatase N activity was related to the clinical state of patients with lymphatic leukemia and disappeared with recovery from infectious mononucleosis.
Preparation of guinea pig macrophage for electrophoretic experiments in space
NASA Technical Reports Server (NTRS)
1979-01-01
Methods of storage and cultivation of macrophage cells in preparation for space experiments were investigated. Results show that freezing and thawing immediately after extraction did not cause any change in viability or electrophoretic mobility of the cells. A prolonged storage at -80 C did cause cell damage as indicated by a 95% reduction in variable cells. Cell damage was decreased when Glycerol or Dimethyl Sulfoxide (DMSO) was added as a cryogenic protective agent. A 100% viability was observed in cultivation experiments after two weeks due to the additional serum. Results from gamma-glutamyl transpeptidase study showed a zero activity rate. It is suggested that a flat stationary field be used for the collection and use of macrophage. It was found that a 24-hour delay in obtaining macrophage cells helps to maintain a pure culture.
Startup of electrophoresis in a suspension of colloidal spheres.
Chiang, Chia C; Keh, Huan J
2015-12-01
The transient electrophoretic response of a homogeneous suspension of spherical particles to the step application of an electric field is analyzed. The electric double layer encompassing each particle is assumed to be thin but finite, and the effect of dynamic electroosmosis within it is incorporated. The momentum equation for the fluid outside the double layers is solved through the use of a unit cell model. Closed-form formulas for the time-evolving electrophoretic and settling velocities of the particles in the Laplace transform are obtained in terms of the electrokinetic radius, relative mass density, and volume fraction of the particles. The time scale for the development of electrophoresis and sedimentation is significantly smaller for a suspension with a higher particle volume fraction or a smaller particle-to-fluid density ratio, and the electrophoretic mobility at any instant increases with an increase in the electrokinetic particle radius. The transient electrophoretic mobility is a decreasing function of the particle volume fraction if the particle-to-fluid density ratio is relatively small, but it may increase with an increase in the particle volume fraction if this density ratio is relatively large. The particle interaction effect in a suspension on the transient electrophoresis is much weaker than that on the transient sedimentation of the particles. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nanolaminate microfluidic device for mobility selection of particles
Surh, Michael P [Livermore, CA; Wilson, William D [Pleasanton, CA; Barbee, Jr., Troy W.; Lane, Stephen M [Oakland, CA
2006-10-10
A microfluidic device made from nanolaminate materials that are capable of electrophoretic selection of particles on the basis of their mobility. Nanolaminate materials are generally alternating layers of two materials (one conducting, one insulating) that are made by sputter coating a flat substrate with a large number of layers. Specific subsets of the conducting layers are coupled together to form a single, extended electrode, interleaved with other similar electrodes. Thereby, the subsets of conducting layers may be dynamically charged to create time-dependent potential fields that can trap or transport charge colloidal particles. The addition of time-dependence is applicable to all geometries of nanolaminate electrophoretic and electrochemical designs from sinusoidal to nearly step-like.
Buitenhuis, Johan
2012-09-18
The electrophoretic mobility of rodlike fd viruses is measured and compared to theory, with the theoretical calculations performed according to Stigter (Stigter, D. Charged Colloidal Cylinder with a Gouy Double-Layer. J. Colloid Interface Sci. 1975, 53, 296-306. Stigter, D. Electrophoresis of Highly Charged Colloidal Cylinders in Univalent Salt- Solutions. 1. Mobility in Transverse Field. J. Phys. Chem. 1978, 82, 1417-1423. Stigter, D. Electrophoresis of Highly Charged Colloidal Cylinders in Univalent Salt Solutions. 2. Random Orientation in External Field and Application to Polyelectrolytes. J. Phys. Chem. 1978, 82, 1424-1429. Stigter, D. Theory of Conductance of Colloidal Electrolytes in Univalent Salt Solutions. J. Phys. Chem. 1979, 83, 1663-1670), who describes the electrophoretic mobility of infinite cylinders including relaxation effects. Using the dissociation constants of the ionizable groups on the surfaces of the fd viruses, we can calculate the mobility without any adjustable parameter (apart from the possible Stern layer thickness). In addition, the approximation in the theoretical description of Stigter (and others) of using a model of infinitely long cylinders, which consequently is independent of the aspect ratio, is examined by performing more elaborate numerical calculations for finite cylinders. It is shown that, although the electrophoretic mobility of cylindrical particles in the limit of low ionic strength depends on the aspect ratio much more than "end effects", at moderate and high ionic strengths the finite and infinite cylinder models differ only to a degree that can be attributed to end effects. Furthermore, the range of validity of the Stokes regime is systematically calculated.
Miwa, S; Ono, J; Nakashima, K; Abe, S; Kageoka, T
1976-01-01
Two new variants of glucose 6-phosphate dehydrogenase (G6PD) deficiency associated with chronic nonspherocytic hemolytic anemia were discovered in Japan. Gd(-) Tokushima was found in a 17-years-old male whose erythrocytes contained 4.4% of normal enzyme activity. Partially purified enzyme revealed a main band of normal electrophoretic mobility with additional two minor bands of different mobility; normal Km G6P, and Km NADP five-to sixfold higher than normal; normal utilization of 2-deoxy-G6P, galactose-6P, and deamino-NADP; marked thermal instability; a normal pH curve; and normal Ki NADPH. The hemolytic anemia was moderate to severe. Gd(-) Tokyo was characterized from a 15-year-old male who had chronic nonspherocytic hemolytic anemia of mild degree. The erythrocytes contained 3% of normal enzyme activity, and partially purified enzyme revealed slow electrophoretic mobility (90% of normal for both a tris-hydrochloride buffer system and a tris-EDTA-borate buffer system, and 70% of normal for a phosphate buffer system); normal Km G6P and Km NADP; normal utilization of 2-deoxy-G6P, galactose-6P, and deamino-NADP; greatly increased thermal instability; a normal pH curve; and normal Ki NADPH. These two variants are clearly different from hitherto described G6PD variants, including the Japanese variants Gd(-) Heian and Gd(-) Kyoto. The mothers of both Gd(-) Tokushima and Gd(-) Tokoyo were found to be heterozygote by an ascorbate-cyanide test.
High-concentration zeta potential measurements using light-scattering techniques
Kaszuba, Michael; Corbett, Jason; Watson, Fraser Mcneil; Jones, Andrew
2010-01-01
Zeta potential is the key parameter that controls electrostatic interactions in particle dispersions. Laser Doppler electrophoresis is an accepted method for the measurement of particle electrophoretic mobility and hence zeta potential of dispersions of colloidal size materials. Traditionally, samples measured by this technique have to be optically transparent. Therefore, depending upon the size and optical properties of the particles, many samples will be too concentrated and will require dilution. The ability to measure samples at or close to their neat concentration would be desirable as it would minimize any changes in the zeta potential of the sample owing to dilution. However, the ability to measure turbid samples using light-scattering techniques presents a number of challenges. This paper discusses electrophoretic mobility measurements made on turbid samples at high concentration using a novel cell with reduced path length. Results are presented on two different sample types, titanium dioxide and a polyurethane dispersion, as a function of sample concentration. For both of the sample types studied, the electrophoretic mobility results show a gradual decrease as the sample concentration increases and the possible reasons for these observations are discussed. Further, a comparison of the data against theoretical models is presented and discussed. Conclusions and recommendations are made from the zeta potential values obtained at high concentrations. PMID:20732896
Dissipative particle dynamics: Effects of thermostating schemes on nano-colloid electrophoresis
NASA Astrophysics Data System (ADS)
Hassanzadeh Afrouzi, Hamid; Moshfegh, Abouzar; Farhadi, Mousa; Sedighi, Kurosh
2018-05-01
A novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced in the present study to model the electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Performance of various thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field (0 . 072 < E < 0 . 361 v/nm) covering linear to non-linear response regime, and ionic salt concentration (0.049 < SC < 0 . 69 [M]) covering weak to strong Debye screening of the colloid. System temperature and electrophoretic mobility both show a direct and inverse relationships respectively with electric field and colloidal repulsion; although they each respectively behave direct and inverse trends with salt concentration under various thermostats. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0 . 145[v/nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the system radial distribution function with available EW3D modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.
Asensi-Bernardi, Lucía; Escuder-Gilabert, Laura; Martín-Biosca, Yolanda; Sagrado, Salvador; Medina-Hernández, María José
2014-01-01
The estimation of apparent binding constants and limit mobilities of the complexes of the enantiomers that characterize the interaction of enantiomers with chiral selectors, in this case highly sulfated β-cyclodextrin, was approached using a simple and economic electrophoretic modality, the complete filling technique (CFT) in counter-current mode. The enantiomers of eight psychoactive drugs, four antihistamines (dimethindene, promethazine, orphenadrine and terfenadine) and four antidepressants (bupropion, fluoxetine, nomifensine and viloxazine) were separated for the first time for this cyclodextrin (CD). Estimations of thermodynamic and electrophoretic enantioselectivies were also performed. Results indicate that, in general, thermodynamic enantioselectivity is the main component explaining the high resolution found, but also one case suggests that electrophoretic enantioselectivity itself is enough to obtain a satisfactory resolution. CFT results advantageous compared with conventional capillary electrophoresis (CE) and partial filling technique (PFT) for the study of the interaction between drugs and chiral selectors. It combines the use of a simple fitting model (as in CE), when the enantiomers do not exit the chiral selector plug during the separation (i.e. mobility of electroosmotic flow larger than mobility of CD), and drastic reduction of the consumption (and cost; ~99.7%) of the CD reagent (as in PFT) compared with the conventional CE. Copyright © 2013 John Wiley & Sons, Ltd.
Hisanaga, S; Yasugawa, S; Yamakawa, T; Miyamoto, E; Ikebe, M; Uchiyama, M; Kishimoto, T
1993-06-01
The dephosphorylation-induced interaction of neurofilaments (NFs) with microtubules (MTs) was investigated by using several phosphatases. Escherichia coli alkaline and wheat germ acid phosphatases increased the electrophoretic mobility of NF-H and NF-M by dephosphorylation, and induced the binding of NF-H to MTs. The binding of NFs to MTs was observed only after the electrophoretic mobility of NF-H approached the exhaustively dephosphorylated level when alkaline phosphatase was used. The number of phosphate remaining when NF-H began to bind to MTs was estimated by measuring phosphate bound to NF-H. NF-H did not bind to MTs even when about 40 phosphates from the total of 51 had been removed by alkaline phosphatase. The removal of 6 further phosphates finally resulted in the association of NF-H with MTs. A similar finding, that the restricted phosphorylation sites in the NF-H tail domain, but not the total amount of phosphates, were important for binding to MTs, was also obtained with acid phosphatases. In contrast to alkaline and acid phosphatases, four classes of protein phosphatases (protein phosphatases 1, 2A, 2B, and 2C) were ineffective for shifting the electrophoretic mobility of NF proteins and for inducing the association of NFs to MTs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rayas-Solis, P.
Great Northern bean (Phaseolus vulgaris L.) drum dried flours at native pH of 6.54, pH 6 and 7 showed reduced activities of trypsin inhibitor, ..cap alpha..-amylase inhibitor, hemagglutinating titer, and nitrogen solubility. Electrophoretic analyses showed a slight modification of the native bean proteins, and the presence of at least four trypsin inhibitors. The study of the effect of 2.5-20 kGy irradiation doses on Great Northern beans showed essentially no modification of the electrophoretic mobility of the storage proteins or the trypsin inhibitors. Nitrogen solubility and hemagglutinating activity were essentially unchanged. With the 20 kGy dose, decrease in ..cap alpha..-amylase inhibitormore » activity, decrease reactive/available lysine content, and decrease cooking time of the irradiated beans after 11 months of storage were observed. Taste panel results indicated that the control and 20 kGy irradiated bean were significantly different at 5% level. At 20 kGy dose, the beans developed a partially water soluble brown color.« less
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj
2011-10-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S
2011-01-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373
Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J
2016-01-01
Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and fluid obtained from metal implant sites.
Electrophoretic Mobility Shift Assay (EMSA) for Detecting Protein-Nucleic Acid Interactions
Hellman, Lance M.; Fried, Michael G.
2009-01-01
The gel electrophoresis mobility shift assay (EMSA) is used to detect protein complexes with nucleic acids. It is the core technology underlying a wide range of qualitative and quantitative analyses for the characterization of interacting systems. In the classical assay, solutions of protein and nucleic acid are combined and the resulting mixtures are subjected to electrophoresis under native conditions through polyacrylamide or agarose gel. After electrophoresis, the distribution of species containing nucleic acid is determined, usually by autoradiography of 32P-labeled nucleic acid. In general, protein-nucleic acid complexes migrate more slowly than the corresponding free nucleic acid. In this article, we identify the most important factors that determine the stabilities and electrophoretic mobilities of complexes under assay conditions. A representative protocol is provided and commonly used variants are discussed. Expected outcomes are briefly described. References to extensions of the method and a troubleshooting guide are provided. PMID:17703195
High Molecular Weight Forms of Mammalian Respiratory Chain Complex II
Nůsková, Hana; Holzerová, Eliška; Vrbacký, Marek; Pecina, Petr; Hejzlarová, Kateřina; Kľučková, Katarína; Rohlena, Jakub; Neuzil, Jiri; Houštěk, Josef
2013-01-01
Mitochondrial respiratory chain is organised into supramolecular structures that can be preserved in mild detergent solubilisates and resolved by native electrophoretic systems. Supercomplexes of respiratory complexes I, III and IV as well as multimeric forms of ATP synthase are well established. However, the involvement of complex II, linking respiratory chain with tricarboxylic acid cycle, in mitochondrial supercomplexes is questionable. Here we show that digitonin-solubilised complex II quantitatively forms high molecular weight structures (CIIhmw) that can be resolved by clear native electrophoresis. CIIhmw structures are enzymatically active and differ in electrophoretic mobility between tissues (500 – over 1000 kDa) and cultured cells (400–670 kDa). While their formation is unaffected by isolated defects in other respiratory chain complexes, they are destabilised in mtDNA-depleted, rho0 cells. Molecular interactions responsible for the assembly of CIIhmw are rather weak with the complexes being more stable in tissues than in cultured cells. While electrophoretic studies and immunoprecipitation experiments of CIIhmw do not indicate specific interactions with the respiratory chain complexes I, III or IV or enzymes of the tricarboxylic acid cycle, they point out to a specific interaction between CII and ATP synthase. PMID:23967256
Electrokinetic properties of polymer colloids
NASA Technical Reports Server (NTRS)
Micale, F. J.; Fuenmayor, D. Y.
1986-01-01
The surface of polymer colloids, especially polystyrene latexes, were modified for the purpose of controlling the electrokinetic properties of the resulting colloids. Achievement required a knowledge of electrical double layer charging mechanism, as a function of the electrolyte conditions, at the polymer/water interface. The experimental approach is to control the recipe formulation in the emulsion polymerization process so as to systematically vary the strong acid group concentration on the surface of the polymer particles. The electrophoretic mobility of these model particles will then be measured as a function of surface group concentration and as a function of electrolyte concentration and type. An effort was also made to evaluate the electrophoretic mobility of polystyrene latexes made in space and to compare the results with latexes made on the ground.
Elimination of cdc2 phosphorylation sites in the cdc25 phosphatase blocks initiation of M-phase.
Izumi, T; Maller, J L
1993-01-01
The cdc25 phosphatase is a mitotic inducer that activates p34cdc2 at the G2/M transition by dephosphorylation of Tyr15 in p34cdc2. cdc25 itself is also regulated through periodic changes in its phosphorylation state. To elucidate the mechanism for induction of mitosis, phosphorylation of cdc25 has been investigated using recombinant proteins. cdc25 is phosphorylated by both cyclin A/p34cdc2 and cyclin B/p34cdc2 at similar sets of multiple sites in vitro. This phosphorylation retards its electrophoretical mobility and activates its ability to increase cyclin B/p34cdc2 kinase activity three- to fourfold in vitro, as found for endogenous Xenopus cdc25 in M-phase extracts. The threonine and serine residues followed by proline that are conserved between Xenopus and human cdc25 have been mutated. Both the triple mutation of Thr48, Thr67, and Thr138 and the quintuple mutation of these three threonine residues plus Ser205 and Ser285, almost completely abolish the shift in electrophoretic mobility of cdc25 after incubation with M-phase extracts or phosphorylation by p34cdc2. These mutations inhibit the activation of cdc25 by phosphorylation with p34cdc2 by 70 and 90%, respectively. At physiological concentrations these mutants cannot activate cyclin B/p34cdc2 in cdc25-immunodepleted oocyte extracts, suggesting that a positive feed-back loop between cdc2 and cdc25 is necessary for the full activation of cyclin B/p34cdc2 that induces abrupt entry into mitosis in vivo. Images PMID:7513216
NASA Astrophysics Data System (ADS)
Sun, Cui; Feng, Ya-Qing; Zhang, Bao; Li, Xiang-Gao; Shao, Ji-Zhou; Han, Jing-Jing; Chen, Xu
2013-05-01
The use of Isopar M as a liquid suspending fluid for electrophoretic display was studied. The dispersion stability and chargeability of pigments suspended in Isopar M were investigated. Polyisobutylene monosuccinimide (T-151) as the charge control additive in Isopar M electrophoretic fluid can provide a good electrophoretic mobility to the particles. The wall materials of a series of blue-white, red-white and yellow-white dual-particle microcapsules were prepared by in situ polymerization of urea and formaldehyde. The mass ratio of wall/core material was a key factor in influencing the yield of microcapsules. The concentration of resorcinol has an impact on the surface morphology and mechanical strength of microcapsule wall. Microcapsules' surface morphologies were characterized by optical microscopy and scanning electron microscopy. The performance of the microcapsules with different binder materials and adhesive layers were investigated. Contrast ratio of microcapsules display device were tested every 10 days for a period of 90 days. The compatibility of Isopar M with both the electrophoretic particles and bounding capsule was studied.
NASA Astrophysics Data System (ADS)
Brans, Toon; Strubbe, Filip; Schreuer, Caspar; Neyts, Kristiaan; Beunis, Filip
2015-06-01
We present a novel approach for label-free concentration measurement of a specific protein in a solution. The technique combines optical tweezers and microelectrophoresis to establish the electrophoretic mobility of a single microparticle suspended in the solution. From this mobility measurement, the amount of adsorbed protein on the particle is derived. Using this method, we determine the concentration of avidin in a buffer solution. After calibration of the setup, which accounts for electro-osmotic flow in the measurement device, the mobilities of both bare and biotinylated microspheres are measured as a function of the avidin concentration in the mixture. Two types of surface adsorption are identified: the biotinylated particles show specific adsorption, resulting from the binding of avidin molecules with biotin, at low avidin concentrations (below 0.04 μg/ml) while at concentrations of several μg/ml non-specific on both types of particles is observed. These two adsorption mechanisms are incorporated in a theoretical model describing the relation between the measured mobility and the avidin concentration in the mixture. This model describes the electrophoretic mobility of these particles accurately over four orders of magnitude of the avidin concentration.
Viviano, Jeffrey; Krishnan, Anuradha; Wu, Hao; Venkataraman, Venkat
2016-02-01
In proteins of the neuronal calcium sensor (NCS) family, changes in structure as well as function are brought about by the binding of calcium. In this article, we demonstrate that these structural changes, solely due to calcium binding, can be assessed through electrophoresis in native gels. The results demonstrate that the NCS proteins undergo ligand-dependent conformational changes that are detectable in native gels as a gradual decrease in mobility with increasing calcium but not other tested divalent cations such as magnesium, strontium, and barium. Surprisingly, such a gradual change over the entire tested range is exhibited only by the NCS proteins but not by other tested calcium-binding proteins such as calmodulin and S100B, indicating that the change in mobility may be linked to a unique NCS family feature--the calcium-myristoyl switch. Even within the NCS family, the changes in mobility are characteristic of the protein, indicating that the technique is sensitive to the individual features of the protein. Thus, electrophoretic mobility on native gels provides a simple and elegant method to investigate calcium (small ligand)-induced structural changes at least in the superfamily of NCS proteins. Copyright © 2015 Elsevier Inc. All rights reserved.
Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E
1998-12-01
Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.
Genetic and developmental variation of hemoglobin in the deermouse, Peromyscus maniculatus.
Maybank, K M; Dawson, W D
1976-04-01
A genetic investigation of electrophoretic hemoglobin variants of the deermouse, Peromyscus maniculatus, shows three alleles, Hblf, Hblr, and Hblo, at a duplicated site controlling the six adult phenotypes. The Hblf allele has not been described previously. The hemoglobin locus is not closely linked to the albino locus. Fetal hemoglobin is distinct from any of the adult components and has a slower electrophoretic mobility. The fetal phenotype changes to the adult type between the days 15 and 18 of prenatal life.
A review of light-scattering techniques for the study of colloids in natural waters
Rees, T.F.
1987-01-01
In order to understand the movement of colloidal materials in natural waters, we first need to have a means of quantifying their physical characteristics. This paper reviews three techniques which utilize light-scattering phenomena to measure the translational diffusion coefficient, the rotational diffusion coefficient, and the electrophoretic mobility of colloids suspended in water. Primary emphasis is to provide sufficient theoretical detail so that hydrologists can evaluate the utility of photon correlation spectrometry, electrophoretic light scattering, and electric birefringence analysis. ?? 1987.
Silica-coated titania and zirconia colloids for subsurface transport field experiments
Ryan, Joseph N.; Elimelech, Menachem; Baeseman, Jenny L.; Magelky, Robin D.
2000-01-01
Silica-coated titania (TiO2) and zirconia (ZrO2) colloids were synthesized in two sizes to provide easily traced mineral colloids for subsurface transport experiments. Electrophoretic mobility measurements showed that coating with silica imparted surface properties similar to pure silica to the titania and zirconia colloids. Measurements of steady electrophoretic mobility and size (by dynamic light scattering) over a 90-day period showed that the silica-coated colloids were stable to aggregation and loss of coating. A natural gradient field experiment conducted in an iron oxide-coated sand and gravel aquifer also showed that the surface properties of the silica-coated colloids were similar. Colloid transport was traced at μg L-1 concentrations by inductively coupled plasma-atomic emission spectroscopy measurement of Ti and Zr in acidified samples.
Separability of electrostatic and hydrodynamic forces in particle electrophoresis
NASA Astrophysics Data System (ADS)
Todd, Brian A.; Cohen, Joel A.
2011-09-01
By use of optical tweezers we explicitly measure the electrostatic and hydrodynamic forces that determine the electrophoretic mobility of a charged colloidal particle. We test the ansatz of O'Brien and White [J. Chem. Soc. Faraday IIJCFTBS0300-923810.1039/f29787401607 74, 1607 (1978)] that the electrostatically and hydrodynamically coupled electrophoresis problem is separable into two simpler problems: (1) a particle held fixed in an applied electric field with no flow field and (2) a particle held fixed in a flow field with no applied electric field. For a system in the Helmholtz-Smoluchowski and Debye-Hückel regimes, we find that the electrostatic and hydrodynamic forces measured independently accurately predict the electrophoretic mobility within our measurement precision of 7%; the O'Brien and White ansatz holds under the conditions of our experiment.
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2009-07-01
Electrophoretic mobility data of four proteins are analyzed and interpreted through a physicochemical CZE model, which provides estimates of quantities like equivalent hydrodynamic radius (size), effective charge number, shape orientation factor, hydration, actual pK values of ionizing groups, and pH near molecule, among others. Protein friction coefficients are simulated through the creeping flow theory of prolate spheroidal particles. The modeling of the effective electrophoretic mobility of proteins requires consideration of hydrodynamic size and shape coupled to hydration and effective charge. The model proposed predicts native protein hydration within the range of values obtained experimentally from other techniques. Therefore, this model provides consistently other physicochemical properties such as average friction and diffusion coefficients and packing fractal dimension. As the pH varies from native conditions to those that are denaturing the protein, hydration and packing fractal dimension change substantially. Needs for further research are also discussed and proposed.
Sadek, Samir H.; Pimenta, Francisco; Pinho, Fernando T.
2017-01-01
In this work, we explore two methods to simultaneously measure the electroosmotic mobility in microchannels and the electrophoretic mobility of micron‐sized tracer particles. The first method is based on imposing a pulsed electric field, which allows to isolate electrophoresis and electroosmosis at the startup and shutdown of the pulse, respectively. In the second method, a sinusoidal electric field is generated and the mobilities are found by minimizing the difference between the measured velocity of tracer particles and the velocity computed from an analytical expression. Both methods produced consistent results using polydimethylsiloxane microchannels and polystyrene micro‐particles, provided that the temporal resolution of the particle tracking velocimetry technique used to compute the velocity of the tracer particles is fast enough to resolve the diffusion time‐scale based on the characteristic channel length scale. Additionally, we present results with the pulse method for viscoelastic fluids, which show a more complex transient response with significant velocity overshoots and undershoots after the start and the end of the applied electric pulse, respectively. PMID:27990654
Hibiscus anthocyanins-rich extract inhibited LDL oxidation and oxLDL-mediated macrophages apoptosis.
Chang, Yun-Ching; Huang, Kai-Xun; Huang, An-Chung; Ho, Yung-Chyuan; Wang, Chau-Jong
2006-07-01
The oxidative modification of low-density lipoprotein (LDL) plays a key role in the pathogenesis of atherosclerosis. Anti-oxidative reagents, which can effectively inhibit LDL oxidation, may prevent atherosclerosis via reducing early atherogenesis, and slowing down the progression to advance stages. As shown in previous studies Hibiscus sabdariffa L. is a natural plant containing a lot of pigments that was found to possess anti-oxidative of activity. Therefore, in this study, we evaluated the anti-oxidative activity of Hibiscus anthocyanins (HAs) by measuring their effects on LDL oxidation (in cell-free system) and anti-apoptotic abilities (in RAW264.7 cells). HAs have been tested in vitro examining their relative electrophoretic mobility (REM), Apo B fragmentation, thiobarbituric acid relative substances (TBARS) and radical 1,1-diphenyl-2-picrylhydrazyl (DPPH) scavenging activity assay. The anti-oxidative activity of HAs was defined by relative electrophoretic mobility of oxLDL (decrease of 50% at 2 mg/ml), fragmentation of Apo B (inhibition of 61% at 1mg/ml), and TBARS assay (IC(50): 0.46 mg/ml) in the Cu(2+)-mediated oxidize LDL. Furthermore, the addition of >0.1 mg/ml of HAs could scavenge over 95% of free DPPH radicals, HAs showed strong potential in inhibiting LDL oxidation induced by copper. In addition, to determine whether oxLDL-induced apoptosis in macrophages is inhibited by HAs, we studied the viability, morphology and caspase-3 expression of RAW 264.7 cells. MTT assay, Leukostate staining analysis and Western blotting reveals that HAs could inhibit oxLDL-induced apoptosis. According to these findings, we suggest that HAs may be used to inhibit LDL oxidation and oxLDL-mediated macrophage apoptosis, serving as a chemopreventive agent. However, further investigations into the specificity and mechanism(s) of HAs are needed.
NASA Astrophysics Data System (ADS)
Noel, Amélie; Mirbel, Déborah; Cloutet, Eric; Fleury, Guillaume; Schatz, Christophe; Navarro, Christophe; Hadziioannou, Georges; CyrilBrochon
2018-01-01
In order to obtain efficient electrophoretic inks, Tridodecylamine (Dod3N), has been studied as charge control agent (CCA) in a non-polar paraffin solvent (Isopar G) for various inorganic pigments (TiO2 and Fe2O3). All hydrophobic mineral oxides, i.e. treated with octyltrimethoxysilane (C8) or dodecyltrimethoxysilane (C12), were found to be negatively charged in presence of Dod3N. The electrophoretic mobilities of inorganic pigments seemed to be strongly dependent of their isoelectric point (IEP) and also of the concentration of dod3N with an optimum range between 10 and 20 mM depending on the pigments. Finally, an electrophoretic ink constituted of hydrophobic mineral oxides in presence of Dod3N was tested in a device. Its efficiency as charge control agent to negatively charge hydrophobic particles was confirmed through good optical properties and fast response time (220 ms at 200 kV m-1).
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Todd, P. W.
1985-01-01
Cultured mouse leukemia cells line L5178Y were subjected to upward electrophoresis in a density gradient and the slower migrating cell populations were enriched in G2 cells. It is indicated that this cell line does not change electrophoretic mobility through the cell cycle. The possibility that increased sedimentation downward on the part of the larger G2 cells caused this separation was explored. Two different cell populations were investigated. The log phase population was found to migrate upward faster than the G2 population, and a similar difference between their velocities and calculated on the basis of a 1 um diameter difference between the two cell populations. The G2 and G1 enriched populations were isolated by Ficoll density gradient sedimentation. The bottom fraction was enriched in G2 cells and the top fraction was enriched with G1 cells, especially when compared with starting materials. The electrophoretic mobilities of these two cell populations did not differ significantly from one another. Cell diameter dependent migration curves were calculated and were found to be different. Families of migration curves that differ when cell size is considered as a parameter are predicted.
Population genetic analysis of oral treponemes by multilocus enzyme electrophoresis.
Dahle, U R; Olsen, I; Tronstad, L; Caugant, D A
1995-10-01
Seventeen treponemes recently isolated from necrotic pulps, periodontal and periapical infections and 17 previously well characterized oral treponemal strains were analyzed by multilocus enzyme electrophoresis. Ten genetic loci were characterized on the basis of the electrophoretic mobilities of their enzymatic products. All loci were polymorphic. The average number of alleles per locus was 7.8. The genetic diversity among the electrophoretic types at each locus ranged from 0.624 to 0.836 with a mean genetic diversity per locus of 0.751. The 34 strains represented 34 electrophoretic types, constituting 6 main divisions (I-VI) separated at genetic distances greater than 0.75. Several of the previously characterized treponemes revealed multiple bands of enzyme activity at several loci, indicating that they were not pure. The characterized strains usually clustered within established species, whereas fresh clinical isolates overlapped species borders. There was a large genetic difference between some reference and clinical strains, indicating that the latter may contain undescribed species. Treponema socranskii and Treponema denticola strains clustered in distinct divisions (IV and V, respectively), with the exception of T. denticola strain FDC 51B2 and T. socranskii subsp. paredis strain VPI D46CPE1, both previously well described. This indicated that the taxonomic assignment of these 2 strains should be reconsidered.
Pyell, Ute; Jalil, Alaa H; Pfeiffer, Christian; Pelaz, Beatriz; Parak, Wolfgang J
2015-07-15
Taking gold nanoparticles with different hydrophilic coatings as an example, it is investigated whether capillary electrophoresis in combination with Taylor dispersion analysis allows for the precise determination of mean electrophoretic mobilities, electrophoretic mobility distributions, and zeta potentials in a matrix of exactly known composition and the calibration-free determination of number-weighted mean hydrodynamic radii. Our experimental data confirm that the calculation of the zeta potential for colloidal nanoparticles with ζ>25 mV requires to take the relaxation effect into account. Because of the requirement to avoid particle-wall interactions, a solution of disodiumtetraborate decahydrate (borax) in deionized water had been selected as suitable electrolyte. Measurements of the electrophoretic mobility at different ionic strength and application of the analytic approximation developed by Ohshima show that in the present case of a buffered solution with a weak electrolyte co-ion and a strong electrolyte counterion, the effective ionic drag coefficient should be approximated with the ionic drag coefficient of the counterion. The obtained results are in good agreement with theoretical expectations regarding the dependence of the zeta potential and the electrokinetic surface charge density on the ionic strength. We also show that Taylor dispersion analysis (besides estimation of the number-weighted mean hydrodynamic radius) provides additional information on the type and width of the number-weighted particle distribution. Copyright © 2015 Elsevier Inc. All rights reserved.
Ion size effects on the electrokinetics of spherical particles in salt-free concentrated suspensions
NASA Astrophysics Data System (ADS)
Roa, Rafael; Carrique, Felix; Ruiz-Reina, Emilio
2012-02-01
In this work we study the influence of the counterion size on the electrophoretic mobility and on the dynamic mobility of a suspended spherical particle in a salt-free concentrated colloidal suspension. Salt-free suspensions contain charged particles and the added counterions that counterbalance their surface charge. A spherical cell model approach is used to take into account particle-particle electro-hydrodynamic interactions in concentrated suspensions. The finite size of the counterions is considered including an entropic contribution, related with the excluded volume of the ions, in the free energy of the suspension, giving rise to a modified counterion concentration profile. We are interested in studying the linear response of the system to an electric field, thus we solve the different electrokinetic equations by using a linear perturbation scheme. We find that the ionic size effect is quite important for moderate to high particles charges at a given particle volume fraction. In addition for such particle surface charges, both the electrophoretic mobility and the dynamic mobility suffer more important changes the larger the particle volume fraction for each ion size. The latter effects are more relevant the larger the ionic size.
Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor
2016-07-12
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.
Boulton, A P; Pascall, J C; Craig, R K
1984-01-01
Golgi and endoplasmic-reticulum fractions were prepared from the lactating guinea-pig mammary gland. The endoplasmic-reticulum fraction was highly active in the processing and sequestration of milk-protein primary translation products. Explants from the lactating gland in organ culture were used to identify milk-protein intermediates present in the secretory pathway, and the timing of the events leading to their post-translational modification. With [35S]methionine, the milk proteins labelled after a short pulse (3 min) were represented by the partially processed (but not phosphorylated) caseins and alpha-lactalbumin sequestered within membrane-bound vesicles. After a 30 min labelling period, higher-Mr caseins with electrophoretic mobilities identical with those of the phosphorylated caseins isolated from milk were identified in the incubation medium, and sequestered within membrane-bound vesicles. Pulse-chase experiments established a precursor-product relationship between these forms. Secretion is apparent approx. 30 min after sequestration. Caseins are highly phosphorylated; removal of the phosphate residues with acid phosphatase results in proteins with increased electrophoretic mobility, similar to those of the partially processed early casein intermediates found sequestered in explants after a 3 min pulse with [35S]methionine, and those sequestered within microsomal membranes after mRNA-directed cell-free protein synthesis. A comparison of the proteins labelled during both short (5 min) and long (30 min) pulses with [35S]methionine and [32P]Pi shows that, in contrast with the 35S-labelled caseins, those labelled with [32P]Pi exhibit only electrophoretic mobilities identical with those of the mature caseins isolated from milk and those identified after long labelling periods with [35S]methionine. No phosphorylated early intermediate forms of caseins were identified. We conclude that the synthesis and post-translational modification of guinea-pig caseins occurs in two stages, (i) an early event involving synthesis and sequestration within the endoplasmic reticulum, an event that involves signal-peptide removal, followed (ii) 10-20 min later by phosphorylation at a different point in the secretory pathway, probably in the Golgi complex. Secretion of the phosphorylated caseins occurs 10-20 min later. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6477529
NASA Technical Reports Server (NTRS)
Todd, P.
1980-01-01
The following aspects of kidney cell electrophoresis are discussed: (1) the development and testing of electrophoresis solutions; (2) optimization of freezing and thawing; (3) procedures for evaluation of separated kidney cells; and (4) electrophoretic mobility characterization of kidney cells.
NASA Technical Reports Server (NTRS)
Todd, P.
1979-01-01
A kidney cell electrophoresis technique is described in four parts: (1) the development and testing of electrophoresis solutions; (2) optimization of freezing and thawing; (3) procedures for evaluation of separated kidney cells; and (4) electrophoretic mobility characteristics of kidney cells.
Rigsby, C M; Showalter, D N; Herms, D A; Koch, J L; Bonello, P; Cipollini, D
2015-07-01
Emerald ash borer, Agrilus planipennis Fairmaire, an Asian wood-boring beetle, has devastated ash (Fraxinus spp.) trees in North American forests and landscapes since its discovery there in 2002. In this study, we collected living larvae from EAB-resistant Manchurian ash (Fraxinus mandschurica), and susceptible white (Fraxinus americana) and green (Fraxinus pennsylvanica) ash hosts, and quantified the activity and production of selected detoxification, digestive, and antioxidant enzymes. We hypothesized that differences in larval physiology could be used to infer resistance mechanisms of ash. We found no differences in cytochrome P450, glutathione-S-transferase, carboxylesterase, sulfotransferase, and tryptic BApNAase activities between larvae feeding on different hosts. Despite this, Manchurian ash-fed larvae produced a single isozyme of low electrophoretic mobility that was not produced in white or green ash-fed larvae. Additionally, larvae feeding on white and green ash produced two serine protease isozymes of high electrophoretic mobility that were not observed in Manchurian ash-fed larvae. We also found lower activity of β-glucosidase and higher activities of monoamine oxidase, ortho-quinone reductase, catalase, superoxide dismutase, and glutathione reductase in Manchurian ash-fed larvae compared to larvae that had fed on susceptible ash. A single isozyme was detected for both catalase and superoxide dismutase in all larval groups. The activities of the quinone-protective and antioxidant enzymes are consistent with the resistance phenotype of the host species, with the highest activities measured in larvae feeding on resistant Manchurian ash. We conclude that larvae feeding on Manchurian ash could be under quinone and oxidative stress, suggesting these may be potential mechanisms of resistance of Manchurian ash to EAB larvae, and that quinone-protective and antioxidant enzymes are important counter-adaptations of larvae for dealing with these resistance mechanisms. Copyright © 2015 Elsevier Ltd. All rights reserved.
Morphology of human embryonic kidney cells in culture after space flight
NASA Technical Reports Server (NTRS)
Todd, P.; Kunze, M. E.; Williams, K.; Morrison, D. R.; Lewis, M. L.; Barlow, G. H.
1985-01-01
The ability of human embyronic kidney cells to differentiate into small epithelioid, large epithelioid, domed, and fenestrated morphological cell types following space flight is examined. Kidney cells exposed to 1 day at 1 g, then 1 day in orbit, and a 12 minute passage through the electrophoretic separator are compared with control cultures. The data reveal that 70 percent of small epithelioid, 16 percent of large epithelioid, 9 percent of dome-forming, and 5 percent of fenestrated cells formed in the space exposed cells; the distributions correlate well with control data. The formation of domed cells from cells cultured from low electrophoretic mobility fractions and small epithelioid cells from high mobility fractions is unaffected by space flight conditions. It is concluded that storage under microgravity conditions does not influence the morphological differentiation of human embryonic kidney cells in low-passage culture.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thornton, Michelle
Capillary electrophoresis (CE) is an effective method for separating ionic species according to differences in their electrophoretic mobilities. CE separations of amino acids by direct detection are difficult due to their similar electrophoretic mobilities and low absorbances. However, native amino acids can be separated by CE as cations at a low pH by adding an alkanesulfonic acid to the electrolyte carrier which imparts selectivity to the system. Derivatization is unnecessary when direct UV detection is used at 185 nm. Simultaneous speciation of metal cations such as vanadium (IV) and vanadium (V) can easily be performed without complexation prior to analysis.more » An indirect UV detection scheme for acidic conditions was also developed using guanidine as the background carrier electrolyte (BCE) for the indirect detection of metal cations. Three chapters have been removed for separate processing. This report contains introductory material, references, and general conclusions. 80 refs.« less
Electrokinetic transport phenomena: Mobility measurement and electrokinetic instability
NASA Astrophysics Data System (ADS)
Oddy, Michael Huson
Miniaturization and integration of traditional bioassay procedures into microfabricated on-chip assay systems, commonly referred to as "Micro Total Analysis" (muTAS) systems, may have a significant impact on the fields of genomics, proteomics, and clinical analysis. These bioanalytical microsystems leverage electroosmosis and electrophoresis for sample transport, mixing, manipulation, and separation. This dissertation addresses the following three topics relevant to such systems: a new diagnostic for measuring the electrophoretic mobility of sub-micron, fluorescently-labeled particles and the electroosmotic mobility of a microchannel; a novel method and device for rapidly stirring micro- and nanoliter volume solutions for microfluidic bioanalytical applications; and a multiple-species electrokinetic instability model. Accurate measurement of the electrophoretic particle mobility and the electroosmotic mobility of microchannel surfaces is crucial to understanding the stability of colloidal suspensions, obtaining particle tracking-based velocimetry measurements of electroosmotic flow fields, and the quantification of electrokinetic bioanalytical device performance. A method for determining these mobilities from alternating and direct current electrokinetic particle tracking measurements is presented. The ability to rapidly mix fluids at low Reynolds numbers is important to the functionality of many bioanalytical, microfluidic devices. We present an electrokinetic process for rapidly stirring microflow streams by initiating an electrokinetic flow instability. The design, fabrication and performance analysis of two micromixing devices capable of rapidly stirring two low Reynolds number fluid streams are presented. Electroosmotic and electrophoretic transport in the presence of conductivity mismatches between reagent streams and the background electrolytes, can lead to an unstable flow field generating significant sample dispersion. In the multiple-species electrokinetic instability model, we consider a high aspect ratio microchannel geometry, a conductivity gradient orthogonal to the applied electric field, and a four-species chemistry model. A linear stability analysis of the depth-averaged governing equations shows unstable eigenmodes for conductivity ratios as close to unity as 1.01. Experiments and full nonlinear simulations of the governing equations were conducted for a conductivity ratio of 1.05. Images of the disturbance dye field from the nonlinear simulations show good qualitative and quantitative agreement with experiment. Species electromigration is shown to a have significant influence on the development of the conductivity field and instability dynamics in multi-ion configurations.
Beckenbach, Andrew T.; Prakash, Satya
1977-01-01
Recently a number of electrophoretic techniques have been applied to reveal the presence of additional genetic variation among the electrophoretic mobility classes of the highly polymorphic xanthine dehydrogenase (XDH ) and esterase-5 (est-5) loci. We examined the hexokinase loci of Drosophila pseudoobscura and D. persimilis using a variety of techniques to determine whether further allelic variation could be revealed for these much less polymorphic loci and to analyze the nature of the known variation at the hexokinase-1 (hex-1) locus. The following studies were conducted: 135 strains of the two species from six localities were examined with buffer pH ranging from 5.5 to 10.0; 40 strains of D. pseudoobscura and 9 strains of D. persimilis from Mather were studied using starch gel concentrations ranging from 8.5 to 15.5% and were examined for differences in heat stability and reactivity to the thiol reagent pCMSA; strains were also tested for susceptibility to urea denaturation and differences in relative activities. Major findings of the work are: (1) No additional allelic variation could be detected at any of the hexokinase loci by applying these techniques. The finding of abundant hidden genetic variation in XDH and est-5 does not extend to all enzyme loci. (2) Evidence from studies using pCMSA indicates that the hex-1 alleles 0.6, 0.8, 1.0 and 1.2 of the two species form a series of unit charge steps. Since the 0.94 allele of D. persimilis has mobility intermediate between 0.8 and 1.0, it is argued that routine electrophoretic techniques are sensitive to at least some conservative amino acid substitutions. (3) Strong correlations were found at the hex-1 locus between low allelic frequency, reduced relative activity and reduced stability to heat and urea denaturation. Since the three sibling species, D. pseudoobscura, D. persimilis and D. miranda, all appear to share a common high frequency allele (1.0) at that locus, these findings are taken as evidence that the observed allelic frequencies are a result of directional selection and mutation, rather than any form of balancing selection. PMID:17248785
Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V
1996-01-19
Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.
Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B
2014-03-01
Several global chain properties of relatively long peptides composed of 20 amino acid residues are estimated through the modeling of their experimental effective electrophoretic mobilities determined by CZE for 2 < pH < 6. In this regard, an all l-α-eicosapeptide, including a secondary α-helix (Peptide 1) and its all retro d-inverso-α-eicosapeptide (Peptide 2), are considered. Despite Peptides 1 and 2 are isomeric chains, they do not present similar global conformations in the whole range of pH studied. These peptides may also differ in the quality of BGE components chain interactions depending on the pH value. Three Peptide 1 fragments (Peptides 3, 4, and 5) are also analyzed in this framework with the following purposes: (i) visualization of the effects of initial and final strands at each side of the α-helix on the global chain conformations of Peptide 1 at different pHs and (ii) analysis of global chain conformations of Peptides 1 and 2, and Peptide 1 fragments in relation to their pI values. Also, the peptide maximum and minimum hydrations predicted by the model, compatible with experimental effective electrophoretic mobilities at different pHs, are quantified and discussed, and needs for further research concerning chain hydration are proposed. It is shown that CZE is a useful analytical tool for peptidomimetic designs and purposes. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Major immunoglobulin classes of the echidna (Tachyglossus aculeatus)
Atwell, J. L.; Marchalonis, J. J.; Ealey, E. H. M.
1973-01-01
The Australian echidna responds to the antigen Salmonella adelaide flagella by producing antibodies characterized by mol. wt of 900,000 and 150,000. After cleavage of interchain disulphide bonds, both the high and low mol. wt immunoglobulins can be resolved into light and heavy polypeptide chains. In both cases, the light chains resemble those of other vertebrate immunoglobulins in size (22,500 Daltons) and electrophoretic mobility. The 900,000 Dalton immunoglobulin contains heavy chains similar to human μ chains in size (70,000 Daltons) and electrophoretic mobility. The 150,000 Dalton immunoglobulin contains a different class of heavy chain, similar in size (50,000 Daltons) and electrophoretic mobility to human γ chains. Proportional mass contributions of the light and heavy chains to the intact molecule suggest the structure of the intact molecules could be represented by (L2, μ2)5 and (L2, γ2) for the high and low mol. wt immunoglobulins respectively. These configurations are similar to those described for human γM and γG immunoglobulins. The results are relevant to theories of the evolution of the different classes of immunoglobulins. While the echidna is distinctly more primitive than eutherian mammals and still retains structural features characteristic of reptiles, its major immunoglobulin classes are very similar to human IgM and IgG. The striking similarities between the γ-like heavy chain of the echnidna and human IgG heavy chains suggest that the echidna may be the first species in which a γ chain gene directly homologous to mammalian γ chain genes is expressed. ImagesFIG. 4 PMID:4761634
Analysis of NCAM helps identify unusual phenotypes of hereditary inclusion-body myopathy.
Broccolini, A; Gidaro, T; Tasca, G; Morosetti, R; Rodolico, C; Ricci, E; Mirabella, M
2010-07-20
Hereditary inclusion-body myopathy or distal myopathy with rimmed vacuoles (h-IBM/DMRV) is due to mutations of the UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE) gene, which codes for an enzyme of the sialic acid biosynthetic pathway. By Western blot (WB) analysis, we have previously shown that in h-IBM/DMRV muscle, the neural cell adhesion molecule (NCAM) has increased electrophoretic mobility that reflects reduced sialylation of the protein. To identify patients with h-IBM/DMRV with atypical clinical or pathologic phenotype using NCAM analysis and the possible cellular mechanism associated with the overall abnormal sialylation of NCAM observed in this disorder. WB analysis of NCAM was performed on muscle biopsies of 84 patients with an uncharacterized muscle disorder who were divided in the following 2 groups: 1) 46 patients with a proximal muscle weakness in whom the main limb-girdle muscular dystrophy syndromes had been ruled out; and 2) 38 patients with a distal distribution of weakness in whom a neurogenic affection had been excluded. Patients in whom a reduced sialylation of NCAM was suspected were studied for the presence of GNE mutations. In 3 patients, we found that NCAM had increased electrophoretic mobility, thus suggesting an abnormal sialylation of the protein. The genetic study demonstrated that they all carried pathogenic GNE mutations. Further studies demonstrated that hyposialylated NCAM, showing increased electrophoretic mobility on WB, is expressed by nonregenerating fibers in h-IBM/DMRV muscle. WB analysis of NCAM may be instrumental in the identification of h-IBM/DMRV with atypical clinical or pathologic features.
Lee, Myung W.; Song, C.K.
2012-01-01
In this study, solution processes were developed for backplane using an organic thin film transistor (OTFT) as a driving device for an electrophoretic display (EPD) panel. The processes covered not only the key device of OTFTs but also interlayer and pixel electrodes. The various materials and printing processes were adopted to achieve the requirements of devices and functioning layers. The performance of OTFT of the backplane was sufficient to drive EPD sheet by producing a mobility of 0.12 cm2/v x sec and on/off current ratio of 10(5).
ALTERATIONS OF PROPERTIES OF RED BLOOD CELLS MEMBRANES PROTEINS OF DIFFERENT AGE AND SEX VOLUNTEERS.
Pruidze, N; Khetsuriani, R; Sujashvili, R; Ioramashvili, I; Arabuli, M; Sanikidze, T
2015-01-01
Considering the age and sex-dependent trend in the manifestation of various diseases, as well as an important pathogenic role of circulatory disorders, we decided to study the age-dependent changes in the physical properties of RBCs membrane proteins (their electric charge and molecular weight) in healthy people of different sex (males and females) and age. Blood of 56 healthy volunteers (Tbilisi, Georgia) of different sex and gender was studied (the patients were divided in 8 groups (7 patients in each groups): 1 - 18-25 years old male, 2 - 18-25 years old female, 3 - 25-44 years old male, 4 - 25-44 years old female, 5 - 44-60 years old male, 6 - 44-60 years old female; 7 - 60-80 years old male, 8 - 70-80 years old female). In groups 6 and 8 were women in menopause was determined according 12 months of amenorrhea. Individuals often consume alcohol addicts, pregnant women and patients with chronic diseases were excluded from the study. The study protocol was approved by Ethical Committee of the Tbilisi State Medical University. RBCs membrane proteins have been extracted from human heparinized blood and their mobility was studied by electrophoretic method. The electrophoretic mobility of RBCs membrane proteins decreases with age of healthy volunteers, that indicates decrease of total charge of proteins, depending on the electrically charged amino acids content. In female patients the electrophoretic mobility of the RBCs membrane proteins especially intensively decreases in period of menopause. Increase of molecular weight of proteins (100-200 kDa) from RBCs' membranes of alder age group was manifested. Intensively decrease electrophoretic mobility of erythrocytes membrane proteins from female patients in period of menopause indicates on estrogen related mechanism of the regulation of membrane protein conformation and composition in females. Increased content of high molecular weight proteins in the RBCs membranes from patients of older age groups may be caused to disorders of protein-protein interaction mechanisms, their ubiquitinylation or oligomerisation and formation of high molecular weight complexes of inactivated proteins in aged RBCs. These processes play important role in regulation of the RBCs shape and stability. Identified sex- and age-related alterations in RBCs membranes proteins affect the rheological properties of blood and can be considered as the etiologic and pathogenic markers of various diseases.
Gwarda, Radosław Ł; Dzido, Tadeusz H
2018-07-13
In our previous papers we have investigated the influence of the mobile phase composition on mechanism of retention, selectivity and efficiency of peptide separation in various high-performance thin-layer chromatography (HPTLC) systems with commercially available silica-based adsorbents. We have also investigated the influence of pH of the mobile phase buffer on migration and separation of peptides in pressurized planar electrochromatography (PPEC). Here we investigate the influence of concentration of ion-pairing additive, and concentration and type of organic modifier of the mobile phase on migration of peptides in PPEC system with octadecyl silica-based adsorbent, and with the same set of the solutes as before. We compare our current results with the results obtained before for similar HPTLC and PPEC systems, and discuss the influence of particular variables on retention, electrophoretic mobility of solutes and electroosmotic flow of the mobile phase. We show, that the final selectivity of peptide separation results from co-influence of all the three factors mentioned. Concentration of organic modifier of the mobile phase, as well as concentration of ion-pairing additive, affect the retention, the electrophoretic mobility, and the electroosmotic flow simultaneously. This makes independent optimization of these factors rather difficult. Anyway PPEC offers much faster separation of peptides with quite different selectivity, in comparison to HPTLC, with similar adsorbents and similar mobile phase composition. However, we also present and discuss the issue of extensive tailing of peptide zones in the PPEC in comparison to similar HPTLC systems. Copyright © 2018 Elsevier B.V. All rights reserved.
Johnson, D E; Brookhart, G L; Kramer, K J; Barnett, B D; McGaughey, W H
1990-03-01
Midgut homogenates from susceptible and resistant strains of the Indian meal moth, Plodia interpunctella, were compared for their ability to activate the entomocidal parasporal crystal protein from Bacillus thuringiensis. The properties of midgut proteinases from both types of larvae were also examined. Electrophoretic patterns of crystal protein from B. thuringiensis subspecies kurstaki (HD-1) and aizawai (HD-133 and HD-144) were virtually unchanged following digestion by either type of midgut homogenate. Changes in pH (9.5 to 11.5) or midgut homogenate concentration during digestion failed to substantially alter protein electrophoretic patterns of B. thuringiensis HD-1 crystal toxin. In vitro toxicity of crystal protein activated by either type of midgut preparation was equal toward cultured insect cells from either Manduca sexta or Choristoneura fumiferana. Electrophoresis of midgut extracts in polyacrylamide gels containing gelatin as substrate also yielded matching mobility patterns of proteinases from both types of midguts. Quantitation of midgut proteolytic activity using tritiated casein as a substrate revealed variation between midgut preparations, but no statistically significant differences between proteolytic activities from susceptible and resistant Indian meal moth larvae. Inhibition studies indicated that a trypsin-like proteinase with maximal activity at pH 10 is a major constituent of Indian meal moth midguts. The results demonstrated that midguts from susceptible and resistant strains of P. interpunctella are similar both in their ability to activate B. thuringiensis protoxin and in their proteolytic activity.
United States Air Force Summer Faculty Research Program. Management Report. Volume 4
1988-12-01
Anderson, N.L. et al (1986). Effects of Aroclor 1254 on proteins of mouse liver: Aplication of two-dimensional electrophoretic protein mapping...transferability of job skill, has surfaced in the context of civilian occupational mobility (Byrne, 1975; Fine, 1957a, 1957b) transitions from military to...considerations from concept through deployment. Defense Management Journal, 16(2), 12-19. Byrne, J. J. (1975). Occupational mobility of workers. Monthly
Pedersen-Bjergaard, S; Rasmussen, K E; Sannes, E
1998-01-01
While the hallucinogenic mushrooms Psilocybe semilanceata have previously been analyzed for the indole alkaloids psilocybin and baeocystin by capillary zone electrophoresis (CZE) at pH 11.5, the present work focused on the development of an alternative and complementary capillary electrophoretic method for their identification. Owing to their structural similarity and zwitterionic nature, the compounds were difficult to resolve based on different interactions with cationic or anionic micelles. However, while the attempts with micellar electrokinetic chromatography (MEKC) were unsuccessful, rapid derivatization with propyl chloroformate and reanalysis by CZE at pH 11.5 was effective to support identification of the two indole alkaloids. Psilocin was difficult to analyze by CZE at pH 11.5 owing to comigration with the electroosmotic flow. For this compound, the pH of the running buffer was reduced to 7.2 to effectively enhance the electrophoretic mobility.
Endospore surface properties of commonly used Bacillus anthracis surrogates vary in aqueous solution
The hydrophobic character and electrophoretic mobility of microorganisms are vital aspects of understanding their interactions with the environment. These properties are fundamental in fate-and-transport, physiological, and virulence studies, and thus integral in surrogate select...
Binary Oscillatory Crossflow Electrophoresis
NASA Technical Reports Server (NTRS)
Molloy, Richard F.; Gallagher, Christopher T.; Leighton, David T., Jr.
1996-01-01
We present preliminary results of our implementation of a novel electrophoresis separation technique: Binary Oscillatory Cross flow Electrophoresis (BOCE). The technique utilizes the interaction of two driving forces, an oscillatory electric field and an oscillatory shear flow, to create an active binary filter for the separation of charged species. Analytical and numerical studies have indicated that this technique is capable of separating proteins with electrophoretic mobilities differing by less than 10%. With an experimental device containing a separation chamber 20 cm long, 5 cm wide, and 1 mm thick, an order of magnitude increase in throughput over commercially available electrophoresis devices is theoretically possible.
Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor
2016-01-01
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089
Determination of ionization constants by paper electrophoresis.
Tate, M E
1981-01-01
Dimensionless apparent ionization constants of charged low-molecular-weight species may be obtained from paper-electrophoretic data at 20-25 degrees C with buffers (I0.1-0.5) of measured pH (1.5-12.5) containing oxalate ions. Relative mobilities rather than absolute mobilities were measured by using glycerol and m-nitrobenzenesulphonate respectively as standards of zero and unit mobility. Application of the procedure to ionizations of adenine, adenosine, 2'-deoxyadenosine, 3'-deoxyadenosine, 3':5'-cyclic AMP, ADP, ADP-glucose-agrocin 84 and ATP is described. PMID:6976169
Gel electrophoresis of linear and star-branched DNA
NASA Astrophysics Data System (ADS)
Lau, Henry W.; Archer, Lynden A.
2011-12-01
The electrophoretic mobility of double-stranded DNA in polyacrylamide gel is investigated using an activated hopping model for the transport of a charged object within a heterogeneous medium. The model is premised upon a representation of the DNA path through the gel matrix as a series of traps with alternating large and small cross sections. Calculations of the trap dimensions from gel data show that the path imposes varying degrees of confinement upon migrating analytes, which retard their forward motion in a size-dependent manner. An expression derived for DNA mobility is shown to provide accurate predictions for the dynamics of linear DNA (67-622 bp) in gels of multiple concentrations. For star-branched DNA, the incorporation within the model of a length scale previously proposed to account for analyte architecture [Yuan , Anal. Chem.ANCHAM0003-270010.1021/ac060414w 78, 6179 (2006)] leads to mobility predictions that compare well with experimental results for a wide range of DNA shapes and molecular weights.
High temperature microelectrophoresis studies of the solid oxide/water interface
NASA Astrophysics Data System (ADS)
Fedkin, Mark Valentinovich
Metal oxides are abundant components of geo-environmental systems and are widely used materials in industry. Many practical applications of oxide materials require the knowledge of their surface properties at both ambient and elevated temperatures. Due to substantial technical challenges associated with experimental studies of solid/water interfaces at elevated temperatures, consistent data on adsorption, surface charge, and zeta potential for most oxide materials are limited to temperatures less than 100°C. A high temperature microelectrophoresis technique, developed in this study, made it possible to extend the zeta potential measurements at the solid oxide/water interface to 200°C. The design of the high temperature electrophoresis cell allowed for the visual microscopic observation of the electrophoretic movement of suspended particles through pressure-tight sapphire windows. The electrophoretic mobilities of metal oxide particles suspended in aqueous solutions were measured in a DC electric field as a function of pH, ionic strength, and temperature. The experimental procedure and methods for evaluation of the main experimental parameters (electrophoretic mobility, electric field strength, high temperature pH, and cell constant) have been developed. Zeta potentials were calculated from the experimental data using O'Brien and White's (1978) numerical solution for electrophoretic mobility equation. Zeta potentials and isoelectric points (IEP) of the metal oxide/aqueous solution interface were experimentally determined for ZrO2, TiO 2(rutile), and alphaAl2O3 at 25, 120, and 200°C. The background solutions used for the preparation of suspensions were pure H2O, NaCl(aq) (10-4--10-2 mol.kg-1), and SrCl2 (10-4 mol.kg, for TiO2). For all studied materials, the IEPs were found to regularly decrease with increasing temperature, which agrees with available theoretical predictions. Thermodynamic functions, including Gibbs energy, enthalpy, and heat capacity, were estimated for the H +/OH- adsorption from the experimental IEP data using the 1-pK model of the oxide/water interface. The experimental information obtained in this study combined with data from potentiometric titration and other experimental methods form the basis for future theoretical studies of the electrical double layer at the oxide/water interface.
The surface properties of microorganisms play an important role in their behavior within the environment. Electrophoretic mobility and cell surface hydrophobicity of bacterial cells influence their initial interaction with surfaces and mediate their stability within an aqueous su...
CONDUCTOMETRIC CHARACTERIZATION OF DISSOLVED HUMIC MATERIALS. (R828158)
Conductometric replacement titrations of humic and fulvic acids dissolved in a slight excess of hydroxide were carried out with standard acid. The slope of the titration curve corresponding to the protonation of humate/fulvate was related to the electrophoretic mobility of the...
Environmental Degradation of Materials: Surface Chemistry Related to Stress Corrosion Cracking
NASA Technical Reports Server (NTRS)
Schwarz, J. A.
1985-01-01
Parallel experiments have been performed in order to develop a comprehensive model for stress cracking (SCC) in structural materials. The central objective is to determine the relationship between the activity and selectivity of the microstructure of structural materials to their dissolution kinetics and experimentally measured SCC kinetics. Zinc was chosen as a prototype metal system. The SCC behavior of two oriented single-crystal disks of zinc in a chromic oxide/sodium sulfate solution (Palmerton solution) were determined. It was found that: (1) the dissolution rate is strongly (hkil)-dependent and proportional to the exposure time in the aggressive environment; and (2) a specific slip system is selectively active to dissolution under applied stress and this slip line controls crack initiation and propagation. As a precursor to potential microgrvity experiments, electrophoretic mobility measurements of zinc particles were obtained in solutions of sodium sulfate (0.0033 M) with concentrations of dissolved oxygen from 2 to 8 ppm. The equilibrium distribution of exposed oriented planes as well as their correlation will determine the particle mobility.
Peroxiredoxin 3 Is a Redox-Dependent Target of Thiostrepton in Malignant Mesothelioma Cells
Newick, Kheng; Cunniff, Brian; Preston, Kelsey; Held, Paul; Arbiser, Jack; Pass, Harvey; Mossman, Brooke; Shukla, Arti; Heintz, Nicholas
2012-01-01
Thiostrepton (TS) is a thiazole antibiotic that inhibits expression of FOXM1, an oncogenic transcription factor required for cell cycle progression and resistance to oncogene-induced oxidative stress. The mechanism of action of TS is unclear and strategies that enhance TS activity will improve its therapeutic potential. Analysis of human tumor specimens showed FOXM1 is broadly expressed in malignant mesothelioma (MM), an intractable tumor associated with asbestos exposure. The mechanism of action of TS was investigated in a cell culture model of human MM. As for other tumor cell types, TS inhibited expression of FOXM1 in MM cells in a dose-dependent manner. Suppression of FOXM1 expression and coincidental activation of ERK1/2 by TS were abrogated by pre-incubation of cells with the antioxidant N-acetyl-L-cysteine (NAC), indicating its mechanism of action in MM cells is redox-dependent. Examination of the mitochondrial thioredoxin reductase 2 (TR2)-thioredoxin 2 (TRX2)-peroxiredoxin 3 (PRX3) antioxidant network revealed that TS modifies the electrophoretic mobility of PRX3. Incubation of recombinant human PRX3 with TS in vitro also resulted in PRX3 with altered electrophoretic mobility. The cellular and recombinant species of modified PRX3 were resistant to dithiothreitol and SDS and suppressed by NAC, indicating that TS covalently adducts cysteine residues in PRX3. Reduction of endogenous mitochondrial TRX2 levels by the cationic triphenylmethane gentian violet (GV) promoted modification of PRX3 by TS and significantly enhanced its cytotoxic activity. Our results indicate TS covalently adducts PRX3, thereby disabling a major mitochondrial antioxidant network that counters chronic mitochondrial oxidative stress. Redox-active compounds like GV that modify the TR2/TRX2 network may significantly enhance the efficacy of TS, thereby providing a combinatorial approach for exploiting redox-dependent perturbations in mitochondrial function as a therapeutic approach in mesothelioma. PMID:22761781
Wang, Nan-Hsuan; Lee, Wan-Li; Her, Guor-Rong
2011-08-15
A strategy based on postcolumn electrophoretic mobility control (EMC) was developed to alleviate the adverse effect of trifluoroacetic acid (TFA) on the liquid chromatography-mass spectrometry (LC-MS) analysis of peptides. The device created to achieve this goal consisted of a poly(dimethylsiloxane) (PDMS)-based junction reservoir, a short connecting capillary, and an electrospray ionization (ESI) sprayer connected to the outlet of the high-performance liquid chromatography (HPLC) column. By apply different voltages to the junction reservoir and the ESI emitter, an electric field was created across the connecting capillary. Due to the electric field, positively charged peptides migrated toward the ESI sprayer, whereas TFA anions remained in the junction reservoir and were removed from the ionization process. Because TFA did not enter the ESI source, ion suppression from TFA was alleviated. Operation of the postcolumn device was optimized using a peptide standard mixture. Under optimized conditions, signals for the peptides were enhanced 9-35-fold without a compromise in separation efficiency. The optimized conditions were also applied to the LC-MS analysis of a tryptic digest of bovine serum albumin.
Capillary Electrophoresis Sensitivity Enhancement Based on Adaptive Moving Average Method.
Drevinskas, Tomas; Telksnys, Laimutis; Maruška, Audrius; Gorbatsova, Jelena; Kaljurand, Mihkel
2018-06-05
In the present work, we demonstrate a novel approach to improve the sensitivity of the "out of lab" portable capillary electrophoretic measurements. Nowadays, many signal enhancement methods are (i) underused (nonoptimal), (ii) overused (distorts the data), or (iii) inapplicable in field-portable instrumentation because of a lack of computational power. The described innovative migration velocity-adaptive moving average method uses an optimal averaging window size and can be easily implemented with a microcontroller. The contactless conductivity detection was used as a model for the development of a signal processing method and the demonstration of its impact on the sensitivity. The frequency characteristics of the recorded electropherograms and peaks were clarified. Higher electrophoretic mobility analytes exhibit higher-frequency peaks, whereas lower electrophoretic mobility analytes exhibit lower-frequency peaks. On the basis of the obtained data, a migration velocity-adaptive moving average algorithm was created, adapted, and programmed into capillary electrophoresis data-processing software. Employing the developed algorithm, each data point is processed depending on a certain migration time of the analyte. Because of the implemented migration velocity-adaptive moving average method, the signal-to-noise ratio improved up to 11 times for sampling frequency of 4.6 Hz and up to 22 times for sampling frequency of 25 Hz. This paper could potentially be used as a methodological guideline for the development of new smoothing algorithms that require adaptive conditions in capillary electrophoresis and other separation methods.
Electrokinetic Particle Aggregation and Flow Instabilities in Non-Dilute Colloidal Suspensions
NASA Astrophysics Data System (ADS)
Navaneetham, Guru; Posner, Jonathan
2007-11-01
An experimental investigation of electrokinetic particle aggregation and flow instabilities of non-dilute colloidal suspensions in microfabricated channels is presented. The addition of charged colloidal particles can alter the solution's conductivity, permittivity as well as the average particle electrophoretic mobility. In this work, a colloid volume fraction gradient is achieved at the intersection of a Y-shaped PDMS microchannel. The solution conductivity and the particle mobility as a function of the particle (500 nm polystyrene) volume fraction are presented. The critical conditions required for particle aggregation and flow instability are given along with a scaling analysis which shows that the flow becomes unstable at a critical electric Rayleigh number for a wide range of applied electric fields and colloid volume fractions. Electrokinetic particle aggregation and instabilities of non-dilute colloidal suspensions may be important for applications such as the electrophoretic deposition of particles to form micropatterned colloidal assemblies, electrorheological devices, and on-chip, electrokinetic manipulation of colloids.
Le Cerf, Didier; Pepin, Anne Sophie; Niang, Pape Momar; Cristea, Mariana; Karakasyan-Dia, Carole; Picton, Luc
2014-11-26
The formation of polyelectrolyte complexes (PECs) between carboxymethyl pullulan and DEAE Dextran, was investigated, in dilute solution, with emphasis on the effect of charge density (molar ratio or pH) and molar masses. Electrophoretic mobility measurements have evidenced that insoluble PECs (neutral electrophoretic mobility) occurs for charge ratio between 0.6 (excess of polycation) and 1 (stoichiometry usual value) according to the pH. This atypical result is explained by the inaccessibility of some permanent cationic charge when screened by pH dependant cationic ones (due to the Hoffman alkylation). Isothermal titration calorimetry (ITC) indicates an endothermic formation of PEC with a binding constant around 10(5) L mol(-1). Finally asymmetrical flow field flow fractionation coupled on line with static multi angle light scattering (AF4/MALS) evidences soluble PECs with very large average molar masses and size around 100 nm, in agreement with scrambled eggs multi-association between various polyelectrolyte chains. Copyright © 2014 Elsevier Ltd. All rights reserved.
Influence of phosphate on the transport properties of lead in sand.
Butkus, Michael A; Johnson, Marie C
2011-01-15
Temporal moment analysis was used to examine the transport of lead species in sand columns. The influence of sodium phosphate (PO(4(aq))) and hydroxyapatite (HA) on lead transport was also evaluated. Transport properties of lead microparticles (diameter>0.45 μm) were a function of electrophoretic mobility: those particles with electrophoretic mobility less than -1 × 10(-8)m(2)/Vs exhibited significantly lower dimensionless first temporal moment (θ) and second temporal moment (σ(θ)(2)). The forms of lead investigated in this work had a tendency to move in sand over a wide pH range. Although the PO(4(aq)) amendment substantially reduced lead mass recoveries in the sand column effluent, lead microparticles were formed that had a tendency to move rapidly and with minimal dispersion when compared with controls. Treatments with HA provided limited reduction in lead mass recovery and minimal changes in lead transport properties. A colloid stability model was used to predict attachment of lead particles in sand. Published by Elsevier B.V.
Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.
Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M
2001-11-01
Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.
Wilson, Emma L; Garton, Mark; Fuller, Heidi R
2016-05-01
Phenytoin is an antiepileptic drug used in the management of partial and tonic-clonic seizures. In previous studies we have shown that valproate, another antiepileptic drug, reduced the amount of two key bone proteins, pro-collagen I and osteonectin (SPARC, BM-40), in both skin fibroblasts and cultured osteoblast-like cells. Here we show that phenytoin also reduces pro-collagen I production in osteoblast-like cells, but does not appear to cause a decrease in osteonectin message or protein production. Instead, a 24h exposure to a clinically relevant concentration of phenytoin resulted in a dose-dependent change in electrophoretic mobility of osteonectin, which was suggestive of a change in post-translational modification status. The perturbation of these important bone proteins could be one of the mechanisms to explain the bone loss that has been reported following long-term treatment with phenytoin. Copyright © 2016 Elsevier B.V. All rights reserved.
Castro, Felipe D; Sedman, Jacqueline; Ismail, Ashraf A; Asadishad, Bahareh; Tufenkji, Nathalie
2010-06-01
The effects of dissolved oxygen tension during bacterial growth and acclimation on the cell surface properties and biochemical composition of the bacterial pathogens Escherichia coli O157:H7 and Yersinia enterocolitica are characterized. Three experimental techniques are used in an effort to understand the influence of bacterial growth and acclimation conditions on cell surface charge and the composition of the bacterial cell: (i) electrophoretic mobility measurements; (ii) potentiometric titration; and (iii) ATR-FTIR spectroscopy. Potentiometric titration data analyzed using chemical speciation software are related to measured electrophoretic mobilities at the pH of interest. Titration of bacterial cells is used to identify the major proton-active functional groups and the overall concentration of these cell surface ligands at the cell membrane. Analysis of titration data shows notable differences between strains and conditions, confirming the appropriateness of this tool for an overall charge characterization. ATR-FTIR spectroscopy of whole cells is used to further characterize the bacterial biochemical composition and macromolecular structures that might be involved in the development of the net surficial charge of the organisms examined. The evaluation of the integrated intensities of HPO(2)(-) and carbohydrate absorption bands in the IR spectra reveals clear differences between growth protocols. Taken together, the three techniques seem to indicate that the dissolved oxygen tension during cell growth or acclimation can noticeably influence the expression of cell surface molecules and the measurable cell surface charge, though in a strain-dependent fashion.
Yamazaki, Yuji; Kubota, Hiroshi; Nozaki, Masami; Nagata, Kazuhiro
2003-08-15
The chaperonin-containing t-complex polypeptide 1 (CCT) is a molecular chaperone that facilitates protein folding in eukaryotic cytosol, and the expression of CCT is highly dependent on cell growth. We show here that transcription of the gene encoding the theta subunit of mouse CCT, Cctq, is regulated by the ternary complex factors (TCFs), Elk-1, Sap-1a, and Net (Sap-2). Reporter gene assay using HeLa cells indicated that the Cctq gene promoter contains a cis-acting element of the CCGGAAGT sequence (CQE1) at -36 bp. The major CQE1-binding proteins in HeLa cell nuclear extract was recognized by anti-Elk-1 or anti-Sap-1a antibodies in electrophoretic mobility shift assay, and recombinant Elk-1, Sap-1a, or Net specifically recognized CQE1. The CQE1-dependent transcriptional activity in HeLa cells was virtually abolished by overexpression of the DNA binding domains of TCFs. Overexpression of full-length TCFs with Ras indicated that exogenous TCFs can regulate the CQE1-dependent transcription in a Ras-dependent manner. PD98059, an inhibitor of MAPK, significantly repressed the CQE1-dependent transcription. However, no serum response factor was detected by electrophoretic mobility shift assay using the CQE1 element. These results indicate that transcription of the Cctq gene is regulated by TCFs under the control of the Ras/MAPK pathway, probably independently of serum response factor.
Su, Wei; Qian, Quanquan; Li, Peiyuan; Lei, Xiaolin; Xiao, Qi; Huang, Shan; Huang, Chusheng; Cui, Jianguo
2013-11-04
A series of ketone-N(4)-substituted thiosemicarbazone (TSC) compounds (L1-L9) and their corresponding [(η(6)-p-cymene)Ru(II)(TSC)Cl](+/0) complexes (1-9) were synthesized and characterized by NMR, IR, elemental analysis, and HR-ESI-mass spectrometry. The molecular structures of L4, L9, 1-6, and 9 were determined by single-crystal X-ray diffraction analysis. The compounds were further evaluated for their in vitro antiproliferative activities against the SGC-7901 human gastric cancer, BEL-7404 human liver cancer, and HEK-293T noncancerous cell lines. Furthermore, the interactions of the compounds with DNA were followed by electrophoretic mobility spectrometry studies.
Variation of human intestinal gamma-glutamyl transpeptidase in ontogenetic development.
Sobiech, K A; Szewczuk, A
1977-01-01
Activity of gamma-glutamyl transpeptidase in human intestines was measured against alpha-naphthylamide and 12 gamma-glutamyl amino acids and peptides as substrate. Distinctly altered activity was found to accompany ontogenetic development. The ratio of the transpeptidase activity tested against monoglutamyl substrates in the intestines of 7-month fetuses, newborns and adults was 15:1:4, whereas the ratio of gamma-glutamyl cyclotransferase activities in the same age groups was 1-0:1-2:1-6. Distinct differences were found in resistance to heating, sensitivity to L-serine plus borate, and other effectors, and electrophoretic mobility, between fetal gamma-glutamyl transpeptidase and the enzyme from adults, which supports the hypothesis of existence of two forms of the enzyme in the human intestines. The results suggest involvement of gamma-glutamyl transpeptidase in the pathomechanism of celiakia in children.
USDA-ARS?s Scientific Manuscript database
Surface macromolecule cleavage experiments were conducted on enterohaemorrhagic Escherichia coli O157:H7 cells to investigate the influence of these macromolecules on cell surface properties. Electrophoretic mobility, hydrophobicity, and titration experiments were carried out on proteinase K treate...
Chen, M; Hieng, S; Qian, X; Costa, R; Ou, J H
1994-11-15
Hepatitis B virus (HBV) ENI enhancer can activate the expression of HBV and non-HBV genes in a liver-specific manner. By performing the electrophoretic mobility-shift assays, we demonstrated that the three related, liver-enriched, transcription factors, HNF3 alpha, HNF3 beta, and HNF3 gamma could all bind to the 2c site of HBV ENI enhancer. Mutations introduced in the 2c site to abolish the binding by HNF3 reduced the enhancer activity approximately 15-fold. Moreover, expression of HNF3 antisense sequences to suppress the expression of HNF3 in Huh-7 hepatoma cells led to reduction of the ENI enhancer activity. These results indicate that HNF3 positively regulates the ENI enhancer activity and this regulation is most likely mediated through the 2c site. The requirement of HNF3 for the ENI enhancer activity could explain the liver specificity of this enhancer element.
Sanchez-Moreno, M; Ortega, J E; Valero, A
1989-12-01
High levels of malate dehydrogenase were found in Trichuris ovis. Two molecular forms of the enzyme, of different cellular location and electrophoretic pattern, were isolated and purified. The activity of soluble malate dehydrogenase was greater than that of mitochondrial malate dehydrogenase. Both forms also displayed different electrophoretic profiles in comparison with purified extracts from goat (Capra hircus) liver. Substrate concentration directly affected enzyme activity. Host and parasite malate dehydrogenase activity were both inhibited by a series of benzimidazoles and pyrimidine-derived compounds, some of which markedly reduced parasite enzyme activity, but not host enzyme activity. Percentage inhibition by some pyrimidine derivatives was greater than that produced by benzimidazoles.
Hemoglobin Brigham (α2Aβ2100 Pro→Leu). HEMOGLOBIN VARIANT ASSOCIATED WITH FAMILIAL ERYTHROCYTOSIS
Lokich, Jacob J.; Moloney, William C.; Bunn, H. Franklin; Bruckheimer, Sally M.; Ranney, Helen M.
1973-01-01
Erythrocytosis associated with the presence of a hemoglobin with increased oxygen affinity has been reported for 10 hemoglobin variants, most of which demonstrate altered electrophoretic mobility. Several members of a family were found to have erythrocytosis, and both the whole blood and the hemoglobin exhibited increased oxygen affinity. Phosphate-free hemoglobin solutions had a normal Bohr effect and reactivity to 2,3-diphosphoglycerate. The electrophoretic properties of the hemoglobin were normal, but on peptide mapping of a tryptic digest of the isolated β-chains, a normal βT11 peptide and an abnormal βT11 with greater Rf were seen. Analysis of the abnormal peptide showed the substitution of leucine for the normal proline at β100 (helical residue G2). The hemoglobin variant, designated Hb Brigham, serves to emphasize the necessity for detailed evaluation of the structure and function of hemoglobin in familial erythrocytosis even with electrophoretically “normal” hemoglobin. PMID:4719677
Cathodic electrodeposition of ceramic and organoceramic materials. Fundamental aspects.
Zhitomirsky, I
2002-03-29
Electrodeposition of ceramic materials can be performed by electrophoretic (EPD) or electrolytic (ELD) deposition. Electrophoretic deposition is achieved via motion of charged particles towards an electrode under an applied electric field. Electrolytic deposition produces colloidal particles in cathodic reactions for subsequent deposition. Various electrochemical strategies and deposition mechanisms have been developed for electrodeposition of ceramic and organoceramic films, and are discussed in the present article. Electrode-position of ceramic and organoceramic materials includes mass transport, accumulation of particles near the electrode and their coagulation to form a cathodic deposit. Various types of interparticle forces that govern colloidal stability in the absence and presence of processing additives are discussed. Novel theoretical contributions towards an interpretation of particle coagulation near the electrode surface are reviewed. Background information is given on the methods of particle charging, stabilization of colloids in aqueous and non-aqueous media, electrophoretic mobility of ceramic particles and polyelectrolytes, and electrode reactions. This review also covers recent developments in the electrodeposition of ceramic and organoceramic materials.
Plant cell transformation with Agrobacterium tumefaciens under simulated microgravity
NASA Astrophysics Data System (ADS)
Sarnatska, Veresa; Gladun, Hanna; Padalko, Svetlana
To investigate simulated microgravity (clinorotation) effect on plant cell transformation with Agrobacterium tumefaciens and crown gall formation, the culture of primary explants of potato and Jerusalem artichoke tubers was used. It is found that the efficiency of tumor formation and development in clinorotated explants are considerably reduced. When using the explants isolated from potato tubers clinorotated for 3, 5 and 19 days, drastic reduction of formation and development of crown gall tumors was observed. Conversely, the tumor number and their development increased when potato tubers were clinorotated for one day. As was estimated by us previously, cells of Jerusalem artichoke explants are the most sensitive to agrobacteria on 4-5 h of in vitro culturing and this time corresponds to the certain period of G1-stage of the cell cycle. We have also estimated that this period is characterized by the increase of binding of acridine orange by nuclear chromatin and increase in activity of RNA-polymerase I and II. Inoculation of explants with agrobacteria in this period was the most optimal for transformation and crown gall induction. We estimated that at four - hour clinorotation of explants the intensity of acridine orange binding to nuclei was considerably lower than on 4h in the control. At one-day clinorotation of potato tubers, a considerable increase in template accessibility of chromatin and in activity of RNA-polymerase I and II occurred. These results may serve as an evidence for the ability of plant dormant tissues to respond to microgravity. Another demonstration of dormant tissue response to changed gravity we obtained when investigating pathogenesis-related proteins (PR-proteins). PR-proteins were subjected to nondenaturing PAGE.and we have not found any effect of microgravity on PR-proteins of potato explants with normal or tumorous growth. We may suggest that such response derives from the common effects of two stress factors - wounding and changed gravity. Investigation of the effect of microgravity on PR-proteins of dormant potato tubers showed that an intensity of several electrophoretic fractions of these proteins with middle electrophoretic mobility increased and appeared two new minor fractions with high electrophoretic mobility under clinorotation of tubers. We discuss the possibility to use short term clinorotation of plant organs, from which the explants for the transformation with A. tumefaciens will be isolated, for an increase in the transformation efficiency of recalcitrant plants.
Electrophoretic separation of kidney and pituitary cells on STS-8
NASA Technical Reports Server (NTRS)
Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Grindeland, R.; Lewis, M. L.
1984-01-01
Specific secretory cells were separated from suspensions of cultured primary human embryonic cells and rat pituitary cells in microgravity conditions, with an objective of isolating the subfractions of kidney cells that produce the largest amount of urakinase, and the subfractions of rat pituitary cells that secrete growth hormones (GH), prolactin (PRL), and other hormones. It is inferred from the experimental observations that the surface charge distributions of the GH-containing cells differ from those of the PRL-containing cells, which is explained by the presence of secretory products on the surface of pituitary cells. For kidney cells, the electrophoretic mobility distributions in flight experiments were spread more than the ground controls.
Zugel, S A; Burke, B J; Regnier, F E; Lytle, F E
2000-11-15
Two-photon excited fluorescence detection was performed on a microfabricated electrophoresis chip. A calibration curve of the fluorescent tag beta-naphthylamine was performed, resulting in a sensitivity of 2.5 x 10(9) counts M(-1) corresponding to a detection limit of 60 nM. Additionally, leucine aminopeptidase was assayed on the chip using electrophoretically mediated microanalysis. The differential electroosmotic mobilities of the enzyme and substrate, L-leucine beta-naphthylamide, allowed for efficient mixing in an open channel, resulting in the detection of a 30 nM enzyme solution under constant potential. A zero potential incubation for 1 min yielded a calculated detection limit of 4 nM enzyme.
Biophysical studies of spermatozoa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pistenma, David Andrew
1970-12-01
The objectives of this thesis include characterization of spermatozoa according to several physical properties (morphology, size, electrophoretic mobility, sedimentation rate and specific gravity), correlation of these properties with several biological properties (viability, intrinsic motility, fertilizing capacity, antigenicity and genetic composition) and an evaluation of interrelationships among these properties and with selected experimental variables.
USDA-ARS?s Scientific Manuscript database
Selenite Se(IV) and selenate Se(VI) selenium adsorption behavior was investigated on gibbsite as a function of solution pH and solution ionic strength. Adsorption of both Se redox states decreased with increasing solution pH. Electrophoretic mobility measurements showed downward shifts in point of...
Isoelectric focusing of red blood cells in a density gradient stabilized column
NASA Technical Reports Server (NTRS)
Smolka, A. J. K.; Miller, T. Y.
1980-01-01
The effects of Ficoll and cell application pH on red blood cell electrophoretic mobility and focusing pH were investigated by focusing cells in a density gradient stabilized column. Sample loading, cell dispersion, column conductivity, resolution of separation, and the effect of Ampholines were examined.
Viviano, Jeffrey; Krishnan, Anuradha; Scully, Jenna; Wu, Hao; Venkataraman, Venkat
2016-06-01
In this data article we show the specificity of the Ca(2+)-induced mobility shift in three proteins that belong to the neuronal calcium sensor (NCS) protein family: Hippocalcin, GCAP1 and GCAP2. These proteins did not display a shift in mobility in native gels when incubated with divalent cations other than Ca(2+) - such as Mg(2+), Ba(2+), and Sr(2+), even at 10× concentrations. The data is similar to that obtained with another NCS protein, neurocalcin delta (Viviano et al., 2016, "Electrophoretic Mobility Shift in Native Gels Indicates Calcium-dependent Structural Changes of Neuronal Calcium Sensor Proteins", [1]).
Shao, Guo; Zhou, Wei-Hua; Gao, Cui-Ying; Zhang, Ran; Lu, Guo-Wei
2007-02-01
To observe change of binding activity of HIF-1 with erythropoietin (EPO) hypoxia response element (HRE) in the hippocampus of mice preconditioned to hypoxia and explore relationship between the changes and the preconditioning. The hippocampus was removed from mice exposed to hypoxia for 0 run (control group), 1 run (H1 group) and 4 runs(H4 group). Electrophoretic mobility shift assays (EMSA), chromatin immunoprecipitation (ChIP)and real time PCR were used to detect the change of activity of HIF-1 on HRE of EPO. Both in vitro and in vivo binding tests showed that the HIF-1 DNA-binding activities were increased in group H1 and markedly increased in group H4. The increase of HIF-1 and HRE of EPO binding activities is thought be involved in hypoxic preconditioning.
Start-up of electrophoresis of an arbitrarily oriented dielectric cylinder.
Chen, Guan Y; Keh, Huan J
2014-09-01
An analytical study is presented for the transient electrophoretic response of a circular cylindrical particle to the step application of an electric field. The electric double layer adjacent to the particle surface is thin but finite compared with the radius of the particle. The time-evolving electroosmotic velocity at the outer boundary of the double layer is utilized as a slip condition so that the transient momentum conservation equation for the bulk fluid flow is solved. Explicit formulas for the unsteady electrophoretic velocity of the particle are obtained for both axially and transversely applied electric fields, and can be linearly superimposed for an arbitrarily-oriented applied field. If the cylindrical particle is neutrally buoyant in the suspending fluid, the transient electrophoretic velocity is independent of the orientation of the particle relative to the applied electric field and will be in the direction of the applied field. If the particle is different in density from the fluid, then the direction of electrophoresis will not coincide with that of the applied field until the steady state is attained. The growth of the electrophoretic mobility with the elapsed time for a cylindrical particle is substantially slower than for a spherical particle. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2010-08-01
Peptide electrophoretic mobility data are interpreted through a physicochemical CZE model, providing estimates of the equivalent hydrodynamic radius, hydration, effective and total charge numbers, actual ionizing pK, pH-near molecule and electrical permittivity of peptide domain, among other basic properties. In this study, they are used to estimate some peptide global structural properties proposed, providing thus a distinction among different peptides. Therefore, the solvent drag on the peptide is obtained through a characteristic friction power coefficient of the number of amino acid residues, defined from the global chain conformation in solution. As modeling of the effective electrophoretic mobility of peptides is carried out in terms of particle hydrodynamic size and shape coupled to hydration and effective charge, a packing dimension related to chain conformation within the peptide domain may be defined. In addition, the effective and total charge number fractions of peptides provide some clues on the interpretation of chain conformations within the framework of scaling laws. Furthermore, the model estimates transport properties, such as sedimentation, friction and diffusion coefficients. As the relative numbers of ionizing, polar and non-polar amino acid residues vary in peptides, their global structural properties defined here change appreciably. Needs for further research are also discussed.
Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A
2014-06-01
The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. Copyright © 2014 Elsevier B.V. All rights reserved.
A study of proteases and protease-inhibitor complexes in biological fluids
Granelli-Piperno, A; Reich, E
1978-01-01
We have (a) screened a variety of cell lines and body fluids for plasminogen activators and (b) studied the activity of proteases bound to α2- macroglobulin after exposing the complexes to partial degradation and/or denaturing procedures to unmask proteolytic activity. The respective results show (a) that the plasminogen activators in urine and cell culture media are generally of lower molecular weight than those in plasma; and (b) that proteases bound to α2-macroglobulin recover the ability to attack macromolecular substrates after exposure to sodium dodecyl sulfate while retaining the electrophoretic mobility of the protease inhibitor complex. This indicates that the protease and inhibitor are probably linked by covalent bonds. In contrast, other complexes formed between proteases and inhibitors of lower molecular weight (such as soybean or Kunitz inhibitors) are fully dissociated by sodium dodecyl sulfate (SDS). The experiments described were based on a new procedure for detecting proteolytic enzyme activity in SDS-polyacrylamide gels. The method relies on solutions of nonionic detergents for extracting SDS, after which the electrophoretic gel is applied to an indicator gel consisting of a fibrin- agar mixture. The method is sensitive, permitting the detection of proteinases in less than 1 μl of fresh plasma, and it is effective for resolving small differences in molecular weight. The procedure can be quantitated and, with minor modifications appropriate to each particular system, it has been applied to a broad spectrum of serine enzymes and proenzymes, including some that function in the pathways of fibrinolysis, coagulation and kinin-generation. Other potential applications appear likely. PMID:78958
Loued, Soumaya; Berrougui, Hicham; Componova, Pamela; Ikhlef, Souad; Helal, Olfa; Khalil, Abdelouahed
2013-10-01
Paraoxonase 1 (PON1) is associated with HDL and modulates the antioxidant and anti-inflammatory role of HDL. The goals of the present study were to investigate the effect of ageing and the role of PON1 on the anti-inflammatory activity of HDL, and to determine whether extra-virgin olive oil (EVOO) consumption could improve the atheroprotective activity of HDL. HDL and PON1 were isolated from the plasma of ten young (Y-HDL and Y-PON1) and ten elderly (E-HDL and E-PON1) healthy volunteers before and after 12 weeks of EVOO consumption. Inflammation was assessed by measuring intracellular adhesion molecule 1 (ICAM-1) expression. THP-1 (human acute monocytic leukaemia cell line) monocyte chemotaxis was measured using a Boyden chamber. Oxidative damage to HDL was assessed by measuring conjugated diene formation and changes in electrophoretic migration. Y-HDL had more anti-inflammatory activity than E-HDL. The conjugated diene content and the electrophoretic mobility of E-HDL were higher than those of Y-HDL. Y-PON1 had significant anti-inflammatory activity, reducing ICAM-1 expression by 32·64 (SD 2·63)%, while E-PON1 had no significant effect. THP-1 chemotaxis measurements confirmed the ICAM-1 expression results. The 12 weeks of EVOO consumption significantly increased the anti-inflammatory activities of both HDL and PON1. The anti-inflammatory activity of HDL was modulated by PON1 and was lower in the elderly volunteers. EVOO consumption increased the anti-inflammatory effect of HDL and reduced the age-related decrease in anti-atherogenic activity.
Leung, Jacqueline M.; Tran, Fanny; Pathak, Ravindra B.; Poupart, Séverine; Heaslip, Aoife T.; Ballif, Bryan A.; Westwood, Nicholas J.; Ward, Gary E.
2014-01-01
Motility of the protozoan parasite Toxoplasma gondii plays an important role in the parasite’s life cycle and virulence within animal and human hosts. Motility is driven by a myosin motor complex that is highly conserved across the Phylum Apicomplexa. Two key components of this complex are the class XIV unconventional myosin, TgMyoA, and its associated light chain, TgMLC1. We previously showed that treatment of parasites with a small-molecule inhibitor of T. gondii invasion and motility, tachypleginA, induces an electrophoretic mobility shift of TgMLC1 that is associated with decreased myosin motor activity. However, the direct target(s) of tachypleginA and the molecular basis of the compound-induced TgMLC1 modification were unknown. We show here by “click” chemistry labelling that TgMLC1 is a direct and covalent target of an alkyne-derivatized analogue of tachypleginA. We also show that this analogue can covalently bind to model thiol substrates. The electrophoretic mobility shift induced by another structural analogue, tachypleginA-2, was associated with the formation of a 225.118 Da adduct on S57 and/or C58, and treatment with deuterated tachypleginA-2 confirmed that the adduct was derived from the compound itself. Recombinant TgMLC1 containing a C58S mutation (but not S57A) was refractory to click labelling and no longer exhibited a mobility shift in response to compound treatment, identifying C58 as the site of compound binding on TgMLC1. Finally, a knock-in parasite line expressing the C58S mutation showed decreased sensitivity to compound treatment in a quantitative 3D motility assay. These data strongly support a model in which tachypleginA and its analogues inhibit the motility of T. gondii by binding directly and covalently to C58 of TgMLC1, thereby causing a decrease in the activity of the parasite’s myosin motor. PMID:24892871
Galson, D L; Tsuchiya, T; Tendler, D S; Huang, L E; Ren, Y; Ogura, T; Bunn, H F
1995-04-01
The erythropoietin (Epo) gene is regulated by hypoxia-inducible cis-acting elements in the promoter and in a 3' enhancer, both of which contain consensus hexanucleotide hormone receptor response elements which are important for function. A group of 11 orphan nuclear receptors, transcribed and translated in vitro, were screened by the electrophoretic mobility shift assay. Of these, hepatic nuclear factor 4 (HNF-4), TR2-11, ROR alpha 1, and EAR3/COUP-TF1 bound specifically to the response elements in the Epo promoter and enhancer and, except for ROR alpha 1, formed DNA-protein complexes that had mobilities similar to those observed in nuclear extracts of the Epo-producing cell line Hep3B. Moreover, both anti-HNF-4 and anti-COUP antibodies were able to supershift complexes in Hep3B nuclear extracts. Like Epo, HNF-4 is expressed in kidney, liver, and Hep3B cells but not in HeLa cells. Transfection of a plasmid expressing HNF-4 into HeLa cells enabled an eightfold increase in the hypoxic induction of a luciferase reporter construct which contains the minimal Epo enhancer and Epo promoter, provided that the nuclear hormone receptor consensus DNA elements in both the promoter and the enhancer were intact. The augmentation by HNF-4 in HeLa cells could be abrogated by cotransfection with HNF-4 delta C, which retains the DNA binding domain of HNF-4 but lacks the C-terminal activation domain. Moreover, the hypoxia-induced expression of the endogenous Epo gene was significantly inhibited in Hep3B cells stably transfected with HNF-4 delta C. On the other hand, cotransfection of EAR3/COUP-TF1 and the Epo reporter either with HNF-4 into HeLa cells or alone into Hep3B cells suppressed the hypoxia induction of the Epo reporter. These electrophoretic mobility shift assay and functional experiments indicate that HNF-4 plays a critical positive role in the tissue-specific and hypoxia-inducible expression of the Epo gene, whereas the COUP family has a negative modulatory role.
Kim, Min-Jung; Han, Jong-Min; Jin, Yue-Yan; Baek, Nam-In; Bang, Myun-Ho; Chung, Hae-Gon; Choi, Myung-Sook; Lee, Kyung-Tae; Sok, Dai-Eun; Jeong, Tae-Sook
2008-04-01
Oxidized low-density lipoprotein (oxLDL) plays a key role in the inflammatory processes of atherosclerosis. Jaceosidin isolated from the methanolic extracts of the aerial parts of Artemisia princeps Pampanini cv. Sajabal was tested for antioxidant and anti-inflammatory activities. Jaceosidin inhibited the Cu(2+)-mediated LDL oxidation with IC(50) values of 10.2 microM in the thiobarbituric acid-reactive substances (TBARS) assay as well as the macrophage-mediated LDL oxidation. The antioxidant activities of jaceosidin were exhibited in the conjugated diene production, relative electrophoretic mobility, and apoB-100 fragmentation on copper-mediated LDL oxidation. Jaceosidin also inhibited the generation of reactive oxygen species (ROS) concerning in regulation of NF-kappaB signaling. And jaceosidin inhibited nuclear factor-kappa B (NF-kappaB) activity, nitric oxide (NO) production, and suppressed expression of inducible nitric oxide synthase (iNOS) in lipopolysaccharide (LPS)-induced RAW264.7 macrophages.
Analysis of E2F factors during epidermal differentiation.
Chang, Wing Y; Dagnino, Lina
2005-01-01
The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.
Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.
Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T
2018-06-01
To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.
Stability and transport of graphene oxide nanoparticles in groundwater and surface water
USDA-ARS?s Scientific Manuscript database
A transport study investigating the effects of natural organic matter (NOM) in the presence of monovalent (KCl) and divalent (CaCl2) salts was performed in a packed bed column. The electrophoretic mobility (EPM) and effective diameter of the graphene oxide nanoparticles (GONPs) were measured as a fu...
USDA-ARS?s Scientific Manuscript database
Selenite Se(IV) and selenate Se(VI) adsorption behavior was investigated on gibbsite as a function of solution pH and solution ionic strength. Adsorption of both Se redox states decreased with increasing solution pH. Electrophoretic mobility measurements showed downward shifts in point of zero cha...
Protein markers for discrimination of meat species in raw beef, pork and poultry and their mixtures.
Kim, Gap-Don; Seo, Jin-Kyu; Yum, Hyeon-Woong; Jeong, Jin-Yeon; Yang, Han-Sul
2017-02-15
The purpose of this study was to find discrimination markers for four major meat species such as beef, pork, chicken and duck. Myofibrillar and sarcoplasmic proteins isolated from each meat type were analyzed by one-dimensional gel electrophoresis and some proteins were identified through LC-MS/MS analysis. We confirmed that troponin I (TnI), enolase 3, l-lactate dehydrogenase (LDH) and triose-phosphate isomerase (TPI) could be useful markers for discrimination of mammals from poultry due to their different electrophoretic mobility. Tropomyosin 1 and carbonic anhydrase 3 were observed as muscle fiber type-related proteins and these could also be markers to distinguish mammals from poultry. Species-specific peptides identified by LC-MS/MS spectra allow the identification of each species regardless of the same protein. Therefore, it is easy to discriminate between mammals and poultry by comparing the electrophoretic mobility of TnI, enolase 3, LDH, TPI and CA3, and each species could be identified through LC-MS/MS analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Sant, Himanshu J; Chakravarty, Siddharth; Merugu, Srinivas; Ferguson, Colin G; Gale, Bruce K
2012-10-02
Characterization of polymerized liposomes (PolyPIPosomes) was carried out using a combination of normal dc electrical field-flow fractionation and cyclical electrical field-flow fractionation (CyElFFF) as an analytical technique. The constant nature of the carrier fluid and channel configuration for this technique eliminates many variables associated with multidimensional analysis. CyElFFF uses an oscillating field to induce separation and is performed in the same channel as standard dc electrical field-flow fractionation separation. Theory and experimental methods to characterize nanoparticles in terms of their sizes and electrophoretic mobilities are discussed in this paper. Polystyrene nanoparticles are used for system calibration and characterization of the separation performance, whereas polymerized liposomes are used to demonstrate the applicability of the system to biomedical samples. This paper is also the first to report separation and a higher effective field when CyElFFF is operated at very low applied voltages. The technique is shown to have the ability to quantify both particle size and electrophoretic mobility distributions for colloidal polystyrene nanoparticles and PolyPIPosomes.
Preparative electrophoresis of cultured human cells: Effect of cell cycle phase
NASA Technical Reports Server (NTRS)
Kunze, M. E.; Todd, P. W.; Goolsby, C. L.; Walker, J. T.
1985-01-01
Human epithelioid T-1E cells were cultured in suspension and subjected to density gradient electrophoresis upward in a vertical column. It is indicated that the most rapidly migrating cells were at the beginning of the cell cycle and the most slowly migrating cells were at the end of the cell cycle. The fastest migrating cells divided 24 hr later than the slowest migrating cells. Colonies developing from slowly migrating cells had twice as many cells during exponential growth as did the most rapidly migrating cells, and the numbers of cells per colony at any time was inversely related to the electrophoretic migration rate. The DNA measurements by fluorescence flow cytometry indicates that the slowest migrating cell populations are enriched in cells that have twice as much DNA as the fastest migrating cells. It is concluded that electrophoretic mobility of these cultured human cells declines steadily through the cell cycle and that the mobility is lowest at the end of G sub 2 phase and highest at the beginning of G sub 1 phase.
Shaw, C F; Schaeffer-Memmel, N; Krawczak, D
1986-03-01
The metabolites of gold in the urine of rats given the antiarthritic drug aurothiomalate were investigated by gel permeation chromatography, electrophoresis, and chemical studies. Following a single dose of aurtothiomalate, the excreted gold was protein-bound in the high-molecular-weight (greater than or equal to 150,000 dalton) and serum albumin fractions. Electrophoresis confirmed the presence of albumin, but showed that the other proteins present differ from those in normal or in vitro aurothiomalate-incubated rat sera. The pattern of the proteins establishes that the proteinuria was of the glomerular type. The alterations in the gold distribution produced by incubation of the urine with the low-molecular-weight thiol penicillamine and with exogenously added aurothiomalate indicated the existence of a labile equilibrium of gold among protein binding sites in the urine. Incubation of rat and human sera and commercially prepared serum albumins with aurothiomalate increased the electrophoretic mobility of the albumin. The significance of this change in electrophoretic mobility with respect to two models of gold binding by serum albumin is discussed.
Investigation of the free flow electrophoretic process. Volume 2: Technical analysis
NASA Technical Reports Server (NTRS)
Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.
1979-01-01
The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible. The results of tests performed using various methods of electrophoresis using supportive media show that the mobility and the ability to separate were essentially independent of concentration, providing promise of being able to perform electrophoresis with higher inlet concentrations in space.
Microelectrophoretic study of calcium oxalate monohydrate in macromolecular solutions
NASA Technical Reports Server (NTRS)
Curreri, P. A.; Onoda, G. Y., Jr.; Finlayson, B.
1987-01-01
Electrophoretic mobilities were measured for calcium oxalate monohydrate (COM) in solutions containing macromolecules. Two mucopolysaccharides (sodium heparin and chondroitin sulfate) and two proteins (positively charged lysozyme and negatively charged bovine serum albumin) were studied as adsorbates. The effects of pH, calcium oxalate surface charge (varied by calcium or oxalate ion activity), and citrate concentration were investigated. All four macromolecules showed evidence for adsorption. The macromolecule concentrations needed for reversing the surface charge indicated that the mucopolysaccharides have greater affinity for the COM surface than the proteins. Citrate ions at high concentrations appear to compete effectively with the negative protein for surface sites but show no evidence for competing with the positively charged protein.
Fundamentals of capillary electrochromatography: migration behavior of ionized sample components.
Xiang, Rong; Horváth, Csaba
2002-02-15
The mechanism of separating charged species by capillary electrochromatography (CEC) was modeled with the conditions of ideal/linear chromatography by using a simple random walk. The most novel aspect of the work rests with the assumption that in sufficiently high electric field ionized sample components can also migrate in the adsorbed state on the ionized surface of the stationary phase. This feature of CEC leads to the introduction of three dimensionless parameters: alpha, reduced mobility of a sample component with the electrosmotic mobility as the reference; beta, the CEC retention factor; and gamma, the ratio of the electrophoretic migration velocity and the velocity of surface electrodiffusion. Since the interplay of retentive and electrophoretic forces determines the overall migration velocity, the separation mechanism in CEC is governed by the relative importance of the above parameters. The model predicts conditions under which the features of the CEC system engender migration behavior that manifests itself in a relatively narrow elution window and in a gradient like elution pattern in the separation of peptides and proteins by using pro forma isocratic CEC. It is believed that such elution patterns, which resemble those obtained by the use of external gradient of the eluent, are brought about by the formation of an internal gradient in the CEC system that gave rise to concomitant peak compression. The peculiarities of CEC are discussed in the three operational modalities of the technique: co-current, countercurrent, and co-counter CEC. The results suggest that CEC, which is often called "liquid chromatography on electrophoretic platform" is an analytical tool with great potential in the separation of peptides and proteins.
Identification of insulin as a novel retinoic acid receptor-related orphan receptor α target gene.
Kuang, Jiangying; Hou, Xiaoming; Zhang, Jinlong; Chen, Yulong; Su, Zhiguang
2014-03-18
Insulin plays an important role in regulation of lipid and glucose metabolism. Retinoic acid receptor-related orphan receptor α (RORα) modulates physiopathological processes such as dyslipidemia and diabetes. In this study, we found overexpression of RORα in INS1 cells resulted in increased expression and secretion of insulin. Suppression of endogenous RORα caused a decrease of insulin expression. Luciferase and electrophoretic mobility shift assay (EMSA) assays demonstrated that RORα activated insulin transcription via direct binding to its promoter. RORα was also observed to regulate BETA2 expression, which is one of the insulin active transfactors. In vivo analyses showed that the insulin transcription is increased by the synthetic RORα agonist SR1078. These findings identify RORα as a transcriptional activator of insulin and suggest novel therapeutic opportunities for management of the disease. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Candidate space processing techniques for biomaterials other than preparative electrophoresis
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1976-01-01
The advantages of performing the partition and countercurrent distribution (CCD) of cells in phase separated aqueous polymer systems under reduced gravity were assessed. Other possible applications considered for the space processing program include the freezing front separation of cells, adsorption of cells at the air-water interface, and the macrophage electrophoretic mobility test for cancer.
Vavvas, D; Apazidis, A; Saha, A K; Gamble, J; Patel, A; Kemp, B E; Witters, L A; Ruderman, N B
1997-05-16
The concentration of malonyl-CoA, a negative regulator of fatty acid oxidation, diminishes acutely in contracting skeletal muscle. To determine how this occurs, the activity and properties of acetyl-CoA carboxylase beta (ACC-beta), the skeletal muscle isozyme that catalyzes malonyl-CoA formation, were examined in rat gastrocnemius-soleus muscles at rest and during contractions induced by electrical stimulation of the sciatic nerve. To avoid the problem of contamination of the muscle extract by mitochondrial carboxylases, an assay was developed in which ACC-beta was first purified by immunoprecipitation with a monoclonal antibody. ACC-beta was quantitatively recovered in the immunopellet and exhibited a high sensitivity to citrate (12-fold activation) and a Km for acetyl-CoA (120 microM) similar to that reported for ACC-beta purified by other means. After 5 min of contraction, ACC-beta activity was decreased by 90% despite an apparent increase in the cytosolic concentration of citrate, a positive regulator of ACC. SDS-polyacrylamide gel electrophoresis of both homogenates and immunopellets from these muscles showed a decrease in the electrophoretic mobility of ACC, suggesting that phosphorylation could account for the decrease in ACC activity. In keeping with this notion, citrate activation of ACC purified from contracting muscle was markedly depressed. In addition, homogenization of the muscles in a buffer free of phosphatase inhibitors and containing the phosphatase activators glutamate and MgCl2 or treatment of immunoprecipitated ACC-beta with purified protein phosphatase 2A abolished the decreases in both ACC-beta activity and electrophoretic mobility caused by contraction. The rapid decrease in ACC-beta activity after the onset of contractions (50% by 20 s) and its slow restoration to initial values during recovery (60-90 min) were paralleled temporally by reciprocal changes in the activity of the alpha2 but not the alpha1 isoform of 5'-AMP-activated protein kinase (AMPK). In conclusion, the results suggest that the decrease in ACC activity during muscle contraction is caused by an increase in its phosphorylation, most probably due, at least in part, to activation of the alpha2 isoform of AMPK. They also suggest a dual mechanism for ACC regulation in muscle in which inhibition by phosphorylation takes precedence over activation by citrate. These alterations in ACC and AMPK activity, by diminishing the concentration of malonyl-CoA, could be responsible for the increase in fatty acid oxidation observed in skeletal muscle during exercise.
Electrophoretic mobility patterns of collagen following laser welding
NASA Astrophysics Data System (ADS)
Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.
1991-06-01
Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.
Neel, J V; Satoh, C; Goriki, K; Asakawa, J; Fujita, M; Takahashi, N; Kageoka, T; Hazama, R
1988-01-01
A sample of (1) children whose parents had been proximally exposed (i.e., less than 2,000 m from the hypocenter) at the time of the atomic bombings of Hiroshima and Nagasaki and (2) a suitable comparison group have been examined for the occurrence of mutations altering the electrophoretic mobility or activity of a series of 30 proteins. The examination of the equivalent of 667,404 locus products in the children of proximally exposed persons yielded three mutations altering electrophoretic mobility; the corresponding figure for the comparison group was three mutations in 466,881 tests. The examination of a subset of 60,529 locus products for loss of enzyme activity in the children of proximally exposed persons yielded one mutation; no mutations were encountered in 61,741 determinations on the children of the comparison group. When these two series are compared, the mutation rate observed in the children of proximally exposed persons is thus 0.60 x 10(-5)/locus/generation, with 95% confidence intervals between 0.2 and 1.5 x 10(-5), and that in the comparison children is 0.64 x 10(-5)/locus/generation, with 95% intervals between 0.1 and 1.9 x 10(-5). The average conjoint gonad doses for the proximally exposed parents are estimated to be 0.437 Gy of gamma radiation and 0.002 Gy of neutron radiation. If a relative biological effectiveness of 20 is assigned to the neutron radiation, the combined total gonad dose for the parents becomes 0.477 Sv. (Organ absorbed doses are expressed in gray [1 Gy = 100 rad]; where dose is a mixture of gamma and neutron radiation, it is necessary because of the differing relative biological effectiveness of gamma and neutron radiation to express the combined gamma-neutron gonad exposures in sieverts [1 Sv = 100 rem]). PMID:3358419
Sopina, V A
2001-01-01
Activity and thermoresistance of acid phosphatase were determined in supernatant of Amoeba proteus homogenates using 1-naphthyl phosphate (pH 4.0) and p-nitrophenyl phosphate (pH 5.5). Although tartrate-resistant and tartrate-sensitive acid phosphatases hydrolyse both substrates, the former mainly hydrolyses p-nitrophenyl phosphate and the latter 1-naphthyl phosphate. A decrease in the activity of the total and tartrate-sensitive acid phosphatases, when using 1-naphthyl phosphate, and of the total and tartrate-resistant acid phosphatases, when using p-nitrophenyl phosphate, was found in amoebae acclimated to 10 degrees C (10 degrees-amoebae) compared to those acclimated to 25 degrees C (25 degrees-amoebae). Using 1-naphthyl phosphate, the thermoresistance of the total acid phosphatase was lower in 10 degrees-amoebae than in 25 degrees-amoebae, but the thermostability of tartrate-resistant enzyme was the same in both groups of amoebae. Using p-nitrophenyl phosphate, the thermoresistance of the total and tartrate-resistant acid phosphatases was lower (the latter only slightly) in 10 degrees-amoebae than in 25 degrees-amoebae. It is suggested that at least with the use of 1-naphthyl phosphate a decrease in thermostability of the total acid phosphatase may be due to a decrease in thermoresistance of tartrate-sensitive enzyme. The results obtained confirm the author's previous data on the activity and thermostability of electrophoretic forms of acid phosphatase using 2-naphthyl phosphate in 10- and 25 degrees-amoebae (Sopina, 2001). It is the first case of discovering a correlation between changes in primary cell thermoresistance of amoebae cultured at different temperatures and changes in the activity and thermostability of acid phosphatase in their homogenates, with the number of electrophoretic forms of this enzyme and their mobility being permanent.
DIGE Analysis of Human Tissues.
Gelfi, Cecilia; Capitanio, Daniele
2018-01-01
Two-dimensional difference gel electrophoresis (2-D DIGE) is an advanced and elegant gel electrophoretic analytical tool for comparative protein assessment. It is based on two-dimensional gel electrophoresis (2-DE) separation of fluorescently labeled protein extracts. The tagging procedures are designed to not interfere with the chemical properties of proteins with respect to their pI and electrophoretic mobility, once a proper labeling protocol is followed. The two-dye or three-dye systems can be adopted and their choice depends on specific applications. Furthermore, the use of an internal pooled standard makes 2-D DIGE a highly accurate quantitative method enabling multiple protein samples to be separated on the same two-dimensional gel. The image matching and cross-gel statistical analysis generates robust quantitative results making data validation by independent technologies successful.
NASA Technical Reports Server (NTRS)
Tsai, Amos; Mosher, Richard A.; Bier, Milan
1986-01-01
Computer simulation is used to analyze a system of two electrophoretic columns coupled by mixing the anolyte of one with the catholyte of the other. A mathematical model is presented which is used to predict the pH gradients formed by monovalent buffers in this system, when the currents in the columns are unequal. In the column with the higher current a pH gradient is created which increases from anode to cathode and is potentially useful for isoelectric focusing. The breadth of this gradient is dependent upon the ratio of the currents. The function of the second column is the compensation of buffer migration which occurs in the first column, thereby maintaining constant electrolyte composition. The effects of buffer pKs and mobilities are evaluated.
Combined electrophoretic-separation and electrospray method and system
Smith, Richard D.; Olivares, Jose A.
1989-01-01
A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5-100 KVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., .+-.2-8 KVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit.
Influence of ion sterics on diffusiophoresis and electrophoresis in concentrated electrolytes
NASA Astrophysics Data System (ADS)
Stout, Robert F.; Khair, Aditya S.
2017-01-01
We quantify the diffusiophoresis and electrophoresis of a uniformly charged, spherical colloid in a binary electrolyte using modified Poisson-Nernst-Planck equations that account for steric repulsion between finite sized ions. Specifically, we utilize the Bikerman (Bik) lattice gas model and the Carnahan-Starling (CS) and Boublik-Mansoori-Carnahan-Starling-Leland (BMCSL) equations of state for monodisperse and polydisperse, respectively, hard spheres. We compute the phoretic mobility for weak applied fields using an asymptotic approach for thin diffuse layers, where ion steric effects are expected to be most prevalent. The thin diffuse layer limit requires λD/R →0 , where λD is the Debye screening length and R is the particle radius; this limit is readily attained for micron-sized colloids in concentrated electrolytic solutions. It is well known that the classic Poisson-Boltzmann (PB) model for pointlike, noninteracting ions leads to a prediction of a maximum in both the diffusiophoretic and electrophoretic mobilities with increasing particle zeta potential (at fixed λD/R ). In contrast, we find that ion sterics essentially eliminate this maximum (for reasonably attainable zeta potentials) and increase the mobility relative to PB. Next, we consider the more experimentally relevant case of a particle with a constant surface charge density and vary the electrolyte concentration, neglecting charge regulation on surface active sites. Rather surprisingly, there is little difference between the predictions of the four models (PB, Bik, CS, and BMCSL) for electrophoretic mobility in concentrated solutions, at reasonable surface charge densities (˜1 -10 μ C /cm2 ). This is because as the concentration increases, the zeta potential is reduced (to below the thermal voltage for concentrations above about 1 M) and therefore the diffuse layer structure is largely unaffected by ion sterics. For gradients of symmetric electrolytes (equal diffusivities, charge, and size) diffusiophoresis is also essentially unaffected by ion sterics, with a mobility that approaches zero with increasing concentration, just as in electrophoresis. For gradients of asymmetric electrolytes, the difference in diffusivities of the cation and anions leads to an induced electric field that acts on the charged particle. Importantly, we show that ion sterics leads to an excess contribution to the induced electric field, which increases rapidly with concentration. This increase overwhelms the accompanying decrease in zeta potential. The result is the diffusiophoretic mobility increases with concentration, rather than approaching zero. Therefore, diffusiophoresis could be an appealing alternative transport mechanism to electrophoresis in concentrated electrolyte solutions.
Lokajová, Jana; Railila, Annika; King, Alistair W T; Wiedmer, Susanne K
2013-09-20
The distribution constants of some analytes, closely connected to the petrochemical industry, between an aqueous phase and a phosphonium ionic liquid phase, were determined by ionic liquid micellar electrokinetic chromatography (MEKC). The phosphonium ionic liquids studied were the water-soluble tributyl(tetradecyl)phosphonium with chloride or acetate as the counter ion. The retention factors were calculated and used for determination of the distribution constants. For calculating the retention factors the electrophoretic mobilities of the ionic liquids were required, thus, we adopted the iterative process, based on a homologous series of alkyl benzoates. Calculation of the distribution constants required information on the phase-ratio of the systems. For this the critical micelle concentrations (CMC) of the ionic liquids were needed. The CMCs were calculated using a method based on PeakMaster simulations, using the electrophoretic mobilities of system peaks. The resulting distribution constants for the neutral analytes between the ionic liquid and the aqueous (buffer) phase were compared with octanol-water partitioning coefficients. The results indicate that there are other factors affecting the distribution of analytes between phases, than just simple hydrophobic interactions. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Todd, P. W.; Sarnoff, B. E.; Li, Z. K.
1985-01-01
Studies of the physical properties of continuous-flow zero-G electrophoretic separator (CFES) buffer, the electrokinetic properties of human erythrocytes in the CFES buffer, the electrokinetic properties of human embryonic kidney cells in the CFES buffer, and the viability and yield of human embryonc kidney cells subjected to flight handling procedures are discussed. In general, the procedure for cell handling and electrophoresis of HEK-8514 cells in 1st or 2nd passage on STS-8 is acceptable if executed properly. The CFES buffer has ionic strength that is barely compatible with cell viability and membrane stability, as seen in experiments with human erythrocytes and trypan-blue staining of human kidney cells. Cells suspended in 10% dialysed horse serum for 3 days in the cold appear to be more stable than freshly trypsinized cells. 10% horse serum appears to be superior to 5% horse serum for this purpose. The mean absolute raw mobility of HEK-8514 cells in CFES buffer at 6 degrees, conductivity 0.055 mmho/cm, is 1.1 to 1.4 um-cm/V-sec, with a range of nearly a whole mobility unit.
NASA Technical Reports Server (NTRS)
Hymer, W. C.; Salada, T.; Cenci, R.; Krishnan, K.; Seaman, G. V. F.; Snyder, R.; Matsumiya, H.; Nagaoka, S.
1996-01-01
In this report we describe the results of a continuous flow electrophoresis (CFE) experiment done on STS-65 in which we tested the idea that intracellular growth hormone (GH) particles contained in a cell lysate prepared from cultured rat anterior pituitary cells in microgravity might have different electrophoretic mobilities from those in a synchronous ground control cell lysate. Collectively, the results suggested that CFE processing in microgravity was better than on earth; more samples could be processed at a time (6 x) and more variant forms of GH molecules could be resolved as well. We had also hoped to carry out a pituitary cell CFE experiment, but failure of the hardware required that the actual cell electrophoresis trials be done on earth shortly after Shuttle landing. Data from these experiments showed that space-flown cells possessed a higher electrophoretic mobility than ground control cells, thereby offering evidence for the idea that exposure of cultured cells to microgravity can change their net surface charge-density especially when the cells are fed. Collectively, the results from this pituitary cell experiment document the advantage of using coupled cell culture and CFE techniques in the microgravity environment.
Assessing the scalability of dynamic field gradient focusing by linear modeling
Tracy, Noah I.; Ivory, Cornelius F.
2010-01-01
Dynamic field gradient focusing (DFGF) separates and concentrates proteins in native buffers, where proteins are most soluble, using a computer-controlled electric field gradient which lets the operator adjust the pace and resolution of the separation in real-time. The work in this paper assessed whether DFGF could be scaled up from microgram analytical-scale protein loads to milligram preparative-scale loads. Linear modeling of the electric potential, protein transport, and heat transfer simulated the performance of a preparative-scale DFGF instrument. The electric potential model showed where the electrodes should be placed to optimize the shape and strength of the electric field gradient. Results from the protein transport model suggested that in 10 min the device should separate 10 mg each of two proteins whose electrophoretic mobilities differ by 5 ×. Proteins with electrophoretic mobilities differing by only 5% should separate in 3 h. The heat transfer model showed that the preparative DFGF design could dissipate 1 kW of Joule heat while keeping the separation chamber at 25°C. Model results pointed to DFGF successfully scaling up by 1000 × using the proposed instrument design. PMID:18196522
NASA Astrophysics Data System (ADS)
Drillien, Robert; Spehner, Daniele; Kirn, Andre; Giraudon, Pascale; Buckland, Robin; Wild, Fabian; Lecocq, Jean-Pierre
1988-02-01
Vaccinia virus recombinants encoding the hemagglutinin or fusion protein of measles virus have been constructed. Infection of cell cultures with the recombinants led to the synthesis of authentic measles proteins as judged by their electrophoretic mobility, recognition by antibodies, glycosylation, proteolytic cleavage, and presentation on the cell surface. Mice vaccinated with a single dose of the recombinant encoding the hemagglutinin protein developed antibodies capable of both inhibiting hemagglutination activity and neutralizing measles virus, whereas animals vaccinated with the recombinant encoding the fusion protein developed measles neutralizing antibodies. Mice vaccinated with either of the recombinants resisted a normally lethal intracerebral inoculation of a cell-associated measles virus subacute sclerosing panencephalitis strain.
Cranberry Proanthocyanidins - Protein complexes for macrophage activation.
Carballo, Sergio M; Haas, Linda; Krueger, Christian G; Reed, Jess D
2017-09-20
In this work we characterize the interaction of cranberry (Vaccinium macrocarpon) proanthocyanidins (PAC) with bovine serum albumin (BSA) and hen egg-white lysozyme (HEL) and determine the effects of these complexes on macrophage activation and antigen presentation. We isolated PAC from cranberry and complexed the isolated PAC with BSA and HEL. The properties of the PAC-protein complexes were studied by matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS), gel electrophoresis and zeta-potential. The effects of PAC-BSA complexes on macrophage activation were studied in RAW 264.7 macrophage like cells after treatment with lipopolysaccharide (LPS). Fluorescence microscopy was used to study the endocytosis of PAC-BSA complexes. The effects of the PAC complexes on macrophage antigen presentation were studied in an in vitro model of HEL antigen presentation by mouse peritoneal mononuclear cells to a T-cell hybridoma. The mass spectra of the PAC complexes with BSA and HEL differed from the spectra of the proteins alone by the presence of broad shoulders on the singly and doubly charged protein peaks. Complexation with PAC altered the electrophoretic mobility shift assay in native agarose gel and the electrophoretic mobility (ζ-potential) values. These results indicate that the PAC-protein complexes are stable and alter the protein structure without precipitating the protein. Fluorescence microscopy showed that the RAW 264.7 macrophages endocytosed BSA and PAC-BSA complexes in discrete vesicles that surrounded the nucleus. Macrophages treated with increasing amounts of PAC-BSA complexes had significantly reduced COX-2 and iNOS expression in response to treatment with lipopolysaccharide (LPS) in comparison to the controls. The PAC-HEL complexes modulated antigen uptake, processing and presentation in murine peritoneal macrophages. After 4 h of pre-incubation, only trace amounts of IL-2 were detected in the co-cultures treated with HEL alone, whereas the PAC-HEL complex had already reached the maximum IL-2 expression. Cranberry PAC may increase the rate of endocytosis of HEL and subsequent expression of IL-2 by the T-cell hybridomas. These results suggest that PAC-protein complexes modulate aspects of innate and acquired immune responses in macrophages.
Biochemical analysis with microfluidic systems.
Bilitewski, Ursula; Genrich, Meike; Kadow, Sabine; Mersal, Gaber
2003-10-01
Microfluidic systems are capillary networks of varying complexity fabricated originally in silicon, but nowadays in glass and polymeric substrates. Flow of liquid is mainly controlled by use of electroosmotic effects, i.e. application of electric fields, in addition to pressurized flow, i.e. application of pressure or vacuum. Because electroosmotic flow rates depend on the charge densities on the walls of capillaries, they are influenced by substrate material, fabrication processes, surface pretreatment procedures, and buffer additives. Microfluidic systems combine the properties of capillary electrophoretic systems and flow-through analytical systems, and thus biochemical analytical assays have been developed utilizing and integrating both aspects. Proteins, peptides, and nucleic acids can be separated because of their different electrophoretic mobility; detection is achieved with fluorescence detectors. For protein analysis, in particular, interfaces between microfluidic chips and mass spectrometers were developed. Further levels of integration of required sample-treatment steps were achieved by integration of protein digestion by immobilized trypsin and amplification of nucleic acids by the polymerase chain reaction. Kinetic constants of enzyme reactions were determined by adjusting different degrees of dilution of enzyme substrates or inhibitors within a single chip utilizing mainly the properties of controlled dosing and mixing liquids within a chip. For analysis of kinase reactions, however, a combination of a reaction step (enzyme with substrate and inhibitor) and a separation step (enzyme substrate and reaction product) was required. Microfluidic chips also enable separation of analytes from sample matrix constituents, which can interfere with quantitative determination, if they have different electrophoretic mobilities. In addition to analysis of nucleic acids and enzymes, immunoassays are the third group of analytical assays performed in microfluidic chips. They utilize either affinity capillary electrophoresis as a homogeneous assay format, or immobilized antigens or antibodies in heterogeneous assays with serial supply of reagents and washing solutions.
An agarose gel electrophoretic method for analysis of hyaluronan molecular weight distribution.
Lee, H G; Cowman, M K
1994-06-01
An electrophoretic method is described for determining the molecular weight distribution of hyaluronan (HA). The method involves separation of HA by electrophoresis on a 0.5% agarose gel, followed by detection of HA using the cationic dye Stains-All (3,3'-dimethyl-9-methyl-4,5,4'5'-dibenzothiacarbocyanine). The recommended sample load is 7 micrograms. Calibration of the method with HA standards of known molecular weight has established a linear relationship between electrophoretic mobility and the logarithm of the weight-average molecular weight over the range of approximately 0.2-6 x 10(6). The separated HA pattern may also be visualized after electrotransfer of HA from the agarose gel to a nylon membrane. The membrane may be stained with the dye alcian blue. Alternatively, specific detection of HA from impure samples can be achieved by probing the nylon membrane with biotin-labeled HA-binding protein and subsequent interaction with a streptavidin-linked gold reagent and silver staining for amplification. The electrophoretic method was used to analyze HA in two different liquid connective tissues. Normal human knee joint synovial fluid showed a narrow HA molecular weight distribution, with a peak at 6-7 x 10(6). Owl monkey vitreous HA also showed a narrow molecular weight distribution, with a peak at 5-6 x 10(6). These results agree well with available published data and indicate the applicability of the method to the analysis of impure HA samples which may be available in limited amounts.
Caugant, D A; Zollinger, W D; Mocca, L F; Frasch, C E; Whittam, T S; Frøholm, L O; Selander, R K
1987-01-01
Two hundred and thirty-four strains of Neisseria meningitidis, including 94 serotype 2a, 111 serotype 2b, and 19 serotype 2c isolates, together with 10 isolates that were serotyped as 2 with polyvalent antiserum but did not react with monoclonal antibodies, were characterized by the electrophoretic mobilities of 15 metabolic enzymes. Of these enzymes, 14 were polymorphic, and 56 distinctive combinations of alleles at the enzyme loci (electrophoretic types) were identified, among which the mean genetic diversity per locus was 0.413, or about 75% of that recorded for the species N. meningitidis as a whole. Mean genetic diversity among electrophoretic types of the same serotype (2a, 2b, or 2c) was, however, on average, less than half the total species diversity, and no multilocus genotypes were shared between isolates of the different serotypes, which belong to distinctive clonal lineages. Recent temporal changes in the frequencies of recovery of pathogenic strains of serotypes 2a and 2b in South Africa and North America resulted from clone replacement in these populations rather than evolutionary modification of the serotype protein of the initially dominant clones. PMID:3106223
Production of human lactoferrin in animal milk.
Goldman, I L; Georgieva, S G; Gurskiy, Ya G; Krasnov, A N; Deykin, A V; Popov, A N; Ermolkevich, T G; Budzevich, A I; Chernousov, A D; Sadchikova, E R
2012-06-01
Genetic constructs containing the human lactoferrin (hLf) gene were created within a joint program of Russian and Belorussian scientists. Using these constructs, transgenic mice were bred (the maximum hLf concentration in their milk was 160 g/L), and transgenic goats were also generated (up to 10 g/L hLf in their milk). Experimental goatherds that produced hLf in their milk were also bred, and the recombinant hLf was found to be identical to the natural protein in its physical and chemical properties. These properties included electrophoretic mobility, isoelectric point, recognition by polyclonal and monoclonal antibodies, circular dichroic spectra, interaction with natural ligands (DNA, lipopolysaccharides, and heparin), the binding of iron ions, the sequence of the 7 terminal amino acids, and its biological activity. The latter was assessed by the agglutination of Micrococcus luteus protoplasts, bactericidal activity against Escherichia coli and Listeria monocytogenes , and fungicidal activity against Candida albicans . We also demonstrated a significant increase in the activity of antibiotics when used in combination with Lf.
Saroj, Sunil D.; Holmer, Linda; Berengueras, Júlia M.; Jonsson, Ann-Beth
2017-01-01
Streptococcus pyogenes an adapted human pathogen asymptomatically colonizes the nasopharynx, among other polymicrobial communities. However, information on the events leading to the colonization and expression of virulence markers subject to interspecies and host-bacteria interactions are limited. The interference of acyl homoserine lactones (AHLs) with the hemolytic activity and viability of S. pyogenes M6 S165 was examined. AHLs, with fatty acid side chains ≥12 carbon atoms, inhibited hemolytic activity by downregulating the expression of the sag operon involved in the production of streptolysin S. Inhibitory AHLs upregulated the expression of transcriptional regulator LuxR. Electrophoretic mobility shift assays revealed the interaction of LuxR with the region upstream of sagA. AHL-mediated bactericidal activity observed at higher concentrations (mM range) was an energy-dependent process, constrained by the requirement of glucose and iron. Ferrichrome transporter FtsABCD facilitated transport of AHLs across the streptococcal membrane. The study demonstrates a previously unreported role for AHLs in S. pyogenes virulence. PMID:28303956
Saroj, Sunil D; Holmer, Linda; Berengueras, Júlia M; Jonsson, Ann-Beth
2017-03-17
Streptococcus pyogenes an adapted human pathogen asymptomatically colonizes the nasopharynx, among other polymicrobial communities. However, information on the events leading to the colonization and expression of virulence markers subject to interspecies and host-bacteria interactions are limited. The interference of acyl homoserine lactones (AHLs) with the hemolytic activity and viability of S. pyogenes M6 S165 was examined. AHLs, with fatty acid side chains ≥12 carbon atoms, inhibited hemolytic activity by downregulating the expression of the sag operon involved in the production of streptolysin S. Inhibitory AHLs upregulated the expression of transcriptional regulator LuxR. Electrophoretic mobility shift assays revealed the interaction of LuxR with the region upstream of sagA. AHL-mediated bactericidal activity observed at higher concentrations (mM range) was an energy-dependent process, constrained by the requirement of glucose and iron. Ferrichrome transporter FtsABCD facilitated transport of AHLs across the streptococcal membrane. The study demonstrates a previously unreported role for AHLs in S. pyogenes virulence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Danno, Hirosuke; Ishii, Kiyo-aki; Nakagawa, Yoshimi
To elucidate the physiological role of CREBH, the hepatic mRNA and protein levels of CREBH were estimated in various feeding states of wild and obesity mice. In the fast state, the expression of CREBH mRNA and nuclear protein were high and profoundly suppressed by refeeding in the wild-type mice. In ob/ob mice, the refeeding suppression was impaired. The diet studies suggested that CREBH expression was activated by fatty acids. CREBH mRNA levels in the mouse primary hepatocytes were elevated by addition of the palmitate, oleate and eicosapenonate. It was also induced by PPAR{alpha} agonist and repressed by PPAR{alpha} antagonist. Luciferasemore » reporter gene assays indicated that the CREBH promoter activity was induced by fatty acids and co-expression of PPAR{alpha}. Deletion studies identified the PPRE for PPAR{alpha} activation. Electrophoretic mobility shift assay and chromatin immunoprecipitation (ChIP) assay confirmed that PPAR{alpha} directly binds to the PPRE. Activation of CREBH at fasting through fatty acids and PPAR{alpha} suggest that CREBH is involved in nutritional regulation.« less
Further analyses of human kidney cell populations separated on the Space Shuttle
NASA Technical Reports Server (NTRS)
Stewart, Robin M.; Todd, Paul; Cole, Kenneth D.; Morrison, Dennis R.
1992-01-01
Cultured human embryonic kidney cells were separated into electrophoretic subpopulations in laboratory experiments and in two separation experiments on the STS-8 (Challenger) Space Shuttle flight using the mid-deck Continuous Flow Electrophoretic Separator (CFES). Populations of cells from each fraction were cultured for the lifetime of the cells, and supernatant medium was withdrawn and replaced at 4-day intervals. Withdrawn medium was frozen at -120 C for subsequent analysis. Enzyme assays, antibodies and gel electrophoresis were used as analytical tools for the detection and quantization of plasminogen activators in these samples. These assays of frozen-culture supernatant fluids confirmed the electrophoretic separation of plasminogen-activator-producing cells from nonproducing cells, the isolation of cells capable of sustained production, and the separation of cells that produce different plasminogen activators from one other.
Optical tweezers with 2.5 kHz bandwidth video detection for single-colloid electrophoresis
NASA Astrophysics Data System (ADS)
Otto, Oliver; Gutsche, Christof; Kremer, Friedrich; Keyser, Ulrich F.
2008-02-01
We developed an optical tweezers setup to study the electrophoretic motion of colloids in an external electric field. The setup is based on standard components for illumination and video detection. Our video based optical tracking of the colloid motion has a time resolution of 0.2ms, resulting in a bandwidth of 2.5kHz. This enables calibration of the optical tweezers by Brownian motion without applying a quadrant photodetector. We demonstrate that our system has a spatial resolution of 0.5nm and a force sensitivity of 20fN using a Fourier algorithm to detect periodic oscillations of the trapped colloid caused by an external ac field. The electrophoretic mobility and zeta potential of a single colloid can be extracted in aqueous solution avoiding screening effects common for usual bulk measurements.
Combined electrophoretic-separation and electrospray method and system
Smith, R.D.; Olivares, J.A.
1989-06-27
A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5--100 kVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., [+-]2--8 kVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit. 10 figs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko
2008-04-11
Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less
EMSA Analysis of DNA Binding By Rgg Proteins
LaSarre, Breah; Federle, Michael J.
2016-01-01
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004
EMSA Analysis of DNA Binding By Rgg Proteins.
LaSarre, Breah; Federle, Michael J
2013-08-20
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).
Purification and properties of an alpha-amylase protein-inhibitor from Arachis hypogaea seeds.
Irshad, M; Sharma, C B
1981-06-15
A protein showing highly specific inhibitory activity towards hog pancreatic and human salivary alpha-amylases (1,4-alpha-D-glucan glucanohydrolase, EC 3.2.1.1), but not towards plant and bacterial alpha-amylases, has been purified 197-fold from an aqueous extract of peanut cotyledons using heat treatment, (NH4)2SO4 precipitation and ion-exchange chromatography on DEAE- and CM-cellulose. The purified inhibitor was homogeneous by polyacrylamide gel electrophoresis. Its molecular weight, as determined by Sephadex G-100 gel-filtration, and its electrophoretic mobility at pH 8 relative to bromophenol blue, were 25 000 and 0.14, respectively. The inhibitory activity was relatively resistant to thermal treatment and markedly increased when the inhibitor was preincubated with the enzyme before the addition of starch. Further, the inhibition was found to be pH-dependent and non-competitive in nature.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Becana, M.; Paris, F.J.; Sandalio, L.M.
1989-08-01
The activity and isozymic composition of superoxide dismutase were determined in nodules of Phaseolus vulgaris L., Pisum sativum L., and Vigna unguiculata (L.) Walp. A Mn-SOD was present in Rhizobium and two in Bradyrhizobium and bacteroids. Nodule mitochondria from all three legume species had a single Mn-SOD with similar relative mobility, whereas the cytosol contained several CuZn-SODs: two in Phaseolus and Pisum, and four in Vigna. In the cytoplasm of V. unguiculata nodules, a Fe-containing SOD was also present, with an electrophoretic mobility between those of CuZn- and Mn-SODs, and an estimated molecular weight of 57,000. Total SOD activity ofmore » the soluble fraction of host cells, expressed on a nodule fresh weight basis, exceeded markedly that of bacteroids. Likewise, specific SOD activities of free-living bacteria were superior or equal to those of their symbiotic forms. Soluble extracts of bacteria and bacteroids did not show peroxidase activity, but the nodule cell cytoplasm contained diverse peroxidase isozymes which were readily distinguishable from leghemoglobin components by electrophoresis. Data indicated that peroxidases and leghemoglobins did not significantly interfere with SOD localization on gels. Treatment with chloroform-ethanol scarcely affected the isozymic pattern of SODs and peroxidases, and had limited success in the removal of leghemoglobin.« less
Panitz, Janda K.; Reed, Scott T.; Ashley, Carol S.; Neiser, Richard A.; Moffatt, William C.
1999-01-01
Electrophoretically active sol-gel processes to fill, seal, and/or density porous, flawed, and/or cracked coatings on electrically conductive substrates. Such coatings may be dielectrics, ceramics, or semiconductors and, by the present invention, may have deposited onto and into them sol-gel ceramic precursor compounds which are subsequently converted to sol-gel ceramics to yield composite materials with various tailored properties.
Hickey, Owen A; Shendruk, Tyler N; Harden, James L; Slater, Gary W
2012-08-31
We introduce a mesoscale simulation method based on multiparticle collision dynamics (MPCD) for the electrohydrodynamics of polyelectrolytes with finite Debye lengths. By applying the Debye-Hückel approximation to assign an effective charge to MPCD particles near charged monomers, our simulations are able to reproduce the rapid rise in the electrophoretic mobility with respect to the degree of polymerization for the shortest polymer lengths followed by a small decrease for longer polymers due to charge condensation. Moreover, these simulations demonstrate the importance of a finite Debye length in accurately determining the mobility of uniformly charged polyelectrolytes and net neutral polyampholytes.
PURIFICATION OF THE SOLUBLE HEMOLYSINS OF LISTERIA MONOCYTOGENES
Jenkins, E. M.; Njoku-Obi, A. N.; Adams, E. W.
1964-01-01
Jenkins, E. M. (Tuskegee Institute, Tuskegee, Ala.), A. N. Njoku-Obi, and E. W. Adams. Purification of the soluble hemolysins of Listeria monocytogenes. J. Bacteriol. 88:418–424. 1964.—A method is described for obtaining relatively purified hemolysin preparations from both virulent and avirulent strains of Listeria monocytogenes. These hemolysins are protein in nature as shown by heat lability, nondialyzable properties, precipitation with trichloroacetic acid, and electrophoretic mobility. The hemolysins are antigenic in rabbits as shown by serum neutralization tests. The potency of the purified hemolysin was markedly increased by cysteine, sodium hydrosulfite, and a number of reducing agents. Many of the actions of the purified hemolysin seemed to parallel that of streptolysin O, and certain of these activities could be explained by the “thioldisulfide hypothesis.” PMID:14203359
Deno, D C; McCafferty, M H; Saba, T M; Blumenstock, F A
1984-01-01
Plasma fibronectin was depleted within 15 min following sublethal burn, followed by partial recovery at 8 h and complete restoration by 24 h in anesthetized rats. Radiolabeled 75Se-plasma fibronectin, injected intravenously before burn, was rapidly sequestered in burn skin as well as the liver. Fibronectin levels at 2 h postburn as detected by immunoassay vs. 75Se-plasma fibronectin indicated that more fibronectin was in the plasma than detected by electroimmunoassay. Crossed immunoelectrophoretic analysis of fibronectin in early postburn plasma demonstrated a reduced electrophoretic mobility of the fibronectin antigen. Addition of heparin or fibrin, both of which have affinity for fibronectin, to normal plasma was unable to reproduce this altered fibronectin electrophoretic pattern. In contrast, addition of gelatin or native collagen to normal plasma reproduced the abnormal electrophoretic pattern of fibronectin seen in burn plasma. Extracts of burned skin, but not extracts of normal skin, when added to normal plasma, elicited a similar altered electrophoretic pattern for fibronectin. By gel filtration, fibronectin in burn plasma had an apparent molecular weight approximately 40% greater than that observed in normal plasma. These data suggest the release into the blood of a gelatinlike ligand from burned skin, which complexes with plasma fibronectin. Thus, fibronectin deficiency acutely postburn appears mediated by (a) its accumulation at the site of burn injury; (b) its removal from the circulation by the liver; and (c) its presence in the plasma in a form that is less detectable by immunoassay. Images PMID:6690478
Duffy, Ciarán F; MacCraith, Brian; Diamond, Dermot; O'Kennedy, Richard; Arriaga, Edgar A
2006-08-01
The analysis of mitochondria by capillary electrophoresis usually takes longer than 20 min per replicate which may compromise the quality of the mitochondria due to degradation. In addition, low sample consumption may be beneficial in the analysis of rare or difficult samples. In this report, we demonstrate the ability to analyze individual mitochondrial events in picoliter-volume samples (approximately 80 pL) taken from a bovine liver preparation using microchip capillary electrophoresis with laser-induced fluorescence detection (micro-chip CE-LIF). Using a commercial "double-T" glass microchip, the sample was electrokinetically loaded in the "double-T" intersection and then subjected to electrophoretic separation along the main separation channel. In order to decrease interactions of mitochondria with channel walls during the analysis, poly(vinyl alcohol) was used as a dynamic coating. This procedure eliminates the need for complicated covalent surface modifications within the channels that were previously used in capillary electrophoresis methods. For analysis, mitochondria, isolated from bovine liver tissue, were selectively labelled using 10-nonyl acridine orange (NAO). The results consist of electropherograms where each mitochondrial event is a narrow spike (240 +/- 44 ms). While the spike intensity is representative of its NAO content, its migration time is used to calculate and describe its electrophoretic mobility, which is a property still largely unexplored for intracellular organelles. The five-fold decrease in separation time (4 min for microchip versus 20 min for capillary electrophoresis) makes microchip electrophoretic separations of organelles a faster, sensitive, low-sample volume alternative for the characterization of individual organelle properties and for investigations of subcellular heterogeneity.
Electro-Optical Platform for the Manipulation of Live Cells
2002-10-02
system, other physical forces may play a significant role. In particular, electroosmotic forces that cause fluid movement relative to a surface can...occur due to the mobility of ions in solution. Electroosmotic forces are commonly utilized in capillary electrophoretic separa- tion, where the capillary...fluid motion that acts to entrain particles to be separated.46 Thus, in the chamber presented here, the patterned anode can induce electroosmotic flow
2009-08-01
tubular mode driven by electroosmotic flow and the inherent electrophoretic mobility of the analytes under the influence of an applied electric field...could be due to unlabeled beads. Figure 3 (C and D) also shows electropherogram of a neutral electroosmotic flow (EOF) marker dye BODIPY and...internal turbulent mixing . The current microfabricated electromagnets cannot produce sufficient fields to trap the NPs against a large flow forces
Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Crespo, José L
2016-01-01
Identification of specific autophagy markers has been fundamental to investigate autophagy as catabolic process. Among them, the ATG8 protein turned out to be one of the most widely used and specific molecular markers of autophagy both in higher and lower eukaryotes. Here, we describe how ATG8 can be used to monitor autophagy in Chlamydomonas and Arabidopsis by western blot analysis.
NASA Technical Reports Server (NTRS)
Rubin, A. L.; Stenzel, K. H.; Cheigh, J. S.; Seaman, G. V. F.; Novogrodsky, A.
1977-01-01
Electrophoretic mobilities (EPM) of peripheral lymphocytes were studied from normal subjects, chronic hemodialysis patients and kidney transplant recipients. A technique to separate B lymphocytes and null cells from non-T lymphocyte preparation was developed. The experiments were designed to determine which subpopulation of the non-T lymphocytes is primarily affected and shows a decreased EPM in chronic hemodialysis patients and kidney transplant recipients.
Electrophoresis experiment for space
NASA Technical Reports Server (NTRS)
Vanderhoff, J. W.; Micale, F. J.
1976-01-01
The Apollo 16 electrophoresis experiment was analyzed, demonstrating that the separation of the two different-size monodisperse latexes did indeed take place, but that the separation was obscured by the pronounced electroosmotic flow of the liquid medium. The results of this experiment, however, were dramatic since it is impossible to carry out a similar separation on earth. It can be stated unequivocally from this experiment that any electrophoretic separation will be enhanced under microgravity conditions. The only question is the degree of this enhancement, which can be expected to vary from one experimental technique to another. The low-electroosmotic-mobility coating (Z6040-MC) developed under this program was found to be suitable for a free-fluid electrophoretic separation such as the experiment designed for the ASTP flight. The problem with this coating, however, is that its permanency is limited because of the slow desorption of the methylcellulose from the coated surface.
Hormone purification by isoelectric focusing in space
NASA Technical Reports Server (NTRS)
Bier, M.
1988-01-01
The objective of the program was the definition and development of optimal methods for electrophoretic separations in microgravity. The approach is based on a triad consisting of ground based experiments, mathematical modeling and experiments in microgravity. Zone electrophoresis is a rate process, where separation is achieved in uniform buffers on the basis of differences in electrophoretic mobilities. Optimization and modeling of continuous flow electrophoresis mainly concern the hydrodynamics of the flow process, including gravity dependent fluid convection due to density gradients and gravity independent electroosmosis. Optimization of focusing requires a more complex model describing the molecular transport processes involved in electrophoresis of interacting systems. Three different focusing instruments were designed, embodying novel principles of fluid stabilization. Fluid stability was achieved by: (1) flow streamlining by means of membrane elements in combination with rapid fluid recycling; (2) apparatus rotation in combination with said membrane elements; and (3) shear stress induced by rapid recycling through a narrow gap channel.
Jeon, Hyungkook; Kim, Youngkyu; Lim, Geunbae
2016-01-28
In this paper, we introduce pressure-driven flow-induced miniaturizing free-flow electrophoresis (PDF-induced μ-FFE), a novel continuous separation method. In our separation system, the external flow and electric field are applied to particles, such that particle movement is affected by pressure-driven flow, electroosmosis, and electrophoresis. We then analyzed the hydrodynamic drag force and electrophoretic force applied to the particles in opposite directions. Based on this analysis, micro- and nano-sized particles were separated according to their electrophoretic mobilities with high separation efficiency. Because the separation can be achieved in a simple T-shaped microchannel, without the use of internal electrodes, it offers the advantages of low-cost, simple device fabrication and bubble-free operation, compared with conventional μ-FFE methods. Therefore, we expect the proposed separation method to have a wide range of filtering/separation applications in biochemical analysis.
Jeon, Hyungkook; Kim, Youngkyu; Lim, Geunbae
2016-01-01
In this paper, we introduce pressure-driven flow-induced miniaturizing free-flow electrophoresis (PDF-induced μ-FFE), a novel continuous separation method. In our separation system, the external flow and electric field are applied to particles, such that particle movement is affected by pressure-driven flow, electroosmosis, and electrophoresis. We then analyzed the hydrodynamic drag force and electrophoretic force applied to the particles in opposite directions. Based on this analysis, micro- and nano-sized particles were separated according to their electrophoretic mobilities with high separation efficiency. Because the separation can be achieved in a simple T-shaped microchannel, without the use of internal electrodes, it offers the advantages of low-cost, simple device fabrication and bubble-free operation, compared with conventional μ-FFE methods. Therefore, we expect the proposed separation method to have a wide range of filtering/separation applications in biochemical analysis. PMID:26819221
He, Liping; Sato, Kae; Abo, Mitsuru; Okubo, Akira; Yamazaki, Sunao
2003-03-01
Saccharides including mono- and disaccharides were quantitatively derivatized with 2-aminobenzoic acid (2-AA). These derivatives were then separated by capillary zone electrophoresis with UV detection using 50mM sodium phosphate buffer as the running electrolyte solution. In particular, the saccharide derivatives with the same molecular weight as 2-AA aldohexoses (mannose and glucose) and 2-AA aldopentoses (ribose and xylose) were well separated. The underlying reasons for separation were explored by studying their structural data using 1H and 13C NMR. It was found that the configurational difference between their hydroxyl group at C2 or C3 could cause the difference in Stokes' radii between their molecules and thus lead to different electrophoretic mobilities. The correlation between the electrophoretic behavior of these carbohydrate derivatives and their structures was studied utilizing the calculated molecular models of the 2-AA-labeled mannose, glucose, ribose, and xylose.
Use of hydrophilic polymer coatings for control of electroosmosis and protein adsorption
NASA Technical Reports Server (NTRS)
Harris, J. Milton
1987-01-01
The purpose of this project was to examine the utility of polyethylene glycol (PEG) and dextran coatings for control of electroosmosis and protein adsorption; electroosmosis is an important, deleterious process affecting electrophoretic separations, and protein adsorption is a factor which needs to be controlled during protein crystal growth to avoid multiple nucleation sites. Performance of the project required use of X-ray photoelectron spectroscopy to refine previously developed synthetic methods. The results of this spectroscopic examination are reported. Measurements of electroosmotic mobility of charged particles in appropriately coated capillaries reveals that a new, one-step route to coating capillaries gives a surface in which electroosmosis is dramatically reduced. Similarly, both PEG and dextran coatings were shown by protein adsorption measurements to be highly effective at reducing protein adsorption on solid surfaces. These results should have impact on future low-g electrophoretic and protein crystal growth experiments.
Duval, Jérôme F L; Slaveykova, Vera I; Hosse, Monika; Buffle, Jacques; Wilkinson, Kevin J
2006-10-01
The electrostatic, hydrodynamic and conformational properties of aqueous solutions of succinoglycan have been analyzed by fluorescence correlation spectroscopy (FCS), proton titration, and capillary electrophoresis (CE) over a large range of pH values and electrolyte (NaCl) concentrations. Using the theoretical formalism developed previously for the electrokinetic properties of soft, permeable particles, a quantitative analysis for the electro-hydrodynamics of succinoglycan is performed by taking into account, in a self-consistent manner, the measured values of the diffusion coefficients, electric charge densities, and electrophoretic mobilities. For that purpose, two limiting conformations for the polysaccharide in solution are tested, i.e. succinoglycan behaves as (i) a spherical, random coil polymer or (ii) a rodlike particle with charged lateral chains. The results show that satisfactory modeling of the titration data for ionic strengths larger than 50 mM can be accomplished using both geometries over the entire range of pH values. Electrophoretic mobilities measured for sufficiently large pH values (pH > 5-6) are in line with predictions based on either model. The best manner to discriminate between these two conceptual models is briefly discussed. For low pH values (pH < 5), both models indicate aggregation, resulting in an increase of the hydrodynamic permeability and a decrease of the diffusion coefficient.
Structure of allelic variants of subtype 5 of histone H1 in pea Pisum sativum L.
Bogdanova, V S; Lester, D R; Berdnikov, V A; Andersson, I
2005-06-01
The pea genome contains seven histone H1 genes encoding different subtypes. Previously, the DNA sequence of only one gene, His1, coding for the subtype H1-1, had been identified. We isolated a histone H1 allele from a pea genomic DNA library. Data from the electrophoretic mobility of the pea H1 subtypes and their N-bromosuccinimide cleavage products indicated that the newly isolated gene corresponded to the H1-5 subtype encoded by His5. We confirmed this result by sequencing the gene from three pea lines with H1-5 allelic variants of altered electrophoretic mobility. The allele of the slow H1-5 variant differed from the standard allele by a nucleotide substitution that caused the replacement of the positively charged lysine with asparagine in the DNA-interacting domain of the histone molecule. A temperature-related occurrence had previously been demonstrated for this H1-5 variant in a study on a worldwide collection of pea germplasm. The variant tended to occur at higher frequencies in geographic regions with a cold climate. The fast allelic variant of H1-5 displayed a deletion resulting in the loss of a duplicated pentapeptide in the C-terminal domain.
Biased Cyclical Electrical Field-Flow Fractionation for Separation of Submicron Particles
Ornthai, Mathuros; Siripinyanond, Atitaya; Gale, Bruce K.
2015-01-01
The potential of biased cyclical electrical field flow fractionation (BCyElFFF), which applies the positive cycle voltage longer than the negative cycle voltage, for characterization of submicron particles, was investigated. Parameters affecting separation and retention such as voltage, frequency, and duty cycle were examined. The results suggest that the separation mechanism in BCyElFFF in many cases is more related to the size of particles, as is the case with normal ElFFF, in the studied conditions, than the electrophoretic mobility, which is what the theory predicts for CyElFFF. However, better resolution was obtained when separating using BCyElFFF mode than when using normal CyElFFF. BCyElFFF was able to demonstrate simultaneous baseline separations of a mixture of 0.04, 0.1, and 0.2 μm particles and near separation of 0.5 μm particles. This study has shown the applicability of the BCyElFFF for separation and characterization of submicron particles greater than 0.1 μm in size, which had not been demonstrated previously. The separation and retention results suggest that for particles of this size, retention is based more on particle size than on electrophoretic mobility, which is contrary to existing theory for CyElFFF. PMID:26612733
Biased cyclical electrical field-flow fractionation for separation of submicron particles.
Ornthai, Mathuros; Siripinyanond, Atitaya; Gale, Bruce K
2016-01-01
The potential of biased cyclical electrical field-flow fractionation (BCyElFFF), which applies the positive cycle voltage longer than the negative cycle voltage, for characterization of submicron particles, was investigated. Parameters affecting separation and retention such as voltage, frequency, and duty cycle were examined. The results suggest that the separation mechanism in BCyElFFF in many cases is more related to the size of particles, as is the case with normal ElFFF, in the studied conditions, than the electrophoretic mobility, which is what the theory predicts for CyElFFF. However, better resolution was obtained when separating using BCyElFFF mode than when using normal CyElFFF. BCyElFFF was able to demonstrate simultaneous baseline separations of a mixture of 0.04-, 0.1-, and 0.2-μm particles and near separation of 0.5-μm particles. This study has shown the applicability of BCyElFFF for separation and characterization of submicron particles greater than 0.1-μm in size, which had not been demonstrated previously. The separation and retention results suggest that for particles of this size, retention is based more on particle size than on electrophoretic mobility, which is contrary to existing theory for CyElFFF.
The electrophoretically 'slow' and 'fast' forms of the alpha 2-macroglobulin molecule.
Barrett, A J; Brown, M A; Sayers, C A
1979-01-01
alpha 2-Macroglobulin (alpha 2M) was isolated from human plasma by a four-step procedure: poly(ethylene glyco) fractionation, gel chromatography, euglobulin precipitation and immunoadsorption. No contaminants were detected in the final preparations by electrophoresis or immunoprecipitation. The protein ran as a single slow band in gel electrophoresis, and was designated 'S-alpha 2M'. S-alpha 2M bound about 2 mol of trypsin/mol. Treatment of S-alpha 2M with a proteinase or ammonium salts produced a form of the molecule more mobile in electrophoresis, and lacking proteinase-binding activity (F-alpha 2M). The electrophoretic mobility of the F-alpha 2M resulting from reaction with NH4+ salts was identical with that of proteinase complexes. We attribute the change in electrophoretic mobility of the alpha 2M to a conformation change, but there was no evidence of a change in pI or Strokes radius. Electrophoresis of S-alpha 2M in the presence of sodium dodecylsulphate gave results consistent with the view that the alpha 2M molecule is a tetramer of identical subunits, assembled as a non-covalent pair of disulphide-linked dimers. Some of the subunits seemed to be 'nicked' into two-thires-length and one-third-length chains, however. This was not apparent with F-alpha 2M produced by ammonium salts. F-alpha 2M produced by trypsin showed two new bands attributable to cleavage of the subunit polypeptide chain near the middle. Immunoassays of F-alpha 2M gave 'rockets' 12-29% lower than those with S-alpha 2M. The nature of the interactions between subunits in S-alpha 2M and F-alpha 2M was investigated by treating each form with glutaraldehyde before electrophoresis in the presence of sodium dodecyl sulphate. A much greater degree of cross-linking was observed with the F-alpha 2M, indicating that the subunits interact most closely in this form of the molecule. Exposure of S-alpha 2M to 3 M-urea or pH3 resulted in dissociation to the disulphide-bonded half-molecules; these did not show the proteinase-binding activity characteristic of the intact alpha 2M. F-alpha 2M was less easily dissociated than was S-alpha 2M. S-alpha 2M was readily dissociated to the quarter-subunits by mild reduction, with the formation of 3-4 new thiol groups per subunit. Inact reactive alpha 2M could then be regenerated in high yield by reoxidation of the subunits. F-alpha 2M formed by reaction with a proteinase or ammonium salts was not dissociated under the same conditions, although the interchain disulphide bonds were reduced. If the thiol groups of the quarter-subunits of S-alpha 2M were blocked by carboxymethylation, oxidative reassociation did not occur. Nevertheless treatment of these subunits with methylammonium salts or a proteinase caused the reassembly of half-molecules and intact (F-) tetramers. It is emphasized that F-alpha 2M does not have the properties of a denatured form of the protein... Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:91367
NASA Technical Reports Server (NTRS)
Todd, Paul; Plank, Lindsay D.; Kunze, M. Elaine; Lewis, Marian L.; Morrison, Dennis R.
1986-01-01
The use of free-fluid electrophoresis methods to separate tissue cells having a specific function is discussed. It is shown that cells suspended by trypsinization from cultures of human embryonic kidney are electrophoretically heterogeneous and tolerate a wide range of electrophoresis buffers and conditions without significant attenuation of function. Moreover, these cells do not separate electrophoretically on the basis of size or cell position alone and can be separated according to their ability to give rise to progeny that produce specific plasminogen activators.
Panitz, J.K.; Reed, S.T.; Ashley, C.S.; Neiser, R.A.; Moffatt, W.C.
1999-07-20
Electrophoretically active sol-gel processes to fill, seal, and/or density porous, flawed, and/or cracked coatings on electrically conductive substrates. Such coatings may be dielectrics, ceramics, or semiconductors and, by the present invention, may have deposited onto and into them sol-gel ceramic precursor compounds which are subsequently converted to sol-gel ceramics to yield composite materials with various tailored properties. 6 figs.
Kumar, Krishan; Singal, Ankita; Rizvi, M Moshahid A; Chauhan, Virander S
2008-06-01
High mobility group box chromosomal protein 1 (HMGB1), known as an abundant, non-histone architectural chromosomal protein, is highly conserved across different species. Homologues of HMGB1 were identified and cloned from malaria parasite, Plasmodium falciparum. Sequence analyses showed that the P. falciparum HMGB1 (PfHMGB1) exhibits 45, 23 and 18%, while PfHMGB2 shares 42, 21 and 17% homology with Saccharomyces cerevisiae, human and mouse HMG box proteins respectively. Parasite PfHMGB1and PfHMGB2 proteins contain one HMG Box domain similar to B-Box of mammalian HMGB1. Electrophoretic Mobility Shift Assay (EMSA) showed that recombinant PfHMGB1 and PfHMGB2 bind to DNA. Immunofluorescence Assay using specific antibodies revealed that these proteins are expressed abundantly in the ring stage nuclei. Significant levels of PfHMGB1 and PfHMGB2 were also present in the parasite cytosol at trophozoite and schizont stages. Both, PfHMGB1 and PfHMGB2 were found to be potent inducers of pro-inflammatory cytokines such as TNFalpha from mouse peritoneal macrophages as analyzed by both reverse transcription PCR and by ELISA. These results suggest that secreted PfHMGB1 and PfHMGB2 may be responsible for eliciting/ triggering host inflammatory immune responses associated with malaria infection.
Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E
1999-07-15
RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.
Binary Oscillatory Crossflow Electrophoresis
NASA Technical Reports Server (NTRS)
Molloy, Richard F.; Gallagher, Christopher T.; Leighton, David T., Jr.
1997-01-01
Electrophoresis has long been recognized as an effective analytic technique for the separation of proteins and other charged species, however attempts at scaling up to accommodate commercial volumes have met with limited success. In this report we describe a novel electrophoretic separation technique - Binary Oscillatory Crossflow Electrophoresis (BOCE). Numerical simulations indicate that the technique has the potential for preparative scale throughputs with high resolution, while simultaneously avoiding many problems common to conventional electrophoresis. The technique utilizes the interaction of an oscillatory electric field and a transverse oscillatory shear flow to create an active binary filter for the separation of charged protein species. An oscillatory electric field is applied across the narrow gap of a rectangular channel inducing a periodic motion of charged protein species. The amplitude of this motion depends on the dimensionless electrophoretic mobility, alpha = E(sub o)mu/(omega)d, where E(sub o) is the amplitude of the electric field oscillations, mu is the dimensional mobility, omega is the angular frequency of oscillation and d is the channel gap width. An oscillatory shear flow is induced along the length of the channel resulting in the separation of species with different mobilities. We present a model that predicts the oscillatory behavior of charged species and allows estimation of both the magnitude of the induced convective velocity and the effective diffusivity as a function of a in infinitely long channels. Numerical results indicate that in addition to the mobility dependence, the steady state behavior of solute species may be strongly affected by oscillating fluid into and out of the active electric field region at the ends of the cell. The effect is most pronounced using time dependent shear flows of the same frequency (cos((omega)t)) flow mode) as the electric field oscillations. Under such conditions, experiments indicate that solute is drawn into the cell from reservoirs at both ends of the cell leading to a large mass build up. As a consequence, any initially induced mass flux will vanish after short times. This effect was not captured by the infinite channel model and hence numerical and experimental results deviated significantly. The revised model including finite cell lengths and reservoir volumes allowed quantitative predictions of the time history of the concentration profile throughout the system. This latter model accurately describes the fluxes observed for both oscillatory flow modes in experiments using single protein species. Based on the results obtained from research funded under NASA grant NAG-8-1080.S, we conclude that binary separations are not possible using purely oscillatory flow modes because of end effects associated with the cos((omega)t) mode. Our research shows, however, that a combination of cos(2(omega)t) and steady flow should lead to efficient separation free of end effects. This possibility is currently under investigation.
NASA Technical Reports Server (NTRS)
Todd, P.
1985-01-01
Materials and procedures for microgravity electrophoresis of living human embryonic kidney cells were evaluated, ground support in the form of analytical cell electrophoresis and flow cytometry was provided and cells returned from space flight were analyzed. Preflight culture media, electrophoresis buffer, fraction collection media, temperature profiles, and urokinase assay procedures were tested prior to flight. Electrophoretic mobility distributions of aliquots of the cell population to be fractionated in flight were obtained. The protocol established and utilized is given.
Genomic Instability and Breast Cancer
2011-06-01
Survival Assay—Atotal of 1 103 cells were seeded onto a 60-mm dish in triplicate. Twenty-four hours after seeding, cells were irradiated by using a JL...ShepherdMark I-68A 137Cs- irradiator at indicated doses and incubated for 14 days. Result- ing colonies were fixed and stainedwithCoomassie Blue. Num...antibodies, cell culture, transfection and siRNAs, DNA substrates protein purification in insect cells, electrophoretic mobility shift assay and the ATPase
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
Liquid and gel electrodes for transverse free flow electrophoresis
Jung, Byoungsok; Rose, Klint A; Shusteff, Maxim; Persat, Alexandre; Santiago, Juan
2015-04-07
The present invention provides a mechanism for separating or isolating charged particles under the influence of an electric field without metal electrodes being in direct contact with the sample solution. The metal electrodes normally in contact with the sample are replaced with high conductivity fluid electrodes situated parallel and adjacent to the sample. When the fluid electrodes transmit the electric field across the sample, particles within the sample migrate according to their electrophoretic mobility.
Triazine herbicide imprinted monolithic column for capillary electrochromatography.
Aşır, Süleyman; Derazshamshir, Ali; Yılmaz, Fatma; Denizli, Adil
2015-12-01
Trietazine was selectively separated from aqueous solution containing the competitor molecule cyanazine, which is similar in size and shape to the template molecule. Structural features of the molecularly imprinted column were figured out by SEM. The influence of the mobile-phase composition, applied electrical field, and pH of the mobile phase on the recognition of trietazine by the imprinted monolithic polymer has been evaluated, and the imprint effect in the trietazine-imprinted monolithic polymer was demonstrated by an imprinting factor. The optimized monolithic column resulted in separation of trietazine from a structurally related competitor molecule, cyanazine. In addition, fast separation was obtained within 6 min by applying higher electrical field, with the electrophoretic mobility of 2.97 × 10(-8) m(2) V(-1) s(-1) at pH 11.0. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Association of electrophoretic karyotype of Candida stellatoidea with virulence for mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kwon-Chung, K.J.; Wickes, B.L.; Merz, W.G.
1988-07-01
Seven isolates of Candida stellatoidea were studied for their electrophoretic karyotype, virulence for mice, sensitivity to UV radiation, growth rate in vitro, reaction on cycloheximide-indicator medium, and proteinase activity. The isolates exhibited one of two distinct electrophoretic karyotypes as determined by orthogonal field alternating gel electrophoresis (OFAGE). Four isolates, including the type culture of C. stellatoidea, belonged to electrophoretic karyotype type I by OFAGE, showing eight to nine bands of which at least two bands were less than 1,000 kilobases in size as estimated by comparison with the DNA bands of Saccharomyces cerevisiae. These isolates failed to produce fatal infectionmore » in mice within 20 days when 5 X 10(5) cells were injected intravenously. The yeasts were cleared from the kidneys of two of three mice tested by day 30. Type I showed proteinase activity on bovine serum albumin agar at pH 3.8 and produced a negative reaction on cycloheximide-bromcresol green medium within 48 h. The three grouped in type II by OFAGE showed banding patterns similar to those of a well-characterized isolate of Candida albicans. The isolates of type II had an electrophoretic karyotype of six to seven bands approximately 1,200 kilobases or greater in size. All three type II isolates were highly virulent for mice, producing fatality curves similar to those of a previously studied C. albicans isolate. From 80 to 90% of the mice injected with 5 X 10(5) cells intravenously died within 20 days. The type II isolates produced a positive reaction on cycloheximide-bromcresol green agar and showed no proteinase activity on bovine serum albumin agar at the low pH. In addition, the type II isolates grew faster and were significantly more resistant to UV irradiation than the type I isolates.« less
Lee, Jin; Lim, Kye-Taek
2011-08-01
Di(2-ethylhexyl)phthalate (DEHP) is one of the many environmental chemicals that are widely used in polyvinyl chloride products, vinyl flooring, food packaging and infant toys. They cause cell proliferation or dysfunction of human liver. The purpose of this study is to investigate the inhibitory effect of a glycoprotein (24 kDa) isolated from Zanthoxylum piperitum DC (ZPDC) on proliferation of liver cell in the DEHP-induced BNL CL. 2 cells. [³H]-thymidine incorporation, intracellular reactive oxygen species (ROS), intracellular Ca²⁺ mobilization and activity of protein kinase C (PKC) were measured using radioactivity and fluorescence method respectively. The expression of mitogen-activated protein kinases [extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK)], activator protein (AP)-1 (c-Jun and c-Fos), proliferating cell nuclear antigen (PCNA) and cell cycle-related factors (cyclin D1/cyclin-dependent kinase [CDK] 4) were evaluated using Western blotting or electrophoretic mobility shift assay. The results in this study showed that the levels of [³H]-thymidine incorporation, intracellular ROS, intracellular Ca²⁺ mobilization and activity of PKCα were inhibited by ZPDC glycoprotein (100 µg/ml) in the DEHP-induced BNL CL. 2 cells. Also, activities of ERK, JNK and AP-1 were reduced by ZPDC glycoprotein (100 µg/ml). With regard to cell proliferation, activities of PCNA and cyclin D1/CDK4 were significantly suppressed at treatment with ZPDC glycoprotein (100 µg/ml) in the presence of DEHP. Taken together, these findings suggest that ZPDC glycoprotein significantly normalized activities of PCNA and cyclin D1/CDK4, which relate to cell proliferation factors. Thus, ZPDC glycoprotein appears to be one of the compounds derived from natural products that are able to inhibit cell proliferation in the phthalate-induced BNL CL. 2 cells. Copyright © 2011 John Wiley & Sons, Ltd.
Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.
Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H
2001-12-21
We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.
Separation of lymphocytes by electrophoresis under terrestrial conditions and at zero gravity
NASA Technical Reports Server (NTRS)
Rubin, A. L.
1977-01-01
Electrophoretic mobility (EPM) of human peripheral lymphocytes were examined with the following objectives: To determine differences in EPM of lymphocytes under immuno-stimulated and immuno-suppressed states. To define the conditions necessary for the separation of lymphocyte sub-populations in normal and pathological conditions; To investigate immunological active, charged chemical groups on lymphocyte surfaces; and to investigate pathophysiological mechanisms of immune responsiveness, as reflected by alterations in EPM. To evaluate the potential of lymphocyte electrophoresis as: (1) a means of monitoring the immune status of kidney transplant recipients, (2) in predicting the outcome of kidney transplants, and (3) as a method for separation of lymphocyte sub-populations, the EPM was studied for unfractionated human peripheral lymphocytes and of populations enriched with T and "B" cells from normal adults, hemodialysis patients and kidney transplant recipients.
Kommoju, Phaneeswara Rao; Macheroux, Peter; Ghisla, Sandro
2007-03-01
A cDNA encoding LAAO from the Malayan pit viper (Calloselasma rhodostoma) was cloned into an expression vector of the methylotropic yeast Pichia pastoris. The LAAO open reading frame was inserted after the alpha-MF-signal sequence. Upon induction soluble and active LAAO is produced and exported into the culture supernatant at a concentration of up to 0.4 mg/L. Recombinant LAAO was purified from this by ion exchange and molecular sieve chromatography to yield apparently homogeneous protein in quantities of approximately 0.25 mg/L growth medium. Expressed LAAO exhibits the same electrophoretic mobility as native LAAO (62 kDa) and exhibits approximately the same extent of glycosylation as authentic LAAO from snake venom. Catalytic properties and substrate specificity of recombinant LAAO are similar to those of native enzyme.
NASA Astrophysics Data System (ADS)
Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.
2017-11-01
Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Todd, P. W.
1985-01-01
A variety of proteolytic and micolytic enzumes, mechanical procedures, and changes in the ionic environment, especially Ca chelation, are used for dispersal of monolayer grown cells. If either chelating agents or mechanical dispersion are used alone, the cell yield is often low and suspensions of single cells are difficult to obtain. Confluent monolayers treated with EDTA tend to be released from their surfaces in sheets, and clumps of cells remain even after further incubation in EDTA. Crude trypsin is the most popular dispersal agent and is known to contain a variety of contaminating enzymes which contribute to the dispersal of cells. A variety of cell injuries resulting from the activity of proteolytic enzymes are reported. It is shown that crystalline trypsin is least harmful to cell integrity as judged by trypan blue uptake.
Parodi, Monica; Pedrazzi, Marco; Cantoni, Claudia; Averna, Monica; Patrone, Mauro; Cavaletto, Maria; Spertino, Stefano; Pende, Daniela; Balsamo, Mirna; Pietra, Gabriella; Sivori, Simona; Carlomagno, Simona; Mingari, Maria Cristina; Moretta, Lorenzo; Sparatore, Bianca; Vitale, Massimo
2015-01-01
In this study we characterize a new mechanism by which Natural Killer (NK) cells may amplify their recruitment to tumors. We show that NK cells, upon interaction with melanoma cells, can release a chemotactic form of High Mobility Group Box-1 (HMGB1) protein capable of attracting additional activated NK cells. We first demonstrate that the engagement of different activating NK cell receptors, including those mainly involved in tumor cell recognition can induce the active release of HMGB1. Then we show that during NK-mediated tumor cell killing two HMGB1 forms are released, each displaying a specific electrophoretic mobility possibly corresponding to a different redox status. By the comparison of normal and perforin-defective NK cells (which are unable to kill target cells) we demonstrate that, in NK/melanoma cell co-cultures, NK cells specifically release an HMGB1 form that acts as chemoattractant, while dying tumor cells passively release a non-chemotactic HMGB1. Finally, we show that Receptor for Advanced Glycation End products is expressed by NK cells and mediates HMGB1-induced NK cell chemotaxis. Proteomic analysis of NK cells exposed to recombinant HMGB1 revealed that this molecule, besides inducing immediate chemotaxis, also promotes changes in the expression of proteins involved in the regulation of the cytoskeletal network. Importantly, these modifications could be associated with an increased motility of NK cells. Thus, our findings allow the definition of a previously unidentified mechanism used by NK cells to amplify their response to tumors, and provide additional clues for the emerging role of HMGB1 in immunomodulation and tumor immunity. PMID:26587323
Vertical ascending electrophoresis of cells with a minimal stabilizing medium
NASA Technical Reports Server (NTRS)
Omenyi, S. N.; Snyder, R. S.
1983-01-01
Vertical fractionation of a mixture of fixed horse and human red blood cells layered over a stabilizing support medium was done to give a valid comparison with proposed space experiments. In particular, the effects of sample thickness and concentration on zone migration rate were investigated. Electrophoretic mobilities of horse and human cells calculated from zone migration rates were compatible with those obtained by microelectrophoresis. Complete cell separation was observed when low power and effective cooling were employed.
The surface charge of trypanosomatids.
Souto-Padrón, Thaïs
2002-12-01
The surface charge of trypanosomatids was evaluated by means of the binding of cationic particles, as visualized by electron microscopy and by direct measurements of the electrophoretic mobility of cells. The results obtained indicate that most of the trypanosomatids exhibit a negatively charged surface whose value is species specific and varies according to the developmental stages. Sialic acids associated with glycoproteins, glycolipids and phosphate groups are the major components responsible for the net negative surface charge of the trypanosomatids.
Divakar, K; Devi, G Nandhini; Gautam, Pennathur
2012-01-01
Protein identification in polyacrylamide gel electrophoresis (PAGE) requires post-electrophoretic steps like fixing, staining, and destaining of the gel, which are time-consuming and cumbersome. A new method for direct visualization of protein bands in PAGE has been developed using meso-tetrakis(4-sulfonatophenyl)porphyrin (TPPS) as a dye without the need for any post-electrophoretic steps; thus, separation and recovery of enzymes become much easier for further analysis. Activity staining was carried out to show that the biochemical activity of the enzymes was preserved after electrophoresis.
Recombinant albumin monolayers on latex particles.
Sofińska, Kamila; Adamczyk, Zbigniew; Kujda, Marta; Nattich-Rak, Małgorzata
2014-01-14
The adsorption of recombinant human serum albumin (rHSA) on negatively charged polystyrene latex micro-particles was studied at pH 3.5 and the NaCl concentration range of 10(-3) to 0.15 M. The electrophoretic mobility of latex monotonically increased with the albumin concentration in the suspension. The coverage of adsorbed albumin was quantitatively determined using the depletion method, where the residual protein concentration was determined by electrokinetic measurements and AFM imaging. It was shown that albumin adsorption was irreversible. Its maximum coverage on latex varied between 0.7 mg m(-2) for 10(-3) M NaCl to 1.3 mg m(-2) for 0.15 M NaCl. The latter value matches the maximum coverage previously determined for human serum albumin on mica using the streaming potential method. The increase in the maximum coverage was interpreted in terms of reduced electrostatic repulsion among adsorbed molecules. These facts confirm that albumin adsorption at pH 3.5 is governed by electrostatic interactions and proceeds analogously to colloid particle deposition. The stability of albumin monolayers was measured in additional experiments where changes in the latex electrophoretic mobility and the concentration of free albumin in solutions were monitored over prolonged time periods. Based on these experimental data, a robust procedure of preparing albumin monolayers on latex particles of well-controlled coverage and molecule distribution was proposed.
Batz, Nicholas G; Mellors, J Scott; Alarie, Jean Pierre; Ramsey, J Michael
2014-04-01
We describe a chemical vapor deposition (CVD) method for the surface modification of glass microfluidic devices designed to perform electrophoretic separations of cationic species. The microfluidic channel surfaces were modified using aminopropyl silane reagents. Coating homogeneity was inferred by precise measurement of the separation efficiency and electroosmotic mobility for multiple microfluidic devices. Devices coated with (3-aminopropyl)di-isopropylethoxysilane (APDIPES) yielded near diffusion-limited separations and exhibited little change in electroosmotic mobility between pH 2.8 and pH 7.5. We further evaluated the temporal stability of both APDIPES and (3-aminopropyl)triethoxysilane (APTES) coatings when stored for a total of 1 week under vacuum at 4 °C or filled with pH 2.8 background electrolyte at room temperature. Measurements of electroosmotic flow (EOF) and separation efficiency during this time confirmed that both coatings were stable under both conditions. Microfluidic devices with a 23 cm long, serpentine electrophoretic separation channel and integrated nanoelectrospray ionization emitter were CVD coated with APDIPES and used for capillary electrophoresis (CE)-electrospray ionization (ESI)-mass spectrometry (MS) of peptides and proteins. Peptide separations were fast and highly efficient, yielding theoretical plate counts over 600,000 and a peak capacity of 64 in less than 90 s. Intact protein separations using these devices yielded Gaussian peak profiles with separation efficiencies between 100,000 and 400,000 theoretical plates.
Quantification of Cysteinyl-S-Nitrosylation by Fluorescence in Unbiased Proteomic Studies*
Wiktorowicz, John E.; Stafford, Susan; Rea, Harriet; Urvil, Petri; Soman, Kizhake; Kurosky, Alexander; Perez-Polo, J. Regino; Savidge, Tor C.
2011-01-01
Cysteinyl-S-nitrosylation has emerged as an important post-translational modification affecting protein function in health and disease. Great emphasis has been placed on global, unbiased quantification of S-nitrosylated proteins due to physiologic and oxidative stimuli. However, current strategies have been hampered by sample loss and altered protein electrophoretic mobility. Here, we describe a novel quantitative approach that combines accurate, sensitive fluorescence modification of cysteine S-nitrosylation that leaves electrophoretic mobility unaffected (SNOFlo), and introduce unique concepts for measuring changes in S-nitrosylation status relative to protein abundance. Its efficacy in defining the functional S-nitrosoproteome is demonstrated in two diverse biological applications: an in vivo rat hypoxia-ischemia reperfusion model, and antimicrobial S-nitrosoglutathione-driven transnitrosylation of an enteric microbial pathogen. The suitability of this approach for investigating endogenous S-nitrosylation is further demonstrated using Ingenuity Pathways analysis that identified nervous system and cellular development networks as the top two networks. Functional analysis of differentially S-nitrosylated proteins indicated their involvement in apoptosis, branching morphogenesis of axons, cortical neurons, and sympathetic neurites, neurogenesis, and calcium signaling. Major abundance changes were also observed for fibrillar proteins known to be stress-responsive in neurons and glia. Thus, both examples demonstrate the technique’s power in confirming the widespread involvement of S-nitrosylation in hypoxia-ischemia/reperfusion injury and in antimicrobial host responses. PMID:21615140
Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland
2017-01-01
For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability. PMID:27639623
Thermotolerant desert lizards characteristically differ in terms of heat-shock system regulation.
Zatsepina, O G; Ulmasov, K A; Beresten, S F; Molodtsov, V B; Rybtsov, S A; Evgen'ev, M B
2000-03-01
We compare the properties and activation of heat-shock transcription factor (HSF1) and the synthesis of a major family of heat-shock proteins (HSP70) in lizard species inhabiting ecological niches with strikingly different thermal parameters. Under normal non-heat-shock conditions, all desert-dwelling lizard species studied so far differ from a northern, non-desert species (Lacerta vivipara) in the electrophoretic mobility and content of proteins constitutively bound to the regulatory heat-shock elements in the heat-shock gene promoter. Under these conditions, levels of activated HSF1 and of both HSP70 mRNA and protein are higher in the desert species than in the non-desert species. Upon heat shock, HSF1 aggregates in all species studied, although in desert species HSF1 subsequently disaggregates more rapidly. Cells of the northern species have a lower thermal threshold for HSP expression than those of the desert species, which correlates with the relatively low constitutive level of HSPs and high basal content of HSF1 in their cells.
GATA-1 directly regulates Nanog in mouse embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100
2015-09-25
Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less
Gahr, M; Schröter, W; Sturzenegger, M; Bornhalm, D; Marti, H R
1976-08-01
A new variant of erythrocytic glucose-6-phosphate dehydrogenase has been found in a family of Swiss origin. It is associated with chronic nonsphaerocytic haemolytic anaemia. The enzyme from the erythrocytes of a young boy of this family was partially purified 110-fold and characterized. It revealed reduced catalytic activity, increased thermolability and two maxima of the pH activity curve at pH 7.0 and 8.5. The Km value for glucose-6-phosphate was reduced, that for NADP was normal. The enzyme showed an increased inhibitor constant for NADPH with respect to NADP. Electrophoretic mobility was normal (B+). 2-Desoxyglucose-6-phosphate and galactose-6-phosphate were utilized at normal rates, whereas the analogue deamino-NADP gave an increased utilization rate. The mother of the propositus could be identified as heterozygous for this enzyme deficiency. Chronic haemolysis is possibly due to the increased thermolability of the variant enzyme.
Mathematical models of continuous flow electrophoresis: Electrophoresis technology
NASA Technical Reports Server (NTRS)
Saville, Dudley A.
1986-01-01
Two aspects of continuous flow electrophoresis were studied: (1) the structure of the flow field in continuous flow devices; and (2) the electrokinetic properties of suspended particles relevant to electrophoretic separations. Mathematical models were developed to describe flow structure and stability, with particular emphasis on effects due to buoyancy. To describe the fractionation of an arbitrary particulate sample by continuous flow electrophoresis, a general mathematical model was constructed. In this model, chamber dimensions, field strength, buffer composition, and other design variables can be altered at will to study their effects on resolution and throughput. All these mathematical models were implemented on a digital computer and the codes are available for general use. Experimental and theoretical work with particulate samples probed how particle mobility is related to buffer composition. It was found that ions on the surface of small particles are mobile, contrary to the widely accepted view. This influences particle mobility and suspension conductivity. A novel technique was used to measure the mobility of particles in concentrated suspensions.
Han, Kyu Yeon; Kwon, Taek Hwan; Lee, Tae Hoon; Lee, Sung-Joon; Kim, Sung-Hoon; Kim, Jiyoung
2008-04-30
A variety of anti-inflammatory agents have been shown to exert chemopreventive activity via targeting of transcription factors such as NF-kappaB and AP-1. Lithospermum erythrorhizon (LE) has long been used in traditional oriental medicine. In this study, we demonstrated the inhibitory effects of LE extracts on lipopolysaccharide (LPS)-stimulated production of inflammatory cytokines. As an underlying mechanism of inhibition, LE extracts reduced LPS-induced transactivation of AP-1 as well as NF-kappaB in mouse macrophage cells. Electrophoretic mobility shift assays indicated that LE extracts inhibited the DNA binding activities of AP-1 and NF-kappaB. In addition, phosphorylation of IkappaB-alpha protein was suppressed by LE extracts. Moreover, LE extracts inhibited c-Jun N-terminal kinase and extracellular signal-regulated signaling pathways. Our results suggest that the anti-inflammatory activity of LE extracts may be mediated by the inhibition of signal transduction pathways that normally lead to the activation of AP-1and NF-kappaB. These inhibitory effects may be useful for chemoprevention of cancer or other chronic inflammatory diseases.
Leptin rapidly activates PPARs in C2C12 muscle cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bendinelli, Paola; Piccoletti, Roberta; Maroni, Paola
2005-07-08
Experimental evidence suggests that leptin operates on the tissues, including skeletal muscle, also by modulating gene expression. Using electrophoretic mobility shift assays, we have shown that physiological doses of leptin promptly increase the binding of C2C12 cell nuclear extracts to peroxisome proliferator-activated receptor (PPAR) response elements in oligonucleotide probes and that all three PPAR isoforms participate in DNA-binding complexes. We pre-treated C2C12 cells with AACOCF{sub 3}, a specific inhibitor of cytosolic phospholipase A{sub 2} (cPLA{sub 2}), an enzyme that supplies ligands to PPARs, and found that it abrogates leptin-induced PPAR DNA-binding activity. Leptin treatment significantly increased cPLA{sub 2} activity, evaluatedmore » as the release of [{sup 3}H]arachidonic acid from pre-labelled C2C12 cells, as well as phosphorylation. Further, using MEK1 inhibitor PD-98059 we showed that leptin activates cPLA{sub 2} through ERK induction. These results support a direct effect of leptin on skeletal muscle cells, and suggest that the hormone may modulate muscle transcription also by precocious activation of PPARs through ERK-cPLA{sub 2} pathway.« less
Nowak, Paweł Mateusz; Woźniakiewicz, Michał; Mitoraj, Mariusz; Sagan, Filip; Kościelniak, Paweł
2018-03-02
Capillary electrophoresis is often used to the determination of the acid-base dissociation/deprotonation constant (pK a ), and the more advanced thermodynamic quantities describing this process (ΔH°, -TΔS°). Remarkably, it is commonly overlooked that due to insufficient dissipation of Joule heating the accuracy of parameters determined using a standard approach may be questionable. In this work we show an effective method allowing to enhance reliability of these parameters, and to estimate the magnitude of errors. It relies on finding a relationship between electrophoretic mobility and actual temperature, and performing pK a determination with the corrected mobility values. It has been employed to accurately examine the thermodynamics of acid-base dissociation of several amine compounds - known for their strong dependency of pK a on temperature: six cathinones (2-methylmethcathinone, 3-methylmethcathinone, 4-methylmethcathinone, α-pyrrolidinovalerophenone, methylenedioxypyrovalerone, and ephedrone); and structurally similar 1-phenylethylamine. The average pK a error caused by Joule heating noted at 25 °C was relatively small - 0.04-0.05 pH unit, however, a more significant inaccuracy was observed in the enthalpic and, in particular, entropic terms. An alternative correction method has also been proposed, simpler and faster, but not such effective in correcting ΔH°/-TΔS° terms. The corrected thermodynamic data have been interpreted with the aid of theoretical calculations, on a ground of the enthalpy-entropy relationships and the most probable structural effects accounting for them. Finally, we have demonstrated that the thermal dependencies of electrophoretic mobility, modelled during the correction procedure, may be directly used to find optimal temperature providing a maximal separation efficiency. Copyright © 2018 Elsevier B.V. All rights reserved.
Chemical and immunochemical characterization of caseins and the major whey proteins of rabbit milk.
Dayal, R; Hurlimann, J; Suard, Y M; Kraehenbuhl, J P
1982-01-01
Caseins were separated from whey proteins by acid precipitation of skimmed rabbit milk. Whole casein was resolved by sodium dodecyl sulphate/polyacrylamide-gel electrophoresis into three major bands with apparent relative molecular masses (Mr of 31 000, 29 000 and 25 000. On agarose/urea-gel electrophoresis whole casein gave three bands with electrophoretic mobilities alpha, beta and gamma. The three components were purified by DEAE-cellulose chromatography under denaturing and reducing conditions. Each was shown to have a different amino acid, hexose and phosphorus content, as well as non-identical peptide fragments after proteinase digestion. The 31 000 Da (dalton) protein, of alpha-electrophoretic mobility, had a high phosphorus content (4.38%, w/w); the 29 000 Da peptide, of gamma-mobility, had the highest hexose content (2.2%, w/w), contained 0.8 cysteine residue per 100 amino acid residues and was susceptible to chymosin digestion corresponding thus to kappa-casein; the 25 000 Da protein migrated to the beta-position. The rabbit casein complex is composed of at least three caseins, two of which (alpha- and kappa-caseins) are analogous to the caseins from ruminants. Although caseins are poor immunogens, specific antibodies were raised against total and purified polypeptides. The antiserum directed against whole casein recognized each polypeptide, each casein corresponding to a distinct precipitation line. The antisera directed against each casein polypeptide reacted exclusively with the corresponding casein and no antiserum cross-reaction occurred between the three polypeptides. From whey, several proteins were isolated, characterized and used as antigens to raise specific antibodies. An iron-binding protein with an apparent Mr of 80 000 was shown to be immunologically and structurally identical with serum transferrin. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6177316
Chloroplast membrane alterations in triazine-resistant Amaranthus retroflexus biotypes
Arntzen, Charles J.; Ditto, Cathy L.; Brewer, Philip E.
1979-01-01
The effectiveness of diuron, atrazine, procyazine, and cyanazine were compared in controlling growth of redroot pigweed (Amaranthus retroflexus L.) in hydroponic culture. A very marked differential inhibition response was observed for atrazine between resistant and susceptible biotypes. Procyazine and cyanazine exhibited less dramatic differential responses, whereas diuron was equally effective in controlling growth in both biotypes. Photosystem II activity of chloroplasts from both triazine-resistant and triazine-susceptible biotypes was inhibited by diuron but only the chloroplasts from triazine-susceptible biotypes were inhibited significantly by atrazine. The photochemical activity of chloroplasts from triazine-resistant biotypes was partially resistant to procyazine or cyanazine inhibition. The parallel lack of diuron differential effects, partial procyazine and cyanazine differential response, and very marked atrazine differential response in both whole plant and chloroplast assays indicates that the chloroplast is the site of selective herbicide tolerance in these triazine-resistant redroot pigweed biotypes. Photosystem II photochemical properties were characterized by analysis of chlorophyll fluorescence transients in the presence or absence of herbicides. Data with susceptible chloroplasts indicated that both diuron and atrazine inhibit electron flow very near the primary electron acceptor of photosystem II. Only diuron altered the fluorescence transient in resistant chloroplasts. In untreated preparations there were marked differences in the fast phases of the fluorescence increase in resistant vs. susceptible chloroplasts; these data are interpreted as showing that the resistant plastids have an alteration in the rate of reoxidation of the primary photosystem II electron acceptor. Electrophoretic analysis of chloroplast membrane proteins of the two biotypes showed small changes in the electrophoretic mobilities of two polypeptide species. The data provide evidence for the following herbicide resistance mechanism: genetically controlled modification of the herbicide target site. Images PMID:16592608
Analysis of results of ASTP experiment in electrophoresis
NASA Technical Reports Server (NTRS)
Vanderhoff, J. W.; Micale, F. J.; Krumrine, P. H.
1977-01-01
The Apollo-Soyuz Test Project (ASTP) included an electrophoretic separation experiment of biological cells. The nature separation results of aldehyde-fixed rabbit, human and horse red blood cells, which were taken in the form of photographs taken at three-minute intervals, are the subject of this report. The electrophoretic separation was successful in that fractionation according to mobility did occur and was found in the sliced samples. Photographic evidence indicates that the low electroosmotic methylcellulose coating was successful in reducing the electroosmosis to a near zero value. Also, the flight film shows that the bands migrated down the column as theory would predict, producing two bands of high cell concentration separated and surrounded by regions of lower cell concentration. However, most likely some clumping of cells occurred to cause the trailing band to be larger than expected from theory. Overall, the experiment was a success in demonstrating a static electrophoresis separation under microgravity conditions with a resolution not possible on earth.
Erol, Özge Ö; Erdoğan, Behice Y; Onar, Atiye N
2017-03-01
Simultaneous determination of nitrate and nitrite in gunshot residue has been conducted by capillary electrophoresis using an acidic run buffer (pH 3.5). In previously developed capillary electrophoretic methods, alkaline pH separation buffers were used where nitrite and nitrate possess similar electrophoretic mobility. In this study, the electroosmotic flow has been reversed by using low pH running buffer without any additives. As a result of reversing the electroosmotic flow, very fast analysis has been actualized, well-defined and separated ion peaks emerge in less than 4 min. Besides, the limit of detection was improved by employing large volume sample stacking. Limit of detection values were 6.7 and 4.3 μM for nitrate and nitrite, respectively. In traditional procedure, mechanical agitation is employed for extraction, while in this work the extraction efficiency of ultrasound mixing for 30 min was found sufficient. The proposed method was successfully applied to authentic gunshot residue samples. © 2016 American Academy of Forensic Sciences.
Shashoua, V E; Nolan, P M; Shea, T B; Milinazzo, B
1992-06-01
Northern blot, immunoprecipitation, and gel electrophoretic data demonstrate that the mouse neuroblastoma NB2a/d1 cells express ependymin mRNA and synthesize and release into the culture medium a protein with immunoreactivity and electrophoretic mobility properties identical to ependymin. This is a brain extracellular glycoprotein that has been implicated in the consolidation process of memory formation and neuronal regeneration. In labeling experiments with 35S-methionine, dibutyrylcyclic3',5'-adenosine-monophosphate (dbcAMP) was found to stimulate the expression of ependymin mRNA and the enhanced synthesis and release of ependymin into the culture medium at the same time that dbcAMP stimulation of neurite outgrowth takes place. These results are consistent with the proposed role of the protein in the mechanism of neuronal regeneration and synaptogenesis. The data indicate that the NB2a/d1 cell line is a good model system for studies of the functional properties of ependymin.
Loxdale, H D; Rhodes, J A; Fox, J S
1985-07-01
A study of variation in three peptidases (PEP-3 to -5) in a parthenogenetic S. avenae field population at Rothamsted using serial one-dimensional polyacrylamide gel electrophoresis (involving changes of gel concentration and electrophoretic run-time) increased the overall number of "allozymes" (mobility variants) detected from 10 under standard conditions (6% gels, 2 h run-time) to 22, as well as revealing putative heterozygous banding patterns under some test conditions. However, an examination of another enzyme, 6-phosphogluconate dehydrogenase (6-PGD) in a sample collected at Rothamsted the following year failed, using a combination of serial methods (changes of gel concentration) and isoelectric focusing, to increase the total number of 6-PGD bands separated (seven, none of which appeared to be allelic in origin). Nevertheless, some major bands were split into several bands, whilst other infrequent bands were either gained or lost. The findings are briefly discussed.
Womack, J E; Cramer, D V
1980-10-01
Starch gel electrophoresis and histochemical staining with L-leucyl-L-tyrosine have revealed genetic variation for dipeptidase in Rattus norvegicus. The tissue distribution, substrate specificity, and heterozygous expression as a monmeric protein suggest homology of the variant peptidase to human PEP-C and mouse Pep-3 (Dip-1). We propose Peptidase-3 (Pep-3) as a name for this autosomal locus in the rat. The allele responsible for slower (less anodal) electrophoretic migration is designated Pep-3a and is characteristic of strain ACI/Pit. A faster (more anodal) electrophoretic mobility is the product of the Pep-3b allele in strain F344/Pit. Twenty-five additional inbred strains carry Pep-3a and 16 others carry Pep-3b. Wild rats trapped in Pittsburgh were polymorphic for this locus. Alleles at Pep-3 segregated independently of c (linkage group I), a (linkage group IV), RT2 and Es-1 (linkage group V), h (linkage group VI), and RTI (linkage group VIII).
Purification and protein composition of endogenous rat viruses.
Hlubinová, K; Prachar, J; Vrbenská, A; Matoska, J; Simkovic, D
1984-01-01
Endogenous retroviruses are not in the majority of cases the cause of any neoplasia, except for the laboratory conditions. As far as they might serve for the evolution of pathogenic retroviruses more attention should have been paid to them. In this paper we introduce some approaches to the purification of rat endogenous retroviruses to such a degree of purity that enabled satisfactory SDS-PAGE analysis of its structural proteins. Purities of samples obtained by usual purification methods, long-term isopycnic centrifugation at a high gravity force and velocity centrifugation are compared. Protein profile of rat endogenous virus in SDS-PAGE is compared with the ones of other retroviruses. For the first time the evidence was obtained for the striking similarity between electrophoretic protein profile of rat endogenous virus WERC and feline leukemia virus. The major structural proteins of rat endogenous retrovirus and feline leukemia virus cannot be distinguished even when resolution long gradient PAGE had been employed. The accordance of electrophoretic mobilities of major structural proteins in SDS-PAGE can indicate the relatedness of retroviruses.
Orphan nuclear receptor TLX regulates astrogenesis by modulating BMP signaling
Qin, Song; Niu, Wenze; Iqbal, Nida; Smith, Derek K.; Zhang, Chun-Li
2014-01-01
Neural stem cells (NSCs) are self-renewing multipotent progenitors that generate both neurons and glia. The precise control of NSC behavior is fundamental to the architecture and function of the central nervous system. We previously demonstrated that the orphan nuclear receptor TLX is required for postnatal NSC activation and neurogenesis in the neurogenic niche. Here, we show that TLX modulates bone morphogenetic protein (BMP)-SMAD signaling to control the timing of postnatal astrogenesis. Genes involved in the BMP signaling pathway, such as Bmp4, Hes1, and Id3, are upregulated in postnatal brains lacking Tlx. Chromatin immunoprecipitation and electrophoretic mobility shift assays reveal that TLX can directly bind the enhancer region of Bmp4. In accordance with elevated BMP signaling, the downstream effectors SMAD1/5/8 are activated by phosphorylation in Tlx mutant mice. Consequently, Tlx mutant brains exhibit an early appearance and increased number of astrocytes with marker expression of glial fibrillary acidic protein (GFAP) and S100B. Taken together, these results suggest that TLX tightly controls postnatal astrogenesis through the modulation of BMP-SMAD signaling pathway activity. PMID:24782704
Orphan nuclear receptor TLX regulates astrogenesis by modulating BMP signaling.
Qin, Song; Niu, Wenze; Iqbal, Nida; Smith, Derek K; Zhang, Chun-Li
2014-01-01
Neural stem cells (NSCs) are self-renewing multipotent progenitors that generate both neurons and glia. The precise control of NSC behavior is fundamental to the architecture and function of the central nervous system. We previously demonstrated that the orphan nuclear receptor TLX is required for postnatal NSC activation and neurogenesis in the neurogenic niche. Here, we show that TLX modulates bone morphogenetic protein (BMP)-SMAD signaling to control the timing of postnatal astrogenesis. Genes involved in the BMP signaling pathway, such as Bmp4, Hes1, and Id3, are upregulated in postnatal brains lacking Tlx. Chromatin immunoprecipitation and electrophoretic mobility shift assays reveal that TLX can directly bind the enhancer region of Bmp4. In accordance with elevated BMP signaling, the downstream effectors SMAD1/5/8 are activated by phosphorylation in Tlx mutant mice. Consequently, Tlx mutant brains exhibit an early appearance and increased number of astrocytes with marker expression of glial fibrillary acidic protein (GFAP) and S100B. Taken together, these results suggest that TLX tightly controls postnatal astrogenesis through the modulation of BMP-SMAD signaling pathway activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Syng-Ook; Jeong, Yun-Jeong; Yu, Mi Hee
2006-12-08
Matrix metalloproteinase-9 (MMP-9) plays a major role in the pathogenesis of atherosclerosis and restenosis by regulating both migration and proliferation of vascular smooth muscle cells (VSMC) after an arterial injury. In this study, we examined the inhibitory effect of three major flavonoids in Scutellariae Radix, baicalin, baicalein, and wogonin, on TNF-{alpha}-induced MMP-9 expression in human aortic smooth muscle cells (HASMC). Wogonin, but not baicalin and baicalein, significantly and selectively suppressed TNF-{alpha}-induced MMP-9 expression in HASMC. Reporter gene, electrophoretic mobility shift, and Western blotting assays showed that wogonin inhibits MMP-9 gene transcriptional activity by blocking the activation of NF-{kappa}B via MAPKmore » signaling pathways. Moreover, the Matrigel migration assay showed that wogonin reduced TNF-{alpha}-induced HASMC migration. These results suggest that wogonin effectively suppresses TNF-{alpha}-induced HASMC migration through the selective inhibition of MMP-9 expression and represents a potential agent for the prevention of vascular disorders related to the migration of VSMC.« less
NF-kappaB mediates FGF signal regulation of msx-1 expression.
Bushdid, P B; Chen, C L; Brantley, D M; Yull, F; Raghow, R; Kerr, L D; Barnett, J V
2001-09-01
The nuclear factor-kappaB (NF-kappaB) family of transcription factors is involved in proliferation, differentiation, and apoptosis in a stage- and cell-dependent manner. Recent evidence has shown that NF-kappaB activity is necessary for both chicken and mouse limb development. We report here that the NF-kappaB family member c-rel and the homeodomain gene msx-1 have partially overlapping expression patterns in the developing chick limb. In addition, inhibition of NF-kappaB activity resulted in a decrease in msx-1 mRNA expression. Sequence analysis of the msx-1 promoter revealed three potential kappaB-binding sites similar to the interferon-gamma (IFN-gamma) kappaB-binding site. These sites bound to c-Rel, as shown by electrophoretic mobility shift assay (EMSA). Furthermore, inhibition of NF-kappaB activity significantly reduced transactivation of the msx-1 promoter in response to FGF-2/-4, known stimulators of msx-1 expression. These results suggest that NF-kappaB mediates the FGF-2/-4 signal regulation of msx-1 gene expression. Copyright 2001 Academic Press.
Kook, Insun; Henley, Caitlin; Meyer, Florencia; Hoffmann, Federico G; Jones, Clinton
2015-10-01
The primary site for life-long latency of bovine herpesvirus 1 (BHV-1) is sensory neurons. The synthetic corticosteroid dexamethasone consistently induces reactivation from latency; however the mechanism by which corticosteroids mediate reactivation is unclear. In this study, we demonstrate for the first time that dexamethasone stimulates productive infection, in part, because the BHV-1 genome contains more than 100 potential glucocorticoid receptor (GR) response elements (GREs). Immediate early transcription unit 1 (IEtu1) promoter activity, but not IEtu2 or VP16 promoter activity, was stimulated by dexamethasone. Two near perfect consensus GREs located within the IEtu1 promoter were necessary for dexamethasone-mediated stimulation. Electrophoretic mobility shift assays and chromatin immunoprecipitation studies demonstrated that the GR interacts with IEtu1 promoter sequences containing the GREs. Although we hypothesize that DEX-mediated stimulation of IEtu1 promoter activity is important during productive infection and perhaps reactivation from latency, stress likely has pleiotropic effects on virus-infected cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Liu, Rongfeng; Liu, Yu-Chih; Meng, Junwei; Zhu, Haiyan; Zhang, Xuehong
2017-11-01
The β-secretase (BACE1) initiates the generation of toxic amyloid-β peptide (Aβ) from amyloid-β precursor protein (APP), which was widely considered to play a key role in the pathogenesis of Alzheimer's disease (AD). Here, a novel microfluidics-based mobility shift assay (MMSA) was developed, validated, and applied for the screening of BACE1 inhibitors for AD. First, the BACE1 activity assay was established with a new fluorescent peptide substrate (FAM-EVNLDAEF) derived from the Swedish mutant APP, and high-quality ratiometric data were generated in both endpoint and kinetic modes by electrophoretic separation of peptide substrate from the BACE1 cleaved product (FAM-EVNL) before fluorescence quantification. To validate the assay, the inhibition and kinetic parameter values of two known inhibitors (AZD3839 and AZD3293) were evaluated, and the results were in good agreement with those reported by other methods. Finally, the assay was applied to screen for new inhibitors from a 900-compound library in a 384-well format, and one novel hit (IC 50 = 26.5 ± 1.5 μM) was identified. Compared with the common fluorescence-based assays, the primary advantage of the direct MMSA was to discover novel BACE1 inhibitors with lower auto-fluorescence interference, and its superb capability for kinetic study. Graphical abstract Microfluidics-based mobility shift assay for BACE1.
Matussek, K; Moritz, P; Brunner, N; Eckerskorn, C; Hensel, R
1998-11-01
Cyclic 2,3-diphosphoglycerate synthetase (cDPGS) catalyzes the synthesis of cyclic 2,3-diphosphoglycerate (cDPG) by formation of an intramolecular phosphoanhydride bond in 2,3-diphosphoglycerate. cDPG is known to be accumulated to high intracellular concentrations (>300 mM) as a putative thermoadapter in some hyperthermophilic methanogens. For the first time, we have purified active cDPGS from a methanogen, the hyperthermophilic archaeon Methanothermus fervidus, sequenced the coding gene, and expressed it in Escherichia coli. cDPGS purification resulted in enzyme preparations containing two isoforms differing in their electrophoretic mobility under denaturing conditions. Since both polypeptides showed the same N-terminal amino acid sequence and Southern analyses indicate the presence of only one gene coding for cDPGS in M. fervidus, the two polypeptides originate from the same gene but differ by a not yet identified modification. The native cDPGS represents a dimer with an apparent molecular mass of 112 kDa and catalyzes the reversible formation of the intramolecular phosphoanhydride bond at the expense of ATP. The enzyme shows a clear preference for the synthetic reaction: the substrate affinity and the Vmax of the synthetic reaction are a factor of 8 to 10 higher than the corresponding values for the reverse reaction. Comparison with the kinetic properties of the electrophoretically homogeneous, apparently unmodified recombinant enzyme from E. coli revealed a twofold-higher Vmax of the enzyme from M. fervidus in the synthesizing direction.
Large-scale collision cross-section profiling on a travelling wave ion mobility mass spectrometer
Lietz, Christopher B.; Yu, Qing; Li, Lingjun
2014-01-01
Ion mobility (IM) is a gas-phase electrophoretic method that separates ions according to charge and ion-neutral collision cross-section (CCS). Herein, we attempt to apply a travelling wave (TW) IM polyalanine calibration method to shotgun proteomics and create a large peptide CCS database. Mass spectrometry methods that utilize IM, such as HDMSE, often use high transmission voltages for sensitive analysis. However, polyalanine calibration has only been demonstrated with low voltage transmission used to prevent gas-phase activation. If polyalanine ions change conformation under higher transmission voltages used for HDMSE, the calibration may no longer be valid. Thus, we aimed to characterize the accuracy of calibration and CCS measurement under high transmission voltages on a TW IM instrument using the polyalanine calibration method and found that the additional error was not significant. We also evaluated the potential error introduced by liquid chromatography (LC)-HDMSE analysis, and found it to be insignificant as well, validating the calibration method. Finally, we demonstrated the utility of building a large-population peptide CCS database by investigating the effects of terminal lysine position, via LysC or LysN digestion, on the formation of two structural sub-families formed by triply charged ions. PMID:24845359
Hoffmann, W.; Kaufmann, R.; Steiner, R.; Werner, W.
1981-01-01
Determination of the electrophoretic mobility of test cells has been widely used in an attempt to detect so-called lymphokines in a laboratory test for cancer, but operational difficulties are inherent in conventional cytopherometers. This study therefore investigates the technical and operational aspects of cell electrophoresis, using the Zeiss cytopherometer; e.g. influence of electro-osmosis, focus uncertainty, movement due to convection and other sources of error. Implications and possible improvements in the test are discussed. PMID:7248145
Biochemical identification of the mallard, Anas platyrhynchos, and black duck, A. rubripes
Morgan, R.P.; Noe, L.A.; Henny, C.J.
1976-01-01
1. Eleven tissue systems from mallards and black ducks were examined for soluble proteins, lactate dehydrogenases and non-specific esterases through discontinuous polyacrylamide techniques.2. Biochemical relationships between the black duck and mallard are extremely similar.3. Hemoglobins and lactate dehydrogenase appear to be common in electrophoretic mobility between the two species.4. Approximately 89% of the soluble proteins and 58% of the non-specific esterases are common among the two species, indicating both biochemical similarity at the genus level and species-specificity.
Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar
1998-01-01
The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.
Majeed, S Abdul; Nambi, K S N; Taju, G; Vimal, S; Venkatesan, C; Hameed, A S Sahul
2014-12-01
The cytotoxicity, genotoxicity and oxidative stress of malachite green (MG) was investigated using the fish Channa striata kidney (CSK) and Channa striata gill (CSG) cell lines. Five concentrations ranging from 0.001 to 10 μg mL(-1) were tested in three independent experiments. Cytotoxicity was assessed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, Rhodamine 123 and Alamar Blue. The mitochondrial changes and apoptosis of MG-exposed cells were observed by Rhodamine 123 and acridine orange/ethidium bromide (AO/EB) staining, respectively. In vitro potential DNA damaging effect of MG was tested using comet assay. Mitochondrial damage, apoptosis and DNA fragmentation increased in a concentration-dependent manner. Additionally, DNA electrophoretic mobility experiments were carried out to study the binding effect of MG to double-stranded DNA (dsDNA) of cells. DNA shift mobility experiments showed that MG is capable of strongly binding to linear dsDNA causing its degradation. Biochemical parameters such as lipid peroxidation (MDA), catalase (CAT) activity and reduced glutathione (GSH) levels were evaluated after exposure to MG. In CSK and CSG cell lines exposed to MG for 48 h, a significant increase in lipid peroxidation, which might be associated with decreased levels of reduced glutathione and catalase activity in these cell lines (p < 0.001), was observed.
Dynamic electrophoretic fingerprinting of the HIV-1 envelope glycoprotein
2013-01-01
Background Interactions between the HIV-1 envelope glycoprotein (Env) and its primary receptor CD4 are influenced by the physiological setting in which these events take place. In this study, we explored the surface chemistry of HIV-1 Env constructs at a range of pH and salinities relevant to mucosal and systemic compartments through electrophoretic mobility (EM) measurements. Sexual transmission events provide a more acidic environment for HIV-1 compared to dissemination and spread of infection occurring in blood or lymph node. We hypothesize functional, trimeric Env behaves differently than monomeric forms. Results The dynamic electrophoretic fingerprint of trimeric gp140 revealed a change in EM from strongly negative to strongly positive as pH increased from that of the lower female genital tract (pHx) to that of the blood (pHy). Similar findings were observed using a trimeric influenza Haemagglutinin (HA) glycoprotein, indicating that this may be a general attribute of trimeric viral envelope glycoproteins. These findings were supported by computationally modeling the surface charge of various gp120 and HA crystal structures. To identify the behavior of the infectious agent and its target cells, EM measurements were made on purified whole HIV-1 virions and primary T-lymphocytes. Viral particles had a largely negative surface charge, and lacked the regions of positivity near neutral pH that were observed with trimeric Env. T cells changed their surface chemistry as a function of activation state, becoming more negative over a wider range of pH after activation. Soluble recombinant CD4 (sCD4) was found to be positively charged under a wide range of conditions. Binding studies between sCD4 and gp140 show that the affinity of CD4-gp140 interactions depends on pH. Conclusions Taken together, these findings allow a more complete model of the electrochemical forces involved in HIV-1 Env functionality. These results indicate that the influence of the localized environment on the interactions of HIV with target cells are more pronounced than previously appreciated. There is differential chemistry of trimeric, but not monomeric, Env under conditions which mimic the mucosa compared to those found systemically. This should be taken into consideration during design of immunogens which targets virus at mucosal portals of entry. PMID:23514633
Fan, Zhong-Qi; Tan, Xiao-Li; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye
2017-06-08
Plant-specific WRKY transcription factors (TFs) have been implicated to function as regulators of leaf senescence, but their association with postharvest leaf senescence of economically important leafy vegetables, is poorly understood. In this work, the characterization of a Group IIe WRKY TF, BrWRKY65, from Chinese flowering cabbage ( Brassica rapa var. parachinensis) is reported. The expression of BrWRKY65 was up-regulated following leaf chlorophyll degradation and yellowing during postharvest senescence. Subcellular localization and transcriptional activation assays showed that BrWRKY65 was localized in the nucleus and exhibited trans-activation ability. Further electrophoretic mobility shift assay (EMSA) and transient expression analysis clearly revealed that BrWRKY65 directly bound to the W-box motifs in the promoters of three senescence-associated genes ( SAGs ) such as BrNYC1 and BrSGR1 associated with chlorophyll degradation, and BrDIN1 , and subsequently activated their expressions. These findings demonstrate that BrWRKY65 may be positively associated with postharvest leaf senescence, at least partially, by the direct activation of SAGs . Taken together, these findings provide new insights into the transcriptional regulatory mechanism of postharvest leaf senescence in Chinese flowering cabbage.
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
Ashikhmin, Aleksandr; Makhneva, Zoya; Bolshakov, Maksim; Moskalenko, Andrey
2017-05-01
Spheroidene and spheroidenone from the non-sulfur bacterium Rhodobacter (Rba.) sphaeroides were incorporated into diphenylamine (DPA) LH1-RC and LH2 complexes from sulfur bacteria Allochromatium (Alc.) minutissimum and Ectothiorhodospira (Ect.) haloalkaliphila in which carotenoid (Car) biosynthesis was inhibited by ~95%. A series of biochemical characteristics of the modified LH2 complexes was studied (electrophoretic mobility, absorption and CD spectra, Car composition, Car-to-BChl energy transfer and thermal stability). It was found that the electrophoretic mobility of the complexes with incorporated Cars did not change compared to that of the control and DPA-complexes, indicating the absence of any significant change in the structure of LH complexes upon DPA-treatment and subsequent incorporation of Cars. The analysis of fluorescence excitation spectra of the spheroidene-incorporated LH2 complex (LH2:sph) and the spheroidenone-incorporated LH2 complex (LH2:sph-ne) showed that spheroidene and spheroidenone exhibited relatively low efficiencies of energy transfer to BChl, when incorporated into the LH2 DPA-complexes from Alc. minutissimum and Ect. haloalkaliphila, although, they showed high efficiencies, being in their natural state in the LH2 complexes from Rba. sphaeroides. A significant increase in thermostability observed for the LH2:sph and LH2:sph-ne complexes with respect to the LH2 DPA-complexes indicated that the two incorporated Cars stabilized the structure of the LH2 complexes. Copyright © 2017 Elsevier B.V. All rights reserved.
Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli
2014-09-01
Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery. Copyright © 2014 Elsevier B.V. All rights reserved.
d'Orlyé, Fanny; Varenne, Anne; Georgelin, Thomas; Siaugue, Jean-Michel; Teste, Bruno; Descroix, Stéphanie; Gareil, Pierre
2009-07-01
In view of employing functionalized nanoparticles (NPs) in the context of an immunodiagnostic, aminated maghemite/silica core/shell particles were synthesized so as to be further coated with an antibody or an antigen via the amino groups at their surface. Different functionalization rates were obtained by coating these maghemite/silica core/shell particles with 3-(aminopropyl)triethoxysilane and 2-[methoxy(polyethyleneoxy)propyl]-trimethoxysilane at different molar ratios. Adequate analytical performances with CE coupled with UV-visible detection were obtained through semi-permanent capillary coating with didodecyldimethyl-ammonium bromide, thus preventing particle adsorption. First, the influence of experimental conditions such as electric field strength, injected particle amount as well as electrolyte ionic strength and pH, was evaluated. A charge-dependent electrophoretic mobility was evidenced and the separation selectivity was tuned according to electrolyte ionic strength and pH. The best resolutions were obtained at pH 8.0, high ionic strength (ca. 100 mM), and low total particle volume fraction (ca. 0.055%), thus eliminating interference effects between different particle populations in mixtures. A protocol derived from Kaiser's original description was performed for quantitation of the primary amino groups attached onto the NP surface. Thereafter a correlation between particle electrophoretic mobility and the density of amino groups at their surface was established. Eventually, CE proved to be an easy, fast, and reliable method for the determination of NP effective surface charge density.
NASA Astrophysics Data System (ADS)
Engel, Nicole Y.; Weiss, Victor U.; Marchetti-Deschmann, Martina; Allmaier, Günter
2017-01-01
In order to better understand biological events, lectin-glycoprotein interactions are of interest. The possibility to gather more information than the mere positive or negative response for interactions brought mass spectrometry into the center of many research fields. The presented work shows the potential of a nano-electrospray gas-phase electrophoretic mobility molecular analyzer (nES GEMMA) to detect weak, noncovalent, biospecific interactions besides still unbound glycoproteins and unreacted lectins without prior liquid phase separation. First results for Sambucus nigra agglutinin, concanavalin A, and wheat germ agglutinin and their retained noncovalent interactions with glycoproteins in the gas phase are presented. Electrophoretic mobility diameters (EMDs) were obtained by nES GEMMA for all interaction partners correlating very well with molecular masses determined by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) of the individual molecules. Moreover, EMDs measured for the lectin-glycoprotein complexes were in good accordance with theoretically calculated mass values. Special focus was laid on complex formation for different lectin concentrations and binding specificities to evaluate the method with respect to results obtained in the liquid phase. The latter was addressed by capillary electrophoresis on-a-chip (CE-on-a-chip). Of exceptional interest was the fact that the formed complexes could be sampled according to their size onto nitrocellulose membranes after gas-phase separation. Subsequent immunological investigation further proved that the collected complex actually retained its native structure throughout nES GEMMA analysis and sampling.
Urey, Carlos; Weiss, Victor U; Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland
2016-11-20
For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Sopina, V A
2001-01-01
In free-living amoebae (Amoeba proteus, strain B), cultured at 10 and 25 degrees C, we compared the number, activity, and thermostability of separate electromorphs of Triton-soluble acid phosphatase (AcP) revealed by disc-electrophoresis in polyacrylamide gel using 2-naphthyl phosphate (pH 4.0) as a substrate. No differences in the number of AcP electromorphs and their mobility were observed at both these temperatures. The total activity of AcP electromorphas per unit of cellular protein and their total thermostability were lower in amoebae acclimated to 10 degrees C than to 25 degrees C. The above decrease may be a consequence of a simultaneous decrease in the activity and thermostability of two tartrate-sensitive electromorphs, both being of lysosomal nature. The total activity and thermostability of tartrate-resistant AcP electromorphs did not differ in amoebae acclimated to the two above temperatures. In amoebae cultured at 10 degrees C the fall of activity and thermostability of lysosomal AcP correlates with the decrease in their primary cell thermoresistance and phagocytic activity. The obtained results confirm the earlier conclusion (Vysotskaya et al., 1994) that lysosomes may be involved in acclimation of electrothermal animals to changing environmental temperatures.
Dubey, S; Kalia, Y N
2014-06-10
The original aim of the study was to investigate the transdermal iontophoretic delivery of lysozyme and to gain further insight into the factors controlling protein electrotransport. Initial experiments were done using porcine skin. Lysozyme transport was quantified by using an activity assay based on the lysis of Micrococcus lysodeikticus and was corrected for the release of endogenous enzyme from the skin during current application. Cumulative iontophoretic permeation of lysozyme during 8h at 0.5mA/cm(2) (0.7mM; pH6) was surprisingly low (5.37±3.46μg/cm(2) in 8h) as compared to electrotransport of cytochrome c (Cyt c) and ribonuclease A (RNase A) under similar conditions (923.0±496.1 and 170.71±92.13μg/cm(2), respectively) - despite its having a higher electrophoretic mobility. The focus of the study then became to understand and explain the causes of its poor iontophoretic transport. Lowering formulation pH to 5 increased histidine protonation in the protein and decreased the ionisation of fixed negative charges in the skin (pI ~4.5) and resulted in a small but statistically significant increase in permeation. Co-iontophoresis of acetaminophen revealed a significant inhibition of electroosmosis; inhibition factors of 12-16 were indicative of strong lysozyme binding to skin. Intriguingly, lidocaine electrotransport, which is due almost exclusively to electromigration, was also decreased (approximately 2.7-fold) following skin pre-treatment by lysozyme iontophoresis (cf. iontophoresis of buffer solution) - suggesting that lysozyme was also able to influence subsequent cation electromigration. In order to elucidate the site of skin binding, different porcine skin models were tested (dermatomed skin with thicknesses of 250 and 750μm, tape-stripped skin and heat-separated dermis). Although no difference was seen between permeation across 250 and 750μm dermatomed skin (13.57±12.20 and 5.37±3.46μg/cm(2), respectively), there was a statistically significant increase across tape-stripped skin and heat-separated dermis (36.86±7.48 and 43.42±13.11μg/cm(2), respectively) - although transport was still much less than that seen across intact skin for Cyt c or RNase A. Furthermore, electroosmotic inhibition factors fell to 2.2 and 1.0 for tape-stripped skin and heat-separated dermis - indicating that lysozyme affected convective solvent flow through interactions with the epidermis and predominantly the stratum corneum. Finally, cation exchange and hydrophobic interaction chromatography confirmed that although lysozyme had greater positive charge than Cyt c or RNase A under the conditions used for iontophoresis, it also possessed the highest surface hydrophobicity, which may have facilitated the interactions with the transport pathways and encouraged aggregation in the skin microenvironment. Thus, high charge and electrophoretic mobility seem to be inadequate descriptors to predict the transdermal iontophoretic transport of proteins whose complex three dimensional structures can facilitate interactions with cutaneous transport pathways. Copyright © 2014 Elsevier B.V. All rights reserved.
Yeh, Li-Hsien; Fang, Kuo-Ying; Hsu, Jyh-Ping; Tseng, Shiojenn
2011-12-01
The electrophoresis of a soft particle comprising a rigid core and a charged porous membrane layer in a narrow space is modeled. This simulates, for example, the capillary electrophoresis of biocolloids such as cells and microorganisms, and biosensor types of device. We show that, in addition to the boundary effect, the effects of double-layer polarization (DLP) and the electroosmotic retardation flow can be significant, yielding interesting electrophoretic behaviors. For example, if the friction coefficient of the membrane layer and/or the boundary is large, then the DLP effect can be offset by the electroosmotic retardation flow, making the particle mobility to decrease with increasing double layer thickness, which is qualitatively consistent with many experimental observations in the literature, but has not been explained clearly in previous analyses. In addition, depending upon the thickness of double layer, the friction of the membrane layer of a particle can either retard or accelerate its movement, an interesting result which has not been reported previously. This work is the first attempt to show solid evidence for the influence of a boundary on the effect of DLP and the electrophoretic behavior of soft particles. The model proposed is verified by the experimental data in the literature. The results of numerical simulation provide valuable information for the design of bio-analytical apparatus such as nanopore-based sensing applications and for the interpretation of relevant experimental data. Copyright © 2011 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wirth, Mary J
Solar energy conversion through biology would provide a renewable and nonpolluting abundance of energy. The bacterium Halobacterium salinarum converts solar to electrical energy by virtue of a transmembrane protein, bacteriorhodopsin. This transmembrane protein pumps protons across a nonconducting bilayer upon irradiation with green light. The bacterium evolved to perform this function inefficiently. If we were able to understand this process to engineer this protein for efficiency, then inexpensive energy production could be achieved. There are tens of thousands of different types of halobacteria, giving the opportunity to study different efficiencies and relating these to the protein structures. Technology does notmore » yet exist to perform such screening. The goal of this research is to generate new separation technology that can ultimately enable such screening. This involves creating a method for separating oriented and functional transmembrane proteins that remain in an electrically insulating lipid bilayer, with aqueous solutions on either side of the bilayer. A pH change across the lipid bilayer upon irradiation of a known concentration of proteins would probe function. Differences in proton pumping efficiency for different proteins variants would provide structure-function information for engineering the proteins. A schematic diagram from the original proposal is shown here. The idea is that (a) a lipid bilayer supported on a hydrophilic polymer film will make the bilayer fluid, and (b) applying an electric field will cause electrophoretic migration of the transmembrane proteins. We demonstrated this concept experimentally in a paper that was published just after this new grant period started (Lipid Bilayers on Polyacrylamide Brushes for Inclusion of Membrane Proteins, Emily A. Smith, Jason W. Coym, Scott M. Cowell, Victor J. Hruby, Henry I. Yamamura, Mary J. Wirth, Langmuir, 21, 9644-9650, 2005). The electrophoretic mobility was slow (10{sup -8} cm{sup 2}/Vs), and we project that a two order of magnitude increase would make this a practical tool. We are investigating two ways of improving electrophoretic mobility: better polymer supports, and a novel nanoporous medium that suspends the bilayer over free solution.« less
An Investigation of Traveling-Wave Electrophoresis using a Trigonometric Potential
NASA Astrophysics Data System (ADS)
Vopal, James
Traveling-wave electrophoresis, a technique for microfluidic separations in lab-on-achip devices, is investigated using a trigonometric model that naturally incorporates the spatial periodicity of the device. Traveling-wave electrophoresis can be used to separate high-mobility ions from low-mobility ions in forensic and medical applications, with a separation threshold that can be tuned for specific applications by simply choosing the traveling wave frequency. Our simulations predict plateaus in the average ion velocity verses the mobility, plateaus that correspond to Farey fractions and yield Devil's staircases for non-zero discreteness values. The plateaus indicate that ions with different mobilities can travel with the same average velocity. To determine the conditions for chaos, Lyapunov exponents and contact maps are employed. Through the use of contact maps, the chaotic trajectories are determined to be either narrowband or broadband. Narrowband chaotic trajectories are exhibited in the plateaus of the average velocity, while broadband chaotic trajectories are exhibited where the average velocity varies nonmonotonically with the mobility. Narrowband chaos will be investigated in future work incorporating the role of diffusion. The results of this and future work can be used to develop new tools for electrophoretic separation.
Qian, Cheng; Kovalchik, Kevin A; MacLennan, Matthew S; Huang, Xiaohua; Chen, David D Y
2017-06-01
Capillary electrophoresis frontal analysis (CE-FA) can be used to determine binding affinity of molecular interactions. However, its current data processing method mandate specific requirement on the mobilities of the binding pair in order to obtain accurate binding constants. This work shows that significant errors are resulted when the mobilities of the interacting species do not meet these requirements. Therefore, the applicability of CE-FA in many real word applications becomes questionable. An electrophoretic mobility-based correction method is developed in this work based on the flux of each species. A simulation program and a pair of model compounds are used to verify the new equations and evaluate the effectiveness of this method. Ibuprofen and hydroxypropyl-β-cyclodextrinare used to demonstrate the differences in the obtained binding constant by CE-FA when different calculation methods are used, and the results are compared with those obtained by affinity capillary electrophoresis (ACE). The results suggest that CE-FA, with the mobility-based correction method, can be a generally applicable method for a much wider range of applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
de la Fuente-Gonzalo, Félix; Nieto, Jorge M; Velasco, Diego; Cela, Elena; Pérez, Germán; Fernández-Teijeiro, Ana; Escudero, Antonio; Villegas, Ana; González-Fernández, Fernando A; Ropero, Paloma
2016-04-01
Structural hemoglobinopathies do not usually have a clinical impact, but they can interfere with the analytical determination of some parameters, such as the glycated hemoglobin in diabetic patients. Thalassemias represent a serious health problem in areas where their incidence is high. The defects in the post-translational modifications produce hyper-unstable hemoglobin that is not detected by most of electrophoretic or chromatographic methods that are available so far. We studied seven patients who belong to six unrelated families. The first two families were studied because they had peak abnormal hemoglobin (Hb) during routine analytical assays. The other four families were studied because they had microcytosis and hypochromia with normal HbA2 and HbF without iron deficiency. HbA2 and F quantification and abnormal Hb separation were performed by chromatographic and electrophoretic methods. The molecular characterization was performed using specific sequencing. The Hb Puerta del Sol presents electrophoretic mobility and elution in HPLC that is different from HbA and similar to HbS. The electrophoretic and chromatographic profiles of the four other variants are normal and do not show any anomalies, and their identification was only possible with sequencing. Some variants, such as Hb Valdecilla, Hb Gran Vía, Hb Macarena and Hb El Retiro, have significant clinical impact when they are associated with other forms of α-thalassemia, which could lead to more serious forms of this group of pathologies as for HbH disease. Therefore, it is important to maintain an adequate program for screening these diseases in countries where the prevalence is high to prevent the occurrence of severe forms.
Lisková, Anna; Krivánková, Ludmila
2005-12-01
Accurate determination of pK(a) values is important for proper characterization of newly synthesized molecules. In this work we have used CZE for determination of pK(a) values of new compounds prepared from intermediates, 2, 3 and 4-(2-chloro-acetylamino)-phenoxyacetic acids, by substituting chloride for 2-oxo-pyrrolidine, 2-oxo-piperidine or 2-oxo-azepane. These substances are expected to have a cognition enhancing activity and free radicals scavenging effect. Measurements were performed in a polyacrylamide-coated fused-silica capillary of 0.075 mm ID using direct UV detection at 254 nm. Three electrolyte systems were used for measurements to eliminate effects of potential interactions between tested compounds and components of the BGE. In the pH range 2.7-5.4, chloride, formate, acetate and phosphate were used as BGE co-ions, and sodium, beta-alanine and epsilon-aminocaproate as counterions. Mobility standards were measured simultaneously with the tested compounds for calculations of correct electrophoretic mobilities. Several approaches for the calculation of the pK(a) values were used. The values of pK(a) were determined by standard point-to-point calculation using Henderson-Hasselbach equation. Mobility and pH data were also evaluated by using nonlinear regression. Three parameter sigmoidal function fitted the experimental data with correlation coefficients higher than 0.99. Results from CZE measurements were compared with spectrophotometric measurements performed in sodium formate buffer solutions and evaluated at wavelength where the highest absorbance difference for varying pH was recorded. The experimental pK(a) values were compared with corresponding values calculated by the SPARC online calculator. Results of all three used methods were in good correlation.
Kang, Rui; Chen, Ruochan; Zhang, Qiuhong; Hou, Wen; Wu, Sha; Cao, Lizhi; Huang, Jin; Yu, Yan; Fan, Xue-gong; Yan, Zhengwen; Sun, Xiaofang; Wang, Haichao; Wang, Qingde; Tsung, Allan; Billiar, Timothy R.; Zeh, Herbert J.; Lotze, Michael T.; Tang, Daolin
2014-01-01
Complex genetic and physiological variations as well as environmental factors that drive emergence of chromosomal instability, development of unscheduled cell death, skewed differentiation, and altered metabolism are central to the pathogenesis of human diseases and disorders. Understanding the molecular bases for these processes is important for the development of new diagnostic biomarkers, and for identifying new therapeutic targets. In 1973, a group of non-histone nuclear proteins with high electrophoretic mobility was discovered and termed High-Mobility Group (HMG) proteins. The HMG proteins include three superfamilies termed HMGB, HMGN, and HMGA. High-mobility group box 1 (HMGB1), the most abundant and well-studied HMG protein, senses and coordinates the cellular stress response and plays a critical role not only inside of the cell as a DNA chaperone, chromosome guardian, autophagy sustainer, and protector from apoptotic cell death, but also outside the cell as the prototypic damage associated molecular pattern molecule (DAMP). This DAMP, in conjunction with other factors, thus has cytokine, chemokine, and growth factor activity, orchestrating the inflammatory and immune response. All of these characteristics make HMGB1 a critical molecular target in multiple human diseases including infectious diseases, ischemia, immune disorders, neurodegenerative diseases, metabolic disorders, and cancer. Indeed, a number of emergent strategies have been used to inhibit HMGB1 expression, release, and activity in vitro and in vivo. These include antibodies, peptide inhbitiors, RNAi, anti-coagulants, endogenous hormones, various chemical compounds, HMGB1-receptor and signaling pathway inhibition, artificial DNAs, physical strategies including vagus nerve stimulation and other surgical approaches. Future work further investigating the details of HMGB1 localizationtion, structure, post-translational modification, and identifccation of additional partners will undoubtedly uncover additional secrets regarding HMGB1’s multiple functions. PMID:25010388
Jiang, Chunfang; Zheng, Hai; Liu, Sunan; Fang, Kaifeng
2008-02-01
The relationship between intracellular trypsinogen activation and NF-kappa B activation in rat pancreatic acinar cells induced by M3 cholinergic receptor agonist (carbachol) hyperstimulation was studied. Rat pancreatic acinar cells were isolated, cultured and treated with carbachol, the active protease inhibitor (pefabloc) and NF-kappa B inhibitor (PDTC) in vitro. Intracellular trypsin activity was measured by using a fluorogenic substrate. The activity of NF-kappa B was monitored by using electrophoretic mobility shift assay. The results showed that after pretreatment with 2 mmol/L pefabloc, the activities of trypsin and NF-kappa B in pancreatic acinar cells treated with high concentrations of carbachol (10(-3) mol/L) in vitro was significantly decreased as compared with control group (P<0.01). The addition of 10(-2) mol/L PDTC resulted in a significant decrease of NF-kappa B activities in pancreatic acinar cells after treated with high concentrations of carbachol (10(-3) mol/L) in vitro, but the intracellular trypsinogen activity was not obviously inhibited (P>0.05). It was concluded that intracellular trypsinogen activation is likely involved in the regulation of high concentrations of carbachol-induced NF-kappa B activation in pancreatic acinar cells in vitro. NF-kappa B activation is likely not necessary for high concentrations of carbachol-induced trypsinogen activation in pancreatic acinar cells in vitro.
Kuwae, T; Andoh, M; Fukasawa, S; Kurata, M
1983-01-01
In order to investigate the relationship between host and symbiosis in the luminous marine fish, Physiculus japonicus, the bacterial lipopolysaccharides (LPS) of symbiotic luminous bacteria were compared serologically and electrophoretically. Five symbiotic luminous bacteria (PJ strains) were separately isolated from five individuals of this fish species caught at three points, off the coasts of Chiba, Nakaminato, and Oharai. LPS preparations were made from these bacteria by Westphal's phenol-water method and highly purified by repeated ultracentrifugation. These LPSs contained little or no 2-keto-3-deoxyoctonate and had powerful mitogenic activity. In sodium dodecylsulfate polyacrylamide gel electrophoresis, these PJ-1 to -5 LPSs were separated by their electrophoretic patterns into three groups; the first group included PJ-1 and PJ-4, the second group PJ-2 and PJ-3, and the third group PJ-5 alone. The results agreed with those of the double immunodiffusion test; precipitin lines completely coalesced within each group but not with other groups. In immunoelectrophoresis, one precipitin line was observed between anti PJ-2 LPS serum and PJ-5 LPS but the electrophoretic mobility of PJ-5 LPS was clearly different from that of the PJ-2 LPS group. Furthermore, in a 50% inhibition test with PJ-2 LPS by the passive hemolysis system, the doses of PJ-2 LPS, PJ-3 LPS, and PJ-5 LPS required for 50% inhibition (ID50) in this system were 0.25, 0.25, and 21.6 micrograms/ml for each alkali-treated LPS, respectively, and the ID50's of both PJ-1 LPS and PJ-4 LPS were above 1,000 micrograms/ml. These results indicate that PJ-5 LPS has an antigenic determinant partially in common with LPS from the PJ-2 group but not with LPS from the PJ-1 group and that the symbiotic luminous bacterium PJ-5 is more closely related to the PJ-2 group than to the PJ-1 group. These results show that the species Physiculus japonicus is symbiotically associated with at least three immunologically different strains of luminous marine bacteria in its specialized light organ.
Enhanced specific capacitance of an electrophoretic deposited MnO2-carbon nanotube supercapacitor
NASA Astrophysics Data System (ADS)
Tagsin, Patin; Klangtakai, Pawinee; Harnchana, Viyada; Amornkitbamrung, Vittaya; Pimanpang, Samuk; Kumnorkaew, Pisist
2017-12-01
MnO2 and MnO2-carbon nanotubes (CNT) composite films were grown directly on stainless- steel substrates using an electrophoretic process employing supercapacitor electrodes. An electrophoretic MnO2 film with a nanoplate-like structure was observed using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Supercapacitor performance was studied using cyclic voltammetry (CV), charge-discharge (CD) and electrochemical impedance spectroscopy (EIS). The specific capacitance (SC) of the electrophoretic MnO2 film was 60 F/g at 1 A/g, with a 38.33% retention of the initial SC values after 1000 cycles. The low SC value of the MnO2 films was attributed to the high series and charge-transfer resistances of 1.70 Ω and 3.20, respectively. The MnO2-CNT composites with the addition of 0.04, 0.06 and 0.08 g CNT to the electrophoretic MnO2 film were found to greatly increase the SC to 300, 206 and 169 F/g at 1 A/g, respectively. The series and charge-transferred resistances of MnO2-CNT composite films decreased to 1.38 - 1.52 Ω and 2.62 - 2.86 Ω, respectively. The SC improvement of the composite electrodes was attributed to presence of two active storage materials (MnO2 and CNT), a high film specific surface area and electrical conductivity.
Method for Single-Cell Mass and Electrophoretic Mobility Measurement
2010-02-01
Staphylococcus Aureus . The species of the contaminant was determined by catalase test and visual comparison with cultured S. Epidermidis. In this experiment...mnicron’crtrVs)) Corrected EPM Hatogam for teratior 2 d) p 0.3 10 I EPM ((rii n*cmy(V**)) CO, ?rz A ) WO Buoyart Mass vs. EPM forSuspected S. Aureus . 583 V...2 -1 E PM ((n cror*crnYC*) Cxnected EPM His-ograrr for Suspected S. Aureus at - - 332 V/cm EPM ((rnicron*cmY(V’s)) Figure 5-3: Integrated measurements
Failure to Confirm the Macrophage Electrophoretic Mobility Test in Cancer
Forrester, J. A.; Dando, P. M.; Smith, W. J.; Turberville, C.
1977-01-01
A series of patients with a variety of histopathologically confirmed cancers have been examined using the MOD-MEM test as described by Pritchard et al. (1973). Despite the closest possible adherence to the experimental protocols recommended by these authors, no positive reactions to the test were observed in this series: neither were we able to demonstrate the release of a “macrophage-slowing factor” by a panel of normal donors when challenged with tubercle PPD. We conclude that the test has no present application to the diagnosis of cancer.
Barron, Annelise
2002-01-01
Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.
Barron, Annelise E.
2004-04-20
Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.
Volkova, P Yu; Geras'kin, S A; Horemans, N; Makarenko, E S; Saenen, E; Duarte, G T; Nauts, R; Bondarenko, V S; Jacobs, G; Voorspoels, S; Kudin, M
2018-01-01
Genetic and epigenetic changes were investigated in chronically irradiated Scots pine (Pinus sylvestris L.) populations from territories that were heavily contaminated by radionuclides as result of the Chernobyl Nuclear Power Plant accident. In comparison to the reference site, the genetic diversity revealed by electrophoretic mobility of AFLPs was found to be significantly higher at the radioactively contaminated areas. In addition, the genome of pine trees was significantly hypermethylated at 4 of the 7 affected sites. Copyright © 2017 Elsevier Ltd. All rights reserved.
Identification of human phosphoglucomutase 3 (PGM3) as N-acetylglucosamine-phosphate mutase (AGM1).
Pang, H; Koda, Y; Soejima, M; Kimura, H
2002-03-01
We performed phenotyping of human phosphoglucomutase 3 (PGM(3)) and screening for mutations in the human N-acetylglucosamine-phosphate mutase gene (AGM(1)) to identify PGM(3) as AGM(1). By sequencing the coding region of AGM(1), two alleles containing a G or A base at nucleotide 1396, that can respectively encode aspartic acid or asparagine at codon 466, were identified. Cell extracts of COS7 cells after transfection with the pcDNA 3.1(+) plasmid containing an AGM(1) allele with 1396G or 1396A showed similar electrophoretic patterns to the PGM(3) 1 or PGM(3) 2 protein, respectively, with the isozyme detection method used for PGM(3) phenotyping. The genotypes determined by the two alleles of AGM(1) coincided exactly with the PGM(3) phenotypes in 20 individuals. We also investigated the allele frequency of the AGM(1) nucleotide polymorphism in a Japanese population by DNA sequencing and found that the frequencies of alleles 1396G and 1396A were similar to previously reported PGM(3) *1 and PGM(3) *2 frequencies. Overall, the facts that the AGM(1) gene product shows PGM activity, AGM(1) is polymorphic, the electrophoretic mobility is similar between AGM(1) allele-specific products and PGM(3) 1 and 2 proteins, PGM(3) phenotypes and AGM(1) genotypes completely coincide in 20 individuals, and AGM(1) allele frequencies are similar to those of PGM(3) *1 and PGM(3) *2 in Japanese populations, suggest that PGM(3) is identical to AGM(1).
Matussek, Karl; Moritz, Patrick; Brunner, Nina; Eckerskorn, Christoph; Hensel, Reinhard
1998-01-01
Cyclic 2,3-diphosphoglycerate synthetase (cDPGS) catalyzes the synthesis of cyclic 2,3-diphosphoglycerate (cDPG) by formation of an intramolecular phosphoanhydride bond in 2,3-diphosphoglycerate. cDPG is known to be accumulated to high intracellular concentrations (>300 mM) as a putative thermoadapter in some hyperthermophilic methanogens. For the first time, we have purified active cDPGS from a methanogen, the hyperthermophilic archaeon Methanothermus fervidus, sequenced the coding gene, and expressed it in Escherichia coli. cDPGS purification resulted in enzyme preparations containing two isoforms differing in their electrophoretic mobility under denaturing conditions. Since both polypeptides showed the same N-terminal amino acid sequence and Southern analyses indicate the presence of only one gene coding for cDPGS in M. fervidus, the two polypeptides originate from the same gene but differ by a not yet identified modification. The native cDPGS represents a dimer with an apparent molecular mass of 112 kDa and catalyzes the reversible formation of the intramolecular phosphoanhydride bond at the expense of ATP. The enzyme shows a clear preference for the synthetic reaction: the substrate affinity and the Vmax of the synthetic reaction are a factor of 8 to 10 higher than the corresponding values for the reverse reaction. Comparison with the kinetic properties of the electrophoretically homogeneous, apparently unmodified recombinant enzyme from E. coli revealed a twofold-higher Vmax of the enzyme from M. fervidus in the synthesizing direction. PMID:9811660
Yea, S S; Yang, K H; Kaminski, N E
2000-02-01
We previously reported that immunosuppressive cannabinoids inhibited interleukin (IL)-2 steady-state mRNA expression and secretion by phorbol-12-myristate-13-acetate plus ionomycin-activated mouse splenocytes and EL4 murine T-cells. Here we show that inhibition of IL-2 production by cannabinol, a modest central nervous system-active cannabinoid, is mediated through the inhibition of IL-2 gene transcription. Moreover, electrophoretic mobility shift assays demonstrated that cannabinol markedly inhibited the DNA binding activity of nuclear factor of activated T-cells (NF-AT) and activator protein-1 (AP-1) in a time- and concentration-dependent manner in activated EL4 cells. The inhibitory effects produced by cannabinol on AP-1 DNA binding were quite transient, showing partial recovery by 240 min after cell activation and no effect on the activity of a reporter gene under the control of AP-1. Conversely, cannabinol-mediated inhibition of NF-AT was robust and sustained as demonstrated by an NF-AT-regulated reporter gene. Collectively, these results suggest that decreased IL-2 production by cannabinol in EL4 cells is due to the inhibition of transcriptional activation of the IL-2 gene and is mediated, at least in part, through a transient inhibition of AP-1 and a sustained inhibition of NF-AT.
Simulating Electrophoresis with Discrete Charge and Drag
NASA Astrophysics Data System (ADS)
Mowitz, Aaron J.; Witten, Thomas A.
A charged asymmetric rigid cluster of colloidal particles in saline solution can respond in exotic ways to an electric field: it may spin or move transversely. These distinctive motions arise from the drag force of the neutralizing countercharge surrounding the cluster. Because of this drag, calculating the motion of arbitrary asymmetric objects with nonuniform charge is impractical by conventional methods. Here we present a new method of simulating electrophoresis, in which we replace the continuous object and the surrounding countercharge with discrete point-draggers, called Stokeslets. The balance of forces imposes a linear, self-consistent relation among the drag and Coulomb forces on the Stokeslets, which allows us to easily determine the object's motion via matrix inversion. By explicitly enforcing charge+countercharge neutrality, the simulation recovers the distinctive features of electrophoretic motion to few-percent accuracy using as few as 1000 Stokeslets. In particular, for uniformly charged objects, we observe the characteristic Smoluchowski independence of mobility on object size and shape. We then discuss electrophoretic motion of asymmetric objects, where our simulation method is particularly advantageous. This work is supported by a Grant from the US-Israel Binational Science Foundation.
On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)
NASA Astrophysics Data System (ADS)
Persat, Alexandre; Santiago, Juan
2008-11-01
We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.
NASA Astrophysics Data System (ADS)
Frants, E. A.; Ganchenko, G. S.; Shelistov, V. S.; Amiroudine, S.; Demekhin, E. A.
2018-02-01
Electrokinetics and the movement of charge-selective micro-granules in an electrolyte solution under the influence of an external electric field are investigated theoretically. Straightforward perturbation analysis is applied to a thin electric double layer and a weak external field, while a numerical solution is used for moderate electric fields. The asymptotic solution enables the determination of the salt concentration, electric charge distribution, and electro-osmotic velocity fields. It may also be used to obtain a simple analytical formula for the electrophoretic velocity in the case of quasi-equilibrium electrophoresis (electrophoresis of the first kind). This formula differs from the famous Helmholtz-Smoluchowski relation, which applies to dielectric microparticles, but not to ion-selective granules. Numerical calculations are used to validate the derived formula for weak external electric fields, but for moderate fields, nonlinear effects lead to a significant increase in electrophoretic mobility and to a transition from quasi-equilibrium electrophoresis of the first kind to nonequilibrium electrophoresis of the second kind. Theoretical results are successfully compared with experimental data.
Hashim, O H; Cushley, W
1988-01-01
The effects of inhibiting selected pairs of oligosaccharide-processing activities upon the secretion of IgM and IgG molecules have been investigated. In the presence of castanospermine (CSP) plus swainsonine (SW) or deoxynojirimycin (dNM) plus deoxymannojirimycin (dMM), secretion of IgM and IgG from rat hybridoma cells was unimpaired relative to control cultures. The structures of the N-linked oligosaccharides found on the Ig heavy chains isolated from treated cells or culture supernatants were shown to be qualitatively different from those associated with control Ig by persistent sensitivity to digestion by endo H. Furthermore, the electrophoretic mobilities of mu and gamma chains on SDS-PAGE derived from treated cells were consistently slower than those of control heavy chains. IgM and IgG were also efficiently secreted when all glucosidase and mannosidase activities were blocked, and the secreted heavy chains bore endo H-sensitive oligosaccharides. The data suggest that Ig secretion from hybridomas can proceed in the absence of N-linked oligosaccharide processing. Images Figure 1 Figure 2 Figure 3 PMID:3350578
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province
2015-02-06
Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less
Presnell, Steven R.; Zhang, Lei; Chlebowy, Corrin N.; Al-Attar, Ahmad; Lutz, Charles T.
2012-01-01
KIR2DL4 is unique among human KIR genes in expression, cellular localization, structure, and function, yet the transcription factors required for its expression have not been identified. Using mutagenesis, electrophoretic mobility shift assay, and co-transfection assays, we identified two redundant Runx binding sites in the 2DL4 promoter as essential for constitutive 2DL4 transcription, with contributions by a CRE site and initiator elements. IL-2-and IL-15-stimulated human NK cell lines increased 2DL4 promoter activity, which required functional Runx, CRE, and Ets sites. Chromatin immunoprecipitation experiments show that Runx3 and Ets1 bind the 2DL4 promoter in situ. 2DL4 promoter activity had similar transcription factor requirements in T cells. Runx, CRE, and Ets binding motifs are present in 2DL4 promoters from across primate species, but other postulated transcription factor binding sites are not preserved. Differences between 2DL4 and clonally-restricted KIR promoters suggest a model that explains the unique 2DL4 expression pattern in human NK cells. PMID:22467658
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi
2014-01-01
We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.
Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.
Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K
2012-11-01
Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi
2014-01-01
We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698
Dopamine-imprinted monolithic column for capillary electrochromatography.
Aşır, Süleyman; Sarı, Duygu; Derazshamshir, Ali; Yılmaz, Fatma; Şarkaya, Koray; Denizli, Adil
2017-11-01
A dopamine-imprinted monolithic column was prepared and used in capillary electrochromatography as stationary phase for the first time. Dopamine was selectively separated from aqueous solution containing the competitor molecule norepinephrine, which is similar in size and shape to the template molecule. Morphology of the dopamine-imprinted column was observed by scanning electron microscopy. The influence of the organic solvent content of mobile phase, applied pressure and pH of the mobile phase on the recognition of dopamine by the imprinted monolithic column has been evaluated, and the imprinting effect in the dopamine-imprinted monolithic polymer was verified. Developed dopamine-imprinted monolithic column resulted in excellent separation of dopamine from structurally related competitor molecule, norepinephrine. Separation was achieved in a short period of 10 min, with the electrophoretic mobility of 5.81 × 10 -5 m 2 V -1 s -1 at pH 5.0 and 500 mbar pressure. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cell Partition in Two Polymer Aqueous Phases
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1985-01-01
In a reduced gravity environment the two polymer phases will not separate via density driven settling in an acceptably short length of time. It is to be expected that a certain amount of phase separation will take place, however, driven by the reduction in free energy gained when the interfacial area is reduced. This stage of separation process will therefore depend directly on the magnitude of the interfacial tension between the phases. In order to induce complete phase separation in a short time, electric field-induced separation which occurs because the droplets of one phase in the other have high electrophoretic mobilities which increase with droplet size was investigated. These mobilities are significant only in the presence of certain salts, particularly phosphates. The presence of such salts, in turn has a strong effect on the cell partition behavior in dextran-poly (ethylene glycol) (PEG) systems. The addition of the salts necessary to produce phase drop mobilities has a large effect on the interfacial tensions in the systems.
Okada, Y; Sawa, H; Tanaka, S; Takada, A; Suzuki, S; Hasegawa, H; Umemura, T; Fujisawa, J; Tanaka, Y; Hall, W W; Nagashima, K
2000-06-02
Polyomavirus JC (JCV) causes the human demyelinating disease, progressive multifocal leukoencephalopathy (PML). The recent demonstration of cases of PML in association with human T-lymphotropic virus type I (HTLV-I) infection prompted us to examine whether the HTLV-I-encoded regulatory protein Tax activates JCV transcription. By employing a dual luciferase assay, we initially found that the expression of Tax activated the transcriptional potential of both early and late promoters of JCV in human neuronal but not in non-neuronal cells. We subsequently analyzed the mechanism of Tax-induced activation of the JCV promoter in neuronal cells with the following results: 1) the JCV promoter that lacks the NF-kappaB-binding motif could not be activated by Tax; 2) the overexpression of IkappaBalpha abolished Tax-induced transcriptional activation of the JCV promoter; 3) a Tax mutant (M22) lacking the potential for activation via the NF-kappaB pathway did not activate the JCV promoter. Furthermore, Tax enhances the gene expression of JCV T antigen and VP1. We examined mechanisms of the cell-specific activation of the JCV promoter by Tax. Electrophoretic mobility shift assay demonstrated the presence of Tax-bound protein(s) that were specifically present in non-neuronal cells. This study is the first demonstration of the activation of JCV promoter by HTLV-I Tax in an NF-kappaB-dependent manner.
Scott, R H; DeMoss, J A
1976-01-01
When Escherichia coli was grown on medium containing 10 mM tungstate the formation of active formate dehydrogenase, nitrate reductase, and the complete formate-nitrate electron transport pathway was inhibited. Incubation of the tungstate-grown cells with 1 mM molybdate in the presence of chloramphenicol led to the rapid activation of both formate dehydrogenase and nitrate reductase, and, after a considerable lag, the complete electron transport pathway. Protein bands which corresponded to formate dehydrogenase and nitrate reductase were identified on polyacrylamide gels containing Triton X-100 after the activities were released from the membrane fraction and partially purified Cytochrome b1 was associated with the protein band corresponding to formate dehydrogenase but was not found elsewhere on the gels. When a similar fraction was prepared from cells grown on 10 mM tungstate, an inactive band corresponding to formate dehydrogenase was not observed on polyacrylamide gels; rather, a new faster migrating band was present. Cytochrome b1 was not associated with this band nor was it found anywhere else on the gels. This new band disappeared when the tungstate-grown cells were incubated with molybdate in the presence of chloramphenicol. The formate dehydrogenase activity which was formed, as well as a corresponding protein band, appeared at the original position on the gels. Cytochrome b1 was again associated with this band. The protein band which corresponded to nitrate reductase also was severely depressed in the tungstate-grown cells and a new faster migrating band appeared on the polyacrylamide gels. Upon activation of the nitrate reductase by incubation of the cells with molybdate, the new band diminished and protein reappeared at the original position. Most of the nitrate reductase activity which was formed appeared at the original position of nitrate reductase on gels although some was present at the position of the inactive band formed by tungstate-grown cells. Apparently, inactive forms of both formate dehydrogenase and nitrate reductase accumulate during growth on tungstate which are electrophoretically distinct from the active enzymes. Activation by molybdate results in molecular changes which include the reassociation of cytochrome b1 with formate dehydrogenase and restoration of both enzymes to their original electrophoretic mobilities. Images PMID:770433
Dilshara, Matharage Gayani; Jayasooriya, Rajapaksha Gedara Prasad Tharanga; Kang, Chang-Hee; Choi, Yung-Hyun; Kim, Gi-Young
2016-06-01
To evaluate whether the methanol extract of Codium fragile (MECF) regulates tumor necrosis factor-α (TNF-α)-induced invasion of human breast cancer MDA-MB-231 cells by suppressing matrix metalloproteinase-9 (MMP-9). Reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis were performed to analyze the expression of MMP-9 and nuclear factor-κB (NF-κB) subunits, p65 and p50, and IκB in MDA-MB-231 cells. 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was used for cell viability. MMP-9 activity and invasion were measured by gelatin zymography and a matrigel invasion assay, respectively. NF-κB activity was measured by an electrophoretic mobility shift assay and luciferase activity. MECF had no effect on cell viability up to a concentration of 100 μg/mL in human breast cancer MDA-MB-231 cells regardless of the presence of TNF-α. MDA-MB-231 cells that were stimulated with TNF-α showed a marked increase of invasion compared to the untreated control, whereas pretreatment with MECF downregulated the TNF-α-induced invasion of MDA-MB-231 cells. Additionally, zymography, western blot analysis, and RT-PCR confirmed that MECF decreased TNF-α-induced MMP-9 expression and activity which is a key regulator for cancer invasion. According to an electrophoretic morbidity shift assay, pretreatment with MECF in MDA-MB-231 cells significantly decreased the TNF-α-induced DNA-binding activity of NF-κB, which is an important transcription factor for regulating cancer invasion-related genes such as MMP-9. Furthermore, treatment with MECF sustained the expression of p65 and p50 in response to TNF-α in the cytosolic compartment. The luciferase assay demonstrated that MECF attenuated TNF-α-induced NF-κB luciferase activity. MECF exhibited its anti-invasive capability by downregulating TNF-α-induced MMP-9 expression, resulting from the suppression of NF-κB activity in the human breast cancer cell line MDA-MB-231. Copyright © 2016 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi
Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.
Orlowska, Karina; Molcan, Tomasz; Swigonska, Sylwia; Sadowska, Agnieszka; Jablonska, Monika; Nynca, Anna; Jastrzebski, Jan P; Ciereszko, Renata E
2016-06-01
The aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor that can be activated by structurally diverse synthetic and natural chemicals, including toxic environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). In the present study, homology models of the porcine AhR-ligand binding domain (LBD) and the porcine aryl hydrocarbon receptor nuclear translocator-ligand binding domain (ARNT-LBD) were created on the basis of structures of closely related respective proteins i.e., human Hif-2α and ARNT. Molecular docking of TCDD to the porcine AhR-LBD model revealed high binding affinity (-8.8kcal/mol) between TCDD and the receptor. Moreover, formation of the TCDD/AhR-LBD complex was confirmed experimentally with the use of electrophoretic mobility shift assay (EMSA). It was found that TCDD (10nM, 2h of incubation) not only bound to the AhR in the porcine granulosa cells but also activated the receptor. The current study provides a framework for examining the key events involved in the ligand-dependent activation of the AhR. Copyright © 2016 Elsevier Inc. All rights reserved.
Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.
Bykowski, Tomasz; Babb, Kelly; von Lackum, Kate; Riley, Sean P; Norris, Steven J; Stevenson, Brian
2006-07-01
The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.
Ekenäs, Catarina; Zebrowska, Anna; Schuler, Barbara; Vrede, Tobias; Andreasen, Katarina; Backlund, Anders; Merfort, Irmgard; Bohlin, Lars
2008-12-01
Several species in the genus Arnica have been used in traditional medicine to treat inflammatory-related disorders. Extracts of twelve Arnica species and two species closely related to arnica ( Layia hieracioides and Madia sativa) were investigated for inhibition of human neutrophil elastase release and inhibition of transcription factor NF-kappaB. Statistical analyses reveal significant differences in inhibitory capacities between extracts. Sesquiterpene lactones of the helenanolide type, of which some are known inhibitors of human neutrophil elastase release and NF-kappaB, are present in large amounts in the very active extracts of A. montana and A. chamissonis. Furthermore, A. longifolia, which has previously not been investigated, shows a high activity similar to that of A. montana and A. chamissonis in both bioassays. Sesquiterpene lactones of the xanthalongin type are present in large amounts in A. longifolia and other active extracts and would be interesting to evaluate further. COX-2:cyclooxygenase 2 EMSA:electrophoretic mobility shift assay fMLP: N-formyl-methionyl-leucyl-phenylalanine HaCaT:human keratinocyte HNE:human neutrophil elastase IkappaB:inhibitory subunit of kappaB iNOS:inducible nitric oxide synthase NF-kappaB:nuclear factor kappaB PAF:platelet activating factor STL:sesquiterpene lactone TNF-alpha:tumor necrosis factor alpha.
Wang, Guohao; Xu, Yuquan
2012-01-01
Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ward, G.E.
When intact Arbacia punctulata spermatozoa are exposed to solubilized egg jelly, the electrophoretic mobility of an abundant sperm flagellar membrane protein changes from an apparent molecular mass of 160 kDa to 150 kDa. A. punctulata spermatozoa can be labeled in vivo with /sup 32/P-labeled cells it was demonstrated that the mobility shift of the 160-kDa protein is due to dephosphorylation. The peptide resact (Cys-Val-Thr-Gly-Ala-Pro-Gly-Cys-Val-Gly-Gly-Gly-Arg-Leu-NH/sub 2/) is the component of egg jelly which is responsible for inducing the dephosphorylation. The 160/150-kdal sperm membrane protein has been purified to homogeneity by affinity chromatography on concanavalin A-agarose, and identified as sperm guanylate cyclase.more » The enzymatic activity of the guanylate cyclase is tightly coupled to its phosphorylation state. Resact has been shown to act as a potent chemoattractant for A. punctulata spermatozoa. The chemotactic response is concentration-dependent, is abolished by pretreatment of the spermatozoa with resact, and shows an absolute requirement for external calcium. This work represents the first demonstration of animal sperm chemotaxis in response to a precisely-defined molecule of egg origin. The results established a new, biologically meaningful function for resact, and may implicate sperm guanylate cyclase and cGMP in flagellar function and the chemotactic response.« less
Urban, Pawel L; Goodall, David M; Bergström, Edmund T; Bruce, Neil C
2007-08-31
An electrophoretically mediated microanalysis (EMMA) method has been developed for yeast alcohol dehydrogenase and quantification of reactant and product cofactors, NAD and NADH. The enzyme substrate ethanol (1% (v/v)) was added to the buffer (50 mM borate, pH 8.8). Results are presented for parallel capillary electrophoresis with a novel miniature UV area detector, with an active pixel sensor imaging an array of two or six parallel capillaries connected via a manifold to a single output capillary in a commercial CE instrument, allowing conversions with five different yeast alcohol dehydrogenase concentrations to be quantified in a single experiment.
The Major Apoptotic Pathway Activated and Suppressed by Poliovirus
Belov, George A.; Romanova, Lyudmila I.; Tolskaya, Elena A.; Kolesnikova, Marina S.; Lazebnik, Yuri A.; Agol, Vadim I.
2003-01-01
Cells respond to poliovirus infection by switching on the apoptotic program, implementation of which is usually suppressed by viral antiapoptotic functions. We show here that poliovirus infection of HeLa cells or derivatives of MCF-7 cells was accompanied by the efflux of cytochrome c from mitochondria. This efflux occurred during both abortive infection (e.g., interrupted by guanidine-HCl and ending with apoptosis) and productive infection (leading to cytopathic effect). The former type of infection, but not the latter, was accompanied by truncation of the proapoptotic protein Bid. The virus-triggered cytochrome c efflux was suppressed by overexpression of Bcl-2. Both abortive and productive infections also resulted in a decreased level of procaspase-9, as revealed by Western blotting. In the former case, this decrease was accompanied by the accumulation of a protein with the electrophoretic mobility of active caspase-9. In contrast, in the productively infected cells, the latter protein was absent but caspase-9-related polypeptides with altered mobility could be detected. Both caspase-9 and caspase-3 were shown to be essential for the development of such hallmarks of virus-induced apoptosis as chromatin condensation, DNA degradation, and nuclear fragmentation. These and some other results suggest the following scenario. Poliovirus infection activates the apoptotic pathway, involving mitochondrial damage, cytochrome c efflux, and consecutive activation of caspase-9 and caspase-3. The apoptotic signal appears to be amplified by a loop which includes secondary processing of Bid. The implementation of the apoptotic program in productively infected cells may be suppressed, however, by the viral antiapoptotic functions, which act at a step(s) downstream of the cytochrome c efflux. The suppression appears to be caused, at least in part, by aberrant processing and degradation of procaspase-9. PMID:12477809
HMGB1 in Cancer: Good, Bad, or Both?
Kang, Rui; Zhang, Qiuhong; Zeh, Herbert J.; Lotze, Michael T.; Tang, Daolin
2013-01-01
Forty years ago, high mobility group box 1 (HMGB1) was discovered in calf thymus and named according to its electrophoretic mobility in polyacrylamide gels. Now, we know that HMGB1 performs dual functions. Inside the cell, HMGB1 is a highly conserved chromosomal protein acting as a DNA chaperone. Outside of the cell, HMGB1 is a prototypical damage-associated molecular pattern, acting with cytokine, chemokine, and growth factor. During tumor development and in cancer therapy, HMGB1 has been reported to play paradoxical roles in promoting both cell survival and death by regulating multiple signaling pathways, including inflammation, immunity, genome stability, proliferation, metastasis, metabolism, apoptosis, and autophagy. Here, we review the current knowledge of both HMGB1’s oncogenic and tumor suppressive roles and the potential strategies that target HMGB1 for the prevention and treatment of cancer. PMID:23723299
Burns, J W; Chen, D; Estes, M K; Ramig, R F
1989-04-01
We have studied a variant virus isolated from a stock of SA11 virus (H. G. Pereira, R. S. Azeredo, A. M. Fialho, and M. N. P. Vidal, 1984, J. Gen. Virol. 65, 815-818). This virus, designated 4F, was initially identified by its faster electrophoretic mobility for genome segment 4. The variant was analyzed to determine if the altered electrophoretic mobility of genome segment 4 could be correlated with phenotypic changes. Comparison of our standard laboratory SA11 virus (clone 3) with the 4F variant showed the following: (i) The 4F variant possesses a viral hemagglutinin (VP4) with a higher apparent molecular weight than clone 3. (ii) The 4F variant produces large plaques when assayed in vitro, as compared to clone 3. (iii) The 4F variant produces plaques in the absence of proteolytic enzymes, whereas clone 3 does not. (iv) The 4F variant reacts with serotype-specific neutralizing monoclonal antibodies to VP7, but fails to react with several neutralizing anti-VP4 monoclonal antibodies generated to SA11 clone 3. (v) The 4F variant grows to a higher titer and is more stable than clone 3. (vi) The 4F variant produces a VP4 that appears to be more susceptible to cleavage by trypsin than is the VP4 of clone 3. Further analyses with the 4F variant may lead to an understanding of the molecular basis for these altered phenotypes that appear to be related, at least in part, to the product of genome segment 4.
Riesová, Martina; Svobodová, Jana; Ušelová, Kateřina; Tošner, Zdeněk; Zusková, Iva; Gaš, Bohuslav
2014-10-17
In this paper we determine acid dissociation constants, limiting ionic mobilities, complexation constants with β-cyclodextrin or heptakis(2,3,6-tri-O-methyl)-β-cyclodextrin, and mobilities of resulting complexes of profens, using capillary zone electrophoresis and affinity capillary electrophoresis. Complexation parameters are determined for both neutral and fully charged forms of profens and further corrected for actual ionic strength and variable viscosity in order to obtain thermodynamic values of complexation constants. The accuracy of obtained complexation parameters is verified by multidimensional nonlinear regression of affinity capillary electrophoretic data, which provides the acid dissociation and complexation parameters within one set of measurements, and by NMR technique. A good agreement among all discussed methods was obtained. Determined complexation parameters were used as input parameters for simulations of electrophoretic separation of profens by Simul 5 Complex. An excellent agreement of experimental and simulated results was achieved in terms of positions, shapes, and amplitudes of analyte peaks, confirming the applicability of Simul 5 Complex to complex systems, and accuracy of obtained physical-chemical constants. Simultaneously, we were able to demonstrate the influence of electromigration dispersion on the separation efficiency, which is not possible using the common theoretical approaches, and predict the electromigration order reversals of profen peaks. We have shown that determined acid dissociation and complexation parameters in combination with tool Simul 5 Complex software can be used for optimization of separation conditions in capillary electrophoresis. Copyright © 2014 Elsevier B.V. All rights reserved.
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
ERIC Educational Resources Information Center
Emry, Randall; Curtright, Robert D.; Wright, Jonathan; Markwell, John
2000-01-01
Introduces electrophoresis activities developed for chemistry and biology courses in which students identify the food, drug, and cosmetic identity of the food dyes used in the coating of candies. (YDS)
Ryu, Gi Seong; Lee, Myung Won; Jeong, Seung Hyeon; Song, Chung Kun
2012-01-01
In this study we developed a simple ink-jet process for 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS-pentacene), which is known as a high-mobility soluble organic semiconductor, to achieve relatively high-mobility and high-uniformity performance for large-area applications. We analyzed the behavior of fluorescent particles in droplets and applied the results to determining a method of controlling the behavior of TIPS-pentacene molecules. The grain morphology of TIPS-pentacene varied depending on the temperature applied to the droplets during drying. We were able to obtain large and uniform grains at 46 degrees C without any "coffee stain". The process was applied to a large-size organic thin-film transistor (OTFT) backplane for an electrophoretic display panel containing 192 x 150 pixels on a 6-in.-sized substrate. The average of mobilities of 36 OTFTs, which were taken from different locations of the backplane, was 0.44 +/- 0.08 cm2.V-1.s-1, with a small deviation of 20%, over a 6-in.-size area comprising 28,800 OTFTs. This process providing high mobility and high uniformity can be achieved by simply maintaining the whole area of the substrate at a specific temperature (46 degrees C in this case) during drying of the droplets.
Wang, Yong-Sheng; Gao, Wei; Li, Hong-Fen; Wang, Ze-Mu; Zhu, Jun; Zhao, Huan; Yan, Jian-Jun; Jia, En-Zhi; Yang, Zhi-Jian; Wang, Lian-Sheng
2012-04-01
Visfatin, a pro-inflammatory cytokine predominantly released from leucocytes, is correlated with coronary artery disease (CAD). We have previously reported that the -1535C>T polymorphism (rs1330082), which located on the promoter region of visfatin, was associated with decreased risk of CAD. Here, we investigated the underlying mechanism by which this polymorphism affects the genetic susceptibility to CAD. The difference of the promoter activities between -1535T variant and -1535C allele was tested by luciferase reporter gene assay. The difference of transcription factor binding activities between T and C allele was evaluated by electrophoretic mobility shift assay. In reporter gene assay, we showed that the T variant had a significantly reduced transcriptional activity compared with the C allele. The T-variant significantly attenuated the promoter binding affinity to nuclear transcription factors and this effect became much obvious after treatment with TNF-α. Moreover, competition experiment revealed that the retarded complex formed by T-1535- or C-1535-probe binding to nuclear extracts was nearly completely inhibited by unlabeled activator protein-1 (AP-1) specific probe, indicating that AP-1 might be the target nuclear effector. Taken together, our data provided potential mechanistic link between the visfatin -1535C>T polymorphism and reduced CAD risk.
The electrokinetic behavior of calcium oxalate monohydrate in macromolecular solutions
NASA Technical Reports Server (NTRS)
Curreri, P. A.; Onoda, G. Y., Jr.; Finlayson, B.
1988-01-01
Electrophoretic mobilities were measured for calcium oxalate monohydrate (COM) in solutions containing macromolecules. Two mucopolysaccharides (sodium heparin and chrondroitin sulfate) and two proteins (positively charged lysozyme and negatively charged bovine serum albumin) were studied as adsorbates. The effects of pH, calcium oxalate surface charge (varied by calcium or oxalate ion activity), and citrate concentration were investigated. All four macromolecules showed evidence for chemical adsorption. The macromolecule concentrations needed for reversing the surface charge indicated that the mucopopolysacchrides have greater affinity for the COM surface than the proteins. The amount of proteins that can chemically adsorb appears to be limited to approximately one monomolecular layer. When the surface charge is high, an insufficient number of proteins can chemically adsorb to neutralize or reverse the surface charge. The remaining surface charge is balanced by proteins held near the surface by longer range electrostatic forces only. Citrate ions at high concentrations appear to compete effectively with the negative protein for surface sites but show no evidence for competing with the positively charged protein.
Serine/Threonine kinase dependent transcription from the polyhedrin promoter of SpltNPV-I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mishra, Gourav; Gautam, Hemant K.; Das, Rakha H.
2007-07-06
Polyhedrin (polh) and p10 are the two hyper-expressed very late genes of nucleopolyhedroviruses. Alpha amanitin resistant transcription from Spodoptera litura nucleopolyhedrovirus (SpltNPV-I) polyhedrin promoter was observed with virus infected nuclear extract of NIV-HA-197 cells but not with that from uninfected nuclear extract. Anti-protein kinase-1 (pk1) antibody inhibited the transcription and the inhibition reversed on addition of pk1, however, pk1 mutant protein, K50M having no phosphorylation activity did not overcome the transcription inhibition. Chromatin immuno-precipitation assays with viral anti-pk1 antibody showed the interaction of pk1 with the polh while electrophoretic mobility shift assays indicated the strong binding affinity (K {sub d}more » {approx} 5.5 x 10{sup -11}) of purified pk1 with the polh promoter. These results suggested that the viral coded pk1 acts as a transcription factor in transcribing baculovirus very late genes.« less
Low density lipoprotein (LDL)-antioxidant flavonoids from roots of Sophora flavescens.
Jeong, Tae-Sook; Ryu, Young Bae; Kim, Hoi Young; Curtis-Long, Marcus John; An, Sojin; An, So Jin; Lee, Jin Hwan; Lee, Woo Song; Park, Ki Hun
2008-11-01
Oxidation of low density lipoprotein (LDL) is strongly implicated as a key process in the onset of atherosclerosis. In this study, nine alkylated (C10-C5) flavonoids from Sophora flavescens were examined for their inhibitory effects on copper-induced LDL oxidation. Of the flavonoids tested, sophoraflavanone G (1), kurarinone (2), kurarinol (3), norkurarinol (4), and kuraridin (9) inhibited the generation of thiobarbituric acid reactive substances (TBARS) with IC50s of 7.9, 14.5, 22.0, 26.9, and 17.5 microM, respectively. The most potent inhibitor, compound 1, also demonstrated significant activities in complementary in vitro investigations, such as lag time (130 min at 5 microM), relative electrophoretic mobility (REM) of ox-LDL (80% inhibition at 20 microM), and fragmentation of apoB-100 (inhibition of 71% at 20 microM). Analysis of the structures of these compounds reveals that a resorcinol moiety in the B-ring is strongly correlated with protection of LDL-oxidation.
Purification and Cultivation of Human Pituitary Growth Hormones Secreting Cells
NASA Technical Reports Server (NTRS)
Hymer, W. C.; Todd, P.; Grindeland, R.; Lanham, W.; Morrison, D.
1985-01-01
The rat and human pituitary gland contains a mixture of hormone producing cell types. The separation of cells which make growth hormone (GH) is attempted for the purpose of understanding how the hormone molecule is made within the pituitary cell; what form(s) it takes within the cell; and what form(s) GH assumes as it leaves the cell. Since GH has a number of biological targets (e.g., muscle, liver, bone), the assessment of the activities of the intracellular/extracellular GH by new and sensitive bioassays. GH cells contained in the mixture was separated by free flow electrophoresis. These experiments show that GH cells have different electrophoretic mobilities. This is relevant to NASA since a lack of GH could be a prime causative factor in muscle atrophy. Further, GH has recently been implicated in the etiology of motion sickness in space. Continous flow electrophoresis experiment on STS-8 showed that GH cells could be partially separated in microgravity. However, definitive cell culture studies could not be done due to insufficient cell recoveries.
Comprehensive Analysis of a Vibrio parahaemolyticus Strain Extracellular Serine Protease VpSP37
Bennici, Carmelo; Quatrini, Paola; Catania, Valentina; Mazzola, Salvatore; Ghersi, Giulio; Cuttitta, Angela
2015-01-01
Proteases play an important role in the field of tissue dissociation combined with regenerative medicine. During the years new sources of proteolytic enzymes have been studied including proteases from different marine organisms both eukaryotic and prokaryotic. Herein we have purified a secreted component of an isolate of Vibrio parahaemolyticus, with electrophoretic mobilities corresponding to 36 kDa, belonging to the serine proteases family. Sequencing of the N-terminus enabled the in silico identification of the whole primary structure consisting of 345 amino acid residues with a calculated molecular mass of 37.4 KDa. The purified enzyme, named VpSP37, contains a Serine protease domain between residues 35 and 276 and a canonical Trypsin/Chimotrypsin 3D structure. Functional assays were performed to evaluate protease activity of purified enzyme. Additionally the performance of VpSP37 was evaluated in tissue dissociations experiments and the use of such enzyme as a component of enzyme blend for tissue dissociation procedures is strongly recommended. PMID:26162075
Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei
2011-11-01
Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.
What is the cause of benign transient hyperphosphatasemia? A study of 35 cases.
Crofton, P M
1988-02-01
In a study of 35 children with benign transient hyperphosphatasemia, I found a marked seasonal clustering of cases after the summer months. Furthermore, plasma 25-hydroxyvitamin D concentrations were almost twice those of controls matched for age and time of year. Many children had evidence of weight loss and one had idiopathic hypercalcemia of infancy. Activities both of liver and bone isoenzymes of alkaline phosphatase (EC 3.1.3.1) in plasma were increased. The liver and (to a lesser extent) bone isoenzymes had enhanced electrophoretic mobility, and both showed increased binding to wheat-germ lectin by affinity electrophoresis. For the liver (and probably also the bone) isoenzyme, these changes were due to an increased content of sialic acid. A possible etiology for the condition is proposed involving (a) increased synthesis of alkaline phosphatase, mediated by vitamin D metabolites, and (b) decreased hepatic clearance caused by the high sialic acid content and exacerbated in some cases by the effects of some drugs on the liver.
Rill, Randolph L; Beheshti, Afshin; Van Winkle, David H
2002-08-01
Electrophoretic mobilities of DNA molecules ranging in length from 200 to 48 502 base pairs (bp) were measured in agarose gels with concentrations T = 0.5% to 1.3% at electric fields from E = 0.71 to 5.0 V/cm. This broad data set determines a range of conditions over which the new interpolation equation nu(L) = (beta+alpha(1+exp(-L/gamma))(-1) can be used to relate mobility to length with high accuracy. Mobility data were fit with chi(2) > 0.999 for all gel concentrations and fields ranging from 2.5 to 5 V/cm, and for lower fields at low gel concentrations. Analyses using so-called reptation plots (Rousseau, J., Drouin, G., Slater, G. W., Phys. Rev. Lett. 1997, 79, 1945-1948) indicate that this simple exponential relation is obeyed well when there is a smooth transition from the Ogston sieving regime to the reptation regime with increasing DNA length. Deviations from this equation occur when DNA migration is hindered, apparently by entropic-trapping, which is favored at low fields and high gel concentrations in the ranges examined.
Ludewig, Ronny; Nietzsche, Sandor; Scriba, Gerhard K E
2011-01-01
A CEC weak cation-exchange monolith has been prepared by in situ polymerization of acrylamide, methylenebisacrylamide and 4-acrylamidobutyric acid in a decanol-dimethylsulfoxide mixture as porogen. The columns were evaluated by SEM and characterized with regard to the separation of diastereomers and α/β-isomers of aspartyl peptides. Column preparation was reproducible as evidenced by comparison of the analyte retention times of several columns prepared simultaneously. Analyte separation was achieved using mobile phases consisting of acidic phosphate buffer and ACN. Under these conditions the peptides migrated due to their electrophoretic mobility but the EOF also contributed as driving force as a function of the pH of the mobile phase due to increasing dissociation of the carboxyl groups of the polymer. Raising the pH of the mobile phase also resulted in deprotonation of the peptides reducing analyte mobility. Due to these mechanisms each pair of diastereomeric peptides displayed the highest resolution at a different pH of the buffer component of the mobile phase. Comparing the weak-cation exchange monolith to an RP monolith and a strong cation-exchange monolith different elution order of some peptide diastereomers was observed, clearly illustrating that interactions with the stationary phase contribute to the CEC separations. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sim, H H; Kim, Y J; Choi, H J
2012-12-01
Black inorganic pigment modified with poly(styrene-co-acrylonitrile) was fabricated via dispersion polymerization, and then the synthesized hybrid nanoparticles were examined by SEM to confirm their morphology, while their density and size were studied using a gas pycnometer and electrophoretic light scattering apparatus, respectively. We also confirmed their chemical structure and coated state via FT-IR and TGA. Electrophoretic characteristics including the zeta potential were examined via an electrophoretic light scattering apparatus, while the movement of particles was directly observed by an optical microscopy under an electric field applied. The hybrid nanoparticles were confirmed to possess an electrophoretic property as a potential candidate for the microcapsule-type electrophoretic display.
Kellenberger, Colleen A; Sales-Lee, Jade; Pan, Yuchen; Gassaway, Madalee M; Herr, Amy E; Hammond, Ming C
2015-01-01
Cyclic di-GMP (c-di-GMP) is a second messenger that is important in regulating bacterial physiology and behavior, including motility and virulence. Many questions remain about the role and regulation of this signaling molecule, but current methods of detection are limited by either modest sensitivity or requirements for extensive sample purification. We have taken advantage of a natural, high affinity receptor of c-di-GMP, the Vc2 riboswitch aptamer, to develop a sensitive and rapid electrophoretic mobility shift assay (EMSA) for c-di-GMP quantitation that required minimal engineering of the RNA.
Molecular evidence of stereo-specific lactoferrin dimers in solution.
Persson, Björn A; Lund, Mikael; Forsman, Jan; Chatterton, Dereck E W; Akesson, Torbjörn
2010-10-01
Gathering experimental evidence suggests that bovine as well as human lactoferrin self-associate in aqueous solution. Still, a molecular level explanation is unavailable. Using force field based molecular modeling of the protein-protein interaction free energy we demonstrate (1) that lactoferrin forms highly stereo-specific dimers at neutral pH and (2) that the self-association is driven by a high charge complementarity across the contact surface of the proteins. Our theoretical predictions of dimer formation are verified by electrophoretic mobility and N-terminal sequence analysis on bovine lactoferrin. 2010 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Davis, Robert H.; Loewenberg, Michael
1997-01-01
The primary objective of this research was to develop a fundamental understanding of aggregation and coalescence processes during electrically-driven migration of cells, particles and droplets. The process by which charged cells, particles, molecules, or drops migrate in a weak electric field is known as electrophoresis. If the migrating species have different charges or surface potentials, they will migrate at different speeds and thus may collide and aggregate or coalesce. Aggregation and coalescence are undesirable, if the goal is to separate the different species on the basis of their different electrophoretic mobilities.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chiles, T.C.; Liu, J.L.; Rothstein, T.L.
1991-03-15
Cross-linking of sIg on primary B lymphocytes leads to increased nuclear DNA-binding activity specific for the tetradecanoyl phorbol acetate-response element (TRE), as judged by gel mobility shift assays. Stimulation of B cells to enter S phase of the cell cycle by treatment with the combination of phorbol ester plus calcium ionophore also stimulated nuclear TRE-binding activity within 2 h, with maximal expression at 4 h; however, phorbol ester and calcium ionophore were not as effective in stimulating binding activity when examined separately. Stimulated nuclear expression of TRE-binding activity appears to require protein synthesis. Fos- and Jun/AP-1-related proteins participate directly inmore » the identified nucleoprotein complex, as shown by the ability of c-fos- and c-jun-specific antisera to either alter or completely abolish electrophoretic migration of the complex in native gels. Further, UV photo-cross-linking studies identified two major TRE-binding protein species, whose sizes correspond to TRE-binding proteins derived from HeLa cell nuclear extracts. The results suggest that in primary B cells nuclear TRE-binding activity represents a downstream signaling event that occurs subsequent to changes in protein kinase C activity and intracellular Ca2+ but that can be triggered physiologically through sIg.« less
Thermoplastic microchannel fabrication using carbon dioxide laser ablation.
Wang, Shau-Chun; Lee, Chia-Yu; Chen, Hsiao-Ping
2006-04-14
We report the procedures of machining microchannels on Vivak co-polyester thermoplastic substrates using a simple industrial CO(2) laser marker. To avoid overheating the substrates, we develop low-power marking techniques in nearly anaerobic environment. These procedures are able to machine microchannels at various aspect ratios. Either straight or serpent channel can be easily marked. Like the wire-embossed channel walls, the ablated channel surfaces become charged after alkaline hydrolysis treatment. Stable electroosmotic flow in the charged conduit is observed to be of the same order of magnitude as that in fused silica capillary. Typical dynamic coating protocols to alter the conduit surface properties are transferable to the ablated channels. The effects of buffer acidity on electroosmotic mobility in both bare and coated channels are similar to those in fused silica capillaries. Using video microscopy we also demonstrate that this device is useful in distinguishing the electrophoretic mobility of bare and latex particles from that of functionalized ones.
Electric field-induced reversible trapping of microtubules along metallic glass microwire electrodes
NASA Astrophysics Data System (ADS)
Kim, Kyongwan; Sikora, Aurélien; Nakayama, Koji S.; Umetsu, Mitsuo; Hwang, Wonmuk; Teizer, Winfried
2015-04-01
Microtubules are among bio-polymers providing vital functions in dynamic cellular processes. Artificial organization of these bio-polymers is a requirement for transferring their native functions into device applications. Using electrophoresis, we achieve an accumulation of microtubules along a metallic glass (Pd42.5Cu30Ni7.5P20) microwire in solution. According to an estimate based on migration velocities of microtubules approaching the wire, the electrophoretic mobility of microtubules is around 10-12 m2/Vs. This value is four orders of magnitude smaller than the typical mobility reported previously. Fluorescence microscopy at the individual-microtubule level shows microtubules aligning along the wire axis during the electric field-induced migration. Casein-treated electrodes are effective to reversibly release trapped microtubules upon removal of the external field. An additional result is the condensation of secondary filamentous structures from oriented microtubules.
Countercurrent distribution of biological cells
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1982-01-01
Detailed physiochemical studies of dextran/poly(ethylene glycol) (PEG) two phase systems were carried out to characterize and provide understanding of the properties of the systems which determine cell partition and the electrophoretic behavior of phase drops responsible for electric field driven phase separation. A detailed study of the electrostatic and electrokinetic potentials developed in these systems was carried out. The salt partition was examined both in phase systems and with pure polymer solutions via equilibrium dialysis and mechanism of sulfate, chloride and phosphate partition shown to be exclusion by PEG rather than binding by dextran. Salt partition was shown to have a strong effect on the polymer compositions of the phases as well, an effect which produces large changes in the interfacial tension between them. These effects were characterized and the interfacial tension shown to obey a power law with respect to its dependence on the length of the tie line describing the system composition on a phase diagram. The electrostatic potential differences measured via salt bridges were shown to obey thermodynamic predictions. The electrophoretic mobilities measured were utilized to provide a partial test of Levine's incomplete theory of phase drop electrophoresis. The data were consistent with Levine's expression over a limited range of the variables tested.
1994-01-01
Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685
Raval, Kunil K.; Tao, Ran; White, Brent E.; De Lange, Willem J.; Koonce, Chad H.; Yu, Junying; Kishnani, Priya S.; Thomson, James A.; Mosher, Deane F.; Ralphe, John C.; Kamp, Timothy J.
2015-01-01
Infantile-onset Pompe disease is an autosomal recessive disorder caused by the complete loss of lysosomal glycogen-hydrolyzing enzyme acid α-glucosidase (GAA) activity, which results in lysosomal glycogen accumulation and prominent cardiac and skeletal muscle pathology. The mechanism by which loss of GAA activity causes cardiomyopathy is poorly understood. We reprogrammed fibroblasts from patients with infantile-onset Pompe disease to generate induced pluripotent stem (iPS) cells that were differentiated to cardiomyocytes (iPSC-CM). Pompe iPSC-CMs had undetectable GAA activity and pathognomonic glycogen-filled lysosomes. Nonetheless, Pompe and control iPSC-CMs exhibited comparable contractile properties in engineered cardiac tissue. Impaired autophagy has been implicated in Pompe skeletal muscle; however, control and Pompe iPSC-CMs had comparable clearance rates of LC3-II-detected autophagosomes. Unexpectedly, the lysosome-associated membrane proteins, LAMP1 and LAMP2, from Pompe iPSC-CMs demonstrated higher electrophoretic mobility compared with control iPSC-CMs. Brefeldin A induced disruption of the Golgi in control iPSC-CMs reproduced the higher mobility forms of the LAMPs, suggesting that Pompe iPSC-CMs produce LAMPs lacking appropriate glycosylation. Isoelectric focusing studies revealed that LAMP2 has a more alkaline pI in Pompe compared with control iPSC-CMs due largely to hyposialylation. MALDI-TOF-MS analysis of N-linked glycans demonstrated reduced diversity of multiantennary structures and the major presence of a trimannose complex glycan precursor in Pompe iPSC-CMs. These data suggest that Pompe cardiomyopathy has a glycan processing abnormality and thus shares features with hypertrophic cardiomyopathies observed in the congenital disorders of glycosylation. PMID:25488666
On-chip Micro- and Nanofluidic Electrokinetic Injection and Separation for PEGylation Analysis
NASA Astrophysics Data System (ADS)
Shelton, Elijah; Baum, Mary; Morse, Dan; Pennathur, Sumita; Pennathur Nanofluidics Laboratory Collaboration; Morse Laboratory Collaboration
2012-11-01
We present an experimental study of micro- and nanofluidic electrokinetic injection and separation in borosilcate channels as a method for characterizing size and zeta potential of biomolecules-specifically polyethlylene glycol (PEG), keyhole limpet hemocyanine (KLH), and pegylated KLH. While pegylation (the conjugation of proteins with PEG) is an established technique for enhancing a protein's therapeutic properties, reliable characterization of these conjugations by traditional analysis techniques (i.e. gel-electrophoresis, zetasizer) remains a challenge. Using a three-step electrokinetic sequence (load, gate, and inject), FITC labeled species and a fluorescein tracer dye are injected into a channel where they separate according to differences in electrophoretic mobility. We find the average absolute mobility of pegylated subunit KLH in 1 micron channels to be 56% that of unpegylated subunit KLH. In a 250 nm channel, we measure a 33% shift in the average absolute mobility of PEG dendrimers as compared to measurements in a 1 micron channel. These results begin to demonstrate how a micro- and nanofluidic-based approach might address the demand for effective and accessible nanoparticle characterization platforms. Supported by the Institute for Collaborative Biotechnologies.
Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R
1997-09-05
To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.
Malá, Zdena; Gebauer, Petr; Boček, Petr
2016-09-07
This article describes for the first time the combination of electrophoretic focusing on inverse electromigration dispersion (EMD) gradient, a new separation principle described in 2010, with electrospray-ionization (ESI) mass spectrometric detection. The separation of analytes along the electromigrating EMD profile proceeds so that each analyte is focused and concentrated within the profile at a particular position given by its pKa and ionic mobility. The proposed methodology combines this principle with the transport of the focused zones to the capillary end by superimposed electromigration, electroosmotic flow and ESI suction, and their detection by the MS detector. The designed electrolyte system based on maleic acid and 2,6-lutidine is suitable to create an inverse EMD gradient of required properties and its components are volatile enough to be compatible with the ESI interface. The characteristic properties of the proposed electrolyte system and of the formed inverse gradient are discussed in detail using calculated diagrams and computer simulations. It is shown that the system is surprisingly robust and allows sensitive analyses of trace amounts of weak acids in the pKa range between approx. 6 and 9. As a first practical application of electrophoretic focusing on inverse EMD gradient, the analysis of several sulfonamides in waters is reported. It demonstrates the potential of the developed methodology for fast and high-sensitivity analyses of ionic trace analytes, with reached LODs around 3 × 10(-9) M (0.8 ng mL(-1)) of sulfonamides in spiked drinking water without any sample pretreatment. Copyright © 2016 Elsevier B.V. All rights reserved.
Silva, Marcilene Rezende; Sendin, Shimene Mascarenhas; Araujo, Isabela Couto de Oliveira; Pimentel, Fernanda Silva; Viana, Marcos Borato
2013-01-01
To characterize alpha-chain variant hemoglobins with electric mobility similar to that of hemoglobin S in a newborn screening program. β(S) allele and alpha-thalassemia deletions were investigated in 14 children who had undefined hemoglobin at birth and an electrophoretic profile similar to that of hemoglobin S when they were six months old. Gene sequencing and restriction enzymes (DdeI, BsaJI, NlaIV, Bsu36I and TaqI) were used to identify hemoglobins. Clinical and hematological data were obtained from children who attended scheduled medical visits. THE FOLLOWING ALPHA CHAIN VARIANTS WERE FOUND: seven children with hemoglobin Hasharon [alpha2 47(CE5) Asp>His, HbA2:c.142G>C], all associated with alpha-thalassemia, five with hemoglobin Ottawa [alpha1 15(A13) Gly>Arg, HBA1:c.46G>C], one with hemoglobin St Luke's [alpha1 95(G2) Pro>Arg, HBA1:c.287C>G] and another one with hemoglobin Etobicoke [alpha212 84(F5) Ser>Arg, HBA212:c.255C>G]. Two associations with hemoglobin S were found: one with hemoglobin Ottawa and one with hemoglobin St Luke's. The mutation underlying hemoglobin Etobicoke was located in a hybrid α212 allele in one child. There was no evidence of clinically relevant hemoglobins detected in this study. Apparently these are the first cases of hemoglobin Ottawa, St Luke's, Etobicoke and the α212 gene described in Brazil. The hemoglobins detected in this study may lead to false diagnosis of sickle cell trait or sickle cell disease when only isoelectric focusing is used in neonatal screening. Additional tests are necessary for the correct identification of hemoglobin variants.
Quirino, Joselito P; Aranas, Agnes T
2011-10-14
The on-line sample concentration technique, micelle to solvent stacking (MSS), was studied for small organic cations (quaternary ammonium herbicides, β-blocker drugs, and tricyclic antidepressant drugs) in reversed migration micellar electrokinetic chromatography. Electrokinetic chromatography was carried out in fused silica capillaries with a background solution of sodium dodecyl sulfate (SDS) in a low pH phosphate buffer. MSS was performed using anionic SDS micelles in the sample solution for analyte transport and methanol or acetonitrile as organic solvent in the background solution for analyte effective electrophoretic mobility reversal. The solvent also allowed for the separation of the analyte test mixtures. A model for focusing and separation was developed and the mobility reversal that involved micelle collapse was experimentally verified. The effect of analyte retention factor was observed by changing the % organic solvent in the background solution or the concentration of SDS in the sample matrix. With an injection length of 31.9 cm (77% of effective capillary length) for the 7 test drugs, the LODs (S/N=3) of 5-14 ng/mL were 101-346-fold better when compared to typical injection. The linearity (R(2), range=0.025-0.8 μg/mL), intraday and interday repeatability (%RSD, n=10) were ≥0.988, <6.0% and <8.5%, respectively. In addition, analysis of spiked urine samples after 10-fold dilution with the sample matrix yielded LODs=0.02-0.10 μg/mL. These LODs are comparable to published electrophoretic methods that required off-line sample concentration. However, the practicality of the technique for more complex samples will rely on dedicated sample preparation schemes. Copyright © 2011 Elsevier B.V. All rights reserved.
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
Xu, R; Birke, S; Carberry, S E; Geacintov, N E; Swenberg, C E; Harvey, R G
1992-01-01
The unwinding of supercoiled phi X174 RFI DNA induced by the tumorigenic (+) and non-tumorigenic (-) enantiomers of trans-7,8-dihydroxy-anti-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) has been investigated by agarose slab-gel and ethidium titration tube gel electrophoresis. The differences in adduct conformations were verified by flow linear dichroism techniques. Both enantiomers cause a reversible unwinding by the formation of noncovalent intercalative complexes. The effects of covalently bound BPDE residues on the electrophoretic mobilities of the RF I DNA form in agarose gels were investigated in detail in the range of binding ratios rb approximately 0.0-0.06 (covalently bound BPDE residues/nucleotide). In this range of rb values, there is a striking difference in the mobilities of (+)-BPDE- and (-)-BPDE-adducted phi X174 DNA in agarose slab-gels, the covalently bound (+)-BPDE residues causing a significantly greater retardation than (-)-BPDE residues. Increasing the level of covalent adducts beyond rb approximately 0.06 in the case of the (+)-BPDE enantiomer, leads to further unwinding and a minimum in the mobilities (corresponding to comigration of the nicked form and the covalently closed relaxed modified form) at rb 0.10 +/- 0.01; at still higher rb values, rewinding of the modified DNA in the opposite sense is observed. From the minimum in the mobility, a mean unwinding angle (per BPDE residue) of theta = 12 +/- 1.5 degrees is determined, which is in good agreement the value of theta = 11 +/- 1.8 degrees obtained by the tube gel titration method. Using this latter method, values of theta = 6.8 +/- 1.7 degrees for (-)-BPDE-phi X174 adducts are observed. It is concluded that agarose slab gel techniques are not suitable for determining unwinding angles for (-)-BPDE-modified phi X174 DNA because the alterations in the tertiary structures for rb < 0.06 are too small to cause sufficiently large changes in the electrophoretic mobilities. The major trans (+)-BPDE-N2-guanosine covalent adduct is situated at external binding sites and the mechanisms of unwinding are therefore different from those relevant to noncovalent intercalative BPDE-DNA complexes or to classical intercalating drug molecules; a flexible hinge joint and a widening of the minor groove at the site of the lesion may account for the observed unwinding effects. The more heterogeneous (-)-BPDE-nucleoside adducts (involving cis and trans N2-guanosine, and adenosine adducts) are less effective in causing unwinding of supercoiled DNA for reasons which remain to be elucidated. Images PMID:1475180
Recent patents on electrophoretic displays and materials.
Christophersen, Marc; Phlips, Bernard F
2010-11-01
Electrophoretic displays (EPDs) have made their way into consumer products. EPDs enable displays that offer the look and form of a printed page, often called "electronic paper". We will review recent apparatus and method patents for EPD devices and their fabrication. A brief introduction into the basic display operation and history of EPDs is given, while pointing out the technological challenges and difficulties for inventors. Recently, the majority of scientific publications and patenting activity has been directed to micro-segmented EPDs. These devices exhibit high optical reflectance and contrast, wide viewing angle, and high image resolution. Micro-segmented EPDs can also be integrated with flexible transistors technologies into flexible displays. Typical particles size ranges from 200 nm to 2 micrometer. Currently one very active area of patenting is the development of full-color EPDs. We summarize the recent patenting activity for EPDs and provide comments on perceiving factors driving intellectual property protection for EPD technologies.
Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James
2003-01-01
Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069
Hu, Donghua; Wang, Yuguang; Chen, Zhiwu; Ma, Zengchun; You, Qing; Zhang, Xianxie; Zhou, Tao; Xiao, Yong; Liang, Qiande; Tan, Hongling; Xiao, Chengrong; Tang, Xianglin; Zhang, Boli; Gao, Yue
2014-09-05
Artemisinin has been used to treat malaria for centuries in the context of traditional Chinese medicine. In the present study, the effects of artemisinin on pregnane X receptor (PXR)-mediated CYP3A expression and its therapeutic role in inflammatory bowel disease were investigated. LS174T cells exposed to artemisinin at various concentrations and for different periods of time were examined with respect to the specific induction of CYP3A4 and PXR mRNA expression. Transient transfection experiments showed transcriptional activation of the CYP3A4 gene through artemisinin to be PXR-dependent. An electrophoretic-mobility shift assay (EMSA) showed that artemisinin activates the DNA-binding capacity of the PXR for the CYP3A4 element. These results indicate that the induction of CYP3A4 by artemisinin is mediated through the activation of PXR. Using animal models, it was demonstrated that artemisinin abrogates dextran sulfate sodium (DDS)-induced intestinal inflammation. Preadministration of artemisinin ameliorated the clinical hallmarks of colitis in DSS-treated mice as determined by body weight loss and assessment of diarrhea, rectal bleeding, colon length, and histology. Artemisinin was found to prevent or reduce the severity of colonic inflammation by inducing CYP3A expression by activation of PXR. Copyright © 2014 Elsevier B.V. All rights reserved.
The human insulin receptor mRNA contains a functional internal ribosome entry segment
Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth
2009-01-01
Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240
Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu
2003-08-29
We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.
Li, Yuhua; Fan, Lei; Sun, Yang; Zhang, Dian; Yue, Zhenggang; Niu, Yinbo; Meng, Jin; Yang, Tiehong; Liu, Wenchao; Mei, Qibing
2013-10-01
Colorectal cancer (CRC) is one of the most common cancers and a leading cause of cancer-related mortality in developed countries. Many ingredients of apples have been proven to have anti-inflammatory and anti-carcinogenic characteristics, and show benefits for CRC prevention. The aim of this study, therefore, was to evaluate inhibitory effect of an apple oligogalactan (AOG) on pro-inflammatory endotoxin lipopolysaccharide (LPS)-activated human colon carcinoma cells HT-29 and SW-620 and investigate the possible mechanisms. The two cell lines were pretreated with AOG (0.1-1 g/L) for 30 min and then treated with 10 μg/mL LPS. Real time PCR, Western blot, electrophoretic mobility shift assay (EMSA), and ELISA were used to detect the expression and activity of cyclooxygenase-2 (COX-2), NF-κB and MAPKs pathways. AOG significantly inhibited the expression and activity of COX-2 in LPS-activated human colon carcinoma cells HT-29 and SW-620. The mechanisms of AOG-suppressed COX-2 expression may be through inhibiting the phosphorylation of MAPKs and the activation of NF-κB and AP-1. These data may provide another molecular basis for understanding how apples act to prevent CRC and indicate that AOG may be useful for treatment of colitis and prevention of carcinogenesis. Copyright © 2013 Elsevier B.V. All rights reserved.
Khan, Rais Ahmad; Yadav, Shipra; Hussain, Zahid; Arjmand, Farukh; Tabassum, Sartaj
2014-02-14
Dimethyltin(IV) complexes with ethanolamine (1) and biologically significant N-glycosides (2 and 3) were designed and synthesized. The structural elucidation of complexes 1-3 was done using elemental and spectroscopic methods; in addition, complex 1 was studied by single crystal X-ray diffraction studies. The in vitro DNA binding profile of complexes 2 and 3 was carried out by employing different biophysical methods to ascertain the feasibility of glycosylated complexes. Further, the cleaving ability of 2 and 3 was investigated by the agarose gel electrophoretic mobility assay with supercoiled pBR322 DNA, and demonstrated significantly good nuclease activity. Furthermore, both the complexes exhibited significant inhibitory effects on the catalytic activity of human Topo I at lower concentration than standard drugs. Computer-aided molecular docking techniques were used to ascertain the mode and mechanism of action towards the molecular target DNA and Topo I. The cytotoxicity of 2 and 3 against human hepatoma cancer cells (Huh7) was evaluated, which revealed significant regression in cancerous cells as compared with the standard drug. The antiproliferative activities of 2 and 3 were tested against human hepatoma cancer cells (Huh7), and results showed significantly good activity. Additionally, to validate the remarkable antiproliferative activity of complexes 2 and 3, specific regulatory gene expression (MMP-2 and TGF-β) was obtained by real time PCR.
Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M
2012-09-19
Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biery, B.J.; Stein, D.E.; Goodman, S.I.
The structure of the human glutaryl coenzyme A dehydrogenase (GCD) gene was determined to contain 11 exons and to span {approximately}7 kb. Fibroblast DNA from 64 unrelated glutaric academia type I (GA1) patients was screened for mutations by PCR amplification and analysis of SSCP. Fragments with altered electrophoretic mobility were subcloned and sequenced to detect mutations that caused GA1. This report describes the structure of the GCD gene, as well as point mutations and polymorphisms found in 7 of its 11 exons. Several mutations were found in more than one patient, but no one prevalent mutation was detected in themore » general population. As expected from pedigree analysis, a single mutant allele causes GA1 in the Old Order Amish of Lancaster County, Pennsylvania. Several mutations have been expressed in Escherichia coli, and all produce diminished enzyme activity. Reduced activity in GCD encoded by the A421V mutation in the Amish may be due to impaired association of enzyme subunits. 13 refs., 5 figs., 3 tabs.« less
Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.
2012-01-01
Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171
Radchenko, Martha; Nie, Rongxin; Lu, Min
2016-01-01
Multidrug and toxic compound extrusion (MATE) transporters contribute to multidrug resistance by extruding different drugs across cell membranes. The MATE transporters alternate between their extracellular and intracellular facing conformations to propel drug export, but how these structural changes occur is unclear. Here we combine site-specific cross-linking and functional studies to probe the movement of transmembrane helices in NorM from Neiserria gonorrheae (NorM-NG), a MATE transporter with known extracellular facing structure. We generated an active, cysteine-less NorM-NG and conducted pairwise cysteine mutagenesis on this variant. We found that copper phenanthroline catalyzed disulfide bond formation within five cysteine pairs and increased the electrophoretic mobility of the corresponding mutants. Furthermore, copper phenanthroline abolished the activity of the five paired cysteine mutants, suggesting that these substituted amino acids come in spatial proximity during transport, and the proximity changes are functionally indispensable. Our data also implied that the substrate-binding transmembrane helices move up to 10 Å in NorM-NG during transport and afforded distance restraints for modeling the intracellular facing transporter, thereby casting new light on the underlying mechanism. PMID:26975373
Buono, P; Conciliis, L D; Izzo, P; Salvatore, F
1997-01-01
A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889
Enhanced separation of membranes during free flow zonal electrophoresis in plants.
Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar
2007-07-15
Free flow zonal electrophoresis (FFZE) is a versatile technique that allows for the separation of cells, organelles, membranes, and proteins based on net surface charge during laminar flow through a thin aqueous layer. We have been optimizing the FFZE technique to enhance separation of plant vacuolar membranes (tonoplast) from other endomembranes to pursue a directed proteomics approach to identify novel tonoplast transporters. Addition of ATP to a mixture of endomembranes selectively enhanced electrophoretic mobility of acidic vesicular compartments during FFZE toward the positive electrode. This has been attributed to activation of the V-ATPase generating a more negative membrane potential outside the vesicles, resulting in enhanced migration of acidic vesicles, including tonoplast, to the anode (Morré, D. J.; Lawrence, J.; Safranski, K.; Hammond, T.; Morré, D. M. J. Chromatogr., A 1994, 668, 201-213). We confirm that ATP does induce a redistribution of membranes during FFZE of microsomal membranes isolated from several plant species, including Arabidopsis thaliana, Thellungiella halophila, Mesembryanthemum crystallinum, and Ananas comosus. However, we demonstrate, using V-ATPase-specific inhibitors, nonhydrolyzable ATP analogs, and ionophores to dissipate membrane potential, that the ATP-dependent migrational shift of membranes under FFZE is not due to activation of the V-ATPase. Addition of EDTA to chelate Mg2+, leading to the production of the tetravalent anionic form of ATP, resulted in a further enhancement of membrane migration toward the anode, and manipulation of cell surface charge by addition of polycations also influenced the ATP-dependent migration of membranes. We propose that ATP enhances the mobility of endomembranes by screening positive surface charges on the membrane surface.
Henke, Sarah K; Cronan, John E
2016-11-01
Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.
Silicon thin-film transistor backplanes on flexible substrates
NASA Astrophysics Data System (ADS)
Kattamis, Alexis Z.
Flexible large area electronics, especially for displays, is a rapidly growing field. Since hydrogenated amorphous silicon thin-film transistors (a-Si:H TFTs) have become the industry standard for liquid crystal displays, it makes sense that they be used in any transition from glass substrates to flexible substrates. The goal of this thesis work was to implement a-Si:H backplane technology on stainless steel and clear plastic substrates, with minimal recipe changes to ensure high device quality. When fabricating TFTs on flexible substrates many new issues arise, from thin-film fracture to overlay alignment errors. Our approach was to maintain elevated deposition temperatures (˜300°C) and engineer methods to minimize these problems, rather than reducing deposition temperatures. The resulting TFTs exhibit more stable operation than their low temperature counterparts and are therefore similar to the TFTs produced on glass. Two display projects using a-Si:H TFTs will be discussed in detail. They are an active-matrix organic light emitting display (AMOLED) on stainless steel and an active-matrix electrophoretic display (AMEPD) on clear plastic, with TFTs deposited at 250°C-280°C. Achieving quality a-Si:H TFTs on these substrates required addressing a host of technical challenges, including surface roughness and feature misalignment. Nanocrystalline silicon (nc-Si) was also implemented on a clear plastic substrate as a possible alternative to a-Si:H. nc-Si:H TFTs can be deposited using the same techniques as a-Si:H but yield carrier mobilities one order of magnitude greater. Their large mobilities could enable high resolution OLED displays and system-on-panel electronics.
Świeca, Michał; Gawlik-Dziki, Urszula; Sęczyk, Łukasz; Dziki, Dariusz; Sikora, Małgorzata
2018-08-30
Interactions of phenolics from green coffee bean flour (GCS) with the matrix of wheat bread have been studied employing direct (electrophoretic and chromatographic techniques) and indirect tests (nutrient digestibility). According to the chromatograms of digests, the antiradical activity of enriched bread was exhibited by free phenolics. An increase the area of chromatograms and some additional peaks observed for enriched bread may confirm some interactions of proteins with phenolics. The electrophoretic profile of these extracts showed that the band corresponding to a protein with molecular mass of 38 kDA had much higher intensity in enriched bread. Electrophoretic analysis of pellets remaining after digestion revealed GCS dose-dependent differences in bands corresponding to proteins with molecular masses of 52 kDa and 23 kDa. The relative digestibility of both starch and proteins was slightly decreased by addition of GCS; however, these changes did not exceed 10%, which justifies the use of this functional material. Copyright © 2018 Elsevier Ltd. All rights reserved.
Multilayer organic based structures with enhanced hole transport
NASA Astrophysics Data System (ADS)
Mladenova, D.; Sinigersky, V.; Budurova, D.; Dobreva, T.; Karashanova, D.; Dimov, D.; Zhivkov, I.
2010-11-01
Multilayer Organic Based Devices (OBDs) were constructed by subsequent casting of organic films (from polymers, soluble in the same organic solvent). The problem with dissolution of the underlying layer was avoided by using electrophoretic deposition technique. Optimized conditions for electrophoretic deposition (EPD) of thin films with homogeneous and smooth surfaces, as confirmed by SEM, were found. The EPD, carried out at constant current, requires continuous increase of the voltage between the electrodes. In this way the decreased deposition rate caused by the decreased concentration of the material in the suspension and the increased thickness of the film deposited is compensated. The SEM images and the current voltage characteristics recorded, show that the hole transport polyvinylcarbazole (PVK) underlayer survive the treatment with the suspension used for the electrophoretic deposition of the active poly[2-methoxy-5-(3,7-dimethyloctyloxy)-1,4-phenylene vinylene] electroluminescent layer. The PVK hole transport layer increases the device current, as confirmed by the current-voltage measurements. The results obtained demonstrate the possibility of OBDs preparation for electroluminescent and photovoltaic applications.
Woo, Kyung Jin; Kwon, Taeg Kyu
2007-12-15
Sulforaphane is a natural, biologically active compound extracted from cruciferous vegetables such as broccoli and cabbage. It possesses potent anti-inflammation and anti-cancer properties. The mechanism by which sulforaphane suppresses COX-2 expression remains poorly understood. In the present report, we investigated the effect of sulforaphane on the expression of COX-2 in lipopolysaccharide (LPS)-activated Raw 264.7 cells. Sulforaphane significantly suppressed the LPS-induced COX-2 protein and mRNA expression in a dose-dependent manner. The ability of sulforaphane to suppress the expression of the COX-2 was investigated using luciferase reporters controlled by various cis-elements in COX-2 promoter region. Electrophoretic mobility shift assay (EMSA) verified that NF-kappaB, C/EBP, CREB and AP-1 were identified as responsible for the sulforaphane-mediated COX-2 down-regulation. In addition, we demonstrated the signal transduction pathway of mitogen-activated protein kinase (MAP kinase) in LPS-induced COX-2 expression. Taken together, these results demonstrate that sulforaphane effectively suppressed the LPS-induced COX-2 protein via modulation of multiple core promoter elements (NF-kappaB, C/EBP, CREB and AP-1) in the COX-2 transcriptional regulation. These results will provide new insights into the anti-inflammatory and anti-carcinogenic properties of sulforaphane.
Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook
2002-07-26
The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.
Ouabain Modulates Zymosan-Induced Peritonitis in Mice
Leite, Jacqueline Alves; Alves, Anne Kaliery De Abreu; Galvão, José Guilherme Marques; Teixeira, Mariana Pires; Rumjanek, Vivian Mary; Rodrigues-Mascarenhas, Sandra
2015-01-01
Ouabain, a potent inhibitor of the Na+, K+-ATPase, was identified as an endogenous substance. Recently, ouabain was shown to affect various immunological processes. We have previously demonstrated the ability of ouabain to modulate inflammation, but little is known about the mechanisms involved. Thus, the aim of the present work is to evaluate the immune modulatory role of ouabain on zymosan-induced peritonitis in mice. Our results show that ouabain decreased plasma exudation (33%). After induction of inflammation, OUA treatment led to a 46% reduction in the total number of cells, as a reflex of a decrease of polymorphonuclear leukocytes, which does not appear to be due to cell death. Furthermore, OUA decreased TNF-α (57%) and IL-1β (58%) levels, without interfering with IL-6 and IL-10. Also, in vitro experiments show that ouabain did not affect endocytic capacity. Moreover, electrophoretic mobility shift assay (EMSA) shows that zymosan treatment increased (85%) NF-κB binding activity and that ouabain reduced (30%) NF-κB binding activity induced by zymosan. Therefore, our data suggest that ouabain modulated acute inflammatory response, reducing the number of cells and cytokines levels in the peritoneal cavity, as well as NFκB activation, suggesting a new mode of action of this substance. PMID:26078492
Shashoua, V E; Adams, D; Boyer-Boiteau, A
2001-10-19
An 8-amino acid peptide fragment (CMX-8933) of Ependymin, a glycoprotein component of the extracellular fluid and cerebrospinal fluid of goldfish brain, was synthesized and tested for its capacity to activate AP-1 transcription factor in cell cultures. Dose-response and time-course studies of AP-1's binding to DNA were carried out in neuroblastoma (NB2a/dl) and primary rat brain cortical cultures using an electrophoretic mobility shift assay (EMSA). A 13-14-fold increase in AP-1's DNA binding was obtained when NB2a cells were incubated for 4 h with 6-10 microg/ml CMX-8933. Primary rat brain cortical cultures were much more sensitive to the effects of CMX-8933 than transformed (NB2a) cultures; here a 26.7+/-5.2-fold increase in binding was observed following a 3-h treatment with as little as 10 ng/ml peptide. These findings are consistent with an activation of this transcription factor, a characteristic that has been previously correlated with functional aspects of full-sized neurotrophic factors (nerve growth factor and brain-derived nerve growth factor) in neuronal differentiation and regeneration. Such data suggest a role for Ependymin in transcriptional control.
Galasinski, Shelly K.; Lively, Tricia N.; Grebe de Barron, Alexandra; Goodrich, James A.
2000-01-01
Protein acetylation has emerged as a means of controlling levels of mRNA synthesis in eukaryotic cells. Here we report that acetyl coenzyme A (acetyl-CoA) stimulates RNA polymerase II transcription in vitro in the absence of histones. The effect of acetyl-CoA on basal and activated transcription was studied in a human RNA polymerase II transcription system reconstituted from recombinant and highly purified transcription factors. Both basal and activated transcription were stimulated by the addition of acetyl-CoA to transcription reaction mixtures. By varying the concentrations of general transcription factors in the reaction mixtures, we found that acetyl-CoA decreased the concentration of TFIID required to observe transcription. Electrophoretic mobility shift assays and DNase I footprinting revealed that acetyl-CoA increased the affinity of the general transcription factor TFIID for promoter DNA in a TBP-associated factor (TAF)-dependent manner. Interestingly, acetyl-CoA also caused a conformational change in the TFIID-TFIIA-promoter complex as assessed by DNase I footprinting. These results show that acetyl-CoA alters the DNA binding activity of TFIID and indicate that this biologically important cofactor functions at multiple levels to control gene expression. PMID:10688640
Galasinski, S K; Lively, T N; Grebe De Barron, A; Goodrich, J A
2000-03-01
Protein acetylation has emerged as a means of controlling levels of mRNA synthesis in eukaryotic cells. Here we report that acetyl coenzyme A (acetyl-CoA) stimulates RNA polymerase II transcription in vitro in the absence of histones. The effect of acetyl-CoA on basal and activated transcription was studied in a human RNA polymerase II transcription system reconstituted from recombinant and highly purified transcription factors. Both basal and activated transcription were stimulated by the addition of acetyl-CoA to transcription reaction mixtures. By varying the concentrations of general transcription factors in the reaction mixtures, we found that acetyl-CoA decreased the concentration of TFIID required to observe transcription. Electrophoretic mobility shift assays and DNase I footprinting revealed that acetyl-CoA increased the affinity of the general transcription factor TFIID for promoter DNA in a TBP-associated factor (TAF)-dependent manner. Interestingly, acetyl-CoA also caused a conformational change in the TFIID-TFIIA-promoter complex as assessed by DNase I footprinting. These results show that acetyl-CoA alters the DNA binding activity of TFIID and indicate that this biologically important cofactor functions at multiple levels to control gene expression.
Vedantam, Gayatri; Knopf, Sarah; Hecht, David W
2006-01-01
Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.
NASA Astrophysics Data System (ADS)
Ryu, Gi Seong; Lee, Myung Won; Jeong, Seung Hyeon; Song, Chung Kun
2012-05-01
In this study we developed a simple ink-jet process for 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS-pentacene), which is known as a high-mobility soluble organic semiconductor, to achieve relatively high-mobility and high-uniformity performance for large-area applications. We analyzed the behavior of fluorescent particles in droplets and applied the results to determining a method of controlling the behavior of TIPS-pentacene molecules. The grain morphology of TIPS-pentacene varied depending on the temperature applied to the droplets during drying. We were able to obtain large and uniform grains at 46 °C without any “coffee stain”. The process was applied to a large-size organic thin-film transistor (OTFT) backplane for an electrophoretic display panel containing 192×150 pixels on a 6-in.-sized substrate. The average of mobilities of 36 OTFTs, which were taken from different locations of the backplane, was 0.44±0.08 cm2·V-1·s-1, with a small deviation of 20%, over a 6-in.-size area comprising 28,800 OTFTs. This process providing high mobility and high uniformity can be achieved by simply maintaining the whole area of the substrate at a specific temperature (46 °C in this case) during drying of the droplets.
Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi
2012-11-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.
Singh, Narendra P.; Singh, Udai P.; Nagarkatti, Prakash S.
2012-01-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions. PMID:22888145
DNA Extraction by Isotachophoresis in a Microfluidic Channel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stephenson, S J
Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in anmore » inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing electrolyte ions. Conversely, the trailing electrolyte ions have a slow electrophoretic mobility, so they lag behind the sample, thus trapping the species of interest between the LE and TE streams. In a typical isotachophoresis configuration, the electric field is applied in a direction parallel to the direction of flow. The species then form bands that stretch across the width of the channel. A major limitation of that approach is that only a finite amount of sample can be processed at once, and the sample must be processed in batches. For our purposes, a form of free-flow isotachophoresis is more convenient, where the DNA forms a band parallel to the edges of the channel. To achieve this, in our chip, the electric field is applied transversely. This creates a force perpendicular to the direction of flow, which causes the different ions to migrate across the flow direction. Because the mobility of the DNA is between the mobility of the leading and the trailing electrolyte, the DNA is focused in a tight band near the center of the channel. The stream of DNA can then be directed to a different output to produce a highly concentrated outlet stream without batch processing. One hurdle that must be overcome for successful ITP is isolating the electrochemical reactions that result from the application of high voltage for the actual process of isotachophoresis. The electrochemical reactions that occur around metal electrodes produce bubbles and pH changes that are detrimental to successful ITP. The design of the chips we use incorporates polyacrylamide gels to serve as electrodes along the central channel. For our design, the metal electrodes are located away from the chip, and high conductivity buffer streams carry the potential to the chip, functioning as a 'liquid electrode.' The stream then runs alongside a gel barrier. The gel electrode permits ion transfer while simultaneously isolating the separation chamber from any contaminants in the outer, 'liquid electrode' streams. The difference in potential from one side of the chip to the other creates an electric field. This field traverses the inner, separation channel, containing the leading electrolyte, the trailing electrolyte, and the sample of interest (DNA). To increase the ease of use of the chips, a newer chip design has been fabricated. This design has wire electrodes integrated on the chip, rather than elsewhere. To keep the pH changes and bubbling isolated from the separation channel, the chip contains deeper wells near the electrodes so that the flowing buffer can wash away any gases that form around the electrode. This design is significantly more compact because it eliminates the cumbersome electrode boxes. Eliminating the electrode boxes also decreases the required voltage, making the experiments safer. This happens because when the 'liquid electrode' streams travel through small diameter tubing, they lose much of their voltage due to the electrical resistance of the fluid in the tubing.« less
Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T
2015-08-01
Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Takada, Honami; Imadome, Ken-Ichi; Shibayama, Haruna; Yoshimori, Mayumi; Wang, Ludan; Saitoh, Yasunori; Uota, Shin; Yamaoka, Shoji; Koyama, Takatoshi; Shimizu, Norio; Yamamoto, Kouhei; Fujiwara, Shigeyoshi; Miura, Osamu; Arai, Ayako
2017-01-01
Epstein-Barr virus (EBV) has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV). However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells.
Shibayama, Haruna; Yoshimori, Mayumi; Wang, Ludan; Saitoh, Yasunori; Uota, Shin; Yamaoka, Shoji; Koyama, Takatoshi; Shimizu, Norio; Yamamoto, Kouhei; Fujiwara, Shigeyoshi; Miura, Osamu
2017-01-01
Epstein–Barr virus (EBV) has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV). However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells. PMID:28346502
Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi
2002-01-01
We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007
Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi
2002-11-01
We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells.
FXR induces SOCS3 and suppresses hepatocellular carcinoma
Zhang, Yan; Jiang, Peng; Huang, Gang; Chen, Shan; Lyu, Xilin; Zheng, Ping; Zhao, Xin; Zeng, Yijun; Wang, Shuguang; He, Fengtian
2015-01-01
Suppressor of cytokine signaling 3 (SOCS3) is regarded as a vital repressor in the liver carcinogenesis mainly by inhibiting signal transducer and activator of transcription 3 (STAT3) activity. Farnesoid X Receptor (FXR), highly expressed in liver, has an important role in protecting against hepatocellular carcinoma (HCC). However, it is unclear whether the tumor suppressive activity of FXR involves the regulation of SOCS3. In the present study, we found that activation of FXR by its specific agonist GW4064 in HCC cells inhibited cell growth, induced cell cycle arrest at G1 phase, elevated p21 expression and repressed STAT3 activity. The above anti-tumor effects of FXR were dramatically alleviated by knockdown of SOCS3 with siRNA. Reporter assay revealed that FXR activation enhanced the transcriptional activity of SOCS3 promoter. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay displayed that FXR directly bound to IR9 DNA motif within SOCS3 promoter region. The in vivo study in nude mice showed that treatment with FXR ligand GW4064 could decelerate the growth of HCC xenografts, up-regulate SOCS3 and p21 expression and inhibit STAT3 phosphorylation in the xenografts. These results suggest that induction of SOCS3 may be a novel mechanism by which FXR exerts its anti-HCC effects, and the FXR-SOCS3 signaling may serve as a new potential target for the prevention/treatment of HCC. PMID:26416445
Uffort, Deon G; Grimm, Elizabeth A; Ellerhorst, Julie A
2009-01-01
Tumor expression of inducible nitric oxide synthase (iNOS) predicts poor outcomes for melanoma patients. We have reported the regulation of melanoma iNOS by the mitogen-activated protein kinase (MAPK) pathway. In this study, we test the hypothesis that NF-kappaB mediates this regulation. Western blotting of melanoma cell lysates confirmed the constitutive expression of iNOS. Western blot detected baseline levels of activated nuclear extracellular signal-regulated kinase and NF-kappaB. Indirect immunofluorescence confirmed the presence of NF-kappaB p50 and p65 in melanoma cell nuclei, with p50 being more prevalent. Electrophoretic mobility shift assay demonstrated baseline NF-kappaB activity, the findings confirmed by supershift analysis. Treatment of melanoma cells with the MEK inhibitor U0126 decreased NF-kappaB binding to its DNA recognition sequence, implicating the MAPK pathway in NF-kappaB activation. Two specific NF-kappaB inhibitors suppressed iNOS expression, demonstrating regulation of iNOS by NF-kappaB. Several experiments indicated the presence of p50 homodimers, which lack a transactivation domain and rely on the transcriptional coactivator Bcl-3 to carry out this function. Bcl-3 was detected in melanoma cells and co-immunoprecipitated with p50. These data suggest that the constitutively activated melanoma MAPK pathway stimulates activation of NF-kappaB hetero- and homodimers, which, in turn, drive iNOS expression and support melanoma tumorigenesis.
Foulon, C; Duhal, N; Lacroix-Callens, B; Vaccher, C; Bonte, J P; Goossens, J F
2007-07-01
Acidity constants of benzoxa-, benzothia- and benzoselena-zolinone derivatives were determined by capillary electrophoresis, potentiometry and spectrophotometry experiments. These three analytical techniques gave pK(a) results that were in good agreement. A convenient, accurate and precise method for the determination of pK(a) was developed to measure changes in acidity constants induced by heteroatom or 6-benzoyl substituted derivatives. pK(a) values were determined simultaneously for two compounds characterized by different electrophoretic mobility (micro(e)) and pK(a) value and in the presence of an analogous neutral marker.
Indirect photometric detection of boron cluster anions electrophoretically separated in methanol.
Vítová, Lada; Fojt, Lukáš; Vespalec, Radim
2014-04-18
3,5-Dinitrobenzoate and picrate are light absorbing anions pertinent to indirect photometric detection of boron cluster anions in buffered methanolic background electrolytes (BGEs). Tris(hydroxymethyl)aminomethane and morpholine have been used as buffering bases, which eliminated baseline steps, and minimized the baseline noise. In methanolic BGEs, mobilities of boron cluster anions depend on both ionic constituents of the BGE buffer. This dependence can be explained by ion pair interaction of detected anions with BGE cations, which are not bonded into ion pairs with the BGE anions. The former ion pair interaction decreases sensitivity of the indirect photometric detection. Copyright © 2014 Elsevier B.V. All rights reserved.
Diepoxybutane Interstrand Cross-Links Induce DNA Bending
Millard, Julie T.; McGowan, Erin E.; Bradley, Sharonda Q.
2011-01-01
The bifunctional alkylating agent 1,2,3,4-diepoxybutane (DEB) is thought to be a major contributor to the carcinogenicity of 1,3-butadiene, from which it is derived in vivo. DEB forms DNA interstrand cross-links primarily between distal deoxyguanosine residues at the duplex sequence 5’-GNC. In order for the short butanediol tether to span this distance, distortion of the DNA target has been postulated. We determined that the electrophoretic mobility of ligated DNA oligomers containing DEB cross-links was retarded in comparison with control, uncross-linked DNA. Our data are consistent with DNA bending of ~34° per lesion towards the major groove. PMID:21839139
Control of electroosmosis in coated quartz capillaries
NASA Technical Reports Server (NTRS)
Herren, Blair J.; Van Alstine, James; Snyder, Robert S.; Shafer, Steven G.; Harris, J. Milton
1987-01-01
The effectiveness of various coatings for controlling the electroosmotic fluid flow that hinders electrophoretic processes is studied using analytical particle microelectrophoresis. The mobilities of 2-micron diameter glass and polystyrene latex spheres (exhibiting both negative and zero effective surface charge) were measured in 2-mm diameter quartz capillaries filled with NaCl solutions within the 3.5-7.8 pH range. It is found that capillary inner surface coatings using 5000 molecular weight (or higher) poly(ethylene glycol): significantly reduced electroosmosis within the selected pH range, were stable for long time periods, and appeared to be more effective than dextran, methylcellulose, or silane coatings.
Dual-opposite injection capillary electrophoresis: Principles and misconceptions.
Blackney, Donna M; Foley, Joe P
2017-03-01
Dual-opposite injection capillary electrophoresis (DOI-CE) is a separation technique that utilizes both ends of the capillary for sample introduction. The electroosmotic flow (EOF) is suppressed to allow all ions to reach the detector quickly. Depending on the individual electrophoretic mobilities of the analytes of interest and the effective length that each analyte travels to the detection window, the elution order of analytes in a DOI-CE separation can vary widely. This review discusses the principles, applications, and limitations of dual-opposite injection capillary electrophoresis. Common misconceptions regarding DOI-CE are clarified. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Wang, Hanyang; Slater, Gary; Haan, Hendrick
We examine the electrophoresis of spherical particles in microfluidic devices made of alternating wells and narrow channels a type of system previously used to separate DNA molecules. Using computer simulations, we first show why it should be possible to separate particles having the same free-solution mobility using these systems in DC fields. Interestingly, in some of the systems we studied, the mobility shows an inversion as the field intensity is increased: while small particles have higher mobilities at low fields, the situation is reversed at high fields with the larger particles then moving faster. The resulting nonlinearity allows us to use asymmetric AC electric fields to build a ratchet in which particles have a net size-dependent velocity in the presence of an unbiased (zero-mean) AC field. Exploiting the inversion mentioned above, we show how to build pulsed field sequences that make particles move against the net field (an example of negative mobility). Finally, we demonstrate that it is possible to use these pulsed fields to make particles of different sizes move in opposite directions even though their charge have the same sign. Potential uses of these idea are discussed. Gary is my supervisor in my Master program.
[Mechanisms for effect of osthole on inhibiting the growth and invasion of bladder cancer cells].
Liu, Jun; Xu, Ran; Zhao, Xiaokun
2016-04-01
To investigate the effect of osthole on epidermal growth factor receptor tyrosine kinase (EGFR-TPK), matrix-metalloproteinase-2 (MMP-2), aminopeptidase N (APN) in bladder cancer cell and the underlying mechanism. The T24 cell lines were cultured. The inhibitory effects of osthole on EGFR-TPK, APN and MMP-2 were evaluated by spectrophotometric and MTT assay. The caspase-3 activity and the expression COX-2 and VEGF in T24 were examined. The activity of NF-κB was determined by electrophoretic mobility shift assay. The half inhibition concentrations (IC50) of osthole on EGFR-TPK, APN and MMP-2 were (45.33±3.98), (28.21±3.23) and (8.11±0.54) µmol/L, respectively. The growth inhibitory rates for T24 cells were increased in a dose-dependent manner (P<0.05). The caspase-3 activities were significantly increased in T24 cells in the osthole group compared with control group, while the expression of angiogenesis related-protein COX-2, VEGF, and NF-κB in T24 cells were decreased. Through the inhibitory effect on EGFR-TPK, APN and MMP-2, osthole can decrease COX-2, VEGF and NF-κB expression while increase the activity of caspase-3, eventually blocking the growth and invasion of bladder cancer cell.
Oliveira, Ruth Medeiros; Câmara, Rafael Barros Gomes; Monte, Jessyka Fernanda Santiago; Viana, Rony Lucas Silva; Melo, Karoline Rachel Teodosio; Queiroz, Moacir Fernandes; Filgueira, Luciana Guimarães Alves; Oyama, Lila Missae; Rocha, Hugo Alexandre Oliveira
2018-06-04
Fucus vesiculosus is a brown seaweed used in the treatment of obesity. This seaweed synthesizes various bioactive molecules, one of them being a sulfated polysaccharide known as fucoidan (FF). This polymer can easily be found commercially, and has antiadipogenic and lipolytic activity. Using differential precipitation with acetone, we obtained four fucoidan-rich fractions (F0.5/F0.9/F1.1/F2.0) from FF. These fractions contain different proportions of fucose:glucuronic acid:galactose:xylose:sulfate, and also showed different electrophoretic mobility and antioxidant activity. Using 3T3-L1 adipocytes, we found that all samples had lipolytic action, especially F2.0, which tripled the amount of glycerol in the cellular medium. Moreover, we observed that FF, F1.0, and F2.0 have antiadipogenic activity, as they inhibited the oil red staining by cells at 40%, 40%, and 50%, respectively. In addition, they decreased the expression of key proteins of adipogenic differentiation (C/EBPα, C/EBPβ, and PPARγ). However, F0.5 and F0.9 stimulated the oil red staining at 80% and increased the expression of these proteins. Therefore, these fucoidan fractions have an adipogenic effect. Overall, the data show that F2.0 has great potential to be used as an agent against obesity as it displays better antioxidant, lipolytic and antiadipogenic activities than the other fucoidan fractions that we tested.
SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells.
Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A; Twiss, Jeffery L; Heise, Tilman
2016-01-01
The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5' untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5' UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality.
SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells
Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A.; Twiss, Jeffery L.
2016-01-01
The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5’ untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5’ UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality. PMID:27224031
STAT3-activated CD36 facilitates fatty acid uptake in chronic lymphocytic leukemia cells
Rozovski, Uri; Harris, David M.; Li, Ping; Liu, Zhiming; Jain, Preetesh; Ferrajoli, Alessandra; Burger, Jan; Thompson, Phillip; Jain, Nitin; Wierda, William; Keating, Michael J.; Estrov, Zeev
2018-01-01
Although several studies established that unlike normal B cells chronic lymphocytic leukemia (CLL) cells metabolize fatty acids (FA), how CLL cells internalize FA is poorly understood. Because in various cell types CD36 facilitates FA uptake, we wondered whether a similar mechanism is operative CLL. We found that CD36 levels are higher in CLL cells than in normal B cells, and that small interfering RNA, CD36 neutralizing antibodies or sulfosuccinimidyl oleate (SSO) that inhibits CD36 significantly reduced the oxygen consumption of CLL cells incubated with FA. Because CD36 is oeverexpressed and STAT3 is constitutively activated in CLL cells, we wondered whether STAT3 induces CD36 expression. Sequence analysis identified putative STAT3 binding sites in the CD36 gene promoter. Chromatin immunoprecipitation and an electrophoretic mobility shift assay revealed that STAT3 binds to the CD36 gene promoter. A luciferase assay and STAT3-small hairpin RNA, that significantly decreased the levels of CD36 in CLL cells, established that STAT3 activates the transcription of the CD36 gene. Furthermore, SSO induced a dose-dependent apoptosis of CLL cells. Taken together, our data suggest that STAT3 activates CD36 and that CD36 facilitates FA uptake in CLL cells. Whether CD36 inhibition would provide clinical benefits in CLL remains to be determined. PMID:29765537
Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.
2001-01-01
The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027
Huda, Kamrul A S M; Guo, Lei; Haga, Sanae; Murata, Hiroshi; Ogino, Tetsuya; Fukai, Moto; Yagi, Takahito; Iwagaki, Hiromi; Tanaka, Noriaki; Ozaki, Michitaka
2006-05-01
Signal transducer and activator of transcription-3 (STAT3) is one of the most important transcription factors for liver regeneration. This study was designed to examine the effects of constitutively activated STAT3 (STAT3-C) on post-transplant liver injury and regeneration in a rat 20% partial liver transplant (PLTx) model by ex vivo adenoviral gene transfer. Adenovirus encoding the STAT3-C gene was introduced intraportally into liver grafts and clamped for 30 min during cold preservation. After orthotopic PLTx, liver graft/body weights and serum biochemistry were monitored, and both a histological study and DNA binding assay were performed. STAT3-C protein expression and its binding to DNA in the liver graft were confirmed by Western blotting and electrophoretic mobility shift assay (EMSA), respectively. This treatment modality promoted post-Tx liver regeneration effectively and rapidly. The serum levels of alanine aminotransferase/aspartate aminotransferase (AST/ALT) and bilirubin decreased in rats with STAT3-C. However, albumin (a marker of liver function) did not. Ex vivo gene transfer of STAT3-C to liver grafts reduced post-Tx injury and promoted liver regeneration. Thus, the activation of STAT3 in the liver graft may be a potentially effective clinical strategy for improving the outcome of small-for-size liver transplantation.
Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M.; Chalfin, Elaine M.; Bepler, Gerold; Patrick, Steve M.
2016-01-01
ERCC1-XPF heterodimer is a 5′-3′ structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy. PMID:27650543
Watchorn, Tammy M; Dowidar, Nabil; Dejong, Cornelis H C; Waddell, Ian D; Garden, O James; Ross, James A
2005-10-01
A novel proteoglycan, proteolysis inducing factor (PIF), is capable of inducing muscle proteolysis during the process of cancer cachexia, and of inducing an acute phase response in human hepatocytes. We investigated whether PIF is able to activate pro-inflammatory pathways in human Kupffer cells, the resident macrophages of the liver, and in monocytes, resulting in the production of pro-inflammatory cytokines. Normal liver tissue was obtained from patients undergoing partial hepatectomy and Kupffer cells were isolated. Monocytes were isolated from peripheral blood. Following exposure to native PIF, pro-inflammatory cytokine production from Kupffer cells and monocytes was measured and the NF-kappaB and STAT3 transcriptional pathways were investigated using electrophoretic mobility shift assays. We demonstrate that PIF is able to activate the transcription factor NF-kappaB and NF-kappaB-inducible genes in human Kupffer cells, and in monocytes, resulting in the production of pro-inflammatory cytokines such as TNF-alpha, IL-8 and IL-6. PIF enhances the expression of the cell surface molecules LFA-1 and CD14 on macrophages. PIF also activates the transcription factor STAT3 in Kupffer cells. The pro-inflammatory effects of PIF, mediated via NF-kappaB and STAT3, are important in macrophage behaviour and may contribute to the inflammatory pro-cachectic process in the liver.
Size and DNA distributions of electrophoretically separated cultured human kidney cells
NASA Technical Reports Server (NTRS)
Kunze, M. E.; Plank, L. D.; Todd, P. W.
1985-01-01
Electrophoretic purification of purifying cultured cells according to function presumes that the size of cycle phase of a cell is not an overriding determinant of its electrophoretic velocity in an electrophoretic separator. The size distributions and DNA distributions of fractions of cells purified by density gradient electrophoresis were determined. No systematic dependence of electrophoretic migration upward in a density gradient column upon either size or DNA content were found. It was found that human leukemia cell populations, which are more uniform function and found in all phases of the cell cycle during exponential growth, separated on a vertical sensity gradient electrophoresis column according to their size, which is shown to be strictly cell cycle dependent.
Electrophoretic fractional elution apparatus employing a rotational seal fraction collector
NASA Technical Reports Server (NTRS)
Bier, M. (Inventor)
1977-01-01
Electrophoretic fractional elution apparatus which has a column with a rotating seal joint is described. A thin jet of eluting buffer is directed across the lumen of the electrophoretic column in a direction perpendicular to that of electrophoretic migration. Either the content of the column is rotated with respect to the stationary jet, or the jet is rotated with respect to the column. The system may employ electrophoresis either in free solution or in packed columns.
Gucciardo, Sébastian; Wisniewski, Jean-Pierre; Brewin, Nicholas J; Bornemann, Stephen
2007-01-01
The cDNAs encoding three germin-like proteins (PsGER1, PsGER2a, and PsGER2b) were isolated from Pisum sativum. The coding sequence of PsGER1 transiently expressed in tobacco leaves gave a protein with superoxide dismutase activity but no detectable oxalate oxidase activity according to in-gel activity stains. The transient expression of wheat germin gf-2.8 oxalate oxidase showed oxalate oxidase but no superoxide dismutase activity under the same conditions. The superoxide dismutase activity of PsGER1 was resistant to high temperature, denaturation by detergent, and high concentrations of hydrogen peroxide. In salt-stressed pea roots, a heat-resistant superoxide dismutase activity was observed with an electrophoretic mobility similar to that of the PsGER1 protein, but this activity was below the detection limit in non-stressed or H(2)O(2)-stressed pea roots. Oxalate oxidase activity was not detected in either pea roots or nodules. Following in situ hybridization in developing pea nodules, PsGER1 transcript was detected in expanding cells just proximal to the meristematic zone and also in the epidermis, but to a lesser extent. PsGER1 is the first known germin-like protein with superoxide dismutase activity to be associated with nodules. It shared protein sequence identity with the N-terminal sequence of a putative plant receptor for rhicadhesin, a bacterial attachment protein. However, its primary location in nodules suggests functional roles other than as a rhicadhesin receptor required for the first stage of bacterial attachment to root hairs.
NASA Astrophysics Data System (ADS)
Sun, Yi; Chian Kwok, Yien; Nguyen, Nam-Trung
2006-08-01
A new method for thermally bonding poly(methyl methacrylate) (PMMA) substrates has been demonstrated. PMMA substrates are first engraved by CO2-laser micromachining to form microchannels. Both channel width and depth can be adjusted by varying the laser power and scanning speed. Channel depths from 50 µm to 1500 µm and widths from 150 µm to 400 µm are attained. CO2 laser is also used for drilling and dicing of the PMMA parts. Considering the thermal properties of PMMA, a novel thermal bonding process with high temperature and low bonding pressure has been developed for assembling PMMA sheets. A high bonding strength of 2.15 MPa is achieved. Subsequent inspection of the cross sections of several microdevices reveals that the dimensions of the channels are well preserved during the bonding process. Electroosmotic mobility of the ablated channel is measured to be 2.47 × 10-4 cm2 V-1 s-1. The functionality of these thermally bonded microfluidic substrates is demonstrated by performing rapid and high-resolution electrophoretic separations of mixture of fluorescein and carboxyfluorescein as well as double-stranded DNA ladders (ΦX174-Hae III dsDNA digest). The performance of the CO2 laser ablated and thermally bonded PMMA devices compares favorably with those fabricated by other professional means.
Marín-Yaseli, Margarita R; Cid, Cristina; Yagüe, Ana I; Ruiz-Bermejo, Marta
2017-02-01
Elucidating the origin of life involves synthetic as well as analytical challenges. Herein, for the first time, we describe the use of gel electrophoresis and ultrafiltration to fractionate HCN polymers. Since the first prebiotic synthesis of adenine by Oró, HCN polymers have gained much interest in studies on the origins of life due to the identification of biomonomers and related compounds within them. Here, we demonstrate that macromolecular fractions with electrophoretic mobility can also be detected within HCN polymers. The migration of polymers under the influence of an electric field depends not only on their sizes (one-dimensional electrophoresis) but also their different isoelectric points (two-dimensional electrophoresis, 2-DE). The same behaviour was observed for several macromolecular fractions detected in HCN polymers. Macromolecular fractions with apparent molecular weights as high as 250 kDa were detected by tricine-SDS gel electrophoresis. Cationic macromolecular fractions with apparent molecular weights as high as 140 kDa were also detected by 2-DE. The HCN polymers synthesized were fractionated by ultrafiltration. As a result, the molecular weight distributions of the macromolecular fractions detected in the HCN polymers directly depended on the synthetic conditions used to produce these polymers. The implications of these results for prebiotic chemistry will be discussed. © 2017 Wiley-VHCA AG, Zurich, Switzerland.
Zhu, J K; Bressan, R A; Hasegawa, P M
1993-09-15
We demonstrate that ANJ1, a higher plant homolog of the bacterial molecular chaperone DnaJ, is a substrate in vitro for protein farnesyl- and geranylgeranyl-transferase activities present in cell extracts of the plant Atriplex nummularia and yeast Saccharomyces cerevisiae. Isoprenylation did not occur when cysteine was replaced by serine in the CAQQ motif at the carboxyl terminus of ANJ1, indicating that this sequence functions as a CaaX consensus sequence for polyisoprenylation (where C is cysteine, a is an aliphatic residue, and X is any amino acid residue). Substitution of leucine for the terminal glutamine did not result in the expected geranylgeranylation as occurs with mammalian proteins containing a carboxyl-terminal leucine. Unlike the wild-type ANJ1, neither of the proteins containing these amino acid substitutions could functionally complement the yeast temperature-sensitive mutant mas5. Farnesylation enhanced the association of ANJ1 with A. nummularia microsomal membranes. Electrophoretic mobility of ANJ1 from the plant indicated that the protein is isoprenylated in vivo.
Zhu, J K; Bressan, R A; Hasegawa, P M
1993-01-01
We demonstrate that ANJ1, a higher plant homolog of the bacterial molecular chaperone DnaJ, is a substrate in vitro for protein farnesyl- and geranylgeranyl-transferase activities present in cell extracts of the plant Atriplex nummularia and yeast Saccharomyces cerevisiae. Isoprenylation did not occur when cysteine was replaced by serine in the CAQQ motif at the carboxyl terminus of ANJ1, indicating that this sequence functions as a CaaX consensus sequence for polyisoprenylation (where C is cysteine, a is an aliphatic residue, and X is any amino acid residue). Substitution of leucine for the terminal glutamine did not result in the expected geranylgeranylation as occurs with mammalian proteins containing a carboxyl-terminal leucine. Unlike the wild-type ANJ1, neither of the proteins containing these amino acid substitutions could functionally complement the yeast temperature-sensitive mutant mas5. Farnesylation enhanced the association of ANJ1 with A. nummularia microsomal membranes. Electrophoretic mobility of ANJ1 from the plant indicated that the protein is isoprenylated in vivo. Images Fig. 1 Fig. 2 Fig. 3 Fig. 5 Fig. 6 Fig. 7 PMID:8378331
Bouarab, Lynda; Maherani, Behnoush; Kheirolomoom, Azadeh; Hasan, Mahmoud; Aliakbarian, Bahar; Linder, Michel; Arab-Tehrany, Elmira
2014-03-01
In this work, we studied the effect of nanoliposome composition based on phospholipids of docosahexaenoic acid (PL-DHA), salmon and soya lecithin, on physico-chemical characterization of vector. Cinnamic acid was encapsulated as a hydrophobic molecule in nanoliposomes made of three different lipid sources. The aim was to evaluate the influence of membrane lipid structure and composition on entrapment efficiency and membrane permeability of cinnamic acid. These properties are important for active molecule delivery. In addition, size, electrophoretic mobility, phase transition temperature, elasticity and membrane fluidity were measured before and after encapsulation. The results showed a correlation between the size of the nanoliposome and the entrapment. The entrapment efficiency of cinnamic acid was found to be the highest in liposomes prepared from salmon lecithin. The nanoliposomes composed of salmon lecithin presented higher capabilities as a carrier for cinnamic acid encapsulation. These vesicles also showed a high stability which in turn increases the membrane rigidity of nanoliposome as evaluated by their elastic properties, membrane fluidity and phase transition temperature. Copyright © 2013 Elsevier B.V. All rights reserved.
Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.
2014-01-01
The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281
NASA Technical Reports Server (NTRS)
Hymer, W. C.; Grindeland, R.; Hayes, C.; Lanham, J. W.; Cleveland, C.; Todd, P.; Morrison, Dennis R.
1988-01-01
The cell separation techniques of velocity sedimentation, flow cytometry and continuous flow electrophoresis were used to obtain enriched populations of growth hormone (GH) cells. The goal was to isolate a GH cell subpopulation which releases GH molecules which are very high in biological activity, it was important to use a method which was effective in processing large numbers of cells over a short time span. The techniques based on sedimentation are limited by cell density overlaps and streaming. While flow cytometry is useful in the analytical mode for objectively establishing cell purity, the numbers of cells which can be processed in the sort mode are so small as to make this approach ineffective in terms of the long term goals. It was shown that continuous flow electrophoresis systems (CFES) can separate GH cells from other cell types on the basis of differences in surface charge. The bioreactive producers appear to be more electrophoretically mobile than the low producers. Current ground based CFES efforts are hampered by cell clumping in low ionic strength buffers and poor cell recoveries from the CFES device.
Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng
2012-01-01
Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly. PMID:22138548
Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng
2012-04-01
Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly.
SDS-PAGE Electrophoretic Property of Human Chorionic Gonadotropin (hCG) and its β-subunit
2005-01-01
The microheterogeneity property of hCG with regards to its sialic acid contents resulted in variable mobility of the glycoprotein in SDS-PAGE. The intact hCG molecule is composed of two dissimilar subunits, namely α- and β-subunits. The identification of hCG bands in SDS-PAGE was accomplished by the immunoblotting experiment, whereby the antibody directed toward the specific region of β-subunit of hCG was used. The data shows that the different mobility of intact hCG was attributed to the different degree of desialylation of the glycoprotein. Nevertheless, unlike the intact hCG, the mobility of its β-subunit was not affected by its variety sialic acid content. This characteristic of β-hCG is beneficial when semi-quantification of total hCG is required. Quantification of hCG using the HPLC-reversed phase C18 analytical column is not possible as the glycoprotein was eluted in multiple fractions at different retention times. The identification of denatured hCG (HPLC eluted fractions) was carried out by immunoblotting experiment whilst immunoassay technique failed to detect its presence in any fraction. PMID:16094462
NASA Astrophysics Data System (ADS)
Zhang, Zhen; Qu, Yinying; Li, Xiaoshuang; Zhang, Sheng; Wei, Qingsong; Shi, Yusheng; Chen, Lili
2014-06-01
Electrophoretic deposition has been widely used for the fabrication of functional coatings onto metal implant. A characteristic feature of this process is that positively charged materials migrate toward the cathode and can deposit on it. In this study, silk fibroin was decorated with tetracycline in aqueous solution to impart positive charge, and then deposited on negatively titanium cathode under certain electric field. The characterization of the obtained coatings indicated that the intermolecular hydrogen bonds formed between the backbone of silk fibroin and tetracycline molecular. In vitro biological tests demonstrated that osteoblast-like cells achieved acceptable cell affinity on the tetracycline cross-linked silk fibroin coatings, although greater cell viability was seen on pure silk fibroin coatings. The cationic silk fibroin coatings showed remarkable antibacterial activity against gram-positive (Staphylococcus aureus) and gram-negative (Escherichia coli) bacteria. Therefore, we concluded that electrophoretic deposition was an effective and efficient technique to prepare cationic silk fibroin coatings on the titanium surface and that cationic silk fibroin coatings with acceptable biocompatibility and antibacterial property were promising candidates for further loading of functional agents.
Dynamic computer simulations of electrophoresis: three decades of active research.
Thormann, Wolfgang; Caslavska, Jitka; Breadmore, Michael C; Mosher, Richard A
2009-06-01
Dynamic models for electrophoresis are based upon model equations derived from the transport concepts in solution together with user-inputted conditions. They are able to predict theoretically the movement of ions and are as such the most versatile tool to explore the fundamentals of electrokinetic separations. Since its inception three decades ago, the state of dynamic computer simulation software and its use has progressed significantly and Electrophoresis played a pivotal role in that endeavor as a large proportion of the fundamental and application papers were published in this periodical. Software is available that simulates all basic electrophoretic systems, including moving boundary electrophoresis, zone electrophoresis, ITP, IEF and EKC, and their combinations under almost exactly the same conditions used in the laboratory. This has been employed to show the detailed mechanisms of many of the fundamental phenomena that occur in electrophoretic separations. Dynamic electrophoretic simulations are relevant for separations on any scale and instrumental format, including free-fluid preparative, gel, capillary and chip electrophoresis. This review includes a historical overview, a survey of current simulators, simulation examples and a discussion of the applications and achievements of dynamic simulation.
Arlian, L G; Vyszenski-Moher, D L; Merski, J A; Ritz, H L; Nusair, T L; Wilson, E R
1990-01-01
Alcalase and savinase, produced by Bacillus species, are proteolytic enzymes that are used in laundry products and are known to cause respiratory allergy. Antigenic and allergenic characteristics of alcalase and savinase and their potential cross-reactivity were evaluated using crossed immunoelectrophoresis and crossed radioimmunoelectrophoresis. Alcalase exhibited two distinct antigens; one electropositive and one electronegative. The electropositive antigen exhibited some retrograde anodic mobility when coupled with antiserum components. Savinase exhibited one electropositive and two electronegative antigens. The antigens of the two enzymes were clearly different from each other, the three savinase antigens exhibiting greater electrophoretic mobility than the two alcalase antigens. In crossed radioimmunoelectrophoresis studies, only the electropositive antigen of alcalase, its retrograde complex, and the electropositive antigen of savinase bound IgE from the sera of individuals who were skin test positive to one or both enzymes. No evidence of cross-reactivity was observed in heterologous and tandem crossed immunoelectrophoresis studies and heterologous microimmunodiffusion reactions.
A Sinusoidal Applied Electric Potential can Induce a Long-Range, Steady Electrophoretic Force
NASA Astrophysics Data System (ADS)
Amrei, Seyyed Hashemi; Ristenpart, William D.; Miller, Greg R.
2017-11-01
We use the standard electrokinetic model to numerically investigate the electric field in aqueous solutions between parallel electrodes under AC polarization. In contrast to prior work, we invoke no simplifying assumptions regarding the applied voltage, frequency, or mismatch in ionic mobilities. We find that the nonlinear electromigration terms significantly contribute to the overall shape of the electric potential vs. time, which at sufficiently high applied potentials develops multi-modal peaks. More surprisingly, we find that electrolytes with non-equal mobilities yield an electric field with non-zero time average at large distances from the electrodes. Our calculations indicate this long-range electric field suffices to levitate colloidal particles many microns away from the electrode against the gravitational field, in accord with experimental observations of such behavior (Woehl et al., PRX, 2015). Moreover, the results indicate that particles will aggregate laterally near electrodes in some electrolytes but separate in others, helping explain a longstanding but not well understood phenomenon.
Effect of Coexisting Ions on Adsorption of Arsenic by Metal Oxides
NASA Astrophysics Data System (ADS)
Meng, Xiaoguang; Shi, Qiantao; Christodoulatos, Christos
2017-04-01
Iron hydroxides and nano TiO2 are commonly used adsorbents for removal of arsenic in water. Iron hydroxides also play an important role in controlling the fate and transport of arsenic in groundwater. Co-existing anions, such as phosphate, silicate, and bicarbonate could significantly affect the adsorption capacity of the adsorbents for arsenate and arsenite and increase their mobility in groundwater aquifers. Arsenate and arsenite interactions at the solid-water interface were investigated using electrophoretic mobility (EM) measurements, Fourier transform infrared (FTIR) spectroscopy, and extended X-ray absorption fine structure (EXAFS) spectroscopy. Electrochemical scanning tunneling microscopy (ECSTM) and in-situ flow cell ATR-FTIR were applied to investigate the interactions between As(III), As(V) and carbonate in water and at the solid-water interface. The experimental results suggested that arsenate and arsenite formed inner-sphere complexes with the hydroxide groups on the adsorbents. Arsenite and carbonate could form ternary surface complexes with the hydroxyl groups on iron hydroxide.
Fractionation of mineral species by electrophoresis
NASA Technical Reports Server (NTRS)
Dunning, J. D.; Herren, B. J.; Tipps, R. W.; Snyder, R. S.
1982-01-01
The fractionation of fine-grained aggregates into their major components is a problem in many scientific areas including earth and planetary science. Electrophoresis, the transport of electrically charged particles, immersed in a suspension medium, by a direct current field (Bier, 1959), was employed in this study as a means of separating simulated lunar soil into its constituent minerals. In these tests, conducted in a static analytical cylindrical microelectrophoresis apparatus, samples of simulated lunar soil and samples of pure mineral constituents were placed in the chamber; the electrophoretic mobilities of the lunar soil and the individual mineral constituents were measured. In most of the suspension buffers employed separability was indicated, on the basis of differences in mobility, for all the constituent mineral species except ilmenite and pyroxene, which were not efficiently separable in any of the buffers. Although only a few suspension media were employed, the success of this initial study suggests that electrophoresis may be an important mineral fractionation option in fine-grained aggregate processing.
Design and preparation of beta-sheet forming repetitive and block-copolymerized polypeptides.
Higashiya, Seiichiro; Topilina, Natalya I; Ngo, Silvana C; Zagorevskii, Dmitri; Welch, John T
2007-05-01
The design and rapid construction of libraries of genes coding beta-sheet forming repetitive and block-copolymerized polypeptides bearing various C- and N-terminal sequences are described. The design was based on the assembly of DNA cassettes coding for the (GA)3GX amino acid sequence where the (GAGAGA) sequences would constitute the beta-strand units of a larger beta-sheet assembly. The edges of this beta-sheet would be functionalized by the turn-inducing amino acids (GX). The polypeptides were expressed in Escherichia coli using conventional vectors and were purified by Ni-nitriloacetic acid (NTA) chromatography. The correlation of polymer structure with molecular weight was investigated by gel electrophoresis and mass spectrometry. The monomer sequences and post-translational chemical modifications were found to influence the mobility of the polypeptides over the full range of polypeptide molecular weights while the electrophoretic mobility of lower molecular weight polypeptides was more susceptible to C- and N-termini polypeptide modifications.
Jastreboff, M; Kedzierska, B; Rode, W
1982-01-15
Ehrlich ascites carcinoma thymidylate synthetase was purified to electrophoretic homogeneity by affinity chromatography on 10-formyl-5,8-dideazofolate-ethyl-Sepharose. Electrophoretic analysis of the formation of the enzyme-5-fluorodeoxyuridylate-5,10-methylenetetrahydrofolate complexes showed the presence of two binding sites for 5-fluorodeoxyuridylate on the enzyme molecule. Molecular weight of the native enzyme was found to be 78,5000, whereas that of its monomer was 38, 500. The apparent Michaelis constants for dUMP and (+/-)-L-5,10-methylenetetrahydrofolate were 1.3 +/- 0.4 and 32.2 +/- 0.7 micrometers respectively. Phosphate acted as a weak inhibitor, competitive toward dUMP. The enzyme reaction exhibited a temperature-dependent change of activation energy, reflected in the binding affinity of dUMP, with a transitional temperature of 35.8 degrees. Both Mg2+ and MgATP2- were strong activators of the enzyme, MgATP2- being more effective.
Fas/Fas ligand regulation mediates cell death in human Ewing's sarcoma cells treated with melatonin
García-Santos, G; Martin, V; Rodríguez-Blanco, J; Herrera, F; Casado-Zapico, S; Sánchez-Sánchez, A M; Antolín, I; Rodríguez, C
2012-01-01
Background: Despite recent advances in cancer therapy, the 5-year survival rate for Ewing's sarcoma is still very low, and new therapeutic approaches are necessary. It was found previously that melatonin induces cell death in the Ewing's sarcoma cell line, SK-N-MC, by activating the extrinsic apoptotic pathway. Methods: Melatonin actions were analysed by metabolic viability/survival cell assays, flow cytometry, quantitative PCR for mRNA expression, western blot for protein activation/expression and electrophoretic mobility shift assay for transcription factor activation. Results: Melatonin increases the expression of Fas and its ligand Fas L, this increase being responsible for cell death induced by the indolamine. Melatonin also produces a transient increase in intracellular oxidants and activation of the redox-regulated transcription factor Nuclear factor-kappaB. Inhibition of such activation prevents cell death and Fas/Fas L upregulation. Cytotoxic effect and Fas/Fas L regulation occur in all Ewing's cell lines studied, and do not occur in the other tumour cell lines studied where melatonin does not induce cell death. Conclusion: Our data offers new insights in the study of alternative therapeutic strategies in the treatment of Ewing's sarcoma. Further attention deserves to be given to the differences in the cellular biology of sensitive tumours that could explain the cytotoxic effect of melatonin and the increase in the level of free radicals caused by this molecule, in particular cancer types. PMID:22382690
Zhang, Benping; Zhao, Jie; Li, Shanshan; Zeng, Linglan; Chen, Yan; Fang, Jun
2015-04-01
Mangiferin (2-C-β-d-gluco-pyranosyl-1,3,6,7-tetrahydroxyxanthone) is a well-known natural antioxidant distributed in various plants of the Anacardiaceae and Gentianaceae families. Mangiferin can inhibit carcinogen-induced lung or colon tumor formation in experimental animals. However, the molecular mechanisms of its chemopreventive activity remain unexplored. This study aimed to investigate the effects of mangiferin on chemical carcinogen-induced DNA damage and Nrf2-ARE signaling in hematopoietic cells. Mononuclear cells (MNCs) were isolated from human umbilical cord blood (hUCB). DNA damage was evaluated by comet and micronucleus assays. The expression of Nrf2 and NQO1 was examined by immunofluorescence and western blotting. An electrophoretic mobility shift assay (EMSA) was used to detect the binding activity of Nrf2 with NQO1-ARE sequences. We found that mangiferin treatment significantly reduced DNA damage in etoposide-treated MNCs, which was verified by decreased olive tail moment (OTM) and micronucleus (MN) frequency. Mangiferin treatment significantly promoted Nrf2 translocation into the nucleus and increased nuclear Nrf2 expression. Moreover, NQO1, an Nrf2 signaling target, was significantly upregulated by mangiferin treatment, and the binding activity of Nrf2 with NQO1-ARE sequences was elevated after mangiferin treatment. Mangiferin activated Nrf2 signaling, upregulated NQO1 expression, and significantly reduced etoposide-induced DNA damage. Thus, mangiferin is a potential cytoprotective agent for hematopoietic cells.
A Student-Made Microfluidic Device for Electrophoretic Separation of Food Dyes
ERIC Educational Resources Information Center
Teerasong, Saowapak; McClain, Robert L.
2011-01-01
We have developed an undergraduate laboratory activity to introduce students to microfluidics. In the activity, each student constructs their own microfluidic device using simple photolithographic techniques and then uses the device to separate a food dye mixture by electrophoresis. Dyes are used so that students are able to visually observe the…
Analysis of the regulation of viral transcription.
Gloss, Bernd; Kalantari, Mina; Bernard, Hans-Ulrich
2005-01-01
Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection ("footprinting") for location of transcription-factor binding sites, electrophoretic mobility shifts ("gelshifts") for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.
Modeling Electrokinetic Flows by the Smoothed Profile Method
Luo, Xian; Beskok, Ali; Karniadakis, George Em
2010-01-01
We propose an efficient modeling method for electrokinetic flows based on the Smoothed Profile Method (SPM) [1–4] and spectral element discretizations. The new method allows for arbitrary differences in the electrical conductivities between the charged surfaces and the the surrounding electrolyte solution. The electrokinetic forces are included into the flow equations so that the Poisson-Boltzmann and electric charge continuity equations are cast into forms suitable for SPM. The method is validated by benchmark problems of electroosmotic flow in straight channels and electrophoresis of charged cylinders. We also present simulation results of electrophoresis of charged microtubules, and show that the simulated electrophoretic mobility and anisotropy agree with the experimental values. PMID:20352076
Precursor–product relationship between intrahepatic albumin and plasma albumin
LeBouton, A. V.
1968-01-01
Rats were injected with [3H]leucine, and at various times thereafter labelled albumin was isolated by electrophoresis from their livers and blood plasma. The specific radioactivity of each protein was determined by spectrophotometry and liquid-scintillation spectrometry. Intrahepatic albumin was shown to be identical with plasma albumin by its electrophoretic mobility and antigenicity. It was found that intrahepatic albumin was the direct precursor of plasma albumin. Comparison of their specific radioactivities showed that intrahepatic albumin attained a higher specific radioactivity before plasma albumin. When plasma albumin reached its maximum specific radioactivity, that of intrahepatic albumin had decreased to a similar value. Thereafter, the specific radioactivity of intrahepatic albumin remained lower than that of plasma albumin. PMID:4966084
NASA Technical Reports Server (NTRS)
Todd, P. W.; Hjerten, S.
1985-01-01
Experiments were designed to replicate, as closely as possible in 1-G, the conditions of the STS-3 red blood cell (RBC) experiments. Free zone electrophoresis was the method of choice, since it minimizes the role of gravity in cell migration. The physical conditions of the STS-3 experiments were used, and human and rabbit RBC's fixed by the same method were the test particles. The effects of cell concentration, electroosmotic mobility, and sample composition were tested in order to seek explanations for the STS-3 results and to provide data on cell concentration effects for future zero-G separation on the continuous-flow zero-G electrophoretics separator.
Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R
2007-01-01
Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2-5_02 had a predominant participation driving 8 transcripts, which includes those involved in cancer (EYA1, Trail, HSF1, and ELK-1), smooth-to-skeletal muscle trans-differentiation, and Z01, a tight-junction protein, expression. Electrophoretic mobility shift assays confirmed that, in the mouse urinary bladder, activation of NK1R by substance P (SP) induces both NKx-2.5 and NF-kappaB translocations. Conclusion This is the first report describing a role for Nkx2.5 in the urinary tract. As Nkx2.5 is the unique discriminator of NK1R-modulated inflammation, it can be imagined that in the near future, new based therapies selective for controlling Nkx2.5 activity in the urinary tract may be used in the treatment in a number of bladder disorders. PMID:17519035
Electrophoretic separator for purifying biologicals, part 1
NASA Technical Reports Server (NTRS)
Mccreight, L. R.
1978-01-01
A program to develop an engineering model of an electrophoretic separator for purifying biologicals is summarized. An extensive mathematical modeling study and numerous ground based tests were included. Focus was placed on developing an actual electrophoretic separator of the continuous flow type, configured and suitable for flight testing as a space processing applications rocket payload.
Siednienko, Jakub; Nowak, Joanna; Moynagh, Paul N; Gorczyca, Wojciech A
2011-06-01
Interleukin 6 (IL-6) and nitric oxide (NO) are important mediators of the inflammatory response. We report that in human peripheral blood mononuclear cells (PBMCs), NO exerts a biphasic effect on the expression of IL-6. Using sodium nitroprusside (SNP) and S-nitrosoglutathione (GSNO) as NO-donating compounds, we observed that both mRNA and protein levels of IL-6 increased at lower (≤10μM) and decreased at higher (>100μM) concentrations of NO donors. Changes in the expression of IL-6 correlated with changes in the activity of NF-κB, which increased at lower and decreased at higher concentrations of both NO donors as shown by the electrophoretic mobility shift assay (EMSA). The effects of NO on NF-κB activity were cGMP-dependent because they were reversed in the presence of ODQ, the inhibitor of soluble guanylyl cyclase (sGC), and KT5823, the inhibitor of cGMP-dependent protein kinase (PKG). Moreover, the membrane permeable analog of cGMP (8-Br-cGMP) mimicked the effect of the NO donors. These observations show that NO, depending on its concentration, may act in human PBMCs as a stimulator of IL-6 expression involving the sGC/cGMP/PKG pathway. Copyright © 2011 Elsevier Ltd. All rights reserved.
Alfonso, Pilar; Pampín, Sandra; García-Rodríguez, Beatriz; Tejedor, Teresa; Domínguez, Carmen; Rodríguez-Rey, Jose C; Giraldo, Pilar; Pocoví, Miguel
2011-01-30
Gaucher disease (GD) is a rare autosomal recessive disorder caused mainly by mutations in the glucocerebrosidase (GBA) gene. Great phenotypic variability has been observed among patients with the same genotype, suggesting other factors, such as polymorphic variants, might influence GD phenotypes. We previously reported the c.(-203)A>G (g.1256A>G) variant in exon 1 of the GBA gene in Spanish GD patients. We analyzed the frequency and transcriptional activity of the promoter carrying the G-allele using restriction isotyping, electrophoretic mobility shift assay, cell culture, transfection, and luciferase assays. We found the variant is present at a similar frequency to the control group. In our patients, the G-allele was always found in combination with another mutation in the same allele, and patients carrying the c.(-203)A>G variant showed a more severe GD phenotype. The promoter containing the G-allele showed a 35% reduction in promoter activity when transfected into HepG2 cells. The c.(-203)A>G variant seems to be a polymorphism resulting in a decrease in activity of the GBA promoter. The change, per se, is not enough to elicit a GD phenotype, but it may produce a more severe phenotype in GD patients when combined with an already defective GBA protein. Copyright © 2010 Elsevier B.V. All rights reserved.
Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta
2008-01-01
Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455
Wang, Qinglian; Yang, Xiaowei; Xu, Ying; Shen, Zhenwei; Cheng, Hongxia; Cheng, Fajuan; Liu, Xiang; Wang, Rong
2018-01-01
Peritoneal fibrosis (PF) with associated peritoneal dysfunction is almost invariably observed in long-term peritoneal dialysis (PD) patients. Advanced glycation end products (AGEs) are pro-oxidant compounds produced in excess during the metabolism of glucose and are present in high levels in standard PD solutions. The GTPase RhoA has been implicated in PF, but its specific role remains poorly understood. Here, we studied the effects of RhoA/Rho-kinase signaling in AGEs-induced epithelial-mesenchymal transition (EMT) in human peritoneal mesothelial cells (HPMCs), and evaluated morphological and molecular changes in a rat model of PD-related PF. Activation of RhoA/Rho-kinase and activating protein-1 (AP-1) was assessed in HPMCs using pull-down and electrophoretic mobility shift assays, respectively, while expression of transforming growth factor-β, fibronectin, α-smooth muscle actin, vimentin, N-cadherin, and E-cadherin expression was assessed using immunohistochemistry and western blot. AGEs exposure activated Rho/Rho-kinase in HPMCs and upregulated EMT-related genes via AP-1. These changes were prevented by the Rho-kinase inhibitors fasudil and Y-27632, and by the AP-1 inhibitor curcumin. Importantly, fasudil normalized histopathological and molecular alterations and preserved peritoneal function in rats. These data support the therapeutic potential of Rho-kinase inhibitors in PD-related PF. PMID:29581852
Effect of extremely low frequency electromagnetic fields on bacterial membrane.
Oncul, Sule; Cuce, Esra M; Aksu, Burak; Inhan Garip, Ayse
2016-01-01
The effect of extremely low frequency electromagnetic fields (ELF-EMF) on bacteria has attracted attention due to its potential for beneficial uses. This research aimed to determine the effect of ELF-EMF on bacterial membrane namely the membrane potential, surface potential, hydrophobicity, respiratory activity and growth. Gram-positive Staphylococcus aureus and Gram-negative Escherichia coli were subjected to ELF-EMF, 50 Hz, 1 mT for 2 h. Membrane potential was determined by fluorescence spectroscopy with or without EDTA (Ethylenediaminetetraacetic acid) with DisC3(5) (3,3-dipropylthiacarbocyanine iodide), zeta potential measurements were performed by electrophoretic mobility, hydrophobicity of the membrane was measured with MATH (Microbial Adhesion to Hydrocarbons) test, respiratory activity was determined with CTC (5-Cyano-2,3-ditolyl tetrazolium chloride), colony forming unit (CFU) and DAPI (4',6-diamidino-2-phenylindole, dihydrochloride) was used for growth determinations. ELF-EMF caused changes in physicochemical properties of both Gram-positive and Gram-negative bacteria. Hyperpolarization was seen in S. aureus and EDTA-treated E. coli. Surface potential showed a positive shift in S. aureus contrariwise to the negative shift seen in EDTA-untreated E. coli. Respiratory activity increased in both bacteria. A slight decrease in growth was observed. These results show that ELF-EMF affects the crucial physicochemical processes in both Gram-positive and Gram-negative bacteria which need further research.
Hubmann, Rainer; Hilgarth, Martin; Schnabl, Susanne; Ponath, Elena; Reiter, Marlies; Demirtas, Dita; Sieghart, Wolfgang; Valent, Peter; Zielinski, Christoph; Jäger, Ulrich; Shehata, Medhat
2013-03-01
Chronic lymphocytic leukaemia (CLL) cells express constitutively activated NOTCH2 in a protein kinase C (PKC)- dependent manner. The transcriptional activity of NOTCH2 correlates not only with the expression of its target gene FCER2 (CD23) but is also functionally linked with CLL cell viability. In the majority of CLL cases, DNA-bound NOTCH2 complexes are less sensitive to the γ-secretase inhibitor (GSI) DAPT. Therefore, we searched for compounds that interfere with NOTCH2 signalling at the transcription factor level. Using electrophoretic mobility shift assays (EMSA), we identified the Aspergillum-derived secondary metabolite gliotoxin as a potent NOTCH2 transactivation inhibitor. Gliotoxin completely blocked the formation of DNA-bound NOTCH2 complexes in CLL cells independent of their sensitivity to DAPT. The inhibition of NOTCH2 signalling by gliotoxin was associated with down regulation of CD23 (FCER) expression and induction of apoptosis. Short time exposure of CLL cells indicated that the early apoptotic effect of gliotoxin is independent of proteasome regulated nuclear factor κB activity, and is associated with up regulation of NOTCH3 and NR4A1 expression. Gliotoxin could overcome the supportive effect of primary bone marrow stromal cells in an ex vivo CLL microenvironment model. In conclusion, we identified gliotoxin as a potent NOTCH2 inhibitor with a promising therapeutic potential in CLL. © 2012 Blackwell Publishing Ltd.
Gao, Shaopei; Fang, Jun; Xu, Fan; Wang, Wei
2016-01-01
Bioactive gibberellins (GAs) are key endogenous regulators of plant growth. Previous work identified ELONGATED UPPERMOST INTERNODE1 (EUI1) as a GA-deactivating enzyme that plays an important role in panicle exsertion from the flag leaf sheath in rice (Oryza sativa). However, the mechanism that regulates EUI1 activity during development is still largely unexplored. In this study, we identified the dominant panicle enclosure mutant regulator of eui1 (ree1-D), whose phenotype is caused by the activation of the homeodomain-leucine zipper transcription factor HOX12. Diminished HOX12 expression by RNA interference enhanced panicle exsertion, mimicking the eui1 phenotype. HOX12 knockdown plants contain higher levels of the major biologically active GAs (such as GA1 and GA4) than the wild type. The expression of EUI1 is elevated in the ree1-D mutant but reduced in HOX12 knockdown plants. Interestingly, both HOX12 and EUI1 are predominantly expressed in panicles, where GA4 is highly accumulated. Yeast one-hybrid, electrophoretic mobility shift assay, and chromatin immunoprecipitation analyses showed that HOX12 physically interacts with the EUI1 promoter both in vitro and in vivo. Furthermore, plants overexpressing HOX12 in the eui1 mutant background retained the elongated uppermost internode phenotype. These results indicate that HOX12 acts directly through EUI1 to regulate panicle exsertion in rice. PMID:26977084
Miwa, S; Fujii, H; Matsumoto, N; Nakatsuji, T; Oda, S; Asano, H; Asano, S
1978-01-01
A case of red cell adenosine deaminase (ADA) overproduction associated with hereditary hemolytic anemia is reported here. This appears to be the second report. Proband is a 38-year-old Japanese male who had hemoglobin, 15.8 g/100 ml; reticulocyte count, 4.5%; serum indirect bilirubin, 4.9 mg/100 ml; 51Cr-labeled red cell half-life, 12 days; red cells showed moderate stomatocytosis. His red cell ADA activity showed 40-fold increase while that of the mother showed 4-fold increase. The mother was hematologically normal. The father had a normal enzyme activity. The proband and the mother showed slightly high serum uric acid levels. The proband's red cell showed: ATP, 628 nmoles/ml (normal, 1,010--1,550); adenine nucleotide pool, 46% of the normal mean; 2,3-diphosphoglycerate content, 3,782 nmoles/ml (normal 4,170--5,300); increased oxygen affinity of hemoglobin, P50 of intact erythrocytes being 21.8 mmHg (normal, 24.1--26.1). Red cell glycolytic intermediates in the proband were low in general, and the rate of lactate production was low. Kinetic studies using crude hemolysate revealed a normal Km for adenosine, normal electrophoretic mobility but slightly abnormal pH curve and slightly low utilization of 2-deoxyadenosine. The ADA activity of lymphocytes was nearly normal.
Yaghi, Layale; Poras, Isabelle; Simoes, Renata T; Donadi, Eduardo A; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D; Moreau, Philippe
2016-09-27
HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2'deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at -966 bp in the 5'UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus.
Arabidopsis DREB2C modulates ABA biosynthesis during germination.
Je, Jihyun; Chen, Huan; Song, Chieun; Lim, Chae Oh
2014-09-12
Plant dehydration-responsive element binding factors (DREBs) are transcriptional regulators of the APETELA2/Ethylene Responsive element-binding Factor (AP2/ERF) family that control expression of abiotic stress-related genes. We show here that under conditions of mild heat stress, constitutive overexpression seeds of transgenic DREB2C overexpression Arabidopsis exhibit delayed germination and increased abscisic acid (ABA) content compared to untransformed wild-type (WT). Treatment with fluridone, an inhibitor of the ABA biosynthesis abrogated these effects. Expression of an ABA biosynthesis-related gene, 9-cis-epoxycarotenoid dioxygenase 9 (NCED9) was up-regulated in the DREB2C overexpression lines compared to WT. DREB2C was able to trans-activate expression of NCED9 in Arabidopsis leaf protoplasts in vitro. Direct and specific binding of DREB2C to a complete DRE on the NCED9 promoter was observed in electrophoretic mobility shift assays. Exogenous ABA treatment induced DREB2C expression in germinating seeds of WT. Vegetative growth of transgenic DREB2C overexpression lines was more strongly inhibited by exogenous ABA compared to WT. These results suggest that DREB2C is a stress- and ABA-inducible gene that acts as a positive regulator of ABA biosynthesis in germinating seeds through activating NCED9 expression. Copyright © 2014 Elsevier Inc. All rights reserved.
Lattka, E.; Eggers, S.; Moeller, G.; Heim, K.; Weber, M.; Mehta, D.; Prokisch, H.; Illig, T.; Adamski, J.
2010-01-01
Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs. PMID:19546342
Lattka, E; Eggers, S; Moeller, G; Heim, K; Weber, M; Mehta, D; Prokisch, H; Illig, T; Adamski, J
2010-01-01
Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs.
Saravanakumar, Kandasamy; Fan, Lili; Fu, Kehe; Yu, Chuanjin; Wang, Meng; Xia, Hai; Sun, Jianan; Li, Yaqian; Chen, Jie
2016-01-01
Trichoderma harzianum is well known to exhibit induced systemic resistance (ISR) to Curvularia leaf spot. We previously reported that a C6 zinc finger protein (Thc6) is responsible for a major contribution to the ISR to the leaf disease, but the types of effectors and the signals mediated by Thc6 from Trichoderma are unclear. In this work, we demonstrated that two hydrolases, Thph1 and Thph2, from T. harzianum were regulated by Thc6. Furthermore, an electrophoretic mobility shift assay (EMSA) study revealed that Thc6 regulated mRNA expression by binding to GGCTAA and GGCTAAA in the promoters of the Thph1 and Thph2 genes, respectively. Moreover, the Thph1 and Thph2 proteins triggered the transient production of reactive oxygen species (ROS) and elevated the free cytosolic calcium levels in maize leaf. Furthermore, the genes related to the jasmonate/ethylene signaling pathway were up-regulated in the wild-type maize strain. However, the ΔThph1- or ΔThph2-deletion mutants could not activate the immune defense-related genes in maize to protect against leaf disease. Therefore, we conclude that functional Thph1 and Thph2 may be required in T. harzianum to activate ISR in maize. PMID:27830829
1990-01-01
Lipopolysaccharide (LPS) potently stimulates human immunodeficiency virus type 1-long terminal repeat (HIV-1-LTR) CAT constructs transfected into monocyte/macrophage-like cell lines but not a T cell line. This effect appears to be mediated through the induction of nuclear factor kappa B (NF-kappa B). Electrophoretic mobility shift assays demonstrate that LPS induces a DNA binding activity indistinguishable from NF-kappa B in U937 and THP-1 cells. LPS is also shown to dramatically increase HIV-1 production from a chronically infected monocyte/macrophage-like cloned cell line, U1, which produces very low levels of HIV-1 at baseline. The stimulation of viral production from this cell line occurs only if these cells are treated with granulocyte/macrophage colony-stimulating factor (GM-CSF) before treatment with LPS. This stimulation of HIV-1 production is correlated with an increase in the level of HIV-1 RNA and and activation of NF- kappa B. LPS is not able to induce HIV-1 production in a cloned T cell line. The effect of LPS on HIV-1 replication occurs at picogram per milliliter concentrations and may be clinically significant in understanding the variability of the natural history of HIV-1 infection. PMID:2193097
Isolation and characterization of target sequences of the chicken CdxA homeobox gene.
Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A
1993-01-01
The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943
Glucose Regulates the Expression of the Apolipoprotein A5 Gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey
2008-04-07
The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter.more » We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.« less
Quantitative analysis of TALE-DNA interactions suggests polarity effects.
Meckler, Joshua F; Bhakta, Mital S; Kim, Moon-Soo; Ovadia, Robert; Habrian, Chris H; Zykovich, Artem; Yu, Abigail; Lockwood, Sarah H; Morbitzer, Robert; Elsäesser, Janett; Lahaye, Thomas; Segal, David J; Baldwin, Enoch P
2013-04-01
Transcription activator-like effectors (TALEs) have revolutionized the field of genome engineering. We present here a systematic assessment of TALE DNA recognition, using quantitative electrophoretic mobility shift assays and reporter gene activation assays. Within TALE proteins, tandem 34-amino acid repeats recognize one base pair each and direct sequence-specific DNA binding through repeat variable di-residues (RVDs). We found that RVD choice can affect affinity by four orders of magnitude, with the relative RVD contribution in the order NG > HD ≈ NN > NI > NK. The NN repeat preferred the base G over A, whereas the NK repeat bound G with 10(3)-fold lower affinity. We compared AvrBs3, a naturally occurring TALE that recognizes its target using some atypical RVD-base combinations, with a designed TALE that precisely matches 'standard' RVDs with the target bases. This comparison revealed unexpected differences in sensitivity to substitutions of the invariant 5'-T. Another surprising observation was that base mismatches at the 5' end of the target site had more disruptive effects on affinity than those at the 3' end, particularly in designed TALEs. These results provide evidence that TALE-DNA recognition exhibits a hitherto un-described polarity effect, in which the N-terminal repeats contribute more to affinity than C-terminal ones.
Lenfant, M; Millerioux, L; Blazsek, I; Duchange, N
1983-01-01
A spleen-derived immunosuppressive peptide (SDIP) has been purified to homogeneity. Its physicochemical properties (electrophoretic mobility, u.v. spectra, absence of dansyl derivative) and its enzymatic susceptibilities (proteolytic enzymes, RNase, and DNase) were similar to those of the thymic hormone 'FTS'. SDIP and FTS were eluted with identical retention times in high performance liquid chromatography analysis in three different systems. When tested in sheep cell rosettes, and in the FTS radioimmunoassay in J.F. Bach's laboratory, SDIP presented an activity similar to FTS. In order to compare the thymic hormone to SDIP the biological activity of FTS was determined in in vivo and in in vitro humoral immunity reactions to a T-dependent antigen. As SDIP, FTS inhibited in vivo and in vitro the 19S-bearing cell formation during the last step of the differentiation of the lymphocytes, in the same range of concentration. The two factors appeared to stimulate the incorporation of [3H]-thymidine into the DNA of short-term cultures of thymocytes. The similarity of biological properties of SDIP and FTS together with the similarity observed in the physico-chemical and biochemical properties led to the conclusion that bovine spleen contains a factor similar to FTS. PMID:6682089
Saravanakumar, Kandasamy; Fan, Lili; Fu, Kehe; Yu, Chuanjin; Wang, Meng; Xia, Hai; Sun, Jianan; Li, Yaqian; Chen, Jie
2016-11-10
Trichoderma harzianum is well known to exhibit induced systemic resistance (ISR) to Curvularia leaf spot. We previously reported that a C6 zinc finger protein (Thc6) is responsible for a major contribution to the ISR to the leaf disease, but the types of effectors and the signals mediated by Thc6 from Trichoderma are unclear. In this work, we demonstrated that two hydrolases, Thph1 and Thph2, from T. harzianum were regulated by Thc6. Furthermore, an electrophoretic mobility shift assay (EMSA) study revealed that Thc6 regulated mRNA expression by binding to GGCTAA and GGCTAAA in the promoters of the Thph1 and Thph2 genes, respectively. Moreover, the Thph1 and Thph2 proteins triggered the transient production of reactive oxygen species (ROS) and elevated the free cytosolic calcium levels in maize leaf. Furthermore, the genes related to the jasmonate/ethylene signaling pathway were up-regulated in the wild-type maize strain. However, the ΔThph1- or ΔThph2-deletion mutants could not activate the immune defense-related genes in maize to protect against leaf disease. Therefore, we conclude that functional Thph1 and Thph2 may be required in T. harzianum to activate ISR in maize.
Okino, Nozomu; Ito, Makoto
2016-01-01
Pseudomonas aeruginosa, an opportunistic, but serious multidrug-resistant pathogen, secretes a ceramidase capable of cleaving the N-acyl linkage of ceramide to generate fatty acids and sphingosine. We previously reported that the secretion of P. aeruginosa ceramidase was induced by host-derived sphingolipids, through which phospholipase C-induced hemolysis was significantly enhanced. We herein investigated the gene(s) regulating sphingolipid-induced ceramidase expression and identified SphR, which encodes a putative AraC family transcriptional regulator. Disruption of the sphR gene in P. aeruginosa markedly decreased the sphingomyelin-induced secretion of ceramidase, reduced hemolytic activity, and resulted in the loss of sphingomyelin-induced ceramidase expression. A microarray analysis confirmed that sphingomyelin significantly induced ceramidase expression in P. aeruginosa. Furthermore, an electrophoretic mobility shift assay revealed that SphR specifically bound free sphingoid bases such as sphingosine, dihydrosphingosine, and phytosphingosine, but not sphingomyelin or ceramide. A β-galactosidase-assisted promoter assay showed that sphingosine activated ceramidase expression through SphR at a concentration of 100 nM. Collectively, these results demonstrated that sphingosine induces the secretion of ceramidase by promoting the mRNA expression of ceramidase through SphR, thereby enhancing hemolytic phospholipase C-induced cytotoxicity. These results facilitate understanding of the physiological role of bacterial ceramidase in host cells. PMID:27941831
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Y.R.; Hartman, F.C.; Lu, T.Y.S.
The authors have achieved, to their knowledge, the first high-level heterologous expression of the gene encoding D-ribulose-5-phosphate 3-epimerase from any source, thereby permitting isolation and characterization of the epimerase as found in photosynthetic organisms. The extremely labile recombinant spinach (Spinacia oleracea L.) enzyme was stabilized by DL-{alpha}-glycerophosphate or ethanol and destabilized by D-ribulose-5-phosphate or 2-mercaptoethanol. Despite this lability, the unprecedentedly high specific activity of the purified material indicates that the structural integrity of the enzyme is maintained throughout isolation. Ethylenediaminetetraacetate and divalent metal cations did not affect epimerase activity, thereby excluding a requirement for the latter in catalysis. As deducedmore » from the sequence of the cloned spinach gene and the electrophoretic mobility under denaturing conditions of the purified recombinant enzyme, its 25-kD subunit size was about the same as that of the corresponding epimerases of yeast and mammals. However, in contrast to these other species, the recombinant spinach enzyme was octameric rather than dimeric, as assessed by gel filtration and polyacrylamide gel electrophoresis under nondenaturing conditions. Western-blot analyses with antibodies to the purified recombinant enzyme confirmed that the epimerase extracted from spinach leaves is also octameric.« less
Cell and Particle Interactions and Aggregation During Electrophoretic Motion
NASA Technical Reports Server (NTRS)
Davis, Robert H.
2000-01-01
The objectives of this research were (i) to perform experiments for observing and quantifying electrophoretic aggregation, (ii) to develop a theoretical description to appropriately analyze and compare with the experimental results, (iii) to study the combined effects of electrophoretic and gravitational aggregation of large particles, and the combined effects of electrophoretic and Brownian aggregation of small particles, and (iv) to perform a preliminary design of a potential future flight experiment involving electrophoretic aggregation. Electrophoresis refers to the motion of charged particles, droplets or molecules in response to an applied electric field. Electrophoresis is commonly used for analysis and separation of biological particles or molecules. When particles have different surface charge densities or potentials, they will migrate at different velocities in an electric field. This differential migration leads to the possibility that they will collide and aggregate, thereby preventing separation.
Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei
2006-01-01
A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592
NASA Astrophysics Data System (ADS)
Hong, S. H.; Kang, M. G.; Lim, J. H.; Hwang, S. W.
2008-07-01
An ensemble of electrophoretically captured gold nanoparticles is exploited to fingerprint their velocity distribution in solution. The electrophoretic capture is performed using a dc biased nanogap electrode, and panoramic scanning electron microscopic images are inspected to obtain the regional density of the captured gold nanoparticles. The regional density profile along the surface of the electrode is in a quantitative agreement with the calculated density of the captured nanoparticles. The calculated density is obtained by counting, in the Boltzmann distribution, the number of nanoparticles whose thermal velocity is smaller than the electrophoretic velocity.
Cell and Particle Interactions and Aggregation During Electrophoretic Motion
NASA Technical Reports Server (NTRS)
Wang, Hua; Zeng, Shulin; Loewenberg, Michael; Todd, Paul; Davis, Robert H.
1996-01-01
The stability and pairwise aggregation rates of small spherical particles under the collective effects of buoyancy-driven motion and electrophoretic migration are analyzed. The particles are assumed to be non-Brownian, with thin double-layers and different zeta potentials. The particle aggregation rates may be enhanced or reduced, respectively, by parallel and antiparallel alignments of the buoyancy-driven and electrophoretic velocities. For antiparallel alignments, with the buoyancy-driven relative velocity exceeding the electrophoretic relative velocity between two widely-separated particles, there is a 'collision-forbidden region' in parameter space due to hydrodynamic interactions; thus, the suspension becomes stable against aggregation.
Column-coupling strategies for multidimensional electrophoretic separation techniques.
Kler, Pablo A; Sydes, Daniel; Huhn, Carolin
2015-01-01
Multidimensional electrophoretic separations represent one of the most common strategies for dealing with the analysis of complex samples. In recent years we have been witnessing the explosive growth of separation techniques for the analysis of complex samples in applications ranging from life sciences to industry. In this sense, electrophoretic separations offer several strategic advantages such as excellent separation efficiency, different methods with a broad range of separation mechanisms, and low liquid consumption generating less waste effluents and lower costs per analysis, among others. Despite their impressive separation efficiency, multidimensional electrophoretic separations present some drawbacks that have delayed their extensive use: the volumes of the columns, and consequently of the injected sample, are significantly smaller compared to other analytical techniques, thus the coupling interfaces between two separations components must be very efficient in terms of providing geometrical precision with low dead volume. Likewise, very sensitive detection systems are required. Additionally, in electrophoretic separation techniques, the surface properties of the columns play a fundamental role for electroosmosis as well as the unwanted adsorption of proteins or other complex biomolecules. In this sense the requirements for an efficient coupling for electrophoretic separation techniques involve several aspects related to microfluidics and physicochemical interactions of the electrolyte solutions and the solid capillary walls. It is interesting to see how these multidimensional electrophoretic separation techniques have been used jointly with different detection techniques, for intermediate detection as well as for final identification and quantification, particularly important in the case of mass spectrometry. In this work we present a critical review about the different strategies for coupling two or more electrophoretic separation techniques and the different intermediate and final detection methods implemented for such separations.
Enhanced sludge dewatering by electrofiltration. A feasibility study.
Saveyn, H; Huybregts, L; Van der Meeren, P
2001-01-01
Sludge treatment is a major issue in today's waste water treatment. One of the problems encountered is the limiting dewaterability of mainly biological sludges, causing high final treatment costs for incineration or landfill. Although during recent years, improvements are realised in the field of dewatering, the actual dry solids content after dewatering remains at a maximum value of about 35%. In order to increase the dry solids content, the technique of electrofiltration was investigated. Electrofiltration is the combination of two known techniques, traditional pressure filtration and electroosmotic/electrophoretic dewatering. Pressure filtration is based on pressure as the driving force for dewatering a sludge. Limitations hereby lie in the clogging of the filter cloth due to the build-up of the filtercake. Electroosmotic/electrophoretic dewatering is based on an electric field to separate sludge colloid particles from the surrounding liquid by placing the sludge liquor between two oppositely charged electrodes. In this case, mobile sludge particles will move to one electrode due to their natural surface charge, and the liquid phase will be collected at the oppositely charged electrode. Combination of both techniques makes it possible to create a more homogeneous filter cake and prevent the filter from clogging, resulting in higher cake dry solids contents and shorter filtration cycles. To investigate the feasibility of this technique for the dewatering of activated sludge, a filter unit was developed for investigations on lab scale. Multiple dewatering tests were performed in which the electric parameters for electrofiltration were varied. It was derived from these experiments that very high filter cake dry solids contents (to more than 60%), and short filtration cycles were attainable by using a relatively small electric DC field. The power consumption was very low compared to the power needed to dewater sludge by thermal drying techniques. For this reason, this technique seems very promising for the dewatering of biological sludges.
ERIC Educational Resources Information Center
Britos, Leticia; Goyenola, Guillermo; Orono, Silvia Umpierrez
2004-01-01
An extremely simple, inexpensive, and safe method is presented, which emulates nucleic acids isolation and electrophoretic analysis as performed in a research environment, in the context of a secondary school hands-on activity. The protocol is amenable to an interdisciplinary approach, taking into consideration the electrical and chemical…
Native red electrophoresis--a new method suitable for separation of native proteins.
Dráb, Tomáš; Kračmerová, Jana; Tichá, Ivana; Hanzlíková, Eva; Tichá, Marie; Ryšlavá, Helena; Doubnerová, Veronika; Maňásková-Postlerová, Pavla; Liberda, Jiří
2011-12-01
A new type of native electrophoresis was developed to separate and characterize proteins. In this modification of the native blue electrophoresis, the dye Ponceau Red S is used instead of Coomassie Brilliant Blue to impose uniform negative charge on proteins to enable their electrophoretic separation according to their relative molecular masses. As Ponceau Red S binds less tightly to proteins, in comparison with Coomassie Blue, it can be easily removed after the electrophoretic separation and a further investigation of protein properties is made possible (e.g. an enzyme detection or electroblotting). The tested proteins also kept their native properties (enzyme activity or aggregation state). Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Orbe, Josune; Rodríguez, José A; Calvayrac, Olivier; Rodríguez-Calvo, Ricardo; Rodríguez, Cristina; Roncal, Carmen; Martínez de Lizarrondo, Sara; Barrenetxe, Jaione; Reverter, Juan C; Martínez-González, José; Páramo, José A
2009-12-01
Thrombin is a multifunctional serine protease that promotes vascular proinflammatory responses whose effect on endothelial MMP-10 expression has not previously been evaluated. Thrombin induced endothelial MMP-10 mRNA and protein levels, through a protease-activated receptor-1 (PAR-1)-dependent mechanism, in a dose- and time-dependent manner. This effect was mimicked by a PAR-1 agonist peptide (TRAP-1) and antagonized by an anti-PAR-1 blocking antibody. MMP-10 induction was dependent on extracellular regulated kinase1/2 (ERK1/2) and c-jun N-terminal kinase (JNK) pathways. By serial deletion analysis, site-directed mutagenesis and electrophoretic mobility shift assay an AP-1 site in the proximal region of MMP-10 promoter was found to be critical for thrombin-induced MMP-10 transcriptional activity. Thrombin and TRAP-1 upregulated MMP-10 in murine endothelial cells in culture and in vivo in mouse aorta. This effect of thrombin was not observed in PAR-1-deficient mice. Interestingly, circulating MMP-10 levels (P<0.01) were augmented in patients with endothelial activation associated with high (disseminated intravascular coagulation) and moderate (previous acute myocardial infarction) systemic thrombin generation. Thrombin induces MMP-10 through a PAR-1-dependent mechanism mediated by ERK1/2, JNK, and AP-1 activation. Endothelial MMP-10 upregulation could be regarded as a new proinflammatory effect of thrombin whose pathological consequences in thrombin-related disorders and plaque stability deserve further investigation.
Ngaotepprutaram, Thitirat; Kaplan, Barbara L F; Kaminski, Norbert E
2013-11-15
We have previously reported that Δ(9)-tetrahydrocannabinol (Δ(9)-THC), the main psychoactive cannabinoid in marijuana, suppresses CD40 ligand (CD40L) expression by activated mouse CD4(+) T cells. CD40L is involved in pathogenesis of many autoimmune and inflammatory diseases. In the present study, we investigated the molecular mechanism of Δ(9)-THC-mediated suppression of CD40L expression using peripheral blood human T cells. Pretreatment with Δ(9)-THC attenuated CD40L expression in human CD4(+) T cells activated by anti-CD3/CD28 at both the protein and mRNA level, as determined by flow cytometry and quantitative real-time PCR, respectively. Electrophoretic mobility shift assays revealed that Δ(9)-THC suppressed the DNA-binding activity of both NFAT and NFκB to their respective response elements within the CD40L promoter. An assessment of the effect of Δ(9)-THC on proximal T cell-receptor (TCR) signaling induced by anti-CD3/CD28 showed significant impairment in the rise of intracellular calcium, but no significant effect on the phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β. Collectively, these findings identify perturbation of the calcium-NFAT and NFκB signaling cascade as a key mechanistic event by which Δ(9)-THC suppresses human T cell function. © 2013.
NASA Astrophysics Data System (ADS)
Hasan, Md. Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan
2016-01-01
Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2 = 3-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2 = 4-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy = 2,2‧-bipyridine, Phen = 1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, 1H NMR, 13C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH ∼ 7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4 > 3 > 1 > 2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4‧,6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87 μM respectively.
Kizis, Dimosthenis; Pagès, Montserrat
2002-06-01
The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.
Rochette, Christophe N; Crassous, Jérôme J; Drechsler, Markus; Gaboriaud, Fabien; Eloy, Marie; de Gaudemaris, Benoît; Duval, Jérôme F L
2013-11-26
The interfacial structure of natural rubber (NR) colloids is investigated by means of cryogenic transmission electron microscopy (cryo-TEM) and electrokinetics over a broad range of KNO3 electrolyte concentrations (4-300 mM) and pH values (1-8). The asymptotic plateau value reached by NR electrophoretic mobility (μ) in the thin double layer limit supports the presence of a soft (ion- and water-permeable) polyelectrolytic type of layer located at the periphery of the NR particles. This property is confirmed by the analysis of the electron density profile obtained from cryo-TEM that evidences a ∼2-4 nm thick corona surrounding the NR polyisoprene core. The dependence of μ on pH and salt concentration is further marked by a dramatic decrease of the point of zero electrophoretic mobility (PZM) from 3.6 to 0.8 with increasing electrolyte concentration in the range 4-300 mM. Using a recent theory for electrohydrodynamics of soft multilayered particles, this "anomalous" dependence of the PZM on electrolyte concentration is shown to be consistent with a radial organization of anionic and cationic groups across the peripheral NR structure. The NR electrokinetic response in the pH range 1-8 is indeed found to be equivalent to that of particles surrounded by a positively charged ∼3.5 nm thick layer (mean dissociation pK ∼ 4.2) supporting a thin and negatively charged outermost layer (0.6 nm in thickness, pK ∼ 0.7). Altogether, the strong dependence of the PZM on electrolyte concentration suggests that the electrostatic properties of the outer peripheral region of the NR shell are mediated by lipidic residues protruding from a shell containing a significant amount of protein-like charges. This proposed NR shell interfacial structure questions previously reported NR representations according to which the shell consists of either a fully mixed lipid-protein layer, or a layer of phospholipids residing exclusively beneath an outer proteic film.
Rim, Jong S; Kozak, Leslie P
2002-09-13
Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.
Human fibrinogen adsorption on positively charged latex particles.
Zeliszewska, Paulina; Bratek-Skicki, Anna; Adamczyk, Zbigniew; Cieśla, Michał
2014-09-23
Fibrinogen (Fb) adsorption on positively charged latex particles (average diameter of 800 nm) was studied using the microelectrophoretic and the concentration depletion methods based on AFM imaging. Monolayers on latex were adsorbed from diluted bulk solutions at pH 7.4 and an ionic strength in the range of 10(-3) to 0.15 M where fibrinogen molecules exhibited an average negative charge. The electrophoretic mobility of the latex after controlled fibrinogen adsorption was systematically measured. A monotonic decrease in the electrophoretic mobility of fibrinogen-covered latex was observed for all ionic strengths. The results of these experiments were interpreted according to the three-dimensional electrokinetic model. It was also determined using the concentration depletion method that fibrinogen adsorption was irreversible and the maximum coverage was equal to 0.6 mg m(-2) for ionic strength 10(-3) M and 1.3 mg m(-2) for ionic strength 0.15 M. The increase of the maximum coverage was confirmed by theoretical modeling based on the random sequential adsorption approach. Paradoxically, the maximum coverage of fibrinogen on positively charged latex particles was more than two times lower than the maximum coverage obtained for negative latex particles (3.2 mg m(-2)) at pH 7.4 and ionic strength of 0.15 M. This was interpreted as a result of the side-on adsorption of fibrinogen molecules with their negatively charged core attached to the positively charged latex surface. The stability and acid base properties of fibrinogen monolayers on latex were also determined in pH cycling experiments where it was observed that there were no irreversible conformational changes in the fibrinogen monolayers. Additionally, the zeta potential of monolayers was more positive than the zeta potential of fibrinogen in the bulk, which proves a heterogeneous charge distribution. These experimental data reveal a new, side-on adsorption mechanism of fibrinogen on positively charged surfaces and confirmed the decisive role of electrostatic interactions in this process.
Aboobakar, Eanas F.; Wang, Xuying; Heitman, Joseph; Kozubowski, Lukasz
2011-01-01
Calcineurin is a conserved calcium/calmodulin-dependent serine/threonine-specific protein phosphatase that acts in cell stress responses. Calcineurin is essential for growth at 37°C and for virulence of the human fungal pathogen Cryptococcus neoformans, but its substrates remain unknown. The C2 domain-containing, phospholipid-binding protein Cts1 was previously identified as a multicopy suppressor of a calcineurin mutation in C. neoformans. Here we further characterize the function of Cts1 and the links between Cts1 and calcineurin. GFP-Cts1 localizes to cytoplasmic puncta and colocalizes with the endosomal marker FM4-64. The cts1Δ mutant shows a distinct FM4-64 staining pattern, suggesting involvement of Cts1 in endocytic trafficking. In large budded cells, GFP-Cts1 localizes transiently at the mother bud neck, as a single ring that undergoes contraction. mCherry-Cts1 colocalizes with the GFP-tagged calcineurin catalytic subunit Cna1 at sites of mRNA processing at 37°C, suggesting that Cts1 and calcineurin function coordinately during thermal stress. GFP-Cts1 exhibits slower electrophoretic mobility for cells grown at 37°C than for cells grown at 24°C, and the shift to a higher molecular weight is more pronounced in the presence of the calcineurin inhibitor FK506. In vitro treatment with calf intestinal alkaline phosphatase (CIP) restores faster electrophoretic mobility to GFP-Cts1, suggesting that Cts1 is phosphorylated at 37°C and may be dephosphorylated in a calcineurin-dependent manner. mCherry-Cts1 also coimmunoprecipitates with GFP-Cna1, with greater complex formation at 37°C than at 24°C. Taken together, these findings support potential roles for Cts1 in endocytic trafficking, mRNA processing, and cytokinesis and suggest that Cts1 is a substrate of calcineurin during high-temperature stress responses. PMID:22002655
Heinrich, Hannah T M; Bremer, Phil J; Daughney, Christopher J; McQuillan, A James
2007-02-27
Acid-base functional groups at the surface of Anoxybacillus flavithermus (AF) were assigned from the modeling of batch titration data of bacterial suspensions and compared with those determined from in situ infrared spectroscopic titration analysis. The computer program FITMOD was used to generate a two-site Donnan model (site 1: pKa = 3.26, wet concn = 2.46 x 10(-4) mol g(-1); site 2: pKa = 6.12, wet concn = 6.55 x 10(-5) mol g(-1)), which was able to describe data for whole exponential phase cells from both batch acid-base titrations at 0.01 M ionic strength and electrophoretic mobility measurements over a range of different pH values and ionic strengths. In agreement with information on the composition of bacterial cell walls and a considerable body of modeling literature, site 1 of the model was assigned to carboxyl groups, and site 2 was assigned to amino groups. pH difference IR spectra acquired by in situ attenuated total reflection infrared (ATR-IR) spectroscopy confirmed the presence of carboxyl groups. The spectra appear to show a carboxyl pKa in the 3.3-4.0 range. Further peaks were assigned to phosphodiester groups, which deprotonated at slightly lower pH. The presence of amino groups could not be confirmed or discounted by IR spectroscopy, but a positively charged group corresponding to site 2 was implicated by electrophoretic mobility data. Carboxyl group speciation over a pH range of 2.3-10.3 at two different ionic strengths was further compared to modeling predictions. While model predictions were strongly influenced by the ionic strength change, pH difference IR data showed no significant change. This meant that modeling predictions agreed reasonably well with the IR data for 0.5 M ionic strength but not for 0.01 M ionic strength.
ERIC Educational Resources Information Center
Xu, Chunxiu; Lin, Wanqi; Cai, Longfei
2016-01-01
A demonstration is described of electrophoretic separation of carmine and sunset yellow with a paper-based device. The channel in the paper device was fabricated by hand with a wax pen. Electrophoretic separation of carmine and sunset yellow was achieved within a few minutes by applying potential on the channel using a simple and inexpensive power…
Choi, Hee-Jung; Chung, Tae-Wook; Kim, Jai-Eun; Jeong, Han-Sol; Joo, Myungsoo; Cha, Jaeho; Kim, Cheorl-Ho; Ha, Ki-Tae
2012-11-01
Expression of matrix metalloproteinase 9 (MMP-9) may contribute to inflammatory conditions such as arthritis, hepatitis, atherosclerosis, and pulmonary fibrosis, which involves the destruction of the extracellular matrix (ECM). Macrophages stimulated with lipopolysaccharide (LPS) express MMP-9 through the nuclear factor-kappa B (NF-κB) and activator protein 1 (AP-1) signaling pathways. Aesculin, a 6,7-dihydroxycoumarin-6-O-beta-glucopyranoside, has been highlighted for its anti-hepatotoxic, hypouricemic, antioxidative, photo-protective, and anti-apoptotic properties. In this study, we investigated the effects of aesculin on LPS-stimulated MMP-9 production and its regulatory mechanism by using murine macrophage RAW264.7 cells. Aesculin did not trigger any significant cytotoxic effect on RAW264.7 cells at concentration up to 150 μM. Secretion and expression levels of MMP-9, which were highly elevated by LPS treatment, were reduced by the addition of aesculin in a dose-dependent manner. However, gelatinolytic activity of MMP-9 was not reduced by aesculin. Luciferase activity assays and electrophoretic mobility shift assays using RAW264.7 cells showed that the inhibition of MMP-9 expression by aesculin was mediated by AP-1 rather than NF-κB. In addition, aesculin inhibited phosphorylation of p38 MAPK and subsequent activation of c-fos, a component of AP-1 transcription factor, but not JNK, ERK1/2, and c-jun. These findings suggest that aesculin is a potent drug candidate that protects against the inflammatory destruction of ECM. Copyright © 2012 Elsevier B.V. All rights reserved.
Lee, Ka-Heng; Abas, Faridah; Mohamed Alitheen, Noorjahan Banu; Shaari, Khozirah; Lajis, Nordin Haji; Israf, Daud Ahmad; Syahida, Ahmad
2015-07-01
Synovial fibroblast has emerged as a potential cellular target in progressive joint destruction in rheumatoid arthritis development. In this study, BDMC33 (2,6-bis[2,5-dimethoxybenzylidene]cyclohexanone), a curcumin analogue with enhanced anti-inflammatory activity has been synthesized and the potency of BDMC33 on molecular and cellular basis of synovial fibroblasts (SF) were evaluated in vitro. Synovial fibroblast cells (HIG-82) were cultured in vitro and induced by phorbol-12-myristate acetate (PMA) to stimulate the expression of matrix metalloproteinase (MMPs) and pro-inflammatory cytokines. The protective effects of BDMC33 were evaluated toward MMP activities, pro-inflammatory cytokine expression and nuclear factor kappa-B (NF-κB) activation by using various bioassay methods, including zymography, Western blotting, reverse transcription polymerase chain reaction, immunofluorescense microscopy and electrophoretic mobility shift assay. The results showed that BDMC33 significantly inhibited the pro-gelatinase B (pro-MMP-9) and collagenase activities via suppression of MMP-1 in activated SF. In addition, BDMC33 strongly suppressed MMP-3 gene expression as well as inhibited COX-2 and IL-6 pro-inflammatory gene expression. We also demonstrated that BDMC33 abolished the p65 NF-κB nuclear translocation and NF-κB DNA binding activity in PMA-stimulated SF. BDMC33 represents an effective chemopreventive agent and could be used as a promising lead compound for further development of rheumatoid arthritis therapeutic intervention. © 2014 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.
Park, SE; Sapkota, K; Kim, S; Kim, H; Kim, SJ
2011-01-01
BACKGROUND AND PURPOSE Kaempferol, a dietary flavonoid and phyto-oestrogen, is known to have anti-inflammatory properties. Microglial activation has been implicated in various neurodegenerative diseases. Anti-inflammatory effects of kaempferol and the underlying mechanisms were investigated by using LPS-stimulated microglial BV2 cells. EXPERIMENTAL APPROACH Cell viability was measured using MTT and neutral red assays. elisa, Western blot, immunocytochemistry and electrophoretic mobility-shift assay were used to analyse NO, PGE2, TNF-α and IL-1β production, inducible NOS (iNOS), COX-2 expression and the involvement of signalling pathways such as toll-like receptor-4 (TLR4), MAPK cascades, PKB (AKT) and NF-κB. Accumulation of reaction oxygen species (ROS) was measured by nitroblue tetrazolium and 2′7′-dichlorofluorescein diacetate assay. Matrix metalloproteinase activity was investigated by zymography and immunoblot assay. Phagocytotic activity was assessed by use of latex beads. KEY RESULTS Kaempferol significantly attenuated LPS-induced NO, PGE2, TNF-α, IL-1β and ROS production and phagocytosis in a concentration-dependent manner. Kaempferol suppressed the expression of iNOS, COX-2, MMP-3 and blocked the TLR4 activation. Moreover, kaempferol inhibited LPS-induced NF-κB activation and p38 MAPK, JNK and AKT phosphorylation. CONCLUSION AND IMPLICATIONS Kaempferol was able to reduce LPS-induced inflammatory mediators through the down-regulation of TLR4, NF-κB, p38 MAPK, JNK and AKT suggesting that kaempferol has therapeutic potential for the treatment of neuroinflammatory diseases. PMID:21449918
Mua (HP0868) Is a Nickel-Binding Protein That Modulates Urease Activity in Helicobacter pylori
Benoit, Stéphane L.; Maier, Robert J.
2011-01-01
A novel mechanism aimed at controlling urease expression in Helicobacter pylori in the presence of ample nickel is described. Higher urease activities were observed in an hp0868 mutant (than in the wild type) in cells supplemented with nickel, suggesting that the HP0868 protein (herein named Mua for modulator of urease activity) represses urease activity when nickel concentrations are ample. The increase in urease activity in the Δmua mutant was linked to an increase in urease transcription and synthesis, as shown by quantitative real-time PCR, SDS-PAGE, and immunoblotting against UreAB. Increased urease synthesis was also detected in a Δmua ΔnikR double mutant strain. The Δmua mutant was more sensitive to nickel toxicity but more resistant to acid challenge than was the wild-type strain. Pure Mua protein binds 2 moles of Ni2+ per mole of dimer. Electrophoretic mobility shift assays did not reveal any binding of Mua to the ureA promoter or other selected promoters (nikR, arsRS, 5′ ureB-sRNAp). Previous yeast two-hybrid studies indicated that Mua and RpoD may interact; however, only a weak interaction was detected via cross-linking with pure components and this could not be verified by another approach. There was no significant difference in the intracellular nickel level between wild-type and mua mutant cells. Taken together, our results suggest the HP0868 gene product represses urease transcription when nickel levels are high through an as-yet-uncharacterized mechanism, thus counterbalancing the well-described NikR-mediated activation. PMID:21505055
Chen, Shih-Chung; Chang, Ying-Ling; Wang, Danny Ling; Cheng, Jing-Jy
2006-01-01
Magnolol (Mag), an active constituent isolated from the Chinese herb Hou p'u (Magnolia officinalis) has long been used to suppress inflammatory processes. Chronic inflammation is well known to be involved in vascular injuries such as atherosclerosis in which interleukin (IL)-6 may participate. Signal transducer and activator of transcription protein 3 (STAT3), a transcription factor involved in inflammation and the cell cycle, is activated by IL-6. In this study, we evaluated whether Mag can serve as an anti-inflammatory agent during endothelial injuries. The effects of Mag on IL-6-induced STAT3 activation and downstream target gene induction in endothelial cells (ECs) were examined. Pretreatment of ECs with Mag dose dependently inhibited IL-6-induced Tyr705 and Ser727 phosphorylation in STAT3 without affecting the phosphorylation of JAK1, JAK2, and ERK1/2. Mag pretreatment of these ECs dose dependently suppressed IL-6-induced promoter activity of intracellular cell adhesion molecule (ICAM)-1 that contains functional IL-6 response elements (IREs). An electrophoretic mobility shift assay (EMSA) revealed that Mag treatment significantly reduced STAT3 binding to the IRE region. Consistently, Mag treatment markedly inhibited ICAM-1 expression on the endothelial surface. As a result, reduced monocyte adhesion to IL-6-activated ECs was observed. Furthermore, Mag suppressed IL-6-induced promoter activity of cyclin D1 and monocyte chemotactic protein (MCP)-1 for which STAT3 activation plays a role. In conclusion, our results indicate that Mag inhibits IL-6-induced STAT3 activation and subsequently results in the suppression of downstream target gene expression in ECs. These results provide a therapeutic basis for the development of Mag as an anti-inflammatory agent for vascular disorders including atherosclerosis. PMID:16520748
Xing, Feiyue; Liu, Jing; Mo, Yongyan; Liu, Zhifeng; Qin, Qinghe; Wang, Jingzhen; Fan, Zhenhua; Long, Yutian; Liu, Na; Zhao, Kesen; Jiang, Yong
2009-01-01
Human endothelial nitric oxide synthase (eNOS) plays a pivotal role in maintaining blood pressure homeostasis and vascular integrity. It has recently been reported that mitogen-activated protein kinases (MAPKs) are intimately implicated in expression of eNOS. However detailed mechanism mediated by them remains to be clarified. In this study, eNOS gene transactivity in human umbilical vein endothelial cells was up-regulated by stimulation of lysophosphatidylcholine (LPC). The stimulation of LPC highly activated both extracellular signal-regulated kinase 1/2 (ERK1/2) and c-Jun N-terminal kinase (JNK), with differences in the dynamic processes of activation between them. Unexpectedly, p38 MAPK could not be activated by the stimulation of LPC. The activation of JNK signalling pathway by overexpression of JNK or its upstream kinase active mutant up-regulated the transactivity of eNOS significantly, but the activation of p38 signalling pathway down-regulated it largely. The inhibition of either ERK1/2 or JNK signalling pathway by kinase-selective inhibitors could markedly block the induction of the transactivity by LPC. It was observed by electrophoretic mobility shift assay that LPC stimulated both SP1 and AP1 DNA binding activity to go up. Additionally using decoy oligonucleotides proved that SP1 was necessary for maintaining the basal or stimulated transactivity, whereas AP1 contributed mainly to the increase of the stimulated transactivity. These findings indicate that the up-regulation of the eNOS gene transactivity by LPC involves the enhancement of SP1 transcription factor by the activation of JNK and ERK1/2 signalling pathways and AP1 transcription factor by the activation of JNK signalling pathway. PMID:18624763
Song, Tian-Shun; Peng-Xiao; Wu, Xia-Yuan; Zhou, Charles C
2013-07-01
Sediment microbial fuel cells (SMFCs) could be used as power sources and one type of new technology for the removal of organic matters in sediments. In order to improve electrode materials and enhance their effect on the performance, we deposited multi-walled carbon nanotube (MWNT) on stainless steel net (SSN). Electrophoretic deposition technique as a method with low cost, process simplicity, and thickness control was used for this electrode modification and produced this novel SSN-MWNT electrode. The performances of SMFCs with SSN-MWNT as electrode were investigated. The results showed that the maximum power density of SMFC with SSN-MWNT cathode was 31.6 mW m(-2), which was 3.2 times that of SMFC with an uncoated stainless steel cathode. However, no significant increase in the maximum power density of SMFC with SSN-MWNT anode was detected. Further electrochemical analysis showed that when SSN-MWNT was used as the cathode, the cathodic electrochemical activity and oxygen reduction rate were significantly improved. This study demonstrates that the electrophoretic deposition of carbon nanotubes on conductive substrate can be applied for improving the performance of SMFC.