AAVPG: A vigilant vector where transgene expression is induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

2013-12-15

Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

PubMed Central

Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

2016-01-01

p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

Changes in O-Linked N-Acetylglucosamine (O-GlcNAc) Homeostasis Activate the p53 Pathway in Ovarian Cancer Cells*

PubMed Central

de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad

2016-01-01

O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830

Modulation of oxidative stress and subsequent induction of apoptosis and endoplasmic reticulum stress allows citral to decrease cancer cell proliferation.

PubMed

Kapur, Arvinder; Felder, Mildred; Fass, Lucas; Kaur, Justanjot; Czarnecki, Austin; Rathi, Kavya; Zeng, San; Osowski, Kathryn Kalady; Howell, Colin; Xiong, May P; Whelan, Rebecca J; Patankar, Manish S

2016-06-08

The monoterpenoid, citral, when delivered through PEG-b-PCL nanoparticles inhibits in vivo growth of 4T1 breast tumors. Here, we show that citral inhibits proliferation of multiple human cancer cell lines. In p53 expressing ECC-1 and OVCAR-3 but not in p53-deficient SKOV-3 cells, citral induces G1/S cell cycle arrest and apoptosis as determined by Annexin V staining and increased cleaved caspase3 and Bax and decreased Bcl-2. In SKOV-3 cells, citral induces the ER stress markers CHOP, GADD45, EDEM, ATF4, Hsp90, ATG5, and phospho-eIF2α. The molecular chaperone 4-phenylbutyric acid attenuates citral activity in SKOV-3 but not in ECC-1 and OVCAR-3 cells. In p53-expressing cells, citral increases phosphorylation of serine-15 of p53. Activation of p53 increases Bax, PUMA, and NOXA expression. Inhibition of p53 by pifithrin-α, attenuates citral-mediated apoptosis. Citral increases intracellular oxygen radicals and this leads to activation of p53. Inhibition of glutathione synthesis by L-buthionine sulfoxamine increases potency of citral. Pretreatment with N-acetylcysteine decreases phosphorylation of p53 in citral-treated ECC-1 and OVCAR-3. These results define a p53-dependent, and in the absence of p53, ER stress-dependent mode of action of citral. This study indicates that citral in PEG-b-PCL nanoparticle formulation should be considered for treatment of breast and other tumors.

Modulation of oxidative stress and subsequent induction of apoptosis and endoplasmic reticulum stress allows citral to decrease cancer cell proliferation

PubMed Central

Kapur, Arvinder; Felder, Mildred; Fass, Lucas; Kaur, Justanjot; Czarnecki, Austin; Rathi, Kavya; Zeng, San; Osowski, Kathryn Kalady; Howell, Colin; Xiong, May P.; Whelan, Rebecca J.; Patankar, Manish S.

2016-01-01

The monoterpenoid, citral, when delivered through PEG-b-PCL nanoparticles inhibits in vivo growth of 4T1 breast tumors. Here, we show that citral inhibits proliferation of multiple human cancer cell lines. In p53 expressing ECC-1 and OVCAR-3 but not in p53-deficient SKOV-3 cells, citral induces G1/S cell cycle arrest and apoptosis as determined by Annexin V staining and increased cleaved caspase3 and Bax and decreased Bcl-2. In SKOV-3 cells, citral induces the ER stress markers CHOP, GADD45, EDEM, ATF4, Hsp90, ATG5, and phospho-eIF2α. The molecular chaperone 4-phenylbutyric acid attenuates citral activity in SKOV-3 but not in ECC-1 and OVCAR-3 cells. In p53-expressing cells, citral increases phosphorylation of serine-15 of p53. Activation of p53 increases Bax, PUMA, and NOXA expression. Inhibition of p53 by pifithrin-α, attenuates citral-mediated apoptosis. Citral increases intracellular oxygen radicals and this leads to activation of p53. Inhibition of glutathione synthesis by L-buthionine sulfoxamine increases potency of citral. Pretreatment with N-acetylcysteine decreases phosphorylation of p53 in citral-treated ECC-1 and OVCAR-3. These results define a p53-dependent, and in the absence of p53, ER stress-dependent mode of action of citral. This study indicates that citral in PEG-b-PCL nanoparticle formulation should be considered for treatment of breast and other tumors. PMID:27270209

Modulation of p53 cellular function and cell death by African swine fever virus.

PubMed

Granja, Aitor G; Nogal, María L; Hurtado, Carolina; Salas, José; Salas, María L; Carrascosa, Angel L; Revilla, Yolanda

2004-07-01

Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells.

Modulation of p53 Cellular Function and Cell Death by African Swine Fever Virus

PubMed Central

Granja, Aitor G.; Nogal, María L.; Hurtado, Carolina; Salas, José; Salas, María L.; Carrascosa, Angel L.; Revilla, Yolanda

2004-01-01

Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells. PMID:15194793

The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.

PubMed

Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Nagao, Toshikazu; Sumitomo, Yasuhiko; Sumitomo, Haruhiko; Masuda, Tomoko; Dawson, Simon; Shimada, Yutaka; Mayer, R John; Fujita, Jun

2005-07-01

Gankyrin is an ankyrin repeat oncoprotein commonly overexpressed in hepatocellular carcinomas. Gankyrin interacts with the S6 proteasomal ATPase and accelerates the degradation of the tumor suppressor Rb. We show here that gankyrin has an antiapoptotic activity in cells exposed to DNA damaging agents. Downregulation of gankyrin induces apoptosis in cells with wild-type p53. In vitro and in vivo experiments revealed that gankyrin binds to Mdm2, facilitating p53-Mdm2 binding, and increases ubiquitylation and degradation of p53. Gankyrin also enhances Mdm2 autoubiquitylation in the absence of p53. Downregulation of gankyrin reduced amounts of Mdm2 and p53 associated with the 26S proteasome. Thus, gankyrin is a cofactor that increases the activities of Mdm2 on p53 and probably targets polyubiquitylated p53 into the 26S proteasome.

Crocidolite asbestos causes an induction of p53 and apoptosis in cultured A-549 lung carcinoma cells.

PubMed

Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A

1998-01-01

A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.

p53-regulated autophagy is controlled by glycolysis and determines cell fate

PubMed Central

Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

2015-01-01

The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

Suppression of p53 Activity through the Cooperative Action of Ski and Histone Deacetylase SIRT1*

PubMed Central

Inoue, Yasumichi; Iemura, Shun-ichiro; Natsume, Tohru; Miyazawa, Keiji; Imamura, Takeshi

2011-01-01

Ski was originally identified as an oncogene based on the fact that Ski overexpression transformed chicken and quail embryo fibroblasts. Consistent with these proposed oncogenic roles, Ski is overexpressed in various human tumors. However, whether and how Ski functions in mammalian tumorigenesis has not been fully investigated. Here, we show that Ski interacts with p53 and attenuates the biological functions of p53. Ski overexpression attenuated p53-dependent transactivation, whereas Ski knockdown enhanced the transcriptional activity of p53. Interestingly, Ski bound to the histone deacetylase SIRT1 and stabilized p53-SIRT1 interaction to promote p53 deacetylation, which subsequently decreased the DNA binding activity of p53. Consistent with the ability of Ski to inactivate p53, overexpressing Ski desensitized cells to genotoxic drugs and Nutlin-3, a small-molecule antagonist of Mdm2 that stabilizes p53 and activates the p53 pathway, whereas knocking down Ski increased the cellular sensitivity to these agents. These results indicate that Ski negatively regulates p53 and suggest that the p53-Ski-SIRT1 axis is an attractive target for cancer therapy. PMID:21149449

Abrogation of p53 by its antisense in MCF-7 breast carcinoma cells increases cyclin D1 via activation of Akt and promotion of cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Rishi Raj; Kumari, Ratna; Upadhyay, Ankur Kumar

2007-11-15

The p53 protein has been a subject of intense research interest since its discovery as about 50% of human cancers carry p53 mutations. Mutations in the p53 gene are the most frequent genetic lesions in breast cancers suggesting a critical role of p53 in breast cancer development, growth and chemosensitivity. This report describes the derivation and characterization of MCF-7As53, an isogenic cell line derived from MCF-7 breast carcinoma cells in which p53 was abrogated by antisense p53 cDNA. Similar to MCF-7 and simultaneously selected hygromycin resistant MCF-7H cells, MCF-7As53 cells have consistent basal epithelial phenotype, morphology, and estrogen receptor expressionmore » levels at normal growth conditions. Present work documents investigation of molecular variations, growth kinetics, and cell cycle related studies in relation to absence of wild-type p53 protein and its transactivation potential as well. Even though wild-type tumor suppressor p53 is an activator of cell growth arrest and apoptosis-mediator genes such as p21, Bax, and GADD45 in MCF-7As53 cells, no alterations in expression levels of these genes were detected. The doubling time of these cells decreased due to depletion of G0/G1 cell phase because of constitutive activation of Akt and increase in cyclin D1 protein levels. This proliferative property was abrogated by wortmannin, an inhibitor of PI3-K/Akt signaling pathway. Therefore this p53 null cell line indicates that p53 is an indispensable component of cellular signaling system which is regulated by caveolin-1 expression, involving Akt activation and increase in cyclin D1, thereby promoting proliferation of breast cancer cells.« less

Functional activation of mutant p53V172F by platinum analogs in cisplatin-resistant human tumor cells is dependent on serine-20 phosphorylation

PubMed Central

Xie, Xiaolei; He, Guangan; Siddik, Zahid H.

2017-01-01

Dysfunctionality of the p53 tumor suppressor is a major cause of therapeutic drug resistance in cancer. Recently we reported that mutant, but otherwise functional, p53V172F was inactivated in cisplatin-resistant 2780CP/Cl-16 and 2780CP/Cl-24 human ovarian tumor cells by increased recruitment of the inhibitor MDM4. The current study demonstrates that, unlike cisplatin, platinum analogs oxaliplatin and DACH-diacetato-dichloro-Pt(IV) (DAP), strongly stabilize and activate p53V172F in resistant cells, as indicated by prolonged p53 half-life and transactivation of targets p21 (CDKN1A) and MDM2. This increase in MDM2 reduced MDM4 levels in cell lysates as well as the p53 immunocomplex and prevented reversion of p53 to the inactive p53-MDM2-MDM4 bound state. Phosphorylation of p53 at Ser15 was demonstrated by all three drugs in sensitive A2780 and corresponding resistant 2780CP/Cl-16 and 2780CP/Cl-24 cell lines. However, cisplatin induced Ser20 phosphorylation in A2780 cells only, but not in resistant cells; in contrast, both DAP and oxaliplatin induced this phosphorylation in all three cell lines. The inference that Ser20 phosphorylation is more important for p53 activation was confirmed by ectopic expression of a phosphomimetic (S20D) mutant p53 that displayed reduced binding, relative to wild-type p53, to both MDM2 and MDM4 in p53-knockout A2780 cells. In consonance, temporal studies demonstrated drug-induced Ser15 phosphorylation coincided with p53 stabilization, whereas Ser20 phosphorylation coincided with p53 transactivation. Implications Cisplatin fails to activate the pathway involved in phosphorylating mutant p53V172F at Ser20 in resistant cells, but this phosphorylation is restored by oxaliplatin and DAP that reactivates p53 function and circumvents cisplatin resistance. PMID:28031409

Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

PubMed Central

2010-01-01

Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441

Fluoride induces apoptosis via inhibiting SIRT1 activity to activate mitochondrial p53 pathway in human neuroblastoma SH-SY5Y cells.

PubMed

Tu, Wei; Zhang, Qian; Liu, Yin; Han, Lianyong; Wang, Qin; Chen, Panpan; Zhang, Shun; Wang, Aiguo; Zhou, Xue

2018-05-15

There has been a great concern about the neurotoxicity of fluoride since it can pass through the blood-brain barrier and accumulate in the brain. It has been suggested that apoptosis plays a vital role in neurotoxicity of fluoride. However, whether p53-mediated apoptotic pathway is involved is still unclear. Our results showed that apoptosis was induced after treatment with 40 and 60 mg/L of NaF for 24 h in human neuroblastoma SH-SY5Y cells. Exposure to 60 mg/L of NaF for 24 h significantly upregulated the levels of p53 and apoptosis-related proteins including PUMA, cytochrome c (cyto c), cleaved caspase-3 and cleaved PARP, whereas downregulated Bcl-2 in SH-SY5Y cells. Meanwhile, fluoride increased p53 nuclear translocation, cyto c release from mitochondria to cytoplasm and mitochondrial translocation of Bax in SH-SY5Y cells. Fluoride-induced increases of apoptotic rates and apoptosis-related protein levels were significantly attenuated by inhibiting p53 transcriptional activity with pifithrin-α. In addition, fluoride inhibited the deacetylase activity of SIRT1 and increased p53 (acetyl K382) level in SH-SY5Y cells. Apoptosis and upregulation of cleaved caspase-3, cleaved PARP and p53 (acetyl K382) induced by fluoride could be ameliorated by SIRT1 overexpression or its activator resveratrol in SH-SY5Y cells. Taken together, our study demonstrates that fluoride induces apoptosis by inhibiting the deacetylase activity of SIRT1 to activate mitochondrial p53 pathway in SH-SY5Y cells, which depends on p53 transcriptional activity. Thus, SIRT1 may be a promising target to protect against neurotoxicity induced by fluoride. Copyright © 2018 Elsevier Inc. All rights reserved.

Inhibition of the ERK phosphorylation plays a role in terbinafine-induced p21 up-regulation and DNA synthesis inhibition in human vascular endothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, P.-Y.; Hsu, S.-P.; Liang, Y.-C.

2008-05-15

Previously, we showed that terbinafine (TB) induces cell-cycle arrest in cultured human umbilical vein endothelial cells (HUVEC) through an up-regulation of the p21 protein. The aim of this study is to delineate the molecular mechanisms underlying TB-induced increase of p21 protein. RT-PCR analysis demonstrated that the mRNA levels of p21 and p53 were increased in the TB-treated HUVEC. The p21 promoter activity was also increased by TB treatment. Transfection of HUVEC with p53 dominant negative (DN) abolished the TB-induced increases of p21 promoter activity and protein level, suggesting that the TB-induced increase of p21 is p53-dependent. Western blot analysis demonstratedmore » that TB decreased the levels of phosphorylated extracellular signal-regulated kinase (ERK). Over-expression of mitogen-activated protein kinase (MEK)-1, the immediate upstream activator kinase of ERK, abolished the TB-induced increases of p21 and p53 protein and decrease of thymidine incorporation. The ERK inhibitor (PD98059) enhanced the TB-induced inhibition of thymidine incorporation into HUVEC. Taken together, these data suggest that the decrease of ERK activity plays a role in the TB-induced up-regulation of p21 in HUVEC. On the other hand, pretreatment of the cells with geranylgeraniol (GGOH), farnesol (FOH), or Ras inhibitor peptide did not affect the TB-induced decrease of thymidine incorporation. Taken together, our results suggest that TB might cause a decrease of MEK, which in turn up-regulates p53 through the inhibition of ERK phosphorylation, and finally causes an increase of p21 expression and cell-cycle arrest.« less

Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice

PubMed Central

Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.

2014-01-01

Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632

SIRT1 activation mediates heat-induced survival of UVB damaged Keratinocytes.

PubMed

Calapre, Leslie; Gray, Elin S; Kurdykowski, Sandrine; David, Anthony; Descargues, Pascal; Ziman, Mel

2017-06-10

Exposure to heat stress after UVB irradiation induces a reduction of apoptosis, resulting in survival of DNA damaged human keratinocytes. This heat-mediated evasion of apoptosis appears to be mediated by activation of SIRT1 and inactivation of p53 signalling. In this study, we assessed the role of SIRT1 in the inactivation of p53 signalling and impairment of DNA damage response in UVB plus heat exposed keratinocytes. Activation of SIRT1 after multiple UVB plus heat exposures resulted in increased p53 deacetylation at K382, which is known to affect its binding to specific target genes. Accordingly, we noted decreased apoptosis and down regulation of the p53 targeted pro-apoptotic gene BAX and the DNA repair genes ERCC1 and XPC after UVB plus heat treatments. In addition, UVB plus heat induced increased expression of the cell survival gene Survivin and the proliferation marker Ki67. Notably, keratinocytes exposed to UVB plus heat in the presence of the SIRT1 inhibitor, Ex-527, showed a similar phenotype to those exposed to UV alone; i.e. an increase in p53 acetylation, increased apoptosis and low levels of Survivin. This study demonstrate that heat-induced SIRT1 activation mediates survival of DNA damaged keratinocytes through deacetylation of p53 after exposure to UVB plus heat.

SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

2014-06-15

Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutatedmore » (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.« less

p53 targets chromatin structure alteration to repress alpha-fetoprotein gene expression.

PubMed

Ogden, S K; Lee, K C; Wernke-Dollries, K; Stratton, S A; Aronow, B; Barton, M C

2001-11-09

Many of the functions ascribed to p53 tumor suppressor protein are mediated through transcription regulation. We have shown that p53 represses hepatic-specific alpha-fetoprotein (AFP) gene expression by direct interaction with a composite HNF-3/p53 DNA binding element. Using solid-phase, chromatin-assembled AFP DNA templates and analysis of chromatin structure and transcription in vitro, we find that p53 binds DNA and alters chromatin structure at the AFP core promoter to regulate transcription. Chromatin assembled in the presence of hepatoma extracts is activated for AFP transcription with an open, accessible core promoter structure. Distal (-850) binding of p53 during chromatin assembly, but not post-assembly, reverses transcription activation concomitant with promoter inaccessibility to restriction enzyme digestion. Inhibition of histone deacetylase activity by trichostatin-A (TSA) addition, prior to and during chromatin assembly, activated chromatin transcription in parallel with increased core promoter accessibility. Chromatin immunoprecipitation analyses showed increased H3 and H4 acetylated histones at the core promoter in the presence of TSA, while histone acetylation remained unchanged at the site of distal p53 binding. Our data reveal that p53 targets chromatin structure alteration at the core promoter, independently of effects on histone acetylation, to establish repressed AFP gene expression.

P53 Is Involved in a Three-Dimensional Architecture-Mediated Decrease in Chemosensitivity in Colon Cancer.

PubMed

He, Jianming; Liang, Xi; Luo, Fen; Chen, Xuedan; Xu, Xueqing; Wang, Fengchao; Zhang, Zhenping

2016-01-01

Three-dimensional (3D) culture models represent a better approximation of solid tumor tissue architecture, especially cell adhesion, in vivo than two-dimensional (2D) cultures do. Here, we explored the role of architecture in chemosensitivity to platinum in colon cancer. Under the 3D culture condition, colon cancer cells formed multicellular spheroids, consisting of layers of cells. 3D cultures displayed significantly decreased sensitivity to platinum compared with 2D cultures. Platinum increased p53 in a dose-dependent and time-dependent manner. There was no detectable difference in basal p53 levels between 3D cultures and 2D cultures but cisplatin induced less p53 in both HCT116 3D cultures and LoVo 3D cultures. It was not due to cisplatin concentration because cisplatin induced similar γ-H2AX in 3D vs 2D. Knockdown of p53 significantly decreased sensitivity to platinum in 3D cultures. Knockdown of p53 decreased cleaved caspase 3 and apoptosis induced by cisplatin. These findings indicate that 3D architecture confers decreased chemosensitivity to platinum and p53 is involved in the mechanism. Knockdown of p53 decreased cisplatin's induction of c-Jun N-terminal kinase 1/2 (JNK1/2) activation, whereas inhibition of JNK1/2 activation increased chemosensitivity. Inhibition of p38 activation decreased cisplatin's induction of p53, but no difference in p38 activation by cisplatin was observed between 2D cultures and 3D cultures. Taken together, our results suggest that p53 is involved in a 3D architecture-mediated decrease in chemosensitivity to platinum in colon cancer. Mitogen-activated protein kinases (JNK1/2 and p38) do not play a dominant role in the mechanism.

Crosstalk between the IGF-1R/AKT/mTORC1 pathway and the tumor suppressors p53 and p27 determines cisplatin sensitivity and limits the effectiveness of an IGF-1R pathway inhibitor

PubMed Central

Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.

2016-01-01

The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276

The Central Sirtuin 1/p53 Pathway Is Essential for the Orexigenic Action of Ghrelin

PubMed Central

Velásquez, Douglas A.; Martínez, Gloria; Romero, Amparo; Vázquez, María J.; Boit, Katia D.; Dopeso-Reyes, Iria G.; López, Miguel; Vidal, Anxo; Nogueiras, Ruben; Diéguez, Carlos

2011-01-01

OBJECTIVE Ghrelin is a stomach-derived peptide that increases food intake through the activation of hypothalamic AMP-activated protein kinase (AMPK). However, the molecular mechanisms initiated by the activation of the ghrelin receptor, which in turn lead to AMPK activation, remain unclear. Sirtuin 1 (SIRT1) is a deacetylase activated in response to calorie restriction that acts through the tumor suppressor gene p53. We tested the hypothesis that the central SIRT1/p53 pathway might be mediating the orexigenic action of ghrelin. RESEARCH DESIGN AND METHODS SIRT1 inhibitors, such as Ex527 and sirtinol, and AMPK activators, such as AICAR, were administered alongside ghrelin in the brain of rats and mice (wild-type versus p53 knockout [KO]). Their hypothalamic effects on lipid metabolism and changes in transcription factors and neuropeptides were assessed by Western blot and in situ hybridization. RESULTS The central pretreatment with Ex527, a potent SIRT1 inhibitor, blunted the ghrelin-induced food intake in rats. Mice lacking p53, a target of SIRT1 action, failed to respond to ghrelin in feeding behavior. Ghrelin failed to phosphorylate hypothalamic AMPK when rats were pretreated with Ex527, as it did in p53 KO mice. It is noteworthy that the hypothalamic SIRT1/p53 pathway seems to be specific for mediating the orexigenic action of ghrelin, because central administration of AICAR, a potent AMPK activator, increased food intake in p53 KO mice. Finally, blockade of the central SIRT1 pathway did not modify ghrelin-induced growth hormone secretion. CONCLUSIONS Ghrelin specifically triggers a central SIRT1/p53 pathway that is essential for its orexigenic action, but not for the release of growth hormone. PMID:21386086

Regulation of p53 Target Gene Expression by Peptidylarginine Deiminase 4 ▿ †

PubMed Central

Li, Pingxin; Yao, Hongjie; Zhang, Zhiqiang; Li, Ming; Luo, Yuan; Thompson, Paul R.; Gilmour, David S.; Wang, Yanming

2008-01-01

Histone Arg methylation has been correlated with transcriptional activation of p53 target genes. However, whether this modification is reversed to repress the expression of p53 target genes is unclear. Here, we report that peptidylarginine deiminase 4, a histone citrullination enzyme, is involved in the repression of p53 target genes. Inhibition or depletion of PAD4 elevated the expression of a subset of p53 target genes, including p21/CIP1/WAF1, leading to cell cycle arrest and apoptosis. Moreover, the induction of p21, cell cycle arrest, and apoptosis by PAD4 depletion is p53 dependent. Protein-protein interaction studies showed an interaction between p53 and PAD4. Chromatin immunoprecipitation assays showed that PAD4 is recruited to the p21 promoter in a p53-dependent manner. RNA polymerase II (Pol II) activities and the association of PAD4 are dynamically regulated at the p21 promoter during UV irradiation. Paused RNA Pol II and high levels of PAD4 were detected before UV treatment. At early time points after UV treatment, an increase of histone Arg methylation and a decrease of citrullination were correlated with a transient activation of p21. At later times after UV irradiation, a loss of RNA Pol II and an increase of PAD4 were detected at the p21 promoter. The dynamics of RNA Pol II activities after UV treatment were further corroborated by permanganate footprinting. Together, these results suggest a role of PAD4 in the regulation of p53 target gene expression. PMID:18505818

p53 is a key regulator for osthole-triggered cancer pathogenesis.

PubMed

Huang, Ssu-Ming; Tsai, Cheng-Fang; Chen, Dar-Ren; Wang, Min-Ying; Yeh, Wei-Lan

2014-01-01

Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development.

Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

PubMed

Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

2010-11-01

Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos

PubMed Central

El Husseini, Nazem; Schlisser, Ava E.; Hales, Barbara F.

2016-01-01

Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. PMID:27208086

The critical role of catalase in prooxidant and antioxidant function of p53

PubMed Central

Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

2013-01-01

The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro

PubMed Central

Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu

2016-01-01

Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798

The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR

PubMed Central

Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

2010-01-01

Summary The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca2+-independent-phospholipase A2 (iPLA2). We previously reported that inhibition of iPLA2 arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA2 induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA2. The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA2-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway. PMID:18032786

The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR.

PubMed

Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

2007-12-01

The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca(2+)-independent-phospholipase A(2) (iPLA(2)). We previously reported that inhibition of iPLA(2) arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA(2) induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA(2). The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA(2)-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway.

Extracellular NAMPT/visfatin causes p53 deacetylation via NAD production and SIRT1 activation in breast cancer cells.

PubMed

Behrouzfar, Kiarash; Alaee, Mohammad; Nourbakhsh, Mitra; Gholinejad, Zafar; Golestani, Abolfazl

2017-08-01

Visfatin, which is secreted as an adipokine and cytokine, has been implicated in cancer development and progression. In this study, we investigated the NAD-producing ability of visfatin and its relationship with SIRT1 (silent information regulator 2) and p53 to clarify the role of visfatin in breast cancer. MCF-7 breast cancer cells were cultured and treated with visfatin. SIRT1 activity was assessed by measuring fluorescence intensity from fluoro-substrate peptide. To investigate the effect of visfatin on p53 acetylation, SDS-PAGE followed by western blotting was performed using specific antibodies against p53 and its acetylated form. Total NAD was measured both in cell lysate and the extracellular medium by colorimetric method. Visfatin increased both extracellular and intracellular NAD concentrations. It also induced proliferation of breast cancer cells, an effect that was abolished by inhibition of its enzymatic activity. Visfatin significantly increased SIRT1 activity, accompanied by induction of p53 deacetylation. In conclusion, the results show that extracellular visfatin produces NAD that causes upregulation of SIRT1 activity and p53 deacetylation. These findings explain the relationship between visfatin and breast cancer progression. Copyright © 2017 John Wiley & Sons, Ltd.

Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

PubMed

Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

2016-03-01

The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan

Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less

Loss of Parkin reduces inflammatory arthritis by inhibiting p53 degradation.

PubMed

Jung, Yu Yeon; Son, Dong Ju; Lee, Hye Lim; Kim, Dae Hwan; Song, Min Jong; Ham, Young Wan; Kim, Youngsoo; Han, Sang Bae; Park, Mi Hee; Hong, Jin Tae

2017-08-01

Parkin is associated with various inflammatory diseases, including Parkinson's disease (PD) and rheumatoid arthritis (RA). However, the precise role of Parkin in RA is unclear. The present study addressed this issue by comparing the development of RA between non-transgenic (non-Tg) mice and PARK2 knockout (KO) mice. We found that cyclooxygenase-2 and inducible nitric oxide synthase expression and nuclear factor-κB activity were reduced but p53 activation was increased in PARK2 KO as compared to non-Tg mice. These effects were associated with reduced p53 degradation. Parkin was found to interact with p53; however, this was abolished in Parkin KO mice, which prevented p53 degradation. Treatment of PARK2 KO mice with p53 inhibitor increased Parkin expression as well as inflammation and RA development while decreasing nuclear p53 translocation, demonstrating that PARK2 deficiency inhibits inflammation in RA via suppression of p53 degradation. These results suggest that RA development may be reduced in PD patients. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

EBNA3C regulates p53 through induction of Aurora kinase B

PubMed Central

Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

2015-01-01

In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

Activation of the miR-34a/SIRT1/p53 Signaling Pathway Contributes to the Progress of Liver Fibrosis via Inducing Apoptosis in Hepatocytes but Not in HSCs.

PubMed

Tian, Xiao-Feng; Ji, Fu-Jian; Zang, Hong-Liang; Cao, Hong

2016-01-01

Liver fibrosis results from a sustained wound healing response to chronic liver injury, and the activation of nonparenchymal hepatic stellate cells (HSCs) is the pivotal process. MicroRNA-34a (miR-34a) is the direct target gene of p53 and activates p53 through sirtuin 1 (SIRT1) simultaneously. The miR-34a/SIRT1/p53 signaling pathway thus forms a positive feedback loop wherein p53 induces miR-34a and miR-34a activates p53 by inhibiting SIRT1, playing an important role in cell proliferation and apoptosis. miR-34a expression has been found to be increased in animal models or in human patients with different liver diseases, including liver fibrosis. However, the exact role of this classical miR-34a/SIRT1/p53 signaling pathway in liver fibrosis remains unclear. In the present study, using a CCl4-induced rat liver fibrosis model, we found that the miR-34a/SIRT1/p53 signaling pathway was activated and could be inhibited by SIRT1 activator SRT1720. Further studies showed that the miR-34a/SIRT1/p53 signaling pathway was activated in hepatocytes but not in HSCs. The activation of this pathway in hepatocytes resulted in the apoptosis of hepatocytes and thus activated HSCs. Our data indicate that the miR-34a/SIRT1/p53 signaling pathway might be a promising therapeutic target for liver fibrosis.

The tumour suppressor protein, p53, is involved in the activation of the apoptotic cascade by Delta9-tetrahydrocannabinol in cultured cortical neurons.

PubMed

Downer, Eric J; Gowran, Aoife; Murphy, Aine C; Campbell, Veronica A

2007-06-14

Cannabis is the most commonly used illegal drug of abuse in Western society. Delta(9)-tetrahydrocannabinol, the psychoactive ingredient of marijuana, regulates a variety of neuronal processes including neurotransmitter release and synaptic transmission. An increasing body of evidence suggests that cannabinoids play a key role in the regulation of neuronal viability. In cortical neurons tetrahydrocannabinol has a neurodegenerative effect, the mechanisms of which are poorly understood, but involve the cannabinoid receptor subtype, CB(1). In this study we report that tetrahydrocannabinol (5 muM) evokes a rapid phosphorylation, and thus activation, of the tumour suppressor protein, p53, in a manner involving the cannabinoid CB(1) receptor, and the stress-activated protein kinase, c-jun N-terminal kinase, in cultured cortical neurons. Tetrahydrocannabinol increased expression of the p53-transcriptional target, Bax and promoted Bcl phosphorylation. These events were abolished by the p53 inhibitor, pifithrin-alpha (100 nM). The tetrahydrocannabinol-induced activation of the pro-apoptotic cysteine protease, caspase-3, and DNA fragmentation was also blocked by pifithrin-alpha. A siRNA knockdown of p53 further verified the role of p53 in tetrahydrocannabinol-induced apoptosis. This study demonstrates a novel cannabinoid signalling pathway involving p53 that culminates in neuronal apoptosis.

p53 Is a Key Regulator for Osthole-Triggered Cancer Pathogenesis

PubMed Central

Huang, Ssu-Ming; Tsai, Cheng-Fang; Wang, Min-Ying

2014-01-01

Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development. PMID:25013761

C/EBPbeta represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19(Arf).

PubMed

Ewing, S J; Zhu, S; Zhu, F; House, J S; Smart, R C

2008-11-01

CCAAT/enhancer-binding protein-beta (C/EBPbeta) is a mediator of cell survival and tumorigenesis. When C/EBPbeta(-/-) mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19(Arf) and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19(Arf) is dramatically elevated in C/EBPbeta(-/-) epidermis and that C/EBPbeta represses a p19(Arf) promoter reporter. To determine whether p19(Arf) is responsible for the proapoptotic phenotype in C/EBPbeta(-/-) mice, C/EBPbeta(-/-);p19(Arf-/-) mice were generated. C/EBPbeta(-/-);p19(Arf-/-) mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19(Arf) is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPbeta(-/-) epidermis, we generated K14-ER:Ras;C/EBPbeta(-/-) mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPbeta(-/-) mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPbeta represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPbeta may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents.

C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

PubMed Central

Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC

2013-01-01

CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53

PubMed Central

Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng

2016-01-01

Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502

Vectors to Increase Production Efficiency of Inducible Pluripotent Stem Cell (iPSC) | NCI Technology Transfer Center | TTC

Cancer.gov

This invention describes the discovery that specific p53 isoform increase the number of inducible pluripotent stem cells (iPS). It is known that the activity of p53 regulates the self-renewal and pluripotency of normal and cancer stem cells, and also affects re-programming efficiency of iPS cells. This p53 isoform-based technology provides a more natural process of increasing iPS cell production than previous methods of decreasing p53. NCI seeks licensees for this technology.

Effects of the Kava Chalcone Flavokawain A Differ in Bladder Cancer Cells with Wild-type versus Mutant p53

PubMed Central

Tang, Yaxiong; Simoneau, Anne R.; Xie, Jun; Shahandeh, Babbak; Zi, Xiaolin

2010-01-01

Flavokawain A is the predominant chalcone from kava extract. We have assessed the mechanisms of flavokawain A's action on cell cycle regulation. In a p53 wild-type, low-grade, and papillary bladder cancer cell line (RT4), flavokawain A increased p21/WAF1 and p27/KIP1, which resulted in a decrease in cyclin-dependent kinase-2 (CDK2) kinase activity and subsequent G1 arrest. The increase of p21/WAF1 protein corresponded to an increased mRNA level, whereas p27/KIP1 accumulation was associated with the down-regulation of SKP2 and then increased the stability of the p27/KIP1 protein. The accumulation of p21/WAF1 and p27/KIP1 was independent of cell cycle position and thus not a result of the cell cycle arrest. In contrast, flavokawain A induced a G2-M arrest in six p53 mutant-type, high-grade bladder cancer cell lines (T24, UMUC3, TCCSUP, 5637, HT1376, and HT1197). Flavokawain A significantly reduced the expression of CDK1-inhibitory kinases, Myt1 and Wee1, and caused cyclin B1 protein accumulation leading to CDK1 activation in T24 cells. Suppression of p53 expression by small interfering RNA in RT4 cells restored Cdc25C expression and down-regulated p21/WAF1 expression, which allowed Cdc25C and CDK1 activation and then led to a G2-M arrest and an enhanced growth-inhibitory effect by flavokawain A. Consistently, flavokawain A also caused a pronounced CDK1 activation and G2-M arrest in p53 knockout but not in p53 wild-type HCT116 cells. This selectivity of flavokawain A for inducing a G2-M arrest in p53-defective cells deserves further investigation as a new mechanism for the prevention and treatment of bladder cancer. PMID:19138991

Recognition of Local DNA Structures by p53 Protein

PubMed Central

Brázda, Václav; Coufal, Jan

2017-01-01

p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

Reciprocal regulation of p53 and malic enzymes modulates metabolism and senescence.

PubMed

Jiang, Peng; Du, Wenjing; Mancuso, Anthony; Wellen, Kathryn E; Yang, Xiaolu

2013-01-31

Cellular senescence both protects multicellular organisms from cancer and contributes to their ageing. The pre-eminent tumour suppressor p53 has an important role in the induction and maintenance of senescence, but how it carries out this function remains poorly understood. In addition, although increasing evidence supports the idea that metabolic changes underlie many cell-fate decisions and p53-mediated tumour suppression, few connections between metabolic enzymes and senescence have been established. Here we describe a new mechanism by which p53 links these functions. We show that p53 represses the expression of the tricarboxylic-acid-cycle-associated malic enzymes ME1 and ME2 in human and mouse cells. Both malic enzymes are important for NADPH production, lipogenesis and glutamine metabolism, but ME2 has a more profound effect. Through the inhibition of malic enzymes, p53 regulates cell metabolism and proliferation. Downregulation of ME1 and ME2 reciprocally activates p53 through distinct MDM2- and AMP-activated protein kinase-mediated mechanisms in a feed-forward manner, bolstering this pathway and enhancing p53 activation. Downregulation of ME1 and ME2 also modulates the outcome of p53 activation, leading to strong induction of senescence, but not apoptosis, whereas enforced expression of either malic enzyme suppresses senescence. Our findings define physiological functions of malic enzymes, demonstrate a positive-feedback mechanism that sustains p53 activation, and reveal a connection between metabolism and senescence mediated by p53.

BTK blocks the inhibitory effects of MDM2 on p53 activity

PubMed Central

Rada, Miran; Althubiti, Mohammad; Ekpenyong-Akiba, Akang E.; Lee, Koon-Guan; Lam, Kong Peng; Fedorova, Olga; Barlev, Nickolai A.; Macip, Salvador

2017-01-01

p53 is a tumour suppressor that is activated in response to various types of stress. It is regulated by a complex pattern of over 50 different post-translational modifications, including ubiquitination by the E3 ligase MDM2, which leads to its proteasomal degradation. We have previously reported that expression of Bruton’s Tyrosine Kinase (BTK) induces phosphorylation of p53 at the N-terminus, including Serine 15, and increases its protein levels and activity. The mechanisms involved in this process are not completely understood. Here, we show that BTK also increases MDM2 and is necessary for MDM2 upregulation after DNA damage, consistent with what we have shown for other p53 target genes. Moreover, we found that BTK binds to MDM2 on its PH domain and induces its phosphorylation. This suggested a negative regulation of MDM2 functions by BTK, supported by the fact BTK expression rescued the inhibitory effects of MDM2 on p53 transcriptional activity. Indeed, we observed that BTK mediated the loss of the ubiquitination activity of MDM2, a process that was dependent on the phosphorylation functions of BTK. Our data together shows that the kinase activity of BTK plays an important role in disrupting the MDM2-p53 negative feedback loop by acting at different levels, including binding to and inactivation of MDM2. This study provides a potential mechanism to explain how BTK modulates p53 functions. PMID:29290977

Cross Talk between PML and p53 during Poliovirus Infection: Implications for Antiviral Defense

PubMed Central

Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K.

2006-01-01

PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation. PMID:16912307

Cross talk between PML and p53 during poliovirus infection: implications for antiviral defense.

PubMed

Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K

2006-09-01

PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation.

Assessment of the DNA damaging potential of environmental chemicals using a quantitative high-throughput screening approach to measure p53 activation.

PubMed

Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R

2017-08-01

Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leão, Mariana; Gomes, Sara; Bessa, Cláudia

In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either permore » se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.« less

Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

PubMed

Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

2016-03-01

Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

PubMed

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

PubMed Central

2014-01-01

Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies. PMID:24927749

Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines.

PubMed

Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid

2017-01-01

The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

MEK5/ERK5 signaling inhibition increases colon cancer cell sensitivity to 5-fluorouracil through a p53-dependent mechanism

PubMed Central

Pereira, Diane M.; Simões, André E. S.; Gomes, Sofia E.; Castro, Rui E.; Carvalho, Tânia; Rodrigues, Cecília M. P.; Borralho, Pedro M.

2016-01-01

The MEK5/ERK5 signaling pathway is emerging as an important contributor to colon cancer onset, progression and metastasis; however, its relevance to chemotherapy resistance remains unknown. Here, we evaluated the impact of the MEK5/ERK5 cascade in colon cancer cell sensitivity to 5-fluorouracil (5-FU). Increased ERK5 expression was correlated with poor overall survival in colon cancer patients. In colon cancer cells, 5-FU exposure impaired endogenous KRAS/MEK5/ERK5 expression and/or activation. In turn, MEK5 constitutive activation reduced 5-FU-induced cytotoxicity. Using genetic and pharmacological approaches, we showed that ERK5 inhibition increased caspase-3/7 activity and apoptosis following 5-FU exposure. Mechanistically, this was further associated with increased p53 transcriptional activation of p21 and PUMA. In addition, ERK5 inhibition increased the response of HCT116 p53+/+ cells to 5-FU, but failed to sensitize HCT116 p53−/− cells to the cytotoxic effects of this chemotherapeutic agent, suggesting a p53-dependent axis mediating 5-FU sensitization. Finally, ERK5 inhibition using XMD8-92 was shown to increase the antitumor effects of 5-FU in a murine subcutaneous xenograft model, enhancing apoptosis while markedly reducing tumor growth. Collectively, our results suggest that ERK5-targeted in hibition provides a promising therapeutic approach to overcome resistance to 5-FU-based chemotherapy and improve colon cancer treatment. PMID:27144434

Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos.

PubMed

El Husseini, Nazem; Schlisser, Ava E; Hales, Barbara F

2016-08-01

Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

p53/PUMA expression in human pulmonary fibroblasts mediates cell activation and migration in silicosis.

PubMed

Wang, Wei; Liu, Haijun; Dai, Xiaoniu; Fang, Shencun; Wang, Xingang; Zhang, Yingming; Yao, Honghong; Zhang, Xilong; Chao, Jie

2015-11-18

Phagocytosis of SiO2 into the lung causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Clinical evidence has indicated that the activation of alveolar macrophages by SiO2 produces rapid and sustained inflammation characterized by the generation of monocyte chemotactic protein 1, which, in turn, induces fibrosis. However, the details of events downstream of monocyte chemotactic protein 1 activity in pulmonary fibroblasts remain unclear. Here, to elucidate the role of p53 in fibrosis induced by silica, both the upstream molecular mechanisms and the functional effects on cell proliferation and migration were investigated. Experiments using primary cultured adult human pulmonary fibroblasts led to the following results: 1) SiO2 treatment resulted in a rapid and sustained increase in p53 and PUMA protein levels; 2) the MAPK and PI3K pathways were involved in the SiO2-induced alteration of p53 and PUMA expression; and 3) RNA interference targeting p53 and PUMA prevented the SiO2-induced increases in fibroblast activation and migration. Our study elucidated a link between SiO2-induced p53/PUMA expression in fibroblasts and cell migration, thereby providing novel insight into the potential use of p53/PUMA in the development of novel therapeutic strategies for silicosis treatment.

Posttranslational Modifications of p53 in Replicative Senescence Overlapping but Distinct from Those Induced by DNA Damage

PubMed Central

Webley, Katherine; Bond, Jane A.; Jones, Christopher J.; Blaydes, Jeremy P.; Craig, Ashley; Hupp, Ted; Wynford-Thomas, David

2000-01-01

Replicative senescence in human fibroblasts is absolutely dependent on the function of the phosphoprotein p53 and correlates with activation of p53-dependent transcription. However, no evidence for posttranslational modification of p53 in senescence has been presented, raising the possibility that changes in transcriptional activity result from upregulation of a coactivator. Using a series of antibodies with phosphorylation-sensitive epitopes, we now show that senescence is associated with major changes at putative regulatory sites in the N and C termini of p53 consistent with increased phosphorylation at serine-15, threonine-18, and serine-376 and decreased phosphorylation at serine-392. Ionizing and UV radiation generated overlapping but distinct profiles of response, with increased serine-15 phosphorylation being the only common change. These results support a direct role for p53 in signaling replicative senescence and are consistent with the generation by telomere erosion of a signal which shares some but not all of the features of DNA double-strand breaks. PMID:10733583

p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

2013-06-15

Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less

UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation

PubMed Central

Du, Cheng; Wu, Hong; Leng, Roger P.

2016-01-01

Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.

2015-11-13

Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less

Hyperosmolarity induced by high glucose promotes senescence in human glomerular mesangial cells.

PubMed

del Nogal, Maria; Troyano, Nuria; Calleros, Laura; Griera, Mercedes; Rodriguez-Puyol, Manuel; Rodriguez-Puyol, Diego; Ruiz-Torres, María P

2014-09-01

Hyperglycemia is involved in the diabetic complication of different organs and can elevate serum osmolarity. Here, we tested whether hyperosmolarity promoted by high glucose levels induces cellular senescence in renal cells. We treated Wistar rats with streptozotocin to induce diabetes or with consecutive daily injections of mannitol to increase serum osmolarity and analyzed p53 and p16 genes in renal cortex by immunohistochemistry. Both diabetic and mannitol treated rats showed a significant increase in serum osmolarity, without significant signs of renal dysfunction, but associated with increased staining for p53 and p16 in the renal cortex. An increase in p53 and p16 expression was also found in renal cortex slices and glomeruli isolated from healthy rats, which were later treated with 30 mM glucose or mannitol. Intracellular mechanisms involved were analyzed in cultured human glomerular mesangial cells treated with 30 mM glucose or mannitol. After treatments, cells showed increased p53, p21 and p16 expression and elevated senescence-associated β-galactosidase activity. Senescence was prevented when myo-inositol was added before treatment. High glucose or mannitol induced constitutive activation of Ras and ERK pathways which, in turn, were activated by oxidative stress. In summary, hyperosmolarity induced renal senescence, particularly in glomerular mesangial cells, increasing oxidative stress, which constitutively activated Ras-ERK 1/2 pathway. Cellular senescence could contribute to the organ dysfunction associated with diabetes. Copyright © 2014 Elsevier Ltd. All rights reserved.

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

Induction of apoptosis in Ehrlich ascites tumour cells via p53 activation by a novel small-molecule MDM2 inhibitor - LQFM030.

PubMed

da Mota, Mariana F; Cortez, Alane P; Benfica, Polyana L; Rodrigues, Bruna Dos S; Castro, Thalyta F; Macedo, Larissa M; Castro, Carlos H; Lião, Luciano M; de Carvalho, Flávio S; Romeiro, Luiz A S; Menegatti, Ricardo; Verli, Hugo; Villavicencio, Bianca; Valadares, Marize C

2016-09-01

The activation of the p53 pathway through the inhibition of MDM2 has been proposed as a novel therapeutic strategy against tumours. A series of cis-imidazoline analogues, termed nutlins, were reported to displace the recombinant p53 protein from its complex with MDM2 by binding to MDM2 in the p53 pocket, and exhibited an antitumour activity both in vitro and in vivo. Thus, the purpose of this study was to evaluate the antitumour properties of LQFM030 (2), a nutlin analogue created by employing the strategy of molecular simplification. LQFM030 (2) cytotoxicity was evaluated in Ehrlich ascites tumour (EAT) cells, p53 wild type, by the trypan blue exclusion test, and the mechanisms involved in EAT cell death were investigated by light and fluorescence microscopy, flow cytometry, real-time PCR and Western blotting. Our results demonstrate that LQFM030 has dose-dependent antiproliferative activity and cytotoxic activity on EAT cells, induces the accumulation of p53 protein and promotes cell cycle arrest and apoptosis. p53 gene transcription was unaffected by LQFM030 (2); however, MDM2 mRNA increased and MDM2 protein decreased. These results suggest that the small-molecule p53 activator LQFM030 (2) has the potential for further development as a novel cancer therapeutic agent. © 2016 Royal Pharmaceutical Society.

Delayed cell cycle progression in selenoprotein W depleted cells is regulated by a mitogen-activated protein kinase kinase 4–p38–p53 pathway

USDA-ARS?s Scientific Manuscript database

Selenoprotein W (SEPW1) is a ubiquitous, highly conserved thioredoxin-like protein whose depletion causes a p53- and p21Cip1-dependent G1-phase cell cycle arrest in breast and prostate epithelial cells. SEPW1 depletion increases phosphorylation of Ser33 in p53, which is associated with decreased p53...

Blocking angiotensin II Type 1 receptor triggers apoptotic cell death in human pancreatic cancer cells.

PubMed

Gong, Qiaoke; Davis, Molly; Chipitsyna, Galina; Yeo, Charles J; Arafat, Hwyda A

2010-07-01

Pancreatic ductal adenocarcinoma (PDA) is an aggressive malignancy with an annual mortality rate close to its annual incidence. We recently demonstrated that angiotensin II (AngII) type 1 receptor (AT1R) might be involved in PDA angiogenesis. This study evaluated the antiproliferative and proapoptotic effects of an AT1R blocker, losartan, in PDA cells with different p53 mutation status. Cell cycle was analyzed by flow cytometric analysis of DNA content; apoptosis by annexin V-fluorescein isothiocyanate (V-FITC) and terminal deoxytransferase (TdT)-mediated dUTP nick-end labeling staining; messenger RNA and protein by real-time polymerase chain reaction and Western blotting; caspase-3 activity by colorimetric assay; and promoter activity by luciferase assay. Losartan dose-dependently decreased cell survival and increased their preG1 accumulation. It also increased p53, p21, p27, and Bax and reduced Bcl-2 and Bcl-xl expression. In wtp53 cells, losartan increased p53 transcription and activated caspase-3 in both cell lines. However, its proapoptotic effects in mtp53 cells were mainly caspase-3-dependent. Our data describe the involvement of AT1R in PDA cell apoptotic machinery and provide the first evidences that losartan stimulates the proapoptotic signaling pathways regardless of the p53 mutation status. As loss of p53 function is frequently observed in PDA patients, our data suggest AT1R blockade as a novel therapeutic strategy to control PDA growth.

Pre-clinical efficacy and synergistic potential of the MDM2-p53 antagonists, Nutlin-3 and RG7388, as single agents and in combined treatment with cisplatin in ovarian cancer

PubMed Central

Zanjirband, Maryam; Edmondson, Richard J.; Lunec, John

2016-01-01

Ovarian cancer is the fifth leading cause of cancer-related female deaths. Due to serious side effects, relapse and resistance to standard chemotherapy, better and more targeted approaches are required. Mutation of the TP53 gene accounts for 50% of all human cancers. In the remaining malignancies, non-genotoxic activation of wild-type p53 by small molecule inhibition of the MDM2-p53 binding interaction is a promising therapeutic strategy. Proof of concept was established with the cis-imidazoline Nutlin-3, leading to the development of RG7388 and other compounds currently in early phase clinical trials. This preclinical study evaluated the effect of Nutlin-3 and RG7388 as single agents and in combination with cisplatin in a panel of ovarian cancer cell lines. Median-drug-effect analysis showed Nutlin-3 or RG7388 combination with cisplatin was additive to, or synergistic in a p53-dependent manner, resulting in increased p53 activation, cell cycle arrest and apoptosis, associated with increased p21WAF1 protein and/or caspase-3/7 activity compared to cisplatin alone. Although MDM2 inhibition activated the expression of p53-dependent DNA repair genes, the growth inhibitory and pro-apoptotic effects of p53 dominated the response. These data indicate that combination treatment with MDM2 inhibitors and cisplatin has synergistic potential for the treatment of ovarian cancer, dependent on cell genotype. PMID:27223080

p53-Regulated Apoptosis Is Differentiation Dependent in Ultraviolet B-Irradiated Mouse Keratinocytes

PubMed Central

Tron, Victor A.; Trotter, Martin J.; Tang, Liren; Krajewska, Maryla; Reed, John C.; Ho, Vincent C.; Li, Gang

1998-01-01

Previous studies from our laboratory, using p53 transgenic mice, have suggested that ultraviolet (UV) light-induced keratinocyte apoptosis in the skin is not affected by overexpression of mutant p53 protein. To further elucidate a possible role for p53 in UV-induced keratinocyte cell death, we now examine apoptosis in skin and isolated keratinocytes from p53 null (−/−) mice and assess the influence of cell differentiation on this process. In vivo, using this knockout model, epidermal keratinocytes in p53−/− mice exhibited only a 5.2-fold increase in apoptosis after 2000 J/m2 UVB irradiation compared with a 26.3-fold increase in normal control animals. If this p53-dependent apoptosis is important in elimination of precancerous, UV-damaged keratinocytes, then it should be active in the undifferentiated cells of the epidermal basal layer. To test this hypothesis, we examined the effect of differentiation on UV-induced apoptosis in primary cultures of murine and human keratinocytes. Apoptosis was p53-independent in undifferentiated murine keratinocytes, which exhibited relative resistance to UVB-induced killing with only a 1.5-fold increase in apoptosis in p53+/+ cells and a 1.4-fold increase in p53−/− cells. Differentiated keratinocytes, in contrast, showed a 9.4-fold UVB induction of apoptosis in p53+/+ cells, almost three times the induction observed in p53−/− cells. This UV-induced difference in apoptosis was observed when keratinocytes were cultured on type IV collagen substrate, but not on plastic alone. Western blotting of UV-irradiated, differentiated keratinocytes did not support a role for either Bax or Bcl-2 in this process. In support of these findings in mice, cell death in human cultured keratinocytes also occurred in a differentiation-associated fashion. We conclude that p53-induced apoptosis eliminates damaged keratinocytes in the differentiated cell compartment, but this mechanism is not active in the basal, undifferentiated cells and is therefore of questionable significance in protection against skin cancer induction. PMID:9708817

Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

PubMed

Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

2000-11-23

Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

Suppression of Familial Adenomatous Polyposis by CP-31398, a TP53 modulator, in APCmin/+ Mice1

PubMed Central

Rao, Chinthalapally V.; Swamy, Malisetty V.; Patlolla, Jagan M.R.; Kopelovich, Levy

2008-01-01

p53 mutations occur in a large number of human malignancies. Mutant p53 is unable to affect downstream genes necessary for DNA repair, cell cycle regulation, and apoptosis. The styrylquinazoline CP-31398 can rescue destabilized mutant p53 expression and promote activity of wild-type p53. The present study examines chemopreventive effects of CP-31398 on intestinal adenoma development in an animal model of familial adenomatous polyposis (FAP). Effects were examined at both early and late stages of adenoma formation. Effects of CP-31398 on early-stage adenomas were determined by feeding 7-week-old female C57B/6J-APCmin (heterozygous) and wild-type C57BL/6J mice with American Institute of Nutrition (AIN)-76A diets containing 0, 100, or 200 ppm CP-31398 for 75 days. To examine activity toward late-stage adenomas, CP31398 administration was delayed until 15 weeks of age and continued for 50 days. During early-stage intervention, dietary CP-31398 suppressed development of intestinal tumors by 36% (p < 0.001) and 75% (p < 0.0001), at low and high dose, respectively. During late-stage intervention, CP-31398 also significantly suppressed intestinal polyp formation, albeit to a lesser extent than observed with early intervention. Adenomas in treated mice showed increased apoptotic cell death and decreased proliferation in conjunction with increased expression of p53, p21WAF1/CIP, cleaved caspase-3, and cleaved poly (ADP-ribose) polymerase (PARP). These observations demonstrate for the first time that the p53-modulating agent CP-31398 possesses significant chemopreventive activity in vivo against intestinal neoplastic lesions in genetically-predisposed APCmin/+ mice. Chemopreventive activity of other agents that restore tumor suppressor functions of mutant p53 in tumor cells is currently under investigation. PMID:18794156

p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex.

PubMed

Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine

2009-04-01

Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.

p53 inactivation decreases dependence on estrogen/ERK signalling for proliferation but promotes EMT and susceptility to 3-bromopyruvate in ERα+ breast cancer MCF-7 cells.

PubMed

Rieber, Manuel; Strasberg-Rieber, Mary

2014-03-15

Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Mulberry leaf polyphenol extract induced apoptosis involving regulation of adenosine monophosphate-activated protein kinase/fatty acid synthase in a p53-negative hepatocellular carcinoma cell.

PubMed

Yang, Tzi-Peng; Lee, Huei-Jane; Ou, Ting-Tsz; Chang, Ya-Ju; Wang, Chau-Jong

2012-07-11

The polyphenols in mulberry leaf possess the ability to inhibit cell proliferation, invasion, and metastasis of tumors. It was reported that the p53 status plays an important role in switching apoptosis and the cell cycle following adenosine monophosphate-activated protein kinase (AMPK) activation. In this study, we aimed to detect the effect of the mulberry leaf polyphenol extract (MLPE) on inducing cell death in p53-negative (Hep3B) and p53-positive (Hep3B with transfected p53) hepatocellular carcinoma cells and also to clarify the role of p53 in MLPE-treated cells. After treatment of the Hep3B cells with MLPE, apoptosis was induced via the AMPK/PI3K/Akt and Bcl-2 family pathways. Transient transfection of p53 into Hep3B cells led to switching autophagy instead of apoptosis by MLPE treatment. We demonstrated that acridine orange staining and protein expressions of LC-3 and beclin-1 were increased in p53-transfected cells. These results implied induction of apoptosis or autophagy in MLPE-treated hepatocellular carcinoma cells can be due to the p53 status. We also found MLPE can not only activate AMPK but also diminish fatty acid synthase, a molecular target for cancer inhibition. At present, our results indicate MLPE can play an active role in mediating the cell death of hepatocellular carcinoma cells and the p53 might play an important role in regulating the death mechanisms.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Youn-hee; Kim, Donghern; Dai, Jin

Occupational and environmental exposure to arsenic (III) and chromium VI (Cr(VI)) have been confirmed to cause lung cancer. Mechanisms of these metals carcinogenesis are still under investigation. Selection of cell lines to be used is essential for the studies. Human bronchial epithelial BEAS-2B cells are the cells to be utilized by most of scientists. However, due to p53 missense mutation (CCG → TCG) at codon 47 and the codon 72 polymorphism (CGC → CCC) in BEAS-2B cells, its usage has frequently been questioned. The present study has examined activity and expression of 53 and its downstream target protein p21 uponmore » acute or chronic exposure of BEAS-2B cells to arsenic and Cr(VI). The results show that short-term exposure of BEAS-2B cells to arsenic or Cr(VI) was able to activate both p53 and p21. Chronic exposure of BEAS-2B cells to these two metals caused malignant cell transformation and tumorigenesis. In arsenic-transformed BEAS-2B cells reductions in p53 promoter activity, mRNA expression, and phosphorylation of p53 at Ser392 were observed, while the total p53 protein level remained the same compared to those in passage-matched parent ones. p21 promoter activity and expression were decreased in arsenic-transformed cells. Cr(VI)-transformed cells exhibit elevated p53 promoter activity, mRNA expression, and phosphorylation at Ser15, but reduced phosphorylation at Ser392 and total p53 protein level compared to passage-matched parent ones. p21 promoter activity and expression were elevated in Cr(VI)-transformed cells. These results demonstrate that p53 is able to respond to exposure of arsenic or Cr(VI), suggesting that BEAS-2B cells are an appropriate in vitro model to investigate arsenic or Cr(VI) induced lung cancer. - Highlights: • Short-term exposure of BEAS-2B cells to arsenic or Cr(VI) activates p53 and p21. • Chronic exposure of BEAS-2B cells to arsenic or Cr(VI) causes cell transformation and tumorigenesis. • Arsenic-transformed cells exhibit reduced activities of p53 and p21. • Cr(VI)-transformed cells exhibit increased activities of p53 and p21.« less

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression.

PubMed

Cathcart, Jillian M; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

2016-09-20

Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype.

Epithelial PIK3R1 (p85) and TP53 Regulate Survivin Expression during Adaptation to Ileocecal Resection.

PubMed

Cohran, Valeria; Managlia, Elizabeth; Bradford, Emily M; Goretsky, Tatiana; Li, Ting; Katzman, Rebecca B; Cheresh, Paul; Brown, Jeffrey B; Hawkins, Jennifer; Liu, Shirley X L; De Plaen, Isabelle G; Weitkamp, Jörn-Hendrik; Helmrath, Michael; Zhang, Zheng; Barrett, Terrence A

2016-07-01

Intestinal adaptation to small-bowel resection (SBR) after necrotizing enterocolitis expands absorptive surface areas and promotes enteral autonomy. Survivin increases proliferation and blunts apoptosis. The current study examines survivin in intestinal epithelial cells after ileocecal resection. Wild-type and epithelial Pik3r1 (p85α)-deficient mice underwent sham surgery or 30% resection. RNA and protein were isolated from small bowel to determine levels of β-catenin target gene expression, activated caspase-3, survivin, p85α, and Trp53. Healthy and post-resection human infant small-bowel sections were analyzed for survivin, Ki-67, and TP53 by immunohistochemistry. Five days after ileocecal resection, epithelial levels of survivin increased relative to sham-operated on mice, which correlated with reduced cleaved caspase-3, p85α, and Trp53. At baseline, p85α-deficient intestinal epithelial cells had less Trp53 and more survivin, and relative responses to resection were blunted compared with wild-type. In infant small bowel, survivin in transit amplifying cells increased 71% after SBR. Resection increased proliferation and decreased numbers of TP53-positive epithelial cells. Data suggest that ileocecal resection reduces p85α, which lowers TP53 activation and releases survivin promoter repression. The subsequent increase in survivin among transit amplifying cells promotes epithelial cell proliferation and lengthens crypts. These findings suggest that SBR reduces p85α and TP53, which increases survivin and intestinal epithelial cell expansion during therapeutic adaptation in patients with short bowel syndrome. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

PubMed Central

Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

2011-01-01

Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

PubMed

Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

2011-09-27

Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

The miR-1000-p53 pathway regulates apoptosis and virus infection in shrimp.

PubMed

Gong, Yi; Ju, Chenyu; Zhang, Xiaobo

2015-10-01

The p53 protein plays an important role in apoptosis which is involved in the immunity of animals. However, effects of the miRNA-mediated regulation of p53 expression on apoptosis and virus infection are not extensively investigated. To address this issue, the miRNA-mediated p53-dependent apoptotic pathway was explored in this study. The results indicated that p53 could regulate the apoptotic activity of Marsupenaeus japonicas shrimp and influence the infection of white spot syndrome virus (WSSV). The further data presented that miR-1000 could target the 3'-untranslated region (3'UTR) of p53 gene. The results of in vivo experiments showed that the miR-1000 overexpression led to significant decreases of shrimp apoptotic activity and the capacity of WSSV infection, while the miR-1000 silencing resulted in significant increases of apoptotic activity and virus infection, indicating that miR-1000 took great effects on apoptosis and virus infection by targeting p53. Therefore, our study revealed a novel mechanism that the miR-1000-p53 pathway regulated apoptosis and virus infection in shrimp. Copyright © 2015 Elsevier Ltd. All rights reserved.

Increased toll-like receptors and p53 levels regulate apoptosis and angiogenesis in non-muscle invasive bladder cancer: mechanism of action of P-MAPA biological response modifier.

PubMed

Garcia, Patrick Vianna; Seiva, Fábio Rodrigues Ferreira; Carniato, Amanda Pocol; de Mello Júnior, Wilson; Duran, Nelson; Macedo, Alda Maria; de Oliveira, Alexandre Gabarra; Romih, Rok; Nunes, Iseu da Silva; Nunes, Odilon da Silva; Fávaro, Wagner José

2016-07-07

The new modalities for treating patients with non-muscle invasive bladder cancer (NMIBC) for whom BCG (Bacillus Calmette-Guerin) has failed or is contraindicated are recently increasing due to the development of new drugs. Although agents like mitomycin C and BCG are routinely used, there is a need for more potent and/or less-toxic agents. In this scenario, a new perspective is represented by P-MAPA (Protein Aggregate Magnesium-Ammonium Phospholinoleate-Palmitoleate Anhydride), developed by Farmabrasilis (non-profit research network). This study detailed and characterized the mechanisms of action of P-MAPA based on activation of mediators of Toll-like Receptors (TLRs) 2 and 4 signaling pathways and p53 in regulating angiogenesis and apoptosis in an animal model of NMIBC, as well as, compared these mechanisms with BCG treatment. Our results demonstrated the activation of the immune system by BCG (MyD88-dependent pathway) resulted in increased inflammatory cytokines. However, P-MAPA intravesical immunotherapy led to distinct activation of TLRs 2 and 4-mediated innate immune system, resulting in increased interferons signaling pathway (TRIF-dependent pathway), which was more effective in the NMIBC treatment. Interferon signaling pathway activation induced by P-MAPA led to increase of iNOS protein levels, resulting in apoptosis and histopathological recovery. Additionally, P-MAPA immunotherapy increased wild-type p53 protein levels. The increased wild-type p53 protein levels were fundamental to NO-induced apoptosis and the up-regulation of BAX. Furthermore, interferon signaling pathway induction and increased p53 protein levels by P-MAPA led to important antitumor effects, not only suppressing abnormal cell proliferation, but also by preventing continuous expansion of tumor mass through suppression of angiogenesis, which was characterized by decreased VEGF and increased endostatin protein levels. Thus, P-MAPA immunotherapy could be considered an important therapeutic strategy for NMIBC, as well as, opens a new perspective for treatment of patients that are refractory or resistant to BCG intravesical therapy.

LincRNA-p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint

PubMed Central

Dimitrova, Nadya; Zamudio, Jesse R.; Jong, Robyn M.; Soukup, Dylan; Resnick, Rebecca; Sarma, Kavitha; Ward, Amanda J.; Raj, Arjun; Lee, Jeannie; Sharp, Phillip A.; Jacks, Tyler

2014-01-01

SUMMARY The p53-regulated long non-coding RNA lincRNA-p21 has been proposed to act in trans via several mechanisms ranging from repressing genes in the p53 transcriptional network to regulating mRNA translation and protein stability. To further examine lincRNA-p21 function we generated a conditional knockout mouse model. We find that lincRNA-p21 predominantly functions in cis to activate expression of its neighboring gene, p21. Mechanistically, we show that lincRNA-p21 acts in concert with hnRNP-K as a co-activator for p53-dependent p21 transcription. Additional phenotypes of lincRNA-p21 deficiency could be attributed to diminished p21 levels, including deregulated expression and altered chromatin state of some Polycomb target genes, defective G1/S checkpoint, increased proliferation rates, and enhanced reprogramming efficiency. These findings indicate that lincRNA-p21 affects global gene expression and influences the p53 tumor suppressor pathway by acting in cis as a locus-restricted co-activator for p53-mediated p21 expression. PMID:24857549

Exercise Activates p53 and Negatively Regulates IGF-1 Pathway in Epidermis within a Skin Cancer Model.

PubMed

Yu, Miao; King, Brenee; Ewert, Emily; Su, Xiaoyu; Mardiyati, Nur; Zhao, Zhihui; Wang, Weiqun

2016-01-01

Exercise has been previously reported to lower cancer risk through reducing circulating IGF-1 and IGF-1-dependent signaling in a mouse skin cancer model. This study aims to investigate the underlying mechanisms by which exercise may down-regulate the IGF-1 pathway via p53 and p53-related regulators in the skin epidermis. Female SENCAR mice were pair-fed an AIN-93 diet with or without 10-week treadmill exercise at 20 m/min, 60 min/day and 5 days/week. Animals were topically treated with TPA 2 hours before sacrifice and the target proteins in the epidermis were analyzed by both immunohistochemistry and Western blot. Under TPA or vehicle treatment, MDM2 expression was significantly reduced in exercised mice when compared with sedentary control. Meanwhile, p53 was significantly elevated. In addition, p53-transcriptioned proteins, i.e., p21, IGFBP-3, and PTEN, increased in response to exercise. There was a synergy effect between exercise and TPA on the decreased MDM2 and increased p53, but not p53-transcripted proteins. Taken together, exercise appeared to activate p53, resulting in enhanced expression of p21, IGFBP-3, and PTEN that might induce a negative regulation of IGF-1 pathway and thus contribute to the observed cancer prevention by exercise in this skin cancer model.

p53 as a retrovirus-induced oxidative stress modulator.

PubMed

Kim, Soo Jin; Wong, Paul K Y

2015-01-01

Infection of astrocytes by the neuropathogenic mutant of Moloney murine leukemia virus, ts1, exhibits increased levels of reactive oxygen species (ROS) and signs of oxidative stress compared with uninfected astrocytes. Previously, we have demonstrated that ts1 infection caused two separate events of ROS upregulation. The first upregulation occurs during early viral establishment in host cells and the second during the virus-mediated apoptotic process. In this study, we show that virus-mediated ROS upregulation activates the protein kinase, ataxia telangiectasia mutated, which in turn phosphorylates serine 15 on p53. This activation of p53 however, is unlikely associated with ts1-induced cell death. Rather p53 appears to be involved in suppressing intracellular ROS levels in astrocytes under oxidative stress. The activated p53 appears to delay retroviral gene expression by suppressing NADPH oxidase, a superoxide-producing enzyme. These results suggest that p53 plays a role as a retrovirus-mediated oxidative stress modulator. © 2015 The Authors.

The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

NASA Technical Reports Server (NTRS)

Kohli, M.; Jorgensen, T. J.

1999-01-01

The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

Distinct downstream targets manifest p53-dependent pathologies in mice.

PubMed

Pant, V; Xiong, S; Chau, G; Tsai, K; Shetty, G; Lozano, G

2016-11-03

Mdm2, the principal negative regulator of p53, is critical for survival, a fact clearly demonstrated by the p53-dependent death of germline or conditional mice following deletion of Mdm2. On the other hand, Mdm2 hypomorphic (Mdm2 Puro/Δ7-12 ) or heterozygous (Mdm2 +/- ) mice that express either 30 or 50% of normal Mdm2 levels, respectively, are viable but present distinct phenotypes because of increased p53 activity. Mdm2 levels are also transcriptionally regulated by p53. We evaluated the significance of this reciprocal relationship in a new hypomorphic mouse model inheriting an aberrant Mdm2 allele with insertion of the neomycin cassette and deletion of 184-bp sequence in intron 3. These mice also carry mutations in the Mdm2 P2-promoter and thus express suboptimal levels of Mdm2 entirely encoded from the P1-promoter. Resulting mice exhibit abnormalities in skin pigmentation and reproductive tissue architecture, and are subfertile. Notably, all these phenotypes are rescued on a p53-null background. Furthermore, these phenotypes depend on distinct p53 downstream activities as genetic ablation of the pro-apoptotic gene Puma reverts the reproductive abnormalities but not skin hyperpigmentation, whereas deletion of cell cycle arrest gene p21 does not rescue either phenotype. Moreover, p53-mediated upregulation of Kitl influences skin pigmentation. Altogether, these data emphasize tissue-specific p53 activities that regulate cell fate.

MDM2 restrains estrogen-mediated AKT activation by promoting TBK1-dependent HPIP degradation

PubMed Central

Shostak, K; Patrascu, F; Göktuna, S I; Close, P; Borgs, L; Nguyen, L; Olivier, F; Rammal, A; Brinkhaus, H; Bentires-Alj, M; Marine, J-C; Chariot, A

2014-01-01

Restoration of p53 tumor suppressor function through inhibition of its interaction and/or enzymatic activity of its E3 ligase, MDM2, is a promising therapeutic approach to treat cancer. However, because the MDM2 targetome extends beyond p53, MDM2 inhibition may also cause unwanted activation of oncogenic pathways. Accordingly, we identified the microtubule-associated HPIP, a positive regulator of oncogenic AKT signaling, as a novel MDM2 substrate. MDM2-dependent HPIP degradation occurs in breast cancer cells on its phosphorylation by the estrogen-activated kinase TBK1. Importantly, decreasing Mdm2 gene dosage in mouse mammary epithelial cells potentiates estrogen-dependent AKT activation owing to HPIP stabilization. In addition, we identified HPIP as a novel p53 transcriptional target, and pharmacological inhibition of MDM2 causes p53-dependent increase in HPIP transcription and also prevents HPIP degradation by turning off TBK1 activity. Our data indicate that p53 reactivation through MDM2 inhibition may result in ectopic AKT oncogenic activity by maintaining HPIP protein levels. PMID:24488098

Negative feedback regulation of wild-type p53 biosynthesis.

PubMed Central

Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

1995-01-01

When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

Phosphorylation and ubiquitination-dependent degradation of CABIN1 releases p53 for transactivation upon genotoxic stress.

PubMed

Choi, Soo-Youn; Jang, Hyonchol; Roe, Jae-Seok; Kim, Seong-Tae; Cho, Eun-Jung; Youn, Hong-Duk

2013-02-01

CABIN1 acts as a negative regulator of p53 by keeping p53 in an inactive state on chromatin. Genotoxic stress causes rapid dissociation of CABIN1 and activation of p53. However, its molecular mechanism is still unknown. Here, we reveal the phosphorylation- and ubiquitination-dependent degradation of CABIN1 upon DNA damage, releasing p53 for transcriptional activation. The DNA-damage-signaling kinases, ATM and CHK2, phosphorylate CABIN1 and increase the degradation of CABIN1 protein. Knockdown or overexpression of these kinases influences the stability of CABIN1 protein showing that their activity is critical for degradation of CABIN1. Additionally, CABIN1 was found to undergo ubiquitin-dependent proteasomal degradation mediated by the CRL4DDB2 ubiquitin ligase complex. Both phosphorylation and ubiquitination of CABIN1 appear to be relevant for controlling the level of CABIN1 protein upon genotoxic stress.

I(2)(PP2A) regulates p53 and Akt correlatively and leads the neurons to abort apoptosis.

PubMed

Liu, Gong-Ping; Wei, Wei; Zhou, Xin; Zhang, Yao; Shi, Hai-Hong; Yin, Jun; Yao, Xiu-Qing; Peng, Cai-Xia; Hu, Juan; Wang, Qun; Li, Hong-Lian; Wang, Jian-Zhi

2012-02-01

A chronic neuron loss is the cardinal pathology in Alzheimer disease (AD), but it is still not understood why most neurons in AD brain do not accomplish apoptosis even though they are actually exposed to an environment with enriched proapoptotic factors. Protein phosphatase-2A inhibitor-2 (I(2)(PP2A)), an endogenous PP2A inhibitor, is significantly increased in AD brain, but the role of I(2)(PP2A) in AD-like neuron loss is elusive. Here, we show that I(2)(PP2A) regulates p53 and Akt correlatively. The mechanisms involve activated transcription and p38 MAPK activities. More importantly, we demonstrate that the simultaneous activation of Akt induced by I(2)(PP2A) counteracts the hyperactivated p53-induced cell apoptosis. Furthermore, I(2)(PP2A), p53 and Akt are all elevated in the brain of mouse model and AD patients. Our results suggest that the increased I(2)(PP2A) may trigger apoptosis by p53 upregulation, but due to simultaneous activation of Akt, the neurons are aborted from the apoptotic pathway. This finding contributes to the understanding of why most neurons in AD brain do not undergo apoptosis. Copyright © 2010. Published by Elsevier Inc.

Curcumin induces permanent growth arrest of human colon cancer cells: link between senescence and autophagy.

PubMed

Mosieniak, Grazyna; Adamowicz, Marek; Alster, Olga; Jaskowiak, Hubert; Szczepankiewicz, Andrzej A; Wilczynski, Grzegorz M; Ciechomska, Iwona A; Sikora, Ewa

2012-06-01

Curcumin, a natural polyphenol derived from the rhizome of Curcuma longa, is a potent anticancer agent, which restricts tumor cell growth both in vitro and in vivo. Thus far curcumin was shown to induce death of cancer cells. This study reports the induction of cellular senescence of human colon cancer cells HCT116 upon curcumin treatment. The SA-β-galactosidase activation was observed both in p53+/+ and p53-/- cells, however the latter ones were less sensitive to the prosenescent activity of curcumin. Upregulation of p53 and p21 proteins was observed in p53+/+ HCT116, while p53-independent induction of p21 was noticed in p53-/- HCT116. Moreover, the senescence of HCT116 cells was accompanied by autophagy, that was confirmed by electron microscopy observations of autophagosomes in the curcumin-treated cells as well as LC3-II expression, punctue staining of LC3 and increased content of acidic vacuoles. Inhibition of autophagy, due to the diminished expression of ATG5 by RNAi decreased the number of senescent cells induced by curcumin, but did not lead to increased cell death. Altogether, we demonstrated a new antitumor activity of curcumin leading to cancer cell senescence and revealed the presence of a functional link between senescence and autophagy in curcumin-treated cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Rpl27a mutation in the sooty foot ataxia mouse phenocopies high p53 mouse models

PubMed Central

Terzian, Tamara; Dumble, Melissa; Arbab, Farinaz; Thaller, Christina; Donehower, Lawrence A; Lozano, Guillermina; Justice, Monica J; Roop, Dennis R; Box, Neil F

2013-01-01

Ribosomal stress is an important, yet poorly understood, mechanism that results in activation of the p53 tumour suppressor. We present a mutation in the ribosomal protein Rpl27a gene (sooty foot ataxia mice), isolated through a sensitized N-ethyl-N-nitrosourea (ENU) mutagenesis screen for p53 pathway defects, that shares striking phenotypic similarities with high p53 mouse models, including cerebellar ataxia, pancytopenia and epidermal hyperpigmentation. This phenocopy is rescued in a haploinsufficient p53 background. A detailed examination of the bone marrow in these mice identified reduced numbers of haematopoietic stem cells and a p53-dependent c-Kit down-regulation. These studies suggest that reduced Rpl27a increases p53 activity in vivo, further evident with a delay in tumorigenesis in mutant mice. Taken together, these data demonstrate that Rpl27a plays a crucial role in multiple tissues and that disruption of this ribosomal protein affects both development and transformation. PMID:21674502

Proton induces apoptosis of hypoxic tumor cells by the p53-dependent and p38/JNK MAPK signaling pathways.

PubMed

Lee, Kheun Byeol; Kim, Kye-Ryung; Huh, Tae-Lin; Lee, You Mie

2008-12-01

Tumor hypoxia is a main obstacle for radiation therapy. To investigate whether exposure to a proton beam can overcome radioresistance in hypoxic tumor cells, three kinds of cancer cells, Lewis lung carcinoma (LLC) cells, hepatoma HepG2 and Molt-4 leukemia cells, were treated with a proton beam (35 MeV, 1, 2, 5, 10 Gy) in the presence or absence of hypoxia. Cell death rates were determined 72 h after irradiation. Hypoxic cells exposed to the proton beam underwent a typical apoptotic program, showing condensed nuclei, fragmented DNA ladders, and poly-ADP-ribose polymerase (PARP) cleavage. Fluorescence-activated cell sorter analysis revealed a significant increase in Annexin-V-positive cells. Cells treated with the proton beam and hypoxia displayed increased expression of p53, p21 and Bax, but decreased levels of phospho-Rb, Bcl-2 and XIAP, as well as activated caspase-9 and -3. The proton beam with hypoxia induced cell death in wild-type HCT116 cells, but not in a p53 knockout cell line, demonstrating a requirement for p53. As reactive oxygen species (ROS) were also significantly increased, apoptosis could also be abolished by treatment with the anti-oxidant N-acetyl cysteine (NAC). P38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK) were activated by the treatment, and their respective DN mutants restored the cell death induced by either proton therapy alone or with hypoxia. In conclusion, proton beam treatment did not differently regulate cancer cell apoptosis either in normoxic or hypoxic conditions via a p53-dependent mechanism and by the activation of p38/JNK MAPK pathways through ROS.

Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression

PubMed Central

Cathcart, Jillian M.; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

2016-01-01

Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype. PMID:27531896

Glucocorticoid receptor activation inhibits p53-induced apoptosis of MCF10Amyc cells via induction of protein kinase Cε.

PubMed

Aziz, Moammir H; Shen, Hong; Maki, Carl G

2012-08-24

Glucocorticoid receptor (GR) is a ligand-dependent transcription factor that can promote apoptosis or survival in a cell-specific manner. Activated GR has been reported to inhibit apoptosis in mammary epithelial cells and breast cancer cells by increasing pro-survival gene expression. In this study, activated GR inhibited p53-dependent apoptosis in MCF10A cells and human mammary epithelial cells that overexpress the MYC oncogene. Specifically, GR agonists hydrocortisone or dexamethasone inhibited p53-dependent apoptosis induced by cisplatin, ionizing radiation, or the MDM2 antagonist Nutlin-3. In contrast, the GR antagonist RU486 sensitized the cells to apoptosis by these agents. Apoptosis inhibition was associated with maintenance of mitochondrial membrane potential, diminished caspase-3 and -7 activation, and increased expression at both the mRNA and protein level of the anti-apoptotic PKC family member PKCε. Knockdown of PKCε via siRNA targeting reversed the protective effect of dexamethasone and restored apoptosis sensitivity. These data provide evidence that activated GR can inhibit p53-dependent apoptosis through induction of the anti-apoptotic factor PKCε.

Cell cycle regulation and apoptosis mediated by p53 in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei.

PubMed

Nuñez-Hernandez, Dahlia M; Felix-Portillo, Monserrath; Peregrino-Uriarte, Alma B; Yepiz-Plascencia, Gloria

2018-01-01

Although hypoxic aquatic environments cause negative effects on shrimp, these animals can withstand somewhat hypoxia, but the cellular mechanisms underlying this capacity are still poorly understood. In humans, mild hypoxia causes the induction of many proteins to allow cell survival. In contrast, apoptosis is induced during severe hypoxia leading to cell death. p53 is a key transcription factor that determines cells fate towards cell cycle arrest or induction of apoptosis in humans. The aim of this work was to study the role of p53 in cell cycle regulation and apoptosis in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei. p53 was silenced by RNAi and afterwards the shrimp were exposed to hypoxia. Cdk-2 was used as indicator of cell cycle progression while caspase-3 expression and caspase activity were analyzed as indicators of apoptosis. p53 levels in hepatopancreas were significantly higher at 48 h after hypoxic treatment. Increased expression levels of Cdk-2 were found in p53-silenced shrimp after 24 and 48 h in the normoxic treatments as well as 48 h after hypoxia, indicating a possible role of p53 in cell cycle regulation. In response to hypoxia, unsilenced shrimp showed an increase in caspase-3 expression levels, however an increase was also observed in caspase activity at 24 h of normoxic conditions in p53-silenced shrimps. Taken together these results indicate the involvement of p53 in regulation of cell cycle and apoptosis in the white shrimp in response to hypoxia. Copyright © 2017 Elsevier Ltd. All rights reserved.

Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53

PubMed Central

Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich

2011-01-01

Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600

Activation of miR-34a/SIRT1/p53 signaling contributes to cochlear hair cell apoptosis: implications for age-related hearing loss.

PubMed

Xiong, Hao; Pang, Jiaqi; Yang, Haidi; Dai, Min; Liu, Yimin; Ou, Yongkang; Huang, Qiuhong; Chen, Suijun; Zhang, Zhigang; Xu, Yaodong; Lai, Lan; Zheng, Yiqing

2015-04-01

The molecular mechanisms underlying age-related hearing loss are not fully understood, and currently, there is no treatment for this disorder. MicroRNAs have recently been reported to be increasingly associated with age-related diseases and are emerging as promising therapeutic targets. In this study, miR-34a/Sirtuin 1 (SIRT1)/p53 signaling was examined in cochlear hair cells during aging. MiR-34a, p53 acetylation, and apoptosis increased in the cochlea of C57BL/6 mice with aging, whereas an age-related decrease in SIRT1 was observed. In the inner ear HEI-OC1 cell line, miR-34a overexpression inhibited SIRT1, leading to an increase in p53 acetylation and apoptosis. Moreover, miR-34a knockdown increased SIRT1 expression and diminished p53 acetylation, and apoptosis. Additionally, resveratrol, an activator of SIRT1, significantly rescued miR-34a overexpression-induced HEI-OC1 cell death and significantly reduced hearing threshold shifts and hair cell loss in C57BL/6 mice after a 2-month administration. Our results support a link between age-related cochlear hair cell apoptosis and miR-34a/SIRT1/p53 signaling, which may serve as a potential target for age-related hearing loss treatment. Copyright © 2015 Elsevier Inc. All rights reserved.

Unbalancing p53/Mdm2/IGF-1R axis by Mdm2 activation restrains the IGF-1-dependent invasive phenotype of skin melanoma

PubMed Central

Worrall, C; Suleymanova, N; Crudden, C; Trocoli Drakensjö, I; Candrea, E; Nedelcu, D; Takahashi, S-I; Girnita, L; Girnita, A

2017-01-01

Melanoma tumors usually retain wild-type p53; however, its tumor-suppressor activity is functionally disabled, most commonly through an inactivating interaction with mouse double-minute 2 homolog (Mdm2), indicating p53 release from this complex as a potential therapeutic approach. P53 and the tumor-promoter insulin-like growth factor type 1 receptor (IGF-1R) compete as substrates for the E3 ubiquitin ligase Mdm2, making their relative abundance intricately linked. Hence we investigated the effects of pharmacological Mdm2 release from the Mdm2/p53 complex on the expression and function of the IGF-1R. Nutlin-3 treatment increased IGF-1R/Mdm2 association with enhanced IGF-1R ubiquitination and a dual functional outcome: receptor downregulation and selective downstream signaling activation confined to the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway. This Nutlin-3 functional selectivity translated into IGF-1-mediated bioactivities with biphasic effects on the proliferative and metastatic phenotype: an early increase and late decrease in the number of proliferative and migratory cells, while the invasiveness was completely inhibited following Nutlin-3 treatment through an impaired IGF-1-mediated matrix metalloproteinases type 2 activation mechanism. Taken together, these experiments reveal the biased agonistic properties of Nutlin-3 for the mitogen-activated protein kinase pathway, mediated by Mdm2 through IGF-1R ubiquitination and provide fundamental insights into destabilizing p53/Mdm2/IGF-1R circuitry that could be developed for therapeutic gain. PMID:28092675

Combined CSL and p53 downregulation promotes cancer-associated fibroblast activation

PubMed Central

Procopio, Maria-Giuseppina; Laszlo, Csaba; Labban, Dania Al; Kim, Dong Eun; Bordignon, Pino; Jo, Seunghee; Goruppi, Sandro; Menietti, Elena; Ostano, Paola; Ala, Ugo; Provero, Paolo; Hoetzenecker, Wolfram; Neel, Victor; Kilarski, Witek; Swartz, Melody A.; Brisken, Cathrin; Lefort, Karine; Dotto, G. Paolo

2015-01-01

Stromal fibroblast senescence has been linked to aging-associated cancer risk. However, density and proliferation of cancer-associated fibroblasts (CAF) are frequently increased. Loss or down-modulation of the Notch effector CSL/RBP-Jκ in dermal fibroblasts is sufficient for CAF activation and ensuing keratinocyte-derived tumors. We report that CSL silencing induces senescence of primary fibroblasts from dermis, oral mucosa, breast and lung. CSL functions in these cells as direct repressor of multiple senescence- and CAF-effector genes. It also physically interacts with p53, repressing its activity. CSL is down-modulated in stromal fibroblasts of premalignant skin actinic keratosis lesions and squamous cell carcinomas (SCC), while p53 expression and function is down-modulated only in the latter, with paracrine FGF signaling as likely culprit. Concomitant loss of CSL and p53 overcomes fibroblast senescence, enhances expression of CAF effectors and promotes stromal and cancer cell expansion. The findings support a CAF activation/stromal co-evolution model under convergent CSL/p53 control. PMID:26302407

TRIM25 enhances cell growth and cell survival by modulating p53 signals via interaction with G3BP2 in prostate cancer.

PubMed

Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi

2018-04-01

Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.

Exposure to cigarette smoke increases apoptosis in the rat gastric mucosa through a reactive oxygen species-mediated and p53-independent pathway.

PubMed

Wang, H; Ma, L; Li, Y; Cho, C H

2000-04-01

Cigarette smoking is a major risk factor for gastric cancer and peptic ulcer. The aim of our study was to investigate the relationship between exposure to cigarette smoke and apoptosis in the rat gastric mucosa and the mechanism involved. Rats were exposed to different concentrations of cigarette smoke (0, 2, and 4%) once daily for a different number of 1 h periods (1, 3, 6, and 9 d). Apoptosis was identified by the terminal deoxy-transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) method and caspase-3 activity. The mucosal xanthine oxidase (XO) activity and p53 level were also measured. The results showed that exposure to cigarette smoke produced a time- and concentration-dependent increase in apoptosis in the rat gastric mucosa that was accompanied by an increase in XO activity. The increased apoptosis and XO activity could be detected after even a single exposure. In contrast, the level of p53 was elevated only in the later stage of cigarette smoke exposure. The apoptotic effect could be blocked by pretreatment with an XO inhibitor (allopurinol, 20 mg/kg intraperitoneally) or a hydroxyl free radical scavenger (DMSO, 0.2%, 1 ml/kg intravenously). However, neither of these treatments had any effect on the p53 level of the mucosa. In summary, we conclude that exposure to cigarette smoke can increase apoptosis in the rat gastric mucosa through a reactive oxygen species- (ROS) mediated and a p53-independent pathway.

A stapled peptide antagonist of MDM2 carried by polymeric micelles sensitizes glioblastoma to temozolomide treatment through p53 activation

PubMed Central

Chen, Xishan; Tai, Lingyu; Gao, Jie; Qian, Jianchang; Zhang, Mingfei; Li, Beibei; Xie, Cao; Lu, Linwei; Lu, Wuyuan; Lu, Weiyue

2017-01-01

Antagonizing MDM2 and MDMX to activate the tumor suppressor protein p53 is an attractive therapeutic paradigm for the treatment of glioblastoma multiforme (GBM). However, challenges remain with respect to the poor ability of p53 activators to efficiently cross the blood–brain barrier and/or blood–brain tumor barrier and to specifically target tumor cells. To circumvent these problems, we developed a cyclic RGD peptide-conjugated poly(-ethylene glycol)-co-poly(lactic acid) polymeric micelle (RGD-M) that carried a stapled peptide antagonist of both MDM2 and MDMX (sPMI). The peptide-carrying micelle RGD-M/sPMI was prepared via film-hydration method with high encapsulation efficiency and loading capacity as well as ideal size distribution. Micelle encapsulation dramatically increased the solubility of sPMI, thus alleviating its serum sequestration. In vitro studies showed that RGD-M/sPMI efficiently inhibited the proliferation of glioma cells in the presence of serum by activating the p53 signaling pathway. Further, RGD-M/sPMI exerted potent tumor growth inhibitory activity against human glioblastoma in nude mouse xenograft models. Importantly, the combination of RGD-M/sPMI and temozolomide — a standard chemotherapy drug for GBM increased antitumor efficacy against glioblastoma in experimental animals. Our results validate a combination therapy using p53 activators with temozolomide as a more effective treatment for GBM. PMID:26428461

Pharmacological activation of a novel p53-dependent S-phase checkpoint involving CHK-1

PubMed Central

Ahmed, A; Yang, J; Maya-Mendoza, A; Jackson, D A; Ashcroft, M

2011-01-01

We have recently shown that induction of the p53 tumour suppressor protein by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis; 2,5-bis(5-hydroxymethyl-2-thienyl)furan) inhibits hypoxia-inducible factor-1α and vascular endothelial growth factor expression in vivo and induces p53-dependent tumour cell apoptosis in normoxia and hypoxia. Here, we demonstrate that RITA activates the canonical ataxia telangiectasia mutated/ataxia telangiectasia and Rad3-related DNA damage response pathway. Interestingly, phosphorylation of checkpoint kinase (CHK)-1 induced in response to RITA was influenced by p53 status. We found that induction of p53, phosphorylated CHK-1 and γH2AX proteins was significantly increased in S-phase. Furthermore, we found that RITA stalled replication fork elongation, prolonged S-phase progression and induced DNA damage in p53 positive cells. Although CHK-1 knockdown did not significantly affect p53-dependent DNA damage or apoptosis induced by RITA, it did block the ability for DNA integrity to be maintained during the immediate response to RITA. These data reveal the existence of a novel p53-dependent S-phase DNA maintenance checkpoint involving CHK-1. PMID:21593792

Aciculatin Induces p53-Dependent Apoptosis via MDM2 Depletion in Human Cancer Cells In Vitro and In Vivo

PubMed Central

Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih

2012-01-01

Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688

Phosphorylated Hsp27 activates ATM-dependent p53 signaling and mediates the resistance of MCF-7 cells to doxorubicin-induced apoptosis.

PubMed

Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin

2013-05-01

DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.

Metabolic activation of 2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine and DNA adduct formation depends on p53: Studies in Trp53(+/+),Trp53(+/-) and Trp53(-/-) mice.

PubMed

Krais, Annette M; Speksnijder, Ewoud N; Melis, Joost P M; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H; Arlt, Volker M

2016-02-15

The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)-mediated biotransformation. The carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/-) and Trp53(-/-) mice with a single oral dose of 50 mg/kg body weight PhIP. N-(Deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP-C8-dG) levels in DNA, measured by liquid chromatography-tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(-/-) mice compared to Trp53(+/+) mice. Lower PhIP-DNA adduct levels in the livers of Trp53(-/-) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin-O-demethylase activity) in these animals. Interestingly, PhIP-DNA adduct levels were significantly higher in kidney and bladder of Trp53(-/-) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2-naphthylsulfate formation from 2-naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue-dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP-DNA adduct formation. © 2015 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

Regulation of p53 expression and apoptosis by vault RNA2-1-5p in cervical cancer cells.

PubMed

Kong, Lu; Hao, Qi; Wang, Ying; Zhou, Ping; Zou, Binbin; Zhang, Yu-xiang

2015-09-29

nc886 or VRNA2-1 has recently been identified as a noncoding RNA instead of a vault RNA or a pre-microRNA. Several studies have reported that pre-miR-886 plays a tumor-suppressive role in a wide range of cancer cells through its activity as a cellular protein kinase RNA-activated (PKR) ligand and repressor. However, by sequencing stem-PCR products, we found that a microRNA originating from this precursor, vault RNA2-1-5p (VTRNA2-1-5p), occurs in cervical cancer cells. The expression levels of the predicted targets of VTRNA2-1-5p are negatively correlated with VTRNA2-1-5p levels by quantitative reversion transcription PCR (qRT-PCR). Previous results have shown that VTRNA2-1-5p is overexpressed in human cervical squamous cell carcinomas (CSCCs) compared with adjacent healthy tissues. Inhibition of VTRNA2-1-5p increases Bax protein expression and apoptotic cell death in cervical cancer cells. Our findings suggest that VTRNA2-1-5p has oncogenic activity related to the progression of cervical cancer. Here, we report that VTRNA2-1-5p directly targeted p53 expression and functioned as an oncomir in cervical cancer. VTRNA2-1-5p inhibition decreased cervical cancer cell invasion, proliferation, and tumorigenicity while increasing apoptosis and p53 expression. Interestingly, VTRNA2-1-5p inhibition also increased cisplatin-induced apoptosis of HeLa and SiHa cells. In human clinical cervical cancer specimens, low p53 expression and high VTRNA2-1-5p expression were positively associated.In addition, VTRNA2-1-5p was found to directly target the 5' and 3' untranslated regions (UTRs) of p53. We propose that VTRNA2-1-5p is a direct regulator of p53 and suggest that it plays an essential role in the apoptosis and proliferation of cervical cancer cells.

B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang Xin; Xu Ke; Xu Yufang

The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report heremore » that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P{sub 2} promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research Highlights: > B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. > B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. > B1 induced significant increase of p53 binding to Bcl-2 P{sub 2} promoter TATA box.« less

Dux4 induces cell cycle arrest at G1 phase through upregulation of p21 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Hongliang; Wang, Zhaoxia; Jin, Suqin

2014-03-28

Highlights: • Dux4 induced TE671 cell proliferation defect and G1 phase arrest. • Dux4 upregulated p21 expression without activating p53. • Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. • Sp1 binding site was required for Dux4-induced p21 promoter activation. - Abstract: It has been implicated that Dux4 plays crucial roles in development of facioscapulohumeral dystrophy. But the underlying myopathic mechanisms and related down-stream events of this retrogene were far from clear. Here, we reported that overexpression of Dux4 in a cell model TE671 reduced cell proliferation rate, and increased G1 phase accumulation. We also determined themore » impact of Dux4 on p53/p21 signal pathway, which controls the checkpoint in cell cycle progression. Overexpression of Dux4 increased p21 mRNA and protein level, while expression of p53, phospho-p53 remained unchanged. Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. Furthermore, we demonstrated that enhanced Dux4 expression increased p21 promoter activity and elevated expression of Sp1 transcription factor. Mutation of Sp1 binding site decreased dux4 induced p21 promoter activation. Chromatin immunoprecipitation (ChIP) assays confirmed the Dux4-induced binding of Sp1 to p21 promoter in vivo. These results suggest that Dux4 might induce proliferation inhibition and G1 phase arrest through upregulation of p21.« less

Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

PubMed

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Inhibition of Mdmx (Mdm4) in vivo induces anti-obesity effects.

PubMed

Kon, Ning; Wang, Donglai; Li, Tongyuan; Jiang, Le; Qiang, Li; Gu, Wei

2018-01-26

Although cell-cycle arrest, senescence and apoptosis remain as major canonical activities of p53 in tumor suppression, the emerging role of p53 in metabolism has been a topic of great interest. Nevertheless, it is not completely understood how p53-mediated metabolic activities are regulated in vivo and whether this part of the activities has an independent role beyond tumor suppression. Mdmx (also called Mdm4), like Mdm2, acts as a major suppressor of p53 but the embryonic lethality of mdmx-null mice creates difficulties to evaluate its physiological significance in metabolism. Here, we report that the embryonic lethality caused by the deficiency of mdmx , in contrast to the case for mdm2 , is fully rescued in the background of p53 3KR/3KR , an acetylation-defective mutant unable to induce cell-cycle arrest, senescence and apoptosis. p53 3KR/3KR /mdmx -/- mice are healthy but skinny without obvious developmental defects. p53 3KR/3KR /mdmx -/- mice are resistant to fat accumulation in adipose tissues upon high fat diet. Notably, the levels of p53 protein are only slightly increased and can be further induced upon DNA damage in p53 3KR/3KR /mdmx -/- mice, suggesting that Mdmx is only partially required for p53 degradation in vivo . Further analyses indicate that the anti-obesity phenotypes in p53 3KR/3KR /mdmx -/- mice are caused by activation of lipid oxidation and thermogenic programs in adipose tissues. These results demonstrate the specific effects of the p53/Mdmx axis in lipid metabolism and adipose tissue remodeling and reveal a surprising role of Mdmx inhibition in anti-obesity effects beyond, commonly expected, tumor suppression. Thus, our study has significant implications regarding Mdmx inhibitors in the treatment of obesity related diseases.

Modulation of the poly (ADP-ribose) polymerase inhibitor response and DNA recombination in breast cancer cells by drugs affecting endogenous wild-type p53.

PubMed

Ireno, Ivanildce Cristiane; Wiehe, Rahel Stephanie; Stahl, Andreea Iulia; Hampp, Stephanie; Aydin, Sevtap; Troester, Melissa A; Selivanova, Galina; Wiesmüller, Lisa

2014-10-01

Synthetic lethal interactions between poly (ADP-ribose) polymerase (PARP) and homologous recombination (HR) repair pathways have been exploited for the development of novel mono- and combination cancer therapies. The tumor suppressor p53 was demonstrated to exhibit indirect and direct regulatory activities in DNA repair, particularly in DNA double-strand break (DSB)-induced and replication-associated HR. In this study, we tested a potential influence of the p53 status on the response to PARP inhibition, which is known to cause replication stress. Silencing endogenous or inducibly expressing p53 we found a protective effect of p53 on PARP inhibitor (PARPi)-mediated cytotoxicities. This effect was specific for wild-type versus mutant p53 and observed in cancer but not in non-transformed cell lines. Enhanced cytotoxicities after treatment with the p53-inhibitory drug Pifithrinα further supported p53-mediated resistance to PARP inhibition. Surprisingly, we equally observed increased PARPi sensitivity in the presence of the p53-activating compound Nutlin-3. As a common denominator, both drug responses correlated with decreased HR activities: Pifithrinα downregulated spontaneous HR resulting in damage accumulation. Nutlin-3 induced a decrease of DSB-induced HR, which was accompanied by a severe drop in RAD51 protein levels. Thus, we revealed a novel link between PARPi responsiveness and p53-controlled HR activities. These data expand the concept of cell and stress type-dependent healer and killer functions of wild-type p53 in response to cancer therapeutic treatment. Our findings have implications for the individualized design of cancer therapies using PARPi and the potentially combined use of p53-modulatory drugs. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

MicroRNAs as Key Effectors in the p53 Network.

PubMed

Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni

2017-01-01

The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.

Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis.

PubMed

Rigby, Cynthia M; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K; Dhar, Deepanshi; Orlicky, David J; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53 +/- ) and p53 knockout (p53 -/- ) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53 +/+ mice, p53 +/- mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53 +/+ mice but silibinin' protective efficacy was significantly compromised in p53 +/- mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53 -/- mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53 +/+ mice while its efficacy was partially compromised in p53 -/- mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis

PubMed Central

Rigby, Cynthia M.; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K.; Dhar, Deepanshi; Orlicky, David J.; Agarwal, Chapla; Agarwal, Rajesh

2017-01-01

Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53+/−) and p53 knockout (p53−/−) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53+/+ mice, p53+/− mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53+/+ mice but silibinin’ protective efficacy was significantly compromised in p53+/− mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53−/− mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53+/+ mice while its efficacy was partially compromised in p53−/− mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. PMID:27729375

Vitamin D receptor deficit induces activation of renin angiotensin system via SIRT1 modulation in podocytes.

PubMed

Chandel, Nirupama; Ayasolla, Kamesh; Wen, Hongxiu; Lan, Xiqian; Haque, Shabirul; Saleem, Moin A; Malhotra, Ashwani; Singhal, Pravin C

2017-02-01

Vitamin D receptor (VDR) deficient status has been shown to be associated with the activation of renin angiotensin system (RAS). We hypothesized that lack of VDR would enhance p53 expression in podocytes through down regulation of SIRT1; the former would enhance the transcription of angiotensinogen (Agt) and angiotensinogen II type 1 receptor (AT1R) leading to the activation of RAS. Renal tissues of VDR mutant (M) mice displayed increased expression of p53, Agt, renin, and AT1R. In vitro studies, VDR knockout podocytes not only displayed up regulation p53 but also displayed enhanced expression of Agt, renin and AT1R. VDR deficient podocytes also displayed an increase in mRNA expression for p53, Agt, renin, and AT1R. Interestingly, renal tissues of VDR-M as well as VDR heterozygous (h) mice displayed attenuated expression of deacetylase SIRT1. Renal tissues of VDR-M mice showed acetylation of p53 at lysine (K) 382 residues inferring that enhanced p53 expression in renal tissues could be the result of ongoing acetylation, a consequence of SIRT1 deficient state. Notably, podocytes lacking SIRT1 not only showed acetylation of p53 at lysine (K) 382 residues but also displayed enhanced p53 expression. Either silencing of SIRT1/VDR or treatment with high glucose enhanced podocyte PPAR-y expression, whereas, immunoprecipitation (IP) of their lysates with anti-retinoid X receptor (RXR) antibody revealed presence of PPAR-y. It appears that either the deficit of SIRT1 has de-repressed expression of PPAR-y or enhanced podocyte expression of PPAR-y (in the absence of VDR) has contributed to the down regulation of SIRT1. Copyright © 2017 Elsevier Inc. All rights reserved.

p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

PubMed

Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

2018-03-06

Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity

PubMed Central

Kaller, Markus; Götz, Ursula; Hermeking, Heiko

2017-01-01

We have previously identified the long non-coding RNA LINC01021 as a direct p53 target (Hünten et al. Mol Cell Proteomics. 2015; 14:2609-2629). Here, we show that LINC01021 is up-regulated in colorectal cancer (CRC) cell lines upon various p53-activating treatments. The LINC01021 promoter and the p53 binding site lie within a MER61C LTR, which originated from insertion of endogenous retrovirus 1 (ERV1) sequences. Deletion of this MER61C element by a CRISPR/Cas9 approach, as well as siRNA-mediated knockdown of LINC01021 RNA significantly enhanced the sensitivity of the CRC cell line HCT116 towards the chemotherapeutic drugs doxorubicin and 5-FU, suggesting that LINC01021 is an integral part of the p53-mediated response to DNA damage. Inactivation of LINC01021 and also its ectopic expression did not affect p53 protein expression and transcriptional activity, implying that LINC01021 does not feedback to p53. Furthermore, in CRC patient samples LINC01021 expression positively correlated with a wild-type p53-associated gene expression signature. LINC01021 expression was increased in primary colorectal tumors and displayed a bimodal distribution that was particularly pronounced in the mesenchymal CMS4 consensus molecular subtype of CRCs. CMS4 tumors with low LINC01021 expression were associated with poor patient survival. Our results suggest that the genomic redistribution of ERV1-derived p53 response elements and generation of novel p53-inducible lncRNA-encoding genes was selected for during primate evolution as integral part of the cellular response to various forms of genotoxic stress. PMID:29262524

Ginsenoside Rg3 Inhibits Melanoma Cell Proliferation through Down-Regulation of Histone Deacetylase 3 (HDAC3) and Increase of p53 Acetylation

PubMed Central

Shan, Xiu; Fu, Yuan-Shan; Aziz, Faisal; Wang, Xiao-Qi; Yan, Qiu; Liu, Ji-Wei

2014-01-01

Malignant melanoma is an aggressive and deadly form of skin cancer, and despite recent advances in available therapies, is still lacking in completely effective treatments. Rg3, a monomer extracted from ginseng roots, has been attempted for the treatment of many cancers. It is reported that the expressions of histone deacetylase 3 (HDAC3) and p53 acetylation correlate with tumor cell growth. However, the antitumor effect of Rg3 on melanoma and the mechanism by which it regulates HDAC3 expression and p53 acetylation remain unknown. We found high expression of HDAC3 in human melanoma tissues to be significantly correlated to lymph node metastasis and clinical stage of disease (p<0.05). In melanoma cells, Rg3 inhibited cell proliferation and induced G0/G1 cell cycle arrest. Rg3 also decreased the expression of HDAC3 and increased the acetylation of p53 on lysine (k373/k382). Moreover, suppression of HDAC3 by either siRNA or a potent HDAC3 inhibitor (MS-275) inhibited cell proliferation, increased p53 acetylation and transcription activity. In A375 melanoma xenograft studies, we demonstrated that Rg3 and HDAC3 short hairpin RNA (shHDAC3) inhibited the growth of xenograft tumors with down-regulation of HDAC3 expression and up-regulation of p53 acetylation. In conclusion, Rg3 has antiproliferative activity against melanoma by decreasing HDAC3 and increasing acetylation of p53 both in vitro and in vivo. Thus, Rg3 serves as a potential therapeutic agent for the treatment of melanoma. PMID:25521755

MG132 plus apoptosis antigen-1 (APO-1) antibody cooperate to restore p53 activity inducing autophagy and p53-dependent apoptosis in HPV16 E6-expressing keratinocytes.

PubMed

Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio

2017-01-01

The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.

Increased nuclear factor-κB and loss of p53 are key mechanisms in Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS).

PubMed

Morris, Gerwyn; Maes, Michael

2012-11-01

Fukuda's criteria are adequate to make a distinction between Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS) and chronic fatigue (CF), but ME/CFS patients should be subdivided into those with (termed ME) and without (termed CFS) post exertional malaise [Maes et al. 2012]. ME/CFS is considered to be a neuro-immune disease. ME/CFS is characterized by activated immuno-inflammatory pathways, including increased levels of pro-inflammatory cytokines, nuclear factor κB (NF-κB) and aberrations in mitochondrial functions, including lowered ATP. These processes may explain typical symptoms of ME/CFS, e.g. fatigue, malaise, hyperalgesia, and neurologic and autonomic symptoms. Here we hypothesize that increased NF-κB together with a loss of p53 are key phenomena in ME/CFS that further explain ME/CFS symptoms, such as fatigue and neurocognitive dysfunction, and explain ME symptoms, such as post-exertional malaise following mental and physical activities. Inactivation of p53 impairs aerobic mitochondrial functions and causes greater dependence on anaerobic glycolysis, elevates lactate levels, reduces mitochondrial density in skeletal muscle and reduces endurance during physical exercise. Lowered p53 and increased NF-κB are associated with elevated reactive oxygen species. Increased NF-κB induces the production of pro-inflammatory cytokines, which increase glycolysis and further compromise mitochondrial functions. All these factors together may contribute to mitochondrial exhaustion and indicate that the demand for extra ATP upon the commencement of increased activity cannot be met. In conditions of chronic inflammation and oxidative stress, high NF-κB and low p53 may conspire to promote neuron and glial cell survival at a price of severely compromised metabolic brain function. Future research should examine p53 signaling in ME/CFS. Copyright © 2012. Published by Elsevier Ltd.

Concurrent acetylation of FoxO1/3a and p53 due to sirtuins inhibition elicit Bim/PUMA mediated mitochondrial dysfunction and apoptosis in berberine-treated HepG2 cells.

PubMed

Shukla, Shatrunajay; Sharma, Ankita; Pandey, Vivek Kumar; Raisuddin, Sheikh; Kakkar, Poonam

2016-01-15

Post-translational modifications i.e. phosphorylation and acetylation are pivotal requirements for proper functioning of eukaryotic proteins. The current study aimed to decode the impact of acetylation/deacetylation of non-histone targets i.e. FoxO1/3a and p53 of sirtuins (NAD(+) dependent enzymes with lysine deacetylase activity) in berberine treated human hepatoma cells. Berberine (100 μM) inhibited sirtuins significantly (P<0.05) at transcriptional level as well as at translational level. Combination of nicotinamide (sirtuin inhibitor) with berberine potentiated sirtuins inhibition and increased the expression of FoxO1/3a and phosphorylation of p53 tumor suppressor protein. As sirtuins deacetylate non-histone targets including FoxO1/3a and p53, berberine increased the acetylation load of FoxO1/3a and p53 proteins. Acetylated FoxO and p53 proteins transcriptionally activate BH3-only proteins Bim and PUMA (3.89 and 3.87 fold respectively, P<0.001), which are known as direct activator of pro-apoptotic Bcl-2 family protein Bax that culminated into mitochondria mediated activation of apoptotic cascade. Bim/PUMA knock-down showed no changes in sirtuins' expression while cytotoxicity induced by berberine and nicotinamide was curtailed up to 28.3% (P<0.001) and it restored pro/anti apoptotic protein ratio in HepG2 cells. Sirtuins inhibition was accompanied by decline in NAD(+)/NADH ratio, ATP generation, enhanced ROS production and decreased mitochondrial membrane potential. TEM analysis confirmed mitochondrial deterioration and cell damage. SRT-1720 (1-10 μM), a SIRT-1 activator, when pre-treated with berberine (25 μM), reversed sirtuins expression comparable to control and significantly restored the cell viability (P<0.05). Thus, our findings suggest that berberine mediated sirtuins inhibition resulting into FoxO1/3a and p53 acetylation followed by BH3-only protein Bim/PUMA activation may in part be responsible for mitochondria-mediated apoptosis. Copyright © 2015 Elsevier Inc. All rights reserved.

Integrative Analysis Reveals an Outcome-associated and Targetable Pattern of p53 and Cell Cycle Deregulation in Diffuse Large B-cell Lymphoma

PubMed Central

Monti, Stefano; Chapuy, Bjoern; Takeyama, Kunihiko; Rodig, Scott J; Hao, Yangsheng; Yeda, Kelly T.; Inguilizian, Haig; Mermel, Craig; Curie, Treeve; Dogan, Ahmed; Kutok, Jeffery L; Beroukim, Rameen; Neuberg, Donna; Habermann, Thomas; Getz, Gad; Kung, Andrew L; Golub, Todd R; Shipp, Margaret A

2013-01-01

Summary Diffuse large B-cell lymphoma (DLBCL) is a clinically and biologically heterogeneous disease with a high proliferation rate. By integrating copy number data with transcriptional profiles and performing pathway analysis in primary DLBCLs, we identified a comprehensive set of copy number alterations (CNAs) that decreased p53 activity and perturbed cell cycle regulation. Primary tumors either had multiple complementary alterations of p53 and cell cycle components or largely lacked these lesions. DLBCLs with p53 and cell cycle pathway CNAs had decreased abundance of p53 target transcripts and increased expression of E2F target genes and the Ki67 proliferation marker. CNAs of the CDKN2A-TP53-RB-E2F axis provide a structural basis for increased proliferation in DLBCL, predict outcome with current therapy and suggest targeted treatment approaches. PMID:22975378

Wasabi 6-(methylsulfinyl)hexyl isothiocyanate induces apoptosis in human colorectal cancer cells through p53-independent mitochondrial dysfunction pathway.

PubMed

Yano, Satoshi; Wu, Shusong; Sakao, Kozue; Hou, De-Xing

2018-05-14

6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC), a major bioactive compound in Wasabi [Wasabia japonica (Miq.) Matsum.], has revealed the inhibitory effect on colon carcinogenesis in rat cancer model although the underlying mechanism is unclear. In this study, we used two types of human colorectal cancer cells (HCT116 p53 +/+ and HCT116 p53 -/- ) to investigate the anticancer activity and molecular mechanisms of 6-MSITC. Interestingly, 6-MSITC inhibited the cell proliferation in both types of cells with similar IC 50 value although a light increase in the phosphorylation and accumulation of P53 protein was observed in HCT116 p53 +/+ cells at 24 h after treatment. In addition, 6-MSITC increased the ratio of proapoptotic cells in both types of cells with the same fashion in a p53-independent manner. The data from mitochondrial analysis revealed that 6-MSITC enhanced the ratio of proapoptotic B-cell lymphoma-2-associated X protein/antiapoptotic myeloid cell leukemia 1, and sequentially caused mitochondrial membrane potential (ΔΨ m ) loss, cytochrome c release, and caspase-3 activation in both types of cells. Taken together, Wasabi 6-MSITC induced apoptosis of human colorectal cancer cells in p53-independent mitochondrial dysfunction pathway. These findings suggest that 6-MSITC might be a potential agent for colon cancer chemoprevention although with p53 mutation. © 2018 BioFactors, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

p63 and p73 coordinate p53 function to determine the balance between survival, cell death, and senescence in adult neural precursor cells

PubMed Central

Fatt, M P; Cancino, G I; Miller, F D; Kaplan, D R

2014-01-01

The p53 family members p73 and p63 have been implicated in various aspects of stem cell regulation. Here, we have asked whether they work together to regulate stem cell biology, focusing upon neural precursor cells (NPCs) in the adult murine brain. By studying mice that are haploinsufficient for p63 and/or p73, we show that these two proteins cooperate to ensure appropriate NPC self-renewal and long-term maintenance in the hippocampus and forebrain, and that when both are haploinsufficient, the NPC deficits are significantly greater than haploinsufficiency for either alone. We show that, in the case of p63+/− mice, this decrease in adult NPCs is caused by enhanced apoptosis. However, when p73 is coincidently haploinsufficient, this rescues the enhanced apoptosis of p63+/− NPCs under both basal conditions and following genotoxic stress, instead causing increased cellular senescence. This increase in cellular senescence is likely due, at least in part, to increased levels of basal DNA damage and p53 activation, as genetic ablation of p53 completely rescues the senescence phenotype observed in p63+/−; p73+/− mice. Thus, the presence of p73 determines whether p63+/− NPCs exhibit increased p53-dependent apoptosis or senescence. Together, these studies demonstrate that p63 and p73 cooperate to maintain adult NPC pools through regulation of p53 function; p63 antagonizes p53 to promote cellular survival, whereas p73 regulates self-renewal and p53-mediated apoptosis versus senescence. PMID:24809925

Gamma rays induce a p53-independent mitochondrial biogenesis that is counter-regulated by HIF1α

PubMed Central

Bartoletti-Stella, A; Mariani, E; Kurelac, I; Maresca, A; Caratozzolo, M F; Iommarini, L; Carelli, V; Eusebi, L H; Guido, A; Cenacchi, G; Fuccio, L; Rugolo, M; Tullo, A; Porcelli, A M; Gasparre, G

2013-01-01

Mitochondrial biogenesis is an orchestrated process that presides to the regulation of the organelles homeostasis within a cell. We show that γ-rays, at doses commonly used in the radiation therapy for cancer treatment, induce an increase in mitochondrial mass and function, in response to a genotoxic stress that pushes cells into senescence, in the presence of a functional p53. Although the main effector of the response to γ-rays is the p53-p21 axis, we demonstrated that mitochondrial biogenesis is only indirectly regulated by p53, whose activation triggers a murine double minute 2 (MDM2)-mediated hypoxia-inducible factor 1α (HIF1α) degradation, leading to the release of peroxisome-proliferator activated receptor gamma co-activator 1β inhibition by HIF1α, thus promoting mitochondrial biogenesis. Mimicking hypoxia by HIF1α stabilization, in fact, blunts the mitochondrial response to γ-rays as well as the induction of p21-mediated cell senescence, indicating prevalence of the hypoxic over the genotoxic response. Finally, we also show in vivo that post-radiotherapy mitochondrial DNA copy number increase well correlates with lack of HIF1α increase in the tissue, concluding this may be a useful molecular tool to infer the trigger of a hypoxic response during radiotherapy, which may lead to failure of activation of cell senescence. PMID:23764844

Feedback modulation of neural network synchrony and seizure susceptibility by Mdm2-p53-Nedd4-2 signaling.

PubMed

Jewett, Kathryn A; Christian, Catherine A; Bacos, Jonathan T; Lee, Kwan Young; Zhu, Jiuhe; Tsai, Nien-Pei

2016-03-22

Neural network synchrony is a critical factor in regulating information transmission through the nervous system. Improperly regulated neural network synchrony is implicated in pathophysiological conditions such as epilepsy. Despite the awareness of its importance, the molecular signaling underlying the regulation of neural network synchrony, especially after stimulation, remains largely unknown. In this study, we show that elevation of neuronal activity by the GABA(A) receptor antagonist, Picrotoxin, increases neural network synchrony in primary mouse cortical neuron cultures. The elevation of neuronal activity triggers Mdm2-dependent degradation of the tumor suppressor p53. We show here that blocking the degradation of p53 further enhances Picrotoxin-induced neural network synchrony, while promoting the inhibition of p53 with a p53 inhibitor reduces Picrotoxin-induced neural network synchrony. These data suggest that Mdm2-p53 signaling mediates a feedback mechanism to fine-tune neural network synchrony after activity stimulation. Furthermore, genetically reducing the expression of a direct target gene of p53, Nedd4-2, elevates neural network synchrony basally and occludes the effect of Picrotoxin. Finally, using a kainic acid-induced seizure model in mice, we show that alterations of Mdm2-p53-Nedd4-2 signaling affect seizure susceptibility. Together, our findings elucidate a critical role of Mdm2-p53-Nedd4-2 signaling underlying the regulation of neural network synchrony and seizure susceptibility and reveal potential therapeutic targets for hyperexcitability-associated neurological disorders.

Cyclin-dependent kinases regulate apoptosis of intestinal epithelial cells

PubMed Central

Bhattacharya, Sujoy; Ray, Ramesh M.; Johnson, Leonard R.

2014-01-01

Homeostasis of the gastrointestinal epithelium is dependent upon a balance between cell proliferation and apoptosis. Cyclin-dependent kinases (Cdks) are well known for their role in cell proliferation. Previous studies from our group have shown that polyamine-depletion of intestinal epithelial cells (IEC-6) decreases cyclin-dependent kinase 2 (Cdk2) activity, increases p53 and p21Cip1 protein levels, induces G1 arrest, and protects cells from camptothecin (CPT)-induced apoptosis. Although emerging evidence suggests that members of the Cdk family are involved in the regulation of apoptosis, their roles directing apoptosis of IEC-6 cells are not known. In this study, we report that inhibition of Cdk1, 2, and 9 (with the broad range Cdk inhibitor, AZD5438) in proliferating IEC-6 cells triggered DNA damage, activated p53 signaling, inhibited proliferation, and induced apoptosis. By contrast, inhibition of Cdk2 (with NU6140) increased p53 protein and activity, inhibited proliferation, but had no effect on apoptosis. Notably, AZD5438 sensitized, whereas, NU6140 rescued proliferating IEC-6 cells from CPT-induced apoptosis. However, in colon carcinoma (Caco2) cells with mutant p53, treatment with either AZD5438 or NU6140 blocked proliferation, albeit more robustly with AZD5438. Both Cdk inhibitors induced apoptosis in Caco2 cells in a p53-independent manner. In serum starved quiescent IEC-6 cells, both AZD5438 and NU6140 decreased TNF- /CPT-induced activation of p53 and, consequently, rescued cells from apoptosis, indicating that sustained Cdk activity is required for apoptosis of quiescent cells. Furthermore, AZD5438 partially reversed the protective effect of polyamine depletion whereas NU6140 had no effect. Together, these results demonstrate that Cdks possess opposing roles in the control of apoptosis in quiescent and proliferating cells. In addition, Cdk inhibitors uncouple proliferation from apoptosis in a p53-dependent manner. PMID:24242917

Sirtuin7 is involved in protecting neurons against oxygen-glucose deprivation and reoxygenation-induced injury through regulation of the p53 signaling pathway.

PubMed

Lv, Jianrui; Tian, Junbin; Zheng, Guoxi; Zhao, Jing

2017-10-01

Sirtuin7 (SIRT7) is known to regulate apoptosis and stress responses. So far, very little is known about the role of SIRT7 in cerebral ischemia/reperfusion injury. In this study, we aimed to investigate the potential role of SIRT7 in regulating oxygen-glucose deprivation and reoxygenation (OGD/R)-induced injury in neurons. We found a significant increase of SIRT7 expression in neurons in response to OGD/R treatment. Knockdown of SIRT7 aggravated OGD/R-induced injury. Knockdown of SIRT7 augmented the levels of total and acetylated p53 protein. Moreover, knockdown of SIRT7 markedly increased the transcriptional activity of p53 toward apoptosis and activated the p53-mediated proapoptotic signaling pathway. By contrast, overexpression of SIRT7 showed the opposite effects. Taken together, the results of our study suggest that SIRT7 is involved in protecting neurons against OGD/R-induced injury, possibly through regulation of the p53-mediated proapoptotic signaling pathway, indicating a potential therapeutic target for cerebral ischemia/reperfusion injury. © 2017 Wiley Periodicals, Inc.

Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

PubMed

Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

2012-06-01

Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

PubMed

Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

2016-11-22

Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

Discovery and Cocrystal Structure of Benzodiazepinedione HDM2 Antagonists that Activate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grasberger,B.; Lu, T.; Schubert, C.

2005-01-01

HDM2 binds to an {alpha}-helical transactivation domain of p53, inhibiting its tumor suppressive functions. A miniaturized thermal denaturation assay was used to screen chemical libraries, resulting in the discovery of a novel series of benzodiazepinedione antagonists of the HDM2-p53 interaction. The X-ray crystal structure of improved antagonists bound to HDM2 reveals their {alpha}-helix mimetic properties. These optimized molecules increase the transcription of p53 target genes and decrease proliferation of tumor cells expressing wild-type p53.

New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

PubMed

Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

2017-04-01

Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

HIPK2 modulates p53 activity towards pro-apoptotic transcription.

PubMed

Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

2009-10-14

Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co-recruitment of p300 and p53Lys382 on apoptotic promoters and on the other hand by inhibiting Sirt1 deacetylase activity. We attempted to reactivate p53 apoptotic transcriptional activity by rescuing both Ser46 and Lys382 modification in response to drug. Our data propose combination strategies for the treatment of tumors with dysfunctional p53 and/or HIPK2 that include classical chemotherapy with pharmacological or natural agents such as Sirt1-deacetylase inhibitors or zinc, respectively.

Leptin reduces apoptosis triggered by high temperature in human placental villous explants: The role of the p53 pathway.

PubMed

Pérez-Pérez, Antonio; Toro, Ayelén R; Vilarino-Garcia, Teresa; Guadix, Pilar; Maymó, Julieta L; Dueñas, José L; Varone, Cecilia L; Sánchez-Margalet, Víctor

2016-06-01

Maternal fever is common during pregnancy and has for many years been suspected to harm the developing fetus. Whether increased maternal temperature produces exaggerated apoptosis in trophoblast cells remains unclear. Since p53 is a critical regulator of apoptosis we hypothesized that increased temperature in placenta produces abnormal expression of proteins in the p53 pathway and finally caspase-3 activation. Moreover, leptin, produced by placenta, is known to promote the proliferation and survival of trophoblastic cells. Thus, we aimed to study the possible role of leptin preventing apoptosis triggered by high temperature, as well as the molecular mechanisms underlying this effect. Fresh placental tissue was collected from normal pregnancies. Explants of placental villi were exposed to 37 °C, 40 °C and 42 °C during 3 h in the presence or absence of 10 nM leptin in DMEM-F12 medium. Western blotting and qRT-PCR was performed to analyze the expression of p53 and downstream effector, P53AIP1, Mdm2, p21, BAX and BCL-2 as well as the activated cleaved form of caspase-3 and the fragment of cytokeratin-18 (CK-18) cleaved at Asp396 (neoepitope M30). Phosphorylation of the Ser 46 residue on p53, the expression of P53AIP1, Mdm2, p21, as well as caspase-3 and CK-18 were significantly increased in explants at 40 °C and 42 °C. Conversely, these effects were significantly attenuated by leptin 10 nM at both 40 °C and 42 °C. The BCL2/BAX ratio was also significantly decreased in explants at 40 °C and 42 °C compared with explants incubated at 37 °C, which was prevented by leptin stimulation. These data illustrate the potential role of leptin for reducing apoptosis in trophoblast explants, including trophoblastic cells, triggered by high temperature, by preventing the activation of p53 signaling. Copyright © 2016 Elsevier Ltd. All rights reserved.

Expression of matrix metalloproteinase 1, matrix metalloproteinase 2, and matrix metalloproteinase 9 in carcinoma of the head and neck.

PubMed

Franchi, Alessandro; Santucci, Marco; Masini, Emanuela; Sardi, Iacopo; Paglierani, Milena; Gallo, Oreste

2002-11-01

Numerous reports have documented a direct involvement of matrix metalloproteinase (MMP) overexpression in the development and progression of head and neck squamous cell carcinoma (HNSCC). In this study, the authors examined whether the expression of MMPs in HNSCC is correlated with other steps involved in tumor growth and metastasis, like angiogenesis, activation the nitric oxide (NO) pathway, and alteration of the p53 tumor suppressor gene. MMP-1, MMP-2, and MMP-9 expression levels were examined immunohistochemically in samples from 43 patients with HNSCC. Microvessel density (MVD) was determined by immunostaining of endothelial cells with anti-CD31 monoclonal antibody. Inducible nitric oxide synthase (iNOS) activity and cyclic guanosine monophosphatate (cGMP) levels were assessed in fresh tumor samples, whereas exons 5-9 of the p53 gene were analyzed by reverse transcriptase-polymerase chain reaction, single-strand conformation polymorphism analysis and were sequenced. MMP-1 overexpression (>10% of tumor cells) was identified in 32 tumors (74.5%), whereas elevated levels of MMP-2 and MMP-9 were detected in 17 tumors (39.5%) each. Tumors with MMP-9 overexpression were characterized by significantly higher MVD (P = 0.05) and significantly higher iNOS activity and cGMP levels (P = 0.005 and P = 0.02, respectively). Moreover, p53 mutation was associated strongly with MMP-9 overexpression (P = 0.004). Conversely, no correlation was found between MMP-1 and MMP-2 expression, angiogenesis, iNOS activity, cGMP levels, and p53 mutation in this series. This study documents the existence of a correlation between MMP-9 expression, activity of the iNOS pathway, p53 status, and angiogenesis in patients with HNSCC. This raises the possibility that p53 mutation, which frequently is present in HNSCC, may result in increased angiogenesis and invasiveness related to increased nitric oxide and MMP production by tumor cells, ultimately contributing to tumor progression. Copyright 2002 American Cancer Society.

JS-K, a GST-activated nitric oxide donor prodrug, enhances chemo-sensitivity in renal carcinoma cells and prevents cardiac myocytes toxicity induced by Doxorubicin.

PubMed

Qiu, Mingning; Ke, Longzhi; Zhang, Sai; Zeng, Xin; Fang, Zesong; Liu, Jianjun

2017-08-01

Doxorubicin, a highly effective and widely used anthracycline antibiotic in multiple chemotherapy regimens, has been limited by its cardiotoxicity. The aim of this study is to investigate the effect of nitric oxide donor prodrug JS-K on proliferation and apoptosis in renal carcinoma cells and cardiac myocytes toxicity induced by Doxorubicin and to explore possible p53-related mechanism in renal carcinoma cells. The effect of JS-K on anti-cancer activity of Doxorubicin was investigated in renal carcinoma cells via detecting cell proliferation, cytotoxicity, cell death and apoptosis and expressions of apoptotic-related proteins. Effect of p53 on the combination of JS-K and Doxorubicin was determined using p53 inhibitor Pifithrin-α and p53 activator III. Furthermore, the effect of JS-K on cardiac myocytes toxicity of Doxorubicin was investigated in H9c2 (2-1) cardiac myocytes via measuring cell growth, cell death and apoptosis, expressions of proteins involved in apoptosis and intracellular reactive oxygen species. We demonstrated that JS-K could increase Doxorubicin-induced renal carcinoma cell growth suppression and apoptosis and could increase expressions of proteins that are involved in apoptosis. Additionally, Pifithrin-α reversed the promoting effect of JS-K on Doxorubicin-induced renal carcinoma cell apoptosis; conversely, the p53 activator III exacerbated the promoting effect of JS-K on Doxorubicin-induced renal carcinoma cell apoptosis. Furthermore, JS-K protected H9c2 (2-1) cardiac myocytes against Doxorubicin-induced toxicity and decreased Doxorubicin-induced reactive oxygen species production. JS-K enhances the anti-cancer activity of Doxorubicin in renal carcinoma cells by upregulating p53 expression and prevents cardiac myocytes toxicity of Doxorubicin by decreasing oxidative stress.

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wan, Chunhua; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu; Ma, Xa

2014-12-15

Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleavedmore » PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly activated in Mn-exposed brain cells. • p53 translocates into mitochondria following Mn exposure. • p53 causes mitochondrial deficit via transcription-dependent and -independent actions. • PFT-α and PFT-μ ameliorate Mn-induced mitochondrial deficit and neuronal apoptosis.« less

p53 prevents progression of nevi to melanoma predominantly through cell cycle regulation

PubMed Central

Terzian, Tamara; Torchia, Enrique C.; Dai, Daisy; Robinson, Steven E.; Murao, Kazutoshi; Stiegmann, Regan A.; Gonzalez, Victoria; Boyle, Glen M.; Powell, Marianne B.; Pollock, Pamela M.; Lozano, Guillermina; Robinson, William A.; Roop, Dennis R.; Box, Neil F.

2011-01-01

p53 is the central member of a critical tumor suppressor pathway in virtually all tumor types, where it is silenced mainly by missense mutations. In melanoma, p53 predominantly remains wild type, thus its role has been neglected. To study the effect of p53 on melanocyte function and melanomagenesis, we crossed the ‘high-p53’ Mdm4+/− mouse to the well-established TP-ras0/+ murine melanoma progression model. After treatment with the carcinogen dimethylbenzanthracene (DMBA), TP-ras0/+ mice on the Mdm4+/− background developed fewer tumors with a delay in the age of onset of melanomas compared to TP-ras0/+ mice. Furthermore, we observed a dramatic decrease in tumor growth, lack of metastasis with increased survival of TP-ras0/+: Mdm4+/− mice. Thus, p53 effectively prevented the conversion of small benign tumors to malignant and metastatic melanoma. p53 activation in cultured primary melanocyte and melanoma cell lines using Nutlin-3, a specific Mdm2 antagonist, supported these findings. Moreover, global gene expression and network analysis of Nutlin-3-treated primary human melanocytes indicated that cell cycle regulation through the p21WAF1/CIP1 signaling network may be the key anti-melanomagenic activity of p53. PMID:20849464

P53 Suppression of Homologous Recombination and Tumorigenesis

DTIC Science & Technology

2012-01-01

mutation acted on both rad51 dependent gene conversion events and deletion events (6). Willers et al. also showed an increase in recombination...suffer from sarcomas. MEFs from these mice show aneuploidy, allelic loss and gene amplification. Most of these germline mutations are missense...the absence of tumor suppressor gene activity, such as p53, results in increased genomic instability and increased cancer predisposition

Mutant human tumor suppressor p53 modulates the activation of mitogen-activated protein kinase and nuclear factor-kappaB, but not c-Jun N-terminal kinase and activated protein-1.

PubMed

Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena

2006-01-01

The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF-kappaB distinctively, while modulating the pathways of JNK and AP-1 similarly. These differences may influence cellular processes such as proliferation, differentiation, and apoptosis. 2005 Wiley-Liss, Inc.

An adaptive molecular timer in p53-meidated cell fate decision

NASA Astrophysics Data System (ADS)

Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

DNA damage in children with scoliosis following X-ray exposure.

PubMed

Himmetoglu, S; Guven, M F; Bilsel, N; Dincer, Y

2014-10-14

It has been suggested that cancer incidence is high in subjects with scoliosis who are relatively more often exposed to X--ray for diagnosis and follow--up. X--ray is a kind of ionizing radiation and leads to formation of oxygen free radicals which are capable of damage to DNA, thus altered gen expression and mutation. p53 tumor suppressor gene plays a crucial role in the damage response. It controls the checkpoint of cell cycle and redirects the cell metabolism to either repair of damaged DNA or apoptosis as response to DNA damage. The aim of the present study was to examine serum levels of 8--Hydroxydeoxyguanosine (8--OHdG), a strongly mutagenic product of oxidative DNA damage, p53, superoxide dismutase (SOD) and glutathione peroxidase (G--Px), as antioxidant activity, in children with scoliosis who had got whole spine radiograph two times during the last year. A total of 31 children with adolescent idiopathic scoliosis and age--matched 21 healthy children were included in the study. Serum levels of 8--OHdG and p53 were measured with ELISA kits. SOD and G--Px activities were determined with spectrophotometric assays. Serum levels of 8--OHdG and p53 were found to be higher (P<0.001 and P<0.01, respectively), SOD activity was found to be lower (P<0.001) in the children with scoliosis as compared to age--matched controls. There was no significant difference between the groups for G--Px activity. Our data show that X--ray exposure causes increased 8--OHdG level, and decreased SOD activity, which both may reflect a tumor promoting condition. Increased p53 level may be interpreted as a compensatory effort of cell to X--ray mediated DNA damage.

DNA damage in children with scoliosis following X-ray exposure.

PubMed

Himmetoglu, S; Guven, M F; Bilsel, N; Dincer, Y

2015-06-01

It has been suggested that cancer incidence is high in subjects with scoliosis who are relatively more often exposed to X-ray for diagnosis and follow-up. X-ray is a kind of ionizing radiation and leads to formation of oxygen free radicals which are capable of damage to DNA, thus altered gen expression and mutation. p53 tumor suppressor gene plays a crucial role in the damage response. It controls the checkpoint of cell cycle and redirects the cell metabolism to either repair of damaged DNA or apoptosis as response to DNA damage. The aim of the present study was to examine serum levels of 8-Hydroxydeoxyguanosine (8-OHdG), a strongly mutagenic product of oxidative DNA damage, p53, superoxide dismutase (SOD) and glutathione peroxidase (G-Px), as antioxidant activity, in children with scoliosis who had got whole spine radiograph two times during the last year. A total of 31 children with adolescent idiopathic scoliosis and 21 age-matched healthy children were included in the study. Serum levels of 8-OHdG and p53 were measured with ELISA kits. SOD and G-Px activities were determined with spectrophotometric assays. Serum levels of 8-OHdG and p53 were found to be higher (P<0.001 and P<0.01, respectively), SOD activity was found to be lower (P<0.001) in the children with scoliosis as compared to age-matched controls. There was no significant difference between the groups for G-Px activity. Our data show that X-ray exposure causes increased 8-OHdG level, and decreased SOD activity, which both may reflect a tumor promoting condition. Increased p53 level may be interpreted as a compensatory effort of cell to X-ray mediated DNA damage.

SIAH1-induced p34SEI-1 polyubiquitination/degradation mediates p53 preferential vitamin C cytotoxicity.

PubMed

Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok

2015-03-01

Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.

WNT activation by lithium abrogates TP53 mutation associated radiation resistance in medulloblastoma.

PubMed

Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri

2014-12-24

TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.

Immunohistochemical expression of protein p53 in neoplasms of the mammary gland in bitches.

PubMed

Rodo, A; Malicka, E

2008-01-01

The aim of the study was to investigate the presence of protein p53 in correlation with other tumor traits: histological type, tumor grade and proliferative activity. Material for the investigation comprised mammary gland tumours collected from dogs, the patients of veterinary clinics, during surgical procedures, and archival samples. Alltogether 21 adenomas, 31 complex carcinomas, 35 simple carcinomas and 12 solid carcinomas were qualified for further investigation. No protein p53 expression was found in adenomas. Cancers show positive reaction in 32.5%. The highest percent of p53 positive neoplasms was observed in solid carcinomas and neoplasms with the highest degree of histological malignancy. The smallest number showing this expression was observed in adenomas and the highest was characteristic for solid carcinomas. Considering the tumour grading, it was found that an increase in neoplasm malignancy was positively correlated with the number of the cells showing the expression of protein p53. The differences were statistically significant. Statistically significant positive correlations were observed between the proliferative activity and protein p53 expression. Higher accumulation of protein p53 in more malignant neoplasms suggests that mutations of protein p53 can be responsible for higher proliferation in neoplasms with advanced progression of malignancy.

p53 Reactivation by PRIMA-1(Met) (APR-246) sensitises (V600E/K)BRAF melanoma to vemurafenib.

PubMed

Krayem, Mohammad; Journe, Fabrice; Wiedig, Murielle; Morandini, Renato; Najem, Ahmad; Salès, François; van Kempen, Leon C; Sibille, Catherine; Awada, Ahmad; Marine, Jean-Christophe; Ghanem, Ghanem

2016-03-01

Intrinsic and acquired resistance of metastatic melanoma to (V600E/K)BRAF and/or MEK inhibitors, which is often caused by activation of the PI3K/AKT survival pathway, represents a major clinical challenge. Given that p53 is capable of antagonising PI3K/AKT activation we hypothesised that pharmacological restoration of p53 activity may increase the sensitivity of BRAF-mutant melanoma to MAPK-targeted therapy and eventually delay and/or prevent acquisition of drug resistance. To test this possibility we exposed a panel of vemurafenib-sensitive and resistant (innate and acquired) (V600E/K)BRAF melanomas to a (V600E/K)BRAF inhibitor (vemurafenib) alone or in combination with a direct p53 activator (PRIMA-1(Met)/APR-246). Strikingly, PRIMA-1(Met) synergised with vemurafenib to induce apoptosis and suppress proliferation of (V600E/K)BRAF melanoma cells in vitro and to inhibit tumour growth in vivo. Importantly, this drug combination decreased the viability of both vemurafenib-sensitive and resistant melanoma cells irrespectively of the TP53 status. Notably, p53 reactivation was invariably accompanied by PI3K/AKT pathway inhibition, the activity of which was found as a dominant resistance mechanism to BRAF inhibition in our lines. From all various combinatorial modalities tested, targeting the MAPK and PI3K signalling pathways through p53 reactivation or not, the PRIMA-1(Met)/vemurafenib combination was the most cytotoxic. We conclude that PRIMA-1(Met) through its ability to directly reactivate p53 regardless of the mechanism causing its deactivation, and thereby dampen PI3K signalling, sensitises (V600E/K)BRAF-positive melanoma to BRAF inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

PubMed

Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM.

Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

PubMed Central

Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM. PMID:22276160

Novel Derivative of Benzofuran Induces Cell Death Mostly by G2/M Cell Cycle Arrest through p53-dependent Pathway but Partially by Inhibition of NF-κB*

PubMed Central

Manna, Sunil K.; Bose, Julie S.; Gangan, Vijay; Raviprakash, Nune; Navaneetha, Thota; Raghavendra, Pongali B.; Babajan, Banaganapalli; Kumar, Chitta S.; Jain, Swatantra K.

2010-01-01

The Dracaena resin is widely used in traditional medicine as an anticancer agent, and benzofuran lignan is the active component. In this report, we provide evidence that the synthetic derivative of benzofuran lignan (Benfur) showed antitumor activities. It induced apoptosis in p53-positive cells. Though it inhibited endotoxin-induced nuclear factor κB (NF-κB) activation in both p53-positive and -negative cells, the activation of caspase 3 was observed in p53-positive cells. It showed partial cell death effect in both p53-positive and -negative cells through inhibition of NF-κB. Cell cycle analysis using flow cytometry showed that treatment with this novel benozofuran lignan derivative to Jurkat T-cells, but not U-937 cells, resulted in a G2/M arrest in a dose- and time-dependent manner. It increased amounts of p21, p27, and cyclin B, but not phospho-Rb through p53 nuclear translocation in Jurkat T-cells, but not in U-937 cells. It inhibited amounts of MDM2 (murine double minute 2) by repressing the transcription factor Sp1, which was also proved in silico. It induced cell death in tumor cells, but not in primary T-cells. Overall, our data suggest that Benfur-mediated cell death is partially dependent upon NF-κB, but predominantly dependent on p53. Thus, this novel benzofuran lignan derivative can be effective chemopreventive or chemotherapeutic agent against malignant T-cells. PMID:20472557

Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

PubMed Central

Stegh, Alexander H.

2012-01-01

Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

mTOR inhibitors blunt the p53 response to nucleolar stress by regulating RPL11 and MDM2 levels

PubMed Central

Goudarzi, Kaveh M; Nistér, Monica; Lindström, Mikael S

2014-01-01

Mechanistic target of rapamycin (mTOR) is a master regulator of cell growth through its ability to stimulate ribosome biogenesis and mRNA translation. In contrast, the p53 tumor suppressor negatively controls cell growth and is activated by a wide range of insults to the cell. The mTOR and p53 signaling pathways are connected by a number of different mechanisms. Chemotherapeutics that inhibit ribosome biogenesis often induce nucleolar stress and activation of p53. Here we have investigated how the p53 response to nucleolar stress is affected by simultaneous mTOR inhibition in osteosarcoma and glioma cell lines. We found that inhibitors of the mTOR pathway including rapamycin, wortmannin, and caffeine blunted the p53 response to nucleolar stress induced by actinomycin D. Synthetic inhibitors of mTOR (temsirolimus, LY294.002 and PP242) also impaired actinomycin D triggered p53 stabilization and induction of p21. Ribosomal protein (RPL11) is known to be required for p53 protein stabilization following nucleolar stress. Treatment of cells with mTOR inhibitors may lead to reduced synthesis of RPL11 and thereby destabilize p53. We found that rapamycin mimicked the effect of RPL11 depletion in terms of blunting the p53 response to nucleolar stress. However, the extent to which the levels of p53 and RPL11 were reduced by rapamycin varied between cell lines. Additional mechanisms whereby rapamycin blunts the p53 response to nucleolar stress are likely to be involved. Indeed, rapamycin increased the levels of endogenous MDM2 despite inhibition of its phosphorylation at Ser-166. Our findings may have implications for the design of combinatorial cancer treatments with mTOR pathway inhibitors. PMID:25482947

Reciprocal inhibition of p53 and nuclear factor-kappaB transcriptional activities determines cell survival or death in neurons.

PubMed

Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef

2003-09-17

The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.

Targeting MDM2 for Treatment of Adenoid Cystic Carcinoma

PubMed Central

Warner, Kristy A.; Nör, Felipe; Acasigua, Gerson A.; Martins, Manoela D.; Zhang, Zhaocheng; McLean, Scott A.; Spector, Matthew E.; Chepeha, Douglas B.; Helman, Joseph; Wick, Michael J.; Moskaluk, Christopher A.; Castilho, Rogerio M.; Pearson, Alexander T.; Wang, Shaomeng; Nör, Jacques E.

2016-01-01

Purpose There are no effective treatment options for patients with advanced adenoid cystic carcinoma (ACC). Here, we evaluated the effect of a new small molecule inhibitor of the MDM2-p53 interaction (MI-773) in preclinical models of ACC. Experimental Design To evaluate the anti-tumor effect of MI-773, we administered it to mice harboring 3 different patient-derived xenograft (PDX) models of ACC expressing functional p53. The effect of MI-773 on MDM2, p53, phospho-p53 and p21 was examined by Western blots in 5 low passage primary human ACC cell lines and in MI-773-treated PDX tumors. Results Single agent MI-773 caused tumor regression in the 3 PDX models of ACC studied here. For example, we observed a tumor growth inhibition (TGI) index of 127% in UM-PDX-HACC-5 tumors that was associated with an increase in the fraction of apoptotic cells (p=0.015). The number of p53-positive cells was increased in MI-773-treated PDX tumors (p<0.001), with a correspondent shift in p53 localization from the nucleus to the cytoplasm. Western blots demonstrated that MI-773 potently induced expression of p53 and its downstream targets p21, MDM2 and induced phosphorylation of p53 (serine 392) in low passage primary human ACC cells. Notably, MI-773 induced a dose-dependent increase in the fraction of apoptotic ACC cells and in the fraction of cells in the G1 phase of cell cycle (p<0.05). Conclusions Collectively, these data demonstrate that therapeutic inhibition of the MDM2-p53 interaction with MI-773 activates downstream effectors of apoptosis and causes robust tumor regression in preclinical models of adenoid cystic carcinoma. PMID:26936915

p205, a potential tumor suppressor, inhibits cell proliferation via multiple pathways of cell cycle regulation.

PubMed

Asefa, Benyam; Dermott, Jonathan M; Kaldis, Philipp; Stefanisko, Karen; Garfinkel, David J; Keller, Jonathan R

2006-02-20

p205 is a member of the interferon-inducible p200 family of proteins that regulate cell proliferation. Over-expression of p205 inhibits cell growth, although its mechanism of action is currently unknown. Therefore, we evaluated the effect of p205 on the p53 and Rb-dependent pathways of cell cycle regulation. p205 expression results in elevated levels of p21, and activates the p21 promoter in vitro in a p53-dependent manner. In addition, p205 induces increased expression of Rb, and binds directly to Rb and p53. Interestingly, p205 also induces growth inhibition independent of p53 and Rb by delaying G2/M progression in proliferating cells, and is a substrate for Cdk2 kinase activity. Finally, we have identified other binding partners of p205 by a yeast two-hybrid screen, including the paired homeodomain protein HoxB2. Taken together, our results indicate that p205 induces growth arrest by interaction with multiple transcription factors that regulate the cell cycle, including but not entirely dependent on the Rb- and p53-mediated pathways of growth inhibition.

Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

PubMed

Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

2015-08-18

p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

PubMed Central

Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle

2016-01-01

Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199

Lysophosphatidic acid and adenylyl cyclase inhibitor increase proliferation of senescent human diploid fibroblasts by inhibiting adenosine monophosphate-activated protein kinase.

PubMed

Rhim, Ji-Heon; Jang, Ik-Soon; Song, Kye-Yong; Ha, Moon-Kyung; Cho, Sung-Chun; Yeo, Eui-Ju; Park, Sang Chul

2008-08-01

This study was designed to elucidate the molecular mechanism underlying lysophosphatidic acid (LPA) and adenylyl cyclase inhibitor SQ22536 (ACI)-induced senescent human diploid fibroblast (HDF) proliferation. Because adenosine monophosphate (AMP)-activated protein kinase (AMPK) is known to inhibit cell proliferation, we examined the phosphorylation status of AMPK and p53 and the expression level of p21(waf1/cip1) after treating HDFs with LPA and ACI. Phosphorylation of AMPKalpha on threonine-172 (p-Thr172-AMPKalpha) increases its catalytic activity but phosphorylation on serine-485/491 (p-Ser485/491-AMPKalpha) reduces the accessibility of the Thr172 phosphorylation site thereby inhibiting its catalytic activity. LPA increased p-Ser485/491-AMPKalpha, presumably by activating cAMP-dependent protein kinase (PKA). However, ACI reduced p-Thr172-AMPKalpha by inhibiting the LKB signaling. Our data demonstrated that both LPA and ACI inhibit the catalytic activity of AMPKalpha and p53 by differentially regulating phosphorylation of AMPKalpha, causing increased senescent cell proliferation. These findings suggest that the proliferation potential of senescent HDFs can be modulated through the regulation of the AMPK signaling pathway.

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

PubMed

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

CRISPR-Cas9-based target validation for p53-reactivating model compounds

PubMed Central

Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten

2015-01-01

Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461

SGK1 (glucose transport), dishevelled2 (wnt signaling), LC3/p62 (autophagy) and p53 (apoptosis) proteins are unaltered in Lafora disease.

PubMed

Wang, Peixiang; Israelian, Lori; Xue, Yunlin; Song, Siyuan; Attisano, Liliana; Minassian, Berge A

2016-01-01

Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.

Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

PubMed

Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

2017-10-15

Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and DNA damage-mediated cellular stresses. This seems to be the first report that p53 activates a viral oncogene; therefore, the discovery would be interesting to a broad readership from the fields of oncology to virology. Copyright © 2017 American Society for Microbiology.

Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

PubMed Central

Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

2015-01-01

ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

Anticancer Activity of Marine Sponge Hyrtios sp. Extract in Human Colorectal Carcinoma RKO Cells with Different p53 Status

PubMed Central

Lim, Hyun Kyung; Bae, Woori; Lee, Hyi-Seung

2014-01-01

Drug development using marine bioresources is limited even though the ocean occupies about 70% of the earth and contains a large number of biological materials. From the screening test of the marine sponge extracts, we found Hyrtios sp. sponge collected from Chuuk island, Micronesia. In this study, the Hyrtios sp. extract was examined for anticancer activity against human colorectal carcinoma RKO cells that are wildtype for p53 and RKO-E6 that are p53 defective. The Hyrtios sp. extract dose-dependently inhibited viability in both cell lines. Multinucleation as an indication of mitotic catastrophe was also observed. Cytotoxicity tests gave significantly different results for RKO and RKO-E6 cells after 48 h exposure to Hyrtios sp. extract. In RKO cells treated with Hyrtios sp. extract, cell death occurred by induction of p53 and p21 proteins. In p53-defective RKO-E6 cells, Hyrtios sp. extract decreased expression of JNK protein and increased p21 protein. These results indicate that Hyrtios sp. extract induced apoptosis via different pathways depending on p53 status and could be a good natural product for developing new anticancer drugs. PMID:25243139

Nutlin-3 down-regulates retinoblastoma protein expression and inhibits muscle cell differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walsh, Erica M.; Niu, MengMeng; Bergholz, Johann

The p53 tumor suppressor gene plays a critical role in regulation of proliferation, cell death and differentiation. The MDM2 oncoprotein is a major negative regulator for p53 by binding to and targeting p53 for proteasome-mediated degradation. The small molecule inhibitor, nutlin-3, disrupts MDM2-p53 interaction resulting in stabilization and activation of p53 protein. We have previously shown that nutlin-3 activates p53, leading to MDM2 accumulation as concomitant of reduced retinoblastoma (Rb) protein stability. It is well known that Rb is important in muscle development and myoblast differentiation and that rhabdomyosarcoma (RMS), or cancer of the skeletal muscle, typically harbors MDM2 amplification.more » In this study, we show that nutlin-3 inhibited myoblast proliferation and effectively prevented myoblast differentiation, as evidenced by lack of expression of muscle differentiation markers including myogenin and myosin heavy chain (MyHC), as well as a failure to form multinucleated myotubes, which were associated with dramatic increases in MDM2 expression and decrease in Rb protein levels. These results indicate that nutlin-3 can effectively inhibit muscle cell differentiation. - Highlights: • Nutlin-3 inhibits myoblast proliferation and prevents differentiation into myotubes. • Nutlin-3 increases MDM2 expression and down-regulates Rb protein levels. • This study has implication in nutlin-3 treatment of rhabdomyosarcomas.« less

Folic acid inhibits COLO-205 colon cancer cell proliferation through activating the FRα/c-SRC/ERK1/2/NFκB/TP53 pathway: in vitro and in vivo studies

PubMed Central

Kuo, Chun-Ting; Chang, Chieh; Lee, Wen-Sen

2015-01-01

To investigate the molecular mechanism underlying folic acid (FA)-induced anti-colon caner activity, we showed that FA caused G0/G1 arrest in COLO-205. FA activated the proto-oncogene tyrosine-protein kinase Src (c-SRC)-mediated signaling pathway to enhance nuclear factor of kappa light polypeptide gene enhancer in B-cells (NFκB) nuclear translocation and binding onto the tumor protein p53 (TP53) gene promoter, and up-regulated expressions of TP53, cyclin-dependent kinase inhibitor 1A (CDKN1A) and cyclin-dependent kinase inhibitor 1B (CDKN1B). Knock-down of TP53 abolished FA-induced increases in the levels of CDKN1A and CDKN1B protein and G0/G1 arrest in COLO-205. Knock-down of folate receptor alpha (FRα) abolished FA-induced activations in the c-SRC-mediated pathway and increases in the levels of CDKN1A, CDKN1B and TP53 protein. These data suggest that FA inhibited COLO-205 proliferation through activating the FRα/c-SRC/mitogen-activated protein kinase 3/1 (ERK1/2)/NFκB/TP53 pathway-mediated up-regulations of CDKN1A and CDKN1B protein. In vivo studies demonstrated that daily i.p. injections of FA led to profound regression of the COLO-205 tumors and prolong the lifespan. In these tumors, the levels of CDKN1A, CDKN1B and TP53 protein were increased and von willebrand factor (VWF) protein levels were decreased. These findings suggest that FA inhibits COLO-205 colon cancer growth through anti-cancer cell proliferation and anti-angiogenesis. PMID:26056802

Wild-type p53 reactivation by small-molecule Minnelide™ in human papillomavirus (HPV)-positive head and neck squamous cell carcinoma.

PubMed

Caicedo-Granados, Emiro; Lin, Rui; Fujisawa, Caitlin; Yueh, Bevan; Sangwan, Veena; Saluja, Ashok

2014-12-01

The incidence of high-risk human papillomavirus (HR-HPV) head and neck squamous cell carcinoma (HNSCC) continues to increase, particularly oropharyngeal squamous cell carcinoma (OPSCC) cases. The inactivation of the p53 tumor suppressor gene promotes a chain of molecular events, including cell cycle progression and apoptosis resistance. Reactivation of wild-type p53 function is an intriguing therapeutic strategy. The aim of this study was to investigate whether a novel compound derived from diterpene triepoxide (Minnelide™) can reactivate wild-type p53 function in HPV-positive HNSCC. For all of our in vitro experiments, we used 2 HPV-positive HNSCC cell lines, University of Michigan squamous cell carcinoma (UM-SCC) 47 and 93-VU-147, and 2 HPV-positive human cervical cancer cell lines, SiHa and CaSki. Cells were treated with different concentrations of triptolide and analyzed for p53 activation. Mice bearing UM-SCC 47 subcutaneous xenografts and HPV-positive patient-derived tumor xenografts were treated with Minnelide and evaluated for tumor growth and p53 activation. In HPV-positive HNSCC, Minnelide reactivated p53 by suppressing E6 oncoprotein. Activation of apoptosis followed, both in vitro and in vivo. In 2 preclinical HNSCC animal models (a subcutaneous xenograft model and a patient-derived tumor xenograft model), Minnelide reactivated p53 function and significantly decreased tumor progression and tumor volume. Triptolide and Minnelide caused cell death in vitro and in vivo in HPV-positive HNSCC by reactivating wild-type p53 and thus inducing apoptosis. In addition, in 2 HPV-positive HNSCC animal models, Minnelide decreased tumor progression and induced apoptosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

UV-A Irradiation Activates Nrf2-Regulated Antioxidant Defense and Induces p53/Caspase3-Dependent Apoptosis in Corneal Endothelial Cells.

PubMed

Liu, Cailing; Vojnovic, Dijana; Kochevar, Irene E; Jurkunas, Ula V

2016-04-01

To examine whether Nrf2-regulated antioxidant defense and p53 are activated in human corneal endothelial cells (CEnCs) by environmental levels of ultraviolet A (UV-A), a known stimulator of oxidative stress. Immortalized human CEnCs (HCEnCi) were exposed to UV-A fluences of 2.5, 5, 10, or 25 J/cm2, then allowed to recover for 3 to 24 hours. Control HCEnCi did not receive UV-A. Reactive oxygen species (ROS) were measured using H2DCFDA. Cell cytotoxicity was evaluated by lactate dehydrogenase (LDH) release. Levels of Nrf2, HO-1, NQO-1, p53, and caspase3 were detected by immunnoblotting or real-time PCR. Activated caspase3 was measured by immunoblotting and a fluorescence assay. Exposure of HCEnCi to 5, 10, and 25 J/cm2 UV-A increased ROS levels compared with controls. Nrf2, HO-1, and NQO-1 mRNA increased 1.7- to 3.2-fold at 3 and 6 hours after irradiation with 2.5 and 5 J/cm2 UV-A. At 6 hours post irradiation, UV-A (5 J/cm2) enhanced nuclear Nrf2 translocation. At 24 hours post treatment, UV-A (5, 10, and 25 J/cm2) produced a 1.8- to 2.8-fold increase in phospho-p53 and a 2.6- to 6.0-fold increase in activated caspase3 compared with controls, resulting in 20% to 42% cell death. Lower fluences of UV-A induce Nrf2-regulated antioxidant defense and higher fluences activate p53 and caspase3, indicating that even near-environmental levels of UV-A may affect normal CEnCs. This data suggest that UV-A may especially damage cells deficient in antioxidant defense, and thus may be involved in the etiology of Fuchs' endothelial corneal dystrophy (FECD).

UV-A Irradiation Activates Nrf2-Regulated Antioxidant Defense and Induces p53/Caspase3-Dependent Apoptosis in Corneal Endothelial Cells

PubMed Central

Liu, Cailing; Vojnovic, Dijana; Kochevar, Irene E.; Jurkunas, Ula V.

2016-01-01

Purpose To examine whether Nrf2-regulated antioxidant defense and p53 are activated in human corneal endothelial cells (CEnCs) by environmental levels of ultraviolet A (UV-A), a known stimulator of oxidative stress. Methods Immortalized human CEnCs (HCEnCi) were exposed to UV-A fluences of 2.5, 5, 10, or 25 J/cm2, then allowed to recover for 3 to 24 hours. Control HCEnCi did not receive UV-A. Reactive oxygen species (ROS) were measured using H2DCFDA. Cell cytotoxicity was evaluated by lactate dehydrogenase (LDH) release. Levels of Nrf2, HO-1, NQO-1, p53, and caspase3 were detected by immunnoblotting or real-time PCR. Activated caspase3 was measured by immunoblotting and a fluorescence assay. Results Exposure of HCEnCi to 5, 10, and 25 J/cm2 UV-A increased ROS levels compared with controls. Nrf2, HO-1, and NQO-1 mRNA increased 1.7- to 3.2-fold at 3 and 6 hours after irradiation with 2.5 and 5 J/cm2 UV-A. At 6 hours post irradiation, UV-A (5 J/cm2) enhanced nuclear Nrf2 translocation. At 24 hours post treatment, UV-A (5, 10, and 25 J/cm2) produced a 1.8- to 2.8-fold increase in phospho-p53 and a 2.6- to 6.0-fold increase in activated caspase3 compared with controls, resulting in 20% to 42% cell death. Conclusions Lower fluences of UV-A induce Nrf2-regulated antioxidant defense and higher fluences activate p53 and caspase3, indicating that even near-environmental levels of UV-A may affect normal CEnCs. This data suggest that UV-A may especially damage cells deficient in antioxidant defense, and thus may be involved in the etiology of Fuchs' endothelial corneal dystrophy (FECD). PMID:27127932

The transcription factor p53: Not a repressor, solely an activator

PubMed Central

Fischer, Martin; Steiner, Lydia; Engeland, Kurt

2014-01-01

The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

Simulation-Based Validation of the p53 Transcriptional Activity with Hybrid Functional Petri Net.

PubMed

Doi, Atsushi; Nagasaki, Masao; Matsuno, Hiroshi; Miyano, Satoru

2011-01-01

MDM2 and p19ARF are essential proteins in cancer pathways forming a complex with protein p53 to control the transcriptional activity of protein p53. It is confirmed that protein p53 loses its transcriptional activity by forming the functional dimer with protein MDM2. However, it is still unclear that protein p53 keeps its transcriptional activity when it forms the trimer with proteins MDM2 and p19ARF. We have observed mutual behaviors among genes p53, MDM2, p19ARF and their products on a computational model with hybrid functional Petri net (HFPN) which is constructed based on information described in the literature. The simulation results suggested that protein p53 should have the transcriptional activity in the forms of the trimer of proteins p53, MDM2, and p19ARF. This paper also discusses the advantages of HFPN based modeling method in terms of pathway description for simulations.

Downregulation of LRRC8A protects human ovarian and alveolar carcinoma cells against Cisplatin-induced expression of p53, MDM2, p21Waf1/Cip1, and Caspase-9/-3 activation

PubMed Central

Sørensen, Belinda Halling; Nielsen, Dorthe; Thorsteinsdottir, Unnur Arna; Hoffmann, Else Kay

2016-01-01

The leucine-rich repeat containing 8A (LRRC8A) protein is an essential component of the volume-sensitive organic anion channel (VSOAC), and using pharmacological anion channel inhibitors (NS3728, DIDS) and LRRC8A siRNA we have investigated its role in development of Cisplatin resistance in human ovarian (A2780) and alveolar (A549) carcinoma cells. In Cisplatin-sensitive cells Cisplatin treatment increases p53-protein level as well as downstream signaling, e.g., expression of p21Waf1/Cip1, Bax, Noxa, MDM2, and activation of Caspase-9/-3. In contrast, Cisplatin-resistant cells do not enter apoptosis, i.e., their p53 and downstream signaling are reduced and caspase activity unaltered following Cisplatin exposure. Reduced LRRC8A expression and VSOAC activity are previously shown to correlate with Cisplatin resistance, and here we demonstrate that pharmacological inhibition and transient knockdown of LRRC8A reduce the protein level of p53, MDM2, and p21Waf1/Cip1 as well as Caspase-9/-3 activation in Cisplatin-sensitive cells. Cisplatin resistance is accompanied by reduction in total LRRC8A expression (A2780) or LRRC8A expression in the plasma membrane (A549). Activation of Caspase-3 dependent apoptosis by TNFα-exposure or hyperosmotic cell shrinkage is almost unaffected by pharmacological anion channel inhibition. Our data indicate 1) that expression/activity of LRRC8A is essential for Cisplatin-induced increase in p53 protein level and its downstream signaling, i.e., Caspase-9/-3 activation, expression of p21Waf1/Cip1 and MDM2; and 2) that downregulation of LRRC8A-dependent osmolyte transporters contributes to acquirement of Cisplatin resistance in ovarian and lung carcinoma cells. Activation of LRRC8A-containing channels is upstream to apoptotic volume decrease as hypertonic cell shrinkage induces apoptosis independent of the presence of LRRC8A. PMID:26984736

Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.

PubMed

Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K

2010-12-01

Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.

ROS-dependent activation of JNK converts p53 into an efficient inhibitor of oncogenes leading to robust apoptosis

PubMed Central

Shi, Y; Nikulenkov, F; Zawacka-Pankau, J; Li, H; Gabdoulline, R; Xu, J; Eriksson, S; Hedström, E; Issaeva, N; Kel, A; Arnér, E S J; Selivanova, G

2014-01-01

Rescue of the p53 tumor suppressor is an attractive cancer therapy approach. However, pharmacologically activated p53 can induce diverse responses ranging from cell death to growth arrest and DNA repair, which limits the efficient application of p53-reactivating drugs in clinic. Elucidation of the molecular mechanisms defining the biological outcome upon p53 activation remains a grand challenge in the p53 field. Here, we report that concurrent pharmacological activation of p53 and inhibition of thioredoxin reductase followed by generation of reactive oxygen species (ROS), result in the synthetic lethality in cancer cells. ROS promote the activation of c-Jun N-terminal kinase (JNK) and DNA damage response, which establishes a positive feedback loop with p53. This converts the p53-induced growth arrest/senescence to apoptosis. We identified several survival oncogenes inhibited by p53 in JNK-dependent manner, including Mcl1, PI3K, eIF4E, as well as p53 inhibitors Wip1 and MdmX. Further, we show that Wip1 is one of the crucial executors downstream of JNK whose ablation confers the enhanced and sustained p53 transcriptional response contributing to cell death. Our study provides novel insights for manipulating p53 response in a controlled way. Further, our results may enable new pharmacological strategy to exploit abnormally high ROS level, often linked with higher aggressiveness in cancer, to selectively kill cancer cells upon pharmacological reactivation of p53. PMID:24413150

p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

PubMed

Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

1996-09-01

Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

Hyperphosphatemia induces cellular senescence in human aorta smooth muscle cells through integrin linked kinase (ILK) up-regulation.

PubMed

Troyano, Nuria; Nogal, María Del; Mora, Inés; Diaz-Naves, Manuel; Lopez-Carrillo, Natalia; Sosa, Patricia; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruiz-Torres, María P

2015-12-01

Aging is conditioned by genetic and environmental factors. Hyperphosphatemia is related to some pathologies, affecting to vascular cells behavior. This work analyze whether high concentration of extracellular phosphate induces vascular smooth muscle cells senescence, exploring the intracellular mechanisms and highlighting the in vivo relevance of this phenomenon. Human aortic smooth muscle cells treated with β-Glycerophosphate (BGP, 10mM) suffered cellular senescence by increasing p53, p21 and p16 expression and the senescence associated β-galactosidase activity. In parallel, BGP induced ILK overexpression, dependent on the IGF-1 receptor activation, and oxidative stress. Down-regulating ILK expression prevented BGP-induced senescence and oxidative stress. Aortic rings from young rats treated with 10mM BGP for 48h, showed increased p53, p16 and ILK expression and SA-β-gal activity. Seven/eight nephrectomized rats feeding a hyperphosphatemic diet and fifteenth- month old mice showed hyperphosphatemia and aortic ILK, p53 and p16 expression. In conclusion, we demonstrated that high extracellular concentration of phosphate induced senescence in cultured smooth muscle through the activation of IGF-1 receptor and ILK overexpression and provided solid evidences for the in vivo relevance of these results since aged animals showed high levels of serum phosphate linked to increased expression of ILK and senescence genes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

NASA Astrophysics Data System (ADS)

Sharifulina, S. A.; Uzdensky, A. B.

2015-03-01

The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

Bim directly antagonizes Bcl-xl in doxorubicin-induced prostate cancer cell apoptosis independently of p53.

PubMed

Yang, Min-Chi; Lin, Ru-Wei; Huang, Shih-Bo; Huang, Shin-Yuan; Chen, Wen-Jie; Wang, Shiaw; Hong, Yi-Ren; Wang, Chihuei

2016-01-01

Doxorubicin and other anthracycline compounds exert their anti-cancer effects by causing DNA damage and initiating cell cycle arrest in cancer cells, followed by apoptosis. DNA damage generally activates a p53-mediated pathway to initiate apoptosis by increasing the level of the BH3-only protein, Puma. However, p53-mediated apoptosis in response to DNA damage has not yet been validated in prostate cancers. In the current study, we used LNCaP and PC3 prostate cancer cells, representing wild type p53 and a p53-null model, to determine if DNA damage activates p53-mediated apoptosis in prostate cancers. Our results revealed that PC3 cells were 4 to 8-fold less sensitive than LNCaP cells to doxorubicin-inuced apoptosis. We proved that the differential response of LNCaP and PC3 to doxorubicin was p53-independent by introducing wild-type or dominant negative p53 into PC3 or LNCaP cells, respectively. By comparing several apoptosis-related proteins in both cell lines, we found that Bcl-xl proteins were much more abundant in PC3 cells than in LNCaP cells. We further demonstrated that Bcl-xl protects LNCaP and PC3 cells from doxorubicin-induced apoptosis by using ABT-263, an inhibitor of Bcl-xl, as a single agent or in combination with doxorubicin to treat LNCaP or PC3 cells. Bcl-xl rather than p53, likely contributes to the differential response of LNCaP and PC3 to doxorubicin in apoptosis. Finally, co-immunoprecipitation and siRNA analysis revealed that a BH3-only protein, Bim, is involved in doxorubicin-induced apoptosis by directly counteracting Bcl-xl.

Auto-ubiquitination of Mdm2 Enhances Its Substrate Ubiquitin Ligase Activity*

PubMed Central

Ranaweera, Ruchira S.; Yang, Xiaolu

2013-01-01

The RING domain E3 ubiquitin ligase Mdm2 is the master regulator of the tumor suppressor p53. It targets p53 for proteasomal degradation, restraining the potent activity of p53 and enabling cell survival and proliferation. Like most E3 ligases, Mdm2 can also ubiquitinate itself. How Mdm2 auto-ubiquitination may influence its substrate ubiquitin ligase activity is undefined. Here we show that auto-ubiquitination of Mdm2 is an activating event. Mdm2 that has been conjugated to polyubiquitin chains, but not to single ubiquitins, exhibits substantially enhanced activity to polyubiquitinate p53. Mechanistically, auto-ubiquitination of Mdm2 facilitates the recruitment of the E2 ubiquitin-conjugating enzyme. This occurs through noncovalent interactions between the ubiquitin chains on Mdm2 and the ubiquitin binding domain on E2s. Mutations that diminish the noncovalent interactions render auto-ubiquitination unable to stimulate Mdm2 substrate E3 activity. These results suggest a model in which polyubiquitin chains on an E3 increase the local concentration of E2 enzymes and permit the processivity of substrate ubiquitination. They also support the notion that autocatalysis may be a prevalent mode for turning on the activity of latent enzymes. PMID:23671280

The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

PubMed

Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

2018-03-23

p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53

PubMed Central

Sullivan, Kelly D.; Padilla-Just, Nuria; Henry, Ryan E.; Porter, Christopher C.; Kim, Jihye; Tentler, John J.; Eckhardt, S. Gail; Tan, Aik Choon; DeGregori, James; Espinosa, Joaquín M.

2012-01-01

The p53 tumor suppressor orchestrates alternative stress responses including cell cycle arrest and apoptosis, but the mechanisms defining cell fate upon p53 activation are poorly understood. Several small molecule activators of p53 have been developed, including Nutlin-3, but their therapeutic potential is limited by the fact that they induce reversible cell cycle arrest in most cancer cell types. We report here the results of a ‘Synthetic Lethal with Nutlin-3’ genome-wide shRNA screen, which revealed that the ATM and MET kinases govern cell fate choice upon p53 activation. Genetic or pharmacological interference with ATM or MET activity converts the cellular response from cell cycle arrest into apoptosis in diverse cancer cell types without affecting expression of key p53 target genes. ATM and MET inhibitors enable Nutlin-3 to kill tumor spheroids. These results identify novel pathways controlling the cellular response to p53 activation and aid in the design of p53-based therapies. PMID:22660439

Protection and sensitization of normal and malignant cells by a naturally occurring compound in a model of photochemical damage

NASA Astrophysics Data System (ADS)

Lee, Yuan-Hao; Kumar, Neeru; Glickman, Randolph D.

2012-03-01

Certain phytonutrients are known to confer protection and immunosuppression against radiation insults. Radiation-induced reactive oxygen species (ROS) can either lead to the destruction of normal tissue cells, or induce tumor radioresistance by activating ROS scavenging proteins. To identify whether the triterpene phytonutrient, ursolic acid, reduces radiation-induced damage in normal cells and promotes the apoptosis of malignant cells, we investigated the biologic mechanisms and effect of radiation-cell interaction with or without treatment with ursolic acid in human skin melanoma cells (ATCC CRL-11147TM) and transformed human retinal pigment epithelial (hTERT-RPE) cells. UV-VIS light was employed to investigate the efficacy of ursolic acid in altering cellular viability by modulations of p53 and NF-κB p65 signaling. Cell response was investigated by changes in proliferative activity and free radical generation assessed by 2',7'-dichlorofluorescin liquid chromatography. Ursolic acid pretreatment strongly increased the level of p53 and decreased the level of phosphorylated p65 leading to enhanced cell death of skin melanoma cells in response to UV-VIS exposure. In contrast, ursolic acid appeared to downregulate p53 levels without disturbing NF-κB activation along with an increase of oxidative stress in hTERT-RPE cells. These findings indicate that ursolic acid may beneficially increase the radiosensitivity of tumor cells while potentiating a photoprotective effect on benign cells through differential effects on the NF-κB and p53 signaling pathways.

CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

PubMed

Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

2017-09-19

Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation

PubMed Central

Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

2017-01-01

Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14–Cre–ERT2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14–Cre–ERT2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte–stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn. PMID:28878021

Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA.

PubMed

Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z

2012-10-01

The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.

Mdm4 loss in the intestinal epithelium leads to compartmentalized cell death but no tissue abnormalities

PubMed Central

Valentin-Vega, Yasmine A.; Box, Neil; Terzian, Tamara; Lozano, Guillermina

2014-01-01

Mdm4 is a critical inhibitor of the p53 tumor suppressor. Mdm4 null mice die early during embryogenesis due to increased p53 activity. In this study, we explore the role that Mdm4 plays in the intestinal epithelium by crossing mice carrying the Mdm4 floxed allele to mice with the Villin Cre transgene. Our data show that loss of Mdm4 (Mdm4intΔ) in this tissue resulted in viable animals with no obvious morphological abnormalities. However, these mutants displayed increased p53 levels and apoptosis exclusively in the proliferative compartment of the intestinal epithelium. This phenotype was completely rescued in a p53 null background. Notably, the observed compartmentalized apoptosis in proliferative intestinal epithelial cells was not due to restricted Mdm4 expression in this region. Thus, in this specific cellular context, p53 is negatively regulated by Mdm4 exclusively in highly proliferative cells. PMID:19371999

Subcellular mechanisms involved in apoptosis induced by aminoglycoside antibiotics: Insights on p53, proteasome and endoplasmic reticulum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denamur, Sophie; Boland, Lidvine

Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasomemore » by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.« less

Arsenite induced poly(ADP-ribosyl)ation of tumor suppressor P53 in human skin keratinocytes as a possible mechanism for carcinogenesis associated with arsenic exposure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Komissarova, Elena V.; Rossman, Toby G., E-mail: toby.rossman@nyumc.or

2010-03-15

Arsenite is an environmental pollutant. Exposure to inorganic arsenic in drinking water is associated with elevated cancer risk, especially in skin. Arsenite alone does not cause skin cancer in animals, but arsenite can enhance the carcinogenicity of solar UV. Arsenite is not a significant mutagen at non-toxic concentrations, but it enhances the mutagenicity of other carcinogens. The tumor suppressor protein P53 and nuclear enzyme PARP-1 are both key players in DNA damage response. This laboratory demonstrated earlier that in cells treated with arsenite, the P53-dependent increase in p21{sup WAF1/CIP1} expression, normally a block to cell cycle progression after DNA damage,more » is deficient. Here we show that although long-term exposure of human keratinocytes (HaCaT) to a nontoxic concentration (0.1 muM) of arsenite decreases the level of global protein poly(ADP-ribosyl)ation, it increases poly(ADP-ribosyl)ation of P53 protein and PARP-1 protein abundance. We also demonstrate that exposure to 0.1 muM arsenite depresses the constitutive expression of p21 mRNA and P21 protein in HaCaT cells. Poly(ADP-ribosyl)ation of P53 is reported to block its activation, DNA binding and its functioning as a transcription factor. Our results suggest that arsenite's interference with activation of P53 via poly(ADP-ribosyl)ation may play a role in the comutagenic and cocarcinogenic effects of arsenite.« less

Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Duanmin; Su, Cunjin; Jiang, Min

There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs,more » siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.« less

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

PubMed Central

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-01-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

PubMed

Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

2013-09-01

We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

PubMed Central

Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

2014-01-01

The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

Nucleophosmin regulates the stability and transcriptional activity of p53.

PubMed

Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe

2002-07-01

Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.

PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu Dehua; Fan, Wufang; Liu, Guohong

2006-04-01

HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showedmore » that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties.« less

Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

PubMed Central

Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

2018-01-01

Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

PubMed

Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

2005-12-08

TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878

2013-11-01

Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less

A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

PubMed Central

Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin

2015-01-01

Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy. PMID:26098630

A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif.

PubMed

Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin

2015-01-01

Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were -0.44 Kcal/mol and -9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

Up-regulation of nucleotide excision repair in mouse lung and liver following chronic exposure to aflatoxin B{sub 1} and its dependence on p53 genotype

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mulder, Jeanne E.; Bondy, Genevieve S.; Mehta, Rekha

Aflatoxin B{sub 1} (AFB{sub 1}) is biotransformed in vivo into an epoxide metabolite that forms DNA adducts that may induce cancer if not repaired. p53 is a tumor suppressor gene implicated in the regulation of global nucleotide excision repair (NER). Male heterozygous p53 knockout (B6.129-Trp53{sup tm1Brd}N5, Taconic) and wild-type mice were exposed to 0, 0.2 or 1.0 ppm AFB{sub 1} for 26 weeks. NER activity was assessed with an in vitro assay, using AFB{sub 1}-epoxide adducted plasmid DNA as a substrate. For wild-type mice, repair of AFB{sub 1}–N7-Gua adducts was 124% and 96% greater in lung extracts from mice exposedmore » to 0.2 ppm and 1.0 ppm AFB{sub 1} respectively, and 224% greater in liver extracts from mice exposed to 0.2 ppm AFB{sub 1} (p < 0.05). In heterozygous p53 knockout mice, repair of AFB{sub 1}–N7-Gua was only 45% greater in lung extracts from mice exposed to 0.2 ppm AFB{sub 1} (p < 0.05), and no effect was observed in lung extracts from mice treated with 1.0 ppm AFB{sub 1} or in liver extracts from mice treated with either AFB{sub 1} concentration. p53 genotype did not affect basal levels of repair. AFB{sub 1} exposure did not alter repair of AFB{sub 1}-derived formamidopyrimidine adducts in lung or liver extracts of either mouse genotype nor did it affect XPA or XPB protein levels. In summary, chronic exposure to AFB{sub 1} increased NER activity in wild-type mice, and this response was diminished in heterozygous p53 knockout mice, indicating that loss of one allele of p53 limits the ability of NER to be up-regulated in response to DNA damage. - Highlights: • Mice are chronically exposed to low doses of the mycotoxin aflatoxin B{sub 1} (AFB{sub 1}). • The effects of AFB{sub 1} and p53 status on nucleotide excision repair are investigated. • AFB{sub 1} increases nucleotide excision repair in wild type mouse lung and liver. • This increase is attenuated in p53 heterozygous mouse lung and liver. • Results portray the role of p53 in nucleotide excision repair after AFB{sub 1} exposure.« less

p21: A Two-Faced Genome Guardian.

PubMed

Georgakilas, Alexandros G; Martin, Olga A; Bonner, William M

2017-04-01

Upon DNA damage or other stressors, the tumor suppressor p53 is activated, leading to transient expression of the cyclin-dependent kinase inhibitor (CKI) p21. This either triggers momentary G1 cell cycle arrest or leads to a chronic state of senescence or apoptosis, a form of genome guardianship. In the clinic, the presence of p21 has been considered an indicator of wildtype p53 activity. However, recent evidence suggests that p21 also acts as an oncogenic factor in a p53-deficient environment. Here, we discuss the controversial aspects of the two-faced involvement of p21 in cancer and speculate on how this new information may increase our understanding of its role in cancer pathogenesis. Prevailing notions indicate that p21 might also act as antiapoptotic agent, which may have relevant implications for future therapeutic strategies. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nitric oxide prodrug JS-K inhibits ubiquitin E1 and kills tumor cells retaining wild-type p53.

PubMed

Kitagaki, J; Yang, Y; Saavedra, J E; Colburn, N H; Keefer, L K; Perantoni, A O

2009-01-29

Nitric oxide (NO) is a major effector molecule in cancer prevention. A number of studies have shown that NO prodrug JS-K (O(2)-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate) induces apoptotic cell death in vitro and in vivo, indicating that it is a promising new therapeutic for cancer. However, the mechanism of its tumor-killing activity remains unclear. Ubiquitin plays an important role in the regulation of tumorigenesis and cell apoptosis. Our earlier report has shown that inactivation of the ubiquitin system through blocking E1 (ubiquitin-activating enzyme) activity preferentially induces apoptosis in p53-expressing transformed cells. As E1 has an active cysteine residue that could potentially interact with NO, we hypothesized that JS-K could inactivate E1 activity. E1 activity was evaluated by detecting ubiquitin-E1 conjugates through immunoblotting. JS-K strikingly inhibits the ubiquitin-E1 thioester formation in cells in a dose-dependent manner with an IC(50) of approximately 2 microM, whereas a JS-K analog that cannot release NO did not affect these levels in cells. Moreover, JS-K decreases total ubiquitylated proteins and increases p53 levels, which is mainly regulated by ubiquitin and proteasomal degradation. Furthermore, JS-K preferentially induces cell apoptosis in p53-expressing transformed cells. These findings indicate that JS-K inhibits E1 activity and kills transformed cells harboring wild-type p53.

The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

PubMed Central

Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

2013-01-01

The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.

PubMed

Garner, Elizabeth; Raj, Kenneth

2008-02-01

There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.

Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

PubMed

Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

2015-10-01

The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

Regulation of PI 3-K, PTEN, p53, and mTOR in Malignant and Benign Tumors Deficient in Tuberin

PubMed Central

Yadav, Anamika; Mahimainathan, Lenin; Valente, Anthony J.

2011-01-01

The tuberous sclerosis complex (TSC) is caused by mutation in either of 2 tumor suppressor genes, TSC-1 (encodes hamartin) and TSC-2 (encodes tuberin). In humans, deficiency in TSC1/2 is associated with benign tumors in many organs, including renal angiomyolipoma (AML) but rarely renal cell carcinoma (RCC). In contrast, deficiency of TSC function in the Eker rat is associated with RCC. Here, we have investigated the activity of PI 3-K and the expression of PTEN, p53, tuberin, p-mTOR, and p-p70S6K in both Eker rat RCC and human renal AML. Compared to normal tissue, increased PI 3-K activity was detected in RCC of Eker rats but not in human AML tissue. In contrast, PTEN was highly expressed in AML but significantly reduced in the renal tumors of Eker rats. Phosphorylation on Ser2448 of mTOR and Thr389 of p70S6K were significantly increased in both RCC and AML compared to matching control tissue. Total tuberin was significantly decreased in AML while completely lost in RCC of Eker rats. Our data also show that while p53 protein expression is lost in rat RCC, it was highly elevated in AML. These novel data provide evidence that loss of TSC-2, PTEN, and p53 as well as activation of PI 3-K and mTOR is associated with kidney cancer in the Eker rat, while sustained expression of TSC-2, PTEN, and p53 may prevent progression of kidney cancer in TSC patients. PMID:22737271

Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

PubMed Central

Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

2009-01-01

Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

SOX14 activates the p53 signaling pathway and induces apoptosis in a cervical carcinoma cell line

PubMed Central

Stanisavljevic, Danijela; Petrovic, Isidora; Vukovic, Vladanka; Schwirtlich, Marija; Gredic, Marija; Stevanovic, Milena

2017-01-01

SOX14 is a member of the SOX family of transcription factors mainly involved in the regulation of neural development. Recently, it became evident that SOX14 is one of four hypermethylated genes in cervical carcinoma, considered as a tumor suppressor candidate in this type of malignancy. In this paper we elucidated the role of SOX14 in the regulation of malignant properties of cervical carcinoma cells in vitro. Functional analysis performed in HeLa cells revealed that SOX14 overexpression decreased viability and promoted apoptosis through altering the expression of apoptosis related genes. Our results demonstrated that overexpression of SOX14 initiated accumulation of p53, demonstrating potential cross-talk between SOX14 and the p53 signaling pathway. Further analysis unambiguously showed that SOX14 triggered posttranslational modification of p53 protein, as detected by the significantly increased level of phospho-p53 (Ser-15) in SOX14-overexpressing HeLa cells. Moreover, the obtained results revealed that SOX14 activated p53 protein, which was confirmed by elevated p21Waf1/Cip1, a well known target gene of p53. This study advances our understanding about the role of SOX14 and might explain the molecular mechanism by which this transcription factor could exert tumor suppressor properties in cervical carcinoma. PMID:28926586

Transcriptome profiling identifies p53 as a key player during calreticulin deficiency: Implications in lipid accumulation.

PubMed

Vig, Saurabh; Talwar, Puneet; Kaur, Kirandeep; Srivastava, Rohit; Srivastava, Arvind K; Datta, Malabika

2015-01-01

Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering identified 34 significant clusters, of which p53 occupied the central hub node in the highest node-rich cluster. Toward validation, we show that CRT knockdown leads to inhibition of p53 protein levels. Both, CRT and p53 siRNA promote hepatic lipid accumulation and this was accompanied by elevated SREBP-1c and FAS levels. p53 was identified to bind at -219 bp on the SREBP-1c promoter and in the presence of CRT siRNA, there was decreased occupancy of p53 on this binding element. This was associated with increased SREBP-1c promoter activity and both, mutation in this binding site or p53 over-expression antagonised the effects of CRT knockdown. We, therefore, identify a negatively regulating p53 binding site on the SREBP-1c promoter that is critical during hepatic lipid accumulation. These results were validated in mouse primary hepatocytes and toward a physiological relevance, we report that while the levels of CRT and p53 are reduced in the fatty livers of diabetic db/db mice, SREBP-1c levels are significantly elevated. Our results suggest that decreased CRT levels might be involved in the development of a fatty liver by preventing p53 occupancy on the SREBP-1c promoter and thereby facilitating SREBP-1c up-regulation and consequently, lipid accumulation.

Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

PubMed Central

Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

2014-01-01

Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

Selective activation of p53-mediated tumour suppression in high-grade tumours.

PubMed

Junttila, Melissa R; Karnezis, Anthony N; Garcia, Daniel; Madriles, Francesc; Kortlever, Roderik M; Rostker, Fanya; Brown Swigart, Lamorna; Pham, David M; Seo, Youngho; Evan, Gerard I; Martins, Carla P

2010-11-25

Non-small cell lung carcinoma (NSCLC) is the leading cause of cancer-related death worldwide, with an overall 5-year survival rate of only 10-15%. Deregulation of the Ras pathway is a frequent hallmark of NSCLC, often through mutations that directly activate Kras. p53 is also frequently inactivated in NSCLC and, because oncogenic Ras can be a potent trigger of p53 (ref. 3), it seems likely that oncogenic Ras signalling has a major and persistent role in driving the selection against p53. Hence, pharmacological restoration of p53 is an appealing therapeutic strategy for treating this disease. Here we model the probable therapeutic impact of p53 restoration in a spontaneously evolving mouse model of NSCLC initiated by sporadic oncogenic activation of endogenous Kras. Surprisingly, p53 restoration failed to induce significant regression of established tumours, although it did result in a significant decrease in the relative proportion of high-grade tumours. This is due to selective activation of p53 only in the more aggressive tumour cells within each tumour. Such selective activation of p53 correlates with marked upregulation in Ras signal intensity and induction of the oncogenic signalling sensor p19(ARF)( )(ref. 6). Our data indicate that p53-mediated tumour suppression is triggered only when oncogenic Ras signal flux exceeds a critical threshold. Importantly, the failure of low-level oncogenic Kras to engage p53 reveals inherent limits in the capacity of p53 to restrain early tumour evolution and in the efficacy of therapeutic p53 restoration to eradicate cancers.

Identification of a small molecule that overcomes HdmX-mediated suppression of p53

PubMed Central

Chakrabarti, Amit; Karan, Sukanya; Liu, Zhigang; Xia, Zhiqiang; Gundluru, Mahesh; Moreton, Stephen; Saunthararajah, Yogen; Jackson, Mark W; Agarwal, Mukesh K; Wald, David N

2016-01-01

Inactivation of the p53 tumor suppressor by mutation or overexpression of negative regulators occurs frequently in cancer. Since p53 plays a key role in regulating proliferation or apoptosis in response to DNA damaging chemotherapies, strategies aimed at reactivating p53 are increasingly being sought. Strategies to reactivate wild-type p53 include the use of small molecules capable of releasing wild-type p53 from key, cellular negative regulators, such as Hdm2 and HdmX. Derivatives of the Hdm2 antagonist Nutlin-3 are in clinical trials. However, Nutlin-3 specifically disrupts Hdm2-p53, leaving tumors harboring high levels of HdmX resistant to Nutlin-3 treatment. Here we identify CTX1, a novel small molecule that overcomes HdmX-mediated p53 repression. CTX1 binds directly to HdmX to prevent p53-HdmX complex formation, resulting in the rapidly induction of p53 in a DNA damage-independent manner. Treatment of a panel of cancer cells with CTX1 induced apoptosis or suppressed proliferation and importantly, CTX1 demonstrates promising activity as a single agent in a mouse model of circulating primary human leukemia. CTX1 is a small molecule HdmX inhibitor that demonstrates promise as a cancer therapeutic candidate. PMID:26883273

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

PubMed Central

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

PubMed

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

Regulatory module involving FGF13, miR-504, and p53 regulates ribosomal biogenesis and supports cancer cell survival

PubMed Central

Bublik, Débora R.; Bursać, Slađana; Sheffer, Michal; Oršolić, Ines; Shalit, Tali; Tarcic, Ohad; Kotler, Eran; Mouhadeb, Odelia; Hoffman, Yonit; Fuchs, Gilad; Levin, Yishai; Volarević, Siniša; Oren, Moshe

2017-01-01

The microRNA miR-504 targets TP53 mRNA encoding the p53 tumor suppressor. miR-504 resides within the fibroblast growth factor 13 (FGF13) gene, which is overexpressed in various cancers. We report that the FGF13 locus, comprising FGF13 and miR-504, is transcriptionally repressed by p53, defining an additional negative feedback loop in the p53 network. Furthermore, we show that FGF13 1A is a nucleolar protein that represses ribosomal RNA transcription and attenuates protein synthesis. Importantly, in cancer cells expressing high levels of FGF13, the depletion of FGF13 elicits increased proteostasis stress, associated with the accumulation of reactive oxygen species and apoptosis. Notably, stepwise neoplastic transformation is accompanied by a gradual increase in FGF13 expression and increased dependence on FGF13 for survival (“nononcogene addiction”). Moreover, FGF13 overexpression enables cells to cope more effectively with the stress elicited by oncogenic Ras protein. We propose that, in cells in which activated oncogenes drive excessive protein synthesis, FGF13 may favor survival by maintaining translation rates at a level compatible with the protein quality-control capacity of the cell. Thus, FGF13 may serve as an enabler, allowing cancer cells to evade proteostasis stress triggered by oncogene activation. PMID:27994142

Simultaneous activation of p53 and inhibition of XIAP enhance the activation of apoptosis signaling pathways in AML

PubMed Central

Carter, Bing Z.; Mak, Duncan H.; Schober, Wendy D.; Koller, Erich; Pinilla, Clemencia; Vassilev, Lyubomir T.; Reed, John C.

2010-01-01

Activation of p53 by murine double minute (MDM2) antagonist nutlin-3a or inhibition of X-linked inhibitor of apoptosis (XIAP) induces apoptosis in acute myeloid leukemia (AML) cells. We demonstrate that concomitant inhibition of MDM2 by nutlin-3a and of XIAP by small molecule antagonists synergistically induced apoptosis in p53 wild-type OCI-AML3 and Molm13 cells. Knockdown of p53 by shRNA blunted the synergy, and down-regulation of XIAP by antisense oligonucleotide (ASO) enhanced nutlin-3a–induced apoptosis, suggesting that the synergy was mediated by p53 activation and XIAP inhibition. This is supported by data showing that inhibition of both MDM2 and XIAP by their respective ASOs induced significantly more cell death than either ASO alone. Importantly, p53 activation and XIAP inhibition enhanced apoptosis in blasts from patients with primary AML, even when the cells were protected by stromal cells. Mechanistic studies demonstrated that XIAP inhibition potentiates p53-induced apoptosis by decreasing p53-induced p21 and that p53 activation enhances XIAP inhibition-induced cell death by promoting mitochondrial release of second mitochondria-derived activator of caspases (SMAC) and by inducing the expression of caspase-6. Because both XIAP and p53 are presently being targeted in ongoing clinical trials in leukemia, the combination strategy holds promise for expedited translation into the clinic. PMID:19897582

Dietary selenomethionine increases exon-specific DNA methylation of the p53 gene in rat liver and colon mucosa.

PubMed

Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O

2011-08-01

The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.

Deoxyinosine triphosphate induces MLH1/PMS2- and p53-dependent cell growth arrest and DNA instability in mammalian cells

PubMed Central

Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku

2016-01-01

Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981

Involvement of stromal p53 in tumor-stroma interactions

PubMed Central

Bar, Jair; Moskovits, Neta; Oren, Moshe

2009-01-01

p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385

A novel alkaloid, evodiamine causes nuclear localization of cytochrome-c and induces apoptosis independent of p53 in human lung cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mohan, Vijay; Agarwal, Rajesh; Singh, Rana P., E-mail: ranaps@hotmail.com

Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survivalmore » of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer cell apoptosis involving mitochondrial membrane depolarization. • Increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. • DR5 and caspase-8 extrinsic pathway was also activated in p53-independent manner. • Thus evodiamine could be a potential anticancer agent against lung cancer.« less

Drug Resistance to Inhibitors of the Human Double Minute-2 E3 Ligase is Mediated by Point Mutations of p53, but can be Overcome with the p53 Targeting Agent RITA

PubMed Central

Jones, Richard J.; Bjorklund, Chad C.; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J.; Orlowski, Robert Z.

2012-01-01

The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover, and has been validated pre-clinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, while Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA. HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor non-genotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G2/M arrest, up-regulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared to RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation. PMID:22933706

Residues in the alternative reading frame tumor suppressor that influence its stability and p53-independent activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tommaso, Anne di; Hagen, Jussara; Tompkins, Van

2009-04-15

The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala{sup 14} and Thr{sup 31}) were found to destabilize the protein while two others (Val{sup 24} and Ala{sup 41}) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significantmore » biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val{sup 24} was required for p53-independent growth suppression whereas multiple residues (Val{sup 24}, Thr{sup 31}, Ala{sup 41} and His{sup 60}) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.« less

Mutant p53 dictates the oncogenic activity of c-Abl in triple-negative breast cancers

PubMed Central

Morrison, Chevaun D; Chang, Jenny C; Keri, Ruth A; Schiemann, William P

2017-01-01

We recently established c-Abl as a potent suppressor of triple-negative breast cancer (TNBC) progression through its reactivation of a p53:p21 signaling axis coupled to senescence. Moreover, we observed co-expression of p53 and c-Abl to be essential for normal mammary epithelial cell physiology, as this relationship is lost upon breast cancer progression. Cytoplasmic c-Abl activity is markedly increased in some TNBCs and contributes to disease progression; however, the mechanisms underlying these events remain largely unknown. In addressing this question, we show here that c-Abl is predominantly restricted to the cytoplasm of human MDA-MB-231 TNBC cells, and to the nucleus of human MCF-7 luminal A cells. TTK is a mitotic protein kinase that phosphorylates c-Abl on Thr735, thereby creating a recognition binding motif for 14-3-3 adaptor proteins in response to oxidative stress. By interrogating the METABRIC database, we observed a significant correlation between p53 expression and that of c-Abl and TTK in basal-like breast cancers. Moreover, heterologous expression of TTK in MCF-7 cells significantly stimulated their growth in part via a c-Abl-dependent mechanism. Conversely, depleting TTK expression in MDA-MB-231 cells not only inhibited their organoid growth in 3D-cultures, but also sensitized them to the tumor suppressing activities of c-Abl independent of its subcellular localization. Moreover, we show that mutant p53 forms cytoplasmic complexes with c-Abl, thereby dictating the subcellular localization of c-Abl and the sensitivity of MDA-MB-231 cells to Imatinib. In response to nutrient deprivation, c-Abl:p53 complexes readily accumulate in the nucleus, resulting in the hyperactivation of c-Abl and initiation of its anti-tumor activities. Collectively, we identified a novel mutant p53:c-Abl cytoplasmic signaling complex that promotes MDA-MB-231 cell growth and highlights the contextual cues that confer oncogenic activity to c-Abl in breast cancer. PMID:28661474

Overexpression of SKI Oncoprotein Leads to p53 Degradation through Regulation of MDM2 Protein Sumoylation*

PubMed Central

Ding, Boxiao; Sun, Yin; Huang, Jiaoti

2012-01-01

Protooncogene Ski was identified based on its ability to transform avian fibroblasts in vitro. In support of its oncogenic activity, SKI was found to be overexpressed in a variety of human cancers, although the exact molecular mechanism(s) responsible for its oncogenic activity is not fully understood. We found that SKI can negatively regulate p53 by decreasing its level through up-regulation of MDM2 activity, which is mediated by the ability of SKI to enhance sumoylation of MDM2. This stimulation of MDM2 sumoylation is accomplished through a direct interaction of SKI with SUMO-conjugating enzyme E2, Ubc9, resulting in enhanced thioester bond formation and mono-sumoylation of Ubc9. A mutant SKI defective in transformation fails to increase p53 ubiquitination and is unable to increase MDM2 levels and to increase mono-sumoylation of Ubc9, suggesting that the ability of SKI to enhance Ubc9 activity is essential for its transforming function. These results established a detailed molecular mechanism that underlies the ability of SKI to cause cellular transformation while unraveling a novel connection between sumoylation and tumorigenesis, providing potential new therapeutic targets for cancer. PMID:22411991

Quercetin Enhances the Antitumor Activity of Trichostatin A through Upregulation of p53 Protein Expression In Vitro and In Vivo

PubMed Central

Chan, Shu-Ting; Yang, Nae-Cherng; Huang, Chin-Shiu; Liao, Jiunn-Wang; Yeh, Shu-Lan

2013-01-01

This study investigated the effects of quercetin on the anti-tumor effect of trichostatin A (TSA), a novel anticancer drug, in vitro and in vivo and the possible mechanisms of these effects in human lung cancer cells. We first showed that quercetin (5 µM) significantly increased the growth arrest and apoptosis in A549 cells (expressing wild-type p53) induced by 25 ng/mL of (82.5 nM) TSA at 48 h by about 25% and 101%, respectively. However, such enhancing effects of quercetin (5 µM) were not significant in TSA-exposed H1299 cells (a p53 null mutant) or were much lower than in A549 cells. In addition, quercetin significantly increased TSA-induced p53 expression in A549 cells. Transfection of p53 siRNA into A549 cells significantly but not completely diminished the enhancing effects of quercetin on TSA-induced apoptosis. Furthermore, we demonstrated that quercetin enhanced TSA-induced apoptosis through the mitochondrial pathway. Transfection of p53 siRNA abolished such enhancing effects of quercetin. However, quercetin increased the acetylation of histones H3 and H4 induced by TSA in A549 cells, even with p53 siRNA transfection as well as in H1299 cells. In a xenograft mouse model of lung cancer, quercetin enhanced the antitumor effect of TSA. Tumors from mice treated with TSA in combination with quercetin had higher p53 and apoptosis levels than did those from control and TSA-treated mice. These data indicate that regulation of the expression of p53 by quercetin plays an important role in enhancing TSA-induced apoptosis in A549 cells. However, p53-independent mechanisms may also contribute to the enhancing effect of quercetin. PMID:23342112

N-Methyl, N-propynyl-2-phenylethylamine (MPPE), a Selegiline Analog, Attenuates MPTP-induced Dopaminergic Toxicity with Guaranteed Behavioral Safety: Involvement of Inhibitions of Mitochondrial Oxidative Burdens and p53 Gene-elicited Pro-apoptotic Change.

PubMed

Shin, Eun-Joo; Nam, Yunsung; Lee, Ji Won; Nguyen, Phuong-Khue Thi; Yoo, Ji Eun; Tran, The-Vinh; Jeong, Ji Hoon; Jang, Choon-Gon; Oh, Young J; Youdim, Moussa B H; Lee, Phil Ho; Nabeshima, Toshitaka; Kim, Hyoung-Chun

2016-11-01

Selegiline is a monoamine oxidase-B (MAO-B) inhibitor with anti-Parkinsonian effects, but it is metabolized to amphetamines. Since another MAO-B inhibitor N-Methyl, N-propynyl-2-phenylethylamine (MPPE) is not metabolized to amphetamines, we examined whether MPPE induces behavioral side effects and whether MPPE affects dopaminergic toxicity induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Multiple doses of MPPE (2.5 and 5 mg/kg/day) did not show any significant locomotor activity and conditioned place preference, whereas selegiline (2.5 and 5 mg/kg/day) significantly increased these behavioral side effects. Treatment with MPPE resulted in significant attenuations against decreases in mitochondrial complex I activity, mitochondrial Mn-SOD activity, and expression induced by MPTP in the striatum of mice. Consistently, MPPE significantly attenuated MPTP-induced oxidative stress and MPPE-mediated antioxidant activity appeared to be more pronounced in mitochondrial-fraction than in cytosolic-fraction. Because MPTP promoted mitochondrial p53 translocation and p53/Bcl-xL interaction, it was also examined whether mitochondrial p53 inhibitor pifithrin-μ attenuates MPTP neurotoxicity. MPPE, selegiline, or pifithrin-μ significantly attenuated mitochondrial p53/Bcl-xL interaction, impaired mitochondrial transmembrane potential, cytosolic cytochrome c release, and cleaved caspase-3 in wild-type mice. Subsequently, these compounds significantly ameliorated MPTP-induced motor impairments. Neuroprotective effects of MPPE appeared to be more prominent than those of selegiline. MPPE or selegiline did not show any additional protective effects against the attenuation by p53 gene knockout, suggesting that p53 gene is a critical target for these compounds. Our results suggest that MPPE possesses anti-Parkinsonian potentials with guaranteed behavioral safety and that the underlying mechanism of MPPE requires inhibition of mitochondrial oxidative stress, mitochondrial translocation of p53, and pro-apoptotic process.

Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

PubMed Central

Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

2012-01-01

Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

Antibody to human α-fetoprotein inhibits cell growth of human hepatocellular carcinoma cells by resuscitating the PTEN molecule: in vitro experiments.

PubMed

Ohkawa, Kiyoshi; Asakura, Tadashi; Tsukada, Yutaka; Matsuura, Tomokazu

2017-06-01

It has been proposed that α-fetoprotein (AFP) is a new member of the intracellular signaling molecule family of the phosphoinositide 3-kinase (PI3K)/AKT signaling pathway via interaction with the phosphatase and tensin homolog (PTEN). In this study, the effects of anti-human AFP antibody on the functions of PTEN were examined using an AFP-producing human hepatoma cell line. The antibody caused significant inhibition of cell growth, compared to a normal IgG control, with the accumulation of intracellular immune complexes followed by significant reduction of cytosolic functional AFP. Decrease in the amount of AKT phosphorylated on serine (S) 473 indicated that PI3K/AKT signaling was suppressed in the cells. S380-phosphorylated PTEN increased markedly by the second day after antibody treatment, with slight but significant increase in the PTEN protein level. Since phosphorylation at S380 is critical for PTEN stability, the increase in S380-phosphorylated PTEN indicated maintenance of the number of PTEN molecules and the related potential to control PI3K/AKT signaling. p53 protein (P53) significantly, but slightly increased during antibody treatment, because PTEN expression increased the stability and function of P53 via both molecular interactions. P53 phosphorylated at S20 or at S392 dramatically increased, suggesting an increase in the stability, accumulation and activation of P53. Glucose transporter 1 (GLUT1) increased immediately after antibody treatment, pointing to a deficiency of glucose in the cells. Immunofluorescence cytology revealed that antibody-treatment re-distributed GLUT1 molecules throughout the cytoplasm with a reduction of their patchy localization on the cell surface. This suggested that translocation of GLUT1 depends on the PI3K/AKT pathway, in particular on PTEN expression. Antibody therapy targeted at AFP-producing tumor cells showed an inhibitory effect on the PI3K/AKT pathway via the liberation, restoration and functional stabilization of PTEN. PTEN simultaneously induced both P53 activation and intracellular translocation of GLUT1, since these are closely associated with PTEN.

Genetic inactivation of the transcription factor TIF-IA leads to nucleolar disruption, cell cycle arrest, and p53-mediated apoptosis.

PubMed

Yuan, Xuejun; Zhou, Yonggang; Casanova, Emilio; Chai, Minqiang; Kiss, Eva; Gröne, Hermann-Josef; Schütz, Günter; Grummt, Ingrid

2005-07-01

Growth-dependent regulation of rRNA synthesis is mediated by TIF-IA, a basal transcription initiation factor for RNA polymerase I. We inactivated the murine TIF-IA gene by homologous recombination in mice and embryonic fibroblasts (MEFs). TIF-IA-/- embryos die before or at embryonic day 9.5 (E9.5), displaying retardation of growth and development. In MEFs, Cre-mediated depletion of TIF-IA leads to disruption of nucleoli, cell cycle arrest, upregulation of p53, and induction of apoptosis. Elevated levels of p53 after TIF-IA depletion are due to increased binding of ribosomal proteins, such as L11, to MDM2 and decreased interaction of MDM2 with p53 and p19(ARF). RNAi-induced loss of p53 overcomes proliferation arrest and apoptosis in response to TIF-IA ablation. The striking correlation between perturbation of nucleolar function, elevated levels of p53, and induction of cell suicide supports the view that the nucleolus is a stress sensor that regulates p53 activity.

p53 mutations promote proteasomal activity.

PubMed

Oren, Moshe; Kotler, Eran

2016-07-27

p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

PubMed

Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

2018-03-01

Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

[The effect of UV-irradiation on telomerase activity and other stress-related proteins in human lens epithelial cells].

PubMed

Wu, Zhi-hong; Zhang, Jin-song

2005-05-01

To investigate the changes and the role of telomerase activity and other stress-related proteins in the process of UV-induced DNA damage and repair in human lens epithelial cells. Human lens epithelial cells were irradiated at UV-doses 0.0 (control group) and 0.5, 1.5, 2.5, 3.5, 5.0, 7.5, 10.0 mJ/cm(2) (treated 1-7 group). Telomerase activity was determined by Telomerase Repeat Amplification Protocol-Enzyme Linked Immunosorbent Assay (TRAP-ELISA), p53, growth arrest and DNA damage inducible (GADD45), proliferating cell nuclear antigen (PCNA) and p16 protein levels were analyzed by Western blotting. Telomerase activity in control group and treated 1-7 group showed increased tendency, the differences of telomerase activity in 8 groups were significantly (P < 0.01). The expression of p53, GADD45, PCNA, p16 proteins showed increased tendency in experimental group, comparing with the control group, there were significant difference (P < 0.01). During UV-induced DNA damage and repair in human lens epithelial cells, telomerase activity was upregulated and the expression of stress-related proteins levels was increased. Upregulated telomerase activity may play both a protective and a proliferative role in human lens epithelial cells. Increased stress-related proteins level is critic in UV-induced DNA damage and repair in human lens epithelial. Increased telomerase activity is associated with increased levels of the stress-related proteins.

Proteasome inhibition mediates p53 reactivation and anti-cancer activity of 6-gingerol in cervical cancer cells.

PubMed

Rastogi, Namrata; Duggal, Shivali; Singh, Shailendra Kumar; Porwal, Konica; Srivastava, Vikas Kumar; Maurya, Rakesh; Bhatt, M L B; Mishra, Durga Prasad

2015-12-22

Human papilloma virus (HPV) expressing E6 and E7 oncoproteins, is known to inactivate the tumor suppressor p53 through proteasomal degradation in cervical cancers. Therefore, use of small molecules for inhibition of proteasome function and induction of p53 reactivation is a promising strategy for induction of apoptosis in cervical cancer cells. The polyphenolic alkanone, 6-Gingerol (6G), present in the pungent extracts of ginger (Zingiber officinale Roscoe) has shown potent anti-tumorigenic and pro-apoptotic activities against a variety of cancers. In this study we explored the molecular mechanism of action of 6G in human cervical cancer cells in vitro and in vivo. 6G potently inhibited proliferation of the HPV positive cervical cancer cells. 6G was found to: (i) inhibit the chymotrypsin activity of proteasomes, (ii) induce reactivation of p53, (iii) increase levels of p21, (iv) induce DNA damage and G2/M cell cycle arrest, (v) alter expression levels of p53-associated apoptotic markers like, cleaved caspase-3 and PARP, and (vi) potentiate the cytotoxicity of cisplatin. 6G treatment induced significant reduction of tumor volume, tumor weight, proteasome inhibition and p53 accumulation in HeLa xenograft tumor cells in vivo. The 6G treatment was devoid of toxic effects as it did not affect body weights, hematological and osteogenic parameters. Taken together, our data underscores the therapeutic and chemosensitizing effects of 6G in the management and treatment of cervical cancer.

Proteasome inhibition mediates p53 reactivation and anti-cancer activity of 6-Gingerol in cervical cancer cells

PubMed Central

Rastogi, Namrata; Duggal, Shivali; Singh, Shailendra Kumar; Porwal, Konica; Srivastava, Vikas Kumar; Maurya, Rakesh; Bhatt, Madan L.B.; Mishra, Durga Prasad

2015-01-01

Human papilloma virus (HPV) expressing E6 and E7 oncoproteins, is known to inactivate the tumor suppressor p53 through proteasomal degradation in cervical cancers. Therefore, use of small molecules for inhibition of proteasome function and induction of p53 reactivation is a promising strategy for induction of apoptosis in cervical cancer cells. The polyphenolic alkanone, 6-Gingerol (6G), present in the pungent extracts of ginger (Zingiber officinale Roscoe) has shown potent anti-tumorigenic and pro-apoptotic activities against a variety of cancers. In this study we explored the molecular mechanism of action of 6G in human cervical cancer cells in vitro and in vivo. 6G potently inhibited proliferation of the HPV positive cervical cancer cells. 6G was found to: (i) inhibit the chymotrypsin activity of proteasomes, (ii) induce reactivation of p53, (iii) increase levels of p21, (iv) induce DNA damage and G2/M cell cycle arrest, (v) alter expression levels of p53-associated apoptotic markers like, cleaved caspase-3 and PARP, and (vi) potentiate the cytotoxicity of cisplatin. 6G treatment induced significant reduction of tumor volume, tumor weight, proteasome inhibition and p53 accumulation in HeLa xenograft tumor cells in vivo. The 6G treatment was devoid of toxic effects as it did not affect body weights, hematological and osteogenic parameters. Taken together, our data underscores the therapeutic and chemosensitizing effects of 6G in the management and treatment of cervical cancer. PMID:26621832

FGF1 protects neuroblastoma SH-SY5Y cells from p53-dependent apoptosis through an intracrine pathway regulated by FGF1 phosphorylation

PubMed Central

Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore

2017-01-01

Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426

ATM phosphorylation of Mdm2 Ser394 regulates the amplitude and duration of the DNA damage response in mice

PubMed Central

Gannon, Hugh S.; Woda, Bruce A.; Jones, Stephen N.

2012-01-01

Summary DNA damage induced by ionizing radiation (IR) activates the ATM kinase, which subsequently stabilizes and activates the p53 tumor suppressor protein. Although phosphorylation of p53 by ATM was found previously to modulate p53 levels and transcriptional activities in vivo, it does not appear to be a major regulator of p53 stability. We have utilized mice bearing altered Mdm2 alleles to demonstrate that ATM phosphorylation of Mdm2 serine 394 is required for robust p53 stabilization and activation after DNA damage. In addition, we demonstrate that dephosphorylation of Mdm2 Ser394 regulates attenuation of the p53-mediated response to DNA damage. Therefore, the phosphorylation status of Mdm2 Ser394 governs p53 protein levels and functions in cells undergoing DNA damage. PMID:22624716

Effect of age on the sensitivity of the rat thyroid gland to ionizing radiation

PubMed Central

Matsuu-Matsuyama, Mutsumi; Shichijo, Kazuko; Okaichi, Kumio; Kurashige, Tomomi; Kondo, Hisayoshi; Miura, Shiro; Nakashima, Masahiro

2015-01-01

Exposure to ionizing radiation during childhood is a well-known risk factor for thyroid cancer. Our study evaluated the effect of age on the radiosensitivity of rat thyroid glands. Four-week-old (4W), 7 -week-old (7W), and 8-month-old (8M) male Wistar rats were exposed to 8 Gy of whole-body X-ray irradiation. Thyroids were removed 3–72 h after irradiation, and non-irradiated thyroids served as controls. Ki67-positivity and p53 binding protein 1 (53BP1) focus formation (a DNA damage response) were evaluated via immunohistochemistry. Amounts of proteins involved in DNA damage response (p53, p53 phosphorylated at serine 15, p21), apoptosis (cleaved caspase-3), and autophagy (LC3, p62) were determined via western blotting. mRNA levels of 84 key autophagy-related genes were quantified using polymerase chain reaction arrays. Ki67-positive cells in 4W (with high proliferative activity) and 7W thyroids significantly decreased in number post-irradiation. The number of 53BP1 foci and amount of p53 phosphorylated at serine 15 increased 3 h after irradiation, regardless of age. No increase in apoptosis or in the levels of p53, p21 or cleaved caspase-3 was detected for any ages. Levels of LC3-II and p62 increased in irradiated 4W but not 8M thyroids, whereas expression of several autophagy-related genes was higher in 4W than 8M irradiated thyroids. Irradiation increased the expression of genes encoding pro-apoptotic proteins in both 4W and 8M thyroids. In summary, no apoptosis or p53 accumulation was noted, despite the expression of some pro-apoptotic genes in immature and adult thyroids. Irradiation induced autophagy in immature, but not in adult, rat thyroids. PMID:25691451

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

PubMed Central

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-01-01

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

PubMed

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-12-13

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

Preclinical Colorectal Cancer Chemopreventive Efficacy and p53-Modulating Activity of 3′,4′,5′-Trimethoxyflavonol, a Quercetin Analog

PubMed Central

Howells, Lynne M; Britton, Robert G; Mazzoletti, Marco; Greaves, Peter; Broggini, Massimo; Brown, Karen; Steward, William P; Gescher, Andreas J; Sale, Stewart

2010-01-01

Some naturally occurring flavonols, exemplified by quercetin, appear to possess experimental cancer chemopreventive efficacy. Modulation of p53 is a mechanism thought to contribute to their activity. The hypothesis was tested that a synthetic flavonol, 3′,4′,5′-trimethoxyflavonol (TMFol), can interfere with tumor development and p53 expression in two models of colorectal carcinogenesis, ApcMin mice and human-derived HCT116 adenocarcinoma-bearing nude mice. Mice received TMFol with their diet (0.2%) from weaning to week 16 in the case of ApcMin, or from either day 7 prior to (“TMFol early”) or day 7 after (“TMFol late”) tumor inoculation in HCT116 mice. The ability of TMFol to affect tumor proliferation or apoptosis, as reflected by staining for Ki-67 or cleaved caspase 3, respectively, was studied in HCT116 tumors. TMFol tumor levels were measured by HPLC. Consumption of TMFol reduced small intestinal adenoma burden in ApcMin mice by 47%, compared to control mice (P<0.002). The TMFol early regimen approximately halved HCT116 tumor size (P<0.05), decreased tumor proliferation and increased apoptosis, whilst the TMFol late regimen had no significant effect, when compared to controls. In tumor tissues from mice, in which TMFol reduced tumor development, p53 expression was increased, 3-fold in ApcMin and 1.5-fold in HCT116 tumor-bearing mice (P=0.02). TMFol increased p53 also in cells derived from these tumors. TMFol was detected in HCT116 tumors, but levels did not correlate to tumor burden. TMFol was not mutagenic in the Ames test. The results suggest that chemical modification of the flavonol structure may generate safe and efficacious cancer chemopreventive agents. PMID:20628003

Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2

PubMed Central

Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja

2012-01-01

Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530

RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.

PubMed

Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh

2011-07-01

The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

PubMed

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.

PubMed

Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C

2017-12-01

Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Biological and genetic properties of the p53 null preneoplastic mammary epithelium

NASA Technical Reports Server (NTRS)

Medina, Daniel; Kittrell, Frances S.; Shepard, Anne; Stephens, L. Clifton; Jiang, Cheng; Lu, Junxuan; Allred, D. Craig; McCarthy, Maureen; Ullrich, Robert L.

2002-01-01

The absence of the tumor suppressor gene p53 confers an increased tumorigenic risk for mammary epithelial cells. In this report, we describe the biological and genetic properties of the p53 null preneoplastic mouse mammary epithelium in a p53 wild-type environment. Mammary epithelium from p53 null mice was transplanted serially into the cleared mammary fat pads of p53 wild-type BALB/c female to develop stable outgrowth lines. The outgrowth lines were transplanted for 10 generations. The outgrowths were ductal in morphology and progressed through ductal hyperplasia and ductal carcinoma in situ before invasive cancer. The preneoplastic outgrowth lines were immortal and exhibited activated telomerase activity. They are estrogen and progesterone receptor-positive, and aneuploid, and had various levels of tumorigenic potential. The biological and genetic properties of these lines are distinct from those found in most hyperplastic alveolar outgrowth lines, the form of mammary preneoplasia occurring in most traditional models of murine mammary tumorigenesis. These results indicate that the preneoplastic cell populations found in this genetically engineered model are similar in biological properties to a subset of precurser lesions found in human breast cancer and provide a unique model to identify secondary events critical for tumorigenicity and invasiveness.

Protosappanin B protects PC12 cells against oxygen-glucose deprivation-induced neuronal death by maintaining mitochondrial homeostasis via induction of ubiquitin-dependent p53 protein degradation.

PubMed

Zeng, Ke-Wu; Liao, Li-Xi; Zhao, Ming-Bo; Song, Fang-Jiao; Yu, Qian; Jiang, Yong; Tu, Peng-Fei

2015-03-15

Protosappanin B (PTB) is a bioactive dibenzoxocin derivative isolated from Caesalpinia sappan L. Here, we investigated the neuroprotective effects and the potential mechanisms of PTB on oxygen-glucose deprivation (OGD)-injured PC12 cells. Results showed that PTB significantly increased cell viability, inhibited cell apoptosis and up-regulated the expression of growth-associated protein 43 (a marker of neural outgrowth). Moreover, our study revealed that PTB effectively maintained mitochondrial homeostasis by up-regulation of mitochondrial membrane potential (MMP), inhibition of cytochrome c release from mitochondria and inactivation of mitochondrial caspase-9/3 apoptosis pathway. Further study showed that PTB significantly promoted cytoplasmic component degradation of p53 protein, a key negative regulator for mitochondrial function, resulting in a release of Bcl-2 from p53-Bcl-2 complex and an enhancing translocation of Bcl-2 to mitochondrial outer membrane. Finally, we found the degradation of p53 protein was induced by PTB via activation of a MDM2-dependent ubiquitination process. Taken together, our findings provided a new viewpoint of neuronal protection strategy for anoxia and ischemic injury with natural small molecular dibenzoxocin derivative by activating ubiquitin-dependent p53 protein degradation as well as increasing mitochondrial function. Copyright © 2015 Elsevier B.V. All rights reserved.

Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

PubMed Central

Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

2016-01-01

Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

Concurrent acetylation of FoxO1/3a and p53 due to sirtuins inhibition elicit Bim/PUMA mediated mitochondrial dysfunction and apoptosis in berberine-treated HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shukla, Shatrunajay; Department of Medical Elementology and Toxicology, Jamia Hamdard; Sharma, Ankita

Post-translational modifications i.e. phosphorylation and acetylation are pivotal requirements for proper functioning of eukaryotic proteins. The current study aimed to decode the impact of acetylation/deacetylation of non-histone targets i.e. FoxO1/3a and p53 of sirtuins (NAD{sup +} dependent enzymes with lysine deacetylase activity) in berberine treated human hepatoma cells. Berberine (100 μM) inhibited sirtuins significantly (P < 0.05) at transcriptional level as well as at translational level. Combination of nicotinamide (sirtuin inhibitor) with berberine potentiated sirtuins inhibition and increased the expression of FoxO1/3a and phosphorylation of p53 tumor suppressor protein. As sirtuins deacetylate non-histone targets including FoxO1/3a and p53, berberine increasedmore » the acetylation load of FoxO1/3a and p53 proteins. Acetylated FoxO and p53 proteins transcriptionally activate BH3-only proteins Bim and PUMA (3.89 and 3.87 fold respectively, P<0.001), which are known as direct activator of pro-apoptotic Bcl-2 family protein Bax that culminated into mitochondria mediated activation of apoptotic cascade. Bim/PUMA knock-down showed no changes in sirtuins' expression while cytotoxicity induced by berberine and nicotinamide was curtailed up to 28.3% (P < 0.001) and it restored pro/anti apoptotic protein ratio in HepG2 cells. Sirtuins inhibition was accompanied by decline in NAD{sup +}/NADH ratio, ATP generation, enhanced ROS production and decreased mitochondrial membrane potential. TEM analysis confirmed mitochondrial deterioration and cell damage. SRT-1720 (1–10 μM), a SIRT-1 activator, when pre-treated with berberine (25 μM), reversed sirtuins expression comparable to control and significantly restored the cell viability (P < 0.05). Thus, our findings suggest that berberine mediated sirtuins inhibition resulting into FoxO1/3a and p53 acetylation followed by BH3-only protein Bim/PUMA activation may in part be responsible for mitochondria-mediated apoptosis. - Highlights: • Berberine inhibits sirtuins at transcriptional as well as at translational level. • Sirtuins inhibition leads to acetylation of non-histone proteins, FoxO1/3a and p53. • Acetylated FoxO and p53 transcriptionally upregulate BH3-only proteins Bim and PUMA respectively. • BH3-only proteins trigger mitochondrial dysfunction culminating into apoptosis. • SRT-1720 (SIRT-1 activator) partially restores Bax/Bcl-2 ratio and reduces berberine induced cytotoxicity in HepG2 cells.« less

2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

PubMed

Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

2016-09-06

The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

Radiation-Induced Salivary Gland Dysfunction Results From p53-Dependent Apoptosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avila, Jennifer L.; Grundmann, Oliver; Burd, Randy

2009-02-01

Purpose: Radiotherapy for head-and-neck cancer causes adverse secondary side effects in the salivary glands and results in diminished quality of life for the patient. A previous in vivo study in parotid salivary glands demonstrated that targeted head-and-neck irradiation resulted in marked increases in phosphorylated p53 (serine{sup 18}) and apoptosis, which was suppressed in transgenic mice expressing a constitutively active mutant of Akt1 (myr-Akt1). Methods and Materials: Transgenic and knockout mouse models were exposed to irradiation, and p53-mediated transcription, apoptosis, and salivary gland dysfunction were analyzed. Results: The proapoptotic p53 target genes PUMA and Bax were induced in parotid salivary glandsmore » of mice at early time points after therapeutic radiation. This dose-dependent induction requires expression of p53 because no radiation-induced expression of PUMA and Bax was observed in p53-/- mice. Radiation also induced apoptosis in the parotid gland in a dose-dependent manner, which was p53 dependent. Furthermore, expression of p53 was required for the acute and chronic loss of salivary function after irradiation. In contrast, apoptosis was not induced in p53-/- mice, and their salivary function was preserved after radiation exposure. Conclusions: Apoptosis in the salivary glands after therapeutic head-and-neck irradiation is mediated by p53 and corresponds to salivary gland dysfunction in vivo.« less

Roles of HAUSP-mediated p53 regulation in central nervous system development.

PubMed

Kon, N; Zhong, J; Kobayashi, Y; Li, M; Szabolcs, M; Ludwig, T; Canoll, P D; Gu, W

2011-08-01

The deubiquitinase HAUSP (herpesvirus-associated ubiquitin-specific protease; also called USP7) has a critical role in regulating the p53-Mdm2 (murine double minute 2) pathway. By using the conventional knockout approach, we previously showed that hausp inactivation leads to early embryonic lethality. To fully understand the physiological functions of hausp, we have generated mice lacking hausp specifically in the brain and examined the impacts of this manipulation on brain development. We found that deletion of hausp in neural cells resulted in neonatal lethality. The brains from these mice displayed hypoplasia and deficiencies in development, which were mainly caused by p53-mediated apoptosis. Detailed analysis also showed an increase of both p53 levels and p53-dependent transcriptional activation in hausp knockout brains. Notably, neural cell survival and brain development of hausp-mutant mice can largely be restored in the p53-null background. Nevertheless, in contrast to the case of mdm2- and mdm4 (murine double minute 4)-mutant mice, inactivation of p53 failed to completely rescue the neonatal lethality of these hausp-mutant mice. These results indicate that HAUSP-mediated p53 regulation is crucial for brain development, and also suggest that both the p53-dependent and the p53-independent functions of HAUSP contribute to the neonatal lethality of hausp-mutant mice.

Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

PubMed Central

Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

2000-01-01

p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

Fusaric Acid Induces DNA Damage and Post-Translational Modifications of p53 in Human Hepatocellular Carcinoma (HepG2 ) Cells.

PubMed

Ghazi, Terisha; Nagiah, Savania; Tiloke, Charlette; Sheik Abdul, Naeem; Chuturgoon, Anil A

2017-11-01

Fusaric acid (FA), a common fungal contaminant of maize, is known to mediate toxicity in plants and animals; however, its mechanism of action is unclear. p53 is a tumor suppressor protein that is activated in response to cellular stress. The function of p53 is regulated by post-translational modifications-ubiquitination, phosphorylation, and acetylation. This study investigated a possible mechanism of FA induced toxicity in the human hepatocellular carcinoma (HepG 2 ) cell line. The effect of FA on DNA integrity and post-translational modifications of p53 were investigated. Methods included: (a) culture and treatment of HepG 2 cells with FA (IC 50 : 580.32 μM, 24 h); (b) comet assay (DNA damage); (c) Western blots (protein expression of p53, MDM2, p-Ser-15-p53, a-K382-p53, a-CBP (K1535)/p300 (K1499), HDAC1 and p-Ser-47-Sirt1); and (d) Hoechst 33342 assay (apoptosis analysis). FA caused DNA damage in HepG 2 cells relative to the control (P < 0.0001). FA decreased the protein expression of p53 (0.24-fold, P = 0.0004) and increased the expression of p-Ser-15-p53 (12.74-fold, P = 0.0126) and a-K382-p53 (2.24-fold, P = 0.0096). This occurred despite the significant decrease in the histone acetyltransferase, a-CBP (K1535)/p300 (K1499) (0.42-fold, P = 0.0023) and increase in the histone deacetylase, p-Ser-47-Sirt1 (1.22-fold, P = 0.0020). The expression of MDM2, a negative regulator of p53, was elevated in the FA treatment compared to the control (1.83-fold, P < 0.0001). FA also inhibited cell proliferation and induced apoptosis in HepG 2 cells as evidenced by the Hoechst assay. Together, these results indicate that FA is genotoxic and post-translationally modified p53 leading to HepG 2 cell death. J. Cell. Biochem. 118: 3866-3874, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence

PubMed Central

Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

2015-01-01

Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773

PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.

PubMed

Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

2015-11-17

Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.

Defect States in InP/InGaAs/InP Heterostructures by Current-Voltage Characteristics and Deep Level Transient Spectroscopy.

PubMed

Vu, Thi Kim Oanh; Lee, Kyoung Su; Lee, Sang Jun; Kim, Eun Kyu

2018-09-01

We studied defect states in In0.53Ga0.47As/InP heterojunctions with interface control by group V atoms during metalorganic chemical vapor (MOCVD) deposition. From deep level transient spectroscopy (DLTS) measurements, two defects with activation energies of 0.28 eV (E1) and 0.15 eV (E2) below the conduction band edge, were observed. The defect density of E1 for In0.53Ga0.47As/InP heterojunctions with an addition of As and P atoms was about 1.5 times higher than that of the heterojunction added P atom only. From the temperature dependence of current- voltage characteristics, the thermal activation energies of In0.53Ga0.47As/InP of heterojunctions were estimated to be 0.27 and 0.25 eV, respectively. It appeared that the reverse light current for In0.53Ga0.47As/InP heterojunction added P atom increased only by illumination of a 940 nm-LED light source. These results imply that only the P addition at the interface can enhance the quality of InGaAs/InP heterojunction.

Radiation-induced hyperproliferation of intestinal crypts results in elevated genome instability with inactive p53-related genomic surveillance.

PubMed

Zhou, Xin; Ma, Xiaofei; Wang, Zhenhua; Sun, Chao; Wang, Yupei; He, Yang; Zhang, Hong

2015-12-15

Radiation-induced hyperproliferation of intestinal crypts is well documented, but its potential tumorigenic effects remain elusive. Here we aim to determine the genomic surveillance process during crypt hyperproliferation, and its consequential outcome after ionizing radiation. Crypt regeneration in the intestine was induced by a single dose of 12Gy abdominal irradiation. γ-H2AX, 53BP1 and DNA-PKcs were used as DNA repair surrogates to investigate the inherent ability of intestinal crypt cells to recognize and repair double-strand breaks. Ki67 staining and the 5-bromo-2'-deoxyuridine incorporation assay were used to study patterns of cell proliferation in regenerating crypts. Staining for ATM, p53, Chk1 and Chk2 was performed to study checkpoint activation and release. Apoptosis was evaluated through H&E staining and terminal deoxynucleotidyl transferase (dUTP) nick-end labeling. The ATM-p53 pathway was immediately activated after irradiation. A second wave of DSBs in crypt cells was observed in regenerating crypts, accompanied with significantly increased chromosomal bridges. The p53-related genomic surveillance pathway was not active during the regeneration phase despite DSBs and chromosomal bridges in the cells of regenerating crypts. Non-homologous end joining (NHEJ) DSBs repair was involved in the DSBs repair process, as indicated by p-DNA-PKcs staining. Intestinal crypt cells retained hyperproliferation with inactive p53-related genomic surveillance system. NHEJ was involved in the resultant genomic instability during hyperproliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

SIRT1 deacetylase is overexpressed in human melanoma and its small molecule inhibition imparts anti-proliferative response via p53 activation.

PubMed

Wilking, Melissa J; Singh, Chandra; Nihal, Minakshi; Zhong, Weixiong; Ahmad, Nihal

2014-12-01

Melanoma causes more deaths than any other skin cancer, and its incidence in the US continues to rise. Current medical therapies are insufficient to control this deadly neoplasm, necessitating the development of new target-based approaches. The objective of this study was to determine the role and functional significance of the class III histone deacetylase SIRT1 in melanoma. We have found that SIRT1 is overexpressed in clinical human melanoma tissues and human melanoma cell lines (Sk-Mel-2, WM35, G361, A375, and Hs294T) compared to normal skin and normal melanocytes, respectively. In addition, treatment of melanoma cell lines A375, Hs294T, and G361 with Tenovin-1, a small molecule SIRT1 inhibitor, resulted in a significant decrease in cell growth and cell viability. Further, Tenovin-1 treatment also resulted in a marked decrease in the clonogenic survival of melanoma cells. Further experiments showed that the anti-proliferative response of Tenovin-1 was accompanied by an increase in the protein as well as activity of the tumor suppressor p53. This increase in p53 activity was substantiated by an increase in the protein level of its downstream target p21. Overall, these data suggest that small molecule inhibition of SIRT1 causes anti-proliferative effects in melanoma cells. SIRT1 appears to be acting through the activity of the tumor suppressor p53, which is not mutated in the majority of melanomas. However, future detailed studies are needed to further explore the role and mechanism of SIRT1 in melanoma development and progression and its usefulness in melanoma treatment.

The c-Abl signaling network in the radioadaptive response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chi-Min, Yuan

2014-01-28

The radioadaptive response, or radiation hormesis, i.e. a low dose of radiation can protect cells and organisms from the effects of a subsequent higher dose, is a widely recognized phenomenon. Mechanisms underlying such radiation hormesis, however, remain largely unclear. Preliminary studies indicate an important role of c-Abl signaling in mediating the radioadaptive response. We propose to investigate how c-Abl regulates the crosstalk between p53 and NFκB in response to low doses irradiation. We found in our recent study that low dose IR induces a reciprocal p53 suppression and NFκB activation, which induces HIF-a and subsequently a metabolic reprogramming resulting inmore » a transition from oxidative phosphorylation to glycolysis. Of importance is that this glycolytic switch is essential for the radioadaptive response. This low-dose radiationinduced HIF1α activation was in sharp contrast with the high-dose IR-induced p53 activation and HIF1α inhibition. HIF1α and p53 seem to play distinct roles in mediating the radiation dose-dependent metabolic response. The induction of HIF1α-mediated glycolysis is restricted to a low dose range of radiation, which may have important implications in assessing the level of radiation exposure and its potential health risk. Our results support a dose-dependent metabolic response to IR. When IR doses are below the threshold of causing detectable DNA damage (<0.2Gy) and thus little p53 activation, HIF1α is induced resulting in induction of glycolysis and increased radiation resistance. When the radiation dose reaches levels eliciting DNA damage, p53 is activated and diminishes the activity of HIF1α and glycolysis, leading to the induction of cell death. Our work challenges the LNT model of radiation exposure risk and provides a metabolic mechanism of radioadaptive response. The study supports a need for determining the p53 and HIF1α activity as a potential reliable biological readout of radiation exposure in humans. The exquisite sensitivity of cellular metabolism to low doses of radiation could also serve as a valuable biomarker for estimating the health effects of low-level radiation exposure.« less

Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX

PubMed Central

Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

2011-01-01

Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907

Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX.

PubMed

Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

2011-11-01

Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.

Mutant p53 expression in fallopian tube epithelium drives cell migration.

PubMed

Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E

2015-10-01

Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.

Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons.

PubMed

Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S

2007-11-07

Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.

Downregulation of B-myb promotes senescence via the ROS-mediated p53/p21 pathway, in vascular endothelial cells.

PubMed

Zhou, Zhihui; Yin, Yanlin; Chang, Qun; Sun, Guanqun; Lin, Jiahui; Dai, Yalei

2017-04-01

To reveal whether B-myb is involved in preventing senescence of vascular endothelial cells, and if so, to identify possible mechanisms for it. C57/BL6 male mice and primary human aortic endothelial cells (HAECs) were used. Bleomycin was applied to induce stress-related premature senescence. B-myb knockdown was achieved using an siRNA technique and cell senescence was assessed using the senescence-associated β-galactosidase (SA-β-gal) assay. Intracellular reactive oxygen species (ROS) production was analysed using an ROS assay kit and cell proliferation was evaluated using KFluor488 EdU kit. Capillary tube network formation was determined by Matrigel assay. Expressions of mRNA and protein levels were detected by real-time PCR and western blotting. B-myb expression significantly decreased, while p53 and p21 expressions increased in the aortas of aged mice. This expression pattern was also found in replicative senescent HAECs and senescent HAECs induced by bleomycin. B-myb knockdown resulted in upregulation of p22 phox , ROS accumulation and cell senescence of HAECs. Downregulation of B-myb significantly inhibited cell proliferation and capillary tube network formation and activated the p53/p21 signalling pathway. Blocking ROS production or inhibiting p53 activation remarkably attenuated SA-β-gal activity and delayed cell senescence induced by B-myb-silencing. Downregulation of B-myb induced senescence by upregulation of p22 phox and activation of the ROS/p53/p21 pathway, in our vascular endothelial cells, suggesting that B-myb may be a novel candidate for regulating cell senescence to protect against endothelial senescence-related cardiovascular diseases. © 2016 John Wiley & Sons Ltd.

Forced Expression of Heat Shock Protein 27 (Hsp27) Reverses P-Glycoprotein (ABCB1)-mediated Drug Efflux and MDR1 Gene Expression in Adriamycin-resistant Human Breast Cancer Cells*

PubMed Central

Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy

2011-01-01

Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846

Forced expression of heat shock protein 27 (Hsp27) reverses P-glycoprotein (ABCB1)-mediated drug efflux and MDR1 gene expression in Adriamycin-resistant human breast cancer cells.

PubMed

Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy

2011-09-23

Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.

Transcriptional inhibition of p21{sup WAF1/CIP1} gene (CDKN1) expression by survivin is at least partially p53-dependent: Evidence for survivin acting as a transcription factor or co-factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang

2012-05-04

Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1} expression at least in part by neutralizing p53-mediated transcriptional activation of the p21 gene.« less

Cellulase and cell differentiation in Acer pseudoplatanus.

PubMed

Sheldrake, A R

1970-06-01

Homogenates of differentiating xylem and phloem tissue have higher cellulase activities than cambial samples; the highest activity is always found in phloem. Callus tissue, in which no vascular differentiation occurs, contains only low cellulase activity. The results suggest that cellulase is involved in vascular differentiation. Different pH optima of cellulase activity were found: in cambium, xylem and phloem tissue, cellulase activity with an optimum at about pH 5.9 is predominantly membrane-bound; it is sedimentable at 100,000 g and releasable by Triton X-100. The same may be true of activity with an optimum at pH 5.3. Phloem tissue also contains a soluble, cytoplasmic cellulase of high activity at pH 7.1, and xylem tissue contains cytoplasmic cellulase with an optimum at pH 6.5. Low cellulase activity with a pH optimum similar to that of xylem homogenates was found in xylem sap. Cellulase activity in abscission zones increases greatly just before leaf abscission. Abscission zone cellulase has two pH optima, et 5.3 and 5.9; both activities are increased by Triton treatment of homogenates. The possible existence of several different cellulases forming part of a cellulase complex, and the rôle of the enzymes in hydrolysing wall material during cell differentiation are discussed.

Adenovirally mediated p53 overexpression diversely influence the cell cycle of HEp-2 and CAL 27 cell lines upon cisplatin and methotrexate treatment.

PubMed

Kraljević Pavelić, Sandra; Marjanović, Marko; Poznić, Miroslav; Kralj, Marijeta

2009-12-01

p53 gene plays a crucial role in the response to therapy. Since it is inactivated in the majority of human cancers, it is strongly believed that the p53 mutations confer resistance to therapeutics. In this paper we analyzed the influence of two mechanistically diverse antitumor agents--cisplatin and methotrexate on the proliferation and cell cycle of two head and neck squamous cancer cell lines HEp-2 (wild type p53 gene, but HPV 18/E6-inactivated protein) and CAL 27 (mutated p53 gene), along with the influence of adenovirally mediated p53 overexpression in modulation of cisplatin and methoterexate effects, whereby subtoxic vector/compound concentrations were employed. p53 gene was introduced into tumor cells using adenoviral vector (AdCMV-p53). The cell cycle perturbations were measured by two parameter flow cytometry. The expression of p53, p21(WAF1/CIP1) and cyclin B1 proteins was examined using immunocytochemistry and western blot methods. In CAL 27 cells overexpression of p53 completely abrogated high S phase content observed in methotrexate-treated cells into a G1 and slight G2 arrest, while it sustained G2 arrest of the cells treated with cisplatin, along with the reduction of DNA synthesis and cyclin B1 expression. On the other hand, in HEp-2 cell line p53 overexpression slightly slowed down the progression through S phase in cells treated with methotrexate, decreased the cyclin B1 expression only after 24 h, and failed to sustain the G2 arrest after treatment with cisplatin alone. Instead, it increased the population of S phase cells that were not actively synthesizing DNA, sustained cyclin B1 expression and allowed the G2 cells to progress through mitosis. This study demonstrates that adenovirally mediated p53 overexpression at sub-cytotoxic levels enhanced the activity of low doses of cisplatin and methotrexate in HEp-2 and CAL 27 cells through changes in the cell cycle. However, the mechanisms of these effects differ depending on the genetic context and on the chemotherapeutics' modality of action.

Preeclampsia Is Associated with Alterations in the p53-Pathway in Villous Trophoblast

PubMed Central

Sharp, Andrew N.; Heazell, Alexander E. P.; Baczyk, Dora; Dunk, Caroline E.; Lacey, Helen A.; Jones, Carolyn J. P.; Perkins, Jonathan E.; Kingdom, John C. P.; Baker, Philip N.; Crocker, Ian P.

2014-01-01

Background Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Methods Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT- α). Equally, Mdm2 was knocked-down with siRNA. Results Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. Conclusions These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation. PMID:24498154

Preeclampsia is associated with alterations in the p53-pathway in villous trophoblast.

PubMed

Sharp, Andrew N; Heazell, Alexander E P; Baczyk, Dora; Dunk, Caroline E; Lacey, Helen A; Jones, Carolyn J P; Perkins, Jonathan E; Kingdom, John C P; Baker, Philip N; Crocker, Ian P

2014-01-01

Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT-α). Equally, Mdm2 was knocked-down with siRNA. Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation.

Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

PubMed

Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

2015-01-01

A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

Battle against cancer: an everlasting saga of p53.

PubMed

Hao, Qian; Cho, William C

2014-12-01

Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Transactivation of bad by vorinostat-induced acetylated p53 enhances doxorubicin-induced cytotoxicity in cervical cancer cells.

PubMed

Lee, Sook-Jeong; Hwang, Sung-Ook; Noh, Eun Joo; Kim, Dong-Uk; Nam, Miyoung; Kim, Jong Hyeok; Nam, Joo Hyun; Hoe, Kwang-Lae

2014-02-14

Vorinostat (VOR) has been reported to enhance the cytotoxic effects of doxorubicin (DOX) with fewer side effects because of the lower DOX dosage in breast cancer cells. In this study, we investigated the novel mechanism underlying the synergistic cytotoxic effects of VOR and DOX co-treatment in cervical cancer cells HeLa, CaSki and SiHa cells. Co-treatment with VOR and DOX at marginal doses led to the induction of apoptosis through caspase-3 activation, poly (ADP-ribose) polymerase cleavage and DNA micronuclei. Notably, the synergistic growth inhibition induced by the co-treatment was attributed to the upregulation of the pro-apoptotic protein Bad, as the silencing of Bad expression using small interfering RNA (siRNA) abolished the phenomenon. As siRNA against p53 did not result in an increase in acetylated p53 and the consequent upregulation of Bad, the observed Bad upregulation was mediated by acetylated p53. Moreover, a chromatin immunoprecipitation analysis showed that the co-treatment of HeLa cells with VOR and DOX increased the recruitment of acetylated p53 to the bad promoter, with consequent bad transactivation. Conversely, C33A cervical cancer cells containing mutant p53 co-treated with VOR and DOX did not exhibit Bad upregulation, acetylated p53 induction or consequent synergistic growth inhibition. Together, the synergistic growth inhibition of cervical cancer cell lines induced by co-treatment with VOR and DOX can be attributed to the upregulation of Bad, which is induced by acetylated p53. These results show for the first time that the acetylation of p53, rather than histones, is a mechanism for the synergistic growth inhibition induced by VOR and DOX co-treatments.

H2O2 accelerates cellular senescence by accumulation of acetylated p53 via decrease in the function of SIRT1 by NAD+ depletion.

PubMed

Furukawa, Ayako; Tada-Oikawa, Saeko; Kawanishi, Shosuke; Oikawa, Shinji

2007-01-01

It has been reported that p53 acetylation, which promotes cellular senescence, can be regulated by the NAD(+)-dependent deacetylase SIRT1, the human homolog of yeast Sir2, a protein that modulates lifespan. To clarify the role of SIRT1 in cellular senescence induced by oxidative stress, we treated normal human diploid fibroblast TIG-3 cells with H(2)O(2) and examined DNA cleavage, depletion of intracellular NAD(+), expression of p21, SIRT1, and acetylated p53, cell cycle arrest, and senescence-associated beta-galactosidase (SA-beta-gal) activity. DNA cleavage was observed immediately in TIG-3 cells treated with H(2)O(2), though no cell death was observed. NAD(+) levels in TIG-3 cells treated with H(2)O(2) were also decreased significantly. Pre-incubation with the poly (ADP-ribose) polymerase (PARP) inhibitor resulted in preservation of intracellular NAD(+) levels. The amount of acetylated p53 was increased in TIG-3 cells at 4h after H(2)O(2) treatment, while there was little to no decrease in SIRT1 protein expression. The expression level of p21 was increased at 12h and continued to increase for up to 24h. Additionally, exposure of TIG-3 cells to H(2)O(2) induced cell cycle arrest at 24h and increased SA-beta-gal activity at 48h. This pathway likely plays an important role in the acceleration of cellular senescence by oxidative stress.

Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

Mechanisms of chromium (VI)-induced apoptosis in anterior pituitary cells.

PubMed

Quinteros, Fernanda A; Machiavelli, Leticia I; Miler, Eliana A; Cabilla, Jimena P; Duvilanski, Beatriz H

2008-07-30

Hexavalent chromium (Cr (VI)) is a highly toxic metal. Exposure to Cr (VI) compounds may affect reproductive functions. Due to the importance of anterior pituitary hormones on reproductive physiology we have studied the effects of Cr (VI) on anterior pituitary. We previously demonstrated that, after in vivo Cr (VI) administration, Cr accumulates in the pituitary gland and affects prolactin secretion. In vitro, Cr (VI) causes apoptosis in anterior pituitary cells due to oxidative stress generation. To better understand the mechanisms involved in Cr (VI)-induced apoptosis we studied: (a) whether Cr (VI) affects the intracellular antioxidant response and (b) which of the apoptotic factors participates in Cr (VI) effect. Our results show that Cr (VI) treatment induces a decrease in catalase and glutathione peroxidase (GPx) activity but does not modify glutathione reductase (GR) activity. Cr (VI) exposure causes an increase of GSH levels. p53 and Bax mRNA are also upregulated by the metal. Pifithrin alpha, a p53 transcriptional inhibitor, increases Cr (VI) cytotoxicity, suggesting a role of p53 as a survival molecule. The antioxidant N-acetyl-cysteine (NAC) could prevent Bax mRNA increase and caspase 3 activation, confirming that Cr (VI)-induced apoptosis involves oxidative stress generation.

Activation of Postnatal Neural Stem Cells Requires Nuclear Receptor TLX

PubMed Central

Niu, Wenze; Zou, Yuhua; Shen, ChengCheng; Zhang, Chun-Li

2011-01-01

Neural stem cells (NSCs) continually produce new neurons in postnatal brains. However, the majority of these cells stay in a non-dividing, inactive state. The molecular mechanism that is required for these cells to enter proliferation still remains largely unknown. Here, we show that nuclear receptor TLX (NR2E1) controls the activation status of postnatal NSCs in mice. Lineage tracing indicates that TLX-expressing cells give rise to both activated and inactive postnatal NSCs. Surprisingly, loss of TLX function does not result in spontaneous glial differentiation, but rather leads to a precipitous age-dependent increase of inactive cells with marker expression and radial morphology for NSCs. These inactive cells are mis-positioned throughout the granular cell layer of the dentate gyrus during development and can proliferate again after reintroducing ectopic TLX. RNA-seq analysis of sorted NSCs revealed a TLX-dependent global expression signature, which includes the p53 signaling pathway. TLX regulates p21 expression in a p53-dependent manner and acute removal of p53 can rescue the proliferation defect of TLX-null NSCs in culture. Together, these findings suggest that TLX acts as an essential regulator that ensures the proliferative ability of postnatal NSCs by controlling their activation through genetic interaction with p53 and other signaling pathways. PMID:21957244

Activation of postnatal neural stem cells requires nuclear receptor TLX.

PubMed

Niu, Wenze; Zou, Yuhua; Shen, Chengcheng; Zhang, Chun-Li

2011-09-28

Neural stem cells (NSCs) continually produce new neurons in postnatal brains. However, the majority of these cells stay in a nondividing, inactive state. The molecular mechanism that is required for these cells to enter proliferation still remains largely unknown. Here, we show that nuclear receptor TLX (NR2E1) controls the activation status of postnatal NSCs in mice. Lineage tracing indicates that TLX-expressing cells give rise to both activated and inactive postnatal NSCs. Surprisingly, loss of TLX function does not result in spontaneous glial differentiation, but rather leads to a precipitous age-dependent increase of inactive cells with marker expression and radial morphology for NSCs. These inactive cells are mispositioned throughout the granular cell layer of the dentate gyrus during development and can proliferate again after reintroduction of ectopic TLX. RNA-seq analysis of sorted NSCs revealed a TLX-dependent global expression signature, which includes the p53 signaling pathway. TLX regulates p21 expression in a p53-dependent manner, and acute removal of p53 can rescue the proliferation defect of TLX-null NSCs in culture. Together, these findings suggest that TLX acts as an essential regulator that ensures the proliferative ability of postnatal NSCs by controlling their activation through genetic interaction with p53 and other signaling pathways.

Ensemble-Based Computational Approach Discriminates Functional Activity of p53 Cancer and Rescue Mutants

PubMed Central

Demir, Özlem; Baronio, Roberta; Salehi, Faezeh; Wassman, Christopher D.; Hall, Linda; Hatfield, G. Wesley; Chamberlin, Richard; Kaiser, Peter; Lathrop, Richard H.; Amaro, Rommie E.

2011-01-01

The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain (“cancer mutants”). Activity can be restored by second-site suppressor mutations (“rescue mutants”). This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD), without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC) metric was strongly correlated (r2 = 0.77) with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i) p53 cancer mutants were more flexible than wild-type protein, (ii) second-site rescue mutations decreased the flexibility of cancer mutants, and (iii) negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants. PMID:22028641

The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling

Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhancedmore » TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.« less

Regulation of autophagy by cytoplasmic p53.

PubMed

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

SCO2 induces p53-mediated apoptosis by Thr845 phosphorylation of ASK-1 and dissociation of the ASK-1-Trx complex.

PubMed

Madan, Esha; Gogna, Rajan; Kuppusamy, Periannan; Bhatt, Madan; Mahdi, Abbas Ali; Pati, Uttam

2013-04-01

p53 prevents cancer via cell cycle arrest, apoptosis, and the maintenance of genome stability. p53 also regulates energy-generating metabolic pathways such as oxidative phosphorylation (OXPHOS) and glycolysis via transcriptional regulation of SCO2 and TIGAR. SCO2, a cytochrome c oxidase assembly factor, is a metallochaperone which is involved in the biogenesis of cytochrome c oxidase subunit II. Here we have shown that SCO2 functions as an apoptotic protein in tumor xenografts, thus providing an alternative pathway for p53-mediated apoptosis. SCO2 increases the generation of reactive oxygen species (ROS) and induces dissociation of the protein complex between apoptosis signal-regulating kinase 1 (ASK-1) (mitogen-activated protein kinase kinase kinase [MAPKKK]) and its cellular inhibitor, the redox-active protein thioredoxin (Trx). Furthermore, SCO2 induces phosphorylation of ASK-1 at the Thr(845) residue, resulting in the activation of the ASK-1 kinase pathway. The phosphorylation of ASK-1 induces the activation of mitogen-activated protein kinase kinases 4 and 7 (MAP2K4/7) and MAP2K3/6, which switches the c-Jun N-terminal protein kinase (JNK)/p38-dependent apoptotic cascades in cancer cells. Exogenous addition of the SCO2 gene to hypoxic cancer cells and hypoxic tumors induces apoptosis and causes significant regression of tumor xenografts. We have thus discovered a novel apoptotic function of SCO2, which activates the ASK-1 kinase pathway in switching "on" an alternate mode of p53-mediated apoptosis. We propose that SCO2 might possess a novel tumor suppressor function via the ROS-ASK-1 kinase pathway and thus could be an important candidate for anticancer gene therapy.

Increased gene expression noise in human cancers is correlated with low p53 and immune activities as well as late stage cancer.

PubMed

Han, Rongfei; Huang, Guanqun; Wang, Yejun; Xu, Yafei; Hu, Yueming; Jiang, Wenqi; Wang, Tianfu; Xiao, Tian; Zheng, Duo

2016-11-01

Gene expression in metazoans is delicately organized. As genetic information transmits from DNA to RNA and protein, expression noise is inevitably generated. Recent studies begin to unveil the mechanisms of gene expression noise control, but the changes of gene expression precision in pathologic conditions like cancers are unknown. Here we analyzed the transcriptomic data of human breast, liver, lung and colon cancers, and found that the expression noise of more than 74.9% genes was increased in cancer tissues as compared to adjacent normal tissues. This suggested that gene expression precision controlling collapsed during cancer development. A set of 269 genes with noise increased more than 2-fold were identified across different cancer types. These genes were involved in cell adhesion, catalytic and metabolic functions, implying the vulnerability of deregulation of these processes in cancers. We also observed a tendency of increased expression noise in patients with low p53 and immune activity in breast, liver and lung caners but not in colon cancers, which indicated the contributions of p53 signaling and host immune surveillance to gene expression noise in cancers. Moreover, more than 53.7% genes had increased noise in patients with late stage than early stage cancers, suggesting that gene expression precision was associated with cancer outcome. Together, these results provided genomic scale explorations of gene expression noise control in human cancers.

Manganese superoxide dismutase: beyond life and death

PubMed Central

Holley, Aaron K.; Dhar, Sanjit Kumar; Xu, Yong

2010-01-01

Manganese superoxide dismutase (MnSOD) is a nuclear-encoded antioxidant enzyme that localizes to the mitochondria. Expression of MnSOD is essential for the survival of aerobic life. Transgenic mice expressing a luciferase reporter gene under the control of the human MnSOD promoter demonstrate that the level of MnSOD is reduced prior to the formation of cancer. Overexpression of MnSOD in transgenic mice reduces the incidences and multiplicity of papillomas in a DMBA/TPA skin carcinogenesis model. However, MnSOD deficiency does not lead to enhanced tumorigenicity of skin tissue similarly treated because MnSOD can modulate both the p53-mediated apoptosis and AP-1-mediated cell proliferation pathways. Apoptosis is associated with an increase in mitochondrial levels of p53 suggesting a link between MnSOD deficiency and mitochondrial-mediated apoptosis. Activation of p53 is preventable by application of a SOD mimetic (MnTE-2-PyP5+). Thus, p53 translocation to mitochondria and subsequent inactivation of MnSOD explain the observed mitochondrial dysfunction that leads to transcription-dependent mechanisms of p53-induced apoptosis. Administration of MnTE-2-PyP5+ following apoptosis but prior to proliferation leads to suppression of protein carbonyls and reduces the activity of AP-1 and the level of the proliferating cellular nuclear antigen, without reducing the activity of p53 or DNA fragmentation following TPA treatment. Remarkably, the incidence and multiplicity of skin tumors are drastically reduced in mice that receive MnTE-2-PyP5+ prior to cell proliferation. The results demonstrate the role of MnSOD beyond its essential role for survival and suggest a novel strategy for an antioxidant approach to cancer intervention. PMID:20454814

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

PubMed

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Combined radiation and p53 gene therapy of malignant glioma cells.

PubMed

Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

1999-01-01

More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.

Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finlay, C.A.; Hinds, P.W.; Tan, T.H.

1988-02-01

The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

The NEDD8 inhibitor MLN4924 increases the size of the nucleolus and activates p53 through the ribosomal-Mdm2 pathway.

PubMed

Bailly, A; Perrin, A; Bou Malhab, L J; Pion, E; Larance, M; Nagala, M; Smith, P; O'Donohue, M-F; Gleizes, P-E; Zomerdijk, J; Lamond, A I; Xirodimas, D P

2016-01-28

The ubiquitin-like molecule NEDD8 is essential for viability, growth and development, and is a potential target for therapeutic intervention. We found that the small molecule inhibitor of NEDDylation, MLN4924, alters the morphology and increases the surface size of the nucleolus in human and germline cells of Caenorhabditis elegans in the absence of nucleolar fragmentation. SILAC proteomics and monitoring of rRNA production, processing and ribosome profiling shows that MLN4924 changes the composition of the nucleolar proteome but does not inhibit RNA Pol I transcription. Further analysis demonstrates that MLN4924 activates the p53 tumour suppressor through the RPL11/RPL5-Mdm2 pathway, with characteristics of nucleolar stress. The study identifies the nucleolus as a target of inhibitors of NEDDylation and provides a mechanism for p53 activation upon NEDD8 inhibition. It also indicates that targeting the nucleolar proteome without affecting nucleolar transcription initiates the required signalling events for the control of cell cycle regulators.

Reverse chemomodulatory effects of the SIRT1 activators resveratrol and SRT1720 in Ewing's sarcoma cells: resveratrol suppresses and SRT1720 enhances etoposide- and vincristine-induced anticancer activity.

PubMed

Sonnemann, Jürgen; Kahl, Melanie; Siranjeevi, Priyanka M; Blumrich, Annelie; Blümel, Lisa; Becker, Sabine; Wittig, Susan; Winkler, René; Krämer, Oliver H; Beck, James F

2016-01-01

SIRT1-activating compounds (STACs) may have potential in the management of cancer. However, the best-studied STAC, the naturally occurring compound resveratrol, is reported to have contradictory effects in combination chemotherapy regimens: It has been shown both to increase and to decrease the action of anticancer agents. To shed more light on this issue, we comparatively investigated the impact of resveratrol and the synthetic STAC SRT1720 on the responsiveness of Ewing's sarcoma (ES) cells to the chemotherapeutic drugs etoposide and vincristine. Because the effects of STACs can depend on the functionality of the tumor suppressor protein p53, we used three ES cell lines differing in their p53 status, i.e., wild-type p53 WE-68 cells, mutant p53 SK-ES-1 cells and p53 null SK-N-MC cells. Single agent and combination therapy effects were assessed by flow cytometric analyses of propidium iodide uptake and mitochondrial depolarization, by measuring caspase 3/7 activity and by gene expression profiling. When applied as single agents, both STACs were effective in ES cells irrespective of their p53 status. Strikingly, however, when applied in conjunction with cytostatic agents, the STACs displayed reverse effects: SRT1720 largely enhanced etoposide- and vincristine-induced cell death, while resveratrol inhibited it. Combination index analyses validated the antipodal impact of the STACs on the effectiveness of the chemotherapeutics. These findings suggest that the synthetic STAC SRT1720 may be useful to enhance the efficacy of anticancer therapy in ES. But they also suggest that the dietary intake of the natural STAC resveratrol may be detrimental during chemotherapy of ES.

Toxicology and Carcinogenesis Study of Senna in the C3B6.129F1-Trp53tm1Brd N12 haploinsufficient mice

PubMed Central

Surh, Inok; Brix, Amy; French, John E.; Collins, Bradley J.; Sanders, J. Michael; Vallant, Molly; Dunnick, June K.

2013-01-01

Senna is a pod or leaf of Senna alexandrina P. Mill and is used as a stimulant laxative. In the large intestine, bacterial enzymes break sennosides and release rhein-9-anthrone, the active form for the laxative effect. To determine potential toxic effects of senna, a 5-week dose range finding study in the C57BL/6N mouse and a 40-week toxicology and carcinogenesis study in the C3B6.129F1-Trp53tm1Brd N12 haploinsufficient (p53+/−) mouse were conducted. In the 5-week study, C57BL/6N mice were exposed up to 10,000 ppm senna in feed. Increased incidences of epithelial hyperplasia of the cecum and colon were observed in males and females exposed to 5,000 or 10,000 ppm senna. These intestinal lesions were not considered to be of sufficient severity to cause mortality and, thus, in the p53+/− mouse 40-week study, the high dose of 10,000 ppm was selected. Significant increases in the incidences of epithelial hyperplasia of the colon and cecum were observed at 10,000 ppm in p53(+/−) males and females, and the incidence of hyperplasia of the colon was significantly increased at 3,000 ppm in females. In conclusion, the large intestine was the major target of senna-induced toxicity in both wild-type and the p53+/− mouse model. There was no neoplastic change, when senna was administered to p53 +/− mouse. PMID:23125117

Toxicology and carcinogenesis study of senna in C3B6.129F1-Trp53 tm1Brd N12 haploinsufficient mice.

PubMed

Surh, Inok; Brix, Amy; French, John E; Collins, Bradley J; Sanders, J Michael; Vallant, Molly; Dunnick, June K

2013-07-01

Senna is a pod or leaf of Senna alexandrina P. Mill and is used as a stimulant laxative. In the large intestine, bacterial enzymes reduce sennosides to rhein-9-anthrone, the active form for the laxative effect. To determine the potential toxic effects of senna, a 5-week dose range finding study in the C57BL/6N mouse and a 40-week toxicology and carcinogenesis study in the C3B6.129F1-Trp53 (tm1Brd) N12 haploinsufficient (p53(+/-)) mouse were conducted. In the 5-week study, C57BL/6N mice were exposed to up to 10,000 ppm senna in feed. Increased incidences of epithelial hyperplasia of the cecum and colon were observed in males and females exposed to 5,000 or 10,000 ppm senna. These intestinal lesions were not considered to be of sufficient severity to cause mortality and, thus, in the p53(+/-) mouse 40-week study, the high dose of 10,000 ppm was selected. Significant increases in the incidences of epithelial hyperplasia of the colon and cecum were observed at 10,000 ppm in p53(+/-) males and females, and the incidence of hyperplasia of the colon was significantly increased at 3,000 ppm in females. In conclusion, the large intestine was the major target of senna-induced toxicity in both wild-type and the p53(+/-) mouse model. There was no neoplastic change when senna was administered to p53(+/-) mouse.

Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells

PubMed Central

Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf

2010-01-01

Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316

Induction of parkinsonism-related proteins in the spinal motor neurons of transgenic mouse carrying a mutant SOD1 gene.

PubMed

Morimoto, Nobutoshi; Nagai, Makiko; Miyazaki, Kazunori; Ohta, Yasuyuki; Kurata, Tomoko; Takehisa, Yasushi; Ikeda, Yoshio; Matsuura, Tohru; Asanuma, Masato; Abe, Koji

2010-06-01

Amyotrophic lateral sclerosis is a progressive and fatal disease caused by selective death of motor neurons, and a number of these patients carry mutations in the superoxide dismutase 1 (SOD1) gene involved in ameliorating oxidative stress. Recent studies indicate that oxidative stress and disruption of mitochondrial homeostasis is a common mechanism for motor neuron degeneration in amyotrophic lateral sclerosis and the loss of midbrain dopamine neurons in Parkinson's disease. Therefore, the present study investigated the presence and alterations of familial Parkinson's disease-related proteins, PINK1 and DJ-1, in spinal motor neurons of G93ASOD1 transgenic mouse model of amyotrophic lateral sclerosis. Following onset of disease, PINK1 and DJ-1 protein expression increased in the spinal motor neurons. The activated form of p53 also increased and translocated to the nuclei of spinal motor neurons, followed by increased expression of p53-activated gene 608 (PAG608). This is the first report demonstrating that increased expression of PAG608 correlates with activation of phosphorylated p53 in spinal motor neurons of an amyotrophic lateral sclerosis model. These results provide further evidence of the profound correlations between spinal motor neurons of amyotrophic lateral sclerosis and parkinsonism-related proteins.

EMT and induction of miR-21 mediate metastasis development in Trp53-deficient tumours

PubMed Central

Bornachea, Olga; Santos, Mirentxu; Martínez-Cruz, Ana Belén; García-Escudero, Ramón; Dueñas, Marta; Costa, Clotilde; Segrelles, Carmen; Lorz, Corina; Buitrago, Agueda; Saiz-Ladera, Cristina; Agirre, Xabier; Grande, Teresa; Paradela, Beatriz; Maraver, Antonio; Ariza, José M.; Prosper, Felipe; Serrano, Manuel; Sánchez-Céspedes, Montse; Paramio, Jesús M.

2012-01-01

Missense mutations in TP53 gene promote metastasis in human tumours. However, little is known about the complete loss of function of p53 in tumour metastasis. Here we show that squamous cell carcinomas generated by the specific ablation of Trp53 gene in mouse epidermis are highly metastatic. Biochemical and genome-wide mRNA and miRNA analyses demonstrated that metastases are associated with the early induction of epithelial-mesenchymal transition (EMT) and deregulated miRNA expression in primary tumours. Increased expression of miR-21 was observed in undifferentiated, prometastatic mouse tumours and in human tumours characterized by p53 mutations and distant metastasis. The augmented expression of miR-21, mediated by active mTOR and Stat3 signalling, conferred increased invasive properties to mouse keratinocytes in vitro and in vivo, whereas blockade of miR-21 in a metastatic spindle cell line inhibits metastasis development. Collectively these data identify novel molecular mechanisms leading to metastasis in vivo originated by p53 loss in epithelia. PMID:22666537

Preclinical efficacy of the MDM2 inhibitor RG7112 in MDM2 amplified and TP53 wild-type glioblastomas

PubMed Central

Verreault, Maite; Schmitt, Charlotte; Goldwirt, Lauriane; Pelton, Kristine; Haidar, Samer; Levasseur, Camille; Guehennec, Jeremy; Knoff, David; Labussiere, Marianne; Marie, Yannick; Ligon, Azra H.; Mokhtari, Karima; Hoang-Xuan, Khe; Sanson, Marc; Alexander, Brian M; Wen, Patrick Y.; Delattre, Jean-Yves; Ligon, Keith L.; Idbaih, Ahmed

2016-01-01

Rationale p53 pathway alterations are key molecular events in glioblastoma (GBM). MDM2 inhibitors increase expression and stability of p53 and are presumed to be most efficacious in patients with TP53 wild-type and MDM2-amplified cancers. However, this biomarker hypothesis has not been tested in patients or patient-derived models for GBM. Methods We performed a preclinical evaluation of RG7112 MDM2 inhibitor, across a panel of 36 patient-derived GBM cell lines (PDCLs), each genetically characterized according to their P53 pathway status. We then performed a pharmacokinetic (PK) profiling of RG7112 distribution in mice and evaluated the therapeutic activity of RG7112 in orthotopic and subcutaneous GBM models. Results MDM2-amplified PDCLs were 44 times more sensitive than TP53 mutated lines that showed complete resistance at therapeutically attainable concentrations (avg. IC50 of 0.52 μM vs 21.9 μM). MDM4 amplified PDCLs were highly sensitive but showed intermediate response (avg. IC50 of 1.2 μM), whereas response was heterogeneous in TP53 wild-type PDCLs with normal MDM2/4 levels (avg. IC50 of 7.7 μM). In MDM2-amplified lines, RG7112 restored p53 activity inducing robust p21 expression and apoptosis. PK profiling of RG7112-treated PDCL intracranial xenografts demonstrated that the compound significantly crosses the blood-brain and the blood-tumor barriers. Most importantly, treatment of MDM2-amplified/TP53 wild-type PDCL-derived model (subcutaneous and orthotopic) reduced tumor growth, was cytotoxic, and significantly increased survival. Conclusion These data strongly support development of MDM2 inhibitors for clinical testing in MDM2-amplified GBM patients. Moreover, significant efficacy in a subset of non-MDM2 amplified models suggests that additional markers of response to MDM2 inhibitors must be identified. PMID:26482041

Tangeretin, a citrus polymethoxyflavonoid, induces apoptosis of human gastric cancer AGS cells through extrinsic and intrinsic signaling pathways.

PubMed

Dong, Yang; Cao, Aili; Shi, Jianrong; Yin, Peihao; Wang, Li; Ji, Guang; Xie, Jianqun; Wu, Dazheng

2014-04-01

Tangeretin, a natural polymethoxyflavone present in citrus peel oil, is known to have anticancer activities in breast cancer, colorectal carcinoma and lung carcinoma, yet, the underlying mechanisms of tangeretin in human gastric cancer AGS cells have not been investigated to date. In the present study, the apoptotic mechanisms of tangeretin in AGS cells were explored. It was observed that tangeretin increased the apoptotic rates of AGS cells following treatment with tangeretin for 48 h in a dose-dependent manner by Annexin V-FITC and PI double staining. In addition, characteristic apoptotic morphology such as nuclear shrinkage and apoptotic bodies was observed after Hoechst 33258 staining. Flow cytometric assay showed that treatment of AGS cells with tangeretin decreased the mitochondrial membrane potential (MMP) in a dose-dependent manner, which indicated that mitochondrial dysfunction was involved in the tangeretin-induced apoptosis. Caspase-3, -8 and -9 activities were increased by tangeretin in a dose-dependent manner. Western blotting showed that the protein levels of pro-apoptotic proteins including cleaved caspase-3, cleaved caspase-8, cleaved caspase-9, Bax, Bid, tBid, p53, p21/cip1, Fas and FasL were significantly upregulated by tangeretin. In addition, PFT-α (a p53 inhibitor) reduced the apoptotic rates and the expression of p53, p21, caspase-3 and caspase-9 induced by tangeretin, indicating that tangeretin-induced apoptosis was p53-dependent. In conclusion, these results suggest that tangeretin induces the apoptosis of AGS cells mainly through p53-dependent mitochondrial dysfunction and the Fas/FasL-mediated extrinsic pathway.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Soo Kyung; Gwak, Jungsug; Song, Im-Sook

Highlights: {yields} TopIn activates p53-dependent transcription in colon cancer cells. {yields} TopIn induces apoptosis in colon cancer cells. {yields} TopIn selectively inhibits topoisomerase I activity. {yields} TopIn does not affect the activity of BCRP and MDR-1. -- Abstract: The tumor suppressor p53 plays an important role in cellular emergency mechanisms through regulating the genes involved in cell cycle arrest and apoptosis. To identify small molecules that can activate p53-responsive transcription, we performed chemical screening using genetically engineered HCT116 reporter cells. We found that TopIn (7-phenyl-6H-[1,2,5]oxadiazolo[3,4-e]indole 3-oxide) efficiently activated p53-mediated transcriptional activity and induced phosphorylation of p53 at Ser15, thereby stabilizingmore » the p53 protein. Furthermore, TopIn upregulated the expression of p21{sup WAF1/CIP1}, a downstream target of p53, and suppressed cellular proliferation in various colon cancer cells. Additionally, TopIn induced DNA fragmentation, caspase-3/7 activation and poly ADP ribose polymerase cleavage, typical biochemical markers of apoptosis, in p53 wild-type and mutated colon cancer cells. Finally, we found that TopIn inhibited topoisomerase I activity, but not topoisomerase II, in vitro and induced the formation of the topoisomerase I-DNA complex in HCT116 colon cancer cells. Unlike camptothecin (CPT) and its derivative SN38, TopIn did not affect the activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP) or multidrug-resistant protein-1 (MDR-1). These results suggest that TopIn may present a promising new topoisomerase I-targeting anti-tumor therapeutics.« less

S-Nitrosylation of parkin as a novel regulator of p53-mediated neuronal cell death in sporadic Parkinson’s disease

PubMed Central

2013-01-01

Background Mutations in the gene encoding parkin, a neuroprotective protein with dual functions as an E3 ubiquitin ligase and transcriptional repressor of p53, are linked to familial forms of Parkinson’s disease (PD). We hypothesized that oxidative posttranslational modification of parkin by environmental toxins may contribute to sporadic PD. Results We first demonstrated that S-nitrosylation of parkin decreased its activity as a repressor of p53 gene expression, leading to upregulation of p53. Chromatin immunoprecipitation as well as gel-shift assays showed that parkin bound to the p53 promoter, and this binding was inhibited by S-nitrosylation of parkin. Additionally, nitrosative stress induced apoptosis in cells expressing parkin, and this death was, at least in part, dependent upon p53. In primary mesencephalic cultures, pesticide-induced apoptosis was prevented by inhibition of nitric oxide synthase (NOS). In a mouse model of pesticide-induced PD, both S-nitrosylated (SNO-)parkin and p53 protein levels were increased, while administration of a NOS inhibitor mitigated neuronal death in these mice. Moreover, the levels of SNO-parkin and p53 were simultaneously elevated in postmortem human PD brain compared to controls. Conclusions Taken together, our data indicate that S-nitrosylation of parkin, leading to p53-mediated neuronal cell death, contributes to the pathophysiology of sporadic PD. PMID:23985028

Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma

PubMed Central

Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong

2007-01-01

Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291

The tumour suppressor CYLD regulates the p53 DNA damage response

PubMed Central

Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

2016-01-01

The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

PubMed

Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

2017-04-01

Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 <3.0 μmol/l) were identified within established (4/9) and primary patient-derived (2/5) CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or oxaliplatin to enhance the antiproliferative response to both chemotherapeutic agents. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

PubMed

Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

1999-06-01

The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting

Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53more » status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.« less

Proteasomal degradation of sphingosine kinase 1 and inhibition of dihydroceramide desaturase by the sphingosine kinase inhibitors, SKi or ABC294640, induces growth arrest in androgen-independent LNCaP-AI prostate cancer cells.

PubMed

McNaughton, Melissa; Pitman, Melissa; Pitson, Stuart M; Pyne, Nigel J; Pyne, Susan

2016-03-29

Sphingosine kinases (two isoforms termed SK1 and SK2) catalyse the formation of the bioactive lipid sphingosine 1-phosphate. We demonstrate here that the SK2 inhibitor, ABC294640 (3-(4-chlorophenyl)-adamantane-1-carboxylic acid (pyridin-4-ylmethyl)amide) or the SK1/SK2 inhibitor, SKi (2-(p-hydroxyanilino)-4-(p-chlorophenyl)thiazole)) induce the proteasomal degradation of SK1a (Mr = 42 kDa) and inhibit DNA synthesis in androgen-independent LNCaP-AI prostate cancer cells. These effects are recapitulated by the dihydroceramide desaturase (Des1) inhibitor, fenretinide. Moreover, SKi or ABC294640 reduce Des1 activity in Jurkat cells and ABC294640 induces the proteasomal degradation of Des1 (Mr = 38 kDa) in LNCaP-AI prostate cancer cells. Furthermore, SKi or ABC294640 or fenretinide increase the expression of the senescence markers, p53 and p21 in LNCaP-AI prostate cancer cells. The siRNA knockdown of SK1 or SK2 failed to increase p53 and p21 expression, but the former did reduce DNA synthesis in LNCaP-AI prostate cancer cells. Moreover, N-acetylcysteine (reactive oxygen species scavenger) blocked the SK inhibitor-induced increase in p21 and p53 expression but had no effect on the proteasomal degradation of SK1a. In addition, siRNA knockdown of Des1 increased p53 expression while a combination of Des1/SK1 siRNA increased the expression of p21. Therefore, Des1 and SK1 participate in regulating LNCaP-AI prostate cancer cell growth and this involves p53/p21-dependent and -independent pathways. Therefore, we propose targeting androgen-independent prostate cancer cells with compounds that affect Des1/SK1 to modulate both de novo and sphingolipid rheostat pathways in order to induce growth arrest.

ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

PubMed Central

Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe

2001-01-01

The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603

Keeping mammalian mutation load in check: regulation of the activity of error-prone DNA polymerases by p53 and p21.

PubMed

Livneh, Zvi

2006-09-01

To overcome DNA lesions that block replication the cell employs translesion DNA synthesis (TLS) polymerases, a group of low fidelity DNA polymerases that have the capacity to bypass a wide range of DNA lesions. This TLS process is also termed error-prone repair, due to its inherent mutagenic nature. We have recently shown that the tumor suppressor p53 and the cell cycle inhibitor p21 are global regulators of TLS. When these proteins are missing or nonfunctional, TLS gets out of control: its extent increases to very high levels, and its fidelity decreases, causing an overall increase in mutation load. This may be explained by the loss of selectivity in the bypass of specific DNA lesions by their cognate specialized polymerases, such that lesion bypass continues to a maximum, regardless of the price paid in increased mutations. The p53 and p21 proteins are also required for efficient UV light-induced monoubiquitination of PCNA, which is consistent with a model in which this modification of PCNA is necessary but not sufficient for the normal activity of TLS. This regulation suggests that TLS evolved in mammals as a system that balances gain in survival with a tolerable mutational cost, and that disturbing this balance causes a potentially harmful increase in mutations, which might play a role in carcinogenesis.

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

PubMed Central

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-01-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

PubMed

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-08-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

Depletion of hepatoma-derived growth factor-related protein-3 induces apoptotic sensitization of radioresistant A549 cells via reactive oxygen species-dependent p53 activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Hong Shik; Hong, Eun-Hee; Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791

2013-09-27

Highlights: •HRP-3 is a radiation- and anticancer drug-responsive protein in A549 cells. •Depletion of HRP-3 induces apoptosis of radio- and chemoresistant A549 cells. •Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. •Depletion of HRP-3 enhances ROS-dependent p53 activation and PUMA expression. -- Abstract: Biomarkers based on functional signaling have the potential to provide greater insight into the pathogenesis of cancer and may offer additional targets for anticancer therapeutics. Here, we identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistance-related gene and characterized the molecular mechanism by which its encoded protein regulates the radio- and chemoresistant phenotypemore » of lung cancer-derived A549 cells. Knockdown of HRP-3 promoted apoptosis of A549 cells and potentiated the apoptosis-inducing action of radio- and chemotherapy. This increase in apoptosis was associated with a substantial generation of reactive oxygen species (ROS) that was attributable to inhibition of the Nrf2/HO-1 antioxidant pathway and resulted in enhanced ROS-dependent p53 activation and p53-dependent expression of PUMA (p53 upregulated modulator of apoptosis). Therefore, the HRP-3/Nrf2/HO-1/ROS/p53/PUMA cascade is an essential feature of the A549 cell phenotype and a potential radiotherapy target, extending the range of targets in multimodal therapies against lung cancer.« less

A high-throughput cellular assay to quantify the p53-degradation activity of E6 from different human papillomavirus types.

PubMed

Gagnon, David; Archambault, Jacques

2015-01-01

A subset of human papillomaviruses (HPVs), known as the high-risk types, are the causative agents of cervical cancer and other malignancies of the anogenital region and oral mucosa. The capacity of these viruses to induce cancer and to immortalize cells in culture relies in part on a critical function of their E6 oncoprotein, that of promoting the poly-ubiquitination of the cellular tumor suppressor protein p53 and its subsequent degradation by the proteasome. Here, we describe a cellular assay to measure the p53-degradation activity of E6 from different HPV types. This assay is based on a translational fusion of p53 to Renilla luciferase (Rluc-p53) that remains sensitive to degradation by high-risk E6 and whose steady-state levels can be accurately measured in standard luciferase assays. The p53-degradation activity of any E6 protein can be tested and quantified in transiently transfected cells by determining the amount of E6-expression vector required to reduce by half the levels of RLuc-p53 luciferase activity (50 % effective concentration [EC50]). The high-throughput and quantitative nature of this assay makes it particularly useful to compare the p53-degradation activities of E6 from several HPV types in parallel.

Tripeptidyl peptidase II plays a role in the radiation response of selected primary cell types but not based on nuclear translocation and p53 stabilization.

PubMed

Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele

2009-04-15

The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.

Phytochemical regulation of the tumor suppressive microRNA, miR-34a, by p53-dependent and independent responses in human breast cancer cells

PubMed Central

Hargraves, Kris G.; He, Lin; Firestone, Gary L.

2016-01-01

The tumor suppressive microRNA miR-34a is transcriptionally regulated by p53 and shown to inhibit breast cancer cell proliferation as well as being a marker of increased disease free survival. Indole-3-carbinol (I3C) derived from cruciferous vegetables, artemisinin, extracted from the sweet wormwood plant, and artesunate, a semi-synthetic derivative of artemisinin, are phytochemicals with anti-tumorigenic properties however, little is known about the role of microRNAs in their mechanism of action. Human breast cancer cells expressing wild-type (MCF-7) or mutant p53 (T47D) were treated with a concentration range and time course of each phytochemical under conditions of cell cycle arrest as detected by flow cytometry to examine the potential connection between miR-34a expression and their anti-proliferative responses. Real-time PCR and western blot analysis of extracted RNA and total protein revealed artemsinin and artesunate increased miR-34a expression in a dose-dependent manner correlating with down-regulation of the miR-34a target gene, CDK4. I3C stimulation of miR-34a expression required functional p53, whereas, both artemisinin and artesunate up-regulated miR-34a expression regardless of p53 mutational status or in the presence of dominant negative p53. Phytochemical treatments inhibited the luciferase activity of a construct containing the wild-type 3′UTR of CDK4, but not those with a mutated miR-34a binding site, whereas, transfection of miR-34a inhibitors ablated the phytochemical mediated down-regulation of CDK4 and induction of cell cycle arrest. Our results suggest that miR-34a is an essential component of the anti-proliferative activities of I3C, artemisinin and artesunate and demonstrate that both wild-type p53 dependent and independent pathways are responsible for miR-34a induction. PMID:25789847

p53 -Dependent and -Independent Nucleolar Stress Responses

PubMed Central

Olausson, Karl Holmberg; Nistér, Monica; Lindström, Mikael S.

2012-01-01

The nucleolus has emerged as a cellular stress sensor and key regulator of p53-dependent and -independent stress responses. A variety of abnormal metabolic conditions, cytotoxic compounds, and physical insults induce alterations in nucleolar structure and function, a situation known as nucleolar or ribosomal stress. Ribosomal proteins, including RPL11 and RPL5, become increasingly bound to the p53 regulatory protein MDM2 following nucleolar stress. Ribosomal protein binding to MDM2 blocks its E3 ligase function leading to stabilization and activation of p53. In this review we focus on a number of novel regulators of the RPL5/RPL11-MDM2-p53 complex including PICT1 (GLTSCR2), MYBBP1A, PML and NEDD8. p53-independent pathways mediating the nucleolar stress response are also emerging and in particular the negative control that RPL11 exerts on Myc oncoprotein is of importance, given the role of Myc as a master regulator of ribosome biogenesis. We also briefly discuss the potential of chemotherapeutic drugs that specifically target RNA polymerase I to induce nucleolar stress. PMID:24710530

Local activation of p53 in the tumor microenvironment overcomes immune suppression and enhances antitumor immunity

PubMed Central

Guo, Gang; Yu, Miao; Xiao, Wei; Celis, Esteban; Cui, Yan

2017-01-01

Mutations in tumor suppressor p53 remain a vital mechanism of tumor escape from apoptosis and senescence. Emerging evidence suggests that p53 dysfunction also fuels inflammation and supports tumor immune evasion, thereby serving as an immunological driver of tumorigenesis. Therefore, targeting p53 in the tumor microenvironment (TME) also represents an immunologically desirable strategy for reversing immunosuppression and enhancing antitumor immunity. Using a pharmacological p53 activator nutlin-3a, we show that local p53 activation in TME comprising overt tumor infiltrating leukocytes (TILeus) induces systemic antitumor immunity and tumor regression, but not in TME with scarce TILeus, such as B16 melanoma. Maneuvers that recruit leukocytes to TME, such as TLR3 ligand in B16 tumors, greatly enhanced nutlin-induced antitumor immunity and tumor control. Mechanistically, nutlin-3a-induced antitumor immunity was contingent on two non-redundant but immunologically synergistic p53-dependent processes: reversal of immunosuppression in TME and induction of tumor immunogenic cell death (ICD), leading to activation and expansion of polyfunctional CD8 CTLs and tumor regression. Our study demonstrates that unlike conventional tumoricidal therapies, which rely on effective p53 targeting in each tumor cell and often associate with systemic toxicity, this immune-based strategy requires only limited local p53 activation to alter the immune landscape of TME and subsequently amplify immune response to systemic antitumor immunity. Hence, targeting the p53 pathway in TME can be exploited to reverse immunosuppression and augment therapeutic benefits beyond tumoricidal effects to harness tumor-specific, durable, and systemic antitumor immunity with minimal toxicity. PMID:28280037

Regulation of autophagy by cytoplasmic p53

PubMed Central

Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2009-01-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ginkel, Paul R. van; Yan, Michael B.; Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792

Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cellsmore » to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.« less

Targeting of the BLT2 in chronic myeloid leukemia inhibits leukemia stem/progenitor cell function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Meifang; Ai, Hongmei; Li, Tao

Imatinib, a tyrosine kinase inhibitor (TKI) has significantly improved clinical outcome for chronic myeloid leukemia (CML) patients. However, patients develop resistance when the disease progresses to the blast phase (BP) and the mechanisms are not well understood. Here we show that BCR-ABL activates BLT2 in hematopoietic stem/progenitor cells to promote leukemogenesis and this involves the p53 signaling pathway. Compared to normal bone marrow (NBM), the mRNA and protein levels of BLT2 are significantly increased in BP-CML CD34{sup +} stem/progenitor cells. This is correlated with increasing BCR-ABL expression. In contrast, knockdown of BCR-ABL or inhibition of its tyrosine kinase activity decreasesmore » Blt2 protein level. BLT2 inhibition induces apoptosis, inhibits proliferation, colony formation and self-renewal capacity of CD34{sup +} cells from TKI-resistant BP-CML patients. Importantly, the inhibitory effects of BCR-ABL TKI on CML stem/progenitor cells are further enhanced upon combination with BLT2 inhibition. We further show that BLT2 activation selectively suppresses p53 but not Wnt or BMP-mediated luciferase activity and transcription. Our results demonstrate that BLT2 is a novel pathway activated by BCR-ABL and critically involved in the resistance of BP-CML CD34{sup +} stem/progenitors to TKIs treatment. Our findings suggest that BLT2 and p53 can serve as therapeutic targets for CML treatment. - Highlights: • BCR-ABL regulates BLT2 expression to promote leukemogenesis. • BLT2 is essential to maintain CML cell function. • Activation of BLT2 suppresses p53 signaling pathway in CML cells. • Inhibition of BLT2 and BCR-ABL synergize in eliminating CML CD34{sup +} stem/progenitors.« less

Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

PubMed Central

Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

2006-01-01

The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

PubMed Central

Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

2016-01-01

Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

p53 Restoration in Induction and Maintenance of Senescence: Differential Effects in Premalignant and Malignant Tumor Cells

PubMed Central

Harajly, Mohamad; Zalzali, Hasan; Nawaz, Zafar; Ghayad, Sandra E.; Ghamloush, Farah; Basma, Hussein; Zainedin, Samiha; Rabeh, Wissam; Jabbour, Mark; Tawil, Ayman; Badro, Danielle A.; Evan, Gerard I.

2015-01-01

The restoration of p53 has been suggested as a therapeutic approach in tumors. However, the timing of p53 restoration in relation to its efficacy during tumor progression still is unclear. We now show that the restoration of p53 in murine premalignant proliferating pineal lesions resulted in cellular senescence, while p53 restoration in invasive pineal tumors did not. The effectiveness of p53 restoration was not dependent on p19Arf expression but showed an inverse correlation with Mdm2 expression. In tumor cells, p53 restoration became effective when paired with either DNA-damaging therapy or with nutlin, an inhibitor of p53-Mdm2 interaction. Interestingly, the inactivation of p53 after senescence resulted in reentry into the cell cycle and rapid tumor progression. The evaluation of a panel of human supratentorial primitive neuroectodermal tumors (sPNET) showed low activity of the p53 pathway. Together, these data suggest that the restoration of the p53 pathway has different effects in premalignant versus invasive pineal tumors, and that p53 activation needs to be continually sustained, as reversion from senescence occurs rapidly with aggressive tumor growth when p53 is lost again. Finally, p53 restoration approaches may be worth exploring in sPNET, where the p53 gene is intact but the pathway is inactive in the majority of examined tumors. PMID:26598601

Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa

Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp53 bearing cancer cells.« less

Transcriptional and post-transcriptional regulation of the ionizing radiation response by ATM and p53

PubMed Central

Venkata Narayanan, Ishwarya; Paulsen, Michelle T.; Bedi, Karan; Berg, Nathan; Ljungman, Emily A.; Francia, Sofia; Veloso, Artur; Magnuson, Brian; di Fagagna, Fabrizio d’Adda; Wilson, Thomas E.; Ljungman, Mats

2017-01-01

In response to ionizing radiation (IR), cells activate a DNA damage response (DDR) pathway to re-program gene expression. Previous studies using total cellular RNA analyses have shown that the stress kinase ATM and the transcription factor p53 are integral components required for induction of IR-induced gene expression. These studies did not distinguish between changes in RNA synthesis and RNA turnover and did not address the role of enhancer elements in DDR-mediated transcriptional regulation. To determine the contribution of synthesis and degradation of RNA and monitor the activity of enhancer elements following exposure to IR, we used the recently developed Bru-seq, BruChase-seq and BruUV-seq techniques. Our results show that ATM and p53 regulate both RNA synthesis and stability as well as enhancer element activity following exposure to IR. Importantly, many genes in the p53-signaling pathway were coordinately up-regulated by both increased synthesis and RNA stability while down-regulated genes were suppressed either by reduced synthesis or stability. Our study is the first of its kind that independently assessed the effects of ionizing radiation on transcription and post-transcriptional regulation in normal human cells. PMID:28256581

p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.

PubMed

Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina

2009-11-01

Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.

Agmatine Ameliorates High Glucose-Induced Neuronal Cell Senescence by Regulating the p21 and p53 Signaling.

PubMed

Song, Juhyun; Lee, Byeori; Kang, Somang; Oh, Yumi; Kim, Eosu; Kim, Chul-Hoon; Song, Ho-Taek; Lee, Jong Eun

2016-02-01

Neuronal senescence caused by diabetic neuropathy is considered a common complication of diabetes mellitus. Neuronal senescence leads to the secretion of pro-inflammatory cytokines, the production of reactive oxygen species, and the alteration of cellular homeostasis. Agmatine, which is biosynthesized by arginine decarboxylation, has been reported in previous in vitro to exert a protective effect against various stresses. In present study, agmatine attenuated the cell death and the expression of pro-inflammatory cytokines such as IL-6, TNF-alpha and CCL2 in high glucose in vitro conditions. Moreover, the senescence associated-β-galatosidase's activity in high glucose exposed neuronal cells was reduced by agmatine. Increased p21 and reduced p53 in high glucose conditioned cells were changed by agmatine. Ultimately, agmatine inhibits the neuronal cell senescence through the activation of p53 and the inhibition of p21. Here, we propose that agmatine may ameliorate neuronal cell senescence in hyperglycemia.

Induction of apoptosis in hepatocellular carcinoma Smmc-7721 cells by vitamin K(2) is associated with p53 and independent of the intrinsic apoptotic pathway.

PubMed

Li, Lu; Qi, Zhiling; Qian, Jin; Bi, Fuyong; Lv, Jun; Xu, Lei; Zhang, Ling; Chen, Hongyu; Jia, Renbing

2010-09-01

Vitamin K(2) (VK(2)) can exert cell growth inhibitory effects in various human cancer cells. In this study, we investigated the cell growth inhibitory effects of VK(2) in hepatocellular carcinoma Smmc-7721 cells and the mechanisms involved. We found that VK(2)-inhibited cell proliferation in Smmc-7721 cells in a dose-dependent manner, and the IC50 of VK(2) in Smmc-7721 cells was 9.73 microM at 24 h. The data from flow cytometric analyses, DNA fragmentation assays, and caspase 3 activity assays revealed that apoptosis was the determining factor in VK(2) activity. Furthermore, a significant increase in p53 phosphorylation and protein level was exhibited in apoptotic cells treated with VK(2), although there were no changes in p53 mRNA expression. Bax expression was unaffected by VK(2) in Smmc-7721 cells. In addition, our study showed that caspase 3 was activated by caspase 8, not caspase 9, in Smmc-7721 cells treated with VK(2). In summary, these data suggested that VK(2) can inhibit the growth of Smmc-7721 cells by induction of apoptosis involving caspase 8 activation and p53. This apoptotic process was not mediated by the intrinsic apoptotic pathway.

Methylseleninic acid super-activates p53-senescence cancer progression barrier in prostate lesions of Pten-knockout mouse

PubMed Central

Wang, Lei; Guo, Xiaolan; Wang, Ji; Jiang, Cheng; Bosland, Maarten C.; Lü, Junxuan; Deng, Yibin

2015-01-01

Monomethylated selenium (MM-Se) forms that are precursors of methylselenol such as methylseleninic acid (MSeA) differ in metabolism and anti-cancer activities in preclinical cell and animal models from seleno-methionine that had failed to exert preventive efficacy against prostate cancer (PCa) in North American men. Given that human PCa arises from precancerous lesions such as high-grade prostatic intraepithelial neoplasia (HG-PIN) which frequently have lost PTEN tumor suppressor permitting AKT oncogenic signaling, we tested the efficacy of MSeA to inhibit HG-PIN progression in Pten prostate specific knockout (KO) mice and assessed the mechanistic involvement of p53-mediated cellular senescence and of the androgen receptor (AR). We observed that short-term (4 weeks) oral MSeA treatment significantly increased expression of P53 and P21Cip1 proteins and senescence-associated-β-galactosidase staining, and reduced Ki-67 cell proliferation index in Pten KO prostate epithelium. Long-term (25 weeks) MSeA administration significantly suppressed HG-PIN phenotype, tumor weight, and prevented emergence of invasive carcinoma in Pten KO mice. Mechanistically, the long-term MSeA treatment not only sustained P53-mediated senescence, but also markedly reduced AKT phosphorylation and AR abundance in the Pten KO prostate. Importantly, these cellular and molecular changes were not observed in the prostate of wild type littermates which were similarly treated with MSeA. Since p53 signaling is likely to be intact in HG-PIN compared to advanced PCa, the selective super-activation of p53-mediated senescence by MSeA suggests a new paradigm of cancer chemoprevention by strengthening a cancer progression barrier through induction of irreversible senescence with additional suppression of AR and AKT oncogenic signaling. PMID:26511486

p53 genes function to restrain mobile elements

PubMed Central

Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

2016-01-01

Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

E2 Ubiquitin-conjugating Enzyme, UBE2C Gene, Is Reciprocally Regulated by Wild-type and Gain-of-Function Mutant p53.

PubMed

Bajaj, Swati; Alam, Sk Kayum; Roy, Kumar Singha; Datta, Arindam; Nath, Somsubhra; Roychoudhury, Susanta

2016-07-01

Spindle assembly checkpoint governs proper chromosomal segregation during mitosis to ensure genomic stability. At the cellular level, this event is tightly regulated by UBE2C, an E2 ubiquitin-conjugating enzyme that donates ubiquitin to the anaphase-promoting complex/cyclosome. This, in turn, facilitates anaphase-onset by ubiquitin-mediated degradation of mitotic substrates. UBE2C is an important marker of chromosomal instability and has been associated with malignant growth. However, the mechanism of its regulation is largely unexplored. In this study, we report that UBE2C is transcriptionally activated by the gain-of-function (GOF) mutant p53, although it is transcriptionally repressed by wild-type p53. We showed that wild-type p53-mediated inhibition of UBE2C is p21-E2F4-dependent and GOF mutant p53-mediated transactivation of UBE2C is NF-Y-dependent. We further explored that DNA damage-induced wild-type p53 leads to spindle assembly checkpoint arrest by repressing UBE2C, whereas mutant p53 causes premature anaphase exit by increasing UBE2C expression in the presence of 5-fluorouracil. Identification of UBE2C as a target of wild-type and GOF mutant p53 further highlights the contribution of p53 in regulation of spindle assembly checkpoint. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells.

PubMed

Kuffer, Christian; Kuznetsova, Anastasia Yurievna; Storchová, Zuzana

2013-08-01

Erroneously arising tetraploid mammalian cells are chromosomally instable and may facilitate cell transformation. An increasing body of evidence shows that the propagation of mammalian tetraploid cells is limited by a p53-dependent arrest. The trigger of this arrest has not been identified so far. Here we show by live cell imaging of tetraploid cells generated by an induced cytokinesis failure that most tetraploids arrest and die in a p53-dependent manner after the first tetraploid mitosis. Furthermore, we found that the main trigger is a mitotic defect, in particular, chromosome missegregation during bipolar mitosis or spindle multipolarity. Both a transient multipolar spindle followed by efficient clustering in anaphase as well as a multipolar spindle followed by multipolar mitosis inhibited subsequent proliferation to a similar degree. We found that the tetraploid cells did not accumulate double-strand breaks that could cause the cell cycle arrest after tetraploid mitosis. In contrast, tetraploid cells showed increased levels of oxidative DNA damage coinciding with the p53 activation. To further elucidate the pathways involved in the proliferation control of tetraploid cells, we knocked down specific kinases that had been previously linked to the cell cycle arrest and p53 phosphorylation. Our results suggest that the checkpoint kinase ATM phosphorylates p53 in tetraploid cells after abnormal mitosis and thus contributes to proliferation control of human aberrantly arising tetraploids.

Non-Thermal Atmospheric Pressure Plasma Preferentially Induces Apoptosis in p53-Mutated Cancer Cells by Activating ROS Stress-Response Pathways

PubMed Central

Ma, Yonghao; Ha, Chang Seung; Hwang, Seok Won; Lee, Hae June; Kim, Gyoo Cheon; Lee, Kyo-Won; Song, Kiwon

2014-01-01

Non-thermal atmospheric pressure plasma (NTAPP) is an ionized gas at room temperature and has potential as a new apoptosis-promoting cancer therapy that acts by generating reactive oxygen species (ROS). However, it is imperative to determine its selectivity and standardize the components and composition of NTAPP. Here, we designed an NTAPP-generating apparatus combined with a He gas feeding system and demonstrated its high selectivity toward p53-mutated cancer cells. We first determined the proper conditions for NTAPP exposure to selectively induce apoptosis in cancer cells. The apoptotic effect of NTAPP was greater for p53-mutated cancer cells; artificial p53 expression in p53-negative HT29 cells decreased the pro-apoptotic effect of NTAPP. We also examined extra- and intracellular ROS levels in NTAPP-treated cells to deduce the mechanism of NTAPP action. While NTAPP-mediated increases in extracellular nitric oxide (NO) did not affect cell viability, intracellular ROS increased under NTAPP exposure and induced apoptotic cell death. This effect was dose-dependently reduced following treatment with ROS scavengers. NTAPP induced apoptosis even in doxorubicin-resistant cancer cell lines, demonstrating the feasibility of NTAPP as a potent cancer therapy. Collectively, these results strongly support the potential of NTAPP as a selective anticancer treatment, especially for p53-mutated cancer cells. PMID:24759730

P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

PubMed

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-08-27

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

PubMed Central

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-01-01

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy. PMID:20957096

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

Minnelide/Triptolide Impairs Mitochondrial Function by Regulating SIRT3 in P53-Dependent Manner in Non-Small Cell Lung Cancer.

PubMed

Kumar, Ajay; Corey, Catherine; Scott, Iain; Shiva, Sruti; D'Cunha, Jonathan

2016-01-01

Minnelide/Triptolide (TL) has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC). However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS). Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2), along with diminished cellular glutathione (GSH) content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC). TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y), restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.

P53 protein in proliferation, repair and apoptosis of cells.

PubMed

Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara

2014-05-01

The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.

Isoindolinone inhibitors of the murine double minute 2 (MDM2)-p53 protein-protein interaction: structure-activity studies leading to improved potency.

PubMed

Hardcastle, Ian R; Liu, Junfeng; Valeur, Eric; Watson, Anna; Ahmed, Shafiq U; Blackburn, Timothy J; Bennaceur, Karim; Clegg, William; Drummond, Catherine; Endicott, Jane A; Golding, Bernard T; Griffin, Roger J; Gruber, Jan; Haggerty, Karen; Harrington, Ross W; Hutton, Claire; Kemp, Stuart; Lu, Xiaohong; McDonnell, James M; Newell, David R; Noble, Martin E M; Payne, Sara L; Revill, Charlotte H; Riedinger, Christiane; Xu, Qing; Lunec, John

2011-03-10

Inhibition of the MDM2-p53 interaction has been shown to produce an antitumor effect, especially in MDM2 amplified tumors. The isoindolinone scaffold has proved to be versatile for the discovery of MDM2-p53 antagonists. Optimization of previously reported inhibitors, for example, NU8231 (7) and NU8165 (49), was guided by MDM2 NMR titrations, which indicated key areas of the binding interaction to be explored. Variation of the 2-N-benzyl and 3-alkoxy substituents resulted in the identification of 3-(4-chlorophenyl)-3-((1-(hydroxymethyl)cyclopropyl)methoxy)-2-(4-nitrobenzyl)isoindolin-1-one (74) as a potent MDM2-p53 inhibitor (IC(50) = 0.23 ± 0.01 μM). Resolution of the enantiomers of 74 showed that potent MDM2-p53 activity primarily resided with the (+)-R-enantiomer (74a; IC(50) = 0.17 ± 0.02 μM). The cellular activity of key compounds has been examined in cell lines with defined p53 and MDM2 status. Compound 74a activates p53, MDM2, and p21 transcription in MDM2 amplified cells and shows moderate selectivity for wild-type p53 cell lines in growth inhibition assays.

Molecular Dynamic Simulation Insights into the Normal State and Restoration of p53 Function

PubMed Central

Fu, Ting; Min, Hanyi; Xu, Yong; Chen, Jianzhong; Li, Guohui

2012-01-01

As a tumor suppressor protein, p53 plays a crucial role in the cell cycle and in cancer prevention. Almost 50 percent of all human malignant tumors are closely related to a deletion or mutation in p53. The activity of p53 is inhibited by over-active celluar antagonists, especially by the over-expression of the negative regulators MDM2 and MDMX. Protein-protein interactions, or post-translational modifications of the C-terminal negative regulatory domain of p53, also regulate its tumor suppressor activity. Restoration of p53 function through peptide and small molecular inhibitors has become a promising strategy for novel anti-cancer drug design and development. Molecular dynamics simulations have been extensively applied to investigate the conformation changes of p53 induced by protein-protein interactions and protein-ligand interactions, including peptide and small molecular inhibitors. This review focuses on the latest MD simulation research, to provide an overview of the current understanding of interactions between p53 and its partners at an atomic level. PMID:22949826

Abrogation of Gli3 expression suppresses the growth of colon cancer cells via activation of p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, Han Na; Oh, Sang Cheul; Kim, Jun Suk

2012-03-10

p53, the major human tumor suppressor, appears to be related to sonic hedgehog (Shh)-Gli-mediated tumorigenesis. However, the role of p53 in tumor progression by the Shh-Gli signaling pathway is poorly understood. Herein we investigated the critical regulation of Gli3-p53 in tumorigenesis of colon cancer cells and the molecular mechanisms underlying these effects. RT-PCR analysis indicated that the mRNA level of Shh and Gli3 in colon tumor tissues was significantly higher than corresponding normal tissues (P < 0.001). The inhibition of Gli3 by treatment with Gli3 siRNA resulted in a clear decrease in cell proliferation and enhanced the level of expressionmore » of p53 proteins compared to treatment with control siRNA. The half-life of p53 was dramatically increased by treatment with Gli3 siRNA. In addition, treatment with MG132 blocked MDM2-mediated p53 ubiquitination and degradation, and led to accumulation of p53 in Gli3 siRNA-overexpressing cells. Importantly, ectopic expression of p53 siRNA reduced the ability of Gli3 siRNA to suppress proliferation of those cells compared with the cells treated with Gli3 siRNA alone. Moreover, Gli3 siRNA sensitized colon cancer cells to treatment with anti-cancer agents (5-FU and bevacizumab). Taken together, our studies demonstrate that loss of Gli3 signaling leads to disruption of the MDM2-p53 interaction and strongly potentiate p53-dependent cell growth inhibition in colon cancer cells, indicating a basis for the rational use of Gli3 antagonists as a novel treatment option for colon cancer.« less

Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

PubMed

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-02-11

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*

PubMed Central

Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

2011-01-01

The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074

Cholesterol Secosterol Aldehydes Induce Amyloidogenesis and Dysfunction of Wild Type Tumor Protein p53

PubMed Central

Nieva, Jorge; Song, Byeong-Doo; Rogel, Joseph K.; Kujawara, David; Altobel, Lawrence; Izharrudin, Alicia; Boldt, Grant E.; Grover, Rajesh K.; Wentworth, Anita D.; Wentworth, Paul

2011-01-01

SUMMARY Epidemiologic and clinical evidence points to an increased risk of cancer when coupled with chronic inflammation. However, the molecular mechanisms that underpin this interrelationship remain largely unresolved. Herein we show that the inflammation-derived cholesterol 5,6-secosterol aldehydes, atheronal-A (KA) and –B (ALD), but not the PUFA-derived aldehydes 4-hydroxynonenal (HNE) and 4-hydroxyhexenal (HHE), induce misfolding of wild-type p53 into an amyloidogenic form that binds thioflavin T and Congo Red dyes but cannot bind to a consensus DNA sequence. Treatment of lung carcinoma cells with KA and ALD leads to a loss of function of extracted p53, as determined by analysis of extracted nuclear protein and in activation of p21. Our results uncover a plausible chemical link between inflammation and cancer and expands the already pivotal role of p53 dysfunction and cancer risk. PMID:21802012

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

PubMed

Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

2013-04-16

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy

PubMed Central

Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.

2013-01-01

Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378

A minimally invasive assay for individual assessment of the ATM/CHEK2/p53 pathway activity.

PubMed

Kabacik, Sylwia; Ortega-Molina, Ana; Efeyan, Alejo; Finnon, Paul; Bouffler, Simon; Serrano, Manuel; Badie, Christophe

2011-04-01

Ionizing radiation induces DNA Double-Strand Breaks (DSBs) which activate the ATM/CHEK2/p53 pathway leading to cell cycle arrest and apoptosis through transcription of genes including CDKN1A (p21) and BBC3 (PUMA). This pathway prevents genomic instability and tumorigenesis as demonstrated in heritable syndromes [e.g. Ataxia Telangiectasia (AT); Li-Fraumeni syndrome (LFS)]. Here, a simple assay based on gene expression in peripheral blood to measure accurately ATM/CHEK2/p53 pathway activity is described. The expression of p21, Puma and Sesn2 was determined in blood from mice with different gene copy numbers of Atm, Trp53 (p53), Chek2 or Arf and in human blood and mitogen stimulated T-lymphocyte (MSTL) cultures from AT, AT carriers, LFS patients, and controls, both before and after ex vivo ionizing irradiation. Mouse Atm/Chek2/p53 activity was highly dependent on the copy number of each gene except Arf. In human MSTL, an AT case, AT carriers and LFS patients showed responses distinct from healthy donors. The relationship between gene copy number and transcriptional induction upon radiation was linear for p21 and Puma and correlated well with cancer incidence in p53 variant mice. This reliable blood test provides an assay to determine ATM/CHEK2/p53 pathway activity and demonstrates the feasibility of assessing the activity of this essential cancer protection pathway in simple assays. These findings may have implications for the individualized prediction of cancer susceptibility.

Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

PubMed

Rani, Reena; Li, Jie; Pang, Qishen

2008-12-01

Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

PubMed Central

Rani, Reena; Li, Jie; Pang, Qishen

2008-01-01

Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

Downregulated long non-coding RNA MEG3 in breast cancer regulates proliferation, migration and invasion by depending on p53’s transcriptional activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Lin; Li, Yu; Yang, Bangxiang, E-mail: b19933009@qq.coom

Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition ofmore » proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.« less

The Isoforms of the p53 Protein

PubMed Central

Khoury, Marie P.; Bourdon, Jean-Christophe

2010-01-01

p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance.

PubMed

Walia, Mannu K; Ho, Patricia Mw; Taylor, Scott; Ng, Alvin Jm; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew Cw; Martin, T John; Walkley, Carl R

2016-04-12

Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.

Heterogeneity of p53 dependent genomic responses following ethanol exposure in a developmental mouse model of fetal alcohol spectrum disorder.

PubMed

Camargo Moreno, Maria; Mooney, Sandra M; Middleton, Frank A

2017-01-01

Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD.

Somatotropinomas, but not nonfunctioning pituitary adenomas, maintain a functional apoptotic RET/Pit1/ARF/p53 pathway that is blocked by excess GDNF.

PubMed

Diaz-Rodriguez, Esther; Garcia-Rendueles, Angela R; Ibáñez-Costa, Alejandro; Gutierrez-Pascual, Ester; Garcia-Lavandeira, Montserrat; Leal, Alfonso; Japon, Miguel A; Soto, Alfonso; Venegas, Eva; Tinahones, Francisco J; Garcia-Arnes, Juan A; Benito, Pedro; Angeles Galvez, Maria; Jimenez-Reina, Luis; Bernabeu, Ignacio; Dieguez, Carlos; Luque, Raul M; Castaño, Justo P; Alvarez, Clara V

2014-11-01

Acromegaly is caused by somatotroph cell adenomas (somatotropinomas [ACROs]), which secrete GH. Human and rodent somatotroph cells express the RET receptor. In rodents, when normal somatotrophs are deprived of the RET ligand, GDNF (Glial Cell Derived Neurotrophic Factor), RET is processed intracellularly to induce overexpression of Pit1 [Transcription factor (gene : POUF1) essential for transcription of Pituitary hormones GH, PRL and TSHb], which in turn leads to p19Arf/p53-dependent apoptosis. Our purpose was to ascertain whether human ACROs maintain the RET/Pit1/p14ARF/p53/apoptosis pathway, relative to nonfunctioning pituitary adenomas (NFPAs). Apoptosis in the absence and presence of GDNF was studied in primary cultures of 8 ACROs and 3 NFPAs. Parallel protein extracts were analyzed for expression of RET, Pit1, p19Arf, p53, and phospho-Akt. When GDNF deprived, ACRO cells, but not NFPAs, presented marked level of apoptosis that was prevented in the presence of GDNF. Apoptosis was accompanied by RET processing, Pit1 accumulation, and p14ARF and p53 induction. GDNF prevented all these effects via activation of phospho-AKT. Overexpression of human Pit1 (hPit1) directly induced p19Arf/p53 and apoptosis in a pituitary cell line. Using in silico studies, 2 CCAAT/enhancer binding protein alpha (cEBPα) consensus-binding sites were found to be 100% conserved in mouse, rat, and hPit1 promoters. Deletion of 1 cEBPα site prevented the RET-induced increase in hPit1 promoter expression. TaqMan qRT-PCR (real time RT-PCR) for RET, Pit1, Arf, TP53, GDNF, steroidogenic factor 1, and GH was performed in RNA from whole ACRO and NFPA tumors. ACRO but not NFPA adenomas express RET and Pit1. GDNF expression in the tumors was positively correlated with RET and negatively correlated with p53. In conclusion, ACROs maintain an active RET/Pit1/p14Arf/p53/apoptosis pathway that is inhibited by GDNF. Disruption of GDNF's survival function might constitute a new therapeutic route in acromegaly.

Dynamic monitoring of p53 translocation to mitochondria for the analysis of specific inhibitors using luciferase-fragment complementation.

PubMed

Noda, Natsumi; Awais, Raheela; Sutton, Robert; Awais, Muhammad; Ozawa, Takeaki

2017-12-01

Intracellular protein translocation plays a pivotal role in regulating complex biological processes, including cell death. The tumor suppressor p53 is a transcription factor activated by DNA damage and oxidative stress that also translocates from the cytosol into the mitochondrial matrix to facilitate necrotic cell death. However, specific inhibitors of p53 mitochondrial translocation are largely unknown. To explore the inhibitors of p53, we developed a bioluminescent probe to monitor p53 translocation from cytosol to mitochondria using luciferase fragment complementation assays. The probe is composed of a novel pair of luciferase fragments, the N-terminus of green click beetle luciferase CBG68 (CBGN) and multiple-complement luciferase fragment (McLuc1). The combination of luciferase fragments showed significant luminescence intensity and high signal-to-background ratio. When the p53 connected with McLuc1 translocates from cytosol into mitochondrial matrix, CBGN in mitochondrial matrix enables to complement with McLuc1, resulting in the restoration of the luminescence. The luminescence intensity was significantly increased under hydrogen peroxide-induced oxidative stress following the complementation of CBGN and McLuc1. Pifithrin-μ, a selective inhibitor of p53 mitochondrial translocation, prevented the mitochondrial translocation of the p53 probe in a concentration-dependent manner. Furthermore, the high luminescence intensity made it easier to visualize the p53 translocation at a single cell level under a bioluminescence microscope. This p53 mitochondrial translocation assay is a new tool for high-throughput screening to identify novel p53 inhibitors, which could be developed as drugs to treat diseases in which necrotic cell death is a major contributor. © 2017 Wiley Periodicals, Inc.

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

PubMed

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

2011-01-01

Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

Cytochrome P450 monooxygenase CYP53 family in fungi: comparative structural and evolutionary analysis and its role as a common alternative anti-fungal drug target.

PubMed

Jawallapersand, Poojah; Mashele, Samson Sitheni; Kovačič, Lidija; Stojan, Jure; Komel, Radovan; Pakala, Suresh Babu; Kraševec, Nada; Syed, Khajamohiddin

2014-01-01

Cytochrome P450 monooxygenases (CYPs/P450s) are heme-thiolate proteins whose role as a drug target against pathogenic microbes has been explored because of their stereo- and regio-specific oxidation activity. We aimed to assess the CYP53 family's role as a common alternative drug target against animal (including human) and plant pathogenic fungi and its role in fungal-mediated wood degradation. Genome-wide analysis of fungal species revealed the presence of CYP53 members in ascomycetes and basidiomycetes. Basidiomycetes had a higher number of CYP53 members in their genomes than ascomycetes. Only two CYP53 subfamilies were found in ascomycetes and six subfamilies in basidiomycetes, suggesting that during the divergence of phyla ascomycetes lost CYP53 P450s. According to phylogenetic and gene-structure analysis, enrichment of CYP53 P450s in basidiomycetes occurred due to the extensive duplication of CYP53 P450s in their genomes. Numerous amino acids (103) were found to be conserved in the ascomycetes CYP53 P450s, against only seven in basidiomycetes CYP53 P450s. 3D-modelling and active-site cavity mapping data revealed that the ascomycetes CYP53 P450s have a highly conserved protein structure whereby 78% amino acids in the active-site cavity were found to be conserved. Because of this rigid nature of ascomycetes CYP53 P450s' active site cavity, any inhibitor directed against this P450 family can serve as a common anti-fungal drug target, particularly toward pathogenic ascomycetes. The dynamic nature of basidiomycetes CYP53 P450s at a gene and protein level indicates that these P450s are destined to acquire novel functions. Functional analysis of CYP53 P450s strongly supported our hypothesis that the ascomycetes CYP53 P450s ability is limited for detoxification of toxic molecules, whereas basidiomycetes CYP53 P450s play an additional role, i.e. involvement in degradation of wood and its derived components. This study is the first report on genome-wide comparative structural (gene and protein structure-level) and evolutionary analysis of a fungal P450 family.

Genotoxic stress-induced activation of Plk3 is partly mediated by Chk2.

PubMed

Xie, Suqing; Wu, Huiyun; Wang, Qi; Kunicki, Jan; Thomas, Raymond O; Hollingsworth, Robert E; Cogswell, John; Dai, Wei

2002-01-01

Polo-like kinase 3 (Plk3, alternatively termed Prk) is involved in the regulation of DNA damage checkpoint as well as in M-phase function. Plk3 physically interacts with p53 and phosphorylates this tumor suppressor protein on serine-20, suggesting that the role of Plk3 in cell cycle progression is mediated, at least in part, through direct regulation of p53. Here we show that Plk3 is rapidly activated by reactive oxygen species in normal diploid fibroblast cells (WI-38), correlating with a subsequent increase in p53 protein level. Plk3 physically interacts with Chk2 and the interaction is enhanced upon DNA damage. In addition, Chk2 immunoprecipitated from cell lysates of Daudi (which expressed little Plk3) is capable of stimulating the kinase activity of purified recombinant Plk3 in vitro, and this stimulation is more pronounced when Plk3 is supplemented with Chk2 immunoprecipitated from Daudi after DNA damage. Furthermore, ectopic expression Chk2 activates cellular Plk3. Together, our studies suggest Chk2 may mediate direct activation of Plk3 in response to genotoxic stresses.

Aging mechanisms in bone

PubMed Central

Almeida, Maria

2012-01-01

Advancing age and loss of bone mass and strength are closely linked. Elevated osteoblast and osteocyte apoptosis and decreased osteoblast number characterize the age-related skeletal changes in humans and rodents. Similar to other tissues, oxidative stress increases in bone with age. This article reviews current knowledge on the effects of the aging process on bone and its cellular constituents, with particular emphasis on the role of reactive oxygen species (ROS). FoxOs, sirtuins and the p53/p66shc signaling cascade alter osteoblast number and bone formation via ROS-dependent and -independent mechanisms. Specifically, activation of the p53/p66shc signaling increases osteoblast/osteocyte apoptosis in the aged skeleton and decreases bone mass. FoxO activation in osteoblasts prevents oxidative stress to preserve skeletal homeostasis. However, while defending against stress FoxOs bind to β-catenin and attenuate Wnt/T-cell cell factor transcriptional activity and osteoblast generation. Thus, pathways that impact longevity and several diseases of ageing might also contribute to age-related osteoporosis. PMID:23705067

p53 elevation in human cells halt SV40 infection by inhibiting T-ag expression

PubMed Central

Drayman, Nir; Ben-nun-Shaul, Orly; Butin-Israeli, Veronika; Srivastava, Rohit; Rubinstein, Ariel M.; Mock, Caroline S.; Elyada, Ela; Ben-Neriah, Yinon; Lahav, Galit; Oppenheim, Ariella

2016-01-01

SV40 large T-antigen (T-ag) has been known for decades to inactivate the tumor suppressor p53 by sequestration and additional mechanisms. Our present study revealed that the struggle between p53 and T-ag begins very early in the infection cycle. We found that p53 is activated early after SV40 infection and defends the host against the infection. Using live cell imaging and single cell analyses we found that p53 dynamics are variable among individual cells, with only a subset of cells activating p53 immediately after SV40 infection. This cell-to-cell variabilty had clear consequences on the outcome of the infection. None of the cells with elevated p53 at the beginning of the infection proceeded to express T-ag, suggesting a p53-dependent decision between abortive and productive infection. In addition, we show that artificial elevation of p53 levels prior to the infection reduces infection efficiency, supporting a role for p53 in defending against SV40. We further found that the p53-mediated host defense mechanism against SV40 is not facilitated by apoptosis nor via interferon-stimulated genes. Instead p53 binds to the viral DNA at the T-ag promoter region, prevents its transcriptional activation by Sp1, and halts the progress of the infection. These findings shed new light on the long studied struggle between SV40 T-ag and p53, as developed during virus-host coevolution. Our studies indicate that the fate of SV40 infection is determined as soon as the viral DNA enters the nucleus, before the onset of viral gene expression. PMID:27462916

Mutation at p53 serine 389 does not rescue the embryonic lethality in mdm2 or mdm4 null mice.

PubMed

Iwakuma, Tomoo; Parant, John M; Fasulo, Mark; Zwart, Edwin; Jacks, Tyler; de Vries, Annemieke; Lozano, Guillermina

2004-10-07

Mdm2 and its homolog Mdm4 inhibit the function of the tumor suppressor p53. Targeted disruption of either mdm2 or mdm4 genes in mice results in embryonic lethality that is completely rescued by concomitant deletion of p53, suggesting that deletion of negative regulators of p53 results in a constitutively active p53. Thus, these mouse models offer a unique in vivo system to assay the functional significance of different p53 modifications. Phosphorylation of serine 389 in murine p53 occurs specifically after ultraviolet-light-induced DNA damage, and phosphorylation of this site enhances p53 activity both in vitro and in vivo. Recently, mice with a serine to alanine substitution at serine 389 (p53S389A) in the endogenous p53 locus were generated. To examine the in vivo significance of serine 389 phosphorylation during embryogenesis, we crossed these mutant mice to mice lacking mdm2 or mdm4. The p53S389A allele did not alter the embryonic lethality of mdm2 or mdm4. Additional crosses to assay the effect of one p53S389A allele with a p53 null allele also did not rescue the lethal phenotypes. In conclusion, the phenotypes due to loss of mdm2 or mdm4 were not even partially rescued by p53S389A, suggesting that p53S389A is functionally wild type during embryogenesis.

Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

PubMed Central

Meng, X; Carlson, NR; Dong, J; Zhang, Y

2016-01-01

The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 are non-redundant pathways possessing similar capabilities to activate p53 upon c-Myc overexpression. PMID:25823025

Methionine sulfoxide reductase A regulates cell growth through the p53-p21 pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Seung Hee; Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr

2011-12-09

Highlights: Black-Right-Pointing-Pointer Down-regulation of MsrA inhibits normal cell proliferation. Black-Right-Pointing-Pointer MsrA deficiency leads to an increase in p21 by enhanced p53 acetylation. Black-Right-Pointing-Pointer Down-regulation of MsrA causes cell cycle arrest at the G{sub 2}/M stage. Black-Right-Pointing-Pointer MsrA is a regulator of cell growth that mediates the p53-p21 pathway. -- Abstract: MsrA is an oxidoreductase that catalyzes the stereospecific reduction of methionine-S-sulfoxide to methionine. Although MsrA is well-characterized as an antioxidant and has been implicated in the aging process and cellular senescence, its roles in cell proliferation are poorly understood. Here, we report a critical role of MsrA in normal cellmore » proliferation and describe the regulation mechanism of cell growth by this protein. Down-regulation of MsrA inhibited cell proliferation, but MsrA overexpression did not promote it. MsrA deficiency led to an increase in p21, a major cyclin-dependent kinase inhibitor, thereby causing cell cycle arrest at the G{sub 2}/M stage. While protein levels of p53 were not altered upon MsrA deficiency, its acetylation level was significantly elevated, which subsequently activated p21 transcription. The data suggest that MsrA is a regulator of cell growth that mediates the p53-p21 pathway.« less

Strategy to enhance efficacy of doxorubicin in solid tumor cells by methyl-β-cyclodextrin: Involvement of p53 and Fas receptor ligand complex

PubMed Central

Mohammad, Naoshad; Vikram Singh, Shivendra; Malvi, Parmanand; Chaube, Balkrishna; Athavale, Dipti; Vanuopadath, Muralidharan; Nair, Sudarslal Sadasivan; Nair, Bipin; Bhat, Manoj Kumar

2015-01-01

Doxorubicin (DOX) is one of the preferred drugs for treating breast and liver cancers. However, its clinical application is limited due to severe side effects and the accompanying drug resistance. In this context, we investigated the effect on therapeutic efficacy of DOX by cholesterol depleting agent methyl-β-cyclodextrin (MCD), and explored the involvement of p53. MCD sensitizes MCF-7 and Hepa1–6 cells to DOX, Combination of MCD and marginal dose of DOX reduces the cell viability, and promoted apoptosis through induction of pro-apoptotic protein, Bax, activation of caspase-8 and caspase-7, down regulation of anti-apoptotic protein Bcl-2 and finally promoting PARP cleavage. Mechanistically, sensitization to DOX by MCD was due to the induction of FasR/FasL pathway through p53 activation. Furthermore, inhibition of p53 by pharmacological inhibitor pifithrin-α (PFT-α) or its specific siRNA attenuated p53 function and down-regulated FasR/FasL, thereby preventing cell death. Animal experiments were performed using C57BL/6J mouse isografted with Hepa1–6 cells. Tumor growth was retarded and survival increased in mice administered MCD together with DOX to as compared to either agent alone. Collectively, these results suggest that MCD enhances the sensitivity to DOX for which wild type p53 is an important determinant. PMID:26149967

Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

PubMed Central

Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

2011-01-01

The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

Decreasing CNPY2 Expression Diminishes Colorectal Tumor Growth and Development through Activation of p53 Pathway.

PubMed

Yan, Ping; Gong, Hui; Zhai, Xiaoyan; Feng, Yi; Wu, Jun; He, Sheng; Guo, Jian; Wang, Xiaoxia; Guo, Rui; Xie, Jun; Li, Ren-Ke

2016-04-01

Neovascularization drives tumor development, and angiogenic factors are important neovascularization initiators. We recently identified the secreted angiogenic factor CNPY2, but its involvement in cancer has not been explored. Herein, we investigate CNPY2's role in human colorectal cancer (CRC) development. Tumor samples were obtained from CRC patients undergoing surgery. Canopy 2 (CNPY2) expression was analyzed in tumor and adjacent normal tissue. Stable lines of human HCT116 cells expressing CNPY2 shRNA or control shRNA were established. To determine CNPY2's effects on tumor xenografts in vivo, human CNPY2 shRNA HCT116 cells and controls were injected into nude mice, separately. Cellular apoptosis, growth, and angiogenesis in the xenografts were evaluated. CNPY2 expression was significantly higher in CRC tissues. CNPY2 knockdown in HCT116 cells inhibited growth and migration and promoted apoptosis. In xenografts, CNPY2 knockdown prevented tumor growth and angiogenesis and promoted apoptosis. Knockdown of CNPY2 in the HCT116 CRC cell line reversibly increased p53 activity. The p53 activation increased cyclin-dependent kinase inhibitor p21 and decreased cyclin-dependent kinase 2, thereby inhibiting tumor cell growth, inducing cell apoptosis, and reducing angiogenesis both in vitro and in vivo. CNPY2 may play a critical role in CRC development by enhancing cell proliferation, migration, and angiogenesis and by inhibiting apoptosis through negative regulation of the p53 pathway. Therefore, CNPY2 may represent a novel CRC therapeutic target and prognostic indicator. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

RNA content in the nucleolus alters p53 acetylation via MYBBP1A

PubMed Central

Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn

2011-01-01

A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53–p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583

NiO nanoparticles induce apoptosis through repressing SIRT1 in human bronchial epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duan, Wei-Xia; He, Min-Di; Mao, Lin

2015-07-15

With application of nano-sized nickel-containing particles (Nano-Ni) expanding, the health concerns about their adverse effects on the pulmonary system are increasing. However, the mechanisms for the pulmonary toxicity of these materials remain unclear. In the present study, we focused on the impacts of NiO nanoparticles (NiONPs) on sirtuin1 (SIRT1), a NAD-dependent deacetylase, and investigated whether SIRT1 was involved in NiONPs-induced apoptosis. Although the NiONPs tended to agglomerate in fluid medium, they still entered into the human bronchial epithelial cells (BEAS-2B) and released Ni{sup 2+} inside the cells. NiONPs at doses of 5, 10, and 20 μg/cm{sup 2} inhibited the cellmore » viability. NiONPs' produced cytotoxicity was demonstrated through an apoptotic process, indicated by increased numbers of Annexin V positive cells and caspase-3 activation. The expression of SIRT1 was markedly down-regulated by the NiONPs, accompanied by the hyperacetylation of p53 (tumor protein 53) and overexpression of Bax (Bcl-2-associated X protein). However, overexpression of SIRT1 through resveratrol treatment or transfection clearly attenuated the NiONPs-induced apoptosis and activation of p53 and Bax. Our results suggest that the repression of SIRT1 may underlie the NiONPs-induced apoptosis via p53 hyperacetylation and subsequent Bax activation. Because SIRT1 participates in multiple biologic processes by deacetylation of dozens of substrates, this knowledge of the impact of NiONPs on SIRT1 may lead to an improved understanding of the toxic mechanisms of Nano-Ni and provide a molecular target to antagonize Nano-Ni toxicity. - Highlights: • NiONPs were taken up by BEAS-2B cells and released Ni{sup 2+}. • NiONPs produced cytotoxicity was demonstrated through an apoptotic process. • NiONPs repressed SIRT1 expression and activated p53 and Bax. • Overexpression of SIRT1 attenuated NiONPs-induced apoptosis via deacetylation p53.« less

Immunohistochemical detection of p53 protein in ameloblastoma types.

PubMed

el-Sissy, N A

1999-05-01

Overexpression of p53 protein in unicystic ameloblastoma (uAB) is denser than in the conventional ameloblastoma (cAB) type, indicating increased wild type p53--suppressing the growth potential of uAB and denoting the early event of neoplastic transformation, probably of a previous odontogenic cyst. Overexpression of p53 in borderline cAB and malignant ameloblastoma (mAB) types might reflect a mutational p53 protein playing an oncogenic role, promoting tumour growth. Overexpression of p53 protein could be a valid screening method for predicting underlying malignant genetic changes in AB types, through increased frequency of immunoreactive cells or increased staining density.

Mdm2 is required for survival of hematopoietic stem cells/progenitors via dampening of ROS-induced p53 activity

USDA-ARS?s Scientific Manuscript database

Mdm2 is an E3 ubiquitin ligase that targets p53 for degradation. p53(515C) (encoding p53R172P) is a hypomorphic allele of p53 that rescues the embryonic lethality of Mdm2(-/-) mice. Mdm2(-/-) p53(515C/515C) mice, however, die by postnatal day 13 resulting from hematopoietic failure. Hematopoietic st...

Using an international p53 mutation database as a foundation for an online laboratory in an upper level undergraduate biology class.

PubMed

Melloy, Patricia G

2015-01-01

A two-part laboratory exercise was developed to enhance classroom instruction on the significance of p53 mutations in cancer development. Students were asked to mine key information from an international database of p53 genetic changes related to cancer, the IARC TP53 database. Using this database, students designed several data mining activities to look at the changes in the p53 gene from a number of perspectives, including potential cancer-causing agents leading to particular changes and the prevalence of certain p53 variations in certain cancers. In addition, students gained a global perspective on cancer prevalence in different parts of the world. Students learned how to use the database in the first part of the exercise, and then used that knowledge to search particular cancers and cancer-causing agents of their choosing in the second part of the exercise. Students also connected the information gathered from the p53 exercise to a previous laboratory exercise looking at risk factors for cancer development. The goal of the experience was to increase student knowledge of the link between p53 genetic variation and cancer. Students also were able to walk a similar path through the website as a cancer researcher using the database to enhance bench work-based experiments with complementary large-scale database p53 variation information. © 2014 The International Union of Biochemistry and Molecular Biology.

Lipoic acid induces p53-independent cell death in colorectal cancer cells and potentiates the cytotoxicity of 5-fluorouracil.

PubMed

Dörsam, Bastian; Göder, Anja; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg

2015-10-01

Alpha-lipoic acid (LA), which plays a pivotal role in mitochondrial energy metabolism, is an endogenous dithiol compound with an array of antioxidative functions. It has been shown that LA triggers cell death in tumor cell lines, whereas non-transformed cells are hardly affected. In the present study, we analyzed the cytotoxicity of LA on colorectal cancer (CRC) cells differing in their p53 status and investigated a putative synergistic effect with the anticancer drug 5-fluorouracil (5-FU). We show that LA induces a dose-dependent decrease in cell viability, which was independent of the p53 status as attested in isogenic p53-proficient and p53-deficient cell lines. This effect was largely attributable to cell death induction as revealed by Annexin-V/PI staining. LA-treated HCT116 cells underwent caspase-dependent and caspase-independent cell death, which was blocked by the pan-caspase inhibitor zVAD and the RIP-kinase inhibitor Necrostatin-1, respectively. In CaCO-2 and HT29 cells, LA induced caspase-dependent cell demise via activation of caspase-9, caspase-3 and caspase-7 with subsequent PARP-1 cleavage as demonstrated by immunoblot analysis, activity assays and pan-caspase inhibition. Interestingly, LA treatment did neither activate p53 nor induced genotoxic effects as shown by lack of DNA strand breaks and phosphorylation of histone 2AX. Finally, we provide evidence that LA increases the cytotoxic effect induced by the anticancer drug 5-FU as revealed by significantly enhanced cell death rates in HCT116 and CaCO-2 cells. Collectively, these findings demonstrate that LA induces CRC cell death independent of their p53 status and potentiates the cytotoxicity of 5-FU without causing DNA damage on its own, which makes it a candidate for tumor therapy.

Growth hormone is a cellular senescence target in pituitary and nonpituitary cells

PubMed Central

Chesnokova, Vera; Zhou, Cuiqi; Ben-Shlomo, Anat; Zonis, Svetlana; Tani, Yuji; Ren, Song-Guang; Melmed, Shlomo

2013-01-01

Premature proliferative arrest in benign or early-stage tumors induced by oncoproteins, chromosomal instability, or DNA damage is associated with p53/p21 activation, culminating in either senescence or apoptosis, depending on cell context. Growth hormone (GH) elicits direct peripheral metabolic actions as well as growth effects mediated by insulin-like growth factor 1 (IGF1). Locally produced peripheral tissue GH, in contrast to circulating pituitary-derived endocrine GH, has been proposed to be both proapoptotic and prooncogenic. Pituitary adenomas expressing and secreting GH are invariably benign and exhibit DNA damage and a senescent phenotype. We therefore tested effects of nutlin-induced p53-mediated senescence in rat and human pituitary cells. We show that DNA damage senescence induced by nutlin triggers the p53/p21 senescent pathway, with subsequent marked induction of intracellular pituitary GH in vitro. In contrast, GH is not induced in cells devoid of p53. Furthermore we show that p53 binds specific GH promoter motifs and enhances GH transcription and secretion in senescent pituitary adenoma cells and also in nonpituitary (human breast and colon) cells. In vivo, treatment with nutlin results in up-regulation of both p53 and GH in the pituitary gland, as well as increased GH expression in nonpituitary tissues (lung and liver). Intracrine GH acts in pituitary cells as an apoptosis switch for p53-mediated senescence, likely protecting the pituitary adenoma from progression to malignancy. Unlike in the pituitary, in nonpituitary cells GH exerts antiapoptotic properties. Thus, the results show that GH is a direct p53 transcriptional target and fulfills criteria as a p53 target gene. Induced GH is a readily measurable cell marker for p53-mediated cellular senescence. PMID:23940366

Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

PubMed

Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

2018-05-23

TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

PubMed

Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

2015-03-01

The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

Effects of high-orbit spaceflight on signaling cascades and apoptosis in immune cells from mice flied on board the BION-M1 satellite

NASA Astrophysics Data System (ADS)

Novoselova, Elena; Shenkman, Boris; Lunin, Sergey; Parfenyuk, Svetlana; Novoselova, Tatyana; Fesenko, Eugeny

The study was designed to evaluate immune cell activity in male C57bl mice after a 30-day high-orbit spaceflight (550 km, higher than conventional manned spaceflights) on board the BION-M1 satellite (Roskosmos Program, Russia). For the present study, thymus, spleens and plasma samples were collected from mice 12 h after landing and, additionally, 7 days subsequently. Assessing the activity of NF-kappaB signaling cascade by measuring Rel A (p65) protein phosphorylation in splenic lymphocytes, we showed that the NF-kappaB activity was significantly increased at 12 h after landing. Contrariwise, one week after landing, the NF-kappaB activity was markedly decreased, even below to the control values. Interestingly, after landing there were no significant changes in SAPK/JNK cascade activity in splenic lymphocytes as well as in the expression of transcription factor IRF3 in thymus cells. To assess the apoptosis status in thymus lymphocytes, levels of p53 protein and its phosphorylated form were measured in thymic lymphocytes. It is known that p53 plays an important role in the cellular response to DNA damage, genomic aberrations, and other characteristic of apoptosis. The results showed that the high-orbit spaceflight environment caused some increase in level of p53 protein, but most notably, activated phosphorylated form of p53 protein. Calculated ratio of active and inactive forms of the protein (ph-p53/p53) 12 h after landing increased by more than 2-fold, indicating the apparent induction of apoptosis in thymus cells. Interestingly, 7 days after the landing, this ratio was not restored, but rather increased: the specified ratio was 4 times higher as compared to the ground-based control. We can conclude that response to the prolonged high-orbit spaceflight is not like the classic "stress response", which is usually observed under various stressful factors. It is known that the stress response is surely accompanied by increased SAPK/JNK cascade activity as well as the expression of the IRF3; in fact, we did not observed any changes in the SAPK/JNK phosphorylation or in the IRF3 production. Furthermore, stressful factors usually result in the fast, but reversible, thymus involution. But our measurements showed that the thymus depletion at 7th day after landing was expressed even more than 12 h after the spaceflight. This is consistent with the results of the level of apoptosis in thymus cells; indeed, the apoptosis in thymus lymphocytes 7 days after was higher than 12 h after landing. Collectively, these results indicate that the changes of immune cell homeostasis may be a result of exposure to damaging factors of not very high intensity. In any case, similar effects are caused, to our knowledge, by low doses of ionizing radiation. As spaceflight is not accompanied only with the gravitational changes, but also with other factors, such as radiation, it is possible that immune disbalance after spaceflight was caused by a combined action of several factors. The work was supported by the Russian Foundation for Basic Research, project 12-04-00113-a.The authors express their gratitude to unified team involved in preparation and implementation of the spaceflight of BION-M #1.

Differential expression of microRNA501-5p affects the aggressiveness of clear cell renal carcinoma

PubMed Central

Mangolini, Alessandra; Bonon, Anna; Volinia, Stefano; Lanza, Giovanni; Gambari, Roberto; Pinton, Paolo; Russo, Gian Rosario; del Senno, Laura; Dell’Atti, Lucio; Aguiari, Gianluca

2014-01-01

Renal cell carcinoma is a common neoplasia of the adult kidney that accounts for about 3% of adult malignancies. Clear cell renal carcinoma is the most frequent subtype of kidney cancer and 20–40% of patients develop metastases. The absence of appropriate biomarkers complicates diagnosis and prognosis of this disease. In this regard, small noncoding RNAs (microRNAs), which are mutated in several neoplastic diseases including kidney carcinoma, may be optimal candidates as biomarkers for diagnosis and prognosis of this kind of cancer. Here we show that patients with clear cell kidney carcinoma that express low levels of miR501-5p exhibited a good prognosis compared with patients with unchanged or high levels of this microRNA. Consistently, in kidney carcinoma cells the downregulation of miR501-5p induced an increased caspase-3 activity, p53 expression as well as decreased mTOR activation, leading to stimulation of the apoptotic pathway. Conversely, miR501-5p upregulation enhanced the activity of mTOR and promoted both cell proliferation and survival. These biological processes occurred through p53 inactivation by proteasome degradation in a mechanism involving MDM2-mediated p53 ubiquitination. Our results support a role for miR501-5p in balancing apoptosis and cell survival in clear cell renal carcinoma. In particular, the downregulation of microRNA501-5p promotes a good prognosis, while its upregulation contributes to a poor prognosis, in particular, if associated with p53 and MDM2 overexpression and mTOR activation. Thus, the expression of miR501-5p is a possible biomarker for the prognosis of clear cell renal carcinoma. PMID:25426415

Prognostic and predictive value of TP53 mutations in node-positive breast cancer patients treated with anthracycline- or anthracycline/taxane-based adjuvant therapy: results from the BIG 02-98 phase III trial

PubMed Central

2012-01-01

Abstract Introduction Pre-clinical data suggest p53-dependent anthracycline-induced apoptosis and p53-independent taxane activity. However, dedicated clinical research has not defined a predictive role for TP53 gene mutations. The aim of the current study was to retrospectively explore the prognosis and predictive values of TP53 somatic mutations in the BIG 02-98 randomized phase III trial in which women with node-positive breast cancer were treated with adjuvant doxorubicin-based chemotherapy with or without docetaxel. Methods The prognostic and predictive values of TP53 were analyzed in tumor samples by gene sequencing within exons 5 to 8. Patients were classified according to p53 protein status predicted from TP53 gene sequence, as wild-type (no TP53 variation or TP53 variations which are predicted not to modify p53 protein sequence) or mutant (p53 nonsynonymous mutations). Mutations were subcategorized according to missense or truncating mutations. Survival analyses were performed using the Kaplan-Meier method and log-rank test. Cox-regression analysis was used to identify independent predictors of outcome. Results TP53 gene status was determined for 18% (520 of 2887) of the women enrolled in BIG 02-98. TP53 gene variations were found in 17% (90 of 520). Nonsynonymous p53 mutations, found in 16.3% (85 of 520), were associated with older age, ductal morphology, higher grade and hormone-receptor negativity. Of the nonsynonymous mutations, 12.3% (64 of 520) were missense and 3.6% were truncating (19 of 520). Only truncating mutations showed significant independent prognostic value, with an increased recurrence risk compared to patients with non-modified p53 protein (hazard ratio = 3.21, 95% confidence interval = 1.740 to 5.935, P = 0.0002). p53 status had no significant predictive value for response to docetaxel. Conclusions p53 truncating mutations were uncommon but associated with poor prognosis. No significant predictive role for p53 status was detected. Trial registration ClinicalTrials.gov NCT00174655 PMID:22551440

Loss of p21{sup Sdi1} expression in senescent cells after DNA damage accompanied with increase of miR-93 expression and reduced p53 interaction with p21{sup Sdi1} gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choi, Ok Ran; Lim, In Kyoung, E-mail: iklim@ajou.ac.kr

2011-04-08

Highlights: {yields} Reduced p21 expression in senescent cells treated with DNA damaging agents. {yields} Increase of [{sup 3}H]thymidine and BrdU incorporations in DNA damaged-senescent cells. {yields} Upregulation of miR-93 expression in senescent cells in response to DSB. {yields} Failure of p53 binding to p21 promoter in senescent cells in response to DSB. {yields} Molecular mechanism of increased cancer development in aged than young individuals. -- Abstract: To answer what is a critical event for higher incidence of tumor development in old than young individuals, primary culture of human diploid fibroblasts were employed and DNA damage was induced by doxorubicin ormore » X-ray irradiation. Response to the damage was different between young and old cells; loss of p21{sup sdi1} expression in spite of p53{sup S15} activation in old cells along with [{sup 3}H]thymidine and BrdU incorporation, but not in young cells. The phenomenon was confirmed by other tissue fibroblasts obtained from different donor ages. Induction of miR-93 expression and reduced p53 binding to p21 gene promoter account for loss of p21{sup sdi1} expression in senescent cells after DNA damage, suggesting a mechanism of in vivo carcinogenesis in aged tissue without repair arrest.« less

Pokemon enhances proliferation, cell cycle progression and anti-apoptosis activity of colorectal cancer independently of p14ARF-MDM2-p53 pathway.

PubMed

Zhao, Yi; Yao, Yun-hong; Li, Li; An, Wei-fang; Chen, Hong-zen; Sun, Li-ping; Kang, Hai-xian; Wang, Sen; Hu, Xin-rong

2014-12-01

Pokemon has been showed to directly suppress p14(ARF) expression and also to overexpress in multiple cancers. However, p14(ARF)-MDM2-p53 pathway is usually aberrant in colorectal cancer (CRC). The aim is to confirm whether Pokemon plays a role in CRC and explore whether Pokemon works through p14(ARF)-MDM2-p53 pathway in CRC. Immunohistochemistry for Pokemon, p14(ARF) and Mtp53 protein was applied to 45 colorectal epitheliums (CREs), 42 colorectal adenomas (CRAs) and 66 CRCs. Pokemon was knocked down with RNAi technique in CRC cell line Lovo to detect mRNA expression of p14(ARF) with qRT-PCR, cell proliferation with CCK8 assay, and cell cycle and apoptosis with flowcytometry analysis. The protein expression rates were significantly higher in CRC (75.8%) than in CRE (22.2 %) or CRA (38.1%) for Pokemon and higher in CRC (53.0%) than in CRE (0) or CRA (4.8%) for Mtp53, but not significantly different in CRC (86.4 %) versus CRE (93.3%) or CRA (90.5 %) for p14(ARF). Higher expression rate of Pokemon was associated with lymph node metastasis and higher Duke's stage. After knockdown of Pokemon in Lovo cells, the mRNA level of p14(ARF) was not significantly changed, the cell proliferation ability was decreased by 20.6%, cell cycle was arrested by 55.7% in G0/G1 phase, and apoptosis rate was increased by 19.0%. Pokemon enhanced the oncogenesis of CRC by promoting proliferation, cell cycle progression and anti-apoptosis activity of CRC cells independently of p14(ARF)-MDM2-p53 pathway. This finding provided a novel idea for understanding and further studying the molecular mechanism of Pokemon on carcinogenesis of CRC.

p53 coordinates decidual sestrin 2/AMPK/mTORC1 signaling to govern parturition timing.

PubMed

Deng, Wenbo; Cha, Jeeyeon; Yuan, Jia; Haraguchi, Hirofumi; Bartos, Amanda; Leishman, Emma; Viollet, Benoit; Bradshaw, Heather B; Hirota, Yasushi; Dey, Sudhansu K

2016-08-01

Inflammation and oxidative stress are known risk factors for preterm birth (PTB); however, the mechanisms and pathways that influence this condition are not fully described. Previously, we showed that mTORC1 signaling is increased in mice harboring a uterine-specific deletion of transformation-related protein 53 (p53d/d mice), which exhibit premature decidual senescence that triggers spontaneous and inflammation-induced PTB. Treatment with the mTORC1 inhibitor rapamycin reduced the incidence of PTB in the p53d/d mice. Decidual senescence with heightened mTORC1 signaling is also a signature of human PTB. Here, we have identified an underlying mechanism for PTB and a potential therapeutic strategy for treating the condition. Treatment of pregnant p53d/d mice with either the antidiabetic drug metformin or the antioxidant resveratrol activated AMPK signaling and inhibited mTORC1 signaling in decidual cells. Both metformin and resveratrol protected against spontaneous and inflammation-induced PTB in p53d/d females. Using multiple approaches, we determined that p53 interacts with sestrins to coordinate an inverse relationship between AMPK and mTORC1 signaling that determines parturition timing. This signature was also observed in human decidual cells. Together, these results reveal that p53-dependent coordination of AMPK and mTORC1 signaling controls parturition timing and suggest that metformin and resveratrol have therapeutic potential to prevent PTB.

p53: traffic cop at the crossroads of DNA repair and recombination.

PubMed

Sengupta, Sagar; Harris, Curtis C

2005-01-01

p53 mutants that lack DNA-binding activities, and therefore, transcriptional activities, are among the most common mutations in human cancer. Recently, a new role for p53 has come to light, as the tumour suppressor also functions in DNA repair and recombination. In cooperation with its function in transcription, the transcription-independent roles of p53 contribute to the control and efficiency of DNA repair and recombination.

The novel tumor suppressor p33ING2 enhances UVB-induced apoptosis in human melanoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chin, M.Y.; Ng, Kin Cheung P.; Li Gang

The roles of p33ING2 as a tumor suppressor candidate have been shown through regulation of gene transcription, induction of cell cycle arrest, and apoptosis. As p33ING2 shares 58.9% homology with p33ING1b, we hypothesized that p33ING2 shares functional similarities with p33ING1b. We previously found that p33ING1b cooperates with p53 to enhance UVB-induced apoptosis. Here, we report that overexpression of p33ING2 enhanced apoptosis in UVB-irradiated and non-irradiated melanoma MMRU cells. We demonstrate that enhancement of apoptosis by p33ING2 requires the presence of functional p53. Furthermore, we found that overexpression of p33ING2 significantly downregulated the expression of Bcl-2 after UVB irradiation, resulting inmore » an increased Bax/Bcl-2 ratio. Moreover, we found that p33ING2 promoted Bax translocation to mitochondria, altered the mitochondrial membrane potential, and induced cytochrome c release and thus the activation of caspases 9 and 3. In addition, we showed that under non-stress conditions p33ING2 upregulates Fas expression and activates caspase 8. Taken together, we demonstrate that p33ING2 cooperates with p53 to regulate apoptosis via activation of both the mitochondrial/intrinsic and death-receptor/extrinsic apoptotic pathways.« less

The RNA surveillance protein SMG1 activates p53 in response to DNA double-strand breaks but not exogenously oxidized mRNA

PubMed Central

Gewandter, Jennifer S; Bambara, Robert A

2011-01-01

DNA damage, stalled replication forks, errors in mRNA splicing and availability of nutrients activate specific phosphatidylinositiol-3-kinase-like kinases (PIKKs) that in turn phosphorylate downstream targets such as p53 on serine 15. While the PIKK proteins ATM and ATR respond to specific DNA lesions, SMG1 responds to errors in mRNA splicing and when cells are exposed to genotoxic stress. Yet, whether genotoxic stress activates SMG1 through specific types of DNA lesions or RNA damage remains poorly understood. Here, we demonstrate that siRNA oligonucleotides targeting the mRNA surveillance proteins SMG1, Upf1, Upf2 or the PIKK protein ATM attenuated p53 (ser15) phosphorylation in cells damaged by high oxygen (hyperoxia), a model of persistent oxidative stress that damages nucleotides. In contrast, loss of SMG1 or ATM, but not Upf1 or Upf2 reduced p53 (ser15) phosphorylation in response to DNA double strand breaks produced by expression of the endonuclease I-PpoI. To determine whether SMG1-dependent activation of p53 was in response to oxidative mRNA damage, mRNA encoding green fluorescence protein (GFP) transcribed in vitro was oxidized by Fenton chemistry and transfected into cells. Although oxidation of GFP mRNA resulted in dose-dependent fragmentation of the mRNA and reduced expression of GFP, it did not stimulate p53 or the p53-target gene p21. These findings establish SMG1 activates p53 in response to DNA double strand breaks independent of the RNA surveillance proteins Upf1 or Upf2; however, these proteins can stimulate p53 in response to oxidative stress but not necessarily oxidized RNA. PMID:21701263

Enhancement of hypoxia-activated prodrug TH-302 anti-tumor activity by Chk1 inhibition.

PubMed

Meng, Fanying; Bhupathi, Deepthi; Sun, Jessica D; Liu, Qian; Ahluwalia, Dharmendra; Wang, Yan; Matteucci, Mark D; Hart, Charles P

2015-05-21

The hypoxia-activated prodrug TH-302 is reduced at its nitroimidazole group and selectively under hypoxic conditions releases the DNA cross-linker bromo-isophosphoramide mustard (Br-IPM). Here, we have explored the effect of Chk1 inhibition on TH-302-mediated pharmacological activities. We employed in vitro cell viability, DNA damage, cellular signaling assays and the in vivo HT29 human tumor xenograft model to study the effect of Chk1inhibition on TH-302 antitumor activities. TH-302 cytotoxicity is greatly enhanced by Chk1 inhibition in p53-deficient but not in p53-proficient human cancer cell lines. Chk1 inhibitors reduced TH-302-induced cell cycle arrest via blocking TH-302-induced decrease of phosphorylation of histone H3 and increasing Cdc2-Y15 phosphorylation. Employing the single-cell gel electrophoresis (comet) assay, we observed a potentiation of the TH-302 dependent tail moment. TH-302 induced γH2AX and apoptosis were also increased upon the addition of Chk1 inhibitor. Potentiation of TH-302 cytotoxicity by Chk1 inhibitor was only observed in cell lines proficient in, but not deficient in homology-directed DNA repair. We also show that combination treatment led to lowering of Rad51 expression levels as compared to either agent alone. In vivo data demonstrate that Chk1 inhibitor enhances TH-302 anti-tumor activity in p53 mutant HT-29 human tumor xenografts, supporting the hypothesis that these in vitro results can translate to enhanced in vivo efficacy of the combination. TH-302-mediated in vitro and in vivo anti-tumor activities were greatly enhanced by the addition of Chk1 inhibitors. The preclinical data presented in this study support a new approach for the treatment of p53-deficient hypoxic cancers by combining Chk1 inhibitors with the hypoxia-activated prodrug TH-302.

Modeling gene-environment interactions in oral cavity and esophageal cancers demonstrates a role for the p53 R72P polymorphism in modulating susceptibility.

PubMed

Sarkar, Jayanta; Dominguez, Emily; Li, Guojun; Kusewitt, Donna F; Johnson, David G

2014-08-01

A large number of epidemiological studies have linked a common single-nucleotide polymorphism (SNP) in the human p53 gene to risk for developing a variety of cancers. This SNP encodes either an arginine or proline at position 72 (R72P) of the p53 protein, which can alter the apoptotic activity of p53 via transcriptional and non-transcriptional mechanisms. This SNP has also been reported to modulate the development of human papilloma virus (HPV)-driven cancers through differential targeting of the p53 variant proteins by the E6 viral oncoprotein. Mouse models for the p53 R72P polymorphism have recently been developed but a role for this SNP in modifying cancer risk in response to viral and chemical carcinogens has yet to be established experimentally. Here, we demonstrate that the p53 R72P polymorphism modulates the hyperprolferative, apoptotic and inflammatory phenotypes caused by expression of the HPV16 E6 and E7 oncoproteins. Moreover, the R72P SNP also modifies the carcinogenic response to the chemical carcinogen 4NQO, in the presence and absence of the HPV16 transgene. Our findings confirm several human epidemiological studies associating the codon 72 proline variant with increased risk for certain cancers but also suggest that there are tissue-specific differences in how the R72P polymorphism influences the response to environmental carcinogens. © 2013 Wiley Periodicals, Inc.

Role of p53, Mitochondrial DNA Deletions, and Paternal Age in Autism: A Case-Control Study

PubMed Central

Wong, Sarah; Napoli, Eleonora; Krakowiak, Paula; Tassone, Flora; Hertz-Picciotto, Irva

2016-01-01

BACKGROUND: The tumor suppressor p53 responds to a variety of environmental stressors by regulating cell cycle arrest, apoptosis, senescence, DNA repair, bioenergetics and mitochondrial DNA (mtDNA) copy number maintenance. Developmental abnormalities have been reported in p53-deficient mice, and altered p53 and p53-associated pathways in autism (AU). Furthermore, via the Pten-p53 crosstalk, Pten haploinsufficient-mice have autisticlike behavior accompanied by brain mitochondrial dysfunction with accumulation of mtDNA deletions. METHODS: mtDNA copy number and deletions, and p53 gene copy ratios were evaluated in peripheral blood monocytic cells from children aged 2–5 years with AU (n = 66), race-, gender-, and age-matched typically neurodeveloping children (n = 46), and both parents from each diagnostic group, recruited by the Childhood Autism Risk from Genes and Environment study at the University of California, Davis. RESULTS: mtDNA deletions and higher p53 gene copy ratios were more common in children with AU and their fathers. The incidence of mtDNA deletions in fathers of children with AU was increased 1.9-fold over fathers of typically neurodeveloping children, suggesting a role for deficient DNA repair capacity not driven by paternal age. Deletions in mtDNA and altered p53 gene copy ratios seem to result from genetics (children with severity scores ≥8) and/or act in concert with environmental factors (children with 6–7 severity scores). CONCLUSIONS: Given pro- and antioxidant activities of p53, and associations of genomic instability with disorders other than AU, our study suggests a link between DNA repair capacity, genomic instability in the 17p13.1 region influenced by environmental triggers, and AU diagnosis. PMID:27033107

[6]-Gingerol Induces Cell Cycle Arrest and Cell Death of Mutant p53-expressing Pancreatic Cancer Cells

PubMed Central

Park, Yon Jung; Wen, Jing; Bang, Seungmin; Park, Seung Woo

2006-01-01

[6]-Gingerol, a major phenolic compound derived from ginger, has anti-bacterial, anti-inflammatory and anti-tumor activities. While several molecular mechanisms have been described to underlie its effects on cells in vitro and in vivo, the underlying mechanisms by which [6]-gingerol exerts anti-tumorigenic effects are largely unknown. The purpose of this study was to investigate the action of [6]-gingerol on two human pancreatic cancer cell lines, HPAC expressing wild-type (wt) p53 and BxPC-3 expressing mutated p53. We found that [6]-gingerol inhibited the cell growth through cell cycle arrest at G1 phase in both cell lines. Western blot analyses indicated that [6]-gingerol decreased both Cyclin A and Cyclin-dependent kinase (Cdk) expression. These events led to reduction in Rb phosphorylation followed by blocking of S phase entry. p53 expression was decreased by [6]-gingerol treatment in both cell lines suggesting that the induction of Cyclin-dependent kinase inhibitor, p21cip1, was p53-independent. [6]-Gingerol induced mostly apoptotic death in the mutant p53-expressing cells, while no signs of early apoptosis were detected in wild type p53-expressing cells and this was related to the increased phosphorylation of AKT. These results suggest that [6]-gingerol can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing apoptotic cell death while it exerts cytostatic effect on wild type p53-expressing cells by inducing temporal growth arrest. PMID:17066513

SMG-1 kinase attenuates mitochondrial ROS production but not cell respiration deficits during hyperoxia.

PubMed

Resseguie, Emily A; Brookes, Paul S; O'Reilly, Michael A

Supplemental oxygen (hyperoxia) used to treat individuals in respiratory distress causes cell injury by enhancing the production of toxic reactive oxygen species (ROS) and inhibiting mitochondrial respiration. The suppressor of morphogenesis of genitalia (SMG-1) kinase is activated during hyperoxia and promotes cell survival by phosphorylating the tumor suppressor p53 on serine 15. Here, we investigate whether SMG-1 and p53 blunt this vicious cycle of progressive ROS production and decline in mitochondrial respiration seen during hyperoxia. Human lung adenocarcinoma A549 and H1299 or colon carcinoma HCT116 cells were depleted of SMG-1, UPF-1, or p53 using RNA interference, and then exposed to room air (21% oxygen) or hyperoxia (95% oxygen). Immunoblotting was used to evaluate protein expression; a Seahorse Bioanalyzer was used to assess cellular respiration; and flow cytometry was used to evaluate fluorescence intensity of cells stained with mitochondrial or redox sensitive dyes. Hyperoxia increased mitochondrial and cytoplasmic ROS and suppressed mitochondrial respiration without changing mitochondrial mass or membrane potential. Depletion of SMG-1 or its cofactor, UPF1, significantly enhanced hyperoxia-induced mitochondrial but not cytosolic ROS abundance. They did not affect mitochondrial mass, membrane potential, or hyperoxia-induced deficits in mitochondrial respiration. Genetic depletion of p53 in A549 cells and ablation of the p53 gene in H1299 or HCT116 cells revealed that SMG-1 influences mitochondrial ROS through activation of p53. Our findings show that hyperoxia does not promote a vicious cycle of progressive mitochondrial ROS and dysfunction because SMG-1-p53 signaling attenuates production of mitochondrial ROS without preserving respiration. This suggests antioxidant therapies that blunt ROS production during hyperoxia may not suffice to restore cellular respiration.

Brain Tumor Genetic Modification Yields Increased Resistance to Paclitaxel in Physical Confinement

PubMed Central

Bui, Loan; Hendricks, Alissa; Wright, Jamie; Chuong, Cheng-Jen; Davé, Digant; Bachoo, Robert; Kim, Young-tae

2016-01-01

Brain tumor cells remain highly resistant to radiation and chemotherapy, particularly malignant and secondary cancers. In this study, we utilized microchannel devices to examine the effect of a confined environment on the viability and drug resistance of the following brain cancer cell lines: primary cancers (glioblastoma multiforme and neuroblastoma), human brain cancer cell lines (D54 and D54-EGFRvIII), and genetically modified mouse astrocytes (wild type, p53−/−, p53−/− PTEN−/−, p53−/− Braf, and p53−/− PTEN−/− Braf). We found that loss of PTEN combined with Braf activation resulted in higher viability in narrow microchannels. In addition, Braf conferred increased resistance to the microtubule-stabilizing drug Taxol in narrow confinement. Similarly, survival of D54-EGFRvIII cells was unaffected following treatment with Taxol, whereas the viability of D54 cells was reduced by 75% under these conditions. Taken together, our data suggests key targets for anticancer drugs based on cellular genotypes and their specific survival phenotypes during confined migration. PMID:27184621

Dihydroptychantol A, a macrocyclic bisbibenzyl derivative, induces autophagy and following apoptosis associated with p53 pathway in human osteosarcoma U2OS cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Xia; School of Ocean, Shandong University, Weihai 264209; Wu, William K.K.

2011-03-01

Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G{sub 2}/M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine,more » suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21{sup Waf1/Cip1}. In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B{sub 1}, a cyclin required for progression through the G{sub 2}/M phase. Taken together, DHA induces G{sub 2}/M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.« less

Flavonoids and Tannins from Smilax china L. Rhizome Induce Apoptosis Via Mitochondrial Pathway and MDM2-p53 Signaling in Human Lung Adenocarcinoma Cells.

PubMed

Fu, San; Yang, Yanfang; Liu, Dan; Luo, Yan; Ye, Xiaochuan; Liu, Yanwen; Chen, Xin; Wang, Song; Wu, Hezhen; Wang, Yuhang; Hu, Qiwei; You, Pengtao

2017-01-01

In vitro evidence indicates that Smilax china L. rhizome (SCR) can inhibit cell proliferation. Therefore, in the present study, we analyzed the effects in vitro of SCR extracts on human lung adenocarcinoma A549 cells. Our results showed that A549 cell growth was inhibited in a dose- and time-dependent manner after treatment with SCR extracts. Total flavonoids and total tannins from SCR induced A549 apoptosis in a dose-dependent manner, as shown by our flow cytometry analysis, which was consistent with the alterations in nuclear morphology we observed. In addition, the total apoptotic rate induced by total tannins was higher than the rate induced by total flavonoids at the same dose. Cleaved-caspase-3 protein levels in A549 cells after treatment with total flavonoids or total tannins were increased in a dose-dependent manner, followed by the activation of caspase-8 and caspase-9, finally triggering to PARP cleavage. Furthermore, total flavonoids and total tannins increased the expression of Bax, decreased the expression of Bcl-2, and promoted cytochrome [Formula: see text] release. Moreover, MDM2 and p-MDM2 proteins were decreased, while p53 and p-p53 proteins were increased, both in a dose-dependent manner, after A549 treatment with total flavonoids and total tannins. Finally, cleaved-caspase-3 protein levels in the total flavonoids or total tannins-treated H1299 (p53 null) and p53-knockdown A549 cells were increased. Our results indicated that total flavonoids and total tannins from SCR exerted a remarkable effect in reducing A549 growth through their action on mitochondrial pathway and disruption of MDM2-p53 balance. Hence, our findings demonstrated a potential application of total flavonoids and total tannins from SCR in the treatment of human lung adenocarcinoma.

53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

PubMed

Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

2016-07-02

Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

PubMed

Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

2010-11-01

Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

Hydroquinone induces TK6 cell growth arrest and apoptosis through PARP-1/p53 regulatory pathway.

PubMed

Luo, Hao; Liang, Hairong; Chen, Jiajia; Xu, Yongchun; Chen, Yuting; Xu, Longmei; Yun, Lin; Liu, Jiaxian; Yang, Hui; Liu, Linhua; Peng, Jianming; Liu, Zhidong; Tang, Lin; Chen, Wen; Tang, Huanwen

2017-09-01

Hydroquinone (HQ), one of the most important metabolites derived from benzene, induces cell cycle arrest and apoptosis. Poly(ADP-ribose) polymerase-1 (PARP-1) participates in various biological processes, including DNA repair and cell cycle regulation. To explore whether PARP-1 regulatory pathway mediated HQ-induced cell cycle arrest and apoptosis, we assessed the effect of PARP-1 suppression on induction of apoptosis analyzed by FACSCalibur flow cytometer in PARP-1 deficientTK6 cells (TK6-shPARP-1). We observed an increase in the fraction of cells in G1 phase by 7.6% and increased apoptosis by 4.5% in PARP-1-deficient TK6 cells (TK6-shPARP-1) compared to those negative control cells (TK6-shNC cells) in response to HQ treatment. Furthermore, HQ might activate the extrinsic pathways of apoptosis via up-regulation of Fas expression, followed by caspase-3 activation, apoptotic body, and sub G1 accumulation. Enhanced p53 expression was observed in TK6-shPARP-1 cells than in TK6-shNC cells after HQ treatment. In contrast, Fas expression was lower in TK6-shPARP-1 cells than in TK6-shNC cells. Therefore, we conclude that HQ may activate apoptotic signals via Fas up-regulation and p53-mediated apoptosis in TK6-shNC cells. The reduction of PARP-1 expression further intensified up-regulation of p53 in TK6-shPARP-1 cells, resulting in an increased G1→S phase cell arrest and apoptosis in TK6-shPARP-1 cells compared to TK6-shNC cells. © 2017 Wiley Periodicals, Inc.

Nogo-B receptor promotes the chemoresistance of human hepatocellular carcinoma via the ubiquitination of p53 protein

PubMed Central

Long, Fei; Liu, Ying; Liu, Zhenzhen; Li, Song; Yang, Xuejun; Sun, Deguang; Wang, Haibo; Liu, Qinlong; Liang, Rui; Li, Yan; Gao, Zhenming; Shao, Shujuan; Miao, Qing Robert; Wang, Liming

2016-01-01

Nogo-B receptor (NgBR), a type I single transmembrane domain receptor is the specific receptor for Nogo-B. Our previous work demonstrated that NgBR is highly expressed in breast cancer cells, where it promotes epithelial mesenchymal transition (EMT), an important step in metastasis. Here, we show that both in vitro and in vivo increased expression of NgBR contributes to the increased chemoresistance of Bel7402/5FU cells, a stable 5-FU (5-Fluorouracil) resistant cell line related Bel7402 cells. NgBR knockdown abrogates S-phase arrest in Bel7402/5FU cells, which correlates with a reduction in G1/S phase checkpoint proteins p53 and p21. In addition, NgBR suppresses p53 protein levels through activation of the PI3K/Akt/MDM2 pathway, which promotes p53 degradation via the ubiquitin proteasome pathway and thus increases the resistance of human hepatocellular cancer cells to 5-FU. Furthermore, we found that NgBR expression is associated with a poor prognosis of human hepatocellular carcinoma (HCC) patients. These results suggest that targeting NgBR in combination with chemotherapeutic drugs, such as 5-FU, could improve the efficacy of current anticancer treatments. PMID:26840457

Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells

PubMed Central

2011-01-01

Background Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. Results We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. Conclusions we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our data suggest the importance of caspase-8-mediated positive feedback amplification in the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. PMID:21801448

Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells.

PubMed

Liu, Juan; Uematsu, Hiroshi; Tsuchida, Nobuo; Ikeda, Masa-Aki

2011-07-31

Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our data suggest the importance of caspase-8-mediated positive feedback amplification in the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells.

Progesterone facilitates chromosome instability (aneuploidy) in p53 null normal mammary epithelial cells

NASA Technical Reports Server (NTRS)

Goepfert, T. M.; McCarthy, M.; Kittrell, F. S.; Stephens, C.; Ullrich, R. L.; Brinkley, B. R.; Medina, D.

2000-01-01

Mammary epithelial cells from p53 null mice have been shown recently to exhibit an increased risk for tumor development. Hormonal stimulation markedly increased tumor development in p53 null mammary cells. Here we demonstrate that mammary tumors arising in p53 null mammary cells are highly aneuploid, with greater than 70% of the tumor cells containing altered chromosome number and a mean chromosome number of 56. Normal mammary cells of p53 null genotype and aged less than 14 wk do not exhibit aneuploidy in primary cell culture. Significantly, the hormone progesterone, but not estrogen, increases the incidence of aneuploidy in morphologically normal p53 null mammary epithelial cells. Such cells exhibited 40% aneuploidy and a mean chromosome number of 54. The increase in aneuploidy measured in p53 null tumor cells or hormonally stimulated normal p53 null cells was not accompanied by centrosome amplification. These results suggest that normal levels of progesterone can facilitate chromosomal instability in the absence of the tumor suppressor gene, p53. The results support the emerging hypothesis based both on human epidemiological and animal model studies that progesterone markedly enhances mammary tumorigenesis.

Zn(II)-curc targets p53 in thyroid cancer cells.

PubMed

Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

2015-10-01

TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach

DTIC Science & Technology

2006-01-01

B) Cells were transfected with 1 mg of the indicated luciferase reporter constructs and 50 ng of pRL- Renilla . 24 hrs post transfections p53 was...induced by removal of tetracyline. Cells were lysed and assayed for luciferase and Renilla activities 24 hrs after induction of p53. The indicated

Telomeres and Mitochondria in the Aging Heart

PubMed Central

Moslehi, Javid; DePinho, Ronald A.; Sahin, Ergün

2013-01-01

Studies in humans and in mice have highlighted the importance of short telomeres and impaired mitochondrial function in driving age-related functional decline in the heart. Although telomere and mitochondrial dysfunction have been viewed mainly in isolation, recent studies in telomerase-deficient mice have provided evidence for an intimate link between these two processes. Telomere dysfunction induces a profound p53-dependent repression of the master regulators of mitochondrial biogenesis and function, peroxisome proliferator-activated receptor gamma coactivator (PGC)-1α and PGC-1β in the heart, which leads to bioenergetic compromise due to impaired oxidative phosphorylation and ATP generation. This telomere-p53-PGC mitochondrial/metabolic axis integrates many factors linked to heart aging including increased DNA damage, p53 activation, mitochondrial, and metabolic dysfunction and provides a molecular basis of how dysfunctional telomeres can compromise cardiomyocytes and stem cell compartments in the heart to precipitate cardiac aging. PMID:22539756

The expanding regulatory universe of p53 in gastrointestinal cancer.

PubMed

Fesler, Andrew; Zhang, Ning; Ju, Jingfang

2016-01-01

Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

PubMed Central

Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

2018-01-01

Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

Integrated High Throughput Analysis Identifies GSK3 as a Crucial Determinant of p53-Mediated Apoptosis in Lung Cancer Cells.

PubMed

Zhang, Yu; Zhu, Chenyang; Sun, Bangyao; Lv, Jiawei; Liu, Zhonghua; Liu, Shengwang; Li, Hai

2017-01-01

p53 dysfunction is frequently observed in lung cancer. Although restoring the tumour suppressor function of p53 is recently approved as a putative strategy for combating cancers, the lack of understanding of the molecular mechanism underlying p53-mediated lung cancer suppression has limited the application of p53-based therapies in lung cancer. Using RNA sequencing, we determined the transcriptional profile of human non-small cell lung carcinoma A549 cells after treatment with two p53-activating chemical compounds, nutlin and RITA, which could induce A549 cell cycle arrest and apoptosis, respectively. Bioinformatics analysis of genome-wide gene expression data showed that distinct transcription profiles were induced by nutlin and RITA and 66 pathways were differentially regulated by these two compounds. However, only two of these pathways, 'Adherens junction' and 'Axon guidance', were found to be synthetic lethal with p53 re-activation, as determined via integrated analysis of genome-wide gene expression profile and short hairpin RNA (shRNA) screening. Further functional protein association analysis of significantly regulated genes associated with these two synthetic lethal pathways indicated that GSK3 played a key role in p53-mediated A549 cell apoptosis, and then gene function study was performed, which revealed that GSK3 inhibition promoted p53-mediated A549 cell apoptosis in a p53 post-translational activity-dependent manner. Our findings provide us with new insights regarding the mechanism by which p53 mediates A549 apoptosis and may cast light on the development of more efficient p53-based strategies for treating lung cancer. © 201 The Author(s). Published by S. Karger AG, Basel.

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Fuming; Saha, Abhik; Murakami, Masanao

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

The antiproliferative effect of Moringa oleifera crude aqueous leaf extract on cancerous human alveolar epithelial cells

PubMed Central

2013-01-01

Background The incidence of lung cancer is expected to increase due to increases in exposure to airborne pollutants and cigarette smoke. Moringa oleifera (MO), a medicinal plant found mainly in Asia and South Africa is used in the traditional treatment of various ailments including cancer. This study investigated the antiproliferative effect of MO leaf extract (MOE) in cancerous A549 lung cells. Methods A crude aqueous leaf extract was prepared and the cells were treated with 166.7 μg/ml MOE (IC50) for 24 h and assayed for oxidative stress (TBARS and Glutathione assays), DNA fragmentation (comet assay) and caspase (3/7 and 9) activity. In addition, the expression of Nrf2, p53, Smac/DIABLO and PARP-1 was determined by Western blotting. The mRNA expression of Nrf2 and p53 was assessed using qPCR. Results A significant increase in reactive oxygen species with a concomitant decrease in intracellular glutathione levels (p < 0.001) in MOE treated A549 cells was observed. MOE showed a significant reduction in Nrf2 protein expression (1.89-fold, p < 0.05) and mRNA expression (1.44-fold). A higher level of DNA fragmentation (p < 0.0001) was seen in the MOE treated cells. MOE’s pro-apoptotic action was confirmed by the significant increase in p53 protein expression (1.02-fold, p < 0.05), p53 mRNA expression (1.59-fold), caspase-9 (1.28-fold, p < 0.05), caspase-3/7 (1.52-fold) activities and an enhanced expression of Smac/DIABLO. MOE also caused the cleavage and activation of PARP-1 into 89 KDa and 24 KDa fragments (p < 0.0001). Conclusion MOE exerts antiproliferative effects in A549 lung cells by increasing oxidative stress, DNA fragmentation and inducing apoptosis. PMID:24041017

CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

PubMed

He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

2016-01-01

The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance

PubMed Central

Walia, Mannu K; Ho, Patricia MW; Taylor, Scott; Ng, Alvin JM; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew CW; Martin, T John; Walkley, Carl R

2016-01-01

Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS. DOI: http://dx.doi.org/10.7554/eLife.13446.001 PMID:27070462

Spontaneous squamous cell carcinoma induced by the somatic inactivation of retinoblastoma and Trp53 tumor suppressors.

PubMed

Martínez-Cruz, Ana Belén; Santos, Mirentxu; Lara, M Fernanda; Segrelles, Carmen; Ruiz, Sergio; Moral, Marta; Lorz, Corina; García-Escudero, Ramón; Paramio, Jesús M

2008-02-01

Squamous cell carcinomas (SCC) represent the most aggressive type of nonmelanoma skin cancer. Although little is known about the causal alterations of SCCs, in organ-transplanted patients the E7 and E6 oncogenes of human papillomavirus, targeting the p53- and pRb-dependent pathways, have been widely involved. Here, we report the functional consequences of the simultaneous elimination of Trp53 and retinoblastoma (Rb) genes in epidermis using Cre-loxP system. Loss of p53, but not pRb, produces spontaneous tumor development, indicating that p53 is the predominant tumor suppressor acting in mouse epidermis. Although the simultaneous inactivation of pRb and p53 does not aggravate the phenotype observed in Rb-deficient epidermis in terms of proliferation and/or differentiation, spontaneous SCC development is severely accelerated in doubly deficient mice. The tumors are aggressive and undifferentiated and display a hair follicle origin. Detailed analysis indicates that the acceleration is mediated by premature activation of the epidermal growth factor receptor/Akt pathway, resulting in increased proliferation in normal and dysplastic hair follicles and augmented tumor angiogenesis. The molecular characteristics of this model provide valuable tools to understand epidermal tumor formation and may ultimately contribute to the development of therapies for the treatment of aggressive squamous cancer.

MicroRNA501-5p induces p53 proteasome degradation through the activation of the mTOR/MDM2 pathway in ADPKD cells.

PubMed

de Stephanis, Lucia; Mangolini, Alessandra; Servello, Miriam; Harris, Peter C; Dell'Atti, Lucio; Pinton, Paolo; Aguiari, Gianluca

2018-09-01

Cell proliferation and apoptosis are typical hallmarks of autosomal dominant polycystic kidney disease (ADPKD) and cause the development of kidney cysts that lead to end-stage renal disease (ESRD). Many factors, impaired by polycystin complex loss of function, may promote these biological processes, including cAMP, mTOR, and EGFR signaling pathways. In addition, microRNAs (miRs) may also regulate the ADPKD related signaling network and their dysregulation contributes to disease progression. However, the role of miRs in ADPKD pathogenesis has not been fully understood, but also the function of p53 is quite obscure, especially its regulatory contribution on cell proliferation and apoptosis. Here, we describe for the first time that miR501-5p, upregulated in ADPKD cells and tissues, induces the activation of mTOR kinase by PTEN and TSC1 gene repression. The increased activity of mTOR kinase enhances the expression of E3 ubiquitin ligase MDM2 that in turn promotes p53 ubiquitination, leading to its degradation by proteasome machinery in a network involving p70S6K. Moreover, the overexpression of miR501-5p stimulates cell proliferation in kidney cells by the inhibition of p53 function in a mechanism driven by mTOR signaling. In fact, the downregulation of this miR as well as the pharmacological treatment with proteasome and mTOR inhibitors in ADPKD cells reduces cell growth by the activation of apoptosis. Consequently, the stimulation of cell death in ADPKD cells may occur through the inhibition of mTOR/MDM2 signaling and the restoring of p53 function. The data presented here confirm that the impaired mTOR signaling plays an important role in ADPKD. © 2018 Wiley Periodicals, Inc.

Assessment of p21, p53 expression, and Ki-67 proliferative activities in the gastric mucosa of children with Helicobacter pylori gastritis.

PubMed

Saf, Coskun; Gulcan, Enver Mahir; Ozkan, Ferda; Cobanoglu Saf, Seyhan Perihan; Vitrinel, Ayca

2015-02-01

Helicobacter pylori that is generally acquired in childhood and infects the gastric mucosa is considered to be responsible for many pathobiological changes that are linked to the pathogenesis of gastric cancer. Although the majority of studies on the subject have been carried out in adults, there are a limited number of studies on children that reflect the early period of infection and may be of greater significance. We aimed to determine the role of H. pylori infection and/or gastritis in several histopathological changes, p53, p21, and cell proliferation-associated Ki-67 antigen expression in the gastric mucosa. We studied 60 patients with a mean age of 7.5 ± 4.5 years at referral. On the basis of endoscopic appearance and the evaluation of the gastric antral specimens, the patients were divided into three groups: patients without gastritis, patients with H. pylori-positive gastritis, and patients with H. pylori-negative gastritis. To determine the expression of p53, Ki-67, and p21 in gastric biopsy specimens, immunohistochemical stains were performed. The incidence of neutrophil activity, which was one of our histopathologic parameters, was significantly higher in the H. pylori-positive gastritis group than the other two groups. The presence of lymphoid aggregate was more frequent in H. pylori ± gastritis groups than the nongastritis group. p53 expression was found to be significantly higher in the H. pylori-positive gastritis group than the nongastritis group. Ki-67 and p21 expressions were significantly more frequent in the H. pylori-positive gastritis group than the other two groups. When we evaluated the density of H. pylori, as the density of bacteria increases, we found that the expressions of p53, p21, and Ki-67 increased significantly. Expression of the studied precancerous markers in significant amounts indicates the importance of childhood H. pylori infection in the constitution of gastric cancer in adulthood.

5-Methoxyflavanone induces cell cycle arrest at the G2/M phase, apoptosis and autophagy in HCT116 human colon cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Soon Young; Department of Biomedical Science and Technology, Research Center for Transcription Control, Konkuk University, Seoul 143-701; Hyun, Jiye

2011-08-01

Natural flavonoids have diverse pharmacological activities, including anti-oxidative, anti-inflammatory, and anti-cancer activities. In this study, we investigated the molecular mechanism underlying the action of 5-methoxyflavanone (5-MF) which has a strong bioavailability and metabolic stability. Our results show that 5-MF inhibited the growth and clonogenicity of HCT116 human colon cancer cells, and that it activated DNA damage responses, as revealed by the accumulation of p53 and the phosphorylation of DNA damage-sensitive proteins, including ataxia-telangiectasia mutated (ATM) at Ser1981, checkpoint kinase 2 (Chk2) at Thr68, and histone H2AX at Ser139. 5-MF-induced DNA damage was confirmed in a comet tail assay. We alsomore » found that 5-MF increased the cleavage of caspase-2 and -7, leading to the induction of apoptosis. Pretreatment with the ATM inhibitor KU55933 enhanced 5-MF-induced {gamma}-H2AX formation and caspase-7 cleavage. HCT116 cells lacking p53 (p53{sup -/-}) or p21 (p21{sup -/-}) exhibited increased sensitivity to 5-MF compared to wild-type cells. 5-MF further induced autophagy via an ERK signaling pathway. Blockage of autophagy with the MEK inhibitor U0126 potentiated 5-MF-induced {gamma}-H2AX formation and caspase-2 activation. These results suggest that a caspase-2 cascade mediates 5-MF-induced anti-tumor activity, while an ATM/Chk2/p53/p21 checkpoint pathway and ERK-mediated autophagy act as a survival program to block caspase-2-mediated apoptosis induced by 5-MF. - Graphical abstract: Display Omitted Highlights: > 5-MF inhibits the proliferation of HCT116 colon cancer cells. > 5-MF inhibits cell cycle progression and induces apoptosis. > Inhibition of autophagy triggers 5-MF-induced apoptosis. > Inhibition of ERK signaling blocks 5-MF-induced autophagy but activates apoptosis. > Treatment with 5-MF in combination with an ERK inhibitor may be a potential therapeutic strategy in human colon cancer.« less

Diaryl- and triaryl-pyrrole derivatives: inhibitors of the MDM2-p53 and MDMX-p53 protein-protein interactions†Electronic supplementary information (ESI) available: Experimental details for compound synthesis, analytical data for all compounds and intermediates. Details for the biological evaluation. Further details for the modeling. Table of combustion analysis data. See DOI: 10.1039/c3md00161jClick here for additional data file.

PubMed

Blackburn, Tim J; Ahmed, Shafiq; Coxon, Christopher R; Liu, Junfeng; Lu, Xiaohong; Golding, Bernard T; Griffin, Roger J; Hutton, Claire; Newell, David R; Ojo, Stephen; Watson, Anna F; Zaytzev, Andrey; Zhao, Yan; Lunec, John; Hardcastle, Ian R

2013-09-21

Screening identified 2-(3-((4,6-dioxo-2-thioxotetrahydropyrimidin-5(2 H )-ylidene)methyl)-2,5-dimethyl-1 H -pyrrol-1-yl)-4,5,6,7-tetrahydrobenzo[ b ]thiophene-3-carbonitrile as an MDM2-p53 inhibitor (IC 50 = 12.3 μM). MDM2-p53 and MDMX-p53 activity was seen for 5-((1-(4-chlorophenyl)-2,5-diphenyl-1 H -pyrrol-3-yl)methylene)-2-thioxodihydropyrimidine-4,6(1 H ,5 H )-dione (MDM2 IC 50 = 0.11 μM; MDMX IC 50 = 4.2 μM) and 5-((1-(4-nitrophenyl)-2,5-diphenyl-1 H -pyrrol-3-yl)methylene)pyrimidine-2,4,6(1 H ,3 H ,5 H )-trione (MDM2 IC 50 = 0.15 μM; MDMX IC 50 = 4.2 μM), and cellular activity consistent with p53 activation in MDM2 amplified cells. Further SAR studies demonstrated the requirement for the triarylpyrrole moiety for MDMX-p53 activity but not for MDM2-p53 inhibition.

p53 down-regulates SARS coronavirus replication and is targeted by the SARS-unique domain and PLpro via E3 ubiquitin ligase RCHY1.

PubMed

Ma-Lauer, Yue; Carbajo-Lozoya, Javier; Hein, Marco Y; Müller, Marcel A; Deng, Wen; Lei, Jian; Meyer, Benjamin; Kusov, Yuri; von Brunn, Brigitte; Bairad, Dev Raj; Hünten, Sabine; Drosten, Christian; Hermeking, Heiko; Leonhardt, Heinrich; Mann, Matthias; Hilgenfeld, Rolf; von Brunn, Albrecht

2016-08-30

Highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV) has developed strategies to inhibit host immune recognition. We identify cellular E3 ubiquitin ligase ring-finger and CHY zinc-finger domain-containing 1 (RCHY1) as an interacting partner of the viral SARS-unique domain (SUD) and papain-like protease (PL(pro)), and, as a consequence, the involvement of cellular p53 as antagonist of coronaviral replication. Residues 95-144 of RCHY1 and 389-652 of SUD (SUD-NM) subdomains are crucial for interaction. Association with SUD increases the stability of RCHY1 and augments RCHY1-mediated ubiquitination as well as degradation of p53. The calcium/calmodulin-dependent protein kinase II delta (CAMK2D), which normally influences RCHY1 stability by phosphorylation, also binds to SUD. In vivo phosphorylation shows that SUD does not regulate phosphorylation of RCHY1 via CAMK2D. Similarly to SUD, the PL(pro)s from SARS-CoV, MERS-CoV, and HCoV-NL63 physically interact with and stabilize RCHY1, and thus trigger degradation of endogenous p53. The SARS-CoV papain-like protease is encoded next to SUD within nonstructural protein 3. A SUD-PL(pro) fusion interacts with RCHY1 more intensively and causes stronger p53 degradation than SARS-CoV PL(pro) alone. We show that p53 inhibits replication of infectious SARS-CoV as well as of replicons and human coronavirus NL63. Hence, human coronaviruses antagonize the viral inhibitor p53 via stabilizing RCHY1 and promoting RCHY1-mediated p53 degradation. SUD functions as an enhancer to strengthen interaction between RCHY1 and nonstructural protein 3, leading to a further increase in in p53 degradation. The significance of these findings is that down-regulation of p53 as a major player in antiviral innate immunity provides a long-sought explanation for delayed activities of respective genes.

p53 down-regulates SARS coronavirus replication and is targeted by the SARS-unique domain and PLpro via E3 ubiquitin ligase RCHY1

PubMed Central

Ma-Lauer, Yue; Carbajo-Lozoya, Javier; Müller, Marcel A.; Deng, Wen; Lei, Jian; Meyer, Benjamin; Kusov, Yuri; von Brunn, Brigitte; Bairad, Dev Raj; Hünten, Sabine; Drosten, Christian; Hermeking, Heiko; Leonhardt, Heinrich; Mann, Matthias; Hilgenfeld, Rolf; von Brunn, Albrecht

2016-01-01

Highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV) has developed strategies to inhibit host immune recognition. We identify cellular E3 ubiquitin ligase ring-finger and CHY zinc-finger domain-containing 1 (RCHY1) as an interacting partner of the viral SARS-unique domain (SUD) and papain-like protease (PLpro), and, as a consequence, the involvement of cellular p53 as antagonist of coronaviral replication. Residues 95–144 of RCHY1 and 389–652 of SUD (SUD-NM) subdomains are crucial for interaction. Association with SUD increases the stability of RCHY1 and augments RCHY1-mediated ubiquitination as well as degradation of p53. The calcium/calmodulin-dependent protein kinase II delta (CAMK2D), which normally influences RCHY1 stability by phosphorylation, also binds to SUD. In vivo phosphorylation shows that SUD does not regulate phosphorylation of RCHY1 via CAMK2D. Similarly to SUD, the PLpros from SARS-CoV, MERS-CoV, and HCoV-NL63 physically interact with and stabilize RCHY1, and thus trigger degradation of endogenous p53. The SARS-CoV papain-like protease is encoded next to SUD within nonstructural protein 3. A SUD–PLpro fusion interacts with RCHY1 more intensively and causes stronger p53 degradation than SARS-CoV PLpro alone. We show that p53 inhibits replication of infectious SARS-CoV as well as of replicons and human coronavirus NL63. Hence, human coronaviruses antagonize the viral inhibitor p53 via stabilizing RCHY1 and promoting RCHY1-mediated p53 degradation. SUD functions as an enhancer to strengthen interaction between RCHY1 and nonstructural protein 3, leading to a further increase in in p53 degradation. The significance of these findings is that down-regulation of p53 as a major player in antiviral innate immunity provides a long-sought explanation for delayed activities of respective genes. PMID:27519799

Intratumoral delivery of docetaxel enhances antitumor activity of Ad-p53 in murine head and neck cancer xenograft model.

PubMed

Yoo, George H; Subramanian, Geetha; Ezzat, Waleed H; Tulunay, Ozlem E; Tran, Vivian R; Lonardo, Fulvio; Ensley, John F; Kim, Harold; Won, Joshua; Stevens, Timothy; Zumstein, Louis A; Lin, Ho-Sheng

2010-01-01

The aim of this study is to determine the ability of intratumorally delivered docetaxel to enhance the antitumor activity of adenovirus-mediated delivery of p53 (Ad-p53) in murine head and neck cancer xenograft model. A xenograft head and neck squamous cell carcinoma mouse model was used. Mice were randomized into 4 groups of 6 mice receiving 6 weeks of biweekly intratumoral injection of (a) diluent, (b) Ad-p53 (1 x 10(10) viral particles per injection), (c) docetaxel (1 mg/kg per injection), and (d) combination of Ad-p53 (1 x 10(10) viral particles per injection) and docetaxel (1 mg/kg per injection). Tumor size, weight, toxicity, and overall and disease-free survival rates were determined. Intratumoral treatments with either docetaxel alone or Ad-p53 alone resulted in statistically significant antitumor activity and improved survival compared with control group. Furthermore, combined delivery of Ad-p53 and docetaxel resulted in a statistically significant reduction in tumor weight when compared to treatment with either Ad-p53 or docetaxel alone. Intratumoral delivery of docetaxel enhanced the antitumor effect of Ad-p53 in murine head and neck cancer xenograft model. The result of this preclinical in vivo study is promising and supports further clinical testing to evaluate efficacy of combined intratumoral docetaxel and Ad-p53 in treatment of head and neck cancer. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Tumorigenicity of MCF-7 human breast cancer cells lacking the p38α mitogen-activated protein kinase.

PubMed

Mendoza, Rhone A; Moody, Emily E; Enriquez, Marlene I; Mejia, Sylvia M; Thordarson, Gudmundur

2011-01-01

We have generated cell lines with significantly reduced expression of the p38 mitogen-activated protein kinase (p38 MAPK), Min-p38 MAPK cells, and used these cells to investigate p38 MAPK's role in tumorigenesis of breast cancer cells. MCF-7 cells were stably transfected with a plasmid producing small interfering RNA that inhibited the expression of p38 MAPK. Control cells were stably transfected with the same plasmid producing non-interfering RNA. The reduction in the p38 MAPK activity caused a significant increase in the expressions of estrogen receptor-α (ERα) and the progesterone receptor, but eliminated the expression of ERβ. Min-p38 MAPK cells showed an enhanced overall growth response to 17β-estradiol (E₂), whereas GH plus epidermal growth factor were largely ineffective growth stimulators in these cells compared to controls. Although the long-term net growth rate of the Min-p38 MAPK cells was increased in response to E₂, their proliferation rate was lower compared to controls in short-term cultures. However, the Min-p38 MAPK cells did show a significant decreased rate of apoptosis after E₂ treatment and a reduction in the basal phosphorylation of p53 tumor suppressor protein compared to controls. When the Min-p38 MAPK cells were xenografted into E₂-treated athymic nude mice, their tumorigenicity was enhanced compared to control cells. Increased tumorigenicity of Min-p38 MAPK cells was caused mainly by a decrease in the apoptosis rate indicating that the lack of the p38 MAPK caused an imbalance to increase the ERα:ERβ ratio and a reduction in the activity of the p53 tumor suppressor protein.

40 Years of Research Put p53 in Translation

PubMed Central

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

HIPK2 restricts SIRT1 activity upon severe DNA damage by a phosphorylation-controlled mechanism

PubMed Central

Conrad, E; Polonio-Vallon, T; Meister, M; Matt, S; Bitomsky, N; Herbel, C; Liebl, M; Greiner, V; Kriznik, B; Schumacher, S; Krieghoff-Henning, E; Hofmann, T G

2016-01-01

Upon severe DNA damage a cellular signalling network initiates a cell death response through activating tumour suppressor p53 in association with promyelocytic leukaemia (PML) nuclear bodies. The deacetylase Sirtuin 1 (SIRT1) suppresses cell death after DNA damage by antagonizing p53 acetylation. To facilitate efficient p53 acetylation, SIRT1 function needs to be restricted. How SIRT1 activity is regulated under these conditions remains largely unclear. Here we provide evidence that SIRT1 activity is limited upon severe DNA damage through phosphorylation by the DNA damage-responsive kinase HIPK2. We found that DNA damage provokes interaction of SIRT1 and HIPK2, which phosphorylates SIRT1 at Serine 682 upon lethal damage. Furthermore, upon DNA damage SIRT1 and HIPK2 colocalize at PML nuclear bodies, and PML depletion abrogates DNA damage-induced SIRT1 Ser682 phosphorylation. We show that Ser682 phosphorylation inhibits SIRT1 activity and impacts on p53 acetylation, apoptotic p53 target gene expression and cell death. Mechanistically, we found that DNA damage-induced SIRT1 Ser682 phosphorylation provokes disruption of the complex between SIRT1 and its activator AROS. Our findings indicate that phosphorylation-dependent restriction of SIRT1 activity by HIPK2 shapes the p53 response. PMID:26113041

Uridine homeostatic disorder leads to DNA damage and tumorigenesis.

PubMed

Cao, Zhe; Ma, Jun; Chen, Xinchun; Zhou, Boping; Cai, Chuan; Huang, Dan; Zhang, Xuewen; Cao, Deliang

2016-03-28

Uridine is a natural nucleoside precursor of uridine monophosphate in organisms and thus is considered to be safe and is used in a wide range of clinical settings. The far-reaching effects of pharmacological uridine have long been neglected. Here, we report that the homeostatic disorder of uridine is carcinogenic. Targeted disruption (-/-) of murine uridine phosphorylase (UPase) disrupted the homeostasis of uridine and increased spontaneous tumorigenesis by more than 3-fold. Multiple tumors (e.g., lymphoma, hepatoma and lung adenoma) occurred simultaneously in some UPase deficient mice, but not in wild-type mice raised under the same conditions. In the tissue from UPase -/- mice, the 2'-deoxyuridine,5'-triphosphate (dUTP) levels and uracil DNA were increased and p53 was activated with an increased phospho-Ser18 p53 level. Exposing cell lines (e.g., MCF-7, RKO, HCT-8 and NCI-H460) to uridine (10 or 30 µM) led to uracil DNA damage and p53 activation, which in turn triggered the DNA damage response. In these cells, phospho-ATM, phospho-CHK2, and phospho-γH2AX were increased by uridine. These data suggest that uridine homeostatic disorder leads to uracil DNA damage and that pharmacological uridine may be carcinogenic. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Metabolic oxidative stress elicited by the copper(II) complex [Cu(isaepy)2] triggers apoptosis in SH-SY5Y cells through the induction of the AMP-activated protein kinase/p38MAPK/p53 signalling axis: evidence for a combined use with 3-bromopyruvate in neuroblastoma treatment.

PubMed

Filomeni, Giuseppe; Cardaci, Simone; Da Costa Ferreira, Ana Maria; Rotilio, Giuseppe; Ciriolo, Maria Rosa

2011-08-01

We have demonstrated previously that the complex bis[(2-oxindol-3-ylimino)-2-(2-aminoethyl)pyridine-N,N']copper(II), named [Cu(isaepy)(2)], induces AMPK (AMP-activated protein kinase)-dependent/p53-mediated apoptosis in tumour cells by targeting mitochondria. In the present study, we found that p38(MAPK) (p38 mitogen-activated protein kinase) is the molecular link in the phosphorylation cascade connecting AMPK to p53. Transfection of SH-SY5Y cells with a dominant-negative mutant of AMPK resulted in a decrease in apoptosis and a significant reduction in phospho-active p38(MAPK) and p53. Similarly, reverse genetics of p38(MAPK) yielded a reduction in p53 and a decrease in the extent of apoptosis, confirming an exclusive hierarchy of activation that proceeds via AMPK/p38(MAPK)/p53. Fuel supplies counteracted [Cu(isaepy)(2)]-induced apoptosis and AMPK/p38(MAPK)/p53 activation, with glucose being the most effective, suggesting a role for energetic imbalance in [Cu(isaepy)(2)] toxicity. Co-administration of 3BrPA (3-bromopyruvate), a well-known inhibitor of glycolysis, and succinate dehydrogenase, enhanced apoptosis and AMPK/p38(MAPK)/p53 signalling pathway activation. Under these conditions, no toxic effect was observed in SOD (superoxide dismutase)-overexpressing SH-SY5Y cells or in PCNs (primary cortical neurons), which are, conversely, sensitized to the combined treatment with [Cu(isaepy)(2)] and 3BrPA only if grown in low-glucose medium or incubated with the glucose-6-phosphate dehydrogenase inhibitor dehydroepiandrosterone. Overall, the results suggest that NADPH deriving from the pentose phosphate pathway contributes to PCN resistance to [Cu(isaepy)(2)] toxicity and propose its employment in combination with 3BrPA as possible tool for cancer treatment. © The Authors Journal compilation © 2011 Biochemical Society

Establishment of a dog model for the p53 family pathway and identification of a novel isoform of p21 cyclin-dependent kinase inhibitor

PubMed Central

Zhang, Jin; Chen, Xiangling; Kent, Michael S.; Rodriguez, Carlos O.; Chen, Xinbin

2009-01-01

Spontaneous tumors in the dog offer a unique opportunity as models to study human cancer etiology and therapy. p53, the most commonly mutated gene in human cancers, is found to be altered in dog cancers. However, little is known about the role of p53 in dog tumorigenesis. Here, we found that upon exposure to DNA damage agents or Mdm2 inhibitor nutlin-3, canine p53 is accumulated and capable of inducing its target genes, MDM2 and p21. We also found that upon DNA damage, canine p53 is accumulated in the nucleus, followed by MDM2 nuclear translocation and increased 53BP1 foci formation. In addition, we found that canine p63 and p73 are up-regulated by DNA damage agents. Furthermore, colony formation assay showed that canine tumor cells are sensitive to DNA damage agents and nutlin-3 in a p53-dependent manner. Surprisingly, canine p21 is expressed as two isoforms. Thus, we generated multiple canine p21 mutants and found that aa 129 to 142 is required, whereas aa 139 is one of the key determinants, for two p21 isoform expression. Finally, we showed that although the full-length human p21 cDNA expresses one polypeptide, aa 139 appears to play a similar role as that in canine p21 for various migration patterns. Taken together, our results indicate that canine p53 family proteins have biological activities similar to human counterparts. These similarities make the dog as an excellent out-bred spontaneous tumor model and the dog can serve as a translation model from bench-top to cage-side and then to bed-side. PMID:19147538

Heterogeneity of p53 dependent genomic responses following ethanol exposure in a developmental mouse model of fetal alcohol spectrum disorder

PubMed Central

Mooney, Sandra M.; Middleton, Frank A.

2017-01-01

Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD. PMID:28723918

Inhibition of autophagy exerts anti-colon cancer effects via apoptosis induced by p53 activation and ER stress.

PubMed

Sakitani, Kosuke; Hirata, Yoshihiro; Hikiba, Yohko; Hayakawa, Yoku; Ihara, Sozaburo; Suzuki, Hirobumi; Suzuki, Nobumi; Serizawa, Takako; Kinoshita, Hiroto; Sakamoto, Kei; Nakagawa, Hayato; Tateishi, Keisuke; Maeda, Shin; Ikenoue, Tsuneo; Kawazu, Shoji; Koike, Kazuhiko

2015-10-24

Although some molecularly targeted drugs for colorectal cancer are used clinically and contribute to a better prognosis, the current median survival of advanced colorectal cancer patients is not sufficient. Autophagy, a basic cell survival mechanism mediated by recycling of cellular amino acids, plays an important role in cancer. Recently, autophagy has been highlighted as a promising new molecular target. The unfolded protein response (UPR) reportedly act in complementary fashion with autophagy in intestinal homeostasis. However, the roles of UPR in colon cancer under autophagic inhibition remain to be elucidated. We aim to clarify the inhibitory effect of autophagy on colon cancer. We crossed K19 (CreERT) and Atg5 (flox/flox) mice to generate Atg5 (flox/flox)/K19 (CreERT) mice. Atg5 (flox/flox)/K19 (CreERT) mice were first treated with azoxymethane/dextran sodium sulfate and then injected with tamoxifen to inhibit autophagy in CK19-positive epithelial cells. To examine the anti-cancer mechanisms of autophagic inhibition, we used colon cancer cell lines harboring different p53 gene statuses, as well as small interfering RNAs (siRNAs) targeting Atg5 and immunoglobulin heavy-chain binding protein (BiP), a chaperone to aid folding of unfolded proteins. Colon tumors in Atg5 (flox/flox)/K19 (CreERT) mice showed loss of autophagic activity and decreased tumor size (the total tumor diameter was 28.1 mm in the control and 20.7 mm in Atg5 (flox/flox)/K19 (CreERT) mice, p = 0.036). We found that p53 and UPR/endoplasmic reticulum (ER) stress-related proteins, such as cleaved caspase 3, and CAAT/enhancer-binding protein homologous protein, are up-regulated in colon tumors of Atg5 (flox/flox)/K19 (CreERT) mice. Although Atg5 and BiP silencing, respectively, increased apoptosis in p53 wild type cells, Atg5 silencing alone did not show the same effect on apoptosis in p53 mutant cells. However, co-transfection of Atg5 and BiP siRNAs led to increased apoptosis in p53 mutant cells. Blocking autophagy has potential in the treatment of colon cancer by inducing apoptosis via p53 and ER stress, and suppressing the UPR pathway is a valid strategy to overcome resistance to autophagic inhibition.

Tumorigenicity of MCF-7 human breast cancer cells lacking the p38α mitogen-activated protein kinase

PubMed Central

Mendoza, Rhone A; Moody, Emily E; Enriquez, Marlene I; Mejia, Sylvia M; Thordarson, Gudmundur

2011-01-01

We have generated cell lines with significantly reduced expression of the p38 mitogen-activated protein kinase (p38 MAPK), Min-p38 MAPK cells, and used these cells to investigate its role in tumorigenesis of breast cancer cells. MCF-7 cells were stably transfected with a plasmid producing small interfering RNA that inhibited the expression of p38 MAPK. Control cells were stably transfected with the same plasmid producing non-interfering RNA. The reduction in the p38 MAPK activity caused a significant increase in the expressions of the estrogen receptor-α (ERα) and the progesterone receptor, but eliminated the expression of the ERβ. Min-p38 MAPK cells showed an enhanced overall growth response to 17β-estradiol (E2), whereas growth hormone plus epidermal growth factor were largely ineffective growth stimulators in these cells compared to controls. Although the long-term net growth rate of the Min-p38 MAPK cells was increased in response to E2, their proliferation rate was not different from controls in short-term cultures. However, the Min-p38 MAPK cells did show a significant decreased rate of apoptosis after E2 treatment and a reduction in the basal phosphorylation of p53 tumor suppressor protein compared to controls. When the Min-p38 MAPK cells were xenografted into E2-treated athymic nude mice, their tumorigenicity was enhanced compared to control cells. Conclusions: increased tumorigenicity of Min-p38 MAPK cells was caused mainly by a decrease in apoptosis rate indicating that the lack of the p38 MAPK caused an imbalance to increase the ERα:ERβ ratio and a reduction in the activity of the p53 tumor suppressor protein. PMID:20974639

Hydroquinone-induced malignant transformation of TK6 cells by facilitating SIRT1-mediated p53 degradation and up-regulating KRAS.

PubMed

Chen, Yuting; Chen, Jiajia; Yun, Lin; Xu, Longmei; Liu, Jiaxian; Xu, Yongchun; Yang, Hui; Liang, Hairong; Tang, Huanwen

2016-09-30

Hydroquinone (HQ), known as one of the metabolic products of benzene, causes a number of hematologic malignancies. The study evaluated the potential mechanism of Sirtuin 1 (SIRT1) in HQ-induced TK6 cell malignant transformation. The data of our study show that short term exposure of TK6 cells to HQ led to a decrease expression of SIRT1. Knockdown of SIRT1 sensitized to the HQ-induced apoptosis in vitro and increased the expression of p53, p21 and γ-H2AX. Furthermore, chronic HQ-treated (20μM once a week for 19 weeks) caused carcinogenic transformation and was confirmed by abnormal cell proliferation, matrix metalloproteinase 9(MMP9) and subcutaneous tumor formation in nude mice. SIRT1 increased KRAS expression, and decreased H3K9 and H3K18 acetylation, inhibited p53 signaling and the level of caspase-3 in HQ-induced transformation cells. Taken together, these data suggest that SIRT1 is involved in HQ-induced malignant transformation associated with suppressing p53 signaling and activation of KRAS. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Proto-oncogene FBI-1 represses transcription of p21CIP1 by inhibition of transcription activation by p53 and Sp1.

PubMed

Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

2009-05-08

Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1-3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target.

Proto-oncogene FBI-1 Represses Transcription of p21CIP1 by Inhibition of Transcription Activation by p53 and Sp1*S⃞

PubMed Central

Choi, Won-Il; Jeon, Bu-Nam; Yun, Chae-Ok; Kim, Pyung-Hwan; Kim, Sung-Eun; Choi, Kang-Yell; Kim, Se Hoon; Hur, Man-Wook

2009-01-01

Aberrant transcriptional repression through chromatin remodeling and histone deacetylation has been postulated as the driving force for tumorigenesis. FBI-1 (formerly called Pokemon) is a member of the POK family of transcriptional repressors. Recently, FBI-1 was characterized as a critical oncogenic factor that specifically represses transcription of the tumor suppressor gene ARF, potentially leading indirectly to p53 inactivation. Our investigations on transcriptional repression of the p53 pathway revealed that FBI-1 represses transcription of ARF, Hdm2 (human analogue of mouse double minute oncogene), and p21CIP1 (hereafter indicated as p21) but not of p53. FBI-1 showed a more potent repressive effect on p21 than on p53. Our data suggested that FBI-1 is a master controller of the ARF-Hdm2-p53-p21 pathway, ultimately impinging on cell cycle arrest factor p21, by inhibiting upstream regulators at the transcriptional and protein levels. FBI-1 acted as a competitive transcriptional repressor of p53 and Sp1 and was shown to bind the proximal Sp1–3 GC-box and the distal p53-responsive elements of p21. Repression involved direct binding competition of FBI-1 with Sp1 and p53. FBI-1 also interacted with corepressors, such as mSin3A, NCoR, and SMRT, thereby deacetylating Ac-H3 and Ac-H4 histones at the promoter. FBI-1 caused cellular transformation, promoted cell cycle proliferation, and significantly increased the number of cells in S phase. FBI-1 is aberrantly overexpressed in many human solid tumors, particularly in adenocarcinomas and squamous carcinomas. The role of FBI-1 as a master controller of the p53 pathway therefore makes it an attractive therapeutic target. PMID:19244234

RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice

PubMed Central

Herold, Marco J.

2016-01-01

Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53−/− mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418

Shuttling imbalance of MLF1 results in p53 instability and increases susceptibility to oncogenic transformation.

PubMed

Yoneda-Kato, Noriko; Kato, Jun-Ya

2008-01-01

Myeloid leukemia factor 1 (MLF1) stabilizes the activity of the tumor suppressor p53 by suppressing its E3 ubiquitin ligase, COP1, through a third component of the COP9 signalosome (CSN3). However, little is known about how MLF1 functions upstream of the CSN3-COP1-p53 pathway and how its deregulation by the formation of the fusion protein nucleophosmin (NPM)-MLF1, generated by t(3;5)(q25.1;q34) chromosomal translocation, leads to leukemogenesis. Here we show that MLF1 is a cytoplasmic-nuclear-shuttling protein and that its nucleolar localization on fusing with NPM prevents the full induction of p53 by both genotoxic and oncogenic cellular stress. The majority of MLF1 was located in the cytoplasm, but the treatment of cells with leptomycin B rapidly induced a nuclear accumulation of MLF1. A mutation of the nuclear export signal (NES) motif identified in the MLF1 sequence enhanced the antiproliferative activity of MLF1. The fusion of MLF1 with NPM translocated MLF1 to the nucleolus and abolished the growth-suppressing activity. The introduction of NPM-MLF1 into early-passage murine embryonic fibroblasts allowed the cells to escape from cellular senescence at a markedly earlier stage and induced neoplastic transformation in collaboration with the oncogenic form of Ras. Interestingly, disruption of the MLF1-derived NES sequence completely abolished the growth-promoting activity of NPM-MLF1 in murine fibroblasts and hematopoietic cells. Thus, our results provide important evidence that the shuttling of MLF1 is critical for the regulation of cell proliferation and a disturbance in the shuttling balance increases the cell's susceptibility to oncogenic transformation.

Shuttling Imbalance of MLF1 Results in p53 Instability and Increases Susceptibility to Oncogenic Transformation▿ †

PubMed Central

Yoneda-Kato, Noriko; Kato, Jun-ya

2008-01-01

Myeloid leukemia factor 1 (MLF1) stabilizes the activity of the tumor suppressor p53 by suppressing its E3 ubiquitin ligase, COP1, through a third component of the COP9 signalosome (CSN3). However, little is known about how MLF1 functions upstream of the CSN3-COP1-p53 pathway and how its deregulation by the formation of the fusion protein nucleophosmin (NPM)-MLF1, generated by t(3;5)(q25.1;q34) chromosomal translocation, leads to leukemogenesis. Here we show that MLF1 is a cytoplasmic-nuclear-shuttling protein and that its nucleolar localization on fusing with NPM prevents the full induction of p53 by both genotoxic and oncogenic cellular stress. The majority of MLF1 was located in the cytoplasm, but the treatment of cells with leptomycin B rapidly induced a nuclear accumulation of MLF1. A mutation of the nuclear export signal (NES) motif identified in the MLF1 sequence enhanced the antiproliferative activity of MLF1. The fusion of MLF1 with NPM translocated MLF1 to the nucleolus and abolished the growth-suppressing activity. The introduction of NPM-MLF1 into early-passage murine embryonic fibroblasts allowed the cells to escape from cellular senescence at a markedly earlier stage and induced neoplastic transformation in collaboration with the oncogenic form of Ras. Interestingly, disruption of the MLF1-derived NES sequence completely abolished the growth-promoting activity of NPM-MLF1 in murine fibroblasts and hematopoietic cells. Thus, our results provide important evidence that the shuttling of MLF1 is critical for the regulation of cell proliferation and a disturbance in the shuttling balance increases the cell's susceptibility to oncogenic transformation. PMID:17967869

Hypoxic resistance of KRAS mutant tumor cells to 3-Bromopyruvate is counteracted by Prima-1 and reversed by N-acetylcysteine.

PubMed

Orue, Andrea; Chavez, Valery; Strasberg-Rieber, Mary; Rieber, Manuel

2016-11-18

The metabolic inhibitor 3-bromopyruvate (3-BrPA) is a promising anti-cancer alkylating agent, shown to inhibit growth of some colorectal carcinoma with KRAS mutation. Recently, we demonstrated increased resistance to 3-BrPA in wt p53 tumor cells compared to those with p53 silencing or mutation. Since hypoxic microenvironments select for tumor cells with diminished therapeutic response, we investigated whether hypoxia unequally increases resistance to 3-BrPA in wt p53 MelJuso melanoma harbouring (Q61L)-mutant NRAS and wt BRAF, C8161 melanoma with (G12D)-mutant KRAS (G464E)-mutant BRAF, and A549 lung carcinoma with a KRAS (G12S)-mutation. Since hypoxia increases the toxicity of the p53 activator, Prima-1 against breast cancer cells irrespective of their p53 status, we also investigated whether Prima-1 reversed hypoxic resistance to 3-BrPA. In contrast to the high susceptibility of hypoxic mutant NRAS MelJuso cells to 3-BrPA or Prima-1, KRAS mutant C8161 and A549 cells revealed hypoxic resistance to 3-BrPA counteracted by Prima-1. In A549 cells, Prima-1 increased p21CDKN1mRNA, and reciprocally inhibited mRNA expression of the SLC2A1-GLUT1 glucose transporter-1 and ALDH1A1, gene linked to detoxification and stem cell properties. 3-BrPA lowered CAIX and VEGF mRNA expression. Death from joint Prima-1 and 3-BrPA treatment in KRAS mutant A549 and C8161 cells seemed mediated by potentiating oxidative stress, since it was antagonized by the anti-oxidant and glutathione precursor N-acetylcysteine. This report is the first to show that Prima-1 kills hypoxic wt p53 KRAS-mutant cells resistant to 3-BrPA, partly by decreasing GLUT-1 expression and exacerbating pro-oxidant stress.

Identification of flubendazole as potential anti-neuroblastoma compound in a large cell line screen.

PubMed

Michaelis, Martin; Agha, Bishr; Rothweiler, Florian; Löschmann, Nadine; Voges, Yvonne; Mittelbronn, Michel; Starzetz, Tatjana; Harter, Patrick N; Abhari, Behnaz A; Fulda, Simone; Westermann, Frank; Riecken, Kristoffer; Spek, Silvia; Langer, Klaus; Wiese, Michael; Dirks, Wilhelm G; Zehner, Richard; Cinatl, Jaroslav; Wass, Mark N; Cinatl, Jindrich

2015-02-03

Flubendazole was shown to exert anti-leukaemia and anti-myeloma activity through inhibition of microtubule function. Here, flubendazole was tested for its effects on the viability of in total 461 cancer cell lines. Neuroblastoma was identified as highly flubendazole-sensitive cancer entity in a screen of 321 cell lines from 26 cancer entities. Flubendazole also reduced the viability of five primary neuroblastoma samples in nanomolar concentrations thought to be achievable in humans and inhibited vessel formation and neuroblastoma tumour growth in the chick chorioallantoic membrane assay. Resistance acquisition is a major problem in high-risk neuroblastoma. 119 cell lines from a panel of 140 neuroblastoma cell lines with acquired resistance to various anti-cancer drugs were sensitive to flubendazole in nanomolar concentrations. Tubulin-binding agent-resistant cell lines displayed the highest flubendazole IC50 and IC90 values but differences between drug classes did not reach statistical significance. Flubendazole induced p53-mediated apoptosis. The siRNA-mediated depletion of the p53 targets p21, BAX, or PUMA reduced the neuroblastoma cell sensitivity to flubendazole with PUMA depletion resulting in the most pronounced effects. The MDM2 inhibitor and p53 activator nutlin-3 increased flubendazole efficacy while RNAi-mediated p53-depletion reduced its activity. In conclusion, flubendazole represents a potential treatment option for neuroblastoma including therapy-refractory cells.

Identification of flubendazole as potential anti-neuroblastoma compound in a large cell line screen

PubMed Central

Michaelis, Martin; Agha, Bishr; Rothweiler, Florian; Löschmann, Nadine; Voges, Yvonne; Mittelbronn, Michel; Starzetz, Tatjana; Harter, Patrick N.; Abhari, Behnaz A.; Fulda, Simone; Westermann, Frank; Riecken, Kristoffer; Spek, Silvia; Langer, Klaus; Wiese, Michael; Dirks, Wilhelm G.; Zehner, Richard; Cinatl, Jaroslav; Wass, Mark N.; Cinatl, Jindrich

2015-01-01

Flubendazole was shown to exert anti-leukaemia and anti-myeloma activity through inhibition of microtubule function. Here, flubendazole was tested for its effects on the viability of in total 461 cancer cell lines. Neuroblastoma was identified as highly flubendazole-sensitive cancer entity in a screen of 321 cell lines from 26 cancer entities. Flubendazole also reduced the viability of five primary neuroblastoma samples in nanomolar concentrations thought to be achievable in humans and inhibited vessel formation and neuroblastoma tumour growth in the chick chorioallantoic membrane assay. Resistance acquisition is a major problem in high-risk neuroblastoma. 119 cell lines from a panel of 140 neuroblastoma cell lines with acquired resistance to various anti-cancer drugs were sensitive to flubendazole in nanomolar concentrations. Tubulin-binding agent-resistant cell lines displayed the highest flubendazole IC50 and IC90 values but differences between drug classes did not reach statistical significance. Flubendazole induced p53-mediated apoptosis. The siRNA-mediated depletion of the p53 targets p21, BAX, or PUMA reduced the neuroblastoma cell sensitivity to flubendazole with PUMA depletion resulting in the most pronounced effects. The MDM2 inhibitor and p53 activator nutlin-3 increased flubendazole efficacy while RNAi-mediated p53-depletion reduced its activity. In conclusion, flubendazole represents a potential treatment option for neuroblastoma including therapy-refractory cells. PMID:25644037

G9a stimulates CRC growth by inducing p53 Lys373 dimethylation-dependent activation of Plk1.

PubMed

Zhang, Jie; Wang, Yafang; Shen, Yanyan; He, Pengxing; Ding, Jian; Chen, Yi

2018-01-01

Rationale: G9a is genetically deregulated in various tumor types and is important for cell proliferation; however, the mechanism underlying G9a-induced carcinogenesis, especially in colorectal cancer (CRC), is unclear. Here, we investigated if G9a exerts oncogenic effects in CRC by increasing polo-like kinase 1 (Plk1) expression. Thus, we further characterized the detailed molecular mechanisms. Methods: The role of Plk1 in G9a aberrant CRC was determined by performing different in vitro and in vivo assays, including assessment of cell growth by performing cell viability assay and assessment of signaling transduction profiles by performing immunoblotting, in the cases of pharmacological inhibition or short RNA interference-mediated suppression of G9a. Detailed molecular mechanisms underlying the effect of G9a on Plk1 expression were determined by performing point mutation analysis, chromatin immunoprecipitation analysis, and luciferase reporter assay. Correlation between G9a and Plk1 expression was determined by analyzing clinical samples of patients with CRC by performing immunohistochemistry. Results: Our study is the first to report a significant positive correlation between G9a and Plk1 levels in 89 clinical samples of patients with CRC. Moreover, G9a depletion decreased Plk1 expression and suppressed CRC cell growth both in vitro and in vivo , thus confirming the significant correlation between G9a and Plk1 levels. Further, we observed that G9a-induced Plk1 regulation depended on p53 inhibition. G9a dimethylated p53 at lysine 373, which in turn increased Plk1 expression and promoted CRC cell growth. Conclusions: These results indicate that G9a-induced and p53-dependent epigenetic programing stimulates the growth of colon cancer, which also suggests that G9a inhibitors that restore p53 activity are promising therapeutic agents for treating colon cancer, especially for CRC expressing wild-type p53.

In vitro cytotoxic potential of friedelin in human MCF-7 breast cancer cell: Regulate early expression of Cdkn2a and pRb1, neutralize mdm2-p53 amalgamation and functional stabilization of p53.

PubMed

Subash-Babu, Pandurangan; Li, David K; Alshatwi, Ali A

2017-10-02

We aimed to explore the cytotoxic and apoptotic effect of friedelin on breast cancer MCF-7 cells. Cytotoxic effect of friedelin on MCF-7 cells was analyzed using MTT, cell and nuclear morphology. The apoptosis mechanism of friedelin on MCF-7 cells was analyzed using real-time PCR. Friedelin potentially inhibit 78% of MCF-7 cell's growth, the IC 50 value was 1.8μM in 24h and 1.2μM in 48h. Friedelin increased ROS significantly and DNA damage was confirmed by tunel assay. We found characteristically 52% apoptotic cells and 6% necrotic cells in PI, AO/ErBr staining after 48h treatment with 1.2μM of friedelin. Apoptosis was confirmed by significantly (p≤0.001) increased tumor suppressor gene Cdkn1a, pRb2, p53, Nrf2, caspase-3 and decreased Bcl-2, mdm2 & PCNA expression after 48h. In conclusion, friedelin effectively inhibit breast cancer MCF-7 cell growth, it was associated with early expression of Cdkn1a, pRb2 and activation of p53 and caspases. Copyright © 2017. Published by Elsevier GmbH.

Genetic networks lead and follow tumor development: microRNA regulation of cell cycle and apoptosis in the p53 pathways.

PubMed

Otsuka, Kurataka; Ochiya, Takahiro

2014-01-01

During the past ten years, microRNAs (miRNAs) have been shown to play a more significant role in the formation and progression of cancer diseases than previously thought. With an increase in reports about the dysregulation of miRNAs in diverse tumor types, it becomes more obvious that classic tumor-suppressive molecules enter deep into the world of miRNAs. Recently, it has been demonstrated that a typical tumor suppressor p53, known as the guardian of the genome, regulates some kinds of miRNAs to contribute to tumor suppression by the induction of cell-cycle arrest and apoptosis. Meanwhile, miRNAs directly/indirectly control the expression level and activity of p53 to fine-tune its functions or to render p53 inactive, indicating that the interplay between p53 and miRNA is overly complicated. The findings, along with current studies, will underline the continuing importance of understanding this interlocking control system for future therapeutic strategies in cancer treatment and prevention.

Genetic Networks Lead and Follow Tumor Development: MicroRNA Regulation of Cell Cycle and Apoptosis in the p53 Pathways

PubMed Central

Otsuka, Kurataka; Ochiya, Takahiro

2014-01-01

During the past ten years, microRNAs (miRNAs) have been shown to play a more significant role in the formation and progression of cancer diseases than previously thought. With an increase in reports about the dysregulation of miRNAs in diverse tumor types, it becomes more obvious that classic tumor-suppressive molecules enter deep into the world of miRNAs. Recently, it has been demonstrated that a typical tumor suppressor p53, known as the guardian of the genome, regulates some kinds of miRNAs to contribute to tumor suppression by the induction of cell-cycle arrest and apoptosis. Meanwhile, miRNAs directly/indirectly control the expression level and activity of p53 to fine-tune its functions or to render p53 inactive, indicating that the interplay between p53 and miRNA is overly complicated. The findings, along with current studies, will underline the continuing importance of understanding this interlocking control system for future therapeutic strategies in cancer treatment and prevention. PMID:25302307

Expression profiles of SnoN in normal and cancerous human tissues support its tumor suppressor role in human cancer.

PubMed

Jahchan, Nadine S; Ouyang, Gaoliang; Luo, Kunxin

2013-01-01

SnoN is a negative regulator of TGF-β signaling and also an activator of the tumor suppressor p53 in response to cellular stress. Its role in human cancer is complex and controversial with both pro-oncogenic and anti-oncogenic activities reported. To clarify its role in human cancer and provide clinical relevance to its signaling activities, we examined SnoN expression in normal and cancerous human esophageal, ovarian, pancreatic and breast tissues. In normal tissues, SnoN is expressed in both the epithelium and the surrounding stroma at a moderate level and is predominantly cytoplasmic. SnoN levels in all tumor epithelia examined are lower than or similar to that in the matched normal samples, consistent with its anti-tumorigenic activity in epithelial cells. In contrast, SnoN expression in the stroma is highly upregulated in the infiltrating inflammatory cells in high-grade esophageal and ovarian tumor samples, suggesting that SnoN may potentially promote malignant progression through modulating the tumor microenvironment in these tumor types. The overall levels of SnoN expression in these cancer tissues do not correlate with the p53 status. However, in human cancer cell lines with amplification of the snoN gene, a strong correlation between increased SnoN copy number and inactivation of p53 was detected, suggesting that the tumor suppressor SnoN-p53 pathway must be inactivated, either through downregulation of SnoN or inactivation of p53, in order to allow cancer cell to proliferate and survive. These data strongly suggest that SnoN can function as a tumor suppressor at early stages of tumorigenesis in human cancer tissues.

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

PubMed Central

Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

2016-01-01

Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

Generation of oscillations by the p53-Mdm2 feedback loop: A theoretical and experimental study

PubMed Central

Lev Bar-Or, Ruth; Maya, Ruth; Segel, Lee A.; Alon, Uri; Levine, Arnold J.; Oren, Moshe

2000-01-01

The intracellular activity of the p53 tumor suppressor protein is regulated through a feedback loop involving its transcriptional target, mdm2. We present a simple mathematical model suggesting that, under certain circumstances, oscillations in p53 and Mdm2 protein levels can emerge in response to a stress signal. A delay in p53-dependent induction of Mdm2 is predicted to be required, albeit not sufficient, for this oscillatory behavior. In line with the predictions of the model, oscillations of both p53 and Mdm2 indeed occur on exposure of various cell types to ionizing radiation. Such oscillations may allow cells to repair their DNA without risking the irreversible consequences of continuous excessive p53 activation. PMID:11016968

β-Sitosterol targets Trx/Trx1 reductase to induce apoptosis in A549 cells via ROS mediated mitochondrial dysregulation and p53 activation.

PubMed

Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi

2018-02-01

β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.

Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin.

PubMed

Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

2011-11-01

Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.

Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin

PubMed Central

Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

2011-01-01

Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment. PMID:22011578

IGF-I enhances cellular senescence via the reactive oxygen species-p53 pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Handayaningsih, Anastasia-Evi; Takahashi, Michiko; Fukuoka, Hidenori

2012-08-24

Highlights: Black-Right-Pointing-Pointer Cellular senescence plays an important role in tumorigenesis and aging process. Black-Right-Pointing-Pointer We demonstrated IGF-I enhanced cellular senescence in primary confluent cells. Black-Right-Pointing-Pointer IGF-I enhanced cellular senescence in the ROS and p53-dependent manner. Black-Right-Pointing-Pointer These results may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging. -- Abstract: Cellular senescence is characterized by growth arrest, enlarged and flattened cell morphology, the expression of senescence-associated {beta}-galactosidase (SA-{beta}-gal), and by activation of tumor suppressor networks. Insulin-like growth factor-I (IGF-I) plays a critical role in cellular growth, proliferation, tumorigenesis, and regulation of aging. In the presentmore » study, we show that IGF-I enhances cellular senescence in mouse, rat, and human primary cells in the confluent state. IGF-I induced expression of a DNA damage marker, {gamma}H2AX, the increased levels of p53 and p21 proteins, and activated SA-{beta}-gal. In the confluent state, an altered downstream signaling of IGF-I receptor was observed. Treatment with a reactive oxygen species (ROS) scavenger, N-acetylcystein (NAC) significantly suppressed induction of these markers, indicating that ROS are involved in the induction of cellular senescence by IGF-I. In p53-null mouse embryonic fibroblasts, the IGF-I-induced augmentation of SA-{beta}-gal and p21 was inhibited, demonstrating that p53 is required for cellular senescence induced by IGF-I. Thus, these data reveal a novel pathway whereby IGF-I enhances cellular senescence in the ROS and p53-dependent manner and may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging.« less

Lebein, a snake venom disintegrin, suppresses human colon cancer cells proliferation and tumor-induced angiogenesis through cell cycle arrest, apoptosis induction and inhibition of VEGF expression.

PubMed

Zakraoui, Ons; Marcinkiewicz, Cezary; Aloui, Zohra; Othman, Houcemeddine; Grépin, Renaud; Haoues, Meriam; Essafi, Makram; Srairi-Abid, Najet; Gasmi, Ammar; Karoui, Habib; Pagès, Gilles; Essafi-Benkhadir, Khadija

2017-01-01

Lebein, is an heterodimeric disintegrin isolated from Macrovipera lebetina snake venom that was previously characterized as an inhibitor of ADP-induced platelet aggregation. In this study, we investigated the effect of Lebein on the p53-dependent growth of human colon adenocarcinoma cell lines. We found that Lebein significantly inhibited LS174 (p53wt), HCT116 (p53wt), and HT29 (p53mut) colon cancer cell viability by inducing cell cycle arrest through the modulation of expression levels of the tumor suppression factor p53, cell cycle regulating proteins cyclin D1, CDK2, CDK4, retinoblastoma (Rb), CDK1, and cyclin-dependent kinase inhibitors p21 and p27. Interestingly, Lebein-induced apoptosis of colon cancer cells was dependent on their p53 status. Thus, in LS174 cells, cell death was associated with PARP cleavage and the activation of caspases 3 and 8 while in HCT116 cells, Lebein induced caspase-independent apoptosis through increased expression of apoptosis inducing factor (AIF). In LS174 cells, Lebein triggers the activation of the MAPK ERK1/2 pathway through induction of reactive oxygen species (ROS). It also decreased cell adhesion and migration to fibronectin through down regulation of α5β1 integrin. Moreover, Lebein significantly reduced the expression of two angiogenesis stimulators, Vascular Endothelial Growth Factor (VEGF) and Neuropilin 1 (NRP1). It inhibited the VEGF-induced neovascularization process in the quail embryonic CAM system and blocked the development of human colon adenocarcinoma in nude mice. Overall, our work indicates that Lebein may be useful to design a new therapy against colon cancer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

NF-kappaB and p53 are the dominant apoptosis-inducing transcription factors elicited by the HIV-1 envelope.

PubMed

Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido

2004-03-01

The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.

Smad Ubiquitylation Regulatory Factor 1/2 (Smurf1/2) Promotes p53 Degradation by Stabilizing the E3 Ligase MDM2*

PubMed Central

Nie, Jing; Xie, Ping; Liu, Lin; Xing, Guichun; Chang, Zhijie; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2010-01-01

The tumor suppressor p53 protein is tightly regulated by a ubiquitin-proteasomal degradation mechanism. Several E3 ubiquitin ligases, including MDM2 (mouse double minute 2), have been reported to play an essential role in the regulation of p53 stability. However, it remains unclear how the activity of these E3 ligases is regulated. Here, we show that the HECT-type E3 ligase Smurf1/2 (Smad ubiquitylation regulatory factor 1/2) promotes p53 degradation by enhancing the activity of the E3 ligase MDM2. We provide evidence that the role of Smurf1/2 on the p53 stability is not dependent on the E3 activity of Smurf1/2 but rather is dependent on the activity of MDM2. We find that Smurf1/2 stabilizes MDM2 by enhancing the heterodimerization of MDM2 with MDMX, during which Smurf1/2 interacts with MDM2 and MDMX. We finally provide evidence that Smurf1/2 regulates apoptosis through p53. To our knowledge, this is the first report to demonstrate that Smurf1/2 functions as a factor to stabilize MDM2 protein rather than as a direct E3 ligase in regulation of p53 degradation. PMID:20484049

ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies

PubMed Central

Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O.; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E.; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C.; Orlowski, Robert; Sarbassov, Dos D.; Lorenzi, Philip L.; Huang, Xuelin; Neelapu, Sattva S.; McDonnell, Timothy; Miranda, Roberto N.; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R. Eric.; Andreeff, Michael

2016-01-01

The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. PMID:26884599

Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway.

PubMed

Namba, Takushi; Chu, Kiki; Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W

2015-08-21

Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53.

Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

PubMed Central

Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.

2015-01-01

Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280

Effect of UVB radiation exposure in the expression of genes and proteins related to apoptosis in freshwater prawn embryos.

PubMed

Schramm, Heloísa; Jaramillo, Michael L; Quadros, Thaline de; Zeni, Eliane C; Müller, Yara M R; Ammar, Dib; Nazari, Evelise M

2017-10-01

Our previous studies showed that embryos of the freshwater prawn Macrobrachium olfersii exposed to ultraviolet B (UVB) radiation exhibited DNA damage, excessive ROS production, mitochondrial dysfunction and increased hsp70 expression, which are able, independently or together, to induce apoptosis. Thus, we attempted to elucidate some key apoptosis-related genes (ARG) and apoptosis-related proteins (ARP) and their expression during different stages of embryonic development, as well as to characterize the chronology of ARG expression and ARP contents after UVB radiation insult. We demonstrate that p53, Bax and Caspase3 genes are active in the embryonic cells at early embryonic developmental stages, and that the Bcl2 gene is active from the mid-embryonic stage. After UVB radiation exposure, we found an increase in ARP such as p53 and Bak after 3h of exposure. Moreover, an increase in ARG transcript levels for p53, Bax, Bcl2 and Caspase3 was observed at 6h after UVB exposure. Then, after 12h of UVB radiation exposure, an increase in Caspase3 gene expression and protein was observed, concomitantly with an increased number of apoptotic cells. Our data reveal that ARG and ARP are developmentally regulated in embryonic cells of M. olfersii and that UVB radiation causes apoptosis after 12h of exposure. Overall, we demonstrate that embryonic cells of M. olfersii are able to active the cell machinery against environmental changes, such as increased incidence of UVB radiation in aquatic ecosystems. Copyright © 2017 Elsevier B.V. All rights reserved.

p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

PubMed Central

Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

2010-01-01

The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

Selective FLT3 inhibitor FI-700 neutralizes Mcl-1 and enhances p53-mediated apoptosis in AML cells with activating mutations of FLT3 through Mcl-1/Noxa axis.

PubMed

Kojima, K; Konopleva, M; Tsao, T; Andreeff, M; Ishida, H; Shiotsu, Y; Jin, L; Tabe, Y; Nakakuma, H

2010-01-01

Treatment using Fms-like tyrosine kinase-3 (FLT3) inhibitors is a promising approach to overcome the dismal prognosis of acute myeloid leukemia (AML) with activating FLT3 mutations. Current trials are combining FLT3 inhibitors with p53-activating conventional chemotherapy. The mechanisms of cytotoxicity of FLT3 inhibitors are poorly understood. We investigated the interaction of FLT3 and p53 pathways after their simultaneous blockade using the selective FLT3 inhibitor FI-700 and the MDM2 inhibitor Nutlin-3 in AML. We found that FI-700 immediately reduced antiapoptotic Mcl-1 levels and enhanced Nutlin-induced p53-mediated mitochondrial apoptosis in FLT3/internal tandem duplication cells through the Mcl-1/Noxa axis. FI-700 induced proteasome-mediated degradation of Mcl-1, resulting in the reduced ability of Mcl-1 to sequester proapoptotic Bim. Nutlin-3 induced Noxa, which displaced Bim from Mcl-1. The FI-700/Nutlin-3 combination profoundly activated Bax and induced apoptosis. Our findings suggest that FI-700 actively enhances p53 signaling toward mitochondrial apoptosis and that a combination strategy aimed at inhibiting FLT3 and activating p53 signaling could potentially be effective in AML.

Rb and p53 Liver Functions Are Essential for Xenobiotic Metabolism and Tumor Suppression

PubMed Central

Nantasanti, Sathidpak; Toussaint, Mathilda J. M.; Youssef, Sameh A.; Tooten, Peter C. J.; de Bruin, Alain

2016-01-01

The tumor suppressors Retinoblastoma (Rb) and p53 are frequently inactivated in liver diseases, such as hepatocellular carcinomas (HCC) or infections with Hepatitis B or C viruses. Here, we discovered a novel role for Rb and p53 in xenobiotic metabolism, which represent a key function of the liver for metabolizing therapeutic drugs or toxins. We demonstrate that Rb and p53 cooperate to metabolize the xenobiotic 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC). DDC is metabolized mainly by cytochrome P450 (Cyp)3a enzymes resulting in inhibition of heme synthesis and accumulation of protoporphyrin, an intermediate of heme pathway. Protoporphyrin accumulation causes bile injury and ductular reaction. We show that loss of Rb and p53 resulted in reduced Cyp3a expression decreased accumulation of protoporphyrin and consequently less ductular reaction in livers of mice fed with DDC for 3 weeks. These findings provide strong evidence that synergistic functions of Rb and p53 are essential for metabolism of DDC. Because Rb and p53 functions are frequently disabled in liver diseases, our results suggest that liver patients might have altered ability to remove toxins or properly metabolize therapeutic drugs. Strikingly the reduced biliary injury towards the oxidative stress inducer DCC was accompanied by enhanced hepatocellular injury and formation of HCCs in Rb and p53 deficient livers. The increase in hepatocellular injury might be related to reduce protoporphyrin accumulation, because protoporphrin is well known for its anti-oxidative activity. Furthermore our results indicate that Rb and p53 not only function as tumor suppressors in response to carcinogenic injury, but also in response to non-carcinogenic injury such as DDC. PMID:26967735

p53 coordinates decidual sestrin 2/AMPK/mTORC1 signaling to govern parturition timing

PubMed Central

Cha, Jeeyeon; Yuan, Jia; Haraguchi, Hirofumi; Bartos, Amanda; Bradshaw, Heather B.; Hirota, Yasushi; Dey, Sudhansu K.

2016-01-01

Inflammation and oxidative stress are known risk factors for preterm birth (PTB); however, the mechanisms and pathways that influence this condition are not fully described. Previously, we showed that mTORC1 signaling is increased in mice harboring a uterine-specific deletion of transformation-related protein 53 (p53d/d mice), which exhibit premature decidual senescence that triggers spontaneous and inflammation-induced PTB. Treatment with the mTORC1 inhibitor rapamycin reduced the incidence of PTB in the p53d/d mice. Decidual senescence with heightened mTORC1 signaling is also a signature of human PTB. Here, we have identified an underlying mechanism for PTB and a potential therapeutic strategy for treating the condition. Treatment of pregnant p53d/d mice with either the antidiabetic drug metformin or the antioxidant resveratrol activated AMPK signaling and inhibited mTORC1 signaling in decidual cells. Both metformin and resveratrol protected against spontaneous and inflammation-induced PTB in p53d/d females. Using multiple approaches, we determined that p53 interacts with sestrins to coordinate an inverse relationship between AMPK and mTORC1 signaling that determines parturition timing. This signature was also observed in human decidual cells. Together, these results reveal that p53-dependent coordination of AMPK and mTORC1 signaling controls parturition timing and suggest that metformin and resveratrol have therapeutic potential to prevent PTB. PMID:27454290

Long noncoding RNA MEG3 mediated angiogenesis after cerebral infarction through regulating p53/NOX4 axis.

PubMed

Zhan, Renya; Xu, Kangli; Pan, Jianwei; Xu, Qingsheng; Xu, Shengjie; Shen, Jian

2017-08-26

This study aimed to explore the mechanism of lncRNA MEG3 on angiogenesis after cerebral infarction (CI). The rat brain microvascular endothelial cells (RBMVECs) isolated from rat was used to establish CI model, which were treated with oxygen-glucose deprivation/reoxygenation (OGD/R). The genes mRNA and protein expression levels in RBMVECs were determined by the quantitative real-time polymerase chain reaction (RT-qPCR) and western blot, respectively. The flow cytometry was used to measured cell apoptosis and intracellular reactive oxygen species (ROS) generation. The RBMVECs activities was detected by MTT method. The RNA-immunoprecipitation (RIP) assay was used to detect the interaction between MEG3 and p53, and the relationship between p53 and NOX4 was proved by chromatin co-immunoprecipitation (chip) assay. The results showed that OGD or OGD/R increased MEG3 and NOX4 expression, and there was positive correlation between MEG3 and NOX4 expression in RBMVECs. Next, knockdown of MEG3 indicated that inhibition of MEG3 was conducive to protect RBMVECs against OGD/R-induced apoptosis, with decreased NOX4 and p53 expression, further enhanced pro-angiogenic factors (HIF-1α and VEGF) expression, and reduced intracellular ROS generation. And then the RIP and CHIP assay demonstrated that MEG3 could interacted with p53 and regulated its expression, and p53 exerted significant binding in the promoters for NOX4, suggesting that MEG3 regulated NOX4 expression via p53. At last, knockdown of NOX4 indicated that inhibition of NOX4 protected RBMVECs against OGD/R-induced apoptosis, with increased cell viability and pro-angiogenic factors expression, and reduced ROS generation. LncRNA MEG3 was an important regulator in OGD/R induced-RBMVECs apoptosis and the mechanism of MEG3 on angiogenesis after CI was reduced ROS by p53/NOX4 axis. Copyright © 2017 Elsevier Inc. All rights reserved.

[Interaction between p53 and MDM2 in human lung cancer cells].

PubMed

Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

2014-01-01

The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.

ERK mediated upregulation of death receptor 5 overcomes the lack of p53 functionality in the diaminothiazole DAT1 induced apoptosis in colon cancer models: efficiency of DAT1 in Ras-Raf mutated cells.

PubMed

Thamkachy, Reshma; Kumar, Rohith; Rajasekharan, K N; Sengupta, Suparna

2016-03-08

p53 is a tumour suppressor protein that plays a key role in many steps of apoptosis, and malfunctioning of this transcription factor leads to tumorigenesis. Prognosis of many tumours also depends upon the p53 status. Most of the clinically used anticancer compounds activate p53 dependent pathway of apoptosis and hence require p53 for their mechanism of action. Further, Ras/Raf/MEK/ERK axis is an important signaling pathway activated in many cancers. Dependence of diaminothiazoles, compounds that have gained importance recently due to their anticancer and anti angiogenic activities, were tested in cancer models with varying p53 or Ras/Raf mutational status. In this study we have used p53 mutated and knock out colon cancer cells and xenograft tumours to study the role of p53 in apoptosis mediated by diaminothiazoles. Colon cancer cell lines with varying mutational status for Ras or Raf were also used. We have also examined the toxicity and in vivo efficacy of a lead diaminothiazole 4-Amino-5-benzoyl-2-(4-methoxy phenylamino)thiazole (DAT1) in colon cancer xenografts. We have found that DAT1 is active in both in vitro and in vivo models with nonfunctional p53. Earlier studies have shown that extrinsic pathway plays major role in DAT1 mediated apoptosis. In this study, we have found that DAT1 is causing p53 independent upregulation of the death receptor 5 by activating the Ras/Raf/MEK/ERK signaling pathway both in wild type and p53 suppressed colon cancer cells. These findings are also confirmed by the in vivo results. Further, DAT1 is more efficient to induce apoptosis in colon cancer cells with mutated Ras or Raf. Minimal toxicity in both acute and subacute studies along with the in vitro and in vivo efficacy of DAT1 in cancers with both wild type and nonfunctional p53 place it as a highly beneficial candidate for cancer chemotherapy. Besides, efficiency in cancer cells with mutations in the Ras oncoprotein or its downstream kinase Raf raise interest in diaminothiazole class of compounds for further follow-up.

ΔNp63 promotes pediatric neuroblastoma and osteosarcoma by regulating tumor angiogenesis

PubMed Central

Bid, Hemant K.; Roberts, Ryan D.; Cam, Maren; Audino, Anthony; Kurmasheva, Raushan T.; Lin, Jiayuh; Houghton, Peter J.; Cam, Hakan

2013-01-01

The tumor suppressor gene p53 and its family members p63/p73 are critical determinants of tumorigenesis. ΔNp63 is a splice variant of p63, which lacks the N-terminal transactivation domain. It is thought to antagonize p53-, p63- and p73- dependent translation, thus blocking their tumor suppressor activity. In our studies of the pediatric solid tumors neuroblastoma and osteosarcoma, we find overexpression of ΔNp63; however, there is no correlation of ΔNp63 expression with p53 mutation status. Our data suggest that ΔNp63 itself endows cells with a gain of function that leads to malignant transformation, a function independent of any p53 antagonism. Here, we demonstrate that ΔNp63 overexpression, independent of p53, increases secretion of interleukin-6 (IL-6) and interleukin-8 (IL-8), leading to elevated phosphorylation of STAT-3 (Tyr-705). We show that elevated phosphorylation of STAT-3 leads to stabilization of HIF-1α protein, resulting in VEGF secretion. We also show human clinical data, which suggests a mechanistic role for ΔNp63 in osteosarcoma metastasis. In summary, our studies reveal the mechanism by which ΔNp63, as a master transcription factor, modulates tumor angiogenesis. PMID:24154873

Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

PubMed Central

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

2014-01-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.

PubMed

Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya

2009-07-01

p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

Pomegranate protects against arsenic-induced p53-dependent ROS-mediated inflammation and apoptosis in liver cells.

PubMed

Choudhury, Sreetama; Ghosh, Sayan; Mukherjee, Sudeshna; Gupta, Payal; Bhattacharya, Saurav; Adhikary, Arghya; Chattopadhyay, Sreya

2016-12-01

Molecular mechanisms involved in arsenic-induced toxicity are complex and elusive. Liver is one of the most favored organs for arsenic toxicity as methylation of arsenic occurs mostly in the liver. In this study, we have selected a range of environmentally relevant doses of arsenic to examine the basis of arsenic toxicity and the role of pomegranate fruit extract (PFE) in combating it. Male Swiss albino mice exposed to different doses of arsenic presented marked hepatic injury as evident from histological and electron microscopic studies. Increased activities of enzymes alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase and alkaline phosphatase corroborated extensive liver damage. It was further noted that arsenic exposure initiated reactive oxygen species (ROS)-dependent apoptosis in the hepatocytes involving loss of mitochondrial membrane potential. Arsenic significantly increased nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB), coupled with increase in phosphorylated Iκ-B, possibly as adaptive cellular survival strategies. Arsenic-induced oxidative DNA damage to liver cells culminated in p53 activation and increased expression of p53 targets like miR-34a and Bax. Pomegranate polyphenols are known to possess remarkable antioxidant properties and are capable of protecting normal cells from various stimuli-induced oxidative stress and toxicities. We explored the protective role of PFE in ameliorating arsenic-induced hepatic damage. PFE was shown to reduce ROS generation in hepatocytes, thereby reducing arsenic-induced Nrf2 activation. PFE also inhibited arsenic-induced NF-κB-inflammatory pathway. Data revealed that PFE reversed arsenic-induced hepatotoxicity and apoptosis by modulating the ROS/Nrf2/p53-miR-34a axis. For the first time, we have mapped the possible signaling pathways associated with arsenic-induced hepatotoxicity and its rescue by pomegranate polyphenols. Copyright © 2016 Elsevier Inc. All rights reserved.

New Insights into the Mechanism of Inhibition of p53 by Simian Virus 40 Large T Antigen

PubMed Central

Sheppard, Hilary M.; Corneillie, Siska I.; Espiritu, Christine; Gatti, Andrea; Liu, Xuan

1999-01-01

Simian virus 40 (SV40) large tumor antigen (T antigen) has been shown to inhibit p53-dependent transcription by preventing p53 from binding to its cognate cis element. Data presented in this report provide the first direct functional evidence that T antigen, under certain conditions, may also repress p53-dependent transcription by a mechanism in which the transactivation domain of p53 is abrogated while DNA binding is unaffected. Specifically, p53 purified as a complex with T antigen from mouse cells was found to bind DNA as a transcriptionally inactive intact complex, while that purified from human cells was found to bind DNA independently of T antigen and could activate p53-dependent transcription. This difference in activity may be dependent on a different interaction of T antigen with mouse and human p53 and, in addition, on the presence of super T, which is found only in transformed rodent cells. These results suggest that subtle yet important differences exist between the inhibition of p53 by T antigen in mouse and human cells. The implications of this finding with respect to SV40-associated malignancies are discussed. PMID:10082540

Simvastatin rises reactive oxygen species levels and induces senescence in human melanoma cells by activation of p53/p21 pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guterres, Fernanda Augusta de Lima Barbosa; Martinez, Glaucia Regina; Rocha, Maria Eliane Merlin

2013-11-15

Recent studies demonstrated that simvastatin has antitumor properties in several types of cancer cells, mainly by inducing apoptosis and inhibiting growth. The arrest of proliferation is a feature of cellular senescence; however, the occurrence of senescence in melanoma cells upon simvastatin treatment has not been investigated until now. Our results demonstrated that exposure of human metastatic melanoma cells (WM9) to simvastatin induces a senescent phenotype, characterized by G1 arrest, positive staining for senescence-associated β-galactosidase assay, and morphological changes. Also, the main pathways leading to cell senescence were examined in simvastatin-treated human melanoma cells, and the expression levels of phospho-p53 andmore » p21 were upregulated by simvastatin, suggesting that cell cycle regulators and DNA damage pathways are involved in the onset of senescence. Since simvastatin can act as a pro-oxidant agent, and oxidative stress may be related to senescence, we measured the intracellular ROS levels in WM9 cells upon simvastatin treatment. Interestingly, we found an increased amount of intracellular ROS in these cells, which was accompanied by elevated expression of catalase and peroxiredoxin-1. Collectively, our results demonstrated that simvastatin can induce senescence in human melanoma cells by activation of p53/p21 pathway, and that oxidative stress may be related to this process. - Highlights: • Lower concentrations of simvastatin can induce senescent phenotype in melanoma cells. • Simvastatin induces senescence in human melanoma cells via p53/p21 pathway. • Senescent phenotype is related with increased intracellular ROS. • Partial detoxification of ROS by catalase/peroxiredoxin-1 could lead cells to senescence rather than apoptosis.« less

Activation of the AMP-activated protein kinase-p38 MAP kinase pathway mediates apoptosis induced by conjugated linoleic acid in p53-mutant mouse mammary tumor cells.

PubMed

Hsu, Yung-Chung; Meng, Xiaojing; Ou, Lihui; Ip, Margot M

2010-04-01

Conjugated linoleic acid (CLA) inhibits tumorigenesis and tumor growth in most model systems, an effect mediated in part by its pro-apoptotic activity. We previously showed that trans-10,cis-12 CLA induced apoptosis of p53-mutant TM4t mouse mammary tumor cells through both mitochondrial and endoplasmic reticulum stress pathways. In the current study, we investigated the role of AMP-activated protein kinase (AMPK), a key player in fatty acid metabolism, in CLA-induced apoptosis in TM4t cells. We found that t10,c12-CLA increased phosphorylation of AMPK, and that CLA-induced apoptosis was enhanced by the AMPK agonist 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR) and inhibited by the AMPK inhibitor compound C. The increased AMPK activity was not due to nutrient/energy depletion since ATP levels did not change in CLA-treated cells, and knockdown of the upstream kinase LKB1 did not affect its activity. Furthermore, our data do not demonstrate a role for the AMPK-modulated mTOR pathway in CLA-induced apoptosis. Although CLA decreased mTOR levels, activity was only modestly decreased. Moreover, rapamycin, which completely blocked the activity of mTORC1 and mTORC2, did not induce apoptosis, and attenuated rather than enhanced CLA-induced apoptosis. Instead, the data suggest that CLA-induced apoptosis is mediated by the AMPK-p38 MAPK-Bim pathway: CLA-induced phosphorylation of AMPK and p38 MAPK, and increased expression of Bim, occurred with a similar time course as apoptosis; phosphorylation of p38 MAPK was blocked by compound C; the increased Bim expression was blocked by p38 MAPK siRNA; CLA-induced apoptosis was attenuated by the p38 inhibitor SB-203580 and by siRNAs directed against p38 MAPK or Bim. Copyright 2009 Elsevier Inc. All rights reserved.

Hepatitis C virus Core overcomes all-trans retinoic acid-induced apoptosis in human hepatoma cells by inhibiting p14 expression via DNA methylation

PubMed Central

Kwak, Juri; Choi, Jung-Hye; Jang, Kyung Lib

2017-01-01

All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, is known to induce p14 expression via promoter hypomethylation to activate the p14-MDM2-p53 pathway, which leads to activation of the p53-dependent apoptotic pathway and subsequent induction of apoptosis in human hepatoma cells. In the present study, we found that hepatitis C virus (HCV) Core derived from ectopic expression or HCV infection overcomes ATRA-induced apoptosis in p53-positive hepatoma cells. For this effect, HCV Core upregulated both protein levels and enzyme activities of DNA methyltransferase 1 (DNMT1), DNMT3a, and DNMT3b and thereby repressed p14 expression via promoter hypermethylation, resulting in inactivation of the pathway leading to p53 accumulation in the presence of ATRA. As a result, HCV Core prevented ATRA from activating several apoptosis-related molecules, including Bax, p53 upregulated modulator of apoptosis, caspase-9, caspase-3, and poly (ADP-ribose) polymerase. In addition, complementation of p14 in the Core-expressing cells by either ectopic expression or treatment with 5-Aza-2′dC almost completely abolished the potential of HCV Core to suppress ATRA-induced apoptosis. Based on these observations, we conclude that HCV Core executes its oncogenic potential by suppressing the p53-dependent apoptosis induced by ATRA in human hepatoma cells. PMID:29156743

Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

PubMed

Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

2018-05-18

The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

Inhibition of p53 attenuates steatosis and liver injury in a mouse model of non-alcoholic fatty liver disease.

PubMed

Derdak, Zoltan; Villegas, Kristine A; Harb, Ragheb; Wu, Annie M; Sousa, Aryanna; Wands, Jack R

2013-04-01

p53 and its transcriptional target miRNA34a have been implicated in the pathogenesis of fatty liver. We tested the efficacy of a p53 inhibitor, pifithrin-α p-nitro (PFT) in attenuating steatosis, associated oxidative stress and apoptosis in a murine model of non-alcoholic fatty liver disease (NAFLD). C57BL/6 mice were fed a high-fat (HFD) or control diet for 8 weeks; PFT or DMSO (vehicle) was administered three times per week. Markers of oxidative stress and apoptosis as well as mediators of hepatic fatty acid metabolism were assessed by immunohistochemistry, Western blot, real-time PCR, and biochemical assays. PFT administration suppressed HFD-induced weight gain, ALT elevation, steatosis, oxidative stress, and apoptosis. PFT treatment blunted the HFD-induced upregulation of miRNA34a and increased SIRT1 expression. In the livers of HFD-fed, PFT-treated mice, activation of the SIRT1/PGC1α/PPARα axis increased the expression of malonyl-CoA decarboxylase (MLYCD), an enzyme responsible for malonyl-CoA (mCoA) degradation. Additionally, the SIRT1/LKB1/AMPK pathway (upstream activator of MLYCD) was promoted by PFT. Thus, induction of these two pathways by PFT diminished the hepatic mCoA content by enhancing MLYCD expression and function. Since mCoA inhibits carnitine palmitoyltransferase 1 (CPT1), the decrease of hepatic mCoA in the PFT-treated, HFD-fed mice increased CPT1 activity, favored fatty acid oxidation, and decreased steatosis. Additionally, we demonstrated that PFT abrogated steatosis and promoted MLYCD expression in palmitoleic acid-treated human HepaRG cells. The p53 inhibitor PFT diminished hepatic triglyceride accumulation and lipotoxicity in mice fed a HFD, by depleting mCoA and favoring the β-oxidation of fatty acids. Copyright © 2012 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.