Science.gov

Sample records for activity planner sap

  1. Mars Exploration Rover Operations with the Science Activity Planner

    NASA Technical Reports Server (NTRS)

    Jeffrey S. Norris; Powell, Mark W.; Vona, Marsette A.; Backes, Paul G.; Wick, Justin V.

    2005-01-01

    The Science Activity Planner (SAP) is the primary science operations tool for the Mars Exploration Rover mission and NASA's Software of the Year for 2004. SAP utilizes a variety of visualization and planning capabilities to enable the mission operations team to direct the activities of the Spirit and Opportunity rovers. This paper outlines some of the challenging requirements that drove the design of SAP and discusses lessons learned from the development and use of SAP in mission operations.

  2. Science Activity Planner for the MER Mission

    NASA Technical Reports Server (NTRS)

    Norris, Jeffrey S.; Crockett, Thomas M.; Fox, Jason M.; Joswig, Joseph C.; Powell, Mark W.; Shams, Khawaja S.; Torres, Recaredo J.; Wallick, Michael N.; Mittman, David S.

    2008-01-01

    The Maestro Science Activity Planner is a computer program that assists human users in planning operations of the Mars Explorer Rover (MER) mission and visualizing scientific data returned from the MER rovers. Relative to its predecessors, this program is more powerful and easier to use. This program is built on the Java Eclipse open-source platform around a Web-browser-based user-interface paradigm to provide an intuitive user interface to Mars rovers and landers. This program affords a combination of advanced display and simulation capabilities. For example, a map view of terrain can be generated from images acquired by the High Resolution Imaging Science Explorer instrument aboard the Mars Reconnaissance Orbiter spacecraft and overlaid with images from a navigation camera (more precisely, a stereoscopic pair of cameras) aboard a rover, and an interactive, annotated rover traverse path can be incorporated into the overlay. It is also possible to construct an overhead perspective mosaic image of terrain from navigation-camera images. This program can be adapted to similar use on other outer-space missions and is potentially adaptable to numerous terrestrial applications involving analysis of data, operations of robots, and planning of such operations for acquisition of scientific data.

  3. Antidiarrhoeal Activity of Musa paradisiaca Sap in Wistar Rats

    PubMed Central

    Yakubu, Musa T.; Nurudeen, Quadri O.; Salimon, Saoban S.; Yakubu, Monsurat O.; Jimoh, Rukayat O.; Nafiu, Mikhail O.; Akanji, Musbau A.; Oladiji, Adenike T.; Williams, Felicia E.

    2015-01-01

    The folkloric claim of Musa paradisiaca sap in the management of diarrhoea is yet to be substantiated or refuted with scientific data. Therefore, the aim of the current study was to screen the sap of M. paradisiaca for both its secondary metabolites and antidiarrhoeal activity at 0.25, 0.50, and 1.00 mL in rats. Secondary metabolites were screened using standard methods while the antidiarrhoeal activity was done by adopting the castor oil-induced diarrhoeal, castor oil-induced enteropooling, and gastrointestinal motility models. The sap contained flavonoids, phenolics, saponins, alkaloids, tannins, and steroids while cardiac glycosides, anthraquinones, triterpenes, cardenolides, and dienolides were not detected. In the castor oil-induced diarrhoeal model, the sap significantly (P < 0.05) prolonged the onset time of diarrhoea, decreased the number, fresh weight, and water content of feaces, and increased the inhibition of defecations. Na+-K+-ATPase activity in the small intestine increased significantly whereas nitric oxide content decreased. The decreases in the masses and volumes of intestinal fluid by the sap were accompanied by increase in inhibition of intestinal fluid content in the enteropooling model. The sap decreased the charcoal meal transit in the gastrointestinal motility model. In all the models, the 1.00 mL of the sap produced changes that compared well with the reference drugs. Overall, the antidiarrhoeal activity of Musa paradisiaca sap attributed to the presence of alkaloids, phenolics, flavonoids, and/or saponins which may involve, among others, enhancing fluid and electrolyte absorption through de novo synthesis of the sodium potassium ATPase and/or reduced nitric oxide levels. PMID:25893000

  4. Antidiarrhoeal Activity of Musa paradisiaca Sap in Wistar Rats.

    PubMed

    Yakubu, Musa T; Nurudeen, Quadri O; Salimon, Saoban S; Yakubu, Monsurat O; Jimoh, Rukayat O; Nafiu, Mikhail O; Akanji, Musbau A; Oladiji, Adenike T; Williams, Felicia E

    2015-01-01

    The folkloric claim of Musa paradisiaca sap in the management of diarrhoea is yet to be substantiated or refuted with scientific data. Therefore, the aim of the current study was to screen the sap of M. paradisiaca for both its secondary metabolites and antidiarrhoeal activity at 0.25, 0.50, and 1.00 mL in rats. Secondary metabolites were screened using standard methods while the antidiarrhoeal activity was done by adopting the castor oil-induced diarrhoeal, castor oil-induced enteropooling, and gastrointestinal motility models. The sap contained flavonoids, phenolics, saponins, alkaloids, tannins, and steroids while cardiac glycosides, anthraquinones, triterpenes, cardenolides, and dienolides were not detected. In the castor oil-induced diarrhoeal model, the sap significantly (P < 0.05) prolonged the onset time of diarrhoea, decreased the number, fresh weight, and water content of feaces, and increased the inhibition of defecations. Na(+)-K(+)-ATPase activity in the small intestine increased significantly whereas nitric oxide content decreased. The decreases in the masses and volumes of intestinal fluid by the sap were accompanied by increase in inhibition of intestinal fluid content in the enteropooling model. The sap decreased the charcoal meal transit in the gastrointestinal motility model. In all the models, the 1.00 mL of the sap produced changes that compared well with the reference drugs. Overall, the antidiarrhoeal activity of Musa paradisiaca sap attributed to the presence of alkaloids, phenolics, flavonoids, and/or saponins which may involve, among others, enhancing fluid and electrolyte absorption through de novo synthesis of the sodium potassium ATPase and/or reduced nitric oxide levels.

  5. Coordinating the activities of a planner and an execution agent

    NASA Technical Reports Server (NTRS)

    Tate, Austin

    1989-01-01

    A research program was defined that will explore the link between planning and execution systems. A simple scenario was defined in which a very capable off-line planning system interacts with the user and a smaller, less capable, on-line real-time system executing plans and reacting to faults. However, the on-line execution system may have a more flexible representation of the plans it is executing. This imbalance in the capabilities of the two agents involved should clarify some of the research objectives and give an experimental framework for the work. The task is to investigate the knowledge representations and communication protocols needed to link a user stating some requirements for a task to be carried out through a planning system to the (remote) execution agent that can carry out the user's wishes. The notion that a single representation can encapsulate the expression of the user's requirements, the capabilities for action, the communication to the execution agent, the successful or faulty response from the execution agent and the means of keeping the user informed, is examined. Methods of creating plan patches to update the plans separately held by each of the parties involved to keep them in step as they each react to changing circumstances in real-time is investigated. This involves the specification of plan patch attachment points that can be understood by the recipient. Transaction based methods are also investigated for coordinating the activities of the planner with those of the execution agent and user. The trial application area for the research is in the command and control of an advanced Earth Observation Space Platform.

  6. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities approved in your...

  7. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  8. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  9. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  10. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, REGULATION, AND... OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting...

  11. A vision system planner for increasing the autonomy of the Extravehicular Activity Helper/Retriever

    NASA Technical Reports Server (NTRS)

    Magee, Michael

    1993-01-01

    The Extravehicular Activity Retriever (EVAR) is a robotic device currently being developed by the Automation and Robotics Division at the NASA Johnson Space Center to support activities in the neighborhood of the Space Shuttle or Space Station Freedom. As the name implies, the Retriever's primary function will be to provide the capability to retrieve tools and equipment or other objects which have become detached from the spacecraft, but it will also be able to rescue a crew member who may have become inadvertently de-tethered. Later goals will include cooperative operations between a crew member and the Retriever such as fetching a tool that is required for servicing or maintenance operations. This paper documents a preliminary design for a Vision System Planner (VSP) for the EVAR that is capable of achieving visual objectives provided to it by a high level task planner. Typical commands which the task planner might issue to the VSP relate to object recognition, object location determination, and obstacle detection. Upon receiving a command from the task planner, the VSP then plans a sequence of actions to achieve the specified objective using a model-based reasoning approach. This sequence may involve choosing an appropriate sensor, selecting an algorithm to process the data, reorienting the sensor, adjusting the effective resolution of the image using lens zooming capability, and/or requesting the task planner to reposition the EVAR to obtain a different view of the object. An initial version of the Vision System Planner which realizes the above capabilities using simulated images has been implemented and tested. The remaining sections describe the architecture and capabilities of the VSP and its relationship to the high level task planner. In addition, typical plans that are generated to achieve visual goals for various scenarios are discussed. Specific topics to be addressed will include object search strategies, repositioning of the EVAR to improve the

  12. 30 CFR 285.617 - What activities require a revision to my SAP, and when will MMS approve the revision?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What activities require a revision to my SAP... Activities Under An Approved Sap § 285.617 What activities require a revision to my SAP, and when will MMS... your approved SAP, describing in detail the type of activities you propose to conduct. We...

  13. MSLICE Science Activity Planner for the Mars Science Laboratory Mission

    NASA Technical Reports Server (NTRS)

    Powell, Mark W.; Shams, Khawaja S.; Wallick, Michael N.; Norris, Jeffrey S.; Joswig, Joseph C.; Crockett, Thomas M.; Fox, Jason M.; Torres, Recaredo J.; Kurien, James A.; McCurdy, Michael P.; Pyrzak, Guy; Aghevli, Arash; Bachmann, Andrew G.

    2009-01-01

    MSLICE (Mars Science Laboratory InterfaCE) is the tool used by scientists and engineers on the Mars Science Laboratory rover mission to visualize the data returned by the rover and collaboratively plan its activities. It enables users to efficiently and effectively search all mission data to find applicable products (e.g., images, targets, activity plans, sequences, etc.), view and plan the traverse of the rover in HiRISE (High Resolution Imaging Science Experiment) images, visualize data acquired by the rover, and develop, model, and validate the activities the rover will perform. MSLICE enables users to securely contribute to the mission s activity planning process from their home institutions using off-the-shelf laptop computers. This software has made use of several plug-ins (software components) developed for previous missions [e.g., Mars Exploration Rover (MER), Phoenix Mars Lander (PHX)] and other technology tasks. It has a simple, intuitive, and powerful search capability. For any given mission, there is a huge amount of data and associated metadata that is generated. To help users sort through this information, MSLICE s search interface is provided in a similar fashion as major Internet search engines. With regard to the HiRISE visualization of the rover s traverse, this view is a map of the mission that allows scientists to easily gauge where the rover has been and where it is likely to go. The map also provides the ability to correct or adjust the known position of the rover through the overlaying of images acquired from the rover on top of the HiRISE image. A user can then correct the rover s position by collocating the visible features in the overlays with the same features in the underlying HiRISE image. MSLICE users can also rapidly search all mission data for images that contain a point specified by the user in another image or panoramic mosaic. MSLICE allows the creation of targets, which provides a way for scientists to collaboratively name

  14. Effects of antifungal agents in sap activity of Candida albicans isolates.

    PubMed

    Costa, Carolina Rodrigues; Jesuíno, Rosália Santos Amorim; de Aquino Lemos, Janine; de Fátima Lisboa Fernandes, Orionalda; Hasimoto e Souza, Lúcia Kioko; Passos, Xisto Sena; do Rosário Rodrigues Silva, Maria

    2010-02-01

    Some antifungal agents have shown to exert effects on expression of virulent factors of Candida as the production of secretory aspartyl proteinase (Sap). In this study, we sought to determine and to compare the influence of fluconazole and voriconazole in proteinase activity of this microorganism. Thirty-one isolates obtained from oral mucosa of human immunodeficiency virus positive (HIV) patients were used in this study. The minimal inhibitory concentrations (MIC) of fluconazole and voriconazole were determined using the broth microdilution method with RPMI 1640 medium and with yeast carbon base-bovine serum albumin (YCB-BSA) medium. The Sap activity following by digestion of BSA as substrate was determined for four Candida albicans strains arbitrarily chosen according to susceptibility (susceptible or resistant) to fluconazole or voriconazole. Besides, the SAP1 to SAP7 genes were screened by PCR for the same isolates that were determined by the Sap activity. In vitro susceptibility testing using the two media presented similar MIC values. Increased Sap activity was observed in resistant isolates on presence of drugs, but the Sap activity by susceptible isolates to azoles showed different behavior on the presence of drug. We detected the presence of SAP1 to SAP7 genes from all susceptible or resistant C. albicans isolates. The present study provides important data about the proteinase activity and the presence of genes of SAP family in fluconazole and voriconazole susceptible or resistant C. albicans isolates.

  15. Distributed Operations for the Mars Exploration Rover Mission with the Science Activity Planner

    NASA Technical Reports Server (NTRS)

    Wick, Justin V.; Callas, John L.; Norris, Jeffrey S.; Powell, Mark W.; Vona, Marsette A., III

    2005-01-01

    Due to the length of the Mars Exploration Rover Mission, most scientists were unable to stay at the central operations facility at the Jet Propulsion Laboratory. This created a need for distributed operations software, in the form of the Distributed Science Activity Planner. The distributed architecture saved a considerable amount of money and increased the number of individuals who could be actively involved in the mission, contributing to its success.

  16. NuSAP modulates the dynamics of kinetochore microtubules by attenuating MCAK depolymerisation activity

    PubMed Central

    Li, Chenyu; Zhang, Yajun; Yang, Qiaoyun; Ye, Fan; Sun, Stella Ying; Chen, Ee Sin; Liou, Yih-Cherng

    2016-01-01

    Nucleolar and spindle-associated protein (NuSAP) is a microtubule-associated protein that functions as a microtubule stabiliser. Depletion of NuSAP leads to severe mitotic defects, however the mechanism by which NuSAP regulates mitosis remains elusive. In this study, we identify the microtubule depolymeriser, mitotic centromere-associated kinesin (MCAK), as a novel binding partner of NuSAP. We show that NuSAP regulates the dynamics and depolymerisation activity of MCAK. Phosphorylation of MCAK by Aurora B kinase, a component of the chromosomal passenger complex, significantly enhances the interaction of NuSAP with MCAK and modulates the effects of NuSAP on the depolymerisation activity of MCAK. Our results reveal an underlying mechanism by which NuSAP controls kinetochore microtubule dynamics spatially and temporally by modulating the depolymerisation function of MCAK in an Aurora B kinase-dependent manner. Hence, this study provides new insights into the function of NuSAP in spindle formation during mitosis. PMID:26733216

  17. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  18. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  19. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  20. 30 CFR 285.617 - What activities require a revision to my SAP, and when will MMS approve the revision?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities require a revision to my SAP... OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.617 What activities require a revision to my SAP, and when will MMS approve the revision? (a) You...

  1. Further studies on the reconstitution of glucosylceramidase activity by Sap C and anionic phospholipids.

    PubMed

    Salvioli, R; Tatti, M; Ciaffoni, F; Vaccaro, A M

    2000-04-21

    The reconstitution of the activity of the lysosomal enzyme glucosylceramidase requires anionic phospholipids and, at least, a protein factor, saposin C (Sap C). We have previously proposed a mechanism for the glucosylceramidase activation [Vaccaro et al. (1993) FEBS Lett. 336, 159-162] which implies that Sap C promotes the association of the enzyme with anionic phospholipid-containing membranes, thus favoring the contact between the enzyme and its lipid substrate, glucosylceramide. We have further investigated the properties of Sap C using a fluorescent hydrophobic probe such as 4, 4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS). The binding between bis-ANS and Sap C was pH-dependent, indicating that protonation leads to increased exposure of hydrophobic surfaces of Sap C. The interaction of Sap C with membranes, triggered by the development of hydrophobic properties at low pH values, was affected by the content of anionic phospholipids, such as phosphatidylserine or phosphatidylinositol, suggesting that anionic phospholipids have the potential to modulate the insertion of Sap C in the hydrophobic environment of lysosomal membranes. We previously showed that Sap C and anionic phospholipids are both required for the binding of glucosylceramidase to large vesicles. We have presently observed that Sap C is able to promote the association of glucosylceramidase with the lipid surface only when anionic phospholipids exceed a concentration of 5-10%. This level can be reached by summing lower amounts of individual anionic phospholipids, since they have additive effects. The present data extend and refine our model of the mechanism of glucosylceramidase activation and stress the key role of pH, Sap C and anionic phospholipids in promoting the interaction of the enzyme with membranes.

  2. The correlation of virulence, pathogenicity, and itraconazole resistance with SAP activity in Candida albicans strains.

    PubMed

    Feng, Wenli; Yang, Jing; Pan, Yanwei; Xi, Zhiqin; Qiao, Zusha; Ma, Yan

    2016-02-01

    The relationship between SAP2 activity and drug resistance in Candida albicans was investigated by using itraconazole-resistant and itraconazole-sensitive C. albicans isolates. The precipitation zones were measured to analyze SAP2 activity. Mice were classified into itraconazole-resistant and -sensitive C. albicans isolate groups, and a control group, with their survival and mortality rate being observed over 30 days. The relative expression levels of CDR1, CDR2, MDR1, and SAP2 were measured using RT-PCR. It was found that the secreted aspartyl proteinase activity of itraconazole-resistant C. albicans strains was significantly higher than that of itraconazole-sensitive C. albicans strains (P < 0.001). A significantly higher mortality rate was recorded for mice treated with itraconazole-resistant C. albicans than for mice treated with itraconazole-sensitive C. albicans. In regards to the CDR1, CDR2, and MDR1 genes, there was no significant difference between the 2 groups of mice. Positive correlations between SAP2 and MDR1 and between CDR1 and CDR2 were found. The high expression level of SAP2 may relate to the virulence, pathogenicity, and resistance of C. albicans.

  3. Next Generation Remote Agent Planner

    NASA Technical Reports Server (NTRS)

    Jonsson, Ari K.; Muscettola, Nicola; Morris, Paul H.; Rajan, Kanna

    1999-01-01

    In May 1999, as part of a unique technology validation experiment onboard the Deep Space One spacecraft, the Remote Agent became the first complete autonomous spacecraft control architecture to run as flight software onboard an active spacecraft. As one of the three components of the architecture, the Remote Agent Planner had the task of laying out the course of action to be taken, which included activities such as turning, thrusting, data gathering, and communicating. Building on the successful approach developed for the Remote Agent Planner, the Next Generation Remote Agent Planner is a completely redesigned and reimplemented version of the planner. The new system provides all the key capabilities of the original planner, while adding functionality, improving performance and providing a modular and extendible implementation. The goal of this ongoing project is to develop a system that provides both a basis for future applications and a framework for further research in the area of autonomous planning for spacecraft. In this article, we present an introductory overview of the Next Generation Remote Agent Planner. We present a new and simplified definition of the planning problem, describe the basics of the planning process, lay out the new system design and examine the functionality of the core reasoning module.

  4. A non-glycosylated and functionally deficient mutant (N215H) of the sphingolipid activator protein B (SAP-B) in a novel case of metachromatic leukodystrophy (MLD).

    PubMed

    Wrobe, D; Henseler, M; Huettler, S; Pascual Pascual, S I; Chabas, A; Sandhoff, K

    2000-02-01

    The lysosomal degradation of sphingolipids with short oligosaccharide chains depends on small glycosylated non-enzymatic sphingolipid activator proteins (SAPs, saposins). Four of the five known SAPs, SAP-A, -B, -C and -D, are derived by proteolytic processing from a common precursor protein (SAP-precursor) that is encoded by a gene on chromosome 10 consisting of 15 exons and 14 introns. SAP-B is a non-specific glycolipid binding protein that stimulates in vitro the hydrolysis of about 20 glycolipids by different enzymes. In vivo SAP-B stimulates in particular the degradation of sulphatides by arylsulphatase A. So far, four different point mutations have been identified on the SAP-B domain of the SAP-precursor gene. The mutations result in a loss of mature SAP-B, causing the lysosomal accumulation of sulphatides and other sphingolipids, resulting in variant forms of metachromatic leukodystrophy (MLD). Here we report on a patient with SAP-B deficiency that is caused by a new homoallelic point mutation that has been identified by mRNA and DNA analysis. A 643A > C transversion results in the exchange of asparagine 215 to histidine and eliminates the single glycosylation site of SAP-B. Metabolic labelling experiments showed that the mutation had no effect on the intracellular transport of the encoded precursor to the acidic compartments and its maturation in the patient's cells. All four SAPs (SAP-A to SAP-D) were detectable by immunochemical methods. SAP-B in the patient's cells was found to be slightly less stable than the protein in normal cells and corresponded in size to the deglycosylated form of the wild-type SAP-B. Feeding studies with non-glycosylated SAP-precursor, generating non-glycosylated SAP-B, showed that the loss of the carbohydrate chain reduced the intracellular activity of the protein significantly. The additional structural change of the patient's SAP-B, caused by the change of amino acid 215 from asparagine to histidine, presumably resulted in an

  5. Effects of dates pulp extract and palm sap (Phoenix dactylifera L.) on gastrointestinal transit activity in healthy rats.

    PubMed

    Souli, Abdellaziz; Sebai, Hichem; Rtibi, Kaïs; Chehimi, Latifa; Sakly, Mohsen; Amri, Mohamed; El-Benna, Jamel

    2014-07-01

    The current study was performed to measure the chemical composition and the effects of dates pulp extract and palm sap on gastrointestinal transit (GIT) activity in healthy adult rats. In this respect, male Wistar rats fasted for 24 hours were used and received per orally (p.o.) sodium chloride (NaCl) (0,9%) (control group) or various doses of dates pulp extract (150 and 300 mg/kg, body weight [b.w.]) and palm sap (0.4 and 4 mL/kg, b.w.). Two other groups of rats (batch tests) received, respectively, clonidine (an alpha-2 adrenergic agonist, 1 mg/kg, b.w.) and yohimbine (an alpha-2 adrenergic antagonist, 2mg/kg, b.w.). Chemical analysis showed that the dates pulp extract is more rich in sugars and minerals, especially potassium and sucrose, as compared with palm sap composition. On the other hand, in vivo study showed that the aqueous dates pulp extract significantly, and dose dependently, increased the GIT activity while the palm sap slightly increased it. Moreover, a converse effect has been observed using clonidine (decreased 68%) and yohimbine (increased 33%) on the GIT activity. These findings suggest that dates pulp extract and palm sap have a stimulating effect on GIT activity in rats and confirm their use in traditional Tunisian medicine for the treatment of constipation.

  6. Effects of Dates Pulp Extract and Palm Sap (Phoenix dactylifera L.) on Gastrointestinal Transit Activity in Healthy Rats

    PubMed Central

    Souli, Abdellaziz; Rtibi, Kaïs; Chehimi, Latifa; Sakly, Mohsen; Amri, Mohamed; El-Benna, Jamel

    2014-01-01

    Abstract The current study was performed to measure the chemical composition and the effects of dates pulp extract and palm sap on gastrointestinal transit (GIT) activity in healthy adult rats. In this respect, male Wistar rats fasted for 24 hours were used and received per orally (p.o.) sodium chloride (NaCl) (0,9%) (control group) or various doses of dates pulp extract (150 and 300 mg/kg, body weight [b.w.]) and palm sap (0.4 and 4 mL/kg, b.w.). Two other groups of rats (batch tests) received, respectively, clonidine (an alpha-2 adrenergic agonist, 1 mg/kg, b.w.) and yohimbine (an alpha-2 adrenergic antagonist, 2mg/kg, b.w.). Chemical analysis showed that the dates pulp extract is more rich in sugars and minerals, especially potassium and sucrose, as compared with palm sap composition. On the other hand, in vivo study showed that the aqueous dates pulp extract significantly, and dose dependently, increased the GIT activity while the palm sap slightly increased it. Moreover, a converse effect has been observed using clonidine (decreased 68%) and yohimbine (increased 33%) on the GIT activity. These findings suggest that dates pulp extract and palm sap have a stimulating effect on GIT activity in rats and confirm their use in traditional Tunisian medicine for the treatment of constipation. PMID:24611963

  7. MAPGEN Planner: Mixed-Initiative Activity Planning for the Mars Exploration Rover Mission

    NASA Technical Reports Server (NTRS)

    Ai-Chang, Mitch; Bresina, John; Charest, Leonard; Hsu, Jennifer; Jonsson, Ari K.; Kanefsky, Bob; Maldague, Pierre; Morris, Paul; Rajan, Kanna; Yglesias, Jeffrey

    2003-01-01

    This document describes the Mixed-initiative Activity Plan Generation system MAPGEN. The system is be- ing developed as one of the tools to be used during surface operations of NASA's Mars Exploration Rover mission (MER). However, the core technology is general and can be adapted to different missions and applications. The motivation for the system is to better support users that need to rapidly build activity plans that have to satisfy complex rules and fit within resource limits. The system therefore combines an existing tool for activity plan editing and resource modeling, with an advanced constraint-based reasoning and planning framework. The demonstration will show the key capabilities of the automated reasoning and planning component of the system, with emphasis on how these capabilities will be used during surface operations of the MER mission.

  8. Antifungal and cytotoxicity activities of the fresh xylem sap of Hymenaea courbaril L. and its major constituent fisetin

    PubMed Central

    2014-01-01

    Background The great potential of plants as Hymenaea courbaril L (jatoba) has not yet been throughly explored scientifically and therefore it is very important to investigate their pharmacological and toxicological activities to establish their real efficacy and safety. This study investigated the cytotoxicity of xylem sap of Hymenaea courbaril L and its bioactivity against the fungi Cryptococcus neoformans species complex and dermatophytes. Methods The fresh xylem sap of H. courbaril was filtered resulting in an insoluble brown color precipitate and was identified as fisetin. In the filtrate was identified the mixture of fisetinediol, fustin, 3-O-methyl-2,3-trans-fustin and taxifolin, which were evaluated by broth microdilution antifungal susceptibility testing against C. neoformans species complex and dermatophytes. The fresh xylem sap and fisetin were screened for cytotoxicity against the 3T3-A31 cells of Balb/c using neutral red uptake (NRU) assay. Results The fresh xylem sap and the fisetin showed higher in vitro activity than the filtrate. The xylem sap of H. courbaril inhibited the growth of dermatophytes and of C. neoformans with minimal inhibition concentration (MIC) < 256 μg/mL, while the fisetin showed MIC < 128 μg/mL for these fungi. Fisetin showed lower toxicity (IC50 = 158 μg/mL) than the fresh xylem sap (IC50 = 109 μg/mL). Conclusion Naturally occurring fisetin can provide excellent starting points for clinical application and can certainly represent a therapeutic potential against fungal infections, because it showed in vitro antifungal activity and low toxicity on animal cells. PMID:25027026

  9. Team Nutrition School Activity Planner. A How-To Guide for Team Nutrition Schools and Supporters.

    ERIC Educational Resources Information Center

    Food and Consumer Service (USDA), Washington, DC.

    This "how-to" guide for Team Nutrition fairs and tasting activities helps Team Nutrition supporters and schools understand how to work together to improve the health and education of children. Team Nutrition is the implementation tool for the U.S. Department of Agriculture's School Meals Initiative for Healthy Children. Section 1 of the guide…

  10. Antioxidant activity, inhibition of nitric oxide overproduction, and in vitro antiproliferative effect of maple sap and syrup from Acer saccharum.

    PubMed

    Legault, Jean; Girard-Lalancette, Karl; Grenon, Carole; Dussault, Catherine; Pichette, André

    2010-04-01

    Antioxidant activity, inhibition of nitric oxide (NO) overproduction, and antiproliferative effect of ethyl acetate extracts of maple sap and syrup from 30 producers were evaluated in regard to the period of harvest in three different regions of Québec, Canada. Oxygen radical absorbance capacity (ORAC) values of maple sap and syrup extracts are, respectively, 12 +/- 6 and 15 +/- 5 micromol of Trolox equivalents (TE)/mg. The antioxidant activity was also confirmed by a cell-based assay. The period of harvest has no statistically significant incidence on the antioxidant activity of both extracts. The antioxidant activity of pure maple syrup was also determined using the ORAC assay. Results indicate that the ORAC value of pure maple syrup (8 +/- 2 micromol of TE/mL) is lower than the ORAC value of blueberry juice (24 +/- 1 micromol of TE/mL) but comparable to the ORAC values of strawberry (10.7 +/- 0.4 micromol of TE/mL) and orange (10.8 +/- 0.5 micromol of TE/mL) juices. Maple sap and syrup extracts showed to significantly inhibit lipopolysaccharide-induced NO overproduction in RAW264.7 murine macrophages. Maple syrup extract was significantly more active than maple sap extract, suggesting that the transformation of maple sap into syrup increases NO inhibition activity. The highest NO inhibition induced by the maple syrup extracts was observed at the end of the season. Moreover, darker maple syrup was found to be more active than clear maple syrup, suggesting that some colored oxidized compounds could be responsible in part for the activity. Finally, maple syrup extracts (50% inhibitory concentration = 42 +/- 6 microg/mL) and pure maple syrup possess a selective in vitro antiproliferative activity against cancer cells.

  11. HURON (HUman and Robotic Optimization Network) Multi-Agent Temporal Activity Planner/Scheduler

    NASA Technical Reports Server (NTRS)

    Hua, Hook; Mrozinski, Joseph J.; Elfes, Alberto; Adumitroaie, Virgil; Shelton, Kacie E.; Smith, Jeffrey H.; Lincoln, William P.; Weisbin, Charles R.

    2012-01-01

    HURON solves the problem of how to optimize a plan and schedule for assigning multiple agents to a temporal sequence of actions (e.g., science tasks). Developed as a generic planning and scheduling tool, HURON has been used to optimize space mission surface operations. The tool has also been used to analyze lunar architectures for a variety of surface operational scenarios in order to maximize return on investment and productivity. These scenarios include numerous science activities performed by a diverse set of agents: humans, teleoperated rovers, and autonomous rovers. Once given a set of agents, activities, resources, resource constraints, temporal constraints, and de pendencies, HURON computes an optimal schedule that meets a specified goal (e.g., maximum productivity or minimum time), subject to the constraints. HURON performs planning and scheduling optimization as a graph search in state-space with forward progression. Each node in the graph contains a state instance. Starting with the initial node, a graph is automatically constructed with new successive nodes of each new state to explore. The optimization uses a set of pre-conditions and post-conditions to create the children states. The Python language was adopted to not only enable more agile development, but to also allow the domain experts to easily define their optimization models. A graphical user interface was also developed to facilitate real-time search information feedback and interaction by the operator in the search optimization process. The HURON package has many potential uses in the fields of Operations Research and Management Science where this technology applies to many commercial domains requiring optimization to reduce costs. For example, optimizing a fleet of transportation truck routes, aircraft flight scheduling, and other route-planning scenarios involving multiple agent task optimization would all benefit by using HURON.

  12. DC-SIGN activation mediates the differential effects of SAP and CRP on the innate immune system and inhibits fibrosis in mice.

    PubMed

    Cox, Nehemiah; Pilling, Darrell; Gomer, Richard H

    2015-07-07

    Fibrosis is caused by scar tissue formation in internal organs and is associated with 45% of deaths in the United States. Two closely related human serum proteins, serum amyloid P (SAP) and C-reactive protein (CRP), strongly affect fibrosis. In multiple animal models, and in Phase 1 and Phase 2 clinical trials, SAP affects several aspects of the innate immune system to reduce fibrosis, whereas CRP appears to potentiate fibrosis. However, SAP and CRP bind the same Fcγ receptors (FcγR) with similar affinities, and why SAP and CRP have opposing effects is unknown. Here, we report that SAP but not CRP binds the receptor DC-SIGN (SIGN-R1) to affect the innate immune system, and that FcγR are not necessary for SAP function. A polycyclic aminothiazole DC-SIGN ligand and anti-DC-SIGN antibodies mimic SAP effects in vitro. In mice, the aminothiazole reduces neutrophil accumulation in a model of acute lung inflammation and, at 0.001 mg/kg, alleviates pulmonary fibrosis by increasing levels of the immunosuppressant IL-10. DC-SIGN (SIGN-R1) is present on mouse lung epithelial cells, and SAP and the aminothiazole potentiate IL-10 production from these cells. Our data suggest that SAP activates DC-SIGN to regulate the innate immune system differently from CRP, and that DC-SIGN is a target for antifibrotics.

  13. Navy Operational Planner

    DTIC Science & Technology

    2015-03-01

    19 B. MCM ANALYSIS ...33 1. In-Depth Analysis in Other Mission Warfare Areas ......................33 2. Scenario Integration with NMP... wine warfare NCC naval component commander NFC numbered fleet commander NM nautical mile NMP Navy mission planner NOP Navy

  14. The Sandia petaflops planner.

    SciTech Connect

    DeBenedictis, Erik P.

    2003-10-01

    The Sandia Petaflops Planner is a tool for projecting the design and performance of parallel supercomputers into the future. The mathematical basis of these projections is the International Technology Roadmap for Semiconductors (ITRS, or a detailed version of Moore's Law) and DOE balance factors for supercomputer procurements. The planner is capable of various forms of scenario analysis, cost estimation, and technology analysis. The tool is described along with technology conclusions regarding PFLOPS-level supercomputers in the upcoming decade.

  15. Variability in Saponin Content, Cancer Antiproliferative Activity and Physicochemical Properties of Concentrated Agave Sap.

    PubMed

    Santos-Zea, Liliana; Rosas-Pérez, Aratza Mireya; Leal-Díaz, Ana María; Gutiérrez-Uribe, Janet A

    2016-08-01

    Concentrated agave sap (CAS) has gained popularity as an unrefined sweetener. It is obtained by boiling "aguamiel" that contains phytochemicals with diverse bioactivities. Saponins have been the most widely studied agave phytochemicals due to their cancer antiproliferative effect but their concentration may vary due to maturity of the agave plant and collection site. In this study, 18 CAS samples produced in different states of Mexico were analyzed using multivariate methods to determine which physicochemical or phytochemical parameters were responsible for variation. Additionally, extracts with different saponin profiles were tested to determine possible correlations with antiproliferative activity. Total soluble solids, pH, and water activity were similar to those reported for other agave sweeteners. Antioxidant capacity of samples was correlated to browning index. Eleven steroidal saponins were found in CAS samples and they were the main source of variability. Magueyoside B, a kammogenin tetraglycoside, was the most abundant saponin in all samples. With respect to bioactivity, multivariate analysis indicated that magueyoside B and a gentrogenin tetraglycoside were compounds strongly related with bioactivity. CAS from Hidalgo, Puebla, and Veracruz had higher concentration of magueyoside B than from the other kamogenin tetraglycoside found in the samples from other Mexican states. These results could be used as a first approach to characterize and standardize CAS to validate the potential health benefits derived from its consumption.

  16. Functional requirement for SAP in 2B4-mediated activation of human natural killer cells as revealed by the X-linked lymphoproliferative syndrome.

    PubMed

    Tangye, S G; Phillips, J H; Lanier, L L; Nichols, K E

    2000-09-15

    X-linked lymphoproliferative syndrome (XLP) is an immunodeficiency characterized by life-threatening infectious mononucleosis and EBV-induced B cell lymphoma. The gene mutated in XLP encodes SLAM (signaling lymphocytic activation molecule-associated protein)-associated protein (SAP), a small SH2 domain-containing protein. SAP associates with 2B4 and SLAM, activating receptors expressed by NK and T cells, and prevents recruitment of SH2 domain-containing protein tyrosine phosphatase-2 SHP-2) to the cytoplasmic domains of these receptors. The phenotype of XLP may therefore result from perturbed signaling through SAP-associating receptors. We have addressed the functional consequence of SAP deficiency on 2B4-mediated NK cell activation. Ligating 2B4 on normal human NK cells with anti-2B4 mAb or interaction with transfectants bearing the 2B4 ligand CD48 induced NK cell cytotoxicity. In contrast, ligation of 2B4 on NK cells from a SAP-deficient XLP patient failed to initiate cytotoxicity. Despite this, CD2 or CD16-induced cytotoxicity of SAP-deficient NK cells was similar to that of normal NK cells. Thus, selective impairment of 2B4-mediated NK cell activation may contribute to the immunopathology of XLP.

  17. EAT-2, a SAP-like adaptor, controls NK cell activation through phospholipase Cγ, Ca++, and Erk, leading to granule polarization.

    PubMed

    Pérez-Quintero, Luis-Alberto; Roncagalli, Romain; Guo, Huaijian; Latour, Sylvain; Davidson, Dominique; Veillette, André

    2014-04-07

    Ewing's sarcoma-associated transcript 2 (EAT-2) is an Src homology 2 domain-containing intracellular adaptor related to signaling lymphocytic activation molecule (SLAM)-associated protein (SAP), the X-linked lymphoproliferative gene product. Both EAT-2 and SAP are expressed in natural killer (NK) cells, and their combined expression is essential for NK cells to kill abnormal hematopoietic cells. SAP mediates this function by coupling SLAM family receptors to the protein tyrosine kinase Fyn and the exchange factor Vav, thereby promoting conjugate formation between NK cells and target cells. We used a variety of genetic, biochemical, and imaging approaches to define the molecular and cellular mechanisms by which EAT-2 controls NK cell activation. We found that EAT-2 mediates its effects in NK cells by linking SLAM family receptors to phospholipase Cγ, calcium fluxes, and Erk kinase. These signals are triggered by one or two tyrosines located in the carboxyl-terminal tail of EAT-2 but not found in SAP. Unlike SAP, EAT-2 does not enhance conjugate formation. Rather, it accelerates polarization and exocytosis of cytotoxic granules toward hematopoietic target cells. Hence, EAT-2 promotes NK cell activation by molecular and cellular mechanisms distinct from those of SAP. These findings explain the cooperative and essential function of these two adaptors in NK cell activation.

  18. A phloem-sap feeder mixes phloem and xylem sap to regulate osmotic potential.

    PubMed

    Pompon, Julien; Quiring, Dan; Goyer, Claudia; Giordanengo, Philippe; Pelletier, Yvan

    2011-09-01

    Phloem-sap feeders (Hemiptera) occasionally consume the dilute sap of xylem, a behaviour that has previously been associated with replenishing water balance following dehydration. However, a recent study reported that non-dehydrated aphids ingested xylem sap. Here, we tested the hypothesis that the consumption of xylem sap, which has a low osmolality, is a general response to osmotic stresses other than dehydration. Alate aphids were subjected to different treatments and subsequently transferred onto a plant, where electrical penetration graph (EPG) was used to estimate durations of passive phloem sap consumption and active sucking of xylem sap. The proportion of time aphids fed on xylem sap (i.e., time spent feeding on xylem sap/total time spent feeding on phloem plus xylem sap) was used as a proxy of the solute concentration of the uptake. The proportion of time alate aphids fed on xylem sap increased: (1) with the time spent imbibing an artificial diet containing a solution of sucrose, which is highly concentrated in phloem sap and is mainly responsible for the high osmotic potential of phloem sap; (2) with the osmotic potential of the artificial diet, when osmotic potential excess was not related to sucrose concentration; and (3) when aphids were deprived of primary symbionts, a condition previously shown to lead to a higher haemolymph osmotic potential. All our results converge to support the hypothesis that xylem sap consumption contributes to the regulation of the osmotic potential in phloem-sap feeders.

  19. Disruption of each of the secreted aspartyl proteinase genes SAP1, SAP2, and SAP3 of Candida albicans attenuates virulence.

    PubMed Central

    Hube, B; Sanglard, D; Odds, F C; Hess, D; Monod, M; Schäfer, W; Brown, A J; Gow, N A

    1997-01-01

    Secreted aspartyl proteinases (Saps), encoded by a gene family with at least nine members (SAP1 to SAP9), are one of the most discussed virulence factors produced by the human pathogen Candida albicans. In order to study the role of each Sap isoenzyme in pathogenicity, we have constructed strains which harbor mutations at selected SAP genes. SAP1, SAP2, and SAP3, which are regulated differentially in vitro, were mutated by targeted gene disruption. The growth rates of all homozygous null mutants were similar to those of the isogenic wild-type parental strain (SC5314) in complex and defined media. In medium with protein as the sole source of nitrogen, sap1 and sap3 mutants grew with reduced growth rates but reached optical densities similar to those measured for SC5314. In contrast, sap2 null mutants tended to clump, grew poorly in this medium, and produced the lowest proteolytic activity. Addition of ammonium ions reversed such growth defects. These results support the view that Sap2 is the dominant isoenzyme. When sap1, sap2, and sap3 mutants were injected intravenously in guinea pigs and mice, the animals had increased survival rates compared to those of control animals infected with SC5314. However, reduction of proteolytic activity in vitro did not correlate directly with the extent of attenuation of virulence observed for all Sap-deficient mutants. These data suggest that SAP1, SAP2, and SAP3 all contribute to the overall virulence of C. albicans and presumably all play important roles during disseminated infections. PMID:9284116

  20. SAP family proteins.

    PubMed

    Fujita, A; Kurachi, Y

    2000-03-05

    Thus far, five members including Dlg, SAP97/hDlg, SAP90/PSD-95, SAP102, and PSD-93/chapsyn110 which belong to SAP family have been identified. Recent studies have revealed that these proteins play important roles in the localization and function of glutamate receptors and K(+) channels. Although most of them have been reported to be localized to the synapse, only one member, SAP97, is expressed also in the epithelial cells. In this review, we have summarized structural characters of SAP family proteins and discuss their functions in neurons and epithelial cells.

  1. Photovoltaics for municipal planners

    SciTech Connect

    Not Available

    1993-04-01

    This booklet is intended for city and county government personnel, as well as community organizations, who deal with supplying, regulating, or recommending electric power resources. Specifically, this document deals with photovoltaic (PV) power, or power from solar cells, which is currently the most cost-effective energy source for electricity requirements that are relatively small, located in isolated areas, or difficult to serve with conventional technology. Recently, PV has been documented to be more cost-effective than conventional alternatives (such as line extensions or engine generators) in dozens of applications within the service territories of electric, gas, and communications utilities. Here, we document numerous cost-effective urban applications, chosen by planners and utilities because they were the most cost-effective option or because they were appropriate for environmental or logistical reasons. These applications occur within various municipal departments, including utility, parks and recreation, traffic engineering, transportation, and planning, and they include lighting applications, communications equipment, corrosion protection, irrigation control equipment, remote monitoring, and even portable power supplies for emergency situations.

  2. The adaptor molecule signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is essential in mechanisms involving the Fyn tyrosine kinase for induction and progression of collagen-induced arthritis.

    PubMed

    Zhong, Ming-Chao; Veillette, André

    2013-11-01

    Signaling lymphocytic activation molecule-associated protein (SAP) is an Src homology 2 domain-only adaptor involved in multiple immune cell functions. It has also been linked to immunodeficiencies and autoimmune diseases, such as systemic lupus erythematosus. Here, we examined the role and mechanism of action of SAP in autoimmunity using a mouse model of autoimmune arthritis, collagen-induced arthritis (CIA). We found that SAP was essential for development of CIA in response to collagen immunization. It was also required for production of collagen-specific antibodies, which play a key role in disease pathogenesis. These effects required SAP expression in T cells, not in B cells. In mice immunized with a high dose of collagen, the activity of SAP was nearly independent of its ability to bind the protein tyrosine kinase Fyn and correlated with the capacity of SAP to promote full differentiation of follicular T helper (TFH) cells. However, with a lower dose of collagen, the role of SAP was more dependent on Fyn binding, suggesting that additional mechanisms other than TFH cell differentiation were involved. Further studies suggested that this might be due to a role of the SAP-Fyn interaction in natural killer T cell development through the ability of SAP-Fyn to promote Vav-1 activation. We also found that removal of SAP expression during progression of CIA attenuated disease severity. However, it had no effect on disease when CIA was clinically established. Together, these results indicate that SAP plays an essential role in CIA because of Fyn-independent and Fyn-dependent effects on TFH cells and, possibly, other T cell types.

  3. The latex sap of the 'Old World Plant' Lagenaria siceraria with potent lectin activity mitigates neoplastic malignancy targeting neovasculature and cell death.

    PubMed

    Vigneshwaran, V; Thirusangu, Prabhu; Madhusudana, S; Krishna, V; Pramod, Siddanakoppalu N; Prabhakar, B T

    2016-10-01

    Lifestyle and dietary modifications have contributed much to somatic genetic alteration which has concomitantly led to increase in malignant diseases. Henceforth, plant based and dietary interventions to mitigate and impede oncogenic transformation are in great demand. We investigated the latex sap (LSL) of the dietary Lagenaria siceraria vegetable, the first domesticated plant species with the potent lectin activity for its functional role against the tumor progression and its mechanism. LSL has markedly stimulated proliferation of lymphocytes and displayed strong cytotoxic activity against cancer both in-vitro and in-vivo. The tumor regression was paralleled with drastic reduction in tumoral neovasculature as evidenced from angiogenic parameters and abrogated related gene expressions. LSL has also triggered apoptotic signaling cascade in cancer cells through activation of caspase-3 mediated activation of endonuclease and inducing apoptotic cellular events. Collectively our study provides tangible evidences that latex sap from L. siceraria with immunopotentiating ability significantly regresses the tumor progression by targeting angiogenesis and inducing cell death.

  4. Comparative Proteomic Analysis of Wild-Type and SAP Domain Mutant Foot-and-Mouth Disease Virus-Infected Porcine Cells Identifies the Ubiquitin-Activating Enzyme UBE1 Required for Virus Replication.

    PubMed

    Zhu, Zixiang; Yang, Fan; Zhang, Keshan; Cao, Weijun; Jin, Ye; Wang, Guoqing; Mao, Ruoqing; Li, Dan; Guo, Jianhong; Liu, Xiangtao; Zheng, Haixue

    2015-10-02

    Leader protein (L(pro)) of foot-and-mouth disease virus (FMDV) manipulates the activities of several host proteins to promote viral replication and pathogenicity. L(pro) has a conserved protein domain SAP that is suggested to subvert interferon (IFN) production to block antiviral responses. However, apart from blocking IFN production, the roles of the SAP domain during FMDV infection in host cells remain unknown. Therefore, we identified host proteins associated with the SAP domain of L(pro) by a high-throughput quantitative proteomic approach [isobaric tags for relative and absolute quantitation (iTRAQ) in conjunction with liquid chromatography/electrospray ionization tandem mass spectrometry]. Comparison of the differentially regulated proteins in rA/FMDVΔmSAP- versus rA/FMDV-infected SK6 cells revealed 45 down-regulated and 32 up-regulated proteins that were mostly associated with metabolic, ribosome, spliceosome, and ubiquitin-proteasome pathways. The results also imply that the SAP domain has a function similar to SAF-A/B besides its potential protein inhibitor of activated signal transducer and activator of transcription (PIAS) function. One of the identified proteins UBE1 was further analyzed and displayed a novel role for the SAP domain of L(pro). Overexpression of UBE1 enhanced the replication of FMDV, and knockdown of UBE1 decreased FMDV replication. This shows that FMDV manipulates UBE1 for increased viral replication, and the SAP domain was involved in this process.

  5. Degradation of membrane-bound ganglioside GM1. Stimulation by bis(monoacylglycero)phosphate and the activator proteins SAP-B and GM2-AP.

    PubMed

    Wilkening, G; Linke, T; Uhlhorn-Dierks, G; Sandhoff, K

    2000-11-17

    According to our hypothesis (Fürst, W., and Sandhoff, K. (1992) Biochim. Biophys. Acta 1126, 1-16) glycosphingolipids of the plasma membrane are digested after endocytosis as components of intraendosomal and intralysosomal vesicles and membrane structures. The lysosomal degradation of glycosphingolipids with short oligosaccharide chains by acid exohydrolases requires small, non-enzymatic cofactors, called sphingolipid activator proteins (SAPs). A total of five activator proteins have been identified as follows: namely the saposins SAP-A, -B, -C, and -D, which are derived from the single chain SAP-precursor protein (prosaposin), and the GM2 activator protein. A deficiency of prosaposin results in the storage of ceramide and sphingolipids with short oligosaccharide head groups. The loss of the GM2 activator protein blocks the degradation of the ganglioside GM2. The enzymatic hydrolysis of the ganglioside GM1 is catalyzed by beta-galactosidase, a water-soluble acid exohydrolase. The lack of ganglioside GM1 accumulation in patients suffering from either prosaposin or GM2 activator protein deficiency has led to the hypothesis that SAPs are not needed for the hydrolysis of the ganglioside GM1 in vivo. In this study we demonstrate that an activator protein is required for the enzymatic degradation of membrane-bound ganglioside GM1 and that both SAP-B and the GM2 activator protein significantly enhance the degradation of the ganglioside GM1 by acid beta-galactosidase in a liposomal, detergent-free assay system. These findings offer a possible explanation for the observation that no storage of the ganglioside GM1 has been observed in patients with either isolated prosaposin or isolated GM2 activator deficiency. We also demonstrate that anionic phospholipids such as bis(monoacylglycero)phosphate and phosphatidylinositol, which specifically occur in inner membranes of endosomes and in lysosomes, are essential for the activator-stimulated hydrolysis of the ganglioside GM1

  6. The Joint Master Operational Planner

    DTIC Science & Technology

    2016-04-04

    understanding of complex environments, and apply forces and functions effectively within these environments. These planners are as much in the dark as...student understanding of Joint Matters from a Service component perspective at the operational and tactical levels of war.”61 Learning areas include...subject matter .63 To comprehend, students must the meaning of the material and information.64 59

  7. In vivo association of ATFa with JNK/SAP kinase activities.

    PubMed

    Bocco, J L; Bahr, A; Goetz, J; Hauss, C; Kallunki, T; Kedinger, C; Chatton, B

    1996-05-02

    The human ATFa proteins belong to the CREB/ATF family of transcription factors. We have previously shown that the ATFa proteins may contribute to the modulation of the transcriptional activity of the Jun/Fos complexes (Chatton et al. (1994). Oncogene, 9, 375-385). We now show that a protein kinase activity is strongly associated with ATFa in vivo, as revealed by coimmunoprecipitation of ATFa/kinase complexes from whole cell extracts, with antibodies against ATFa. Two independent regions were found to be implicated in kinase binding: a major interaction site is located within the N-terminal 82 residues comprising an important metal-chelating element; a weaker binding site corresponds to the basic sequence element preceding the C-terminal leucine-zipper of ATFa. Induction experiments suggest that each of these ATFa domains may interact with different kinases. The major activity is associated with the ATFa N-terminal domain. Based on its response to various inducers, on both in vitro and in vivo binding assays, and on its immunological properties, this activity most likely corresponds to the 54/55 kDa JNK2 protein. Taken together, these observations suggest that the ATFa proteins, among other CREB/ATF proteins, may be important effectors of cell signalling pathways.

  8. 30 CFR 285.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Assessment Plan (SAP)? (a) A SAP describes the activities (e.g., installation of meteorological towers... project easement, or to test technology devices. (1) Your SAP must describe how you will conduct...

  9. 30 CFR 285.610 - What must I include in my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What must I include in my SAP? 285.610 Section... I include in my SAP? Your SAP must include the following information, as applicable. (a) For all activities you propose to conduct under your SAP, you must provide the following information: ER29AP09.115...

  10. Personal Development Planner

    NASA Astrophysics Data System (ADS)

    Vogten, Hubert; Martens, Harrie

    We are facing many ever changing and increasing learning needs in our information society. Society is changing at an increasing pace, constantly pushed forward by emerging new information and communication technologies. New and changing demands of society on the individual, both on and off the job, are following these technological changes in a similar pace. In just one generation, information and communications technologies have revolutionised the way we live, learn, work and play. As a result, technical skills, communication skills, knowledge, in short competences are quickly outdated and require constant updating. Jobs for a lifetime have become the exception and are in fact considered undesirable by both the employer and the employee. Therefore, the traditional approach towards learning, which mainly took place during very specific stages of someone’s life, has been replaced by the idea of professional development. The information society has also lead to more active and involved society members, who are increasingly more demanding regarding their personal goals and developments. Individuals are regularly confronted with question such as: are my competences still up-to-date?; is my current job still satisfying and challenging enough?; in what directions can I change my career?; can I improve myself?; what other opportunities do I have? These types of question are not necessarily work related, although they often are.

  11. Xylem sap proteomics.

    PubMed

    de Bernonville, Thomas Dugé; Albenne, Cécile; Arlat, Matthieu; Hoffmann, Laurent; Lauber, Emmanuelle; Jamet, Elisabeth

    2014-01-01

    Proteomic analysis of xylem sap has recently become a major field of interest to understand several biological questions related to plant development and responses to environmental clues. The xylem sap appears as a dynamic fluid undergoing changes in its proteome upon abiotic and biotic stresses. Unlike cell compartments which are amenable to purification in sufficient amount prior to proteomic analysis, the xylem sap has to be collected in particular conditions to avoid contamination by intracellular proteins and to obtain enough material. A model plant like Arabidopsis thaliana is not suitable for such an analysis because efficient harvesting of xylem sap is difficult. The analysis of the xylem sap proteome also requires specific procedures to concentrate proteins and to focus on proteins predicted to be secreted. Indeed, xylem sap proteins appear to be synthesized and secreted in the root stele or to originate from dying differentiated xylem cells. This chapter describes protocols to collect xylem sap from Brassica species and to prepare total and N-glycoprotein extracts for identification of proteins by mass spectrometry analyses and bioinformatics.

  12. Vertical Launch System Loadout Planner

    DTIC Science & Technology

    2015-03-01

    Submarine Rocket (ASROC): Ship -launched rocket used in ASW.  RIM-174 SM6: Advanced version of a ship -launched SM2 missile capable of over-the...Operational planners strive to fmd ways to load missiles on Vertical Latmch System (VLS) ships to meet mission requit·ements in theit· AI·ea of...Responsibility (AOR). Requirements are variable: there are missions requiting specific types of missiles; each ship may have distinct capability or capacity to

  13. Stress- and mitogen-induced phosphorylation of the synapse-associated protein SAP90/PSD-95 by activation of SAPK3/p38gamma and ERK1/ERK2.

    PubMed Central

    Sabio, Guadalupe; Reuver, Suzana; Feijoo, Carmen; Hasegawa, Masato; Thomas, Gareth M; Centeno, Francisco; Kuhlendahl, Sven; Leal-Ortiz, Sergio; Goedert, Michel; Garner, Craig; Cuenda, Ana

    2004-01-01

    SAPK3 (stress-activated protein kinase-3, also known as p38gamma) is a member of the mitogen-activated protein kinase family; it phosphorylates substrates in response to cellular stress, and has been shown to bind through its C-terminal sequence to the PDZ domain of alpha1-syntrophin. In the present study, we show that SAP90 [(synapse-associated protein 90; also known as PSD-95 (postsynaptic density-95)] is a novel physiological substrate for both SAPK3/p38gamma and the ERK (extracellular-signal-regulated protein kinase). SAPK3/p38gamma binds preferentially to the third PDZ domain of SAP90 and phosphorylates residues Thr287 and Ser290 in vitro, and Ser290 in cells in response to cellular stresses. Phosphorylation of SAP90 is dependent on the binding of SAPK3/p38gamma to the PDZ domain of SAP90. It is not blocked by SB 203580, which inhibits SAPK2a/p38alpha and SAPK2b/p38beta but not SAPK3/p38gamma, or by the ERK pathway inhibitor PD 184352. However, phosphorylation is abolished when cells are treated with a cell-permeant Tat fusion peptide that disrupts the interaction of SAPK3/p38gamma with SAP90. ERK2 also phosphorylates SAP90 at Thr287 and Ser290 in vitro, but this does not require PDZ-dependent binding. SAP90 also becomes phosphorylated in response to mitogens, and this phosphorylation is prevented by pretreatment of the cells with PD 184352, but not with SB 203580. In neurons, SAP90 and SAPK3/p38gamma co-localize and they are co-immunoprecipitated from brain synaptic junctional preparations. These results demonstrate that SAP90 is a novel binding partner for SAPK3/p38gamma, a first physiological substrate described for SAPK3/p38gamma and a novel substrate for ERK1/ERK2, and that phosphorylation of SAP90 may play a role in regulating protein-protein interactions at the synapse in response to adverse stress- or mitogen-related stimuli. PMID:14741046

  14. Robotic planner expert system (RPLANES)

    NASA Technical Reports Server (NTRS)

    Grice, Ervin Oneal

    1987-01-01

    The Artificial Intelligence Section of the Mission Planning and Analysis of the Johnson Space Center has developed a prototype of an expert system for robotic planning. A robot is given a high level goal to perform an action (i.e., swap, adjust, or stow) on a component unit of an object such as a satellite and the Robotic Planner Expert System (RPLANES) generates the necessary goals for arm actions. RPLANES is designed using the Inference Corp. Automated Reasoning Tool (ART) development tool. It resides on a SYMBOLICS 3670. RPLANES and its evolution are described.

  15. The Emergency Landing Planner Experiment

    NASA Technical Reports Server (NTRS)

    Meuleau, Nocolas F.; Neukom, Christian; Plaunt, Christian John; Smith, David E.; Smith, Tristan B.

    2011-01-01

    In previous work, we described an Emergency Landing Planner (ELP) designed to assist pilots in choosing the best emergency landing site when damage or failures occur in an aircraft. In this paper, we briefly describe the system, but focus on the integration of this system into the cockpit of a 6 DOF full-motion simulator and a study designed to evaluate the ELP. We discuss the results of this study, the lessons learned, and some of the issues involved in advancing this work further.

  16. Monitoring and Modelling of Soil-Plant Interactions: the Joint Use of ERT, Sap Flow and Eddy Covariance to Define the Volume of Orange Tree Active Root Zones.

    NASA Astrophysics Data System (ADS)

    Cassiani, G.; Boaga, J.; Vanella, D.; Perri, M. T.; Consoli, S.

    2014-12-01

    Mass and energy exchanges between soil, plants and atmosphere are key factors controlling a number of environmental processes involving hydrology, biota and climate. The understanding of these exchanges also play a critical role for practical purposes such as precision agriculture. In this contribution we present a methodology based on coupling innovative data collection and models. In particular we propose the use of hydro-geophysical monitoring via 4D Electrical Resistivity Tomography (ERT) in conjunction with measurements of plant transpiration via sap flow and evapotranspiration from Eddy Correlation (EC). This abundance of data are to be fed in spatially distributed soil models in order to comprehend the distribution of active roots. We conducted experiments in an orange orchard in Eastern Sicily (Italy). We installed a 3D electrical tomography apparatus consisting of 4 instrumented micro boreholes placed at the corners of a square (about 1.3 m in side) surrounding an orange tree. During the monitoring, we collected repeated ERT and TDR soil moisture measurements, soil water sampling, sap flow measurements from the orange tree and EC data. Irrigation, precipitation, sap flow and ET data are available for a long period of time allowing knowledge of the long term forcing conditions on the system. This wealth of information was used to calibrate a 1D Richards' equation model representing the dynamics of the volume monitored via 3D ERT. Information on the soil hydraulic properties was collected from laboratory experiments as well as by time-lapse ERT monitoring of irrigation a few months after the main experiment, when the orange tree had been cut. The results of the calibrated modeling exercise allow the quantification of the soil volume interested by root water uptake. This volume is much smaller (an area less than 2 square meters, 40 cm thick) than generally believed and assumed in the design of classical drip irrigation schemes.

  17. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  18. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  19. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  20. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  1. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Maple sap. 1437.107 Section 1437.107 Agriculture... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is limited to maple sap produced on private property for sale as sap or syrup. Eligible maple sap must...

  2. Anti-transpirant activity in xylem sap from flooded tomato (Lycopersicon esculentum Mill.) plants is not due to pH-mediated redistributions of root- or shoot-sourced ABA.

    PubMed

    Else, Mark A; Taylor, June M; Atkinson, Christopher J

    2006-01-01

    In flooded soils, the rapid effects of decreasing oxygen availability on root metabolic activity are likely to generate many potential chemical signals that may impact on stomatal apertures. Detached leaf transpiration tests showed that filtered xylem sap, collected at realistic flow rates from plants flooded for 2 h and 4 h, contained one or more factors that reduced stomatal apertures. The closure could not be attributed to increased root output of the glucose ester of abscisic acid (ABA-GE), since concentrations and deliveries of ABA conjugates were unaffected by soil flooding. Although xylem sap collected from the shoot base of detopped flooded plants became more alkaline within 2 h of flooding, this rapid pH change of 0.5 units did not alter partitioning of root-sourced ABA sufficiently to prompt a transient increase in xylem ABA delivery. More shoot-sourced ABA was detected in the xylem when excised petiole sections were perfused with pH 7 buffer, compared with pH 6 buffer. Sap collected from the fifth oldest leaf of "intact" well-drained plants and plants flooded for 3 h was more alkaline, by approximately 0.4 pH units, than sap collected from the shoot base. Accordingly, xylem [ABA] was increased 2-fold in sap collected from the fifth oldest petiole compared with the shoot base of flooded plants. However, water loss from transpiring, detached leaves was not reduced when the pH of the feeding solution containing 3-h-flooded [ABA] was increased from 6.7 to 7.1 Thus, the extent of the pH-mediated, shoot-sourced ABA redistribution was not sufficient to raise xylem [ABA] to physiologically active levels. Using a detached epidermis bioassay, significant non-ABA anti-transpirant activity was also detected in xylem sap collected at intervals during the first 24 h of soil flooding.

  3. Implementation of SAP Waste Management System

    SciTech Connect

    Frost, M.L.; LaBorde, C.M.; Nichols, C.D.

    2008-07-01

    The Y-12 National Security Complex (Y-12) assumed responsibility for newly generated waste on October 1, 2005. To ensure effective management and accountability of newly generated waste, Y-12 has opted to utilize SAP, Y-12's Enterprise Resource Planning (ERP) tool, to track low-level radioactive waste (LLW), mixed waste (MW), hazardous waste, and non-regulated waste from generation through acceptance and disposal. SAP Waste will include the functionality of the current waste tracking system and integrate with the applicable modules of SAP already in use. The functionality of two legacy systems, the Generator Entry System (GES) and the Waste Information Tracking System (WITS), and peripheral spreadsheets, databases, and e-mail/fax communications will be replaced by SAP Waste. Fundamentally, SAP Waste will promote waste acceptance for certification and disposal, not storage. SAP Waste will provide a one-time data entry location where waste generators can enter waste container information, track the status of their waste, and maintain documentation. A benefit of the new system is that it will provide a single data repository where Y-12's Waste Management organization can establish waste profiles, verify and validate data, maintain inventory control utilizing hand-held data transfer devices, schedule and ship waste, manage project accounting, and report on waste handling activities. This single data repository will facilitate the production of detailed waste generation reports for use in forecasting and budgeting, provide the data for required regulatory reports, and generate metrics to evaluate the performance of the Waste Management organization and its subcontractors. SAP Waste will replace the outdated and expensive legacy system, establish tools the site needs to manage newly generated waste, and optimize the use of the site's ERP tool for integration with related business processes while promoting disposition of waste. (authors)

  4. From Sap to Syrup

    ERIC Educational Resources Information Center

    Bjork, Janna

    2005-01-01

    Warm days, cold nights, melting snow-signs winter is waning and spring is nearing. Though winter may just be getting started in some areas, it's always fun to appreciate the good things about winter, including the special time at the end of winter in New England known as "sugaring time." The sap starts flowing in the sugar maples, and…

  5. An efficient hybrid planner in changing environments

    SciTech Connect

    Barbehenn, M.; Hutchinson, S. |; Chen, P.C.

    1993-11-01

    In this paper, we present a new hybrid motion planner than is capable of exploiting previous planning episodes when confronted with new planning problems. Our approach is applicable when several (similar) problems are successively posed for the same static environment, or when the environment changes incrementally between planning episodes. At the heart of our system lie two low-level motion planners: a fast, but incomplete planner (which we call LOCAL), and a computationally costly (possibly resolution) complete planner (which we call GLOBAL). When a new planning problem is presented to our planner, a meta-level planner (which we call MANAGER) decomposes the problem into segments that are amenable to solution by LOCAL. This decomposition is made by exploiting a task graph, in which successful planning episodes have been recorded. In cases where the decomposition fails, GLOBAL is invoked. The key to our planner`s success is a novel representation of solution trajectories, in which segments of collision-free paths are associated with the boundary of nearby obstacles.

  6. Corps Support Command Planner Version .01B

    DTIC Science & Technology

    2007-11-02

    Visual Basic for Applications Excel derivative, COSCOM Planner Version .01B answered the research question, is it possible?, with a definitive "yes." Decision matrix results indicated that COSCOM Planner Version .01B will be a useful tool for logisticians. Further usability testing and algorithm improvement is required to insure its survivability over the next several

  7. (BOREAS) BOREAS TE-7 Sap Flow Data

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Papagno, Andrea (Editor); Hogg, E. H.; Hurdle, P. A.

    2000-01-01

    The BOREAS TE-7 team collected data sets in support of its efforts to characterize and interpret information on the sap flow of boreal vegetation. The heat pulse method was used to monitor sap flow and to estimate rates of transpiration from aspen, black spruce, and mixed wood forests at the SSAOA, MIX, SSA-OBS. and Batoche sites in Saskatchewan, Canada. Measurements were made at the various sites from May to October 1994, May to October 1995, and April to October 1996. A scaling procedure was used to estimate canopy transpiration rates from the sap flow measurements. The data were stored in tabular ASCII files. Analyses to date show a tendency for sap flow in aspen to remain remarkably constant over a wide range of environmental conditions VPD from 1.0 to 4.8 kPa and solar radiation less than 400 W/sq m). For forests with high aerodynamic conductance, the results would indicate an inverse relationship between stomatal conductance and VPD, for VPD greater than 1 kPa. A possible interpretation is that stomata are operating to maintain leaf water potentials above a critical minimum value, which in turn places a maximum value on the rate of sap flow that can be sustained by the tree. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distrobuted Activity Archive Center (DAAC).

  8. APEX (Air Pollution Exercise) Volume 19: County Planner's Manual.

    ERIC Educational Resources Information Center

    Environmental Protection Agency, Research Triangle Park, NC. Office of Manpower Development.

    The County Planner's Manual is part of a set of 21 manuals (AA 001 009-001 029) used in APEX (Air Pollution Exercise), a computerized college and professional level "real world" game simulation of a community with urban and rural problems, industrial activities, and air pollution difficulties. The first two sections, which are the same in each of…

  9. APEX (Air Pollution Exercise) Volume 18: City Planner's Manual.

    ERIC Educational Resources Information Center

    Environmental Protection Agency, Research Triangle Park, NC. Office of Manpower Development.

    The City Planner's Manual is part of a set of 21 manuals (AA 001 009-001 029) used in APEX (Air Pollution Exercise), a computerized college and professional level "real world" game simulation of a community with urban and rural problems, industrial activities, and air pollution difficulties. The first two sections, which are the same in each of…

  10. BOREAS TE-11 Sap Flow Data

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Papagno, Andrea (Editor); Saugier, Bernard

    2000-01-01

    The BOREAS TE-11 team collected several data sets in support of its efforts to characterize and interpret information on the sap flow, gas exchange, and lichen photosynthesis of boreal vegetation and meteorological data of the area studied. This data set contains measurements of sap flow conducted at the SSA-OJP site in the growing seasons of 1993 and 1994. The data are stored in ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Center (DAAC).

  11. 30 CFR 285.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Commercial Leases § 285.605 What is a Site Assessment Plan (SAP)? (a) A SAP describes the activities (e.g... your commercial lease, including your project easement, or to test technology devices. (1) Your...

  12. Dissection of SAP-dependent and SAP-independent SLAM family signaling in NKT cell development and humoral immunity.

    PubMed

    Chen, Shasha; Cai, Chenxu; Li, Zehua; Liu, Guangao; Wang, Yuande; Blonska, Marzenna; Li, Dan; Du, Juan; Lin, Xin; Yang, Meixiang; Dong, Zhongjun

    2017-02-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) mutations in X-linked lymphoproliferative disease (XLP) lead to defective NKT cell development and impaired humoral immunity. Because of the redundancy of SLAM family receptors (SFRs) and the complexity of SAP actions, how SFRs and SAP mediate these processes remains elusive. Here, we examined NKT cell development and humoral immunity in mice completely deficient in SFR. We found that SFR deficiency severely impaired NKT cell development. In contrast to SAP deficiency, SFR deficiency caused no apparent defect in follicular helper T (TFH) cell differentiation. Intriguingly, the deletion of SFRs completely rescued the severe defect in TFH cell generation caused by SAP deficiency, whereas SFR deletion had a minimal effect on the defective NKT cell development in SAP-deficient mice. These findings suggest that SAP-dependent activating SFR signaling is essential for NKT cell selection; however, SFR signaling is inhibitory in SAP-deficient TFH cells. Thus, our current study revises our understanding of the mechanisms underlying T cell defects in patients with XLP.

  13. Structural and binding studies of SAP-1 protein with heparin.

    PubMed

    Yadav, Vikash K; Mandal, Rahul S; Puniya, Bhanwar L; Kumar, Rahul; Dey, Sharmistha; Singh, Sarman; Yadav, Savita

    2015-03-01

    SAP-1 is a low molecular weight cysteine protease inhibitor (CPI) which belongs to type-2 cystatins family. SAP-1 protein purified from human seminal plasma (HuSP) has been shown to inhibit cysteine and serine proteases and exhibit interesting biological properties, including high temperature and pH stability. Heparin is a naturally occurring glycosaminoglycan (with varied chain length) which interacts with a number of proteins and regulates multiple steps in different biological processes. As an anticoagulant, heparin enhances inhibition of thrombin by the serpin antithrombin III. Therefore, we have employed surface plasmon resonance (SPR) to improve our understanding of the binding interaction between heparin and SAP-1 (protease inhibitor). SPR data suggest that SAP-1 binds to heparin with a significant affinity (KD = 158 nm). SPR solution competition studies using heparin oligosaccharides showed that the binding of SAP-1 to heparin is dependent on chain length. Large oligosaccharides show strong binding affinity for SAP-1. Further to get insight into the structural aspect of interactions between SAP-1 and heparin, we used modelled structure of the SAP-1 and docked with heparin and heparin-derived polysaccharides. The results suggest that a positively charged residue lysine plays important role in these interactions. Such information should improve our understanding of how heparin, present in the reproductive tract, regulates cystatins activity.

  14. Sapping In Nirgal Vallis

    NASA Astrophysics Data System (ADS)

    Jaumann, R.; Reiss, D.

    The topographic information provided by the Mars Orbiter Laser Altimeter has been used in combination with Viking and Mars Observer Camera imagery to estimate the three-dimensional structure of the Nirgal Vallis drainage system in order to constrain the formation process. Based on precisely correlated Viking, Mars Orbiter Laser Altimeter (MOLA) and Mars Orbiter Camera (MOC) cartographic data (1,2), we have measured morphometric and topologic parameters (3,4,5,6,7) of the valley network. Although there is no single parameter, which unambiguously distinguishes between run-off and sapping, the combination of parameters such as surface dip angle, longitudinal profile, width to depth ratio, drainage density, structural control, valley terminations and bifurcation ratio will constrain the formation process. All topographic based valley network parameters indicate an origin by groundwater sapping processes and headward erosion for Nirgal Vallis and confirms former geomorphologic analyses. The extremely low drainage density of Nirgal Vallis may either be caused by very slow erosion, due to low groundwater supply or arid conditions, or by sequential interruptions of the erosion process due to probable climate changes. (1) Zeitler and Oberst, 1999; JGR, 104, 14051. (2) Hauber et al., 2000, Int. Arch. Photogram. Rem. Sens. XXXIII, 360. (3) Horton, 1945, Geol. Sic. Amer. 56. 275. (4) Strahler, 1964, In: Handbook Appl. Hydrogeol. McGraw Hill. (5) Leopold et al, 1964, In: Fluvial Proc. Geomorph. Freeman (6) Summerfield, 1991, In: Global Geomorph. Longman, Burnt Mill.(7) Ritter et al. 1995, In: Processes Geomorph. Wm.C.Brown Publ..

  15. Measuring sap flow in plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sap flow measurements provide a powerful tool for quantifying plant water use and monitoring qualitative physiological responses of plants to environmental conditions. As such, sap flow methods are widely employed to invesitgate the agronomic, ecological and hydrological outcomes of plant growth. T...

  16. Novel Aggregation Properties of Candida albicans Secreted Aspartyl Proteinase Sap6 Mediate Virulence in Oral Candidiasis.

    PubMed

    Kumar, Rohitashw; Saraswat, Darpan; Tati, Swetha; Edgerton, Mira

    2015-07-01

    Candida albicans, a commensal fungus of the oral microbiome, causes oral candidiasis in humans with localized or systemic immune deficiencies. Secreted aspartic proteinases (Saps) are a family of 10 related proteases and are virulence factors due to their proteolytic activity, as well as their roles in adherence and colonization of host tissues. We found that mice infected sublingually with C. albicans cells overexpressing Sap6 (SAP6 OE and a Δsap8 strain) had thicker fungal plaques and more severe oral infection, while infection with the Δsap6 strain was attenuated. These hypervirulent strains had highly aggregative colony structure in vitro and higher secreted proteinase activity; however, the levels of proteinase activity of C. albicans Saps did not uniformly match their abilities to damage cultured oral epithelial cells (SCC-15 cells). Hyphal induction in cells overexpressing Sap6 (SAP6 OE and Δsap8 cells) resulted in formation of large cell-cell aggregates. These aggregates could be produced in germinated wild-type cells by addition of native or heat-inactivated Sap6. Sap6 bound only to germinated cells and increased C. albicans adhesion to oral epithelial cells. The adhesion properties of Sap6 were lost upon deletion of its integrin-binding motif (RGD) and could be inhibited by addition of RGD peptide or anti-integrin antibodies. Thus, Sap6 (but not Sap5) has an alternative novel function in cell-cell aggregation, independent of its proteinase activity, to promote infection and virulence in oral candidiasis.

  17. Novel Aggregation Properties of Candida albicans Secreted Aspartyl Proteinase Sap6 Mediate Virulence in Oral Candidiasis

    PubMed Central

    Kumar, Rohitashw; Saraswat, Darpan; Tati, Swetha

    2015-01-01

    Candida albicans, a commensal fungus of the oral microbiome, causes oral candidiasis in humans with localized or systemic immune deficiencies. Secreted aspartic proteinases (Saps) are a family of 10 related proteases and are virulence factors due to their proteolytic activity, as well as their roles in adherence and colonization of host tissues. We found that mice infected sublingually with C. albicans cells overexpressing Sap6 (SAP6 OE and a Δsap8 strain) had thicker fungal plaques and more severe oral infection, while infection with the Δsap6 strain was attenuated. These hypervirulent strains had highly aggregative colony structure in vitro and higher secreted proteinase activity; however, the levels of proteinase activity of C. albicans Saps did not uniformly match their abilities to damage cultured oral epithelial cells (SCC-15 cells). Hyphal induction in cells overexpressing Sap6 (SAP6 OE and Δsap8 cells) resulted in formation of large cell-cell aggregates. These aggregates could be produced in germinated wild-type cells by addition of native or heat-inactivated Sap6. Sap6 bound only to germinated cells and increased C. albicans adhesion to oral epithelial cells. The adhesion properties of Sap6 were lost upon deletion of its integrin-binding motif (RGD) and could be inhibited by addition of RGD peptide or anti-integrin antibodies. Thus, Sap6 (but not Sap5) has an alternative novel function in cell-cell aggregation, independent of its proteinase activity, to promote infection and virulence in oral candidiasis. PMID:25870228

  18. SOLON: An autonomous vehicle mission planner

    NASA Technical Reports Server (NTRS)

    Dudziak, M. J.

    1987-01-01

    The State-Operator Logic Machine (SOLON) Planner provides an architecture for effective real-time planning and replanning for an autonomous vehicle. The highlights of the system, which distinguish it from other AI-based planners that have been designed previously, are its hybrid application of state-driven control architecture and the use of both schematic representations and logic programming for the management of its knowledge base. SOLON is designed to provide multiple levels of planning for a single autonomous vehicle which is supplied with a skeletal, partially-specified mission plan at the outset of the vehicle's operations. This mission plan consists of a set of objectives, each of which will be decomposable by the planner into tasks. These tasks are themselves comparatively complex sets of actions which are executable by a conventional real-time control system which does not perform planning but which is capable of making adjustments or modifications to the provided tasks according to constraints and tolerances provided by the Planner. The current implementation of the SOLON is in the form of a real-time simulation of the Planner module of an Intelligent Vehicle Controller (IVC) on-board an autonomous underwater vehicle (AUV). The simulation is embedded within a larger simulator environment known as ICDS (Intelligent Controller Development System) operating on a Symbolics 3645/75 computer.

  19. p53 contributes to T cell homeostasis through the induction of pro-apoptotic SAP.

    PubMed

    Madapura, Harsha S; Salamon, Daniel; Wiman, Klas G; Lain, Sonia; Klein, George; Klein, Eva; Nagy, Noémi

    2012-12-15

    Lack of functional SAP protein, due to gene deletion or mutation, is the cause of X-linked lymphoproliferative disease (XLP), characterized by functionally impaired T and NK cells and a high risk of lymphoma development. We have demonstrated earlier that SAP has a pro-apoptotic function in T and B cells. Deficiency of this function might contribute to the pathogenesis of XLP. We have also shown that SAP is a target of p53 in B cell lines. In the present study, we show that activated primary T cells express p53, which induces SAP expression. p53 is functional as a transcription factor in activated T cells and induces the expression of p21, PUMA and MDM2. PARP cleavage in the late phase of activation indicates that T cells expressing high levels of SAP undergo apoptosis. Modifying p53 levels using Nutlin-3, which specifically dissociates the MDM2-p53 interaction, was sufficient to upregulate SAP expression, indicating that SAP is a target of p53 in T cells. We also demonstrated p53's role as a transcription factor for SAP in activated T cells by ChIP assays. Our result suggests that p53 contributes to T cell homeostasis through the induction of the pro-apoptotic SAP. A high level of SAP is necessary for the activation-induced cell death that is pivotal in termination of the T cell response.

  20. Confessions of a Campus Planner.

    ERIC Educational Resources Information Center

    Dober, Richard

    1997-01-01

    Richard Dober, in his fortieth year of campus planning, reflects on his work, the emergence of campus planning as a separate professional activity, and the future issues of college and university planning and design. He argues for special attention to faculty offices, landscaping, "green" architecture, preservation of heritage buildings, removal…

  1. A strategy planner for NASA robotics applications

    NASA Technical Reports Server (NTRS)

    Brodd, S. S.

    1985-01-01

    Automatic strategy or task planning is an important element of robotics systems. A strategy planner under development at Goddard Space Flight Center automatically produces robot plans for assembly, disassembly, or repair of NASA spacecraft from computer aided design descriptions of the individual parts of the spacecraft.

  2. Memo to: Ambulatory Health Care Planners.

    ERIC Educational Resources Information Center

    Educational Facilities Labs., Inc., New York, NY.

    Planning for changing types of health professions and a changing clientele necessitates designing flexible facilities. Findings from a recently completed analysis of ambulatory care facilities are directed to planners in the form of 16 memos. Approaches to planning and design considerations are made that attempt to humanize these facilities.…

  3. 30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources MINERALS MANAGEMENT SERVICE... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must notify MMS in writing...

  4. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  5. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  6. 30 CFR 585.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 585.902 Section 585.902 Mineral Resources..., Inspections, and Facility Assessments for Activities Conducted Under SAPs, COPs and GAPs Decommissioning... authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by BOEM under § 585.909, within...

  7. 30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must...

  8. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  9. Inhibition of α-glucosidase activity by N-deoxynojirimycin analogs in several insect phloem sap feeders.

    PubMed

    Ya'kobovitz, Marina Katzman; Butters, Terry D; Cohen, Ephraim

    2016-02-01

    Secondary metabolites and synthetic iminosugars that structurally resemble monosaccharides are potent inhibitors of α-glucosidase activity. The enzyme is core in cleaving sucrose in phloem feeding insects and it also plays a crucial role of reducing osmotic stress via the formation of oligosaccharides. Inhibition of hydrolysis by iminosugars should result in nutritional deficiencies and/or disruption of normal osmoregulation. Deoxynojirimycin (DNJ) and 2 N-alkylated analogs [N-butyl DNJ (NB-DNJ) and N-nonyl DNJ (NN-DNJ)] were the major iminosugars used throughout the study. The extensive experiments conducted with α-glucosidase of the whitefly Bemisia tabaci indicated the competitive nature of inhibition and that the hydrophilic DNJ is a potent inhibitor in comparison to the more hydrophobic NB-DNJ and NN-DNJ compounds. The same inhibitory pattern was observed with the psyllid Cacopsylla bidens α-glucosidase. In contrast to the above pattern, enzymes of the aphids, Myzus persicae and Aphis gossypii were more sensitive to the hydrophobic iminosugars as compared to DNJ. In vivo experiments in which adult B. tabaci were fed dietary iminosugars, show that the hydrophilic DNJ was far less toxic than the lipophilic NB-DNJ and NN-DNJ. It is proposed that this pattern is attributed to the better accessibility of the hydrophobic NN-DNJ to the α-glucosidase membrane-bound compartment in the midgut. Based on the inhibitory effects of certain polyhydroxy N-alkylated iminosugars, α-glucosidase of phloem feeding hemipterans could serve as an attractive target site for developing novel pest control agents.

  10. Variability of sap flow on forest hillslopes: patterns and controls

    NASA Astrophysics Data System (ADS)

    Hassler, Sibylle; Blume, Theresa

    2013-04-01

    Sap flow in trees is an essential variable in integrated studies of hydrologic fluxes. It gives indication of transpiration rates for single trees and, with a suitable method of upscaling, for whole stands. This information is relevant for hydrologic and climate models, especially for the prediction of change in water fluxes in the soil-plant-atmosphere continuum under climate change. To this end, we do not only need knowledge concerning the response of sapflow to atmospheric forcing but also an understanding of the main controls on its spatial variability. Our study site consists of several subcatchments of the Attert basin in Luxembourg underlain by schists of the Ardennes massif. Within these subcatchments we measure sap flow in more than 20 trees on a range of forested hillslopes covered by a variety of temperate deciduous tree species such as beech, oak, hornbeam and maple as well as conifers such as firs. Our sap flow sensors are based on the heat pulse velocity method and consist of three needles, one needle acting as the heating device and the other two holding three thermistors each, enabling us to simultaneously measure sap flow velocity at three different depths within the tree. In close proximity to the trees we collect additional data on soil moisture, matric potential and groundwater levels. First results show that the sensor design seems promising for an upscaling of the measured sap flow velocities to sap flow at the tree level. The maximum depth of actively used sapwood as well as the decrease in sap flow velocity with increasing depth in the tree can be determined by way of the three thermistors. Marked differences in sap flow velocity profiles are visible between the different species, resulting in differences in sap flow for trees of similar diameter. We examine the range of tree sap flow values and variation due to species, size class, slope position and exposition and finally relate them to the dynamics of soil moisture conditions with the

  11. SapC-DOPS Nanovesicles as Targeted Therapy for Lung Cancer

    PubMed Central

    Zhao, Shuli; Chu, Zhengtao; Blanco, Victor M.; Nie, Yunzhong; Hou, Yayi; Qi, Xiaoyang

    2014-01-01

    Lung cancer is the deadliest type of cancer for both men and women. In this study, we evaluate the in vitro and in vivo efficacy of a biotherapeutic agent composed of a lysosomal protein (Saposin C, SapC) and a phospholipid (dioleoylphosphatidylserine, DOPS) which can be assembled into nanovesicles (SapC-DOPS) with selective antitumor activity. SapC-DOPS targets phosphatidylserine, an anionic phospholipid preferentially exposed in the surface of cancer cells and tumor-associated vasculature. Since binding of SapC to phosphatidylserine is favored at acidic pHs, and the latter characterizes the milieu of many solid tumors, we tested the effect of pH on the binding capacity of SapC-DOPS to lung tumor cells. Results showed that SapC-DOPS binding to cancer cells was more pronounced at low pH. Viability assays on a panel of human lung tumor cells showed that SapC-DOPS cytotoxicity was positively correlated with cell surface phosphatidylserine levels, whereas mitochondrial membrane potential measurements were consistent with apoptosis-related cell death. Using a fluorescence tracking method in live mice, we show that SapC-DOPS specifically targets human lung cancer xenografts, and that systemic therapy with SapC-DOPS induces tumor apoptosis and significantly inhibits tumor growth. These results suggest that SapC-DOPS nanovesicles are a promising treatment option for lung cancer. PMID:25670331

  12. Euphorbia sap keratopathy: four cases and a possible pathogenic mechanism.

    PubMed Central

    Scott, I U; Karp, C L

    1996-01-01

    AIMS: To report four cases of Euphorbia sap causing anterior segment toxicity. METHODS: Medical records of four patients who presented with Euphorbia sap keratoconjunctivitis were reviewed. Clinical findings were compared with previously published reports. RESULTS: All of these patients experienced a similar clinical course. Initial contact with Euphorbia sap caused punctate epitheliopathy; patients noted immediate burning and photophobia, but no visual loss. In all cases, patients experienced epithelial slough with delayed healing, requiring approximately 9 days to heal the epithelial defect. Patients were treated with topical antibiotics, pressure patching or a bandage contact lens, and final visual acuities were excellent in all cases. A review of the literature revealed that Euphorbia sap contains a diterpenoid diester which exhibits antineoplastic activity in rodents. CONCLUSIONS: Individuals who work with Euphorbia plants should be cautioned to wear eye protection. Patients with Euphorbia sap anterior segment toxicity should be informed that their condition may worsen initially, but that visual outcome is generally excellent. The progressive corneal epithelial sloughing and delayed corneal epithelial healing may be secondary to the antineoplastic effects of Euphorbia sap. Images PMID:8942380

  13. How to choose the right financial planner.

    PubMed

    Maurer, Timothy J

    2010-01-01

    An "economic Pearl Harbor." That is how the world's most famous investor, Warren Buffett, described what we have gone through and what we're still going through.' Even the most optimistic appraisals of our economic conditions suggest that we are likely to feel the effects of the Great Recession through the decade we recently entered. Healthcare reform, in whatever form, may also create change in your medical practice ranging from immaterial to revolutionary. To whom should you turn to ensure that your personal economy survives and thrives, especially in these times? A financial planner, possibly, but what is a financial planner, how do you choose one, and what sort of service should you expect?

  14. Mobilization Handbook for Installation Manpower Planners

    DTIC Science & Technology

    1989-06-01

    Manpower Mobilization Planning ," and as a supplement to policy guidance contained in DoD Directive .40j.31, "Mobilization Management of the DoD Civilian...Work Force." It’s purpose is to help reinforce mobilization readiness by providing a planning reference guide for Continental United States (CONUS...installations of the Department of Defense (DoD). It is designed to assist local manpower and personnel planners in anticipating and planning the

  15. Phosphorylated SAP155, the spliceosomal component, is localized to chromatin in postnatal mouse testes

    SciTech Connect

    Eto, Ko; Sonoda, Yoshiyuki; Jin, Yuji; Abe, Shin-ichi

    2010-03-19

    SAP155 is an essential component of the spliceosome and its phosphorylation is required for splicing catalysis, but little is known concerning its expression and regulation during spermatogenesis in postnatal mouse testes. We report that SAP155 is ubiquitously expressed in nuclei of germ and Sertoli cells within the seminiferous tubules of 6- and 35-day postpartum (dpp) testes. Analyses by fractionation of testes revealed that (1) phosphorylated SAP155 was found in the fraction containing nuclear structures at 6 dpp in amounts much larger than that at other ages; (2) non-phosphorylated SAP155 was detected in the fraction containing nucleoplasm; and (3) phosphorylated SAP155 was preferentially associated with chromatin. Our findings suggest that the active spliceosome, containing phosphorylated SAP155, performs pre-mRNA splicing on chromatin concomitant with transcription during testicular development.

  16. Validation and Development of Competencies for Meeting Planners. Final Report.

    ERIC Educational Resources Information Center

    Walk, Mary H.

    A study was conducted to determine the entry-level requirements for meeting planners. The study benefited from the definition of the body of knowledge that had already been done for a professional meeting planner certificate by the Association of Professional Meeting Planners International. To document the competencies needed for an entry-level…

  17. Wireless sap flow measurement system

    NASA Astrophysics Data System (ADS)

    Kuo, C.; Davis, T. W.; Tseng, C.; Cheng, C.; Liang, X.; Yu, P.

    2010-12-01

    This study exhibits a measurement system for wireless sensor networks to measure sap flow in multiple locations simultaneously. Transpiration is a major component of the land-surface system because it is indicative of the water movement between the soil and the air. Sap flow can be used to approximate transpiration. In forests, transpiration cannot be represented by the sap flow from a single tree. Multi-location sap flow measurements are required to show the heterogeneity caused by different trees or soil conditions. Traditional multi-location measurements require manpower and capital for data collection and instrument maintenance. Fortunately, multi-location measurements can be achieved by using the new technology of wireless sensor networks. With multi-hop communication protocol, data can be forwarded to the base station via multiple sensor nodes. This communication protocol can provide reliable data collection with the least power consumption. This study encountered two major problems. The first problem was signal amplification. The Crossbow IRIS mote was selected as the sensor node that receives the temperature data of the sap flow probe (thermocouple) through a MDA300 data acquisition board. However, the wireless sensor node could not directly receive any data from the thermocouples since the least significant bit value of the MDA300, 0.6 mV, is much higher than the voltage signal generated. Thus, the signal from the thermocouple must be amplified to exceed this threshold. The second problem is power management. A specific heat differential is required for the thermal dissipation method of measuring sap flow. Thus, an adjustable DC power supply is necessary for calibrating the heater's temperature settings. A circuit was designed to combine the signal amplifier and power regulator. The regulator has been designed to also provide power to the IRIS mote to extend battery life. This design enables wireless sap flow measurements in the forest. With the

  18. [Application of thermal dissipation probe in the study of Bambusa chungii sap flow].

    PubMed

    Zhao, Ping; Mei, Ting-Ting; Ni, Guang-Yan; Yu, Meng-Hao; Zeng, Xiao-Ping

    2012-04-01

    Based on the validation of Granier's empirical formula for calculating tree stem sap flux density, a comparative study was conducted on the measurement of Bambusa chungi sap flow by using different lengths of thermal dissipation probe (TDP), aimed to approach the applicability of TDP in measuring the sap flow of B. chungii. The difference in the daily change of the sap flow between B. chungii and nearby growing Schima superb was also analyzed. Because of the thinner bamboo wall and the heterogeneous anatomy, the sap flux density of B. chungii measured by 10 mm long probe could be underestimated, but that measured by 8 and 5 mm long probes could be relatively accurate. The comparison of the sap flow between B. chungii and nearby growing S. superba revealed that both the mean sap flux density and its daily change pattern' s skewness of B. chungii were higher than those of S. superba, but the nighttime sap flow of B. chungii was less than that of S. superba, indicating that the water recharge of B. chungii during nighttime was less active than that of S. superba. It was suggested that using TDP to investigate the sap flow of bamboo would be feasible, but careful calibration would be required before the TDP was put into application on different bamboo species.

  19. The adaptor molecule SAP plays essential roles during invariant NKT cell cytotoxicity and lytic synapse formation.

    PubMed

    Das, Rupali; Bassiri, Hamid; Guan, Peng; Wiener, Susan; Banerjee, Pinaki P; Zhong, Ming-Chao; Veillette, André; Orange, Jordan S; Nichols, Kim E

    2013-04-25

    The adaptor molecule signaling lymphocytic activation molecule-associated protein (SAP) plays critical roles during invariant natural killer T (iNKT) cell ontogeny. As a result, SAP-deficient humans and mice lack iNKT cells. The strict developmental requirement for SAP has made it difficult to discern its possible involvement in mature iNKT cell functions. By using temporal Cre recombinase-mediated gene deletion to ablate SAP expression after completion of iNKT cell development, we demonstrate that SAP is essential for T-cell receptor (TCR)-induced iNKT cell cytotoxicity against T-cell and B-cell leukemia targets in vitro and iNKT-cell-mediated control of T-cell leukemia growth in vivo. These findings are not restricted to the murine system: silencing RNA-mediated suppression of SAP expression in human iNKT cells also significantly impairs TCR-induced cytolysis. Mechanistic studies reveal that iNKT cell killing requires the tyrosine kinase Fyn, a known SAP-binding protein. Furthermore, SAP expression is required within iNKT cells to facilitate their interaction with T-cell targets and induce reorientation of the microtubule-organizing center to the immunologic synapse (IS). Collectively, these studies highlight a novel and essential role for SAP during iNKT cell cytotoxicity and formation of a functional IS.

  20. Tree Hydraulics: How Sap Rises

    ERIC Educational Resources Information Center

    Denny, Mark

    2012-01-01

    Trees transport water from roots to crown--a height that can exceed 100 m. The physics of tree hydraulics can be conveyed with simple fluid dynamics based upon the Hagen-Poiseuille equation and Murray's law. Here the conduit structure is modelled as conical pipes and as branching pipes. The force required to lift sap is generated mostly by…

  1. Operations mission planner beyond the baseline

    NASA Technical Reports Server (NTRS)

    Biefeld, Eric; Cooper, Lynne

    1991-01-01

    The scheduling of Space Station Freedom must satisfy four major requirements. It must ensure efficient housekeeping operations, maximize the collection of science, respond to changes in tasking and available resources, and accommodate the above changes in a manner that minimizes disruption of the ongoing operations of the station. While meeting these requirements the scheduler must cope with the complexity, scope, and flexibility of SSF operations. This requires the scheduler to deal with an astronomical number of possible schedules. The Operations Mission Planner (OMP) is centered around minimally disruptive replanning and the use of heuristics limit search in scheduling. OMP has already shown several artificial intelligence based scheduling techniques such as Interleaved Iterative Refinement and Bottleneck Identification using Process Chronologies.

  2. Model Checking the Remote Agent Planner

    NASA Technical Reports Server (NTRS)

    Khatib, Lina; Muscettola, Nicola; Havelund, Klaus; Norvig, Peter (Technical Monitor)

    2001-01-01

    This work tackles the problem of using Model Checking for the purpose of verifying the HSTS (Scheduling Testbed System) planning system. HSTS is the planner and scheduler of the remote agent autonomous control system deployed in Deep Space One (DS1). Model Checking allows for the verification of domain models as well as planning entries. We have chosen the real-time model checker UPPAAL for this work. We start by motivating our work in the introduction. Then we give a brief description of HSTS and UPPAAL. After that, we give a sketch for the mapping of HSTS models into UPPAAL and we present samples of plan model properties one may want to verify.

  3. Traffic Aware Planner (TAP) Flight Evaluation

    NASA Technical Reports Server (NTRS)

    Maris, John M.; Haynes, Mark A.; Wing, David J.; Burke, Kelly A.; Henderson, Jeff; Woods, Sharon E.

    2014-01-01

    NASA's Traffic Aware Planner (TAP) is a cockpit decision support tool that has the potential to achieve significant fuel and time savings when it is embedded in the data-rich Next Generation Air Transportation System (NextGen) airspace. To address a key step towards the operational deployment of TAP and the NASA concept of Traffic Aware Strategic Aircrew Requests (TASAR), a system evaluation was conducted in a representative flight environment in November, 2013. Numerous challenges were overcome to achieve this goal, including the porting of the foundational Autonomous Operations Planner (AOP) software from its original simulation-based, avionics-embedded environment to an Electronic Flight Bag (EFB) platform. A flight-test aircraft was modified to host the EFB, the TAP application, an Automatic Dependent Surveillance Broadcast (ADS-B) processor, and a satellite broadband datalink. Nine Evaluation Pilots conducted 26 hours of TAP assessments using four route profiles in the complex eastern and north-eastern United States airspace. Extensive avionics and video data were collected, supplemented by comprehensive inflight and post-flight questionnaires. TAP was verified to function properly in the live avionics and ADS-B environment, characterized by recorded data dropouts, latency, and ADS-B message fluctuations. Twelve TAP-generated optimization requests were submitted to ATC, of which nine were approved, and all of which resulted in fuel and/or time savings. Analysis of subjective workload data indicated that pilot interaction with TAP during flight operations did not induce additional cognitive loading. Additionally, analyses of post-flight questionnaire data showed that the pilots perceived TAP to be useful, understandable, intuitive, and easy to use. All program objectives were met, and the next phase of TAP development and evaluations with partner airlines is in planning for 2015.

  4. Detoxification of Sap from Felled Oil Palm Trunks for the Efficient Production of Lactic Acid.

    PubMed

    Kunasundari, Balakrishnan; Arai, Takamitsu; Sudesh, Kumar; Hashim, Rokiah; Sulaiman, Othman; Stalin, Natra Joseph; Kosugi, Akihiko

    2017-03-30

    The availability of fermentable sugars in high concentrations in the sap of felled oil palm trunks and the thermophilic nature of the recently isolated Bacillus coagulans strain 191 were exploited for lactic acid production under non-sterile conditions. Screening indicated that strain 191 was active toward most sugars including sucrose, which is a major component of sap. Strain 191 catalyzed a moderate conversion of sap sugars to lactic acid (53%) with a productivity of 1.56 g/L/h. Pretreatment of oil palm sap (OPS) using alkaline precipitation improved the sugar fermentability, providing a lactic acid yield of 92% and productivity of 2.64 g/L/h. To better characterize potential inhibitors in the sap, phenolic, organic, and mineral compounds were analyzed using non-treated sap and saps treated with activated charcoal and alkaline precipitation. Phthalic acid, 3,4-dimethoxybenzoic acid, aconitic acid, syringic acid, and ferulic acid were reduced in the sap after treatment. High concentrations of Mg, P, K, and Ca were also precipitated by the alkaline treatment. These results suggest that elimination of excess phenolic and mineral compounds in OPS can improve the fermentation yield. OPS, a non-food resource that is readily available in bulk quantities from plantation sites, is a promising source for lactic acid production.

  5. THE CELL SAP OF HYDRODICTYON

    PubMed Central

    Blinks, L. R.; Nielsen, John P.

    1940-01-01

    Analysis of the cell sap of Hydrodictyon patenaeforme Pocock, from California indicates the usual marked accumulation of potassium, which is 4000 times as concentrated as in the surrounding pond water. Small amounts of sodium and calcium were found. Chloride makes up about three-fourths of the anions, with a very high sulfate, and much lower bicarbonate concentration accounting for most of the remainder. Electrical conductivity and osmotic studies indicate that the analyzed elements are ionized, and account for most of the sap's osmotic pressure. pH is 5.5 to 6.0. The analytical procedure was designed to determine as many of the cations as possible on one small sample. Hydrodictyon is a large multinucleate cell belonging to an order (Chlorococcales) new to permeability and accumulation studies. PMID:19873174

  6. Critical role of SAP in progression and reactivation but not maintenance of T cell-dependent humoral immunity.

    PubMed

    Zhong, Ming-Chao; Veillette, André

    2013-03-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (T(FH)) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway.

  7. Heuristic Route Generation for the Navy Mission Planner

    DTIC Science & Technology

    2013-09-01

    SCENARIO, ANALYSIS, AND CONCLUSION ...................................................27  A.  ORIGINAL NAVY MISSION PLANNER MODEL ... Modeling System Intel Intelligence JFMCC Joint Force Maritime Component Commander JP Joint Publication MCM Mine Countermeasures MHQ...Ballistic Missile Defense VBA Visual Basic for Applications xiv THIS PAGE INTENTIONALLY LEFT BLANK xv EXECUTIVE SUMMARY Navy Mission Planner

  8. Applications Explorer Missions (AEM): Mission planners handbook

    NASA Technical Reports Server (NTRS)

    Smith, S. R. (Editor)

    1974-01-01

    The Applications Explorer Missions (AEM) Program is a planned series of space applications missions whose purpose is to perform various tasks that require a low cost, quick reaction, small spacecraft in a dedicated orbit. The Heat Capacity Mapping Mission (HCMM) is the first mission of this series. The spacecraft described in this document was conceived to support a variety of applications instruments and the HCMM instrument in particular. The maximum use of commonality has been achieved. That is, all of the subsystems employed are taken directly or modified from other programs such as IUE, IMP, RAE, and Nimbus. The result is a small versatile spacecraft. The purpose of this document, the AEM Mission Planners Handbook (AEM/MPH) is to describe the spacecraft and its capabilities in general and the HCMM in particular. This document will also serve as a guide for potential users as to the capabilities of the AEM spacecraft and its achievable orbits. It should enable each potential user to determine the suitability of the AEM concept to his mission.

  9. A global motion planner for curve-tracing robots

    SciTech Connect

    Hwang, Y.K.; Chen, P.C.; Neidigk, D.D.; Maciejewski, A.A.

    1993-11-01

    We present a global motion planner for tracing curves in three dimensions with robot manipulator tool frames. This planner generates an efficient motion satisfying three types of constraints; constraints on the tool tip for curve tracing, robot kinematic constraints and robot-link collision constraints. Motions are planned using a global search algorithm and a local planner based on a potential-field approach. This planner can be used with potential-field approach. This planner can be used with any robots including redundant manipulators, and can any robots including redundant manipulators, and can control the trade-offs between its algorithmic completeness and computation time. It can be applied in many robotic tasks such as seam welding, caulking, edge deburrring and chamfering, and is expected to reduce motion programming times from days to minutes.

  10. December 1993 National Drunk and Drugged Driving (3D) Prevention Month: Program Planner.

    ERIC Educational Resources Information Center

    National Highway Traffic Safety Administration (DOT), Washington, DC.

    This program planner's kit is based on the experiences of the first 12 years of the National Drunk and Drugged Driving (3D) Prevention Month program and provides practical advice to help readers plan activities for this year's campaign. Included in the kit is a background and resource guide that explains the background and goals of the program and…

  11. Tree hydraulics: how sap rises

    NASA Astrophysics Data System (ADS)

    Denny, Mark

    2012-01-01

    Trees transport water from roots to crown—a height that can exceed 100 m. The physics of tree hydraulics can be conveyed with simple fluid dynamics based upon the Hagen-Poiseuille equation and Murray's law. Here the conduit structure is modelled as conical pipes and as branching pipes. The force required to lift sap is generated mostly by transpiration or capillary action; we investigate the effectiveness of both these forces for the two conduit architectures considered. The level of analysis is appropriate for undergraduates. The subject is of broad interest because it provides a naturally-occurring example of an unusual metastable state of matter: liquid under tension.

  12. Special population planner, version 4.0.

    SciTech Connect

    Kuiper, J.; Tanzman, E.; Metz, W.

    2007-03-26

    Emergencies happen every day. Many are caused by storms or auto accidents and can be planned for, if not predicted. Emergencies resulting from natural hazards often affect a large number of people, and planning for them can be difficult, since knowledge of the needs of the people involved is generally unavailable. Emergencies resulting from accidents at industrial and military facilities can also be large scale in nature if people must be evacuated or sheltered in place. Federal planning for large scale emergencies is the responsibility of the Federal Emergency Management Agency (FEMA), which provides assistance to various emergency management agencies at the national, state and local level. More information about FEMA is available at http://www.fema.gov/. The purpose of the Special Population Planner (SPP) is to help emergency planners address the needs of persons with special needs. The exact definition of 'special population' is a policy decision. Policymakers have included a variety of groups in this term, such as persons with disabilities, those who do not have vehicles with which to evacuate, children who are unattended at times (latchkey children), and many others. The SPP was developed initially for the Alabama Emergency Management Agency as part of its Chemical Stockpile Emergency Preparedness Program (CSEPP), which aids emergency planning and preparedness in communities surrounding military installations across the United States where chemical weapons are stored pending their destruction under federal law. Like that specialized application, this open-source version contains a set of specialized Geographic Information System (GIS) tools to facilitate emergency planning on behalf of persons with special needs, regardless of how the term is defined. While the original SPP system was developed for emergency planning relating to chemical hazards, it can be applied to other threats as well. It is apparent from Hurricane Katrina and other natural and man

  13. Response of Sap-Flow Measurements on Environmental Forcings

    NASA Astrophysics Data System (ADS)

    Howe, J. A.; Dragoni, D.; Schmid, H.

    2005-05-01

    The exchange of water between the atmosphere and biosphere is an important determinant of climate and the productivity of vegetation. Both evaporation and transpiration involve substantial amounts of energy exchange at the interface of the biosphere and atmosphere. Knowing how transpiration changes throughout the seasonal and diurnal cycles can help increase the understanding of how a forest reacts to changes in the biosphere and atmosphere. A common way to estimate transpiration is by measuring the sap flowing through the living tissues of trees. A study was conducted at Morgan-Monroe State Forest, a mixed deciduous forest in south central Indiana (USA), to investigate how sap flow in trees responds to changes in meteorological and environmental conditions. The heat -dissipation technique was used to estimate sap velocities from two Big Tooth Aspen (Populus grandidentata) and two Tulip Poplars (Liriodendron tulipifera). Sap velocity patterns (normalized by a reference potential evapo-transpiration) were directly compared with meteorological and ecological measurements, such as vapor pressure deficits, photosynthetic active radiation (PAR), rain fall, and soil moisture content. In this study, we also investigated the uncertainties and problems that arise in using the heat dissipation technique to extrapolate the single-tree measurements to the forest scale.

  14. N-SAP and G-SAP neutron and gamma ray albedo model scatter shield analysis program

    NASA Technical Reports Server (NTRS)

    Sapovchak, B. J.; Stephenson, L. D.

    1967-01-01

    Computer program calculates neutron or gamma ray first order scattering from a plane or cylindrical surface to a detector point. The SAP Codes, G-SAP and N-SAP, constitute a multiple scatter albedo model shield analysis.

  15. SAP expression in invariant NKT cells is required for cognate help to support B-cell responses.

    PubMed

    Detre, Cynthia; Keszei, Marton; Garrido-Mesa, Natividad; Kis-Toth, Katalin; Castro, Wilson; Agyemang, Amma F; Veerapen, Natacha; Besra, Gurdyal S; Carroll, Michael C; Tsokos, George C; Wang, Ninghai; Leadbetter, Elizabeth A; Terhorst, Cox

    2012-07-05

    One of the manifestations of X-linked lymphoproliferative disease (XLP) is progressive agammaglobulinemia, caused by the absence of a functional signaling lymphocyte activation molecule (SLAM)-associated protein (SAP) in T, invariant natural killer T (NKT) cells and NK cells. Here we report that α-galactosylceramide (αGalCer) activated NKT cells positively regulate antibody responses to haptenated protein antigens at multiple checkpoints, including germinal center formation and affinity maturation. Whereas NKT cell-dependent B cell responses were absent in SAP(-/-).B6 mice that completely lack NKT cells, the small number of SAP-deficient NKT cells in SAP(-/-).BALB/c mice adjuvated antibody production, but not the germinal center reaction. To test the hypothesis that SAP-deficient NKT cells can facilitate humoral immunity, SAP was deleted after development in SAP(fl/fl).tgCreERT2.B6 mice. We find that NKT cell intrinsic expression of SAP is dispensable for noncognate helper functions, but is critical for providing cognate help to antigen-specific B cells. These results demonstrate that SLAM-family receptor-regulated cell-cell interactions are not limited to T-B cell conjugates. We conclude that in the absence of SAP, several routes of NKT cell-mediated antibody production are still accessible. The latter suggests that residual NKT cells in XLP patients might contribute to variations in dysgammaglobulinemia.

  16. Effects of Acer okamotoanum sap on the function of polymorphonuclear neutrophilic leukocytes in vitro and in vivo.

    PubMed

    An, Beum-Soo; Kang, Ji-Houn; Yang, Hyun; Yang, Mhan-Pyo; Jeung, Eui-Bae

    2013-02-01

    Sap is a plant fluid that primarily consists of water and small amounts of mineral elements, sugars, hormones and other nutrients. Acer mono (A. mono) is an endemic Korean mono maple which was recently suggested to have health benefits due to its abundant calcium and magnesium ion content. In the present study, we examined the effects of sap from Acer okamotoanum (A. okamotoanum) on the phagocytic response of mouse neutrophils in vivo and rat and canine neutrophils in vitro. We tested the regulation of phagocytic activity, oxidative burst activity (OBA) and the levels of filamentous polymeric actin (F-actin) in the absence and presence of dexamethasone (DEX) in vitro and in vivo. Our results showed that DEX primarily reduced OBA in the mouse neutrophils, and that this was reversed in the presence of the sap. By contrast, the phagocytic activity of the mouse cells was not regulated by either DEX or the sap. Rat and canine polymorphonuclear neutrophilic leukocytes (PMNs) responded in vitro to the sap in a similar manner by increasing OBA. However, regulation of phagocytic activity by the sap was different between the species. In canine PMNs, phagocytic activity was enhanced by the sap at a high dose, while it did not significantly modulate this activity in rat PMNs. These findings suggest that the sap of A. okamotoanum stimulates neutrophil activity in the mouse, rat and canine by increasing OBA in vivo and in vitro, and thus may have a potential antimicrobial effect in the PMNs of patients with infections.

  17. Phosphatidylserine-selective targeting and anticancer effects of SapC-DOPS nanovesicles on brain tumors.

    PubMed

    Blanco, Víctor M; Chu, Zhengtao; Vallabhapurapu, Subrahmanya D; Sulaiman, Mahaboob K; Kendler, Ady; Rixe, Olivier; Warnick, Ronald E; Franco, Robert S; Qi, Xiaoyang

    2014-08-30

    Brain tumors, either primary (e.g., glioblastoma multiforme) or secondary (metastatic), remain among the most intractable and fatal of all cancers. We have shown that nanovesicles consisting of Saposin C (SapC) and dioleylphosphatidylserine (DOPS) are able to effectively target and kill cancer cells both in vitro and in vivo. These actions are a consequence of the affinity of SapC-DOPS for phosphatidylserine, an acidic phospholipid abundantly present in the outer membrane of a variety of tumor cells and tumor-associated vasculature. In this study, we first characterize SapC-DOPS bioavailability and antitumor effects on human glioblastoma xenografts, and confirm SapC-DOPS specificity towards phosphatidylserine by showing that glioblastoma targeting is abrogated after in vivo exposure to lactadherin, which binds phosphatidylserine with high affinity. Second, we demonstrate that SapC-DOPS selectively targets brain metastases-forming cancer cells both in vitro, in co-cultures with human astrocytes, and in vivo, in mouse models of brain metastases derived from human breast or lung cancer cells. Third, we demonstrate that SapC-DOPS have cytotoxic activity against metastatic breast cancer cells in vitro, and prolong the survival of mice harboring brain metastases. Taken together, these results support the potential of SapC-DOPS for the diagnosis and therapy of primary and metastatic brain tumors.

  18. [Dynamics of sap flow density in stems of typical desert shrub Calligonum mongolicum and its responses to environmental variables].

    PubMed

    Xu, Shi-qin; Ji, Xi-bin; Jin, Bo-wen

    2016-02-01

    Independent measurements of stem sap flow in stems of Calligonum mongolicum and environmental variables using commercial sap flow gauges and a micrometeorological monitoring system, respectively, were made to simulate the variation of sap flow density in the middle range of Hexi Corridor, Northwest China during June to September, 2014. The results showed that the diurnal process of sap flow density in C. mongolicum showed a broad unimodal change, and the maximum sap flow density reached about 30 minutes after the maximum of photosynthetically active radiation (PAR) , while about 120 minutes before the maximum of temperature and vapor pressure deficit (VPD). During the studying period, sap flow density closely related with atmosphere evapor-transpiration demand, and mainly affected by PAR, temperature and VPD. The model was developed which directly linked the sap flow density with climatic variables, and good correlation between measured and simulated sap flow density was observed in different climate conditions. The accuracy of simulation was significantly improved if the time-lag effect was taken into consideration, while this model underestimated low and nighttime sap flow densities, which was probably caused by plant physiological characteristics.

  19. The Planner in the Vortex of a Developing Storm

    ERIC Educational Resources Information Center

    Humphreys, Edward H.

    1975-01-01

    Discusses three essential differences between playing the planning game at the national and at the local level. These involve financial constraints, a concern for manpower development, and the distance between the planner and the public. (Author/WM)

  20. Entry Trajectory Planner for High Elevation Mars Landing

    NASA Astrophysics Data System (ADS)

    Bombelli, A.; Soler, L.; Mease, K.

    2014-06-01

    Achieving high elevation landing sites requires parachute deployment altitude control. A planner is proposed that yields trajectories with near-optimal performance, where control profiles are obtained as solutions of non-linear programming problems.

  1. Mekong Floods Fill Tonle Sap

    NASA Technical Reports Server (NTRS)

    2002-01-01

    The monsoon season in Southeast Asia brings recurring, often devastating floods to countries in the region, but these floods also play a necessary role in the region's water cycle. These MODIS images centered on Cambodia reveal extensive flooding of the Mekong River, which comes in from Laos in the north, to the right of center in the images, and flows south through Cambodia and southeast through Vietnam to empty into the South China Sea. The true-color image shows the brownish, sediment-laden floodwaters filling the Mekong Delta in southern Cambodia and Vietnam on September 15, 2001. The false color image above has been enhanced to bring out the contrast between the floodwaters and the lands, with sediment-carrying floodwaters in purple. Sediment can be seen flowing into the South China Sea as well. This year's floods have affected over a million people, and 100 people have been killed in Vietnam alone. The monsoon floods bring not only devastation, but renewal. The large body of water just left of center in Cambodia is the Tonle Sap. This shallow lake plays a changing role in the regional water cycle. During the dry season, the stream-fed Tonle Sap drains via the Tonle Sab River into the Mekong River. During the wet season (June-November), flooding of the Mekong reverses the course of the Tonle Sab, roughly tripling the lake's size from about 3000 km2 to about 10,000. When the dry season returns, the lake once again begins to drain into the Mekong Delta, where it provides a flow of fresh water that balances the intrusion of salty seawater into the delta's agricultural lands. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  2. TEAM (Technologies Enabling Agile Manufacturing) macro planner requirements guide: Version 1.0

    SciTech Connect

    1995-03-28

    The Macro Planner will provide required resource identities, bill of material list, routing sequences and identities of all supporting information to the Shop Floor Control System to enable the actual manufacturing activities. The Macro Planner must also collect manufacturing performance data from the shop floor to effectively measure the plan`s performance. The critical feedback will be evaluated during closure of the business cycle and provide the metrics on cost and quality to the planning function. This document is intended to describe the requirements for a Macro Planner system which supports the above environment. The Macro planner should progress to a logically, rule driven processor to automate major portions of the planning cycle. It should do the following: support concurrent product/process design; define a globally optimized manufacturing plan for realization of product; compile a complete manufacturing plan script (routing and operational detail documentation); be based on 3-D CAD models imported via STEP standards; and define an Enterprise Resource Base that maps manufacturing capabilities to component features.

  3. Structure-function analysis of SAP97, a modular scaffolding protein that drives dendrite growth.

    PubMed

    Zhang, L; Hsu, F-C; Mojsilovic-Petrovic, J; Jablonski, A M; Zhai, J; Coulter, D A; Kalb, R G

    2015-03-01

    Activation of AMPA receptors assembled with the GluA1 subunit can promote dendrite growth in a manner that depends on its direct binding partner, SAP97. SAP97 is a modular scaffolding protein that has at least seven recognizable protein-protein interaction domains. Several complementary approaches were employed to show that the dendrite branching promoting action of full length SAP97 depends on ligand(s) that bind to the PDZ3 domain. Ligand(s) to PDZ1, PDZ2 and I3 domains also contribute to dendrite growth. The ability of PDZ3 ligand(s) to promote dendrite growth depends on localization at the plasma membrane along with GluA1 and SAP97. These results suggest that the assembly of a multi-protein complex at or near synapses is vital for the translation of AMPA-R activity into dendrite growth.

  4. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 1 2014-10-01 2014-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  5. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 1 2013-10-01 2013-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  6. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  7. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 1 2011-10-01 2011-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  8. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 1 2012-10-01 2012-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  9. The FORTRAN static source code analyzer program (SAP) system description

    NASA Technical Reports Server (NTRS)

    Decker, W.; Taylor, W.; Merwarth, P.; Oneill, M.; Goorevich, C.; Waligora, S.

    1982-01-01

    A source code analyzer program (SAP) designed to assist personnel in conducting studies of FORTRAN programs is described. The SAP scans FORTRAN source code and produces reports that present statistics and measures of statements and structures that make up a module. The processing performed by SAP and of the routines, COMMON blocks, and files used by SAP are described. The system generation procedure for SAP is also presented.

  10. Behavior and Characteristics of Sap-Feeding North Island kākā (Nestor meridionalis septentrionalis) in Wellington, New Zealand

    PubMed Central

    Charles, Kerry E.; Linklater, Wayne L.

    2013-01-01

    Simple Summary Understanding the behavior of problem animal species assists in understanding and mitigating problems caused by wildlife in urban landscapes. The kākā, a threatened New Zealand native parrot, causes damage to trees while feeding on sap. Through observations of sap foraging kākā in Wellington City, this study builds on the limited knowledge of sap feeding and tests hypotheses about the age and sex of sap feeding birds. We found that sap feeding likely occurs in both sexes and across age groups, and that sap feeding birds also utilize supplementary food. This study suggests that sap is an important food source for kākā and that further provision of supplementary food is unlikely to reduce sap feeding and associated tree damage. Abstract The North Island kākā (Nestor meridionalis septentrionalis), a threatened New Zealand native parrot, was successfully reintroduced to an urban sanctuary in Wellington, New Zealand. Conflict has recently begun to emerge with Wellington City residents due to tree damage caused by kākā sap foraging. Little is known about sap foraging behavior of kākā, and this study aimed to gain a greater understanding of this behavior, and to test hypotheses that sap feeding is predominantly a female activity and that one technique, forming transverse gouges through bark, may be restricted to adult kākā. We used instantaneous scan sampling to record the behavior of kākā during 25 60–100 minute observation periods at Anderson Park, Wellington Botanic Garden, and during 13 opportunistic observations of sap feeding kākā in Wellington City. Forty-one observations of sap feeding were made of 21 individually-identified birds. Sap feeding birds were predominantly young and, based on estimated sex, females were no more likely to sap feed than males (exact binomial test p = 0.868). Twenty of the 21 identified sap feeding kākā utilized supplementary feeding stations at Zealandia-Karori Wildlife Sanctuary. Kākā were observed

  11. Environmental controls on sap flow in a northern hardwood forest.

    PubMed

    Bovard, B D; Curtis, P S; Vogel, C S; Su, H-B; Schmid, H P

    2005-01-01

    Our objective was to gain a detailed understanding of how photosynthetically active radiation (PAR), vapor pressure deficit (D) and soil water interact to control transpiration in the dominant canopy species of a mixed hardwood forest in northern Lower Michigan. An improved understanding of how these environmental factors affect whole-tree water use in unmanaged ecosystems is necessary in assessing the consequences of climate change on the terrestrial water cycle. We used continuously heated sap flow sensors to measure transpiration in mature trees of four species during two successive drought events. The measurements were scaled to the stand level for comparison with eddy covariance estimates of ecosystem water flux (Fw). Photosynthetically active radiation and D together explained 82% of the daytime hourly variation in plot-level transpiration, and low soil water content generally resulted in increased stomatal sensitivity to increasing D. There were also species-specific responses to drought. Quercus rubra L. showed low water use during both dry and wet conditions, and during periods of high D. Among the study species, Acer rubrum L. showed the greatest degree of stomatal closure in response to low soil water availability. Moderate increases in stomatal sensitivity to D during dry periods were observed in Populus grandidentata Michx. and Betula papyrifera Marsh. Sap flow scaled to the plot level and Fw demonstrated similar temporal patterns of water loss suggesting that the mechanisms controlling sap flow of an individual tree also control ecosystem evapotranspiration. However, the absolute magnitude of scaled sap flow estimates was consistently lower than Fw. We conclude that species-specific responses to PAR, D and soil water content are key elements to understanding current and future water fluxes in this ecosystem.

  12. Job Analysis of the Professional Requirements of the Certified Financial Planner.

    ERIC Educational Resources Information Center

    Skurnik, Larry

    A study examined the job functions of certified financial planners, the areas of knowledge needed by new financial planners, the links between these knowledge areas and the job functions of financial planners, and the validity of the examinations currently used by the College of Financial Planning to certify financial planners. A multimethod…

  13. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins, which are likely to be important players in th...

  14. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins which are likely to be important players in the...

  15. Insects attracted to Maple Sap: Observations from Prince Edward Island, Canada

    PubMed Central

    Majka, Christopher G.

    2010-01-01

    Abstract The collection of maple sap for the production of maple syrup is a large commercial enterprise in Canada and the United States. In Canada, which produces 85% of the world’s supply, it has an annual value of over $168 million CAD. Over 38 million trees are tapped annually, 6.5% of which use traditional buckets for sap collection. These buckets attract significant numbers of insects. Despite this, there has been very little investigation of the scale of this phenomenon and the composition of insects that are attracted to this nutrient source. The present paper reports the results of a preliminary study conducted on Prince Edward Island, Canada. Twenty-eight species of Coleoptera, Lepidoptera, and Trichoptera were found in maple sap buckets, 19 of which are known to be attracted to saps and nectars. The physiological role of sap feeding is discussed with reference to moths of the tribe Xylenini, which are active throughout the winter, and are well documented as species that feed on sap flows. Additionally, 18 of the 28 species found in this study are newly recorded in Prince Edward Island. PMID:21594122

  16. Sap phytochemical compositions of some bananas in Thailand.

    PubMed

    Pothavorn, Pongsagon; Kitdamrongsont, Kasipong; Swangpol, Sasivimon; Wongniam, Siripope; Atawongsa, Kanokporn; Savasti, Jisnuson; Somana, Jamorn

    2010-08-11

    Banana sap has some special properties relating to various phenomena such as browning of fruits after harvesting, permanent staining of cloth and fibers, and antioxidant and antibleeding properties. Analysis of banana sap using high-performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS) indicated the presence of phenolic and aromatic amino compounds of interest due to their special properties. With the online positive electrospray ionization mode (ESI), the possible structures of specific compounds were determined from the fragmentation patterns of each particular ion appearing in the mass spectra. The major compounds revealed from the sap of banana accessions, namely, Musa balbisiana , Musa laterita , Musa ornata , and Musa acuminata , and some cultivars were apigenin glycosides, myricetin glycoside, myricetin-3-O-rutinoside, naringenin glycosides, kaempferol-3-O-rutinoside, quercetin-3-O-rutinoside, dopamine, and N-acetylserotonin. The results indicated that there was a variety of phenolic and aromatic amino contents in many banana species. These compounds were reported to relate with biological activities. Moreover, the identities of these phytochemical compositions may be used as markers for banana diet, the assessment of physiochemical status, or the classification of banana clones.

  17. Using Model Checking to Validate AI Planner Domain Models

    NASA Technical Reports Server (NTRS)

    Penix, John; Pecheur, Charles; Havelund, Klaus

    1999-01-01

    This report describes an investigation into using model checking to assist validation of domain models for the HSTS planner. The planner models are specified using a qualitative temporal interval logic with quantitative duration constraints. We conducted several experiments to translate the domain modeling language into the SMV, Spin and Murphi model checkers. This allowed a direct comparison of how the different systems would support specific types of validation tasks. The preliminary results indicate that model checking is useful for finding faults in models that may not be easily identified by generating test plans.

  18. A Constraint-Based Planner for Data Production

    NASA Technical Reports Server (NTRS)

    Pang, Wanlin; Golden, Keith

    2005-01-01

    This paper presents a graph-based backtracking algorithm designed to support constrain-tbased planning in data production domains. This algorithm performs backtracking at two nested levels: the outer- backtracking following the structure of the planning graph to select planner subgoals and actions to achieve them and the inner-backtracking inside a subproblem associated with a selected action to find action parameter values. We show this algorithm works well in a planner applied to automating data production in an ecological forecasting system. We also discuss how the idea of multi-level backtracking may improve efficiency of solving semi-structured constraint problems.

  19. Teachers as Curriculum Planners. Narratives of Experience.

    ERIC Educational Resources Information Center

    Connelly, F. Michael; Clandinin, D. Jean

    The intent of this book is to strengthen the professional role teachers play in curriculum planning and development, a process central to teacher activity and responsibility. Contextual narratives, document analysis, the use of metaphor, personal rules, principles, beliefs, images, and philosophy are all described for use in hands-on exercises.…

  20. Reduced cathepsins B and D cause impaired autophagic degradation that can be almost completely restored by overexpression of these two proteases in Sap C-deficient fibroblasts.

    PubMed

    Tatti, Massimo; Motta, Marialetizia; Di Bartolomeo, Sabrina; Scarpa, Susanna; Cianfanelli, Valentina; Cecconi, Francesco; Salvioli, Rosa

    2012-12-01

    Saposin (Sap) C deficiency, a rare variant form of Gaucher disease, is due to mutations in the Sap C coding region of the prosaposin (PSAP) gene. Sap C is required as an activator of the lysosomal enzyme glucosylceramidase (GCase), which catalyzes glucosylceramide (GC) degradation. Deficit of either GCase or Sap C leads to the accumulation of undegraded GC and other lipids in lysosomes of monocyte/macrophage lineage. Recently, we reported that Sap C mutations affecting a cysteine residue result in increased autophagy. Here, we characterized the basis for the autophagic dysfunction. We analyzed Sap C-deficient and GCase-deficient fibroblasts and observed that autophagic disturbance was only associated with lack of Sap C. By a combined fluorescence microscopy and biochemical studies, we demonstrated that the accumulation of autophagosomes in Sap C-deficient fibroblasts is not due to enhanced autophagosome formation but to delayed degradation of autolysosomes caused, in part, to decreased amount and reduced enzymatic activity of cathepsins B and D. On the contrary, in GCase-deficient fibroblasts, the protein level and enzymatic activity of cathepsin D were comparable with control fibroblasts, whereas those of cathepsin B were almost doubled. Moreover, the enhanced expression of both these lysosomal proteases in Sap C-deficient fibroblasts resulted in close to functional autophagic degradation. Our data provide a novel example of altered autophagy as secondary event resulting from insufficient lysosomal function.

  1. The Personal Learning Planner: Collaboration through Online Learning and Publication

    ERIC Educational Resources Information Center

    Gibson, David; Sherry, Lorraine; Havelock, Bruce

    2007-01-01

    This paper discusses the online Personal Learning Planner (PLP) project underway at the National Institute of Community Innovations (NICI), one of the partners in the Teacher Education Network (TEN), a 2000 PT3 Catalyst grantee. The Web-based PLP provides a standards-linked "portfolio space" for both works in progress and demonstration collections…

  2. Office Landscape: A New Concept for Library Planners

    ERIC Educational Resources Information Center

    Barkey, Patrick

    1969-01-01

    A discussion of the design principles that architects and planners call "Office Landscape, which is an attempt to incorporate a management concept into the total environmental system of a library. The goals of the management concept are to effect communication and to allow change. (RM)

  3. Water facts and figures for planners and managers

    USGS Publications Warehouse

    Feth, John Henry Frederick

    1973-01-01

    The units commonly used by hydrologists with respect to quantities and quality of water are denned; their significance in water management is outlined, and metric-english equivalents are given for many. A glossary of terms concludes the report which is intended as a reference work for use by planners and managers.

  4. METRO-APEX Volume 5.1: Planner's Manual. Revised.

    ERIC Educational Resources Information Center

    University of Southern California, Los Angeles. COMEX Research Project.

    The Planner's Manual is one of a set of twenty-one manuals used in METRO-APEX 1974, a computerized college and professional level, computer-supported, role-play, simulation exercise of a community with "normal" problems. Stress is placed on environmental quality considerations. APEX 1974 is an expansion of APEX--Air Pollution Exercise…

  5. Educational Cost Analysis in Action: Case Studies for Planners -- II.

    ERIC Educational Resources Information Center

    Coombs, Philip H.; Hallak, Jacques

    This document is the second in a series of three documents, which together contain 27 case studies on the uses of cost analysis in educational planning. The case studies are presented to help planners and administrators see how cost analysis can be used to improve the efficiency of their educational systems, or to get the best value existing…

  6. Enlisting the support of land-use planners to reduce debris-flow hazards in the United States

    USGS Publications Warehouse

    Gori, P.L.; Jeer, S.P.; Highland, L.M.; ,

    2003-01-01

    Land-use planners have an important role in reducing losses from debris-flow hazards. For that reason, the U.S. Geological Survey (USGS) and the American Planning Association (APA) have developed a strategy to make information about landslide and debris-flow hazards available to local planners so that they can incorporate this information into the planning process. A guidebook for planners and active training and technical support are the centerpieces of this strategy. The strategy that the USGS is using, which enlists the support of a professional society such as the APA to develop the guidebook and communicate with its members, may be a useful example for other countries to follow. ?? 2003 Millpress.

  7. OPPS - OEL PROJECT PLANNER/SCHEDULER

    NASA Technical Reports Server (NTRS)

    Murphy, S. C.

    1994-01-01

    OPPS is a window-based graphics tool that provides easy and fast on-screen WYSIWYG editing capabilities. It has a canvas area which displays a full image of the schedule being edited. The canvas contains a header area (for text) and a schedule area (for plotting graphic representations of milestone objects in a flexible timeline). The OPPS tool is object-oriented, but it is unique in its capability for creating objects that have date attributes. Each object on the screen can be treated as a unit for moving, editing, etc. There is a mouse interface for simple control of pointer location. The user can position objects to pixel resolution, but objects with an associated date are positioned automatically in their correct timeline position in the schedule area. The schedule area has horizontal lines across the page with capabilities for multiple pages and for editing the number of lines per page and the line grid. The text on a line can be edited and a line can be moved with all objects on the line moving with it. The timeline display can be edited to plot any time period in a variety of formats from Fiscal Year to Calendar Year and days to years. Text objects and image objects (rasterfiles and icons) can be created for placement anywhere on the page. Milestone event objects with a single associated date (and optional text and milestone symbol) and activity objects with start and end dates (and an optional completion date) have unique editing panels for entering data. A representation for schedule slips is also provided. A milestone schedule can be saved to an ASCII file on another computer to be read by OPPS. The program can also print a schedule to a PostScript file. This program is not intended to replace a commercial scheduling/project management program. It does not provide the capability for defining dependencies between activities; dates must be provided manually. However, because OPPS has an ASCII file interface it can be used in conjunction with a project

  8. COSMO-SkyMed Second Generation planner

    NASA Astrophysics Data System (ADS)

    Covello, Fabio; Scopa, Tiziana; Serva, Stefano; Caltagirone, Francesco; De Luca, Giuseppe Francesco; Pacaccio, Alessandro; Profili, Mario

    2014-10-01

    COSMO-SkyMed Second Generation (CSG) system has been conceived, according to Italian Space Agency (ASI) and Italian Ministry of Defence (It-MoD) requirements, at the twofold objective of ensuring operational continuity to the current constellation (COSMO-SkyMed - CSK), while improving functionality and performances. It is an "end-to-end" Italian Earth Observation Dual-Use (Civilian and Defence) Space System with Synthetic Aperture Radar (SAR) operating in X-Band. CSG mission planning purpose is to fully employ the system resources, shared between partners with very different needs, producing a mission plan that satisfies the higher priority requests and optimizes the overall plan with the remaining requests according to the users programming rights consumption. CSG Mission Planning tool provides new performances in terms of adaptability and flexibility of the planning and scheduling algorithms conceived to select and synchronize data acquisition and downloading activities. CSG planning and scheduling problem is characterized by a large size of research space and a particular structure of technical and managerial constraints that has led to the implementation of innovative design of the planning algorithms based on both priority criteria and saturation of system resources. This approach envisages two scheduling strategies: the rank-based and the optimization-based. The former strategy is firstly applied to the most important request categories, with an associated rank value or priority level; the latter is subsequently applied to the unranked or lower priority requests. This is an iterative dynamic process of finding optimal solutions able to better answer the demanding requirements coming from the needs of heterogeneous users.

  9. XOPPS - OEL PROJECT PLANNER/SCHEDULER TOOL

    NASA Technical Reports Server (NTRS)

    Mulnix, C. L.

    1994-01-01

    XOPPS is a window-based graphics tool for scheduling and project planning that provides easy and fast on-screen WYSIWYG editing capabilities. It has a canvas area which displays the full image of the schedule being edited. The canvas contains a header area for text and a schedule area for plotting graphic representations of milestone objects in a flexible timeline. XOPPS is object-oriented, but it is unique in its capability for creating objects that have date attributes. Each object on the screen can be treated as a unit for moving, editing, etc. There is a mouse interface for simple control of pointer location. The user can position objects to pixel resolution, but objects with an associated date are positioned automatically in their correct timeline position in the schedule area. The schedule area has horizontal lines across the page with capabilities for multiple pages and for editing the number of lines per page and the line grid. The text on a line can be edited and a line can be moved with all objects on the line moving with it. The timeline display can be edited to plot any time period in a variety of formats from Fiscal year to Calendar Year and days to years. Text objects and image objects (rasterfiles and icons) can be created for placement anywhere on the page. Milestone event objects with a single associated date (and optional text and milestone symbol) and activity objects with start and end dates (and an optional completion date) have unique editing panels for entering data. A representation for schedule slips is also provided with the capability to automatically convert a milestone event to a slip. A milestone schedule on another computer can be saved to an ASCII file to be read by XOPPS. The program can print a schedule to a PostScript file. Dependencies between objects can also be displayed on the chart through the use of precedence lines. This program is not intended to replace a commercial scheduling/project management program. Because XOPPS has

  10. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 2 2013-04-01 2013-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  11. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 2 2012-04-01 2012-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  12. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 2 2014-04-01 2014-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  13. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 2 2011-04-01 2011-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  14. N-terminal SAP97 isoforms differentially regulate synaptic structure and postsynaptic surface pools of AMPA receptors.

    PubMed

    Goodman, Lucy; Baddeley, David; Ambroziak, Wojciech; Waites, Clarissa L; Garner, Craig C; Soeller, Christian; Montgomery, Johanna M

    2017-02-28

    The location and density of postsynaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors is controlled by scaffolding proteins within the postsynaptic density (PSD). SAP97 is a PSD protein with two N-terminal isoforms, α and β, that have opposing effects on synaptic strength thought to result from differential targeting of AMPA receptors into distinct synaptic versus extrasynaptic locations, respectively. In this study, we have applied dSTORM super resolution imaging in order to localize the synaptic and extrasynaptic pools of AMPA receptors in neurons expressing α or βSAP97. Unexpectedly, we observed that both α and βSAP97 enhanced the localization of AMPA receptors at synapses. However, this occurred via different mechanisms: αSAP97 increased PSD size and consequently the number of receptor binding sites, whilst βSAP97 increased synaptic receptor cluster size and surface AMPA receptor density at the PSD edge and surrounding perisynaptic sites without changing PSD size. αSAP97 also strongly enlarged presynaptic active zone protein clusters, consistent with both presynaptic and postsynaptic enhancement underlying the previously observed αSAP97-induced increase in AMPA receptor-mediated currents. In contrast, βSAP97-expressing neurons increased the proportion of immature filopodia that express higher levels of AMPA receptors, decreased the number of functional presynaptic terminals, and also reduced the size of the dendritic tree and delayed the maturation of mushroom spines. Our data reveal that SAP97 isoforms can specifically regulate surface AMPA receptor nanodomain clusters, with βSAP97 increasing extrasynaptic receptor domains at peri-synaptic and filopodial sites. Moreover, βSAP97 negatively regulates synaptic maturation both structurally and functionally. These data support diverging presynaptic and postsynaptic roles of SAP97 N-terminal isoforms in synapse maturation and plasticity. As numerous splice isoforms exist in

  15. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  16. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 7 2012-10-01 2012-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  17. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 7 2013-10-01 2013-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  18. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 7 2014-10-01 2014-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  19. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 7 2011-10-01 2011-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  20. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  1. Surface Absorption Polarization Sensors (SAPS), Final Technical Report, Laser Probing of Immobilized SAPS Actuators Component

    SciTech Connect

    Joseph I. Cline

    2010-04-22

    A novel hypothesized detection scheme for the detection of chemical agents was proposed: SAPS ``Surface-Adsorbed Polarization Sensors''. In this technique a thin layer of molecular rotors is adsorbed to a surface. The rotors can be energized by light absorption, but are otherwise locked in position or alternatively rotate slowly. Using polarized light, the adsorbed rotors are turned as an ensemble. Chemical agent (analyte) binding that alters the rotary efficiency would be detected by sensitive polarized absorption techniques. The mechanism of the SAPS detection can be mechanical, chemical, or photochemical: only a change in rotary efficiency is required. To achieve the goal of SAPS detection, new spectroscopic technique, polarized Normal Incidence Cavity Ringdown Spectroscopy (polarized NICRDS), was developed. The technique employs very sensitive and general Cavity Ringdown absorption spectroscopy along with the ability to perform polarized absorption measurements. Polarized absorption offers the ability to measure the angular position of molecular chromophores. In the new experiments a thin layer of SAPS sensors (roughly corresponding to a monolayer coverage on a surface) immobilized in PMMA. The PMMA layer is less than 100~nm thick and is spin-coated onto a flat fused-silica substrate. The new technique was applied to study the photoisomerization-driven rotary motion of a family of SAPS actuators based on a family of substituted dibenzofulvene rotors based upon 9-(2,2,2- triphenylethylidene)fluorene. By varying the substitution to include moieties such as nitro, amino, and cyano the absorption spectrum and the quantum efficiency of photoisomerization can be varied. This SAPS effect was readily detected by polarized NICRDS. The amino substituted SAPS actuator binds H+ to form an ammonium species which was shown to have a much larger quantum efficiency for photoisomerization. A thin layer of immobilized amino actuators were then shown by polarized NICRDS to have a

  2. The Education and Development of Strategic Planners in the Navy

    DTIC Science & Technology

    1990-12-01

    University 1968-1970 USS DDG, Main Propulsion Assistant 1970-1972 USS MSO, Executive Officer/Navigation 1972 Naval Destroyer School , Department Head ...AD-A247 021 ’ NAVAL POSTGRADUATE SCHOOL Monterey, California DTIC ELECTEMAR 0 9199a THE SIS S I, THE EDUCATION AND DEVELOPMENT OF STRATEGIC PLANNERS...OF PERFORMING ORGANIZATION I6b OFIFICE SYMBOL 7a NAME OF Mt)NITORING OIi(,ANI/AIION (If applcable) Naval Postgraduate School NS Naval Postgraduate

  3. Engaging an army of planners: An eBay case study.

    PubMed

    Baldwin, Scott

    2014-01-01

    Although led by a central corporate group, continuity planning at eBay is conducted by a community of planners native to their own departments. True programme success requires the full participation of these planners. This paper presents a case study of eBay's experience in achieving and maintaining planner engagement.

  4. Behavior and Characteristics of Sap-Feeding North Island kākā (Nestor meridionalis septentrionalis) in Wellington, New Zealand.

    PubMed

    Charles, Kerry E; Linklater, Wayne L

    2013-08-16

    The North Island kākā (Nestor meridionalis septentrionalis), a threatened New Zealand native parrot, was successfully reintroduced to an urban sanctuary in Wellington, New Zealand. Conflict has recently begun to emerge with Wellington City residents due to tree damage caused by kākā sap foraging. Little is known about sap foraging behavior of kākā, and this study aimed to gain a greater understanding of this behavior, and to test hypotheses that sap feeding is predominantly a female activity and that one technique, forming transverse gouges through bark, may be restricted to adult kākā. We used instantaneous scan sampling to record the behavior of kākā during 25 60-100 minute observation periods at Anderson Park, Wellington Botanic Garden, and during 13 opportunistic observations of sap feeding kākā in Wellington City. Forty-one observations of sap feeding were made of 21 individually-identified birds. Sap feeding birds were predominantly young and, based on estimated sex, females were no more likely to sap feed than males (exact binomial test p = 0.868). Twenty of the 21 identified sap feeding kākā utilized supplementary feeding stations at Zealandia-Karori Wildlife Sanctuary. Kākā were observed defending sap feeding sites from tui (Prosthemadera novaeseelandiae) and conspecifics. Sap appears to be an important resource for kākā across sexes and life stages, and provision of supplementary food is unlikely to reduce sap feeding and tree damage in Wellington City.

  5. Sampling and analysis of phloem sap.

    PubMed

    Dinant, Sylvie; Kehr, Julia

    2013-01-01

    The transport tubes of the phloem are essential for higher plants. They not only provide the route for the distribution of assimilates produced during photosynthesis from source to sink organs but also (re-) distribute mineral nutrients. Additionally, the phloem is essential for sending information between distant plant organs and steering developmental and defense processes. For example, flowering and tuberization time are controlled by phloem-mobile signals and important defense reactions on the whole plant level, like systemic acquired resistance or systemic gene silencing, are spread through the phloem. In addition, recent results demonstrate that also the allocation of mineral nutrients is coordinated by phloem mobile signaling molecules. However, in many studies the important analysis of phloem sap is neglected, probably because the content of sieve tubes is not easy to access. This chapter will describe the current methods for sampling and analysis of phloem sap in order to encourage researchers to include the analysis of this crucial compartment in their relevant studies.

  6. Assessment of Combined Ascorbyl Palmitate (AP) and Sodium Ascorbyl Phosphate (SAP) on Facial Skin Sebum Control in Female Healthy Volunteers.

    PubMed

    Khan, H; Akhtar, N; Ali, A

    2017-01-01

    The skin is fortified with a setup of lipophilic and hydrophilic, enzymatic and non-enzymatic antioxidant systems. Ascorbyl palmitate (AP) and sodium ascorbyl phosphate (SAP) are reported as lipophilic and hydrophilic antioxidants, respectively used for skin care. Present study was aimed to assess the combined AP (in oil phase) and SAP (in aqueous phase) via multiple emulsion (ME1) for controlling sebum secretions in healthy human females. FTIR analysis of AP and SAP was performed for identification. Multiple emulsions (ME1 and control) were prepared and analyzed for physical stability. Antioxidant activities of AP, SAP as well as ME1 (with combination of these compounds) were determined by DPPH method. 11 female volunteers were included in a single-blinded, placebo-controlled, split-face comparative study. Volunteers were instructed to apply ME1 on left cheek while control (without AP and SAP) on right cheek, for a period of 90 days. A non-invasive photometric device (Sebumeter(®)) was used for the measurement of sebum secretions on both sides of the face with subsequent time intervals. A good antioxidant activity of ME1 was observed. ME1 treatments reduced significant facial sebum secretions as compared with control/placebo treatments. It was concluded that combined AP and SAP supplementations to skin proved a promising choice for controlling facial sebum secretions and could be evaluated for undesired oily skin and acne reductions for beautifying the facial appearance.

  7. Environmental Measurements Path Planner (EMPath) User’s Manual

    DTIC Science & Technology

    2012-06-01

    Environmental Measurements Path Planner (EMPath) User’s Manual Kevin D. Heaney RicHaRD L. campbeLL RicHaRD H. StRoop Ocean Acoustical Services and... Stroop ,* Lucy F. Smedstad, and Germana Peggion† Naval Research Laboratory Oceanography Division Stennis Space Center, MS 39529-5004 NRL/MR/7320--12-9359...genetic material for the evaluation setCords – uses information in “Cords_initial.txt” to define where the platforms must start ( effectively only

  8. Structure Constraints in a Constraint-Based Planner

    NASA Technical Reports Server (NTRS)

    Pang, Wan-Lin; Golden, Keith

    2004-01-01

    In this paper we report our work on a new constraint domain, where variables can take structured values. Earth-science data processing (ESDP) is a planning domain that requires the ability to represent and reason about complex constraints over structured data, such as satellite images. This paper reports on a constraint-based planner for ESDP and similar domains. We discuss our approach for translating a planning problem into a constraint satisfaction problem (CSP) and for representing and reasoning about structured objects and constraints over structures.

  9. Potential pathways for regulation of NK and T cell responses: differential X-linked lymphoproliferative syndrome gene product SAP interactions with SLAM and 2B4.

    PubMed

    Sayós, J; Nguyen, K B; Wu, C; Stepp, S E; Howie, D; Schatzle, J D; Kumar, V; Biron, C A; Terhorst, C

    2000-12-01

    SAP, the gene that is altered or absent in the X-linked lymphoproliferative syndrome (XLP), encodes a small protein that comprises a single SH2 domain and binds to the cell-surface protein SLAM which is present on activated or memory T and B cells. Because defective NK cell activity also has been reported in XLP patients, we studied the SAP gene in NK cells. SAP was induced upon viral infection of SCID mice and shown to be expressed in NK cells by in vitro culturing in the presence of IL-2. Moreover, SAP was expressed in the NK cell lines YT and RNK 16. Because SLAM, the cell-surface protein with which SAP interacts, and 2B4, a membrane protein having sequence homologies with SLAM, also were found to be expressed on the surfaces of activated NK and T cell populations, they may access SAP functions in these populations. Whereas we found that 2B4 also binds SAP, 2B4-SAP interactions occurred only upon tyrosine phosphorylation of 2B4. By contrast, SLAM-SAP interactions were independent of phosphorylation of Y281 and Y327 on SLAM. As CD48, the ligand for 2B4, is expressed on the surface of Epstein-Barr virus (EBV)-infected B cells, it is likely that SAP regulates signal transduction through this pair of cell-surface molecules. These data support the hypothesis that XLP is a result of both defective NK and T lymphocyte responses to EBV. The altered responses may be due to aberrant control of the signaling cascades which are initiated by the SLAM-SLAM and 2B4-CD48 interactions.

  10. A Critical Role for the GluA1 Accessory Protein, SAP97, in Cocaine Seeking

    PubMed Central

    White, Samantha L; Ortinski, Pavel I; Friedman, Shayna H; Zhang, Lei; Neve, Rachael L; Kalb, Robert G; Schmidt, Heath D; Pierce, R Christopher

    2016-01-01

    A growing body of evidence indicates that the transport of GluA1 subunit-containing calcium-permeable AMPA receptors (CP-AMPARs) to synapses in subregions of the nucleus accumbens promotes cocaine seeking. Consistent with these findings, the present results show that administration of the CP-AMPAR antagonist, Naspm, into the caudal lateral core or caudal medial shell of the nucleus accumbens attenuated cocaine priming-induced reinstatement of drug seeking. Moreover, viral-mediated overexpression of ‘pore dead' GluA1 subunits (via herpes simplex virus (HSV) GluA1-Q582E) in the lateral core or medial shell attenuated the reinstatement of cocaine seeking. The overexpression of wild-type GluA1 subunits (via HSV GluA1-WT) in the medial shell, but not the lateral core, enhanced the reinstatement of cocaine seeking. These results indicate that activation of GluA1-containing AMPARs in subregions of the nucleus accumbens reinstates cocaine seeking. SAP97 and 4.1N are proteins involved in GluA1 trafficking to and stabilization in synapses; SAP97-GluA1 interactions also influence dendritic growth. We next examined potential roles of SAP97 and 4.1N in cocaine seeking. Viral-mediated expression of a microRNA that reduces SAP97 protein expression (HSV miSAP97) in the medial accumbens shell attenuated cocaine seeking. In contrast, a virus that overexpressed a dominant-negative form of a 4.1N C-terminal domain (HSV 4.1N-CTD), which prevents endogenous 4.1N binding to GluA1 subunits, had no effect on cocaine seeking. These results indicate that the GluA1 subunit accessory protein SAP97 may represent a novel target for pharmacotherapeutic intervention in the treatment of cocaine craving. PMID:26149358

  11. Color planner for designers based on color emotions

    NASA Astrophysics Data System (ADS)

    Cheng, Ka-Man; Xin, John H.; Taylor, Gail

    2002-06-01

    During the color perception process, an associated feeling or emotion is induced in our brains, and this kind of emotion is termed as 'color emotion.' The researchers in the field of color emotions have put many efforts in quantifying color emotions with the standard color specifications and evaluating the influence of hue, lightness and chroma to the color emotions of human beings. In this study, a color planner was derived according to these findings so that the correlation of color emotions and standard color specifications was clearly indicated. Since people of different nationalities usually have different color emotions as different cultural and traditional backgrounds, the subjects in this study were all native Hong Kong Chinese and the color emotion words were all written in Chinese language in the visual assessments. Through the color planner, the designers from different areas, no matter fashion, graphic, interior or web site etc., can select suitable colors for inducing target color emotions to the customers or product-users since different colors convey different meanings to them. In addition, the designers can enhance the functionality and increase the attractiveness of their designed products by selecting suitable colors.

  12. Protein tyrosine phosphatase SAP-1 protects against colitis through regulation of CEACAM20 in the intestinal epithelium.

    PubMed

    Murata, Yoji; Kotani, Takenori; Supriatna, Yana; Kitamura, Yasuaki; Imada, Shinya; Kawahara, Kohichi; Nishio, Miki; Daniwijaya, Edwin Widyanto; Sadakata, Hisanobu; Kusakari, Shinya; Mori, Munemasa; Kanazawa, Yoshitake; Saito, Yasuyuki; Okawa, Katsuya; Takeda-Morishita, Mariko; Okazawa, Hideki; Ohnishi, Hiroshi; Azuma, Takeshi; Suzuki, Akira; Matozaki, Takashi

    2015-08-04

    Intestinal epithelial cells contribute to regulation of intestinal immunity in mammals, but the detailed molecular mechanisms of such regulation have remained largely unknown. Stomach-cancer-associated protein tyrosine phosphatase 1 (SAP-1, also known as PTPRH) is a receptor-type protein tyrosine phosphatase that is localized specifically at microvilli of the brush border in gastrointestinal epithelial cells. Here we show that SAP-1 ablation in interleukin (IL)-10-deficient mice, a model of inflammatory bowel disease, resulted in a marked increase in the severity of colitis in association with up-regulation of mRNAs for various cytokines and chemokines in the colon. Tyrosine phosphorylation of carcinoembryonic antigen-related cell adhesion molecule (CEACAM) 20, an intestinal microvillus-specific transmembrane protein of the Ig superfamily, was greatly increased in the intestinal epithelium of the SAP-1-deficient animals, suggesting that this protein is a substrate for SAP-1. Tyrosine phosphorylation of CEACAM20 by the protein tyrosine kinase c-Src and the consequent association of CEACAM20 with spleen tyrosine kinase (Syk) promoted the production of IL-8 in cultured cells through the activation of nuclear factor-κB (NF-κB). In addition, SAP-1 and CEACAM20 were found to form a complex through interaction of their ectodomains. SAP-1 and CEACAM20 thus constitute a regulatory system through which the intestinal epithelium contributes to intestinal immunity.

  13. The adaptor protein SAP regulates type II NKT-cell development, cytokine production, and cytotoxicity against lymphoma.

    PubMed

    Weng, Xiufang; Liao, Chia-Min; Bagchi, Sreya; Cardell, Susanna L; Stein, Paul L; Wang, Chyung-Ru

    2014-12-01

    CD1d-restricted NKT cells represent a unique lineage of immunoregulatory T cells that are divided into two groups, type I and type II, based on their TCR usage. Because there are no specific tools to identify type II NKT cells, little is known about their developmental requirements and functional regulation. In our previous study, we showed that signaling lymphocytic activation molecule associated protein (SAP) is essential for the development of type II NKT cells. Here, using a type II NKT-cell TCR transgenic mouse model, we demonstrated that CD1d-expressing hematopoietic cells, but not thymic epithelial cells, meditate efficient selection of type II NKT cells. Furthermore, we showed that SAP regulates type II NKT-cell development by controlling early growth response 2 protein and promyelocytic leukemia zinc finger expression. SAP-deficient 24αβ transgenic T cells (24αβ T cells) exhibited an immature phenotype with reduced Th2 cytokine-producing capacity and diminished cytotoxicity to CD1d-expressing lymphoma cells. The impaired IL-4 production by SAP-deficient 24αβ T cells was associated with reduced IFN regulatory factor 4 and GATA-3 induction following TCR stimulation. Collectively, these data suggest that SAP is critical for regulating type II NKT cell responses. Aberrant responses of these T cells may contribute to the immune dysregulation observed in X-linked lymphoproliferative disease caused by mutations in SAP.

  14. Faculty performance evaluation: the CIPP-SAPS model.

    PubMed

    Mitcham, M

    1981-11-01

    The issues of faculty performance evaluation for allied health professionals are addressed. Daniel Stufflebeam's CIPP (content-input-process-product) model is introduced and its development in a CIPP-SAPS (self-administrative-peer-student) model is pursued. Data sources for the SAPS portion of the model are discussed. A suggestion for the use of the CIPP-SAPS model within a teaching contract plan is explored.

  15. Decreased SAP Expression in T Cells from Patients with Systemic Lupus Erythematosus Contributes to Early Signaling Abnormalities and Reduced IL-2 Production.

    PubMed

    Karampetsou, Maria P; Comte, Denis; Kis-Toth, Katalin; Terhorst, Cox; Kyttaris, Vasileios C; Tsokos, George C

    2016-06-15

    T cells from patients with systemic lupus erythematosus (SLE) display a number of abnormalities, including increased early signaling events following engagement of the TCR. Signaling lymphocytic activation molecule family cell surface receptors and the X-chromosome-defined signaling lymphocytic activation molecule-associated protein (SAP) adaptor are important in the development of several immunocyte lineages and modulating the immune response. We present evidence that SAP protein levels are decreased in T cells and in their main subsets isolated from 32 women and three men with SLE, independent of disease activity. In SLE T cells, SAP protein is also subject to increased degradation by caspase-3. Forced expression of SAP in SLE T cells normalized IL-2 production, calcium (Ca(2+)) responses, and tyrosine phosphorylation of a number of proteins. Exposure of normal T cells to SLE serum IgG, known to contain anti-CD3/TCR Abs, resulted in SAP downregulation. We conclude that SLE T cells display reduced levels of the adaptor protein SAP, probably as a result of continuous T cell activation and degradation by caspase-3. Restoration of SAP levels in SLE T cells corrects the overexcitable lupus T cell phenotype.

  16. Expression of SAP5 and SAP9 in Candida albicans biofilms: comparison of bloodstream isolates with isolates from other sources.

    PubMed

    Joo, Min Young; Shin, Jong Hee; Jang, Hee-Chang; Song, Eun Song; Kee, Seung Jung; Shin, Myung Geun; Suh, Soon Pal; Ryang, Dong Wook

    2013-11-01

    Secreted aspartic proteases (Sap), encoded by a family of 10 SAP genes, are key virulence determinants in Candida albicans. Although biofilm-associated bloodstream infections (BSIs) are frequently caused by C. albicans, SAP gene expression in C. albicans biofilms formed by BSI isolates has not been evaluated. We compared the expression of two SAP genes, SAP5 and SAP9, in C. albicans biofilms formed by BSI isolates with those formed by isolates from other body sites. Sixty-three C. albicans isolates were analyzed, comprising 35 BSI isolates and 28 from other sites. A denture-strip biofilm model was used, and expression of the two SAP genes was quantified by real-time RT-PCR during planktonic or biofilm growth. Mean SAP5 expression levels of the BSI isolates were 3.59-fold and 3.86-fold higher in 24-h and 48-h biofilms, respectively, than in planktonic cells. These results did not differ from those for isolates from other sites (2.71-fold and 2.8-fold for 24-h and 48-h biofilms, respectively). By contrast, mean SAP9 expression during biofilm formation was higher in BSI isolates (2.89-fold and 3.29-fold at 24 and 48 h, respectively) than in isolates from other sites (1.27-fold and 1.32-fold at 24 and 48 h, respectively; both, P < 0.001). These results show, for the first time, that both SAP5 and SAP9 are upregulated in C. albicans biofilms formed by BSI isolates, and that BSI isolates may have a greater capacity to express SAP9 under biofilm conditions than isolates from other sites.

  17. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes.

    PubMed

    Rodríguez-Celma, Jorge; Ceballos-Laita, Laura; Grusak, Michael A; Abadía, Javier; López-Millán, Ana-Flor

    2016-08-01

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins which are likely to be important players in their functionalities. However, detailed information about their proteomes is only starting to arise due to the difficulties inherent to the collection methods. This review compiles the proteomic information available to date in these three plant fluids, and compares the proteomes obtained in different plant species in order to shed light into conserved functions in each plant fluid. Inter-species comparisons indicate that all these fluids contain the protein machinery for self-maintenance and defense, including proteins related to cell wall metabolism, pathogen defense, proteolysis, and redox response. These analyses also revealed that proteins may play more relevant roles in signaling in the phloem sap and apoplastic fluid than in the xylem sap. A comparison of the proteomes of the three fluids indicates that although functional categories are somewhat similar, proteins involved are likely to be fluid-specific, except for a small group of proteins present in the three fluids, which may have a universal role, especially in cell wall maintenance and defense. This article is part of a Special Issue entitled: Plant Proteomics--a bridge between fundamental processes and crop production, edited by Dr. Hans-Peter Mock.

  18. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false May employees or employers seek a second SAP... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an employee... seek a second SAP's evaluation in order to obtain another recommendation. (b) As an employer, you...

  19. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  20. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  1. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  2. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  3. NK cell cytotoxicity mediated by 2B4 and NTB-A is dependent on SAP acting downstream of receptor phosphorylation.

    PubMed

    Meinke, Stephan; Watzl, Carsten

    2013-01-01

    2B4 (CD244) and NK-T-B-antigen (NTB-A, CD352) are activating receptors on human natural killer (NK) cells and belong to the family of signaling lymphocyte activation molecule (SLAM)-related receptors (SRR). Engagement of these receptors leads to phosphorylation of their cytoplasmic tails and recruitment of the adapter proteins SLAM-associated protein (SAP) and Ewing's sarcoma-activated transcript-2 (EAT-2). X-linked lymphoproliferative syndrome (XLP) is a severe immunodeficiency that results from mutations in the SAP gene. 2B4 and NTB-A-mediated cytotoxicity are abrogated in XLP NK cells. To elucidate the molecular basis for this defect we analyzed early signaling events in SAP knockdown cells. Similar to XLP NK cells, knockdown of SAP in primary human NK cells leads to a reduction of 2B4 and NTB-A-mediated cytotoxicity. We found that early signaling events such as raft recruitment and receptor phosphorylation are not affected by the absence of SAP, indicating the defect in the absence of SAP is downstream of these events. In addition, knockdown of EAT-2 does not impair 2B4 or NTB-A-mediated cytotoxicity. Surprisingly, EAT-2 recruitment to both receptors is abrogated in the absence of SAP, revealing a novel cooperativity between these adapters.

  4. Leap Before You Look: Information Gathering In the PUCCINI Planner

    NASA Technical Reports Server (NTRS)

    Golden, Keith; Lau, Sonie (Technical Monitor)

    1998-01-01

    Most of the work in planning with incomplete information takes a "look before you leap" perspective: Actions must be guaranteed to have their intended effects before they can be executed. We argue that this approach is impossible to follow in many real-world domains. The agent may not have enough information to ensure that an action will have a given effect in advance of executing it. This paper describes PUCCINI, a partial order planner used to control the Internet Softbot (Etzioni & Weld 1994). PUCCINI takes a different approach to coping with incomplete information: "Leap before you look!" PUCCINI doesn't require actions to be known to have the desired effects before execution. However, it still maintains soundness, by requiring the effects to be verified eventually. We discuss how this is achieved using a simple generalization of causal links.

  5. A planner's perspective on the health impacts of urban settings.

    PubMed

    Thompson, Susan

    2007-01-01

    The profession of town planning originated out of concerns for the health and well-being of people. Progress was made as crowded and unsanitary inner city slums were replaced with suburban environments where individuals could access green open spaces and clean air. With significant increases in urban populations and the geographic spread of the city, over time these environments became increasingly unhealthy. This paper provides an overview of how modern urban environments impact on people's physical and psychological health. This understanding will assist planners and health professionals to ensure that HIA and other related impact assessment tools are effective in identifying and ameliorating potential adverse well-being outcomes of different urban policies and proposals for varying scales of development.

  6. The Challenge of Configuring Model-Based Space Mission Planners

    NASA Technical Reports Server (NTRS)

    Frank, Jeremy D.; Clement, Bradley J.; Chachere, John M.; Smith, Tristan B.; Swanson, Keith J.

    2011-01-01

    Mission planning is central to space mission operations, and has benefited from advances in model-based planning software. Constraints arise from many sources, including simulators and engineering specification documents, and ensuring that constraints are correctly represented in the planner is a challenge. As mission constraints evolve, planning domain modelers need help with modeling constraints efficiently using the available source data, catching errors quickly, and correcting the model. This paper describes the current state of the practice in designing model-based mission planning tools, the challenges facing model developers, and a proposed Interactive Model Development Environment (IMDE) to configure mission planning systems. We describe current and future technology developments that can be integrated into an IMDE.

  7. Advanced Free Flight Planner and Dispatcher's Workstation: Preliminary Design Specification

    NASA Technical Reports Server (NTRS)

    Wilson, J.; Wright, C.; Couluris, G. J.

    1997-01-01

    The National Aeronautics and Space Administration (NASA) has implemented the Advanced Air Transportation Technology (AATT) program to investigate future improvements to the national and international air traffic management systems. This research, as part of the AATT program, developed preliminary design requirements for an advanced Airline Operations Control (AOC) dispatcher's workstation, with emphasis on flight planning. This design will support the implementation of an experimental workstation in NASA laboratories that would emulate AOC dispatch operations. The work developed an airline flight plan data base and specified requirements for: a computer tool for generation and evaluation of free flight, user preferred trajectories (UPT); the kernel of an advanced flight planning system to be incorporated into the UPT-generation tool; and an AOC workstation to house the UPT-generation tool and to provide a real-time testing environment. A prototype for the advanced flight plan optimization kernel was developed and demonstrated. The flight planner uses dynamic programming to search a four-dimensional wind and temperature grid to identify the optimal route, altitude and speed for successive segments of a flight. An iterative process is employed in which a series of trajectories are successively refined until the LTPT is identified. The flight planner is designed to function in the current operational environment as well as in free flight. The free flight environment would enable greater flexibility in UPT selection based on alleviation of current procedural constraints. The prototype also takes advantage of advanced computer processing capabilities to implement more powerful optimization routines than would be possible with older computer systems.

  8. Utilization of chitosan as an antimicrobial agent for pasteurized palm sap (Borassus flabellifer Linn.) during storage.

    PubMed

    Naknean, Phisut; Jutasukosol, Keawta; Mankit, Theerarat

    2015-02-01

    The objective of this research was to assess the potential of chitosan for improvement the quality of pasteurized palm sap during storage. First, the effect of chitosan content on sensory attributes was investigated to select suitable concentration of chitosan for further study. Fresh palm sap was enriched with chitosan at various concentrations (0-2 g/L) and pasteurized at 80 °C for 10 min, consequently evaluated by consumers. It was found that samples added chitosan in the range of 0-1.00 g/L were considered acceptable. Thus, the addition chitosan in the concentration of 0-1.00 g/L was chosen for further study. The sample without chitosan addition was used as a control sample. Each selected sample was determined for their qualities during storage at 1 week interval. It was found that lightness and transmittance values of all samples tended to increase during storage. Lower PPO and invertase activity were observed in all chitosan-treated samples compared to control sample. Chitosan could minimize the loss of sucrose and the increase in glucose and fructose content during storage. In addition, an increase in chitosan concentration resulted in the increase in DPPH radical scavenging activity. Furthermore, the addition of chitosan could retard the development of microorganism during storage as demonstrated by lower microbial loads compared to control sample. It can be concluded that a combination of pasteurization with chitosan addition (0.50 g/L) and low temperature storage could preserve palm sap for approximately 6 weeks. Thus, the incorporation of chitosan in palm sap could be used as an alternative way to extend shelf life of pasteurized palm sap.

  9. Creating "SMART" Supply Chain Scenarios Using SAP R/3

    ERIC Educational Resources Information Center

    Ragan, Joseph M.; McGettigan, Patrick J.; Storms, Michael R.; Rizman, Brian

    2004-01-01

    Pedagogical revisions to the undergraduate Haub School of Business curriculum at Saint Joseph's University employing the SAP R/3 system encompass the core accounting courses traversing the sophomore and junior years. The entire accounting curriculum was overhauled in order to integrate SAP R/3. Each course progressively builds upon and expands the…

  10. Stem sap flow in plants under low gravity conditions

    NASA Astrophysics Data System (ADS)

    Tokuda, Ayako; Hirai, Hiroaki; Kitaya, Yoshiaki

    2016-07-01

    A study was conducted to obtain a fundamental knowledge for plant functions in bio-regenerative life support systems in space. Stem sap flow in plants is important indicators for water transport from roots to atmosphere through leaves. In this study, stem sap flow in sweetpotato was assessed at gravity levels from 0.01 to 2 g for about 20 seconds each during parabolic airplane flights. Stem sap flow was monitored with a heat balance method in which heat generated with a tiny heater installed in the stem was transferred upstream and downstream by conduction and upstream by convection with the sap flow through xylems of the vascular tissue. Thermal images of stem surfaces near heated points were captured using infrared thermography and the internal heat convection corresponding to the sap flow was analyzed. In results, the sap flow in stems was suppressed more at lower gravity levels without forced air circulation. No suppression of the stem sap flow was observed with forced air circulation. Suppressed sap flow in stems would be caused by suppression of transpiration in leaves and would cause restriction of water and nutrient uptake in roots. The forced air movement is essential to culture healthy plants at a high growth rate under low gravity conditions in space.

  11. SAPS onset timing during substorms and the westward traveling surge

    NASA Astrophysics Data System (ADS)

    Mishin, Evgeny, V.

    2016-07-01

    We present multispacecraft observations in the magnetosphere and conjugate ionosphere of the onset time of subauroral polarization streams (SAPS) and tens of keV ring current injections on the duskside in three individual substorms. This is probably the first unequivocal determination of the substorm SAPS onset timing. The time lag between the SAPS and substorm onsets is much shorter than the gradient-curvature drift time of ˜10 keV ions in the plasmasphere. It seemingly depends on the propagation time of substorm-injected plasma from the dipolarization onset region to the plasmasphere, as well as on the SAPS position. These observations suggest that fast onset SAPS and ring current injections are causally related to the two-loop system of the westward traveling surge.

  12. Effect of preservation methods of oil palm sap (Elaeis guineensis) on the reproductive indices of male wistar rats.

    PubMed

    Ikegwu, Theophilus Maduabuchukwu; Okafor, Gabriel Ifeanyi; Ochiogu, Izuchukwu Shedrack

    2014-12-01

    Thirty male Wistar rats, split into five groups of six rats each, were administered different forms of oil palm tree (Elaeis guineensis) sap samples by gavage based on 1.5% of their weekly body weights. Group 1 which served as control received only water, group 2 received pasteurized palm sap (PPS), group 3 received market palm wine (MPW), group 4 received frozen palm sap (FPS), whereas group 5 received fresh palm sap (FrPS). Chemical composition of the sap samples was determined. Normal feed and water were fed ad libitum. After 2 months of treatment, each male rat group was allowed 7 days to mate with six female Wistar rats. Thereafter, blood and epididymal samples were collected for testosterone assay and sperm count, respectively, before they were humanely sacrificed and testicular tissues taken for testicular histology. Litter weight and size of the pups produced by the females of each group were determined at birth. The sap samples contained carbohydrate (0.01-11.71%), protein (1.56-1.95%), ash (0.22-0.35%), moisture (92.55-98.24%), and alcohol (0.26-3.50%). PPS-treated rat group had significantly (P<.05) decreased sperm count (42.60±23.64×10(6)), abnormal increase in testosterone level, and necrosis in the histology of the testes with reduced spermatogenetic activity, compared with other treatment groups. The female rats crossed with male rats fed on FrPS or FPS produced the highest number of pups followed by the control group. This study demonstrated that the intake of FrPS improved fertility in male animals, but its administration for a long period led to necrotic changes in the testes, whereas pasteurization of palm sap, impacted negatively on the reproductive indices of male animals.

  13. Effect of Preservation Methods of Oil Palm Sap (Elaeis guineensis) on the Reproductive Indices of Male Wistar Rats

    PubMed Central

    Ikegwu, Theophilus Maduabuchukwu; Ochiogu, Izuchukwu Shedrack

    2014-01-01

    Abstract Thirty male Wistar rats, split into five groups of six rats each, were administered different forms of oil palm tree (Elaeis guineensis) sap samples by gavage based on 1.5% of their weekly body weights. Group 1 which served as control received only water, group 2 received pasteurized palm sap (PPS), group 3 received market palm wine (MPW), group 4 received frozen palm sap (FPS), whereas group 5 received fresh palm sap (FrPS). Chemical composition of the sap samples was determined. Normal feed and water were fed ad libitum. After 2 months of treatment, each male rat group was allowed 7 days to mate with six female Wistar rats. Thereafter, blood and epididymal samples were collected for testosterone assay and sperm count, respectively, before they were humanely sacrificed and testicular tissues taken for testicular histology. Litter weight and size of the pups produced by the females of each group were determined at birth. The sap samples contained carbohydrate (0.01–11.71%), protein (1.56–1.95%), ash (0.22–0.35%), moisture (92.55–98.24%), and alcohol (0.26–3.50%). PPS-treated rat group had significantly (P<.05) decreased sperm count (42.60±23.64×106), abnormal increase in testosterone level, and necrosis in the histology of the testes with reduced spermatogenetic activity, compared with other treatment groups. The female rats crossed with male rats fed on FrPS or FPS produced the highest number of pups followed by the control group. This study demonstrated that the intake of FrPS improved fertility in male animals, but its administration for a long period led to necrotic changes in the testes, whereas pasteurization of palm sap, impacted negatively on the reproductive indices of male animals. PMID:25101691

  14. Freshwater bryozoa of Tonle Sap, Cambodia.

    PubMed

    Hirose, Masato; Mawatari, Shunsuke F

    2007-06-01

    We identified a collection of freshwater bryozoans from Tonle Sap (meaning Tonle Lake), Cambodia, a body of water fed by the Mekong River and characterized by extreme fluctuations in water level between the wet and dry seasons. The collection also included specimens from the moat of Angkor Wat, located at the north end of the lake. We found four phylactolaemate species (Plumatella bombayensis, Plumatella casmiana, Plumatella vorstmani, Hyalinella lendenfeldi) and one ctenostome species (Hislopia cambodgiensis) from the lake, and only a single, additional phylactolaemate species (Plumatella javanica) from the moat. We provide brief descriptions of these species, photographs of colonies for some, and photomicrographs by light and scanning electron microscopy (SEM) of statoblasts. None of the species encountered in this study is endemic to Cambodia, and the wide distributions of the species are possibly related to the dispersability of floatoblasts by birds. We briefly discuss some of the taxonomic problems surrounding Hislopia cambodgiensis.

  15. Factors Related to Choosing between the Internet and a Financial Planner

    ERIC Educational Resources Information Center

    Son, Jiyeon

    2012-01-01

    In this dissertation, I aim to clarify the factors affecting a consumers' choice between the Internet and a financial planner for making saving and investment decisions, based on household production theory. Moreover, I explore the likelihood of an individual being an Internet user (vs. a non-user), a financial planner user (vs. a non-user),…

  16. Disaster preparedness of linguistically isolated populations: practical issues for planners.

    PubMed

    Nepal, Vishnu; Banerjee, Deborah; Perry, Mark; Scott, Deborah

    2012-03-01

    In the absence of culturally and linguistically appropriate disaster preparedness plans, several linguistically isolated and culturally diverse population groups are disproportionately disadvantaged in the United States. The communication gap poses challenges to emergency preparedness planners and response personnel in predisaster communication and postdisaster response efforts. Houston Department of Health and Human Services aimed to develop practical recommendations for local emergency response personnel so as to improve dissemination of emergency information and equitable delivery of services to linguistically isolated communities in the greater Houston area. Sixteen focus group discussions were conducted among linguistically isolated immigrant populations living in the greater Houston metropolitan area who primarily spoke one of the Spanish, Chinese, Vietnamese, and Somali languages. Our questions focused on general knowledge and understanding of disasters and explored experiences during Houston's most recent disaster, Hurricane Ike. We found that (a) understanding of disaster and preparedness is contextual, (b) awareness of preparedness needs and actual plans among LIPs is inadequate, and (c) word of mouth is the preferred information source for linguistically isolated groups. Disaster preparedness plans of a given jurisdiction should reflect the culturally and linguistically appropriate components addressing the needs, concerns, context-based knowledge or awareness, and perceptions of linguistically isolated populations.

  17. Planner-Based Control of Advanced Life Support Systems

    NASA Technical Reports Server (NTRS)

    Muscettola, Nicola; Kortenkamp, David; Fry, Chuck; Bell, Scott

    2005-01-01

    The paper describes an approach to the integration of qualitative and quantitative modeling techniques for advanced life support (ALS) systems. Developing reliable control strategies that scale up to fully integrated life support systems requires augmenting quantitative models and control algorithms with the abstractions provided by qualitative, symbolic models and their associated high-level control strategies. This will allow for effective management of the combinatorics due to the integration of a large number of ALS subsystems. By focusing control actions at different levels of detail and reactivity we can use faster: simpler responses at the lowest level and predictive but complex responses at the higher levels of abstraction. In particular, methods from model-based planning and scheduling can provide effective resource management over long time periods. We describe reference implementation of an advanced control system using the IDEA control architecture developed at NASA Ames Research Center. IDEA uses planning/scheduling as the sole reasoning method for predictive and reactive closed loop control. We describe preliminary experiments in planner-based control of ALS carried out on an integrated ALS simulation developed at NASA Johnson Space Center.

  18. Radioisotope Power Systems Reference Book for Mission Designers and Planners

    NASA Technical Reports Server (NTRS)

    Lee, Young; Bairstow, Brian

    2015-01-01

    The RPS Program's Program Planning and Assessment (PPA) Office commissioned the Mission Analysis team to develop the Radioisotope Power Systems (RPS) Reference Book for Mission Planners and Designers to define a baseline of RPS technology capabilities with specific emphasis on performance parameters and technology readiness. The main objective of this book is to provide RPS technology information that could be utilized by future mission concept studies and concurrent engineering practices. A progress summary from the major branches of RPS technology research provides mission analysis teams with a vital tool for assessing the RPS trade space, and provides concurrent engineering centers with a consistent set of guidelines for RPS performance characteristics. This book will be iterated when substantial new information becomes available to ensure continued relevance, serving as one of the cornerstone products of the RPS PPA Office. This book updates the original 2011 internal document, using data from the relevant publicly released RPS technology references and consultations with RPS technologists. Each performance parameter and RPS product subsection has been reviewed and cleared by at least one subject matter representative. A virtual workshop was held to reach consensus on the scope and contents of the book, and the definitions and assumptions that should be used. The subject matter experts then reviewed and updated the appropriate sections of the book. The RPS Mission Analysis Team then performed further updates and crosschecked the book for consistency. Finally, a second virtual workshop was held to ensure all subject matter experts and stakeholders concurred on the contents.

  19. Special population planner 4 : an open source release.

    SciTech Connect

    Kuiper, J.; Metz, W.; Tanzman, E.

    2008-01-01

    Emergencies like Hurricane Katrina and the recent California wildfires underscore the critical need to meet the complex challenge of planning for individuals with special needs and for institutionalized special populations. People with special needs and special populations often have difficulty responding to emergencies or taking protective actions, and emergency responders may be unaware of their existence and situations during a crisis. Special Population Planner (SPP) is an ArcGIS-based emergency planning system released as an open source product. SPP provides for easy production of maps, reports, and analyses to develop and revise emergency response plans. It includes tools to manage a voluntary registry of data for people with special needs, integrated links to plans and documents, tools for response planning and analysis, preformatted reports and maps, and data on locations of special populations, facility and resource characteristics, and contacts. The system can be readily adapted for new settings without programming and is broadly applicable. Full documentation and a demonstration database are included in the release.

  20. Traffic Aware Planner for Cockpit-Based Trajectory Optimization

    NASA Technical Reports Server (NTRS)

    Woods, Sharon E.; Vivona, Robert A.; Henderson, Jeffrey; Wing, David J.; Burke, Kelly A.

    2016-01-01

    The Traffic Aware Planner (TAP) software application is a cockpit-based advisory tool designed to be hosted on an Electronic Flight Bag and to enable and test the NASA concept of Traffic Aware Strategic Aircrew Requests (TASAR). The TASAR concept provides pilots with optimized route changes (including altitude) that reduce fuel burn and/or flight time, avoid interactions with known traffic, weather and restricted airspace, and may be used by the pilots to request a route and/or altitude change from Air Traffic Control. Developed using an iterative process, TAP's latest improvements include human-machine interface design upgrades and added functionality based on the results of human-in-the-loop simulation experiments and flight trials. Architectural improvements have been implemented to prepare the system for operational-use trials with partner commercial airlines. Future iterations will enhance coordination with airline dispatch and add functionality to improve the acceptability of TAP-generated route-change requests to pilots, dispatchers, and air traffic controllers.

  1. A Conceptual Design of a Departure Planner Decision Aid

    NASA Technical Reports Server (NTRS)

    Anagnostakis, Ioannis; Idris, Husni R.; Clark, John-Paul; Feron, Eric; Hansman, R. John; Odoni, Amedeo R.; Hall, William D.

    2000-01-01

    Terminal area Air Traffic Management handles both arriving and departing traffic. To date, research work on terminal area operations has focused primarily on the arrival flow and typically departures are taken into account only in an approximate manner. However, arrivals and departures are highly coupled processes especially in the terminal airspace, with complex interactions and sharing of the same airport resources between arrivals and departures taking place in practically every important terminal area. Therefore, the addition of automation aids for departures, possibly in co-operation with existing arrival flow automation systems, could have a profound contribution in enhancing the overall efficiency of airport operations. This paper presents the conceptual system architecture for such an automation aid, the Departure Planner (DP). This architecture can be used as a core in the development of decision-aiding systems to assist air traffic controllers in improving the performance of departure operations and optimize runway time allocation among different operations at major congested airports. The design of such systems is expected to increase the overall efficiency of terminal area operations and yield benefits for all stakeholders involved in Air Traffic Management (ATM) operations, users as well as service providers.

  2. Transient response of sap flow to wind speed.

    PubMed

    Chu, Chia R; Hsieh, Cheng-I; Wu, Shen-Yuang; Phillips, Nathan G

    2009-01-01

    Transient responses of sap flow to step changes in wind speed were experimentally investigated in a wind tunnel. A Granier-type sap flow sensor was calibrated and tested in a cylindrical tube for analysis of its transient time response. Then the sensor was used to measure the transient response of a well-watered Pachira macrocarpa plant to wind speed variations. The transient response of sap flow was described using the resistance-capacitance model. The steady sap flow rate increased as the wind speed increased at low wind speeds. Once the wind speed exceeded 8.0 m s(-1), the steady sap flow rate did not increase further. The transpiration rate, measured gravimetrically, showed a similar trend. The response of nocturnal sap flow to wind speed variation was also measured and compared with the results in the daytime. Under the same wind speed, the steady sap flow rate was smaller than that in the daytime, indicating differences between diurnal and nocturnal hydraulic function, and incomplete stomatal closure at night. In addition, it was found that the temporal response of the Granier sensor is fast enough to resolve the transient behaviour of water flux in plant tissue.

  3. Comparison of Sugars, Iridoid Glycosides and Amino Acids in Nectar and Phloem Sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus

    PubMed Central

    Lohaus, Gertrud; Schwerdtfeger, Michael

    2014-01-01

    Background Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus) were compared. Methodology and Principal Findings Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae) M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. Conclusions/Significance The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of antirrhinoside in nectar

  4. [Characteristics of dominant tree species stem sap flow and their relationships with environmental factors in a mixed conifer-broadleaf forest in Dinghushan, Guangdong Province of South China].

    PubMed

    Huang, De-Wei; Zhang, De-Qiang; Zhou, Guo-Yi; Liu, Shi-Zhong; Otieno, Dennis; Li, Yue-Lin

    2012-05-01

    By the method of Granier' s thermal dissipation probe, the stem sap flow density of four dominant tree species (Pinus massoniana, Castanopsis chinensis, Schima superba, and Machilus kwangtungensis) in a mixed conifer-broadleaf forest in Dinghushan Reserve of South China was continuously measured in the dry season (November) and wet season (July) in 2010, and the environmental factors including air temperature, relative humidity, and photosynthetically active radiation (PAR) were measured synchronically, aimed to study the characteristics of the stem sap flow of the tree species in response to environmental factors. During the dry and wet seasons, the diurnal changes of the stem sap flow velocity of the tree species all presented a typical single-peak curve, with high values in the daytime and low values in the nighttime. The average and maximum sap flow velocities and the daily sap flow flux of broad-leaved trees (C. chinensis, S. superba, and M. kwangtungensis) were significantly higher than those of coniferous tree (P. massoniana), and the maximum sap flow velocity of P. massoniana, C. valueschinensis, S. superba, and M. kwangtungensis was 29.48, 38.54, 51.67 and 58.32 g H2O x m(-2) x s(-1), respectively. A time lag was observed between the sap flow velocity and the diurnal variations of PAR, vapor pressure deficiency, and air temperature, and there existed significant positive correlations between the sap flow velocity and the three environmental factors. The PAR in wet season and the air temperature in dry season were the leading factors affecting the stem sap flow velocity of the dominant tree species.

  5. Genomic organization and characterization of mouse SAP, the gene that is altered in X-linked lymphoproliferative disease.

    PubMed

    Wu, C; Sayos, J; Wang, N; Howie, D; Coyle, A; Terhorst, C

    2000-08-01

    X-linked lymphoproliferative (XLP) disease is a fatal immunological disorder that renders the immune system unable to respond effectively to Epstein-Barr virus (EBV) infection. The gene that encodes a protein termed SAP or SH2D1A is either deleted or mutated in XLP patients, resulting in uncontrolled B- and T-cell proliferation upon EBV infection. Here, we report the cloning and characterization of the mouse SAP gene. It is localized on the mouse X chromosome and comprises four exons spanning approximately 25 kb. Its expression appears to be restricted to T lymphocytes. Whereas a high level of SAP expression is observed in Thl cells, only small amounts are detectable in Th2 cells. Moreover, SAP expression is down-regulated upon in vitro activation of T cells, including CD4+, CD8+ single-positive T cells, and Thl and Th2 cells. This study provides valuable information for in-depth genetic and biochemical analysis of the function of SAP in the immune system.

  6. No association between GSTM1 and GSTT1 genetic polymorphisms and susceptibility to opium sap dependence

    PubMed Central

    Saify, Khyber; Khalighinasab, Mohammad Rashid; Saadat, Mostafa

    2016-01-01

    Glutathione S-transferases (GSTs; EC: 2.5.1.18) are a ubiquitous family of eukaryotic and prokaryotic phase II metabolic isozymes. Genes encoding GSTM1 (OMIM: 138350), and GSTT1 (OMIM: 600436) are members of class mu and theta, respectively. The most common polymorphism in the GSTM1 is a deletion of the whole GSTM1 gene with a lack of enzyme activity. A homozygous deletion in the GSTT1 has also been reported (null genotypes of GSTT1). The aim of the present study was to investigate the association between GSTM1 and GSTT1 polymorphisms and risk of dependency to opium sap. The present study was performed in Shiraz (southern Iran). In total, 71 males dependent to opium sap and 590 healthy males (as a control group) were included in this study. The genotypes of GSTM1 and GSTT1 polymorphisms were determined by PCR. Our data indicate that neither GSTM1 (OR=0.78, 95% CI: 0.47-1.27, P=0.325) nor GSTT1 (OR=1.25, 95% CI: 0.70-2.21, P=0.442) null genotypes significantly associated with the risk of opium sap dependence. There is no additive effect of the null genotypes of GSTT1 and GSTM1 in relation to the risk of dependency to opium sap. The present study indicated that the null genotypes of GSTT1 and GSTM1 are not risk factor for opium sap dependence. PMID:27844021

  7. No association between GSTM1 and GSTT1 genetic polymorphisms and susceptibility to opium sap dependence.

    PubMed

    Saify, Khyber; Khalighinasab, Mohammad Rashid; Saadat, Mostafa

    2016-03-01

    Glutathione S-transferases (GSTs; EC: 2.5.1.18) are a ubiquitous family of eukaryotic and prokaryotic phase II metabolic isozymes. Genes encoding GSTM1 (OMIM: 138350), and GSTT1 (OMIM: 600436) are members of class mu and theta, respectively. The most common polymorphism in the GSTM1 is a deletion of the whole GSTM1 gene with a lack of enzyme activity. A homozygous deletion in the GSTT1 has also been reported (null genotypes of GSTT1). The aim of the present study was to investigate the association between GSTM1 and GSTT1 polymorphisms and risk of dependency to opium sap. The present study was performed in Shiraz (southern Iran). In total, 71 males dependent to opium sap and 590 healthy males (as a control group) were included in this study. The genotypes of GSTM1 and GSTT1 polymorphisms were determined by PCR. Our data indicate that neither GSTM1 (OR=0.78, 95% CI: 0.47-1.27, P=0.325) nor GSTT1 (OR=1.25, 95% CI: 0.70-2.21, P=0.442) null genotypes significantly associated with the risk of opium sap dependence. There is no additive effect of the null genotypes of GSTT1 and GSTM1 in relation to the risk of dependency to opium sap. The present study indicated that the null genotypes of GSTT1 and GSTM1 are not risk factor for opium sap dependence.

  8. 30 CFR 285.613 - How will MMS process my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false How will MMS process my SAP? 285.613 Section... MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided... be complex or significant; (2) We will notify you if your submitted SAP lacks any...

  9. 30 CFR 285.610 - What must I include in my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my SAP? 285.610 Section... Requirements Contents of the Site Assessment Plan § 285.610 What must I include in my SAP? Your SAP must... SAP, you must provide the following information: ER29AP09.115 (b) You must provide the results...

  10. Sapflow+: a four-needle heat-pulse sap flow sensor enabling nonempirical sap flux density and water content measurements.

    PubMed

    Vandegehuchte, Maurits W; Steppe, Kathy

    2012-10-01

    • To our knowledge, to date, no nonempirical method exists to measure reverse, low or high sap flux density. Moreover, existing sap flow methods require destructive wood core measurements to determine sapwood water content, necessary to convert heat velocity to sap flux density, not only damaging the tree, but also neglecting seasonal variability in sapwood water content. • Here, we present a nonempirical heat-pulse-based method and coupled sensor which measure temperature changes around a linear heater in both axial and tangential directions after application of a heat pulse. By fitting the correct heat conduction-convection equation to the measured temperature profiles, the heat velocity and water content of the sapwood can be determined. • An identifiability analysis and validation tests on artificial and real stem segments of European beech (Fagus sylvatica L.) confirm the applicability of the method, leading to accurate determinations of heat velocity, water content and hence sap flux density. • The proposed method enables sap flux density measurements to be made across the entire natural occurring sap flux density range of woody plants. Moreover, the water content during low flows can be determined accurately, enabling a correct conversion from heat velocity to sap flux density without destructive core measurements.

  11. Family planners need to absorb importance of mortality study.

    PubMed

    Hatcher, R A

    1982-07-01

    The article by Benjamin Sachs and several members of the Family Planning Evaluation Division at the Centers for Disease Control states forcefully that the efforts to improve the health of women in their reproductive years have been extraordinarily effective over the past 25 years and that total deaths among women who are either trying to prevent pregnancy or who are pregnant are dropping markedly. Some journalists appear to have gathered the wrong message from this article. Sachs and his colleagues have shown that there are risks from using contraceptives and that those risks are now almost as great, in terms of absolute numbers, as the risks of pregnancies to American women. That does not mean that oral contraceptives (OCs) are as dangerous as pregnancy. The article should have placed more emphasis on the fact that the excess attributable mortality rate from contraceptives is far lower than the mortality rate attributable to pregnancy. Many important points are made in this article, and the following are directed to family planners: 1) the effort should made to think in terms of "reproductive mortality" rather than simply in terms of maternal mortality, 2) over the next 6 months there will be many questions relating to the safety of providing OCs to teenagers without parental consent, 3) there is a need to recognize that the deaths caused by modern contraceptives center primarily in heavy smokers using OCs in the latter half of the their reproductive life span, and 4) there are women dying of contraceptive complications whose deaths might be prevented if closer attention was paid to the OC danger signals. The concept of reproductive mortality allows epidemiologists, clinicians, and women to put into perspective all the risks of sexual intercourse. Most would argue that the benefits of highly effective contraceptives have exceeded the risks. This is particularly the case if one includes the numerous noncontraceptive benefits of OCs such as prevention of pelvic

  12. Sap Flow Sensors: Construction, Quality Control and Comparison

    PubMed Central

    Davis, Tyler W.; Kuo, Chen-Min; Liang, Xu; Yu, Pao-Shan

    2012-01-01

    This work provides a design for two types of sensors, based on the thermal dissipation and heat ratio methods of sap flow calculation, for moderate to large scale deployments for the purpose of monitoring tree transpiration. These designs include a procedure for making these sensors, a quality control method for the final products, and a complete list of components with vendors and pricing information. Both sensor designs were field tested alongside a commercial sap flow sensor to assess their performance and show the importance for quality controlling the sensor outputs. Results show that for roughly 2% of the cost of commercial sensors, self-made sap flow sensors can provide acceptable estimates of the sap flow measurements compared to the commercial sensors. PMID:22368504

  13. Sap flow sensors: construction, quality control and comparison.

    PubMed

    Davis, Tyler W; Kuo, Chen-Min; Liang, Xu; Yu, Pao-Shan

    2012-01-01

    This work provides a design for two types of sensors, based on the thermal dissipation and heat ratio methods of sap flow calculation, for moderate to large scale deployments for the purpose of monitoring tree transpiration. These designs include a procedure for making these sensors, a quality control method for the final products, and a complete list of components with vendors and pricing information. Both sensor designs were field tested alongside a commercial sap flow sensor to assess their performance and show the importance for quality controlling the sensor outputs. Results show that for roughly 2% of the cost of commercial sensors, self-made sap flow sensors can provide acceptable estimates of the sap flow measurements compared to the commercial sensors.

  14. Genetic Evidence for the Involvement of the S-Layer Protein Gene sap and the Sporulation Genes spo0A, spo0B, and spo0F in Phage AP50c Infection of Bacillus anthracis

    PubMed Central

    Beaber, John W.; Zemansky, Jason; Kaur, Ajinder P.; George, Matroner; Biswas, Biswajit; Henry, Matthew; Bishop-Lilly, Kimberly A.; Mokashi, Vishwesh; Hannah, Ryan M.; Pope, Robert K.; Read, Timothy D.; Stibitz, Scott; Calendar, Richard; Sozhamannan, Shanmuga

    2014-01-01

    In order to better characterize the Bacillus anthracis typing phage AP50c, we designed a genetic screen to identify its bacterial receptor. Insertions of the transposon mariner or targeted deletions of the structural gene for the S-layer protein Sap and the sporulation genes spo0A, spo0B, and spo0F in B. anthracis Sterne resulted in phage resistance with concomitant defects in phage adsorption and infectivity. Electron microscopy of bacteria incubated with AP50c revealed phage particles associated with the surface of bacilli of the Sterne strain but not with the surfaces of Δsap, Δspo0A, Δspo0B, or Δspo0F mutants. The amount of Sap in the S layer of each of the spo0 mutant strains was substantially reduced compared to that of the parent strain, and incubation of AP50c with purified recombinant Sap led to a substantial reduction in phage activity. Phylogenetic analysis based on whole-genome sequences of B. cereus sensu lato strains revealed several closely related B. cereus and B. thuringiensis strains that carry sap genes with very high similarities to the sap gene of B. anthracis. Complementation of the Δsap mutant in trans with the wild-type B. anthracis sap or the sap gene from either of two different B. cereus strains that are sensitive to AP50c infection restored phage sensitivity, and electron microscopy confirmed attachment of phage particles to the surface of each of the complemented strains. Based on these data, we postulate that Sap is involved in AP50c infectivity, most likely acting as the phage receptor, and that the spo0 genes may regulate synthesis of Sap and/or formation of the S layer. PMID:24363347

  15. Genetic evidence for the involvement of the S-layer protein gene sap and the sporulation genes spo0A, spo0B, and spo0F in Phage AP50c infection of Bacillus anthracis.

    PubMed

    Plaut, Roger D; Beaber, John W; Zemansky, Jason; Kaur, Ajinder P; George, Matroner; Biswas, Biswajit; Henry, Matthew; Bishop-Lilly, Kimberly A; Mokashi, Vishwesh; Hannah, Ryan M; Pope, Robert K; Read, Timothy D; Stibitz, Scott; Calendar, Richard; Sozhamannan, Shanmuga

    2014-03-01

    In order to better characterize the Bacillus anthracis typing phage AP50c, we designed a genetic screen to identify its bacterial receptor. Insertions of the transposon mariner or targeted deletions of the structural gene for the S-layer protein Sap and the sporulation genes spo0A, spo0B, and spo0F in B. anthracis Sterne resulted in phage resistance with concomitant defects in phage adsorption and infectivity. Electron microscopy of bacteria incubated with AP50c revealed phage particles associated with the surface of bacilli of the Sterne strain but not with the surfaces of Δsap, Δspo0A, Δspo0B, or Δspo0F mutants. The amount of Sap in the S layer of each of the spo0 mutant strains was substantially reduced compared to that of the parent strain, and incubation of AP50c with purified recombinant Sap led to a substantial reduction in phage activity. Phylogenetic analysis based on whole-genome sequences of B. cereus sensu lato strains revealed several closely related B. cereus and B. thuringiensis strains that carry sap genes with very high similarities to the sap gene of B. anthracis. Complementation of the Δsap mutant in trans with the wild-type B. anthracis sap or the sap gene from either of two different B. cereus strains that are sensitive to AP50c infection restored phage sensitivity, and electron microscopy confirmed attachment of phage particles to the surface of each of the complemented strains. Based on these data, we postulate that Sap is involved in AP50c infectivity, most likely acting as the phage receptor, and that the spo0 genes may regulate synthesis of Sap and/or formation of the S layer.

  16. Evolutionary algorithm based offline/online path planner for UAV navigation.

    PubMed

    Nikolos, I K; Valavanis, K P; Tsourveloudis, N C; Kostaras, A N

    2003-01-01

    An evolutionary algorithm based framework, a combination of modified breeder genetic algorithms incorporating characteristics of classic genetic algorithms, is utilized to design an offline/online path planner for unmanned aerial vehicles (UAVs) autonomous navigation. The path planner calculates a curved path line with desired characteristics in a three-dimensional (3-D) rough terrain environment, represented using B-spline curves, with the coordinates of its control points being the evolutionary algorithm artificial chromosome genes. Given a 3-D rough environment and assuming flight envelope restrictions, two problems are solved: i) UAV navigation using an offline planner in a known environment, and, ii) UAV navigation using an online planner in a completely unknown environment. The offline planner produces a single B-Spline curve that connects the starting and target points with a predefined initial direction. The online planner, based on the offline one, is given on-board radar readings which gradually produces a smooth 3-D trajectory aiming at reaching a predetermined target in an unknown environment; the produced trajectory consists of smaller B-spline curves smoothly connected with each other. Both planners have been tested under different scenarios, and they have been proven effective in guiding an UAV to its final destination, providing near-optimal curved paths quickly and efficiently.

  17. Effect of microgravity on sap flow in plant stems

    NASA Astrophysics Data System (ADS)

    Kitaya, Yoshiaki; Hirai, Hiroaki; Nobol Ikeda, MR..

    2012-07-01

    A fundamental study was conducted to assess the possibility of plant growth suppression caused by poor movement of air in closed plant growth facilities in space farming. Sap water flow in plant stems, which plays an important role to transport fluid and nutrients from roots to leaves, will be suppressed through suppression of transpiration because of little natural convection of air under microgravity conditions. In this study, the sap flow in tomato stems was examined using a heat flow method at 0.01 and 1.0 g for 20 seconds each during parabolic airplane flights in order to clarify the effect of microgravity on the sap flow in stems. Heat generated with a tiny heater installed in the stem was transferred upstream and downstream by conduction and upstream by the sap flow through xylems of the vascular tissue. The internal heat convection corresponding to the sap flow was analyzed with thermal images captured on stems near heated points. In results, the sap flow in stems at 0.01 g was suppressed under a retarded air condition at a wind speed of 0.1 m s-1 compared with that at 1 g. No suppression of the sap flow was observed under a stirred air condition at a wind speed of 0.5 m s-1. Suppressed sap water flow in stems would be caused by suppression of transpiration in leaves and would cause restriction of water and nutrient uptake in roots. The forced air movement is, therefore, essential to culture healthy plants at a high growth rate under microgravity conditions in space.

  18. Limitations in the use of ozone to disinfect maple sap.

    PubMed

    Labbe, R G; Kinsley, M; Wu, J

    2001-01-01

    The sap of the maple sugar tree (Acer saccharum) contains 2 to 3% sucrose and is traditionally collected early in the year and concentrated by boiling to produce maple syrup. High levels of microorganisms in the sap occur during holding, leading to a darker syrup with lower economic value. We investigated the use of dissolved ozone as a method to reduce the microbial population in sap. After 40 min of ozone treatment, concentrations of up to 0.30 mg/liter were achieved but were ineffective in reducing the aerobic plate count. Three predominant colonies on nutrient agar were selected for isolation and identification from sap. These included one mucoid and one nonmucoid yeast, both identified as Candida, and Pseudomonas fluorescens. When suspended in buffer, each was readily inactivated by ozone. Addition of 3% sucrose to the buffer markedly reduced the effectiveness of ozone. With the use of an ozone generator with a larger ozone output, saturating ozone concentrations (1 mg/liter) were achieved within 5 min but were accompanied by only a 1-log reduction in aerobic plate count of maple sap. After 40 min of ozone treatment, a less than 3-log reduction occurred. The results indicate that, because of the presence of sucrose, ozone may be of limited use in reducing the microbial population in sap.

  19. BCM-95 and (2-hydroxypropyl)-β-cyclodextrin reverse autophagy dysfunction and deplete stored lipids in Sap C-deficient fibroblasts.

    PubMed

    Tatti, Massimo; Motta, Marialetizia; Scarpa, Susanna; Di Bartolomeo, Sabrina; Cianfanelli, Valentina; Tartaglia, Marco; Salvioli, Rosa

    2015-08-01

    Saposin (Sap) C deficiency is a rare variant form of Gaucher disease caused by impaired Sap C expression or accelerated degradation, and associated with accumulation of glucosylceramide and other lipids in the endo/lysosomal compartment. No effective therapies are currently available for the treatment of Sap C deficiency. We previously reported that a reduced amount and enzymatic activity of cathepsin (Cath) B and Cath D, and defective autophagy occur in Sap C-deficient fibroblasts. Here, we explored the use of two compounds, BCM-95, a curcumin derivative, and (2-hydroxypropyl)-β-cyclodextrin (HP-β-CD), to improve lysosomal function of Sap C-deficient fibroblasts. Immunofluorescence and biochemical studies documented that each compound promotes an increase of the expression levels and activities of Cath B and Cath D, and efficient clearance of cholesterol (Chol) and ceramide (Cer) in lysosomes. We provide evidence that BCM-95 and HP-β-CD enhance lysosomal function promoting autophagic clearance capacity and lysosome reformation. Our findings suggest a novel pharmacological approach to Sap C deficiency directed to treat major secondary pathological aspects in this disorder.

  20. SAP97-mediated ADAM10 trafficking from Golgi outposts depends on PKC phosphorylation

    PubMed Central

    Saraceno, C; Marcello, E; Di Marino, D; Borroni, B; Claeysen, S; Perroy, J; Padovani, A; Tramontano, A; Gardoni, F; Di Luca, M

    2014-01-01

    A disintegrin and metalloproteinase 10 (ADAM10) is the major α-secretase that catalyzes the amyloid precursor protein (APP) ectodomain shedding in the brain and prevents amyloid formation. Its activity depends on correct intracellular trafficking and on synaptic membrane insertion. Here, we describe that in hippocampal neurons the synapse-associated protein-97 (SAP97), an excitatory synapse scaffolding element, governs ADAM10 trafficking from dendritic Golgi outposts to synaptic membranes. This process is mediated by a previously uncharacterized protein kinase C phosphosite in SAP97 SRC homology 3 domain that modulates SAP97 association with ADAM10. Such mechanism is essential for ADAM10 trafficking from the Golgi outposts to the synapse, but does not affect ADAM10 transport from the endoplasmic reticulum. Notably, this process is altered in Alzheimer's disease brains. These results help in understanding the mechanism responsible for the modulation of ADAM10 intracellular path, and can constitute an innovative therapeutic strategy to finely tune ADAM10 shedding activity towards APP. PMID:25429624

  1. Xylem sap in cotton contains proteins that contribute to environmental stress response and cell wall development.

    PubMed

    Zhang, Zhiyong; Xin, Wanwan; Wang, Sufang; Zhang, Xin; Dai, Haifang; Sun, Runrun; Frazier, Taylor; Zhang, Baohong; Wang, Qinglian

    2015-01-01

    The xylem sap of a plant is primarily responsible for transporting molecules from the underground root system to the aboveground parts of the plant body. In order to understand the role that roots play in cotton growth and development, the components present in xylem sap must be elucidated. In this study, we used a shotgun HPLC-ESI-MS/MS proteomics approach to identify 455 peptides from the xylem sap of field-grown cotton plants at peak blooming stage. Of these peptides, 384 (84.4%) were found to be secreted proteins and 320 (70.3%) had special molecular functions. Based on Gene Ontology (GO) analysis, 348 peptides were annotated in terms of molecular function, biological process, and cellular localization, with 46.9 and 45.1% being related to catalytic activity and binding activity, respectively. Many xylem sap-containing proteins were predicted to be involved in different phases of xylem differentiation including cell wall metabolism, secondary cell wall development and patterning, and programmed cell death. The identification of starch and sucrose hydrolyzing enzymes implicated the interaction between roots and aboveground parts on the aspect of carbohydrate metabolism. Many of the proteins identified in this study are involved in defense mechanisms including pathogen-related proteins, such as peroxidases, chitinases, and germin-like proteins, proteases involved in disease resistance, and phytoalexin phenylpropanoid synthesis-related proteins. The majority of identified signaling proteins were fasciclin-like arabinogalactan proteins and kinases. The results of this study provide useful insight into the communication mechanisms between cotton roots and the rest of the cotton plant.

  2. Validation of the scale on Satisfaction of Adolescents with Postoperative pain management – idiopathic Scoliosis (SAP-S)

    PubMed Central

    Khadra, Christelle; Le May, Sylvie; Ballard, Ariane; Théroux, Jean; Charette, Sylvie; Villeneuve, Edith; Parent, Stefan; Tsimicalis, Argerie; MacLaren Chorney, Jill

    2017-01-01

    Background Spinal fusion is a common orthopedic surgery in children and adolescents and is associated with high pain levels postoperatively. If the pain is not well managed, negative outcomes may ensue. To our knowledge, there is no measure in English that assesses patient’s satisfaction with postoperative pain management following idiopathic scoliosis surgery. The aim of the present study was to assess the psychometric properties of the satisfaction subscale of the English version of the Satisfaction of Adolescents with Postoperative pain management – idiopathic Scoliosis (SAP-S) scale. Methods Eighty-two participants aged 10–18 years, who had undergone spinal fusion surgery, fully completed the SAP-S scale at 10–14 days postdischarge. Construct validity was assessed through a principal component analysis using varimax rotation. Results Principal component analysis indicated a three-factor structure of the 13-item satisfaction subscale of the SAP-S scale. Factors referred to satisfaction regarding current medication received (Factor 1), actions taken by nurses and doctors to manage pain (Factor 2) and information received after surgery (Factor 3). Cronbach’s alpha was 0.91, showing very good internal consistency. Data on satisfaction and clinical outcomes were also reported. Conclusion The SAP-S is a valid and reliable measure of satisfaction with postoperative pain management that can be used in both research and clinical settings to improve pain management practices. Although it was developed and validated with adolescents who had undergone spinal fusion surgery, it can be used, with further validation, to assess adolescents’ satisfaction with pain management in other postoperative contexts. PMID:28138264

  3. Radial variation in sap velocity as a function of stem diameter and sapwood thickness in yellow-poplar trees.

    PubMed

    Wullschleger, Stan D.; King, Anthony W.

    2000-04-01

    Canopy transpiration and forest water use are frequently estimated as the product of sap velocity and cross-sectional sapwood area. Few studies, however, have considered whether radial variation in sap velocity and the proportion of sapwood active in water transport are significant sources of uncertainty in the extrapolation process. Therefore, radial profiles of sap velocity were examined as a function of stem diameter and sapwood thickness for yellow-poplar (Liriodendron tulipifera L.) trees growing on two adjacent watersheds in eastern Tennessee. The compensation heat pulse velocity technique was used to quantify sap velocity at four equal-area depths in 20 trees that ranged in stem diameter from 15 to 69 cm, and in sapwood thickness from 2.1 to 14.8 cm. Sap velocity was highly dependent on the depth of probe insertion into the sapwood. Rates of sap velocity were greatest for probes located in the two outer sapwood annuli (P1 and P2) and lowest for probes in closest proximity to the heartwood (P3 and P4). Relative sap velocities averaged 0.98 at P1, 0.66 at P2, 0.41 at P3 and 0.35 at P4. Tree-specific sap velocities measured at each of the four probe positions, divided by the maximum sap velocity measured (usually at P1 or P2), indicated that the fraction of sapwood functional in water transport (f(S)) varied between 0.49 and 0.96. There was no relationship between f(S) and sapwood thickness, or between f(S) and stem diameter. The fraction of functional sapwood averaged 0.66 +/- 0.13 for trees on which radial profiles were determined. No significant depth-related differences were observed for sapwood density, which averaged 469 kg m(-3) across all four probe positions. There was, however, a significant decline in sapwood water content between the two outer probe positions (1.04 versus 0.89 kg kg(-1)). This difference was not sufficient to account for the observed radial variation in sap velocity. A Monte-Carlo analysis indicated that the standard error in

  4. A workstation-based evaluation of a far-field route planner for helicopters

    NASA Technical Reports Server (NTRS)

    Warner, David N., Jr.; Moran, Francis J.

    1991-01-01

    Helicopter flight missions at very low, nap of the Earth, altitudes place a heavy workload on the pilot. To aid in reducing this workload, Ames Research Center has been investigating various types of automated route planners. As part of an automated preflight mission planner, a route planner algorithm aids in selecting the overall (far-field) route to be flown. During the mission, the route planner can be used to replan a new route in case of unexpected threats or change in mission requirements. An evaluation of a candidate route planning algorithm, based on dynamic programming techniques is described. This algorithm meets most of the requirements for route planning, both preflight and during the mission. In general, the requirements are to minimize the distance and/or fuel and the deviation from a flight time schedule, and must be flyable within the constraints of available fuel and time.

  5. Solution structural studies and low-resolution model of the Schizosaccharomyces pombe sap1 protein.

    PubMed

    Bada, M; Walther, D; Arcangioli, B; Doniach, S; Delarue, M

    2000-07-14

    Sap1 is a DNA-binding protein involved in controlling the mating type switch in fission yeast Schizosaccharomyces pombe. In the absence of any significant sequence similarity with any structurally known protein, a variety of biophysical techniques has been used to probe the solution low-resolution structure of the sap1 protein. First, sap1 is demonstrated to be an unusually elongated dimer in solution by measuring the translational diffusion coefficient with two independent techniques: dynamic light-scattering and ultracentrifugation. Second, sequence analysis revealed the existence of a long coiled-coil region, which is responsible for dimerization. The length of the predicted coiled-coil matches estimates drawn from the hydrodynamic experimental behaviour of the molecule. In addition, the same measurements done on a shorter construct with a coiled-coil region shortened by roughly one-half confirmed the localization of the long coiled-coil region. A crude T-shape model incorporating all these information was built. Third, small-angle X-ray scattering (SAXS) of the free molecule provided additional evidence for the model. In particular, the P(r) curve strikingly demonstrates the existence of long intramolecular distances. Using a novel 3D reconstruction algorithm, a low resolution 3D model of the protein has been independently constructed that matches the SAXS experimental data. It also fits the translation diffusion coefficients measurements and agrees with the first T-shaped model. This low-resolution model has clearly biologically relevant new functional implications, suggesting that sap1 is a bifunctional protein, with the two active sites being separated by as much as 120 A; a tetrapeptide repeated four times at the C terminus of the molecule is postulated to be of utmost functional importance.

  6. A Novel Putrescine Exporter SapBCDF of Escherichia coli.

    PubMed

    Sugiyama, Yuta; Nakamura, Atsuo; Matsumoto, Mitsuharu; Kanbe, Ayaka; Sakanaka, Mikiyasu; Higashi, Kyohei; Igarashi, Kazuei; Katayama, Takane; Suzuki, Hideyuki; Kurihara, Shin

    2016-12-16

    Recent research has suggested that polyamines (putrescine, spermidine, and spermine) in the intestinal tract impact the health of animals either negatively or positively. The concentration of polyamines in the intestinal tract results from the balance of uptake and export of the intestinal bacteria. However, the mechanism of polyamine export from bacterial cells to the intestinal lumen is still unclear. In Escherichia coli, PotE was previously identified as a transporter responsible for putrescine excretion in an acidic growth environment. We observed putrescine concentration in the culture supernatant was increased from 0 to 50 μm during growth of E. coli under neutral conditions. Screening for the unidentified putrescine exporter was performed using a gene knock-out collection of E. coli, and deletion of sapBCDF significantly decreased putrescine levels in the culture supernatant. Complementation of the deletion mutant with the sapBCDF genes restored putrescine levels in the culture supernatant. Additionally, the ΔsapBCDF strain did not facilitate uptake of putrescine from the culture supernatant. Quantification of stable isotope-labeled putrescine derived from stable isotope-labeled arginine supplemented in the medium revealed that SapBCDF exported putrescine from E. coli cells to the culture supernatant. It was previously reported that SapABCDF of Salmonella enterica sv. typhimurium and Haemophilus influenzae conferred resistance toantimicrobial peptides; however, the E. coli ΔsapBCDF strain did not affect resistance to antimicrobial peptide LL-37. These results strongly suggest that the natural function of the SapBCDF proteins is the export of putrescine.

  7. SAP- FORTRAN STATIC SOURCE CODE ANALYZER PROGRAM (IBM VERSION)

    NASA Technical Reports Server (NTRS)

    Manteufel, R.

    1994-01-01

    The FORTRAN Static Source Code Analyzer program, SAP, was developed to automatically gather statistics on the occurrences of statements and structures within a FORTRAN program and to provide for the reporting of those statistics. Provisions have been made for weighting each statistic and to provide an overall figure of complexity. Statistics, as well as figures of complexity, are gathered on a module by module basis. Overall summed statistics are also accumulated for the complete input source file. SAP accepts as input syntactically correct FORTRAN source code written in the FORTRAN 77 standard language. In addition, code written using features in the following languages is also accepted: VAX-11 FORTRAN, IBM S/360 FORTRAN IV Level H Extended; and Structured FORTRAN. The SAP program utilizes two external files in its analysis procedure. A keyword file allows flexibility in classifying statements and in marking a statement as either executable or non-executable. A statistical weight file allows the user to assign weights to all output statistics, thus allowing the user flexibility in defining the figure of complexity. The SAP program is written in FORTRAN IV for batch execution and has been implemented on a DEC VAX series computer under VMS and on an IBM 370 series computer under MVS. The SAP program was developed in 1978 and last updated in 1985.

  8. SAP- FORTRAN STATIC SOURCE CODE ANALYZER PROGRAM (DEC VAX VERSION)

    NASA Technical Reports Server (NTRS)

    Merwarth, P. D.

    1994-01-01

    The FORTRAN Static Source Code Analyzer program, SAP, was developed to automatically gather statistics on the occurrences of statements and structures within a FORTRAN program and to provide for the reporting of those statistics. Provisions have been made for weighting each statistic and to provide an overall figure of complexity. Statistics, as well as figures of complexity, are gathered on a module by module basis. Overall summed statistics are also accumulated for the complete input source file. SAP accepts as input syntactically correct FORTRAN source code written in the FORTRAN 77 standard language. In addition, code written using features in the following languages is also accepted: VAX-11 FORTRAN, IBM S/360 FORTRAN IV Level H Extended; and Structured FORTRAN. The SAP program utilizes two external files in its analysis procedure. A keyword file allows flexibility in classifying statements and in marking a statement as either executable or non-executable. A statistical weight file allows the user to assign weights to all output statistics, thus allowing the user flexibility in defining the figure of complexity. The SAP program is written in FORTRAN IV for batch execution and has been implemented on a DEC VAX series computer under VMS and on an IBM 370 series computer under MVS. The SAP program was developed in 1978 and last updated in 1985.

  9. [Radial variation and time lag of sap flow of Populus gansuensis in Minqin Oasis, Northwest].

    PubMed

    Dang, Hong-Zhong; Yang, Wen-Bin; Li, Wei; Zhang, You-Yan; Li, Chang-Long

    2014-09-01

    Sap flow of tree trunk is very important to reflect the dynamics of physiological activities, as well as to estimate the water consumption of individual plant. In the present study, we used the thermal dissipation technique to monitor the sap flow velocity (J) at four depth loci (i. e. 2 cm, 3 cm, 5 cm, 8 cm) of three Populus gansuensis trees (30 year-old) in Minqin Oasis for two consecutive growing seasons. The results showed that there were significant differences among J values at four depth loci under tree trunk cambium. J value at the 3 cm depth locus (J3) of the tree trunk was the highest, and then in sequences, were 2 cm, 5 cm and 8 cm depth loci (J2, J5 and J8). J value (J3) on typical sunny days in June with the highest atmospheric potential evapotranspiration (ET0) was up to 28.53 g · cm(-2) · h(-1), which was 1.42, 2.74 and 4.4 times of J2, J5 and J8, respectively. In the process of diurnal variation of sap flow velocity, the peak value time of J at the four depth loci of the tree trunk was different, but the differences among them were within 20 min. Furthermore, the peak value time of sap flow velocity was very different to that of solar radiation (Rs) and air vapour pressure deficit (VPD). The time lag between J and Rs was from 55 to 88 min on typical sunny days during the main growing seasons (from June to August), and, positively related to the depth of the locus under tree trunk cambium, while the time lag between J and VPD reached 60-96 min, and was negatively related to the depth of the locus. The seasonal variation patterns of J were consistent with ET0. With the increase of tree physiological activities, there was a trend that the major water transportation layer extended to the interior sapwood. The most important meteorological factor was the solar radiation, which primarily drove sap flow at different depths of tree trunk. However, the secondary factor changed along with the depth, and VPD became increasingly important with increasing the

  10. Adulteration and Contamination of Commercial Sap of Hymenaea Species.

    PubMed

    Farias, Katyuce de Souza; Auharek, Sarah Alves; Cunha-Laura, Andréa Luiza; de Souza, Jeana Mara Escher; Damasceno-Junior, Geraldo Alves; Toffoli-Kadri, Mônica Cristina; de Oliveira Filiú, Wander Fernando; Dos Santos, Edson Dos Anjos; Chang, Marilene Rodrigues; Carollo, Carlos Alexandre

    2017-01-01

    The Hymenaea stigonocarpa and Hymenaea martiana species, commonly known as "jatobá," produce a sap which is extracted by perforation of the trunk and is commonly used in folk medicine as a tonic. For this study, the authenticity of commercial samples of jatobá was verified by the identification of the main compounds and multivariate analysis and contamination by microbial presence analysis. The acute toxicity of the authentic jatobá sap was also evaluated. The metabolites composition and multivariate analysis revealed that none of the commercial samples were authentic. In the microbiological contamination analysis, five of the six commercial samples showed positive cultures within the range of 1,700-100,000 CFU/mL and the authentic sap produced no signs of toxicity, and from a histological point of view, there was the maintenance of tissue integrity. In brief, the commercial samples were deemed inappropriate for consumption and represent a danger to the population.

  11. SAPFLUXNET: towards a global database of sap flow measurements.

    PubMed

    Poyatos, Rafael; Granda, Víctor; Molowny-Horas, Roberto; Mencuccini, Maurizio; Steppe, Kathy; Martínez-Vilalta, Jordi

    2016-12-01

    Plant transpiration is the main evaporative flux from terrestrial ecosystems; it controls land surface energy balance, determines catchment hydrological responses and influences regional and global climate. Transpiration regulation by plants is a key (and still not completely understood) process that underlies vegetation drought responses and land evaporative fluxes under global change scenarios. Thermometric methods of sap flow measurement have now been widely used to quantify whole-plant and stand transpiration in forests, shrublands and orchards around the world. A large body of research has applied sap flow methods to analyse seasonal and diurnal patterns of transpiration and to quantify their responses to hydroclimatic variability, but syntheses of sap flow data at regional to global scales are extremely rare. Here we present the SAPFLUXNET initiative, aimed at building the first global database of plant-level sap flow measurements. A preliminary metadata survey launched in December 2015 showed an encouraging response by the sap flow community, with sap flow data sets from field studies representing >160 species and >120 globally distributed sites. The main goal of SAPFLUXNET is to analyse the ecological factors driving plant- and stand-level transpiration. SAPFLUXNET will open promising research avenues at an unprecedented global scope, namely: (i) exploring the spatio-temporal variability of plant transpiration and its relationship with plant and stand attributes, (ii) summarizing physiological regulation of transpiration by means of few water-use traits, usable for land surface models, (iii) improving our understanding of the coordination between gas exchange and plant-level traits (e.g., hydraulics) and (iv) analysing the ecological factors controlling stand transpiration and evapotranspiration partitioning. Finally, SAPFLUXNET can provide a benchmark to test models of physiological controls of transpiration, contributing to improve the accuracy of

  12. SAP-Dependent and -Independent Regulation of Innate T Cell Development Involving SLAMF Receptors.

    PubMed

    De Calisto, Jaime; Wang, Ninghai; Wang, Guoxing; Yigit, Burcu; Engel, Pablo; Terhorst, Cox

    2014-01-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) plays an essential role in the immune system mediating the function of several members of the SLAM family (SLAMF) of receptors, whose expression is essential for T, NK, and B-cell responses. Additionally, the expression of SAP in double-positive thymocytes is mandatory for natural killer T (NKT) cells and, in mouse, for innate CD8(+) T cell development. To date, only two members of the SLAMF of receptors, Slamf1 and Slamf6, have been shown to positively cooperate during NKT cell differentiation in mouse. However, it is less clear whether other members of this family may also participate in the development of these innate T cells. Here, we show that Slamf[1 + 6](-/-) and Slamf[1 + 5 + 6](-/-) B6 mice have ~70% reduction of NKT cells compared to wild-type B6 mice. Unexpectedly, the proportion of innate CD8(+) T cells slightly increased in the Slamf[1 + 5 + 6](-/-) , but not in the Slamf[1 + 6](-/-) strain, suggesting that Slamf5 may function as a negative regulator of innate CD8(+) T cell development. Accordingly, Slamf5(-/-) B6 mice showed an exclusive expansion of innate CD8(+) T cells, but not NKT cells. Interestingly, the SAP-independent Slamf7(-/-) strain showed an expansion of both splenic innate CD8(+) T cells and thymic NKT cells. On the other hand, and similar to what was recently shown in Slamf3(-/-) BALB/c mice, the proportions of thymic promyelocytic leukemia zinc finger (PLZF(hi)) NKT cells and innate CD8(+) T cells significantly increased in the SAP-independent Slamf8(-/-) BALB/c strain. In summary, these results show that NKT and innate CD8(+) T cell development can be regulated in a SAP-dependent and -independent fashion by SLAMF receptors, in which Slamf1, Slamf6, and Slamf8 affect development of NKT cells, and that Slamf5, Slamf7, and Slamf8 affect the development of innate CD8(+) T cells.

  13. Visual Data Comm: A Tool for Visualizing Data Communication in the Multi Sector Planner Study

    NASA Technical Reports Server (NTRS)

    Lee, Hwasoo Eric

    2010-01-01

    Data comm is a new technology proposed in future air transport system as a potential tool to provide comprehensive data connectivity. It is a key enabler to manage 4D trajectory digitally, potentially resulting in improved flight times and increased throughput. Future concepts with data comm integration have been tested in a number of human-in-the-loop studies but analyzing the results has proven to be particularly challenging because future traffic environment in which data comm is fully enabled has assumed high traffic density, resulting in data set with large amount of information. This paper describes the motivation, design, current and potential future application of Visual Data Comm (VDC), a tool for visualizing data developed in Java using Processing library which is a tool package designed for interactive visualization programming. This paper includes an example of an application of VDC on data pertaining to the most recent Multi Sector Planner study, conducted at NASA s Airspace Operations Laboratory in 2009, in which VDC was used to visualize and interpret data comm activities

  14. Comparative Statistical Study of Some SAP UI Technologies

    NASA Astrophysics Data System (ADS)

    Berdie, Adela; Osaci, Mihaela; Dan Lemle, Ludovic

    2011-09-01

    The goal of this paper is to present a comparative study on some web UI (User Interface) technologies that involve the creation of web applications on the platform SAP Net Weaver AS 7.01 of the integrated SAP (System Application Products) system. The attention will be directed mainly to the ABAP (Advanced Business Application Programing) development environment and to the Web Dynpro (WD) technologies, Floor Plan Manager (FPM) and Web Client UI. Through this study, we make an assesment regarding the decision of choosing a technology for the realisation of a project which consists of a web application.

  15. 30 CFR 285.800 - How must I conduct my activities to comply with safety and environmental requirements?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Activities Conducted Under SAPs, COPs and GAPs § 285.800 How must I conduct my activities to comply with... compliance with those terms and conditions identified in your approved SAP, COP, or GAP, as required...

  16. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  17. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  18. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  19. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  20. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  1. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  2. 30 CFR 285.607 - How do I submit my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false How do I submit my SAP? 285.607 Section 285.607... Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a)....

  3. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... demonstrate in my SAP? (a) Your SAP must demonstrate that you have planned and are prepared to conduct...

  4. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  5. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  6. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  7. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  8. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, REGULATION, AND ENFORCEMENT... Commercial Leases § 285.606 What must I demonstrate in my SAP? (a) Your SAP must demonstrate that you...

  9. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  10. 30 CFR 285.613 - How will MMS process my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my SAP? 285.613 Section... Requirements Contents of the Site Assessment Plan § 285.613 How will MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided pursuant to § 285.611, to determine if...

  11. Diurnal and seasonal variability in the radial distribution of sap flow: predicting total stem flow in Pinus taeda trees.

    PubMed

    Ford, Chelcy R; Goranson, Carol E; Mitchell, Robert J; Will, Rodney E; Teskey, Robert O

    2004-09-01

    We monitored the radial distribution of sap flux density (v; g H2O m(-2) s(-1)) in the sapwood of six plantation-grown Pinus taeda L. trees during wet and dry soil periods. Mean basal diameter of the 32-year-old trees was 33.3 cm. For all trees, the radial distribution of sap flow in the base of the stem (i.e., radial profile) was Gaussian in shape. Sap flow occurred maximally in the outer 4 cm of sapwood, comprising 50-60% of total stem flow (F), and decreased toward the center, with the innermost 4 cm of sapwood (11-15 cm) comprising less than 10% of F. The percent of flow occurring in the outer 4 cm of sapwood was stable with time (average CV < 10%); however, the percentage of flow occurring in the remaining sapwood was more variable over time (average CV > 40%). Diurnally, the radial profile changed predictably with time and with total stem flow. Seasonally, the radial profile became less steep as the soil water content (theta) declined from 0.38 to 0.21. Throughout the season, daytime sap flow also decreased as theta decreased; however, nighttime sap flow (an estimate of stored water use) remained relatively constant. As a result, the percentage of stored water use increased as theta declined. Time series analysis of 15-min values of F, theta, photosynthetically active radiation (PAR) and vapor pressure deficit (D) showed that F lagged behind D by 0-15 min and behind PAR by 15-30 min. Diurnally, the relationship between F and D was much stronger than the relationship between F and PAR, whereas no relationship was found between F and theta. An autoregressive moving average (ARIMA) model estimated that 97% of the variability in F could be predicted by D alone. Although total sap flow in all trees responded similarly to D, we show that the radial distribution of sap flow comprising total flow could change temporally, both on daily and seasonal scales.

  12. CO2 uptake of a mature Acacia mangium plantation estimated from sap flow measurements and stable carbon isotope discrimination

    NASA Astrophysics Data System (ADS)

    Wang, H.; Zhao, P.; Zou, L. L.; McCarthy, H. R.; Zeng, X. P.; Ni, G. Y.; Rao, X. Q.

    2014-03-01

    A simple, nondestructive method for the estimation of canopy CO2 uptake is important for understanding the CO2 exchange between forest and atmosphere. Canopy CO2 uptake (FCO2) of a subtropical mature A. mangium plantation was estimated by combining sap flow measurements and stable carbon isotope discrimination (Δ) in Southern China from 2004 to 2007. The mechanistic relationship linking FCO2, Δ in leaf sap, and sap flow-based canopy stomatal conductance (Gs) was applied in our study. No significant seasonal variations were observed in Δ or in the ratio of the intercellular and ambient CO2 concentrations (Ci/Ca), although diurnal Ci/Ca varied between sunlit and shaded leaves. A sensitivity analysis showed that estimates of FCO2 were more sensitive to dynamics in Gs than in Ca and Δ. By using seasonally and canopy averaged Ci/Ca values, we obtained an acceptable estimate of FCO2 compared to other estimates. FCO2 exhibited similar diurnal variation to that of Gs. Large seasonal variation in FCO2 was attributed to the responsiveness of Gs to vapor pressure deficit, photosynthetically active radiation, and soil moisture deficit. Our estimate of FCO2 for a mature A. mangium plantation (2.13 ± 0.40 gC m-2 d-1) approached the lower range of values for subtropical mixed forests, probably due to lower mean canopy stomatal conductance, higher Ci/Ca, and greater tree height than other measured forests. Our estimate was also lower than values determined by satellite-based modeling or carbon allocation studies, suggesting the necessity of stand level flux data for verification. Qualitatively, the sap flux/stable isotope results compared well with gas exchange results. Differences in results between the two approaches likely reflected variability due to leaf position and age, which should be reduced for the combined sap flux and isotope technique, as it uses canopy average values of Gs and Ci/Ca.

  13. CO2 uptake of a mature Acacia mangium plantation estimated from sap flow measurements and stable carbon isotope discrimination

    NASA Astrophysics Data System (ADS)

    Wang, H.; Zhao, P.; Zou, L. L.; McCarthy, H. R.; Zeng, X. P.; Ni, G. Y.; Rao, X. Q.

    2013-07-01

    Canopy CO2 uptake (FCO2) of a subtropical mature textit{A. mangium} plantation was estimated by combining sap flow measurements and stable carbon isotope discrimination (Δ) in Southern China from 2004 to 2007. The mechanistic relationship linking FCO2, Δ in leaf sap, and sap flow based canopy stomatal conductance (Gs) was applied in our study. No significant seasonal variations were observed in Δ or in the ratio of the intercellular and ambient CO2 concentrations (Ci/Ca), although diurnal Ci/Ca varied between sunlit and shaded leaves. A sensitivity analysis showed that estimates of FCO2 were more sensitive to dynamics in Gs than in Ca and Δ. By using seasonally and canopy averaged Ci/Ca values, an acceptable estimate of FCO2 was obtained. FCO2 exhibited similar diurnal variation to that of Gs. Large seasonal variation in FCO2 was attributed to the responsiveness of Gs to vapour pressure deficit, photosynthetically active radiation, and soil moisture deficit. Our estimate of FCO2 for a mature A. mangium plantation (2.13 ± 0.40 g C m-2 day-1) approached the lower range of values for subtropical mixed forest, probably due to lower mean canopy stomatal conductance, higher Ci/Ca, and greater tree height than other measured forests. Our estimate was also lower than values determined by satellite-based modeling or component carbon analysis, suggesting the necessity of stand level flux data for verification. Qualitatively, the sap flux/stable isotope results compared well with gas exchange results. Differences in results between the two approaches reflected variability due to leaf position and age, which could be reduced for sap flux/stable isotope, which uses canopy average values of Gs and Ci/Ca.

  14. Artesunate ameliorates severe acute pancreatitis (SAP) in rats by inhibiting expression of pro-inflammatory cytokines and Toll-like receptor 4.

    PubMed

    Cen, Yanyan; Liu, Chao; Li, Xiaoli; Yan, Zifei; Kuang, Mei; Su, Yujie; Pan, Xichun; Qin, Rongxin; Liu, Xin; Zheng, Jiang; Zhou, Hong

    2016-09-01

    Severe acute pancreatitis (SAP) is a severe clinical condition with significant morbidity and mortality. Multiple organs dysfunction (MOD) is the leading cause of SAP-related death. The over-release of pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α is the underlying mechanism of MOD; however, there is no effective agent against the inflammation. Herein, artesunate (AS) was found to increase the survival of SAP rats significantly when injected with 3.5% sodium taurocholate into the biliopancreatic duct in a retrograde direction, improving their pancreatic pathology and decreasing serum amylase and pancreatic lipase activities along with substantially reduced pancreatic IL-1β and IL-6 release. In vitro, AS-pretreatment strongly inhibited IL-1β and IL-6 release and their mRNA expressions in the pancreatic acinar cells treated with lipopolysaccharide (LPS) but exerted little effect on TNF-α release. Additionally, AS reduced the mRNA expressions of Toll-like receptor 4 (TLR4) and nuclear factor-κB (NF-κB) p65 as well as their protein expressions in the pancreatic acinar cells. In conclusion, our results demonstrated that AS could significantly protect SAP rats, and this protection was related to the reduction of digestive enzyme activities and pro-inflammatory cytokine expressions via inhibition of TLR4/NF-κB signaling pathway. Therefore, AS may be considered as a potential therapeutic agent against SAP.

  15. Overexpression of OsSAP16 Regulates Photosynthesis and the Expression of a Broad Range of Stress Response Genes in Rice (Oryza sativa L.)

    PubMed Central

    Wang, Fei; Coe, Robert A.; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul

    2016-01-01

    This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes. PMID:27303811

  16. Program planner's guide to geothermal development in California

    SciTech Connect

    Yen, W.W.S.; Chambers, D.M.; Elliott, J.F.; Whittier, J.P.; Schnoor, J.J.; Blachman, S.

    1980-09-30

    The resource base, status of geothermal development activities, and the state's energy flow are summarized. The present and projected geothermal share of the energy market is discussed. The public and private sector initiatives supporting geothermal development in California are described. These include legislation to provide economic incentives, streamline regulation, and provide planning assistance to local communities. Private sector investment, research, and development activities are also described. The appendices provide a ready reference of financial incentives. (MHR)

  17. Faculty Performance Evaluation: The CIPP-SAPS Model.

    ERIC Educational Resources Information Center

    Mitcham, Maralynne

    1981-01-01

    The issues of faculty performance evaluation for allied health professionals are addressed. Daniel Stufflebeam's CIPP (content-imput-process-product) model is introduced and its development into a CIPP-SAPS (self-administrative-peer- student) model is pursued. (Author/CT)

  18. Accounting Control Technology Using SAP: A Case-Based Approach

    ERIC Educational Resources Information Center

    Ragan, Joseph; Puccio, Christopher; Talisesky, Brandon

    2014-01-01

    The Sarbanes-Oxley Act (SOX) revolutionized the accounting and audit industry. The use of preventative and process controls to evaluate the continuous audit process done via an SAP ERP ECC 6.0 system is key to compliance with SOX and managing costs. This paper can be used in a variety of ways to discuss issues associated with auditing and testing…

  19. On the Relationship of SAPS to Storm-Enhanced Density

    DTIC Science & Technology

    2007-01-01

    Journal of Atmospheric and Solar - Terrestrial Physics , 69, (2007) © 2007 Elsevier Science B.V. *Massachusetts...TERRESTRIALPHYSICS ELSEVIER Journal of Atmospheric and Solar - Terrestrial Physics 69 (2007) 303--313 www.elevier.comlIocate/jastp 0o On the relationship of SAPS to...2006.07.021 304 J. C Foster et al. / Journal of " Atmospheric and Solar - Terrestrial

  20. Gravity like forces in sap conducting tissue in plants.

    NASA Astrophysics Data System (ADS)

    Wagner, Orvin

    2007-04-01

    I used miniature brass shielded Entran accelerometers in small holes in tree tissue to measure forces (penetrating the brass shield) in the direction of sap flow. These forces increased with sap flow up to 22% of gravity magnitude. It is assumed that measured forces would have been larger except for the presence of the distorting hole. These forces were measured in horizontal roots and vertical trunks (here a gravity decrease). Distances of mm. between the tissue and the accelerometer, over which the measured forces acted, could only be compared to gravity. The force's penetration of the brass shield also indicates gravity like forces. See e.g. Physiol. Chem. Phys. & Med. NMR (1995) 27: 31-34 and other publications of the author. The present generally presented controversial explanation of sap flow up tall trees apparently needs modification. Plant produced forces provide an incredible alternative. The macroscopic behavior of plants has so far been mostly ignored by physicists. The study of plants may answer some fundamental questions about gravity. (Earlier observations of weight loss in hanging weights in sap conducting tissue in bent trees led to the above work).

  1. Local land-use planning to conserve biodiversity: planners' perspectives on what works.

    PubMed

    Stokes, David L; Hanson, Marian F; Oaks, Deborah D; Straub, Jaime E; Ponio, Aileen V

    2010-04-01

    Because habitat loss due to urbanization is a primary threat to biodiversity, and land-use decisions in urbanizing areas are mainly made at the local level, land-use planning by municipal planning departments has a potentially important--but largely unrealized--role in conserving biodiversity. To understand planners' perspectives on the factors that facilitate and impede biodiversity conservation in local planning, we interviewed directors of 17 municipal planning departments in the greater Seattle (Washington, U.S.A.) area and compared responses of planners from similar-sized jurisdictions that were "high" and "low performing" with respect to incorporation of biodiversity conservation in local planning. Planners from low-performing jurisdictions regarded mandates from higher governmental levels as the primary drivers of biodiversity conservation, whereas those from high-performing jurisdictions regarded community values as the main drivers, although they also indicated that mandates were important. Biodiversity conservation was associated with presence of local conservation flagship elements (e.g., salmonids) and human-centered benefits of biodiversity conservation (e.g., quality of life). Planners from high- and low-performing jurisdictions favored different planning mechanisms for biodiversity conservation, perhaps reflecting differences in funding and staffing. High performers reported more collaborations with other entities on biodiversity issues. Planners' comments indicated that the term biodiversity may be problematic in the context of local planning. The action most planners recommended to increase biodiversity conservation in local planning was public education. These results suggest that to advance biodiversity conservation in local land-use planning, conservation biologists should investigate and educate the public about local conservation flagships and human benefits of local biodiversity, work to raise ecological literacy and explain biodiversity more

  2. Understanding Country Planning: A Guide for Air Force Component Planners

    DTIC Science & Technology

    2012-01-01

    execution and can help deconflict activities as necessary. Many Air Force components and most Security Assistance Organizations maintain a calendar ...on various Earth-based experiments and in the provision of ground station support to such initiatives as Japan’s Kaguya lunar mission.22 In addition

  3. 30 CFR 585.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.618 What must I do... application, that describes the continued use of existing facilities approved in your SAP, you may keep...

  4. 30 CFR 585.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.618 What must I do... application, that describes the continued use of existing facilities approved in your SAP, you may keep...

  5. 30 CFR 585.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.618 What must I do... application, that describes the continued use of existing facilities approved in your SAP, you may keep...

  6. 30 CFR 285.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.618 What must I do upon... application, that describes the continued use of existing facilities approved in your SAP, you may keep...

  7. 30 CFR 285.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap... approved in your SAP, you may keep such facilities in place on your lease during the time that MMS...

  8. Structural characterization of disease-causing mutations on SAP and the functional impact on the SLAM peptide: a molecular dynamics approach.

    PubMed

    Chandrasekaran, P; Rajasekaran, R

    2014-07-01

    X-linked lymphoproliferative (XLP) syndrome is an extremely rare inherited immunodeficiency disease characterized by severe immune dysregulation caused by mutations in signaling lymphocyte activation molecule (SLAM) associated protein (SAP) gene. The XLP syndrome was manifested due to dysfunction of SAP as a result of amino acid substitution. Hence, to understand the molecular aspects of the XLP syndrome, we structurally characterized two observed mutations, R32Q and T53I on SAP through the systematic molecular dynamics (MD) approach. Our MD analysis showed that mutant structures elucidated an atomic level variation influenced by mutations that substantially altered the residual flexibility and more importantly the hot spot residues as well in unbound and bound systems. In addition, change in residual flexibility of mutant structures showed an unusual conformational behavior associated with their molecular recognition function compared to the wild-type SAP in both systems. Besides, both mutant structures established different secondary structural profiles during the course of the simulation period in both systems. Moreover, the docking analysis revealed that mutant R32Q and T53I structures displayed remarkably reduced levels of binding affinity to the unphosphorylated SLAM peptide with respect to their docking scores. Collectively, our findings provide knowledge to understand the structural and functional relationship of disease-causing mutations, R32Q and T53I on SAP as well as gain further insights into the molecular pathogenesis of the XLP syndrome.

  9. SAP suppresses the development of experimental autoimmune encephalomyelitis in C57BL/6 mice.

    PubMed

    Ji, Zhe; Ke, Zun-Ji; Geng, Jian-Guo

    2012-04-01

    Experimental autoimmune encephalomyelitis (EAE) is a CD4(+) T cell-mediated disease of the central nervous system. Serum amyloid P component (SAP) is a highly conserved plasma protein named for its universal presence in amyloid deposits. Here we report that SAP-transgenic mice had unexpectedly attenuated EAE due to impaired encephalitogenic responses. Following induction with myelin oligodendroglial glycoprotein (MOG) peptide 35-55 in complete Freund's adjuvant, SAP-transgenic mice showed reduced spinal cord inflammation with lower severity of EAE attacks as compared with control C57BL/6 mice. However, in SAP-Knockout mice, the severity of EAE is enhanced. Adoptive transfer of Ag-restimulated T cells from wild type to SAP-transgenic mice, or transfer of SAP-transgenic Ag-restimulated T cells to control mice, induced milder EAE. T cells from MOG-primed SAP-transgenic mice showed weak proliferative responses. Furthermore, in SAP-transgenic mice, there is little infiltration of CD45-positive cells in the spinal cord. In vitro, SAP suppressed the secretion of interleukin-2 stimulated by P-selectin and blocked P-selectin binding to T cells. Moreover, SAP could change the affinity between α4-integrin and T cells. These data suggested that SAP could antagonize the development of the acute phase of inflammation accompanying EAE by modulating the function of P-selectin.

  10. SAP modulates B cell functions in a genetic background-dependent manner.

    PubMed

    Detre, Cynthia; Yigit, Burcu; Keszei, Marton; Castro, Wilson; Magelky, Erica M; Terhorst, Cox

    2013-06-01

    Mutations affecting the SLAM-associated protein (SAP) are responsible for the X-linked lympho-proliferative syndrome (XLP), a severe primary immunodeficiency syndrome with disease manifestations that include fatal mononucleosis, B cell lymphoma and dysgammaglobulinemia. It is well accepted that insufficient help by SAP-/- CD4+ T cells, in particular during the germinal center reaction, is a component of dysgammaglobulinemia in XLP patients and SAP-/- animals. It is however not well understood whether in XLP patients and SAP-/- mice B cell functions are affected, even though B cells themselves do not express SAP. Here we report that B cell intrinsic responses to haptenated protein antigens are impaired in SAP-/- mice and in Rag-/- mice into which B cells derived from SAP-/- mice together with wt CD4+ T cells had been transferred. This impaired B cells functions are in part depending on the genetic background of the SAP-/- mouse, which affects B cell homeostasis. Surprisingly, stimulation with an agonistic anti-CD40 causes strong in vivo and in vitro B cell responses in SAP-/- mice. Taken together, the data demonstrate that genetic factors play an important role in the SAP-related B cell functions. The finding that anti-CD40 can in part restore impaired B cell responses in SAP-/- mice, suggests potentially novel therapeutic interventions in subsets of XLP patients.

  11. Serum Amyloid P Component (SAP) Interactome in Human Plasma Containing Physiological Calcium Levels.

    PubMed

    Poulsen, Ebbe Toftgaard; Pedersen, Kata Wolff; Marzeda, Anna Maria; Enghild, Jan J

    2017-02-14

    The pentraxin serum amyloid P component (SAP) is secreted by the liver and found in plasma at a concentration of approximately 30 mg/L. SAP is a 25 kDa homopentamer known to bind both protein and nonprotein ligands, all in a calcium-dependent manner. The function of SAP is unclear but likely involves the humoral innate immune system spanning the complement system, inflammation, and coagulation. Also, SAP is known to bind to the generic structure of amyloid deposits and possibly to protect them against proteolysis. In this study, we have characterized the SAP interactome in human plasma containing the physiological Ca(2+) concentration using SAP affinity pull-down and co-immunoprecipitation experiments followed by mass spectrometry analyses. The analyses resulted in the identification of 33 proteins, of which 24 were direct or indirect interaction partners not previously reported. The SAP interactome can be divided into categories that include apolipoproteins, the complement system, coagulation, and proteolytic regulation.

  12. NuSAP governs chromosome oscillation by facilitating the Kid-generated polar ejection force.

    PubMed

    Li, Chenyu; Xue, Chenyi; Yang, Qiaoyun; Low, Boon Chuan; Liou, Yih-Cherng

    2016-02-03

    In vertebrate cells, chromosomes oscillate to align precisely during metaphase. NuSAP, a microtubule-associated protein, plays a critical role in stabilizing spindle microtubules. In this study, we utilize 3D time-lapse live-cell imaging to monitor the role of NuSAP in chromosome oscillation and identify NuSAP as a novel regulator of the chromokinesin, Kid. Depletion of NuSAP significantly suppresses the amplitude and velocity of chromosome oscillation. We analyse the effects of NuSAP and Kid depletion in monopolar and bipolar cells with or without kinetochore microtubule depletion. Twelve postulated conditions are deciphered to reveal the contribution of NuSAP to the polar force generated at kinetochore microtubules and to the regulation of the polar ejection force generated by Kid, thus revealing a pivotal role of NuSAP in chromosome oscillation.

  13. The FORTRAN static source code analyzer program (SAP) user's guide, revision 1

    NASA Technical Reports Server (NTRS)

    Decker, W.; Taylor, W.; Eslinger, S.

    1982-01-01

    The FORTRAN Static Source Code Analyzer Program (SAP) User's Guide (Revision 1) is presented. SAP is a software tool designed to assist Software Engineering Laboratory (SEL) personnel in conducting studies of FORTRAN programs. SAP scans FORTRAN source code and produces reports that present statistics and measures of statements and structures that make up a module. This document is a revision of the previous SAP user's guide, Computer Sciences Corporation document CSC/TM-78/6045. SAP Revision 1 is the result of program modifications to provide several new reports, additional complexity analysis, and recognition of all statements described in the FORTRAN 77 standard. This document provides instructions for operating SAP and contains information useful in interpreting SAP output.

  14. A Proactive Program Planner's Guide to Community Services Development from an Ecological Point of View.

    ERIC Educational Resources Information Center

    Karan, Orv C.; Gardner, William I.

    The paper considers the role of program planners in ensuring community adjustment of deinstitutionalized severely mentally handicapped persons, especially in light of the provisions of the Budget Reconciliation Act of 1981, which provides a waiver authority to states to increase community programs for the deinstitutionalized population. The paper…

  15. History, Language Planners, and Strategies of Forgetting: The Problem of Consciousness in the Philippines.

    ERIC Educational Resources Information Center

    Tupas, T. Ruanni F.

    2003-01-01

    Examines why language planners in the Philippines argue the way they do concerning critical language issues in the country. Suggests discursive "strategies of forgetting" are employed across complex structures of relations shaped by decades of colonialization, Filipino elite collaboration, and current neocolonial and global conditions.…

  16. NDEA Institute for In-Service Training of Educational Planners for State Departments of Education.

    ERIC Educational Resources Information Center

    Institute for State Educational Planners, Mankato, Minn.

    This document includes the papers presented at an inservice training institute for planners from State education agencies. Guidelines concerning information analysis techniques and basic pupil, personnel, and fiscal information needs are covered in papers by Stanley Hecker, John J. Stiglmeier, Paul Bethke, Robert L. Hopper, and Burton D. Friedman.…

  17. Web-Based Geographic Information Systems: Experience and Perspectives of Planners and the Implications for Extension

    ERIC Educational Resources Information Center

    Göçmen, Z. Asligül

    2016-01-01

    Web-based geographic information system (GIS) technology, or web-based GIS, offers many opportunities for public planners and Extension educators who have limited GIS backgrounds or resources. However, investigation of its use in planning has been limited. The study described here examined the use of web-based GIS by public planning agencies. A…

  18. Design and Planning of National Information Systems (NATIS). A Paper for Government Planners.

    ERIC Educational Resources Information Center

    United Nations Educational, Scientific, and Cultural Organization, Paris (France).

    This draft UNESCO document, an extension of a National Information System (NATIS) planning objective, provides guidelines for government planners in determining information policy, and designing and planning NATIS. It is aimed at governments who believe there is a need to develop NATIS for their countries' economic, cultural and social well-being,…

  19. Self-Motivated Personal Career Planning Program. Planner's Guide. [Adult Form].

    ERIC Educational Resources Information Center

    Walter, Verne; Wallace, Melvin

    The Self-Motivated Personal Career Planning guide for adults presents a process of self-assessment and goal-setting involving employee planners and management facilitators. An overview and rationale of the program and instructions and procedures are discussed in Chapters 1 and 2. The remainder of the guide consists of procedural steps for (1)…

  20. Computer-Aided Training for Transport Planners: Experience with the Pluto Package.

    ERIC Educational Resources Information Center

    Bonsall, P. W.

    1995-01-01

    Describes the PLUTO model, an interactive computer program designed for use in education and training of city planners and engineers. Emphasizes four issues: (1) the balance between realism and simplification; (2) the design of the user interface; (3) comparative advantages of group and solo working; and (4) factors affecting the decision to…

  1. The Personal Nutrition Planner: A 5-Week, Computer-Tailored Intervention for Women

    ERIC Educational Resources Information Center

    Mouttapa, Michele; Robertson, Trina P.; McEligot, Archana J.; Weiss, Jie W.; Hoolihan, Lori; Ora, Ann; Trinh, Linda

    2011-01-01

    Objective: To conduct a dietary intervention using the Personal Nutrition Planner (PNP), an on-line nutrition intervention tool. Design: Randomized controlled trial with pretest, posttest, and 2-month follow-up self-report assessments. Setting: Web/on-line. Participants: Female university staff (n = 307; 59.1% Caucasian) recruited via e-mail.…

  2. Conflict and Collaboration: Providers and Planners Implementing the Workforce Investment Act (WIA)

    ERIC Educational Resources Information Center

    Hopkins, John L.; Monaghan, Catherine H.; Hansman, Catherine A.

    2009-01-01

    This qualitative case study investigated the impact of Workforce Investment Act (WIA) funding on the providers and planners of programs for incumbent workers in one Midwest WIA region. It examines the collaboration and power conflicts that are part of planning and implementing this legislation for the stakeholders. The study applied Matland's…

  3. Nutrient management planners feedback on New York and Pennsylvania phosphorus indices

    Technology Transfer Automated Retrieval System (TEKTRAN)

    State Phosphorus Indices (PIs) are being evaluated across the US due to variability in P management recommendations and questions about the lack of water quality improvement in some watersheds. Nutrient management planners in New York (NY) and Pennsylvania (PA) were surveyed via two separate but rel...

  4. Searching for the Meanings of Learning at Work: Cases of Product Planners.

    ERIC Educational Resources Information Center

    Collin, Kaija

    As part of a larger research project on workplace learning, a study examined learning at work as it is experienced among product planners in Finland. The study focused on three questions: (1) What kind of experience do employees interpret as learning? (2) What kind of meanings do employees give their action and learning individually and together?…

  5. Comprehensive Erosion and Sediment Control Training Program for Engineers, Architects and Planners.

    ERIC Educational Resources Information Center

    Porter, Harry L., Jr.

    This program training text was designed to provide uniform instruction to the engineer, architect, planner, and others who will be helping to implement an erosion and sediment control program. Although tailored for use in Virginia, the basic principles covered are universal, and the material is adaptable to meet the needs in any State. The 11…

  6. Waste Reduction Model (WARM) Resources for State and Local Government/Solid Waste Planners

    EPA Pesticide Factsheets

    This page provides a brief overview of how EPA’s Waste Reduction Model (WARM) can be used by state and local government/solid waste planners. The page includes a brief summary of uses of WARM for the audience and links to other resources.

  7. The Educated Person in Cross-Cultural Perspective: Implications for the Postsecondary Educational Planner.

    ERIC Educational Resources Information Center

    Feldman, Reynold

    1979-01-01

    The question of what constitutes an educated person is considered from a cross-cultural perspective. Ideas from culture-based models--including the educated Westerner, the classical Hindu, the Confucian Chinese, the Maoist, and the holistic model--are presented. Implications of these concepts for the educational planner of today are discussed. (SF)

  8. Technology Training for Teachers: Topics and Tips for Staff Development Planners.

    ERIC Educational Resources Information Center

    North Carolina State Dept. of Public Instruction, Raleigh.

    This workbook offers tips for staff development planners who train teachers about technology. The first six sections are "Getting Started with Competencies and Context,""Looking at Learner Needs,""Taking School Technology Inventory,""Outlining Parameters for Program Design,""Selecting Resources and…

  9. Site Planning for Solar Access: A Guidebook for Residential Developers and Site Planners.

    ERIC Educational Resources Information Center

    Erley, Duncan; Jaffe, Martin

    This manual is intended to guide developers, site planners, and builders in designing residential developments so that access to sunlight is maintained for planned or potential solar collectors. Almost any housing development can be designed to facilitate the use of solar energy. Differences are not in costs but in planning. Described in this…

  10. The Adaptor Molecule SAP Regulates IFNγ and IL-4 Production in Vα14 Transgenic NKT cells via Effects on GATA-3 and T-bet Expression1

    PubMed Central

    Cen, Osman; Ueda, Aki; Guzman, Laura; Jain, Jimmy; Bassiri, Hamid; Nichols, Kim E.; Stein, Paul L.

    2008-01-01

    NKT cells comprise a rare regulatory T cell population of limited TCR diversity, with most cells utilizing a Vα14Jα18 TCR. These cells exhibit a critical dependence on the signaling adapter molecule SAP for their ontogeny, an aspect not seen in conventional αβ T cells. Prior studies demonstrate that SAP enhances TCR-induced activation of NF-kB in CD4+ T cells. Since NF-kB is required for NKT cell development, SAP might promote the ontogeny of this lineage by signaling to NF-kB. In this report, we demonstrate that forced expression of the NF-kB target gene, Bcl-xL, or IKKβ, a catalytic subunit of the IkB kinase complex essential for NF-kB activation, fails to restore NKT cell development in sap−/− mice, suggesting that SAP mediates NKT cell development independently of NF-kB. To examine the role of SAP in NKT cell function, we generated NKT cells in sap−/− mice by expressing a transgene encoding the Vα14Jα18 component of the invariant TCR. These cells bound α-GalCer loaded CD1d tetramers, but exhibited a very immature CD24+NK1.1- phenotype. While sap−/− tetramer-reactive cells proliferated in response to TCR activation, they did not produce appreciable levels of IL-4 or IFN-γ. The reduction in cytokine production correlated with the near absence of GATA-3 and T-bet, key transcription factors regulating cytokine expression and maturation of NKT cells. Ectopic expression of GATA-3 partially restored IL-4 production by the NKT cells. Collectively these data suggest that by promoting GATA3 and T-bet expression, SAP exerts control over NKT cell development and mature NKT cell cytokine production. PMID:19155483

  11. CT-simulator based brachytherapy planner: seed localization and incorporation of biological considerations.

    PubMed

    Mayer, R; Fong, W; Frankel, T; Simons, S; Kleinberg, L; Lee, D J

    1998-01-01

    Radiation dose prescription, interpretation, and planning can be problematic for brachytherapy due to high spatial heterogeneity, varying and various dose rates, absence of superimposed calculated isodose distributions onto affected tissues, and lack of dose volume histograms. A new treatment planner has been developed to reduce these limitations in brachytherapy planning. The PC-based planning system uses a CT-simulator to sequentially scan the patient to generate orthogonal images (to localize seed positions) and subsequently axially scan the patient. This sequential scanning procedure avoids using multiple independent patient scans, templates, external frames, or fiducial markers to register the reconstructed seed positions with patient contours. Dose is computed after assigning activity to (low dose rate) Ir192, linear Cs137, or I125 seeds or dwell times (high dose rate) to the Ir192 source. The planar isodose distribution is superimposed onto axial, coronal, or sagittal views of the tissues following image reconstruction. The treatment plan computes (1) direct and cumulative volume dose histograms for individual tissues, (2) the average, standard deviation, and coefficient of skewness of the dose distribution within individual tissues, (3) an average (over all tissue pixels) survival probability (S) and average survival dose DASD for a given radiation treatment, (4) normal tissue complication probability (NTCP) delivered to a given tissue. All four computed quantities account for dose heterogeneity. These estimates of the biological response to radiation from laboratory-based studies may help guide the evaluation of the prescribed low- or high-dose rate therapy in retrospective and prospective clinical studies at a number of treatment sites.

  12. Impacts of Hydrological Alterations to the Tonle Sap Ecosystem of the Mekong River Basin

    NASA Astrophysics Data System (ADS)

    Arias, M. E.; Cochrane, T. A.

    2013-12-01

    The Tonle Sap is the largest and most important natural wetland in Southeast Asia. It covers an area of more than 15,000 km2 with a unique mosaic of natural and agricultural floodplain habitats that coexist with the largest fishery in the Mekong Basin. Accelerating hydropower development and climate change, however, are altering the Mekong's hydrology, which could negatively affect downstream ecosystems. The Tonle Sap is facing a two-fold problem. First, the link between its hydrology and ecosystem properties is not well understood. Second, potential ecological changes caused by future hydrological disruptions related to hydropower and climate change are unknown. Thus, the main objective of this study was to quantify how alterations to the Mekong hydrology could affect the Tonle Sap ecosystem. An assessment of landscape patterns revealed a distinct relationship between inundation and vegetation. Habitats in the Tonle Sap were divided into five groups based on annual flood duration, as well as physiognomic factors and human activity: (1) open water, (2) gallery forest, (3) seasonally flooded habitats, (4) transitional habitats, and (5) rainfed habitats. Large shifts could occur as a result of hydropower development scenarios by the 2030s; areas optimal for gallery forest could decrease by 82% from baseline conditions, whereas areas of rainfed habitats could increase by 10-13 % (813-1061 km2). An assessment of habitat patterns demonstrated that despite the complexity and intense human use of this ecosystem, the Mekong flood-pulse hydrology is the underlying driver of habitat characteristics by (1) determining inundation depth and duration, (2) creating the main soils gradient, (3) limiting the area cleared for agriculture, (4) influencing vegetation structure and water quality, and (5) shaping the composition of plant species. A numerical model was used to estimate aquatic net primary production (NPP) as a function of hydrology, sediments, and habitat characteristics

  13. Transforming the Knowledge Gap for Local Planning Officials: Impacts of Continuing Education in a Master Citizen Planner Program

    ERIC Educational Resources Information Center

    Beyea, Wayne; Menon, Rohit; Crawford, Pat

    2016-01-01

    In an era of increasing complexity, the majority of local land-use decisions in the United States are made by volunteer citizen planners. Often these elected or appointed volunteers enter their positions with a passion for their communities but without appropriate background training. The Michigan Citizen Planner Program was developed to address…

  14. Indiscriminate Fisheries: Understanding the Foodweb of the Great Tonle Sap Lake, Cambodia

    NASA Astrophysics Data System (ADS)

    Hannah, L.; Kaufman, L.

    2014-12-01

    Indiscriminate fisheries target multiple species with multiple gear types. In contrast to well-studied, industrialized single-species, single-gear fisheries, little theory and little but growing literature on practice exists for indiscriminate fisheries. Indiscriminate fisheries are disproportionately important in low-income countries, providing most of the animal protein intake in countries such as Cambodia and Bangladesh. Indiscriminate fisheries may be either freshwater or marine, but here we focus on what may be the largest freshwater indiscriminate fishery in the world. Cambodia's freshwater fishery stands out because it provides the majority of animal protein to over 3 million people living in poverty. The fishery of the Tonle Sap lake is one of the largest, if not the largest contributor to this freshwater fish take, and is perhaps the largest freshwater fishery in the world. In contrast to its importance, very little is known about the foodweb ecology of this system, or how community management which now governs the entire fishery, interacts with biological and physical factors such as climate change.The foodweb of the Tonle Sap has changed dramatically due to high fishing pressure. A system that once harbored giant catfish, barbs and stingrays is now dominated by fish under 20cm in length. The simplification of the system may not have reduced its productivity. Theory of indiscriminate fisheries suggests that r-selected species may be favored and that biomass available for harvest may be maximized, while being more sensitive to environmental fluctuations such as climate change due to food web simplification. The r-selection and size predictions of theory have been confirmed by observations of the Tonle Sap. Early model results suggest sensitivity to environmental stochasticity. The interaction of these ecological changes with social systems will be tested in the Tonle Sap. Fisheries management across the lake has been transferred to community management

  15. Electric Potential Variations on a Poplar: Beyond Electrokinetic Effects Associated With Sap Flow

    NASA Astrophysics Data System (ADS)

    Gibert, D.; Le Mouël, J.; Lambs, L.; Nicollin, F.; Conil, F.; Perrier, F.

    2004-12-01

    Electric potential has been monitored since December 2003 in the roots and at two circumferences and one vertical profile in a standing poplar (Populus incognitus). Electric potential is sampled using 5 mm diameter stainless steel rods, inserted 5 mm deep in the cambium, and is referenced to an unpolarizable Petiau electrode installed 80 cm deep in the soil. Various types of signals are observed. Transient signals with long relaxation times affecting some electrodes simultaneously, may be contact potentials triggered by condensation and evaporation. Diurnal variations are observed which present a seasonal variation. During winter, diurnal variations depend on the measurement point, with variable amplitudes and sometimes anticorrelations between electrodes. By contrast, a stable and coherent organization is established in the spring, with larger amplitudes, and lasts during summer. Such signals have been reported previously (Koppan et al., 2000; Morat et al., 1994; Fensom, 1963), have been interpreted as electrokinetic effects associated with sap flow. However, a comparison of the electrical signals with a measurement of the sap flow by a heat flow method, shows that the electrical variation, although clearly correlated to sap flow, is not simply proportional to it. In a living system, electrokinetic effects, in addition to thermoelectrical effects, are probably modified significantly by additional electrochemical effects, such as membrane diffusion potentials, ion active transport by proteins, and action potentials. Such effects have been evidenced in laboratory experiments with plants (e.g., Fromm and Hei, 1998). Electric potential variations in trees may thus reveal mechanisms not accessible by other methods, and maybe reveal new aspects of the physics of living systems. A better understanding of the electrical response of trees to meteorological, chemical or biological forcing may improve the knowledge of transfer processes between the soil and the atmosphere

  16. Sap flow measurements combining sap-flux density radial profiles with punctual sap-flux density measurements in oak trees (Quercus ilex and Quercus pyrenaica) - water-use implications in a water-limited savanna-

    NASA Astrophysics Data System (ADS)

    Reyes, J. Leonardo; Lubczynski1, Maciek W.

    2010-05-01

    Sap flow measurement is a key aspect for understanding how plants use water and their impacts on the ecosystems. A variety of sensors have been developed to measure sap flow, each one with its unique characteristics. When the aim of a research is to have accurate tree water use calculations, with high temporal and spatial resolution (i.e. scaled), a sensor with high accuracy, high measurement efficiency, low signal-to-noise ratio and low price is ideal, but such has not been developed yet. Granier's thermal dissipation probes (TDP) have been widely used in many studies and various environmental conditions because of its simplicity, reliability, efficiency and low cost. However, it has two major flaws when is used in semi-arid environments and broad-stem tree species: it is often affected by high natural thermal gradients (NTG), which distorts the measurements, and it cannot measure the radial variability of sap-flux density in trees with sapwood thicker than two centimeters. The new, multi point heat field deformation sensor (HFD) is theoretically not affected by NTG, and it can measure the radial variability of the sap flow at different depths. However, its high cost is a serious limitation when simultaneous measurements are required in several trees (e.g. catchment-scale studies). The underlying challenge is to develop a monitoring schema in which HFD and TDP are combined to satisfy the needs of measurement efficiency and accuracy in water accounting. To assess the level of agreement between TDP and HFD methods in quantifying sap flow rates and temporal patterns on Quercus ilex (Q.i ) and Quercus pyrenaica trees (Q.p.), three measurement schemas: standard TDP, TDP-NTG-corrected and HFD were compared in dry season at the semi-arid Sardon area, near Salamanca in Spain in the period from June to September 2009. To correct TDP measurements with regard to radial sap flow variability, a radial sap flux density correction factor was applied and tested by adjusting TDP

  17. Visualization of scattering angular distributions with the SAP code

    NASA Astrophysics Data System (ADS)

    Fernandez, J. E.; Scot, V.; Basile, S.

    2010-07-01

    SAP (Scattering Angular distribution Plot) is a graphical tool developed at the University of Bologna to compute and plot Rayleigh and Compton differential cross-sections (atomic and electronic), form-factors (FFs) and incoherent scattering functions (SFs) for single elements, compounds and mixture of compounds, for monochromatic excitation in the range of 1-1000 keV. The computation of FFs and SFs may be performed in two ways: (a) by interpolating Hubbell's data from EPDL97 library and (b) by using semi-empirical formulas as described in the text. Two kinds of normalization permit to compare the plots of different magnitudes, by imposing a similar scale. The characteristics of the code SAP are illustrated with one example.

  18. Zn and Cu complexes with glutathione in ricinis phloem sap

    SciTech Connect

    Albrigo, L.G.; Taylor, K.C. )

    1989-04-01

    To characterize phloem Cu and Zn carriers, phloem sap was collected from native stands of Ricinis communis. The sap was separated by DEAE-Sephadex ion exchange chromatography. Two peaks were resolved from subsequent Zorbax CN-HPLC (isocratic elution: 0.25% MeOH, 0.025% TFA). Both peaks contained Cu and Zn. Further assessment by Mono Q-FPLC showed that these peaks were approximately 90% homogeneous, with similar retention times. The amino acid compositions of the HPLC eluted Cu- and Zn-containing fractions were determined. Both peaks contained glutathione (cysteic acid: glutamic acid: glycine, 1:1:1). Further work is underway to verify a complexing association of these metals with glutathione.

  19. Maple sap uptake, exudation, and pressure changes correlated with freezing exotherms and thawing endotherms.

    PubMed

    Tyree, M T

    1983-10-01

    Sap flow rates and sap pressure changes were measured in dormant sugar maple trees (Acer saccharum Marsh.). In the forest, sap flow rates and pressure changes were measured from tap holes drilled into tree trunks in mature trees and sap flow rates were measured from the base of excised branches. Excised branches were also brought into the laboratory where air temperature could be carefully controlled in a refrigerated box and sap flow rates and sap pressures were measured from the cut base of the branches.Under both forest and laboratory conditions, sap uptake occurred as the wood temperature declined but much more rapid sap uptake correlated with the onset of the freezing exotherm. When sap pressures were measured under conditions of negligible volume displacement, the sap pressure rapidly fell to -60 to -80 kilopascals at the start of the freezing exotherm. The volume of water uptake and the rate of uptake depended on the rate of freezing. A slow freezing rate correlated with a large volume of water uptake, a fast freezing rate induced a smaller volume of water uptake. The volume of water uptake ranged from 0.02 to 0.055 grams water per gram dry weight of sapwood. The volume of water exuded after thawing was usually less than the volume of uptake so that after several freezing and thawing cycles the sapwood water content increased from 0.7 to 0.8 grams water per gram dry weight.These results are discussed in terms of a physical model of the mechanism of maple sap uptake and exudation first proposed by P. E. R. O'Malley. The proposed mechanism of sap uptake is by vapor distillation in air filled wood fiber lumina during the freezing of minor branches. Gravity and pressurized air bubbles (compressed during freezing) cause sap flow from the canopy down the tree after the thaw.

  20. Adulteration and Contamination of Commercial Sap of Hymenaea Species

    PubMed Central

    Farias, Katyuce de Souza; Auharek, Sarah Alves; Cunha-Laura, Andréa Luiza; de Souza, Jeana Mara Escher; Damasceno-Junior, Geraldo Alves; Toffoli-Kadri, Mônica Cristina; de Oliveira Filiú, Wander Fernando; dos Santos, Edson dos Anjos; Chang, Marilene Rodrigues

    2017-01-01

    The Hymenaea stigonocarpa and Hymenaea martiana species, commonly known as “jatobá,” produce a sap which is extracted by perforation of the trunk and is commonly used in folk medicine as a tonic. For this study, the authenticity of commercial samples of jatobá was verified by the identification of the main compounds and multivariate analysis and contamination by microbial presence analysis. The acute toxicity of the authentic jatobá sap was also evaluated. The metabolites composition and multivariate analysis revealed that none of the commercial samples were authentic. In the microbiological contamination analysis, five of the six commercial samples showed positive cultures within the range of 1,700–100,000 CFU/mL and the authentic sap produced no signs of toxicity, and from a histological point of view, there was the maintenance of tissue integrity. In brief, the commercial samples were deemed inappropriate for consumption and represent a danger to the population. PMID:28303155

  1. Phytoplasma Effector SAP54 Hijacks Plant Reproduction by Degrading MADS-box Proteins and Promotes Insect Colonization in a RAD23-Dependent Manner

    PubMed Central

    MacLean, Allyson M.; Orlovskis, Zigmunds; Kowitwanich, Krissana; Zdziarska, Anna M.; Angenent, Gerco C.; Immink, Richard G. H.; Hogenhout, Saskia A.

    2014-01-01

    Pathogens that rely upon multiple hosts to complete their life cycles often modify behavior and development of these hosts to coerce them into improving pathogen fitness. However, few studies describe mechanisms underlying host coercion. In this study, we elucidate the mechanism by which an insect-transmitted pathogen of plants alters floral development to convert flowers into vegetative tissues. We find that phytoplasma produce a novel effector protein (SAP54) that interacts with members of the MADS-domain transcription factor (MTF) family, including key regulators SEPALLATA3 and APETALA1, that occupy central positions in the regulation of floral development. SAP54 mediates degradation of MTFs by interacting with proteins of the RADIATION SENSITIVE23 (RAD23) family, eukaryotic proteins that shuttle substrates to the proteasome. Arabidopsis rad23 mutants do not show conversion of flowers into leaf-like tissues in the presence of SAP54 and during phytoplasma infection, emphasizing the importance of RAD23 to the activity of SAP54. Remarkably, plants with SAP54-induced leaf-like flowers are more attractive for colonization by phytoplasma leafhopper vectors and this colonization preference is dependent on RAD23. An effector that targets and suppresses flowering while simultaneously promoting insect herbivore colonization is unprecedented. Moreover, RAD23 proteins have, to our knowledge, no known roles in flower development, nor plant defence mechanisms against insects. Thus SAP54 generates a short circuit between two key pathways of the host to alter development, resulting in sterile plants, and promotes attractiveness of these plants to leafhopper vectors helping the obligate phytoplasmas reproduce and propagate (zombie plants). PMID:24714165

  2. Phytoplasma effector SAP54 hijacks plant reproduction by degrading MADS-box proteins and promotes insect colonization in a RAD23-dependent manner.

    PubMed

    MacLean, Allyson M; Orlovskis, Zigmunds; Kowitwanich, Krissana; Zdziarska, Anna M; Angenent, Gerco C; Immink, Richard G H; Hogenhout, Saskia A

    2014-04-01

    Pathogens that rely upon multiple hosts to complete their life cycles often modify behavior and development of these hosts to coerce them into improving pathogen fitness. However, few studies describe mechanisms underlying host coercion. In this study, we elucidate the mechanism by which an insect-transmitted pathogen of plants alters floral development to convert flowers into vegetative tissues. We find that phytoplasma produce a novel effector protein (SAP54) that interacts with members of the MADS-domain transcription factor (MTF) family, including key regulators SEPALLATA3 and APETALA1, that occupy central positions in the regulation of floral development. SAP54 mediates degradation of MTFs by interacting with proteins of the RADIATION SENSITIVE23 (RAD23) family, eukaryotic proteins that shuttle substrates to the proteasome. Arabidopsis rad23 mutants do not show conversion of flowers into leaf-like tissues in the presence of SAP54 and during phytoplasma infection, emphasizing the importance of RAD23 to the activity of SAP54. Remarkably, plants with SAP54-induced leaf-like flowers are more attractive for colonization by phytoplasma leafhopper vectors and this colonization preference is dependent on RAD23. An effector that targets and suppresses flowering while simultaneously promoting insect herbivore colonization is unprecedented. Moreover, RAD23 proteins have, to our knowledge, no known roles in flower development, nor plant defence mechanisms against insects. Thus SAP54 generates a short circuit between two key pathways of the host to alter development, resulting in sterile plants, and promotes attractiveness of these plants to leafhopper vectors helping the obligate phytoplasmas reproduce and propagate (zombie plants).

  3. Sap flux-upscaled canopy transpiration, stomatal conductance, and water use efficiency in an old growth forest in the Great Lakes region of the United States

    NASA Astrophysics Data System (ADS)

    Tang, Jianwu; Bolstad, Paul V.; Ewers, Brent E.; Desai, Ankur R.; Davis, Kenneth J.; Carey, Eileen V.

    2006-06-01

    Combining sap flux and eddy covariance measurements provides a means to study plant stomatal conductance and the relationship between transpiration and photosynthesis. We measured sap flux using Granier-type sensors in a northern hardwood-dominated old growth forest in Michigan, upscaled to canopy transpiration, and calculated canopy conductance. We also measured carbon and water fluxes with the eddy covariance method and derived daytime gross primary production (GPP). The diurnal patterns of sap flux and canopy transpiration were mainly controlled by vapor pressure deficit (D) and photosynthetically active radiation (PAR). Daily sums of sap flux and canopy transpiration had exponential relationships to D that saturated at higher D and had linear relationships to PAR. Sugar maple (Acer saccharum) and yellow birch (Betula alleghaniesis) had higher sap flux per unit of sapwood area than eastern hemlock (Tsuga canadensis), while sugar maple and hemlock had higher canopy transpiration per unit of leaf area than yellow birch. Sugar maple dominated canopy transpiration per ground area. Canopy transpiration averaged 1.57 mm d-1, accounting for 65% of total evapotranspiration in the growing season. Canopy conductance was controlled by both D and PAR, but the day-to-day variation in canopy conductance mainly followed a negatively logarithmic relationship with D. By removing the influences of PAR, half-hourly canopy conductance was also negatively logarithmically correlated with D. Water use efficiency (WUE) had a strong exponential relationship with D on a daily basis and approached a minimum of 4.4 mg g-1. WUE provides an alternative to estimate GPP from measurements of sap flux.

  4. Nitrogen transport in the xylem sap of Quercus ilex: the role of ornithine.

    PubMed

    Nabais, Cristina; Hagemeyer, Jürgen; Freitas, Helena

    2005-05-01

    The storage and remobilization of nitrogen in deciduous and evergreen species is a major source of N, supporting the seasonal growth of trees. In evergreens, in addition to wood and roots, older leaves are important reservoirs of N used in the growth of new foliage. Just before bud burst, when transpiration is inactive or low, and when uptake of nitrogen by the roots may be restricted due to low temperatures, levels of organic N in the xylem are high. Amino acids usually comprise the bulk of this organic N. Changes in amino acid concentrations in early spring are thought to result mainly from hydrolysis of N reserves, and not from current N uptake. The seasonal profiles of amino acids in the xylem sap of Quercus ilex, an evergreen Mediterranean tree, were investigated. The first amino acid detected in the xylem sap before spring was ornithine, which may result from the breakdown of arginine present in storage proteins. Arginine is one of the main amino acids present in storage proteins because each arginine molecule has four nitrogen atoms. When protein degradation increases the free arginine pool, the arginase activity is enhanced and, consequently, the conversion of arginine to ornithine. It seems that ornithine has an important role in N transport early in the growth season of Q. ilex.

  5. Multiscale model of a freeze-thaw process for tree sap exudation.

    PubMed

    Graf, Isabell; Ceseri, Maurizio; Stockie, John M

    2015-10-06

    Sap transport in trees has long fascinated scientists, and a vast literature exists on experimental and modelling studies of trees during the growing season when large negative stem pressures are generated by transpiration from leaves. Much less attention has been paid to winter months when trees are largely dormant but nonetheless continue to exhibit interesting flow behaviour. A prime example is sap exudation, which refers to the peculiar ability of sugar maple (Acer saccharum) and related species to generate positive stem pressure while in a leafless state. Experiments demonstrate that ambient temperatures must oscillate about the freezing point before significantly heightened stem pressures are observed, but the precise causes of exudation remain unresolved. The prevailing hypothesis attributes exudation to a physical process combining freeze-thaw and osmosis, which has some support from experimental studies but remains a subject of active debate. We address this knowledge gap by developing the first mathematical model for exudation, while also introducing several essential modifications to this hypothesis. We derive a multiscale model consisting of a nonlinear system of differential equations governing phase change and transport within wood cells, coupled to a suitably homogenized equation for temperature on the macroscale. Numerical simulations yield stem pressures that are consistent with experiments and provide convincing evidence that a purely physical mechanism is capable of capturing exudation.

  6. Multiscale model of a freeze–thaw process for tree sap exudation

    PubMed Central

    Graf, Isabell; Ceseri, Maurizio; Stockie, John M.

    2015-01-01

    Sap transport in trees has long fascinated scientists, and a vast literature exists on experimental and modelling studies of trees during the growing season when large negative stem pressures are generated by transpiration from leaves. Much less attention has been paid to winter months when trees are largely dormant but nonetheless continue to exhibit interesting flow behaviour. A prime example is sap exudation, which refers to the peculiar ability of sugar maple (Acer saccharum) and related species to generate positive stem pressure while in a leafless state. Experiments demonstrate that ambient temperatures must oscillate about the freezing point before significantly heightened stem pressures are observed, but the precise causes of exudation remain unresolved. The prevailing hypothesis attributes exudation to a physical process combining freeze–thaw and osmosis, which has some support from experimental studies but remains a subject of active debate. We address this knowledge gap by developing the first mathematical model for exudation, while also introducing several essential modifications to this hypothesis. We derive a multiscale model consisting of a nonlinear system of differential equations governing phase change and transport within wood cells, coupled to a suitably homogenized equation for temperature on the macroscale. Numerical simulations yield stem pressures that are consistent with experiments and provide convincing evidence that a purely physical mechanism is capable of capturing exudation. PMID:26400199

  7. Phoenix dactylifera L. sap enhances wound healing in Wistar rats: Phytochemical and histological assessment.

    PubMed

    Abdennabi, Raed; Bardaa, Sana; Mehdi, Meriem; Rateb, Mostafa E; Raab, Andrea; Alenezi, Faizah N; Sahnoun, Zouheir; Gharsallah, Neji; Belbahri, Lassaad

    2016-07-01

    The sap of the date palm "Lagmi" is a clear liquid, rich in sugars and minerals, with a pleasant flavour. Folk remedies based on the use of "Lagmi" for wound healing are still practiced. However, no studies investigated the relevance of "Lagmi" for wound healing. Therefore, the aim of this study was to identify the in vivo healing properties of "lagmi" on mechanically wounded wistar rats. Injured rats were divided into three groups: a first group treated by "lagmi", a second reference group processed by CICAFLORA(®) and a third untreated control group. On the 12th day of the experiment, total healing in the first group was reached, while healing was incomplete in the other groups. The sap seems to accelerate cell proliferation and contribute to faster healing with a gain of more than 30% as compared to CICAFLORA(®). Chemical Analysis of "Lagmi" showed important radical scavenging activity and high total antioxidant capacity. Features reported to help healing process and/or provides a favourable environment for tissue healing in wound sites. Extensive characterization of "Lagmi" phenolic and flavonoid compounds by High Resolution LC-MS (LC-HRESIMS) analysis indicates "Lagmi" is an important source of known anti-inflammatory compounds as well as promising wound healing candidates.

  8. Groundwater sapping channels: Summary of effects of experiments with varied stratigraphy

    NASA Technical Reports Server (NTRS)

    Kochel, R. Craig; Simmons, David W.

    1987-01-01

    Experiments in the recirculating flume sapping box have modeled valley formation by groundwater sapping processes in a number of settings. The effects of the following parameters on sapping channel morphology were examined: surface slope; stratigraphic variations in permeability cohesion and dip; and structure of joints and dikes. These kinds of modeling experiments are particularly good for: testing concepts; developing a suite of distinctive morphologies and morphometries indicative of sapping; helping to relate process to morphology; and providing data necessary to assess the relative importance of runoff, sapping, and mass wasting processes on channel development. The observations from the flume systems can be used to help interpret features observed in terrestrial and Martian settings where sapping processes are thought to have played an important role in the development of valley networks.

  9. Systems Engineering Management Plan NASA Traffic Aware Planner Integration Into P-180 Airborne Test-Bed

    NASA Technical Reports Server (NTRS)

    Maris, John

    2015-01-01

    NASA's Traffic Aware Planner (TAP) is a cockpit decision support tool that provides aircrew with vertical and lateral flight-path optimizations with the intent of achieving significant fuel and time savings, while automatically avoiding traffic, weather, and restricted airspace conflicts. A key step towards the maturation and deployment of TAP concerned its operational evaluation in a representative flight environment. This Systems Engineering Management Plan (SEMP) addresses the test-vehicle design, systems integration, and flight-test planning for the first TAP operational flight evaluations, which were successfully completed in November 2013. The trial outcomes are documented in the Traffic Aware Planner (TAP) flight evaluation paper presented at the 14th AIAA Aviation Technology, Integration, and Operations Conference, Atlanta, GA. (AIAA-2014-2166, Maris, J. M., Haynes, M. A., Wing, D. J., Burke, K. A., Henderson, J., & Woods, S. E., 2014).

  10. Counterurbanisation and rural depopulation revisited: landowners, planners and the rural development process.

    PubMed

    Spencer, D

    1997-01-01

    "This paper reopens the debate between Weekley (1988) and Rowsell (1989) over why pockets of depopulation have persisted within parts of rural Britain which have experienced net growth through counterurbanisation. It argues that Weekley has not fully appreciated the context for local population losses, namely the emergence of a new structural relationship between people, households, and dwellings, and the growing tension between production and consumption interests in rural locales. Moreover, the paper disputes claims that depopulation is triggered by the actions of either the landowner or the planner. Drawing on case study material informed by critical realism, it argues that planners and landowners have been drawn into an asymmetrical power relationship. This has tended to buttress landed interests and, in so doing, reproduce mechanisms which protect the less populous communities from growth and change."

  11. Highly Reactive, Real-Time Planner for Aggressive 3D Aircraft Maneuvers to Avoid Unguided Threats

    DTIC Science & Technology

    2012-01-01

    Future plans are also described. Nomenclature PRM = Probabilistic Road Map PP = Path Planner RPG = Rocket Propelled Grenade UAV = Unmanned Aerial...NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7 . PERFORMING ORGANIZATION...to determine the feasible path, it does not pass these back, nor expect them to be used by the trajectory follower. The control settings are only

  12. P.A.C. Planner's Workbook. E.S.E.A. Title I. Revised.

    ERIC Educational Resources Information Center

    Davis, Chuck

    This workbook provides information and guidelines for planning and operating Parent Advisory Councils (P.A.C.s) provided for under the Elementary and Secondary Education Act Title I. The first part of the workbook, which was prepared for P.A.C. planners in the Phoenix, Arizona, Union High School District, is a month-by-month guide to P.A.C.…

  13. District heating from electric-generating plants and municipal incinerators: local planner's assessment guide

    SciTech Connect

    Pferdehirt, W.; Kron, N. Jr.

    1980-11-01

    This guide is designed to aid local government planners in the preliminary evaluation of the feasibility of district heating using heat recovered from electric generating plants and municipal incinerators. System feasibility is indicated by: (1) the existence of an adequate supply of nearby waste heat, (2) the presence of a sufficiently dense and large thermal load, and (3) a favorable cost comparison with conventional heating methods. 34 references.

  14. 30 CFR 585.600 - What plans and information must I submit to BOEM before I conduct activities on my lease or grant?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... must submit a SAP, COP, or GAP and receive BOEM approval as set forth in the following table: Before... approval for your SAP according to §§ 585.605 through 585.613. (b) conduct any activities pertaining...

  15. 30 CFR 285.607 - How do I submit my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I submit my SAP? 285.607 Section 285.607... Assessment Plan and Information Requirements for Commercial Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a)....

  16. Dynamic control of osmolality and ionic composition of the xylem sap in two mangrove species.

    PubMed

    López-Portillo, Jorge; Ewers, Frank W; Méndez-Alonzo, Rodrigo; Paredes López, Claudia L; Angeles, Guillermo; Alarcón Jiménez, Ana Luisa; Lara-Domínguez, Ana Laura; Torres Barrera, María Del Carmen

    2014-06-01

    • Premise of the study: Xylem sap osmolality and salinity is a critical unresolved issue in plant function with impacts on transport efficiency, pressure gradients, and living cell turgor pressure, especially for halophytes such as mangrove trees.• Methods: We collected successive xylem vessel sap samples from stems and shoots of Avicennia germinans and Laguncularia racemosa using vacuum and pressure extraction and measured their osmolality. Following a series of extractions with the pressure chamber, we depressurized the shoot and pressurized again after various equilibration periods (minutes to hours) to test for dynamic control of osmolality. Transpiration and final sap osmolality were measured in shoots perfused with deionized water or different seawater dilutions.• Key results: For both species, the sap osmolality values of consecutive samples collected by vacuum extraction were stable and matched those of the initial samples extracted with the pressure chamber. Further extraction of samples with the pressure chamber decreased sap osmolality, suggesting reverse osmosis occurred. However, sap osmolalities increased when longer equilibration periods after sap extraction were allowed. Analysis of expressed sap with HPLC indicated a 1:1 relation between measured osmolality and the osmolality of the inorganic ions in the sap (mainly Na(+), K(+), and Cl(-)), suggesting no contamination by organic compounds. In stems perfused with deionized water, the sap osmolality increased to mimic the native sap osmolality.• Conclusions: Xylem sap osmolality and ionic contents are dynamically adjusted by mangroves and may help modulate turgor pressure, hydraulic conductivity, and water potential, thus being important for mangrove physiology, survival, and distribution.

  17. Chronological Sequence of Leaf Phenology, Xylem and Phloem Formation and Sap Flow of Quercus pubescens from Abandoned Karst Grasslands

    PubMed Central

    Lavrič, Martina; Eler, Klemen; Ferlan, Mitja; Vodnik, Dominik; Gričar, Jožica

    2017-01-01

    Intra-annual variations in leaf development, radial growth, including the phloem part, and sap flow have rarely been studied in deciduous trees from drought-prone environments. In order to understand better the chronological order and temporal course of these processes, we monitored leaf phenology, xylem and phloem formation and sap flow in Quercus pubescens from abandoned karst grasslands in Slovenia during the growing season of 2014. We found that the initial earlywood vessel formation started before bud opening at the beginning of April. Buds started to open in the second half of April and full leaf unfolding occurred by the end of May. LAI values increased correspondingly with leaf development. About 28% of xylem and 22% of phloem annual increment were formed by the time of bud break. Initial earlywood vessels were fully lignified and ready for water transport, indicating that they are essential to provide hydraulic conductivity for axial water flow during leaf development. Sap flow became active and increasing contemporarily with leaf development and LAI values. Similar early spring patterns of xylem sap flow and LAI denoted that water transport in oaks broadly followed canopy leaf area development. In the initial 3 weeks of radial growth, phloem growth preceded that of xylem, indicating its priority over xylem at the beginning of the growing season. This may be related to the fact that after bud break, the developing foliage is a very large sink for carbohydrates but, at the same time, represents a small transpirational area. Whether the interdependence of the chronological sequence of the studied processes is fixed in Q. pubescens needs to be confirmed with more data and several years of analyses, although the ‘correct sequence’ of processes is essential for synchronized plant performance and response to environmental stress. PMID:28321232

  18. Nizwaside: a new anticancer pregnane glycoside from the sap of Desmidorchis flava.

    PubMed

    Hussain, Hidayat; Raees, Muhammad Adil; Rehman, Najeeb Ur; Al-Rawahi, Ahmed; Csuk, René; Khan, Husain Yar; Abbas, Ghulam; Al-Broumi, Mohammed Abdullah; Green, Ivan R; Elyassi, Ali; Mahmood, Talat; Al-Harrasi, Ahmed

    2015-12-01

    The sap from the succulent Desmidorchis flava (N.E.Br) Meve and Liede yielded a new pregnane glycoside, named nizwaside whose structure was established using 1D and 2D NMR techniques as well as mass spectrometry (ESIMS). Nizwaside was tested for anticancer, DPPH antioxidant, urease enzyme inhibition, α-glucosidase enzyme inhibition and acetylcholinesterase inhibition activities. Interestingly, nizwaside showed significant anti-proliferative effects on MDA MB231 breast cancer cells with an IC(50) of 23.5 µg/ml. Moreover, nizwaside was more effective than Doxorubicin, a well-known clinical anticancer drug, in suppressing MDA MB231 cell proliferation even at concentrations lower than that of Doxorubicin (75 µg/ml nizwaside vs. 100 µg/ml Doxorubicin). On the other hand, nizwaside showed relatively weak antioxidant activity with 15 % inhibition.

  19. Research for Stakeholders: Delivering the ShakeOut Earthquake Scenario to Golden Guardian Emergency Exercise Planners

    NASA Astrophysics Data System (ADS)

    Perry, S. C.; Holbrook, C. C.

    2008-12-01

    The ShakeOut Scenario of a magnitude 7.8 earthquake on the southern San Andreas Fault was developed to fit needs of end users, particularly emergency managers at Federal, State, and local levels. Customization has continued after initial publication. The Scenario, a collaboration among some 300 experts in physical and social sciences, engineering, and industry, was released in May, 2008, to a key planning conference for the November 2008 Golden Guardian Exercise series. According to long-standing observers, the 2008 exercise is the most ambitious of their experience. The scientific foundation has attracted a large number of participants and there are already requests to continue use of the Scenario in 2009. Successful exercises cover a limited range of capabilities, in order to test performance in measurable ways, and to train staff without overwhelming them. Any one exercise would fail if it attempted to capture the complexity of impacts from a major earthquake. Instead, exercise planners have used the Scenario like a magnifying glass to identify risk and capabilities most critical to their own jurisdictions. Presentations by Scenario scientists and a 16-page narrative provided an initial overview. However, many planners were daunted in attempts to extract details from a 300-page report, 12 supplemental studies, and 10 appendices, or in attempts to cast the reality into straightforward events to drive successful exercises. Thus we developed an evolving collection of documents, presentations, and consultations that included impacts to specific jurisdictions; distillations of damages and consequences; and annotated lists of capabilities and situations to consider. Some exercise planners needed realistic extrapolations beyond posited damages; others sought reality checks; yet others needed new formats or perspectives. Through all this, it was essential to maintain flexibility, assisting planners to adjust findings where appropriate, while indicating why some results

  20. Interactive ion-mediated sap flow regulation in olive and laurel stems: physicochemical characteristics of water transport via the pit structure.

    PubMed

    Ryu, Jeongeun; Ahn, Sungsook; Kim, Seung-Gon; Kim, TaeJoo; Lee, Sang Joon

    2014-01-01

    Sap water is distributed and utilized through xylem conduits, which are vascular networks of inert pipes important for plant survival. Interestingly, plants can actively regulate water transport using ion-mediated responses and adapt to environmental changes. However, ionic effects on active water transport in vascular plants remain unclear. In this report, the interactive ionic effects on sap transport were systematically investigated for the first time by visualizing the uptake process of ionic solutions of different ion compositions (K+/Ca2+) using synchrotron X-ray and neutron imaging techniques. Ionic solutions with lower K+/Ca2+ ratios induced an increased sap flow rate in stems of Olea europaea L. and Laurus nobilis L. The different ascent rates of ionic solutions depending on K+/Ca2+ ratios at a fixed total concentration increases our understanding of ion-responsiveness in plants from a physicochemical standpoint. Based on these results, effective structural changes in the pit membrane were observed using varying ionic ratios of K+/Ca2+. The formation of electrostatically induced hydrodynamic layers and the ion-responsiveness of hydrogel structures based on Hofmeister series increase our understanding of the mechanism of ion-mediated sap flow control in plants.

  1. Interactive Ion-Mediated Sap Flow Regulation in Olive and Laurel Stems: Physicochemical Characteristics of Water Transport via the Pit Structure

    PubMed Central

    Ryu, Jeongeun; Ahn, Sungsook; Kim, Seung-Gon; Kim, TaeJoo; Lee, Sang Joon

    2014-01-01

    Sap water is distributed and utilized through xylem conduits, which are vascular networks of inert pipes important for plant survival. Interestingly, plants can actively regulate water transport using ion-mediated responses and adapt to environmental changes. However, ionic effects on active water transport in vascular plants remain unclear. In this report, the interactive ionic effects on sap transport were systematically investigated for the first time by visualizing the uptake process of ionic solutions of different ion compositions (K+/Ca2+) using synchrotron X-ray and neutron imaging techniques. Ionic solutions with lower K+/Ca2+ ratios induced an increased sap flow rate in stems of Olea europaea L. and Laurus nobilis L. The different ascent rates of ionic solutions depending on K+/Ca2+ ratios at a fixed total concentration increases our understanding of ion-responsiveness in plants from a physicochemical standpoint. Based on these results, effective structural changes in the pit membrane were observed using varying ionic ratios of K+/Ca2+. The formation of electrostatically induced hydrodynamic layers and the ion-responsiveness of hydrogel structures based on Hofmeister series increase our understanding of the mechanism of ion-mediated sap flow control in plants. PMID:24852943

  2. Sap flow measurements to determine the transpiration of facade greenings

    NASA Astrophysics Data System (ADS)

    Hölscher, Marie-Therese; Nehls, Thomas; Wessolek, Gerd

    2014-05-01

    Facade greening is expected to make a major contribution to the mitigation of the urban heat-island effect through transpiration cooling, thermal insulation and shading of vertical built structures. However, no studies are available on water demand and the transpiration of urban vertical green. Such knowledge is needed as the plants must be sufficiently watered, otherwise the posited positive effects of vertical green can turn into disadvantages when compared to a white wall. Within the framework of the German Research Group DFG FOR 1736 "Urban Climate and Heat Stress" this study aims to test the practicability of the sap flow technique for transpiration measurements of climbing plants and to obtain potential transpiration rates for the most commonly used species. Using sap flow measurements we determined the transpiration of Fallopia baldschuanica, Parthenocissus tricuspidata and Hedera helix in pot experiments (about 1 m high) during the hot summer period from August 17th to August 30th 2012 under indoor conditions. Sap flow measurements corresponded well to simultaneous weight measurement on a daily base (factor 1.19). Fallopia baldschuanica has the highest daily transpiration rate based on leaf area (1.6 mm d-1) and per base area (5.0 mm d-1). Parthenocissus tricuspidata and Hedera helix show transpiration rates of 3.5 and 0.4 mm d-1 (per base area). Through water shortage, transpiration strongly decreased and leaf temperature measured by infrared thermography increased by 1 K compared to a well watered plant. We transferred the technique to outdoor conditions and will present first results for facade greenings in the inner-city of Berlin for the hottest period in summer 2013.

  3. Spring sapping on the lower continental slope, offshore New Jersey

    USGS Publications Warehouse

    Robb, James M.

    1984-01-01

    Undersea discharge of ground water during periods of lower sea level may have eroded valleys on part of the lower continental slope, offshore New Jersey. Steep-headed basins, cliffed and terraced walls, and irregular courses of these valleys may have been produced by sapping of exposed near-horizontal Tertiary strata. Joints in Eocene calcareous rocks would have localized ground-water movement. Some karstlike features of the submarine topography and the outcrops suggest that solution of the calcareous rocks also took place.

  4. Ternary complex factors SAP-1 and Elk-1, but not net, are functionally equivalent in thymocyte development.

    PubMed

    Costello, Patrick; Nicolas, Robert; Willoughby, Jane; Wasylyk, Bohdan; Nordheim, Alfred; Treisman, Richard

    2010-07-15

    The ternary complex factors (TCFs; SAP-1, Elk-1, and Net) are serum response factor cofactors that share many functional properties and are coexpressed in many tissues. SAP-1, the predominant thymus TCF, is required for thymocyte positive selection. In this study, we assessed whether the different TCFs are functionally equivalent. Elk-1 deletion, but not the hypomorphic Net(delta) mutation, exacerbated the SAP-1 positive selection phenotype, but triply deficient thymocytes were no more defective than SAP-1(-/-) Elk-1(-/-) cells. Inactivation of the other TCFs did not affect SAP-1-independent processes, including beta-selection, regulatory T cell selection, and negative selection, although reduced marginal zone B cells were observed in SAP-1(-/-) Elk-1(-/-) animals. Ectopic expression of Elk-1, but not Net, rescued positive selection of SAP-1(-/-) thymocytes; thus, SAP-1 and Elk-1 are functionally equivalent in this system, and the SAP-1 null selection phenotype reflects only its high expression in the thymus. Array analysis of TCR-stimulated double-positive cells identified SAP-1-dependent inducible genes whose transcription was further impaired in SAP-1(-/-) Elk-1(-/-) cells; thus, these genes, which include Egr-1 and Egr-2, represent candidate mediators of positive selection. Chromatin immunoprecipitation revealed subtly different promoter targeting between the different TCFs. Ectopic expression of Egr-1 restored positive selection in SAP-1 null thymocytes, establishing it (and possibly other Egr family members) as the major effector for ERK-SAP-1 signaling in thymocyte positive selection.

  5. The fbpA/sapM Double Knock Out Strain of Mycobacterium tuberculosis Is Highly Attenuated and Immunogenic in Macrophages

    PubMed Central

    Saikolappan, Sankaralingam; Estrella, Jaymie; Sasindran, Smitha J.; Khan, Arshad; Armitige, Lisa Y.; Jagannath, Chinnaswamy; Dhandayuthapani, Subramanian

    2012-01-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is the leading cause of death due to bacterial infections in mankind, and BCG, an attenuated strain of Mycobacterium bovis, is an approved vaccine. BCG sequesters in immature phagosomes of antigen presenting cells (APCs), which do not fuse with lysosomes, leading to decreased antigen processing and reduced Th1 responses. However, an Mtb derived ΔfbpA attenuated mutant underwent limited phagosome maturation, enhanced immunogenicity and was as effective as BCG in protecting mice against TB. To facilitate phagosome maturation of ΔfbpA, we disrupted an additional gene sapM, which encodes for an acid phosphatase. Compared to the wild type Mtb, the ΔfbpAΔsapM (double knock out; DKO) strain was attenuated for growth in mouse macrophages and PMA activated human THP1 macrophages. Attenuation correlated with increased oxidants in macrophages in response to DKO infection and enhanced labeling of lysosomal markers (CD63 and rab7) on DKO phagosomes. An in vitro Antigen 85B peptide presentation assay was used to determine antigen presentation to T cells by APCs infected with DKO or other mycobacterial strains. This revealed that DKO infected APCs showed the strongest ability to present Ag85B to T cells (>2500 pgs/mL in 4 hrs) as compared to APCs infected with wild type Mtb or ΔfbpA or ΔsapM strain (<1000 pgs/mL in 4 hrs), indicating that DKO strain has enhanced immunogenicity than other strains. The ability of DKO to undergo lysosomal fusion and vacuolar acidification correlated with antigen presentation since bafilomycin, that inhibits acidification in APCs, reduced antigen presentation. Finally, the DKO vaccine elicited a better Th1 response in mice after subcutaneous vaccination than either ΔfbpA or ΔsapM. Since ΔfbpA has been used in mice as a candidate vaccine and the DKO (ΔfbpAΔsapM) mutant is more immunogenic than ΔfbpA, we propose the DKO is a potential anti-tuberculosis vaccine. PMID:22574140

  6. Effect of gender on sap-flux-scaled transpiration in a dominant riparian tree species: Box elder (Acer negundo)

    NASA Astrophysics Data System (ADS)

    Hultine, K. R.; Bush, S. E.; West, A. G.; Ehleringer, J. R.

    2007-09-01

    Acer negundo is a dioecious riparian tree species with a spatial segregation of the sexes along soil moisture gradients. Females are typically more common in wet sites along streams (typically F/M ≈ 1.6), whereas males are more common in drier sites away from streams (typically F/M ≈ 0.6). Spatial segregation between sexes may develop because of the higher reproductive cost in females compared to males. If so, female Acer negundo trees would be under stronger selection to maximize resource uptake, and would therefore likely occur at greater frequencies in high resources sites (i.e., along streamsides), and increase rates of resource acquisition (i.e., water and nutrients). The spatial segregation of the sexes leads to the hypothesis that male and female individuals have varying influence on ecosystem evapotranspiration. To address this, stem sap flux was measured on mature streamside (≤1 m from stream channel) and nonstreamside (>1 m from stream channel) male and female Acer negundo trees occurring in Red Butte Canyon near Salt Lake City, Utah, during the 2004 growing season. Despite having similar predawn and midday water potentials, sap flux density was 76% higher in streamside female trees than in males (P < 0.0001), while sap flux density was 19% greater in nonstreamside female trees compared to males (P < 0.0001). Mean daily sap flux density of all A. negundo populations was highly correlated with mean daily vapor pressure deficit (P < 0.0001), and was moderately correlated with mean daily photosynthetic active radiation (P = 0.0263). At the watershed scale, nonstreamside male and female A. negundo trees contributed 20 and 21% respectively to the estimated 1.7 mm d-1 transpiration flux from dominant riparian vegetation away from streamsides (estimated from scaled sap flux measurements of all dominant riparian tree species in Red Butte Canyon). Male and female A. negundo trees contributed 31 and 46% respectively of the estimated 8.0 mm d-1 transpiration

  7. The fbpA/sapM double knock out strain of Mycobacterium tuberculosis is highly attenuated and immunogenic in macrophages.

    PubMed

    Saikolappan, Sankaralingam; Estrella, Jaymie; Sasindran, Smitha J; Khan, Arshad; Armitige, Lisa Y; Jagannath, Chinnaswamy; Dhandayuthapani, Subramanian

    2012-01-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), is the leading cause of death due to bacterial infections in mankind, and BCG, an attenuated strain of Mycobacterium bovis, is an approved vaccine. BCG sequesters in immature phagosomes of antigen presenting cells (APCs), which do not fuse with lysosomes, leading to decreased antigen processing and reduced Th1 responses. However, an Mtb derived ΔfbpA attenuated mutant underwent limited phagosome maturation, enhanced immunogenicity and was as effective as BCG in protecting mice against TB. To facilitate phagosome maturation of ΔfbpA, we disrupted an additional gene sapM, which encodes for an acid phosphatase. Compared to the wild type Mtb, the ΔfbpAΔsapM (double knock out; DKO) strain was attenuated for growth in mouse macrophages and PMA activated human THP1 macrophages. Attenuation correlated with increased oxidants in macrophages in response to DKO infection and enhanced labeling of lysosomal markers (CD63 and rab7) on DKO phagosomes. An in vitro Antigen 85B peptide presentation assay was used to determine antigen presentation to T cells by APCs infected with DKO or other mycobacterial strains. This revealed that DKO infected APCs showed the strongest ability to present Ag85B to T cells (>2500 pgs/mL in 4 hrs) as compared to APCs infected with wild type Mtb or ΔfbpA or ΔsapM strain (<1000 pgs/mL in 4 hrs), indicating that DKO strain has enhanced immunogenicity than other strains. The ability of DKO to undergo lysosomal fusion and vacuolar acidification correlated with antigen presentation since bafilomycin, that inhibits acidification in APCs, reduced antigen presentation. Finally, the DKO vaccine elicited a better Th1 response in mice after subcutaneous vaccination than either ΔfbpA or ΔsapM. Since ΔfbpA has been used in mice as a candidate vaccine and the DKO (ΔfbpAΔsapM) mutant is more immunogenic than ΔfbpA, we propose the DKO is a potential anti-tuberculosis vaccine.

  8. Serum amyloid P component bound to gram-negative bacteria prevents lipopolysaccharide-mediated classical pathway complement activation.

    PubMed

    de Haas, C J; van Leeuwen, E M; van Bommel, T; Verhoef, J; van Kessel, K P; van Strijp, J A

    2000-04-01

    Although serum amyloid P component (SAP) is known to bind many ligands, its biological function is not yet clear. Recently, it was demonstrated that SAP binds to lipopolysaccharide (LPS). In the present study, SAP was shown to bind to gram-negative bacteria expressing short types of LPS or lipo-oligosaccharide (LOS), such as Salmonella enterica serovar Copenhagen Re and Escherichia coli J5, and also to clinical isolates of Haemophilus influenzae. It was hypothesized that SAP binds to the bacteria via the lipid A part of LPS or LOS, since the htrB mutant of the nontypeable H. influenzae strain NTHi 2019-B29-3, which expresses a nonacetylated lipid A, did not bind SAP. This was in contrast to the parental strain NTHi 2019. The binding of SAP resulted in a clear inhibition of the deposition of complement component C3 on the bacteria. SAP inhibited only the activation of the classical complement pathway; the alternative route remained unaffected. In the classical route, SAP prevented the deposition of the first complement component, Clq, probably by interfering with the binding of Clq to LPS. Since antibody-mediated Clq activation was not inhibited by SAP, SAP seems to inhibit only the LPS-induced classical complement pathway activation. The SAP-induced inhibition of C3 deposition strongly diminished the complement-mediated lysis as well as the phagocytosis of the bacteria. The binding of SAP to gram-negative bacteria, therefore, might influence the pathophysiology of an infection with such bacteria.

  9. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  10. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  11. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  12. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  13. 49 CFR 40.299 - What is the SAP's role and what are the limits on a SAP's discretion in referring employees for...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty Process § 40.299 What is the SAP's... insurance program (e.g., the single substance abuse in-patient treatment program made available by...

  14. Introduction of Sap ERP System Into a Heterogeneous Academic Community

    NASA Astrophysics Data System (ADS)

    Mornar, Vedran; Fertalj, Krešimir; Kalpić, Damir

    2010-06-01

    Introduction of a complex ERP system like SAP into a heterogeneous academic environment like the University of Zagreb is far from being a trivial task. The University comprises more than 30 constituents, called faculties or academies, geographically dispersed, with long and specific traditions. Financing according to the lump sum principle, enforced in Croatia as a side effect of the in Europe obligatory and omnipresent Bologna process, requires a unified view on the educational institutions in order to provide a more just and appropriate financing scheme than the current one. After the experience with own development to support educational tasks and student administration, for standard financial and administration tasks SAP has been chosen as the most appropriate platform. The developer was selected after public bidding and the authors' institution was chosen for the pilot project. The authors were playing principal roles in the process of successful deployment and still expect to offer their expertise for implementation in the rest of the University. However, serious risks stemming from lack of motivation by some constituents are present.

  15. Handling of the demilitarized zone using service providers in SAP

    NASA Astrophysics Data System (ADS)

    Iovan, A.; Robu, R.

    2016-02-01

    External collaboration needs to allow data access from the Internet. In a trusted Internet collaboration scenario where the external user works on the same data like the internal user direct access to the data in the Intranet is required. The paper presents a solution to get access to certain data in the Enterprise Resource Planning system, having the User Interface on a system in the Demilitarized Zone and the database on a system which is located in the trusted area. Using the Service Provider Interface framework, connections between separate systems can be created in different areas of the network. The paper demonstrates how to connect the two systems, one in the Demilitarized Zone and one in the trusted area, using SAP ERP 6.0 with Enhancement Package 7. In order to use the Service Provider Interface SAP Business Suite Foundation component must be installed in both systems. The advantage of using the Service Provider Interface framework is that the external user works on the same data like the internal user (and not on copies). This assures data consistency and less overhead for backup and security systems.

  16. The Holocene history and development of the Tonle Sap, Cambodia

    NASA Astrophysics Data System (ADS)

    Penny, Dan

    2006-02-01

    The Tonle Sap, the 'Great Lake' of central Cambodia, is the central component of wetland ecosystems in the lower Mekong River basin, and is of enormous conservation value. The lake's unusual hydraulic relationship with the Mekong River, and its consequent sensitivity to monsoon variability, makes the Tonle Sap sensitive to climate change. Exploring the dynamics and development of this system under different climate regimes of the past offers a perspective on possible future impacts, which is critical for sound management. Biostratigraphic and sedimentological data derived from cores of lake sediment indicate that during the period >7000 to ca. 5500 14C years Before Present the lake was less variable than present in terms of depth during the annual cycle of flood, and may have been strongly influenced by saline tidal waters associated with higher-than-present seas levels. As regional environments became drier and more seasonal in the late Holocene, more sediment was re-suspended during the increasingly marked dry season lake level minimum, lowering the effective sediment accumulation rate. Contrary to current interpretations of the history of the lake and associated wetland ecosystems, the data presented here imply that regional hydraulic connections between the lake and the Mekong River existed from at least the early Holocene.

  17. Transport of resistance-inducing sterols in phloem sap of barley.

    PubMed

    Lehrer, A T; Dugassa-Gobena, D; Vidal, S; Seifert, K

    2000-01-01

    After root application of [7alpha-3H]-7beta-hydroxysitosterol and [3alpha,6beta-3H2]-6alpha-hydroxylathosterol these sterols could be detected in the leaves and phloem sap feeding aphids. These results imply that the phloem sap is a sterol transport system in barley plants.

  18. Subcellular targeting and cytoskeletal attachment of SAP97 to the epithelial lateral membrane.

    PubMed

    Wu, H; Reuver, S M; Kuhlendahl, S; Chung, W J; Garner, C C

    1998-08-01

    The synapse-associated protein SAP97 is a member of a novel family of cortical cytoskeletal proteins involved in the localization of ion channels at such membrane specializations as synaptic junctions. These multidomain proteins have binding sites for protein 4.1, GKAPs/SAPAPs, voltage- and ligand-gated ion channels and cell-adhesion molecules containing C-terminal T/SXV motifs. In this study, we evaluated the contribution of individual domains in SAP97 to its selective recruitment and attachment to the cortical cytoskeleton in epithelial cells. We find that the PDZ, SH3 and GK domains, as well as the I3 insert in SAP97, are not essential for subcellular targeting, though both PDZ1-2 domains and the I3 insert affect the efficiency of localization. Instead, we show that the first 65 amino acid residues in SAP97, which are absent from SAP90/PSD-95 and SAP102, direct the selective subcellular localization and can mediate at least one point of attachment of SAP97 to the cytoskeleton assembled at sites of cell-cell contact. Our data demonstrate that it is the sequences unique to SAP97 that direct its subcellular targeting to the epithelial lateral membrane.

  19. Ethanol and lactic acid production using sap squeezed from old oil palm trunks felled for replanting.

    PubMed

    Kosugi, Akihiko; Tanaka, Ryohei; Magara, Kengo; Murata, Yoshinori; Arai, Takamitsu; Sulaiman, Othman; Hashim, Rokiah; Hamid, Zubaidah Aimi Abdul; Yahya, Mohd Khairul Azri; Yusof, Mohd Nor Mohd; Ibrahim, Wan Asma; Mori, Yutaka

    2010-09-01

    Old oil palm trunks that had been felled for replanting were found to contain large quantities of high glucose content sap. Notably, the sap in the inner part of the trunk accounted for more than 80% of the whole trunk weight. The glucose concentration of the sap from the inner part was 85.2g/L and decreased towards the outer part. Other sugars found in relatively low concentrations were sucrose, fructose, galactose, xylose, and rhamnose. In addition, oil palm sap was found to be rich in various kinds of amino acids, organic acids, minerals and vitamins. Based on these findings, we fermented the sap to produce ethanol using the sake brewing yeast strain, Saccharomyces cerevisiae Kyokai no.7. Ethanol was produced from the sap without the addition of nutrients, at a comparable rate and yield to the reference fermentation on YPD medium with glucose as a carbon source. Likewise, we produced lactic acid, a promising material for bio-plastics, poly-lactate, from the sap using the homolactic acid bacterium Lactobacillus lactis ATCC19435. We confirmed that sugars contained in the sap were readily converted to lactic acid with almost the same efficiency as the reference fermentation on MSR medium with glucose as a substrate. These results indicate that oil palm trunks felled for replanting are a significant resource for the production of fuel ethanol and lactic acid in palm oil-producing countries such as Malaysia and Indonesia.

  20. SAP: structure, function, and its roles in immune-related diseases.

    PubMed

    Xi, Dan; Luo, TianTian; Xiong, Haowei; Liu, Jichen; Lu, Hao; Li, Menghao; Hou, Yuqing; Guo, Zhigang

    2015-01-01

    Serum amyloid P component (SAP), also known as pentraxin-2, is a member of the pentraxin protein family with an established relationship to the immune response. In the last century, SAP has been used as a diagnostic marker in amyloidosis diagnosis and patient follow-up. SAP has been thought to have potential for treating and curing amyloidosis and fibrosis diseases. More recently, it has been shown that SAP may serve as both a diagnostic marker and a therapeutic target for many immune-related diseases, such as cardiovascular, pulmonary, nephritic, neurological and autoimmune diseases. In the cardiovascular system, SAP has been defined as the culprit in amyloidosis in the heart. SAP may also exert a protective role during the early stage of atherosclerosis and myocardial fibrosis. In noncardiovascular system diseases, SAP is being developed for the treatment of pulmonary fibrosis. In this review, we summarize SAP history, structure, and its roles in immune-related diseases in different systems with emphasis on the cardiovascular system.

  1. Circadian patterns of xylem sap properties and their covariation with plant hydraulic traits in hybrid aspen.

    PubMed

    Meitern, Annika; Õunapuu-Pikas, Eele; Sellin, Arne

    2017-03-22

    Physiological processes taking place in plants are subject to diverse circadian patterns but some of them are poorly documented in natural conditions. The daily dynamics of physico-chemical properties of xylem sap and their covariation with tree hydraulic traits were investigated in hybrid aspen (Populus tremula L.×P. tremuloides Michx) in field conditions in order to clarify which environmental drivers govern the daily variation in these parameters. K(+) concentration ([K(+)]), electrical conductivity (σsap), osmolality (Osm) and pH of the xylem sap, as well as branch hydraulic traits, were measured in the field over 24-h cycles. All studied xylem sap properties and hydraulic characteristics including whole-branch (Kwb), leaf blade (Klb) and petiole hydraulic conductances (KP) showed clear daily dynamics. Air temperature (TA) and photosynthetic photon flux density (PPFD), but also water vapour pressure deficit (VPD) and relative humidity (RH), had significant impacts on KwbKlb, KP, [K(+)] and σsap. Osm varied only with light intensity, while KB varied depending on atmospheric evaporative demand expressed as TA, VPD or RH. Xylem sap pH depended inversely on soil water potential (ΨS) and during daylight also on VPD. Although soil water content was close to saturation during the study period, ΨS influenced also [K(+)] and σsap. The present study presents evidence of coupling between circadian patterns of xylem sap properties and plant hydraulic conductance providing adequate water supply to foliage under environmental conditions characterised by diurnal variation.

  2. Using Sap Flow Monitoring for Improved Process-based Ecohydrologic Understanding 2022

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sap flow measurements can be an important tool for unraveling the complex web of ecosystem fluxes, especially when it is combined with other measurements like eddy covariance, isotopes, remote sensing, etc. In this talk, we will demonstrate how sap flow measurements have improved our process-level u...

  3. Comparative transcriptome analysis of Gossypium hirsutum L. in response to sap sucking insects: aphid and whitefly

    PubMed Central

    2013-01-01

    Background Cotton (Gossypium hirsutum L.) is a major fiber crop that is grown worldwide; it faces extensive damage from sap-sucking insects, including aphids and whiteflies. Genome-wide transcriptome analysis was performed to understand the molecular details of interaction between Gossypium hirsutum L. and sap-sucking pests, namely Aphis gossypii (Aphid) and Bemisia tabacci (Whiteflies). Roche’s GS-Titanium was used to sequence transcriptomes of cotton infested with aphids and whiteflies for 2 h and 24 h. Results A total of 100935 contigs were produced with an average length of 529 bp after an assembly in all five selected conditions. The Blastn of the non-redundant (nr) cotton EST database resulted in the identification of 580 novel contigs in the cotton plant. It should be noted that in spite of minimal physical damage caused by the sap-sucking insects, they can change the gene expression of plants in 2 h of infestation; further change in gene expression due to whiteflies is quicker than due to aphids. The impact of the whitefly 24 h after infestation was more or less similar to that of the aphid 2 h after infestation. Aphids and whiteflies affect many genes that are regulated by various phytohormones and in response to microbial infection, indicating the involvement of complex crosstalk between these pathways. The KOBAS analysis of differentially regulated transcripts in response to aphids and whiteflies indicated that both the insects induce the metabolism of amino acids biosynthesis specially in case of whiteflies infestation at later phase. Further we also observed that expression of transcript related to photosynthesis specially carbon fixation were significantly influenced by infestation of Aphids and Whiteflies. Conclusions A comparison of different transcriptomes leads to the identification of differentially and temporally regulated transcripts in response to infestation by aphids and whiteflies. Most of these differentially expressed contigs were

  4. Optimizing marketing intervention strategies in the obesogenic environment: REACH FAR, the eight criteria for program planners.

    PubMed

    Harker, Michael; Harker, Debra; Burns, Robert

    2008-01-01

    Obesity is a significant problem for most industrialised nations and an emerging one for developing nations (Organisation for Economic Co-operation and Development 2005). Childhood obesity is of particular concern. This paper, using systematic review procedures, has analysed the intervention strategies used to fight the obesity battle over the past twenty years. For a number of reasons the effectiveness of many intervention strategies was found wanting whilst a minority of cases studied were sound. These cases were analysed and a set of principles developed that could deliver improved processes and outcomes to the problems encountered by planners in the complex obesogenic environment.

  5. On designing geometric motion planners to solve regulating and trajectory tracking problems for robotic locomotion systems.

    PubMed

    Asnafi, Alireza; Mahzoon, Mojtaba

    2011-09-01

    Based on a geometric fiber bundle structure, a generalized method to solve both regulation and trajectory tracking problems for locomotion systems is presented. The method is especially applied to two case studies of robotic locomotion systems; a three link articulated fish-like robot as a prototype of locomotion systems with symmetry, and the snakeboard as a prototype of mixed locomotion systems. Our results show that although these motion planners have an open loop structure, due to their generalities, they can steer case studies with negligible errors for almost any complicated path.

  6. Morphology of large valleys on Hawaii - Evidence for groundwater sapping and comparisons with Martian valleys

    NASA Technical Reports Server (NTRS)

    Kochel, R. Craig; Piper, Jonathan F.

    1986-01-01

    Morphometric data on the runoff and sapping valleys on the slopes of Hawaii and Molokai in Hawaii are analyzed. The analysis reveals a clear distinction between the runoff valleys and sapping valleys. The Hawaiian sapping valleys are characterized by: (1) steep valley walls and flat floors, (2) amphitheater heads, (3) low drainage density, (4) paucity of downstream tributaries, (5) low frequency of up-dip tributaries, and (6) structural and stratigraphic control on valley patterns. The characteristics of the Hawaiian sapping valleys are compared to Martian valleys and experimental systems, and good correlation between the data is detected. Flume experiments were also conducted to study the evolution of sapping valleys in response to variable structure and stratigraphy.

  7. Variation in mineral content of red maple sap across an atmospheric deposition gradient

    SciTech Connect

    McCormick, L.H.

    1997-11-01

    Xylem sap was collected from red maple (Acer rubrum L.) trees during the spring of 1988 and 1989 at seven forest sites along an atmospheric deposition gradient in north central Pennsylvania and analyzed for pH and twelve mineral constituents. The objectives of the study were to examine the sources and patterns of variation in red maple sap chemistry across an atmospheric deposition gradient and to assess the feasibility of using sap analysis as an indicator of nutrient bioavailability. For most sap constituents, there was considerable spatial and temporal variation in concentration. Sources of variation included within and between site variation, date, and year of collection. The nature and extent of variation varied for different constituents. Site differences were similar in 1988 and 1989 for most sap constituents and for some constituents corresponded with differences in soil levels.

  8. Redox‐dependent disulfide bond formation in SAP30L corepressor protein: Implications for structure and function

    PubMed Central

    Laitaoja, Mikko; Tossavainen, Helena; Pihlajamaa, Tero; Valjakka, Jarkko; Viiri, Keijo; Lohi, Olli; Permi, Perttu

    2015-01-01

    Abstract Sin3A‐associated protein 30‐like (SAP30L) is one of the key proteins in a multi‐subunit protein complex involved in transcriptional regulation via histone deacetylation. SAP30L, together with a highly homologous SAP30 as well as other SAP proteins (i.e., SAP25, SAP45, SAP130, and SAP180), is an essential component of the Sin3A corepressor complex, although its actual role has remained elusive. SAP30L is thought to function as an important stabilizing and bridging molecule in the complex and to mediate its interactions with other corepressors. SAP30L has been previously shown to contain an N‐terminal Cys3His type zinc finger (ZnF) motif, which is responsible for the key protein–protein, protein–DNA, and protein–lipid interactions. By using high‐resolution mass spectrometry, we studied a redox‐dependent disulfide bond formation in SAP30L ZnF as a regulatory mechanism for its structure and function. We showed that upon oxidative stress SAP30L undergoes the formation of two specific disulfide bonds, a vicinal Cys29‐Cys30 and Cys38‐Cys74, with a concomitant release of the coordinated zinc ion. The oxidized protein was shown to remain folded in solution and to bind signaling phospholipids. We also determined a solution NMR structure for SAP30L ZnF that showed an overall fold similar to that of SAP30, determined earlier. The NMR titration experiments with lipids and DNA showed that the binding is mediated by the C‐terminal tail as well as both α‐helices of SAP30L ZnF. The implications of these results for the structure and function of SAP30L are discussed. PMID:26609676

  9. Collection and Chemical Composition of Phloem Sap from Citrus sinensis L. Osbeck (Sweet Orange)

    PubMed Central

    Hijaz, Faraj; Killiny, Nabil

    2014-01-01

    Through utilizing the nutrient-rich phloem sap, sap feeding insects such as psyllids, leafhoppers, and aphids can transmit many phloem-restricted pathogens. On the other hand, multiplication of phloem-limited, uncultivated bacteria such as Candidatus Liberibacter asiaticus (CLas) inside the phloem of citrus indicates that the sap contains all the essential nutrients needed for the pathogen growth. The phloem sap composition of many plants has been studied; however, to our knowledge, there is no available data about citrus phloem sap. In this study, we identified and quantified the chemical components of phloem sap from pineapple sweet orange. Two approaches (EDTA enhanced exudation and centrifugation) were used to collect phloem sap. The collected sap was derivatized with methyl chloroformate (MCF), N-methyl-N- [tert-butyl dimethylsilyl]-trifluroacetamide (MTBSTFA), or trimethylsilyl (TMS) and analyzed with GC-MS revealing 20 amino acids and 8 sugars. Proline, the most abundant amino acid, composed more than 60% of the total amino acids. Tryptophan, tyrosine, leucine, isoleucine, and valine, which are considered essential for phloem sap-sucking insects, were also detected. Sucrose, glucose, fructose, and inositol were the most predominant sugars. In addition, seven organic acids including succinic, fumaric, malic, maleic, threonic, citric, and quinic were detected. All compounds detected in the EDTA-enhanced exudate were also detected in the pure phloem sap using centrifugation. The centrifugation technique allowed estimating the concentration of metabolites. This information expands our knowledge about the nutrition requirement for citrus phloem-limited bacterial pathogen and their vectors, and can help define suitable artificial media to culture them. PMID:25014027

  10. Collection and chemical composition of phloem sap from Citrus sinensis L. Osbeck (sweet orange).

    PubMed

    Hijaz, Faraj; Killiny, Nabil

    2014-01-01

    Through utilizing the nutrient-rich phloem sap, sap feeding insects such as psyllids, leafhoppers, and aphids can transmit many phloem-restricted pathogens. On the other hand, multiplication of phloem-limited, uncultivated bacteria such as Candidatus Liberibacter asiaticus (CLas) inside the phloem of citrus indicates that the sap contains all the essential nutrients needed for the pathogen growth. The phloem sap composition of many plants has been studied; however, to our knowledge, there is no available data about citrus phloem sap. In this study, we identified and quantified the chemical components of phloem sap from pineapple sweet orange. Two approaches (EDTA enhanced exudation and centrifugation) were used to collect phloem sap. The collected sap was derivatized with methyl chloroformate (MCF), N-methyl-N- [tert-butyl dimethylsilyl]-trifluroacetamide (MTBSTFA), or trimethylsilyl (TMS) and analyzed with GC-MS revealing 20 amino acids and 8 sugars. Proline, the most abundant amino acid, composed more than 60% of the total amino acids. Tryptophan, tyrosine, leucine, isoleucine, and valine, which are considered essential for phloem sap-sucking insects, were also detected. Sucrose, glucose, fructose, and inositol were the most predominant sugars. In addition, seven organic acids including succinic, fumaric, malic, maleic, threonic, citric, and quinic were detected. All compounds detected in the EDTA-enhanced exudate were also detected in the pure phloem sap using centrifugation. The centrifugation technique allowed estimating the concentration of metabolites. This information expands our knowledge about the nutrition requirement for citrus phloem-limited bacterial pathogen and their vectors, and can help define suitable artificial media to culture them.

  11. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  12. 30 CFR 585.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false How will my SAP be processed for Federal... Plan § 585.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on how your commercial lease was issued: If your...

  13. 30 CFR 285.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 285.902 Section 285.902 Mineral Resources... facilities authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by MMS under § 285.909...) Before decommissioning the facilities under your SAP, COP, or GAP, you must submit a...

  14. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  15. 30 CFR 585.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 585.902 Section 585.902 Mineral Resources... authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by BOEM under § 585.909, within 2... decommissioning the facilities under your SAP, COP, or GAP, you must submit a decommissioning application...

  16. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  17. 30 CFR 585.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false How will my SAP be processed for Federal... Plan § 585.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on how your commercial lease was issued: If your...

  18. 30 CFR 285.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will my SAP be processed for Federal... Plan § 285.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on how your commercial lease was issued: ER29AP09.118...

  19. 30 CFR 285.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false How will my SAP be processed for Federal... Contents of the Site Assessment Plan § 285.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on how your commercial lease...

  20. 30 CFR 585.612 - How will my SAP be processed for Federal consistency under the Coastal Zone Management Act?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false How will my SAP be processed for Federal... Plan § 585.612 How will my SAP be processed for Federal consistency under the Coastal Zone Management Act? Your SAP will be processed based on whether it is submitted before or after your lease is...

  1. 30 CFR 585.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 585.902 Section 585.902 Mineral Resources... authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by BOEM under § 585.909, within 2... decommissioning the facilities under your SAP, COP, or GAP, you must submit a decommissioning application...

  2. 30 CFR 285.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 285.902 Section 285.902 Mineral Resources... SAP, COP, or GAP? (a) Except as otherwise authorized by MMS under § 285.909, within 2 years following... under your SAP, COP, or GAP, you must submit a decommissioning application and receive approval from...

  3. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  4. 49 CFR 40.303 - What happens if the SAP believes the employee needs additional treatment, aftercare, or support...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What happens if the SAP believes the employee... the Return-to-Duty Process § 40.303 What happens if the SAP believes the employee needs additional...? (a) As a SAP, if you believe that ongoing services (in addition to follow-up tests) are needed...

  5. 2B4-SAP signaling is required for the priming of naive CD8(+) T cells by antigen-expressing B cells and B lymphoma cells.

    PubMed

    Huang, Yu-Hsuan; Tsai, Kevin; Tan, Sara Y; Kang, Sohyeong; Ford, Mandy L; Harder, Kenneth W; Priatel, John J

    2017-01-01

    Mutations in SH2D1A gene that encodes SAP (SLAM-associated protein) result in X-linked lymphoproliferative disease (XLP), a rare primary immunodeficiency disease defined by exquisite sensitivity to the B-lymphotropic Epstein-Barr virus (EBV) and B cell lymphomas. However, the precise mechanism of how the loss of SAP function contributes to extreme vulnerability to EBV and the development of B cell lymphomas remains unclear. Here, we investigate the hypothesis that SAP is critical for CD8(+) T cell immune surveillance of antigen (Ag)-expressing B cells or B lymphoma cells under conditions of defined T cell receptor (TCR) signaling. Sh2d1a(-)(/)(-) CD8(+) T cells exhibited greatly diminished proliferation relative to wild type when Ag-presenting-B cells or -B lymphoma cells served as the primary Ag-presenting cell (APC). By contrast, Sh2d1a(-)(/)(-) CD8(+) T cells responded equivalently to wild-type CD8(+) T cells when B cell-depleted splenocytes, melanoma cells or breast carcinoma cells performed Ag presentation. Through application of signaling lymphocyte activation molecule (SLAM) family receptor blocking antibodies or SLAM family receptor-deficient CD8(+) T cells and APCs, we found that CD48 engagement on the B cell surface by 2B4 is crucial for initiating SAP-dependent signaling required for the Ag-driven CD8(+) T cell proliferation and differentiation. Altogether, a pivotal role for SAP in promoting the expansion and differentiation of B cell-primed viral-specific naive CD8(+) T cells may explain the selective immune deficiency of XLP patients to EBV and B cell lymphomas.

  6. Development and demonstration of an on-board mission planner for helicopters

    NASA Technical Reports Server (NTRS)

    Deutsch, Owen L.; Desai, Mukund

    1988-01-01

    Mission management tasks can be distributed within a planning hierarchy, where each level of the hierarchy addresses a scope of action, and associated time scale or planning horizon, and requirements for plan generation response time. The current work is focused on the far-field planning subproblem, with a scope and planning horizon encompassing the entire mission and with a response time required to be about two minutes. The far-feld planning problem is posed as a constrained optimization problem and algorithms and structural organizations are proposed for the solution. Algorithms are implemented in a developmental environment, and performance is assessed with respect to optimality and feasibility for the intended application and in comparison with alternative algorithms. This is done for the three major components of far-field planning: goal planning, waypoint path planning, and timeline management. It appears feasible to meet performance requirements on a 10 Mips flyable processor (dedicated to far-field planning) using a heuristically-guided simulated annealing technique for the goal planner, a modified A* search for the waypoint path planner, and a speed scheduling technique developed for this project.

  7. Drivers’ Visual Behavior-Guided RRT Motion Planner for Autonomous On-Road Driving

    PubMed Central

    Du, Mingbo; Mei, Tao; Liang, Huawei; Chen, Jiajia; Huang, Rulin; Zhao, Pan

    2016-01-01

    This paper describes a real-time motion planner based on the drivers’ visual behavior-guided rapidly exploring random tree (RRT) approach, which is applicable to on-road driving of autonomous vehicles. The primary novelty is in the use of the guidance of drivers’ visual search behavior in the framework of RRT motion planner. RRT is an incremental sampling-based method that is widely used to solve the robotic motion planning problems. However, RRT is often unreliable in a number of practical applications such as autonomous vehicles used for on-road driving because of the unnatural trajectory, useless sampling, and slow exploration. To address these problems, we present an interesting RRT algorithm that introduces an effective guided sampling strategy based on the drivers’ visual search behavior on road and a continuous-curvature smooth method based on B-spline. The proposed algorithm is implemented on a real autonomous vehicle and verified against several different traffic scenarios. A large number of the experimental results demonstrate that our algorithm is feasible and efficient for on-road autonomous driving. Furthermore, the comparative test and statistical analyses illustrate that its excellent performance is superior to other previous algorithms. PMID:26784203

  8. Drivers' Visual Behavior-Guided RRT Motion Planner for Autonomous On-Road Driving.

    PubMed

    Du, Mingbo; Mei, Tao; Liang, Huawei; Chen, Jiajia; Huang, Rulin; Zhao, Pan

    2016-01-15

    This paper describes a real-time motion planner based on the drivers' visual behavior-guided rapidly exploring random tree (RRT) approach, which is applicable to on-road driving of autonomous vehicles. The primary novelty is in the use of the guidance of drivers' visual search behavior in the framework of RRT motion planner. RRT is an incremental sampling-based method that is widely used to solve the robotic motion planning problems. However, RRT is often unreliable in a number of practical applications such as autonomous vehicles used for on-road driving because of the unnatural trajectory, useless sampling, and slow exploration. To address these problems, we present an interesting RRT algorithm that introduces an effective guided sampling strategy based on the drivers' visual search behavior on road and a continuous-curvature smooth method based on B-spline. The proposed algorithm is implemented on a real autonomous vehicle and verified against several different traffic scenarios. A large number of the experimental results demonstrate that our algorithm is feasible and efficient for on-road autonomous driving. Furthermore, the comparative test and statistical analyses illustrate that its excellent performance is superior to other previous algorithms.

  9. [Antimicrobial activity of Calendula L. plants].

    PubMed

    Radioza, S A; Iurchak, L D

    2007-01-01

    The sap of different organs of genus Calendula plant species has been studied for antimicrobial activity. The sap of racemes demonstrated the most expressed antimicrobial effect while that of the roots - the least one. Calendula species inhibited all tested pathogenic microorganisms, especially Pseudomonas syringae, P. fluorescens, Xanthomonas campestris, Agrobacterium tumefaciens. Calendula suffruticosa was the most active to all investigated microorganisms.

  10. Observation of intravascular changes of superabsorbent polymer microsphere (SAP-MS) with monochromatic X-ray imaging.

    PubMed

    Tanimoto, Daigo; Ito, Katsuyoshi; Yamamoto, Akira; Sone, Teruki; Kobatake, Makito; Tamada, Tsutomu; Umetani, Keiji

    2010-10-01

    This study was designed to evaluate the intravascular transformation behavior of superabsorbent polymer microsphere (SAP-MS) in vivo macroscopically by using monochromatic X-ray imaging and to quantitatively compare the expansion rate of SAP-MS among different kinds of mixtures. Fifteen rabbits were used for our study and transcatheter arterial embolization (TAE) was performed for their auricular arteries using monochromatic X-ray imaging. We used three kinds of SAP-MS (particle diameter 100-150 mum) mixture as embolic spherical particles: SAP-MS(H) absorbed with sodium meglumine ioxaglate (Hexabrix 320), SAP-MS(V) absorbed with isosmolar contrast medium (Visipaque 270), and SAP-MS(S) absorbed with 0.9% sodium saline. The initial volume of SAP-MS particles just after TAE and its final volume 10 minutes after TAE in the vessel were measured to calculate the expansion rate (ER) (n = 30). Intravascular behavior of SAP-MS particles was clearly observed in real time at monochromatic X-ray imaging. Averaged initial volumes of SAP-MS (H) (1.24 x 10(7) microm(3)) were significantly smaller (p < 0.001) than those of SAP-MS (V) (5.99 x 10(7) microm(3)) and SAP-MS (S) (5.85 x 10(7) microm(3)). Averaged final volumes of SAP-MS (H) were significantly larger than averaged initial volumes (4.41 x 10(7) microm(3) vs. 1.24 x 10(7) microm(3); p < 0.0001, ER = 3.55). There were no significant difference between averaged final volumes and averaged initial volumes of SAP-MS (V) and SAP-MS (S). SAP-MS (H), which first travels distally, reaches to small arteries, and then expands to adapt to the vessel lumen, is an effective particle as an embolic agent, causing effective embolization.

  11. Brazilian city planners, American city planning? New perspectives on urban planning in Rio de Janeiro, 1930-1945.

    PubMed

    Rezende, Vera F

    2010-01-01

    This article analyses the connections between the ideas and principles of American city planning from 1920 with those articulated by Brazilian city planners in the 1930s and implemented by the administration of the City of Rio de Janeiro, then the capital of Brazil, notably during the period of the Estado Novo [The New State] from 1937 to 1945. In a period characterized by the centralization of political power and the concentration of decision-making in the hands of the president and the state, the City of Rio de Janeiro undertook a series of restructuring projects which utilized new forms of administration and organization. This article explores the links between urban planning in Brazil and the USA that were a notable feature of these projects. It examines particular requirements set down in city plans, city planning commissions and funding for urban activities, such as 'excess condemnation', by focusing upon articles and books written by four Brazilian engineers and proposals put forward by the American City Planning Institute, detailed in the proceedings of the National Conference on City Planning, in the periodical, City Planning and works by affiliated authors.

  12. Mechanical behaviour analyses of sap ascent in vascular plants.

    PubMed

    Perez-Diaz, Jose-Luis; Garcia-Prada, Juan-Carlos; Romera-Juarez, Fernando; Diez-Jimenez, Efren

    2010-09-01

    A pure mechanical anisotropic model of a tree trunk has been developed based on the 3D finite element method. It simulates the microscopic structure of vessels in the trunk of a European beech (Fagus sylvatica) in order to study and analyse its mechanical behaviour with different configurations of pressures in the conduits of xylem and phloem. The dependence of the strains at the inner bark was studied when sap pressure changed. The comparison with previously published experimental data leads to the conclusion that a great tensile stress-or 'negative pressure'-must exist in the water column in order to achieve the measured strains if only the mechanical point of view is taken into account. Moreover, the model can help to design experiments where qualitatively knowing the strains and the purely mechanical behaviour of the tree is required.

  13. Mechanical behaviour analyses of sap ascent in vascular plants

    PubMed Central

    Perez-Diaz, Jose-Luis; Garcia-Prada, Juan-Carlos; Romera-Juarez, Fernando

    2010-01-01

    A pure mechanical anisotropic model of a tree trunk has been developed based on the 3D finite element method. It simulates the microscopic structure of vessels in the trunk of a European beech (Fagus sylvatica) in order to study and analyse its mechanical behaviour with different configurations of pressures in the conduits of xylem and phloem. The dependence of the strains at the inner bark was studied when sap pressure changed. The comparison with previously published experimental data leads to the conclusion that a great tensile stress—or ‘negative pressure’—must exist in the water column in order to achieve the measured strains if only the mechanical point of view is taken into account. Moreover, the model can help to design experiments where qualitatively knowing the strains and the purely mechanical behaviour of the tree is required. PMID:21886343

  14. Low serum alkaline phosphatase activity in Kikuchi-Fujimoto disease

    PubMed Central

    Inamo, Yasuji

    2017-01-01

    Abstract Various laboratory findings are helpful in making a diagnosis of Kikuchi-Fujimoto disease (KFD); however, they are not specific. We found decreased serum alkaline phosphatase (SAP) activity in children with KFD. The levels of SAP fell in the acute phase and recovered during convalescence. We conclude that low SAP activity is a characteristic of KFD and may be an auxiliary diagnostic marker for the disease. PMID:28248884

  15. Cloning, expression and cellular localization of Daphnia pulex senescence-associated protein, DpSAP.

    PubMed

    Liu, Ajing; Kong, Ling; Zhang, Mingqing; Wu, Donglei; Wang, Danli; Zhao, Yunlong

    2014-01-25

    Daphnia (water fleas) are small crustaceans that undergo an unusual switch from asexual to sexual reproduction that is dependent on environmental conditions. In this study, a senescence-associated protein (SAP) from the common freshwater species Daphnia pulex was cloned using primers based on homologous sequences and rapid amplification of cDNA ends (RACE). Real-time PCR was employed to quantify the expression of D. pulex SAP (DpSAP) in individual organisms. The role of DpSAP in the reproductive transformation was further investigated in both parthenogenetic and sexual females by using digoxin-labeled SAP RNA probes and RNA whole-mount in situ hybridization. DpSAP was more highly expressed in sexual females, indicating a role in growth and reproduction. Cellular localization studies using RNA whole-mount in situ hybridization showed specific expression in the second tentacle joints. These expression patterns suggest an important role for DpSAP in the reproductive transformation of D. pulex.

  16. The sap of Acer okamotoanum decreases serum alcohol levels after acute ethanol ingestion in rats.

    PubMed

    Yoo, Yeong-Min; Jung, Eui-Man; Kang, Ha-Young; Choi, In-Gyu; Choi, Kyung-Chul; Jeung, Eui-Bae

    2011-10-01

    In the present study, we examined whether Acer okamotoanum (A. okamotoanum) sap decreased the serum alcohol and acetaldehyde levels after acute ethanol treatment in a rat model. Male rats were orally administered 25, 50 or 100% A. okamotoanum sap 30 min prior to oral challenge with 3 ml of ethanol (15 ml/kg of a 20% ethanol solution in water), and the blood concentrations of alcohol and acetaldehyde were analyzed up to 7 h after the treatment. Pre-treatment with the sap significantly decreased the blood ethanol and acetaldehyde concentrations after 5 h when compared with ethanol treatment alone (a negative control). The expression levels of liver alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) mRNA were increased significantly in animals pre-treated with A. okamotoanum sap when compared with negative and positive controls. The data suggest that sap pre-treatment enhanced the alcohol metabolism rate in the rat liver. To investigate the involvement of mitochondrial regulation in the ethanol-induced hepatocyte apoptosis, we carried out an immunohistochemical analysis of Bax and Bcl-2. Pre-treatment with sap significantly decreased Bax expression and increased Bcl-2 expression 7 h after ethanol administration when compared with the negative control. The data suggest that A. okamotoanum sap pre-treatment may reduce the alcohol-induced oxidative stress in the rat liver.

  17. Haemophilus ducreyi SapA contributes to cathelicidin resistance and virulence in humans.

    PubMed

    Mount, Kristy L B; Townsend, Carisa A; Rinker, Sherri D; Gu, Xiaoping; Fortney, Kate R; Zwickl, Beth W; Janowicz, Diane M; Spinola, Stanley M; Katz, Barry P; Bauer, Margaret E

    2010-03-01

    Haemophilus ducreyi is an extracellular pathogen of human epithelial surfaces that resists human antimicrobial peptides (APs). The organism's genome contains homologs of genes sensitive to antimicrobial peptides (sap operon) in nontypeable Haemophilus influenzae. In this study, we characterized the sap-containing loci of H. ducreyi 35000HP and demonstrated that sapA is expressed in broth cultures and H. ducreyi-infected tissue; sapA is also conserved among both class I and class II H. ducreyi strains. We constructed a nonpolar sapA mutant of H. ducreyi 35000HP, designated 35000HPsapA, and compared the percent survival of wild-type 35000HP and 35000HPsapA exposed to several human APs, including alpha-defensins, beta-defensins, and the cathelicidin LL-37. Unlike an H. influenzae sapA mutant, strain 35000HPsapA was not more susceptible to defensins than strain 35000HP was. However, we observed a significant decrease in the survival of strain 35000HPsapA after exposure to LL-37, which was complemented by introducing sapA in trans. Thus, the Sap transporter plays a role in resistance of H. ducreyi to LL-37. We next compared mutant strain 35000HPsapA with strain 35000HP for their ability to cause disease in human volunteers. Although both strains caused papules to form at similar rates, the pustule formation rate at sites inoculated with 35000HPsapA was significantly lower than that of sites inoculated with 35000HP (33.3% versus 66.7%; P = 0.007). Together, these data establish that SapA acts as a virulence factor and as one mechanism for H. ducreyi to resist killing by antimicrobial peptides. To our knowledge, this is the first demonstration that an antimicrobial peptide resistance mechanism contributes to bacterial virulence in humans.

  18. Sap Flux Scaled Transpiration in Ring-porous Tree Species: Assumptions, Pitfalls and Calibration

    NASA Astrophysics Data System (ADS)

    Bush, S. E.; Hultine, K. R.; Ehleringer, J. R.

    2008-12-01

    Thermal dissipation probes for measuring sap flow (Granier-type) at the whole tree and stand level are routinely used in forest ecology and site water balance studies. While the original empirical relationship used to calculate sap flow was reported as independent of wood anatomy (ring-porous, diffuse-porous, tracheid), it has been suggested that potentially large errors in sap flow calculations may occur when using the original calibration for ring-porous species, due to large radial trends in sap velocity and/or shallow sapwood depth. Despite these concerns, sap flux measurements have rarely been calibrated in ring-porous taxa. We used a simple technique to calibrate thermal dissipation sap flux measurements on ring-porous trees in the lab. Calibration measurements were conducted on five ring-porous species in the Salt Lake City, USA metropolitan area including Quercus gambelii (Gambel oak), Gleditsia triacanthos (Honey locust), Elaeagnus angustifolia (Russian olive), Sophora japonica (Japanese pagoda), and Celtis occidentalis (Common hackberry). Six stems per species of approximately 1 m in length were instrumented with heat dissipation probes to measure sap flux concurrently with gravimetric measurements of water flow through each stem. Safranin dye was pulled through the stems following flow rate measurements to determine sapwood area. As expected, nearly all the conducting sapwood area was limited to regions within the current year growth rings. Consequently, we found that the original Granier equation underestimated sap flux density for all species considered. Our results indicate that the use of thermal dissipation probes for measuring sap flow in ring-porous species should be independently calibrated, particularly when species- specific calibration data are not available. Ring-porous taxa are widely distributed and represent an important component of the regional water budgets of many temperate regions. Our results are important for evaluating plant water

  19. Effect of Flos carthami on stress-activated protein kinase activity in the isolated reperfused rat heart.

    PubMed

    Siow, Y L; Choy, P C; Leung, W M; O, K

    2000-04-01

    The apoptotic death of cardiomyocytes due to ischemia/reperfusion is one of the major complications of heart disease. Ischemia/reperfusion has been shown to lead to the activation of the stress-activated protein (SAP) kinases and the p38/reactivating kinase (p38/RK). In this study, the direct effect of an aqueous Flos carthami (FC) extract on SAP kinases was investigated. When isolated rat hearts were perfused by Langendorff mode with media containing FC extract prior to the induction of global ischemia and the subsequent reperfusion, SAP kinase activity was inhibited 95%. Untreated ischemic/reperfused hearts showed a 57% elevation in the activity of SAP kinase. The in vitro effect of these FC extracts on SAP kinase was also tested. At a concentration of 10 microg/ml, the aqueous FC extract resulted in 50% inhibition of SAP kinase activity in ischemic heart tissue. Our results showed that FC affected both the interaction of SAP kinase with c-jun as well as the phosphotransferase reaction. These results clearly demonstrate that extracts from Flos carthami exerted inhibitory effects on SAP kinase. The administration of the FC extract may lead to a modulation of the apoptotic effect of SAP kinase activation induced during ischemia/reperfusion.

  20. Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh.

    PubMed

    Nahar, Nazmun; Paul, Repon C; Sultana, Rebeca; Gurley, Emily S; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P

    2015-01-01

    Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1-1.3, p<0.001). When sap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9-1.1, p = 0.512). Respondents' knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission.

  1. Drought, Frost, Rain and Sunshine. Four Years of Sap Flow Measurements for One of the World's Largest Conifers

    NASA Astrophysics Data System (ADS)

    Macinnis-Ng, C.; Taylor, D. T.; Kaplick, J.; Clearwater, M.

    2015-12-01

    Amongst the largest and longest lived conifers in the world, the endemic New Zealand kauri, Agathis australis, provides a proxy-climate record dating back 4000 y. Tree-ring widths provide a strong indicator of the occurrence of El Niño Southern Oscillation (ENSO) events. We are measuring physiological processes, including carbon uptake and loss, leaf-scale gas exchange and sap flow together with meteorological data to explore the mechanisms of the climate response of this iconic and culturally significant species. In this continuous 15 min time interval sap flow dataset spanning four years, we have captured very wet and very dry summer periods. Winter flow rates peaked lower than summer flow rates and winter flow also started later and finished earlier in the day, resulting in less water use. Larger, canopy dominant trees (DBH up to 176 cm) had large sapwood area (sapwood depth up to 18 cm) and faster flow rates and therefore dominated stand water use. During dry periods, smaller trees (DBH 20-80 cm) were more responsive to dry soils than larger trees, suggesting access to deeper soil water stores. Leaf-scale gas exchange rates were low with very low stomatal conductance values reflecting known vulnerability to xylem embolism. Night-time refilling of sapwood was particularly evident during the summer drought with evidence that refilling was incomplete as the drought progressed. Photosynthetically active radiation and vapour pressure deficit are strongly correlated with sap flow across all seasons, a promising indicator for future modelling work on this dataset. Water saving strategies and stand-scale water budgets are discussed.

  2. SAP-like domain in nucleolar spindle associated protein mediates mitotic chromosome loading as well as interphase chromatin interaction

    SciTech Connect

    Verbakel, Werner; Carmeliet, Geert; Engelborghs, Yves

    2011-08-12

    Highlights: {yields} The SAP-like domain in NuSAP is a functional DNA-binding domain with preference for dsDNA. {yields} This SAP-like domain is essential for chromosome loading during early mitosis. {yields} NuSAP is highly dynamic on mitotic chromatin, as evident from photobleaching experiments. {yields} The SAP-like domain also mediates NuSAP-chromatin interaction in interphase nucleoplasm. -- Abstract: Nucleolar spindle associated protein (NuSAP) is a microtubule-stabilizing protein that localizes to chromosome arms and chromosome-proximal microtubules during mitosis and to the nucleus, with enrichment in the nucleoli, during interphase. The critical function of NuSAP is underscored by the finding that its depletion in HeLa cells results in various mitotic defects. Moreover, NuSAP is found overexpressed in multiple cancers and its expression levels often correlate with the aggressiveness of cancer. Due to its localization on chromosome arms and combination of microtubule-stabilizing and DNA-binding properties, NuSAP takes a special place within the extensive group of spindle assembly factors. In this study, we identify a SAP-like domain that shows DNA binding in vitro with a preference for dsDNA. Deletion of the SAP-like domain abolishes chromosome arm binding of NuSAP during mitosis, but is not sufficient to abrogate its chromosome-proximal localization after anaphase onset. Fluorescence recovery after photobleaching experiments revealed the highly dynamic nature of this NuSAP-chromatin interaction during mitosis. In interphase cells, NuSAP also interacts with chromatin through its SAP-like domain, as evident from its enrichment on dense chromatin regions and intranuclear mobility, measured by fluorescence correlation spectroscopy. The obtained results are in agreement with a model where NuSAP dynamically stabilizes newly formed microtubules on mitotic chromosomes to enhance chromosome positioning without immobilizing these microtubules. Interphase NuSAP

  3. From discharge planner to "concierge": recommendations for hospital social work by clients with intracerebral hemorrhage.

    PubMed

    Linton, Kristen F; Ing, Marissa M; Vento, Megan A; Nakagawa, Kazuma

    2015-01-01

    The Affordable Care Act and budget cuts have changed the role of hospital social workers by placing pressure on them to conduct speedy discharges and decrease readmission rates. This qualitative study aimed to assess if hospital social work is meeting the needs of clients in the hospital and postdischarge. Semistructured interviews with 10 clients with intracerebral hemorrhage (ICH) and 11 caregivers were conducted. Participants reported that social work services were not meeting their needs. Clients with ICH and their caregivers expressed needs from social workers that surpassed their roles as discharge planners, including counseling, help with finances and insurance, and advocacy. Participants wanted social work services to begin early in acute treatment with continuity postdischarge. Social workers should conduct ethical social work by meeting clients where they are, addressing needs as prioritized by the client, and advocating individually and organizationally for clients.

  4. Comparisons of the Interpersonal-Psychological Theory of Suicide Constructs Among Individuals Without Suicidality, Ideators, Planners, and Attempters.

    PubMed

    Forrest, Lauren N; Smith, April R

    2016-12-16

    The Interpersonal-Psychological Theory of Suicide (IPTS) proposes that combinations of thwarted belongingness, perceived burdensomeness, and acquired capability lead to suicide ideation, planning, and attempting. We compared individuals with and without suicidality on thwarted belongingness and perceived burdensomeness, and compared a combined group of planners and attempters to ideators on fearlessness about death (one component of acquired capability). Individuals with suicidality had higher thwarted belongingness and perceived burdensomeness than individuals without suicidality. Planners and attempters did not have higher fearlessness about death than ideators. These findings partially support IPTS hypotheses. Assessing thwarted belongingness and perceived burdensomeness may improve suicide risk determination.

  5. Rice SAPs are responsive to multiple biotic stresses and overexpression of OsSAP1, an A20/AN1 zinc-finger protein, enhances the basal resistance against pathogen infection in tobacco.

    PubMed

    Tyagi, Himani; Jha, Shweta; Sharma, Meenakshi; Giri, Jitender; Tyagi, Akhilesh K

    2014-08-01

    Eukaryotic A20/AN1 zinc-finger proteins (ZFPs) play an important role in the regulation of immune and stress response. After elucidation of the role of first such protein, OsSAP1, in abiotic stress tolerance, 18 rice stress associated protein (SAP) genes have been shown to be regulated by multiple abiotic stresses. In the present study, expression pattern of all the 18 OsSAP genes have been analysed in response to different biotic stress simulators, in order to get insights into their possible involvement in biotic stress tolerance. Our results showed the upregulation of OsSAP1 and OsSAP11 by all biotic stress simulator treatments. Furthermore, the functional role of OsSAP1 in plant defence responses has been explored through overexpression in transgenic plants. Constitutive expression of OsSAP1 in transgenic tobacco resulted into enhanced disease resistance against virulent bacterial pathogen, together with the upregulation of known defence-related genes. Present investigation suggests that rice SAPs are responsive to multiple biotic stresses and OsSAP1 plays a key role in basal resistance against pathogen infection. This strongly supports the involvement of rice SAPs in cross-talk between biotic and abiotic stress signalling pathways, which makes them ideal candidate to design strategies for protecting crop plants against multiple stresses.

  6. An investigation of potential applications of OP-SAPS: Operational sampled analog processors

    NASA Technical Reports Server (NTRS)

    Parrish, E. A.; Mcvey, E. S.

    1976-01-01

    The impact of charge-coupled device (CCD) processors on future instrumentation was investigated. The CCD devices studied process sampled analog data and are referred to as OP-SAPS - operational sampled analog processors. Preliminary studies into various architectural configurations for systems composed of OP-SAPS show that they have potential in such diverse applications as pattern recognition and automatic control. It appears probable that OP-SAPS may be used to construct computing structures which can serve as special peripherals to large-scale computer complexes used in real time flight simulation. The research was limited to the following benchmark programs: (1) face recognition, (2) voice command and control, (3) terrain classification, and (4) terrain identification. A small amount of effort was spent on examining a method by which OP-SAPS may be used to decrease the limiting ground sampling distance encountered in remote sensing from satellites.

  7. Sapping Features of the Colorado Plateau: a Comparative Planetary Geology Field Guide

    NASA Technical Reports Server (NTRS)

    Howard, Alan D. (Editor); Kochel, R. Craig (Editor); Holt, Henry E. (Editor)

    1987-01-01

    This book is an attempt to determine geomorphic criteria to be used to distinguish between channels formed predominantly by sapping and seepage erosion and those formed principally by surface runoff processes. The geologic nature of the Colorado Plateau has resulted in geomorphic features that show similarities to some areas on Mars, especially certain valley networks within thick sandstone formations. Where spring sapping is an effective process, the valleys that develop are unique in terms of their morphology and network pattern.

  8. Radial variation in sap flow in five laurel forest tree species in Tenerife, Canary Islands.

    PubMed

    Jiménez, M. Soledad; Nadezhdina, Nadezhda; Cermák, Jan; Morales, Domingo

    2000-11-01

    Variations in radial patterns of xylem water content and sap flow rate were measured in five laurel forest tree species (Laurus azorica (Seub.) Franco, Persea indica (L.) Spreng., Myrica faya Ait., Erica arborea L. and Ilex perado Ait. ssp. platyphylla (Webb & Berth.) Tutin) growing in an experimental plot at Agua García, Tenerife, Canary Islands. Measurements were performed around midday during warm and sunny days by the heat field deformation method. In all species, water content was almost constant (around 35% by volume) over the whole xylem cross-sectional area. There were no differences in wood color over the whole cross-sectional area of the stem in most species with the exception of E. arborea, whose wood became darker in the inner layers. Radial patterns of sap flow were highly variable and did not show clear relationships with tree diameter or species. Sap flow occurred over the whole xylem cross-sectional area in some species, whereas it was limited to the outer xylem layers in others. Sap flow rate was either similar along the xylem radius or exhibited a peak in the outer part of the xylem area. Low sap flow rates with little variation in radial pattern were typical for shaded suppressed trees, whereas dominant trees exhibited high sap flow rates with a peak in the radial pattern. Stem damage resulted in a significant decrease in sap flow rate in the outer xylem layers. The outer xylem is more important for whole tree water supply than the inner xylem because of its larger size. We conclude that measurement of radial flow pattern provides a reliable method of integrating sap flow from individual measuring points to the whole tree.

  9. Water Use Patterns of Four Tropical Bamboo Species Assessed with Sap Flux Measurements.

    PubMed

    Mei, Tingting; Fang, Dongming; Röll, Alexander; Niu, Furong; Hendrayanto; Hölscher, Dirk

    2015-01-01

    Bamboos are grasses (Poaceae) that are widespread in tropical and subtropical regions. We aimed at exploring water use patterns of four tropical bamboo species (Bambusa vulgaris, Dendrocalamus asper, Gigantochloa atroviolacea, and G. apus) with sap flux measurement techniques. Our approach included three experimental steps: (1) a pot experiment with a comparison of thermal dissipation probes (TDPs), the stem heat balance (SHB) method and gravimetric readings using potted B. vulgaris culms, (2) an in situ calibration of TDPs with the SHB method for the four bamboo species, and (3) field monitoring of sap flux of the four bamboo species along with three tropical tree species (Gmelina arborea, Shorea leprosula, and Hevea brasiliensis) during a dry and a wet period. In the pot experiment, it was confirmed that the SHB method is well suited for bamboos but that TDPs need to be calibrated. In situ, species-specific parameters for such calibration formulas were derived. During field monitoring we found that some bamboo species reached high maximum sap flux densities. Across bamboo species, maximal sap flux density increased with decreasing culm diameter. In the diurnal course, sap flux densities in bamboos peaked much earlier than radiation and vapor pressure deficit (VPD), and also much earlier than sap flux densities in trees. There was a pronounced hysteresis between sap flux density and VPD in bamboos, which was less pronounced in trees. Three of the four bamboo species showed reduced sap flux densities at high VPD values during the dry period, which was associated with a decrease in soil moisture content. Possible roles of internal water storage, root pressure and stomatal sensitivity are discussed.

  10. [Application of three heat pulse technique-based methods to determine the stem sap flow].

    PubMed

    Wang, Sheng; Fan, Jun

    2015-08-01

    It is of critical importance to acquire tree transpiration characters through sap flow methodology to understand tree water physiology, forest ecology and ecosystem water exchange. Tri-probe heat pulse sensors, which are widely utilized in soil thermal parameters and soil evaporation measurement, were applied to implement Salix matsudana sap flow density (Vs) measurements via heat-ratio method (HRM), T-Max method (T-Max) and single-probe heat pulse probe (SHPP) method, and comparative analysis was conducted with additional Grainer's thermal diffusion probes (TDP) measured results. The results showed that, it took about five weeks to reach a stable measurement stage after TPHP installation, Vs measured with three methods in the early stage after installation was 135%-220% higher than Vs in the stable measurement stage, and Vs estimated via HRM, T-Max and SHPP methods were significantly linearly correlated with Vs estimated via TDP method, with R2 of 0.93, 0.73 and 0.91, respectively, and R2 for Vs measured by SHPP and HRM reached 0.94. HRM had relatively higher precision in measuring low rates and reverse sap flow. SHPP method seemed to be very promising to measure sap flow for configuration simplicity and high measuring accuracy, whereas it couldn' t distinguish directions of flow. T-Max method had relatively higher error in sap flow measurement, and it couldn' t measure sap flow below 5 cm3 · cm(-2) · h(-1), thus this method could not be used alone, however it could measure thermal diffusivity for calculating sap flow when other methods were imposed. It was recommended to choose a proper method or a combination of several methods to measure stem sap flow, based on specific research purpose.

  11. Water Use Patterns of Four Tropical Bamboo Species Assessed with Sap Flux Measurements

    PubMed Central

    Mei, Tingting; Fang, Dongming; Röll, Alexander; Niu, Furong; Hendrayanto; Hölscher, Dirk

    2016-01-01

    Bamboos are grasses (Poaceae) that are widespread in tropical and subtropical regions. We aimed at exploring water use patterns of four tropical bamboo species (Bambusa vulgaris, Dendrocalamus asper, Gigantochloa atroviolacea, and G. apus) with sap flux measurement techniques. Our approach included three experimental steps: (1) a pot experiment with a comparison of thermal dissipation probes (TDPs), the stem heat balance (SHB) method and gravimetric readings using potted B. vulgaris culms, (2) an in situ calibration of TDPs with the SHB method for the four bamboo species, and (3) field monitoring of sap flux of the four bamboo species along with three tropical tree species (Gmelina arborea, Shorea leprosula, and Hevea brasiliensis) during a dry and a wet period. In the pot experiment, it was confirmed that the SHB method is well suited for bamboos but that TDPs need to be calibrated. In situ, species-specific parameters for such calibration formulas were derived. During field monitoring we found that some bamboo species reached high maximum sap flux densities. Across bamboo species, maximal sap flux density increased with decreasing culm diameter. In the diurnal course, sap flux densities in bamboos peaked much earlier than radiation and vapor pressure deficit (VPD), and also much earlier than sap flux densities in trees. There was a pronounced hysteresis between sap flux density and VPD in bamboos, which was less pronounced in trees. Three of the four bamboo species showed reduced sap flux densities at high VPD values during the dry period, which was associated with a decrease in soil moisture content. Possible roles of internal water storage, root pressure and stomatal sensitivity are discussed. PMID:26779233

  12. Correlation of maple sap composition with bacterial and fungal communities determined by multiplex automated ribosomal intergenic spacer analysis (MARISA).

    PubMed

    Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

    2011-08-01

    During collection, maple sap is contaminated by bacteria and fungi that subsequently colonize the tubing system. The bacterial microbiota has been more characterized than the fungal microbiota, but the impact of both components on maple sap quality remains unclear. This study focused on identifying bacterial and fungal members of maple sap and correlating microbiota composition with maple sap properties. A multiplex automated ribosomal intergenic spacer analysis (MARISA) method was developed to presumptively identify bacterial and fungal members of maple sap samples collected from 19 production sites during the tapping period. Results indicate that the fungal community of maple sap is mainly composed of yeast related to Mrakia sp., Mrakiella sp., Guehomyces pullulans, Cryptococcus victoriae and Williopsis saturnus. Mrakia, Mrakiella and Guehomyces peaks were identified in samples of all production sites and can be considered dominant and stable members of the fungal microbiota of maple sap. A multivariate analysis based on MARISA profiles and maple sap chemical composition data showed correlations between Candida sake, Janthinobacterium lividum, Williopsis sp., Leuconostoc mesenteroides, Mrakia sp., Rhodococcus sp., Pseudomonas tolaasii, G. pullulans and maple sap composition at different flow periods. This study provides new insights on the relationship between microbial community and maple sap quality.

  13. [Cloning and expression pattern of a zinc finger protein gene ShSAP1 in Saccharum officinarum].

    PubMed

    Li, Xiaojun; Cai, Wenwei; Zhang, Shuzhen; Xu, Liping; Chen, Ping; Wang, Jungang

    2011-06-01

    In plants, proteins with A20/AN1 zinc finger domain are involved in stress responses, named as "Stress Associated Protein" (SAP) gene family. Based on Expressed Sequence Tag (EST) sequences information in Badila Saccharum officinarum mature related cDNA library, we cloned an SAP gene from sugarcane full length cDNA library, named ShSAP1 (GenBank: Accession No. HM991960). To characterize ShSAP1, we analyzed its genome structure and expression pattern. Southern blot analysis showed ShSAP1 was present as one or two copy in the genome of Badila. Comparison of ShSAP1 1 008 bp full length cDNA with a genomic frangment (2 241 bp) generated by PCR amplification and sequencing, revealed the presence of two introns (202 bp and 1 052 bp) located in the 5'UTR region. Semiquantitative RT-PCR analysis found ShSAP1 expressed in leaves, roots and stalk in mature sugarcane. Compared with immature stems, ShSAP1 expressed higher in mature stalk. ShSAP1 was induced by different types of treatments, such as salt (200 mmol/L NaCl), drought (10% PEG 6 000), GA3 (200 mg/L), ABA (100 micromol/L) and ET (1 mmol/L) during sugarcane seedling stage. These results indicated that ShSAP1 may function in sugarcane maturation and abiotic stress response processes.

  14. Isolation and characterization of LcSAP, a Leymus chinensis gene which enhances the salinity tolerance of Saccharomyces cerevisiae.

    PubMed

    Liu, Jingying; Yang, Xiangna; Yang, Xizhe; Xu, Mingyue; Liu, Jie; Xue, Mengmeng; Ma, Pengda

    2017-02-01

    A number of members of the SAP ("stress-associated protein") gene family have been implicated in the plant stress response. Here, a SAP gene has been isolated using PCR RACE from the perennial grass Leymus chinensis, a species which has reputation for ecological adaptability. The 17.6 kDa LcSAP product comprised 161 residues, including both an A20 domain and an AN1 domain, a feature of type I SAPs. Using a semi-quantitative RT-PCR assay to profile its transcription, it was shown that LcSAP was more strongly transcribed in the leaf than in the root under control conditions. The level of LcSAP transcription began to rise 6 h after the plant's exposure to 400 mM NaCl, and the abundance of transcript remained stable for at least 24 h. Exposing the plant to 100 mM Na2CO3 also induced LcSAP transcription, but the abundance of SAP transcript faded after 6 h. When LcSAP was introduced into yeast cells, the transgenic cells grew better than wild type ones when the medium contained 1.4 M NaCl. The ability of LcSAP to respond to salinity stress in yeast suggests that it also makes a contribution to the stress tolerance shown by L. chinensis.

  15. Autophagy regulation revealed by SapM-induced block of autophagosome-lysosome fusion via binding RAB7

    SciTech Connect

    Hu, Dong; Wu, Jing; Wang, Wan; Mu, Min; Zhao, Runpeng; Xu, Xuewei; Chen, Zhaoquan; Xiao, Jian; Hu, Fengyu; Yang, Yabo; Zhang, Rongbo

    2015-05-29

    The mechanism underlying autophagy alteration by mycobacterium tuberculosis remains unclear. Our previous study shows LpqH, a lipoprotein of mycobacterium tuberculosis, can cause autophagosomes accumulation in murine macrophages. It is well known that SapM, another virulence factor, plays an important role in blocking phagosome-endosome fusion. However, the mechanism that SapM interferes with autophagy remains poorly defined. In this study, we report that SapM suppresses the autophagy flux by blocking autophagosome fusion with lysosome. Exposure to SapM results in accumulations of autophagosomes and decreased co-localization of autophagosome with lysosome. Molecularly, Rab7, a small GTPase, is blocked by SapM through its CT domain and is prevented from involvement of autophagosome-lysosome fusion. In conclusion, our study reveals that SapM takes Rab7 as a previously unknown target to govern a distinct molecular mechanism underlying autophagosome-lysosome fusion, which may bring light to a new thought about developing potential drugs or vaccines against tuberculosis. - Highlights: • A mechanism for disrupting autophagosome-lysosome fusion induced by SapM. • Rab7 is involved in SapM-inhibited autophagy. • SapM interacts with Rab7 by CT-domain. • CT-domain is indispensable to SapM-inhibited autophagy.

  16. Use of infrared camera to understand bats' access to date palm sap: implications for preventing Nipah virus transmission.

    PubMed

    Khan, M Salah Uddin; Hossain, Jahangir; Gurley, Emily S; Nahar, Nazmun; Sultana, Rebeca; Luby, Stephen P

    2010-12-01

    Pteropus bats are commonly infected with Nipah virus, but show no signs of illness. Human Nipah outbreaks in Bangladesh coincide with the date palm sap harvesting season. In epidemiologic studies, drinking raw date palm sap is a risk factor for human Nipah infection. We conducted a study to evaluate bats' access to date palm sap. We mounted infrared cameras that silently captured images upon detection of motion on date palm trees from 5:00 pm to 6:00 am. Additionally, we placed two locally used preventative techniques, bamboo skirts and lime (CaCO₃) smeared on date palm trees to assess their effectiveness in preventing bats access to sap. Out of 20 camera-nights of observations, 14 identified 132 visits of bats around the tree, 91 to the shaved surface of the tree where the sap flow originates, 4 at the stream of sap moving toward the collection pot, and no bats at the tap or on the collection pots; the remaining 6 camera-nights recorded no visits. Of the preventative techniques, the bamboo skirt placed for four camera-nights prevented bats access to sap. This study confirmed that bats commonly visited date palm trees and physically contacted the sap collected for human consumption. This is further evidence that date palm sap is an important link between Nipah virus in bats and Nipah virus in humans. Efforts that prevent bat access to the shaved surface and the sap stream of the tree could reduce Nipah spillovers to the human population.

  17. Accumulation of weathered pp'-DDE in xylem sap of grafted watermelon.

    PubMed

    Isleyen, Mehmet; Sevim, Pinar

    2012-04-01

    Movement of weathered p,p'-dichlorodiphenyldichloroethane (p,p'-DDE) from contaminated soil to the rhizosphere pore water to the xylem sap of grafted watermelon was studied under green house conditions. p,p'-DDE concentrations in pore water and xylem sap was compared in intact plants, homografted, and compatible heterografts of Cucurbita pepo spp. pepo and Citrullus lanatus plants. An average p,p'-DDE concentrations in pore water of contaminated soil ranged from 0.36 microg/L to 0.55 microg/L and there were no statistically significant among the cultivars. Conversely, the xylem sap p,p'-DDE concentration of heterografted watermelon having a zucchini rootstock and watermelon scion was 71 microg/L and it was greater than intact watermelon plants (0.49 microg/L) but less than that of intact plants of zucchini (141 microg/L). Homografting showed no effect on xylem sap p,p'-DDE concentrations of the identical cultivars. The bio-concentration factors (BCFs) which is an average p,p'-DDE concentration in xylem sap over average p,p'-DDE in pore water were 344, 325, 197, 1.28, and 0.89 for intact plant of zucchini, homografted zucchini, heterografted watermelon, homografted watermelon, and intact plant of watermelon, respectively. Xylem sap p,p'-DDE concentrations of the heterografted watermelon plants were clearly influenced by plant phylogeny and enhanced by the zucchini rootstock compared to intact watermelon plants.

  18. Altered thalamocortical development in the SAP102 knockout model of intellectual disability

    PubMed Central

    Crocker-Buque, Alex; Currie, Stephen P.; Luz, Liliana L.; Grant, Seth G.; Duffy, Kevin R.; Kind, Peter C.; Daw, Michael I.

    2016-01-01

    Genetic mutations known to cause intellectual disabilities (IDs) are concentrated in specific sets of genes including both those encoding synaptic proteins and those expressed during early development. We have characterized the effect of genetic deletion of Dlg3, an ID-related gene encoding the synaptic NMDA-receptor interacting protein synapse-associated protein 102 (SAP102), on development of the mouse somatosensory cortex. SAP102 is the main representative of the PSD-95 family of postsynaptic MAGUK proteins during early development and is proposed to play a role in stabilizing receptors at immature synapses. Genetic deletion of SAP102 caused a reduction in the total number of thalamocortical (TC) axons innervating the somatosensory cortex, but did not affect the segregation of barrels. On a synaptic level SAP102 knockout mice display a transient speeding of NMDA receptor kinetics during the critical period for TC plasticity, despite no reduction in GluN2B-mediated component of synaptic transmission. These data indicated an interesting dissociation between receptor kinetics and NMDA subunit expression. Following the critical period NMDA receptor function was unaffected by loss of SAP102 but there was a reduction in the divergence of TC connectivity. These data suggest that changes in synaptic function early in development caused by mutations in SAP102 result in changes in network connectivity later in life. PMID:27466188

  19. Application of superabsorbent polymers (SAP) as desiccants to dry maize and reduce aflatoxin contamination.

    PubMed

    Mbuge, Duncan O; Negrini, Renata; Nyakundi, Livine O; Kuate, Serge P; Bandyopadhyay, Ranajit; Muiru, William M; Torto, Baldwyn; Mezzenga, Raffaele

    2016-08-01

    The ability of superabsorbent polymers (SAP) in drying maize and controlling aflatoxin contamination was studied under different temperatures, drying times and SAP-to-maize ratios. Temperature and drying time showed significant influence on the aflatoxin formation. SAP-to-maize ratios between 1:1 and 1:5 showed little or no aflatoxin contamination after drying to the optimal moisture content (MC) of 13 %, while for ratios 1:10 and 1:20, aflatoxin contamination was not well controlled due to the overall higher MC and drying time, which made these ratios unsuitable for the drying process. Results clearly show that temperature, frequency of SAP change, drying time and SAP-to-maize ratio influenced the drying rate and aflatoxin contamination. Furthermore, it was shown that SAP had good potential for grain drying and can be used iteratively, which can make this system an optimal solution to reduce aflatoxin contamination in maize, particular for developing countries and resource-lacking areas.

  20. A simple, novel and high efficiency sap inoculation method to screen for tobacco streak virus.

    PubMed

    Sundaresha, S; Sreevathsa, Rohini; Balol, Gurupada B; Keshavareddy, G; Rangaswamy, K T; Udayakumar, M

    2012-10-01

    A rapid and efficient sap inoculation method for tobacco streak virus (TSV) was developed in sunflower. Sap from TSV-infected sunflower plants was freshly extracted in phosphate buffer and diluted serially from 10(-1) to 10(-8). Two-day old seedlings of sunflower were injured at the meristem and immersed in the sap for 10 min, maintained at 20 °C for 2-3 days and shifted to greenhouse. The surviving seedlings in the respective sap dilution were scored for symptoms of sunflower necrosis disease (SND). SND symptoms were seen in 80 % of the seedlings inoculated with a sap dilution of 10(-5). ELISA and RT-PCR analysis of coat protein and movement protein of TSV confirmed SND symptoms. The methodology was also found to be reproducible when the sap from the infected plants was inoculated onto healthy plants. The main aim of the study was to develop a primary screening strategy for the selection of transgenics developed for SND resistance. This methodology can also be extended for the analysis of resistance against other viruses.

  1. Isolation and characterization of SAP and CRP, two pentraxins from Pangasianodon (Pangasius) hypophthalmus.

    PubMed

    Huong Giang, Duong Thi; Van Driessche, Edilbert; Vandenberghe, Isabel; Devreese, Bart; Beeckmans, Sonia

    2010-01-01

    From the serum of Pangasianodon hypophthalmus, two proteins were isolated by affinity chromatography on Sepharose and phosphorylcholine-Sepharose. Their binding on the affinity matrices critically depends on the presence of Ca2+ ions. N-terminal sequencing and sequencing of internal tryptic peptides identified the proteins as pentraxins and from their binding properties they are identified as SAP (serum amyloid P component) and CRP (C-reactive protein). Per ml serum, 36 microg SAP and 56 microg CRP was purified. Upon gel filtration, both the SAP and CRP elute as trimers of respectively 24 kDa and 28 kDa subunits. Both proteins are devoid of inter-chain disulfide bonds. Both SAP and CRP are glycosylated and agglutinate rabbit erythrocytes and pathogenic bacteria Edwardsiella ictaluri and Aeromonas hydrophila, but not Micrococcus lysodeikticus or Escherichia coli. Haemagglutination of SAP and CRP is inhibited by galactose (MIC = 1 mM) and by phosphorylcholine (MIC = 1-2 mM), respectively. Circular dichroism studies revealed that antiparallel beta-pleated sheets are dominating the secondary structure. Upon removing the Ca(2+) ions by EDTA, slight structural changes are observed by CD spectroscopy in the near-UV region. Immunodiffusion shows that P. hypophthalmus SAP and CRP do not cross-react.

  2. Molecular pathogenesis of EBV susceptibility in XLP as revealed by analysis of female carriers with heterozygous expression of SAP.

    PubMed

    Palendira, Umaimainthan; Low, Carol; Chan, Anna; Hislop, Andrew D; Ho, Edwin; Phan, Tri Giang; Deenick, Elissa; Cook, Matthew C; Riminton, D Sean; Choo, Sharon; Loh, Richard; Alvaro, Frank; Booth, Claire; Gaspar, H Bobby; Moretta, Alessandro; Khanna, Rajiv; Rickinson, Alan B; Tangye, Stuart G

    2011-11-01

    X-linked lymphoproliferative disease (XLP) is a primary immunodeficiency caused by mutations in SH2D1A which encodes SAP. SAP functions in signalling pathways elicited by the SLAM family of leukocyte receptors. A defining feature of XLP is exquisite sensitivity to infection with EBV, a B-lymphotropic virus, but not other viruses. Although previous studies have identified defects in lymphocytes from XLP patients, the unique role of SAP in controlling EBV infection remains unresolved. We describe a novel approach to this question using female XLP carriers who, due to random X-inactivation, contain both SAP(+) and SAP(-) cells. This represents the human equivalent of a mixed bone marrow chimera in mice. While memory CD8(+) T cells specific for CMV and influenza were distributed across SAP(+) and SAP(-) populations, EBV-specific cells were exclusively SAP(+). The preferential recruitment of SAP(+) cells by EBV reflected the tropism of EBV for B cells, and the requirement for SAP expression in CD8(+) T cells for them to respond to Ag-presentation by B cells, but not other cell types. The inability of SAP(-) clones to respond to Ag-presenting B cells was overcome by blocking the SLAM receptors NTB-A and 2B4, while ectopic expression of NTB-A on fibroblasts inhibited cytotoxicity of SAP(-) CD8(+) T cells, thereby demonstrating that SLAM receptors acquire inhibitory function in the absence of SAP. The innovative XLP carrier model allowed us to unravel the mechanisms underlying the unique susceptibility of XLP patients to EBV infection in the absence of a relevant animal model. We found that this reflected the nature of the Ag-presenting cell, rather than EBV itself. Our data also identified a pathological signalling pathway that could be targeted to treat patients with severe EBV infection. This system may allow the study of other human diseases where heterozygous gene expression from random X-chromosome inactivation can be exploited.

  3. Quality Education and Training for the Adult Unemployed. A Manual for Planners and Managers in Further Education.

    ERIC Educational Resources Information Center

    Further Education Unit, London (England).

    This manual is designed to support college management teams in Great Britain in the planning and delivery of effective learning opportunities for unemployed people, within the context of changes in the economy, labor market, and education and training policy. Section 1 discusses the context of these changes, and key issues for college planners are…

  4. [Dynamic change of Yulania sap flow before dormancy in response to environmental factors].

    PubMed

    Zhu, Zhong-Long; Jia, Zhong-Kui; Ma, Lu-Yi; Wang, Xiao-Ling; Duan, Jie

    2012-09-01

    From September 26 to November 5, 2011, the sap flow of Yulania wufengensis trees including cold-resistance type (HK) and non cold-resistance type (HF), Y. 'Sunspire' (HY), and Yulania x soulangeana (EQ) which were introduced into Beijing four years before was monitored by Flow-32 stem heat balance sensor, and, in combining with the environmental factors monitored synchronically, the changes of the sap flow before dormancy and the environmental factors were analyzed, with the responses of the sap flow to the environmental factors investigated at the scales of 0.5 h and 1 day. The sap flow of the Yulanias trees before dormancy displayed an obvious trend of declining day by day. The environmental factors affecting the sap flow could be divided into two categories, i. e., meteorological index (MI) and soil index (SI). The sap flow of the Yulanias trees had a synchronous variation rhythm with MI, and declined in parallel to SI. The combined effect of MI and SI on the diurnal changes of the sap flow was 69% - 73%. At both 0.5 h and 1 day scales, the sap flow showed significantly correlations with total radiation (Rs), air vapor pressure deficit (D), air relative humidity (RH), air temperature (Ta), and wind speed (w). The sap flow showed no significant correlations with soil temperature (Ts) and soil water content (SWC) at 0. 5 h scale, but had significant correlations with Ts, SWC, and day length (Z) at 1 day scale (the correlation efficient was about 0.8). Only Rs, Z, and D were included into the model at 1 day scale, but almost all environmental factors (except SWC and Ts) were included in the model at 0.5 h scale. Except for HF type, the regression coefficients of the model for the Yulanias trees at 1 day scale (0.92-0.96) were larger than those at 0.5 h scale (0.77-0.87), and the correlations between the dynamic changes of sap flow and the environmental factor were consistent, which was in accord with the fact that the HF could not overwinter in Beijing but the

  5. Predictive models for radial sap flux variation in coniferous, diffuse-porous and ring-porous temperate trees.

    PubMed

    Berdanier, Aaron B; Miniat, Chelcy F; Clark, James S

    2016-08-01

    Accurately scaling sap flux observations to tree or stand levels requires accounting for variation in sap flux between wood types and by depth into the tree. However, existing models for radial variation in axial sap flux are rarely used because they are difficult to implement, there is uncertainty about their predictive ability and calibration measurements are often unavailable. Here we compare different models with a diverse sap flux data set to test the hypotheses that radial profiles differ by wood type and tree size. We show that radial variation in sap flux is dependent on wood type but independent of tree size for a range of temperate trees. The best-fitting model predicted out-of-sample sap flux observations and independent estimates of sapwood area with small errors, suggesting robustness in the new settings. We develop a method for predicting whole-tree water use with this model and include computer code for simple implementation in other studies.

  6. Can sucrose content in the phloem sap reaching field pea seeds (Pisum sativum L.) be an accurate indicator of seed growth potential?

    PubMed

    Munier-Jolain, Nathalie; Salon, Christophe

    2003-11-01

    The composition of the translocates reaching the seeds of pea plants having various nitrogen (N) nutrition regimes was investigated under field situations. Sucrose flow in the phloem sap increased with the node number, but was not significantly different between N nutrition levels. Because N deficiency reduced the number of flowering nodes and the number of seeds per pod, the sucrose flow bleeding from cut peduncles was divided by the number of seeds to give the amount of assimilates available per seed. The sucrose concentration in phloem sap supplied to seeds at the upper nodes was higher than that at the lower nodes. The flow of sucrose delivered to the seeds during the cell division period was correlated with seed growth potential. Seeds from the more N-stressed plants had both the highest seed growth rate and received a higher sucrose flux per seed during the cell division period. As seed growth rate is highly correlated with the number of cotyledonary cells produced during the cell division period, sucrose flow in phloem sap is proposed to be an important determinant of mitotic activity in seed embryos. The carbon (C)/N ratio of the flow of translocates towards seeds was higher under conditions of N-deficiency than with optimal N nutrition, indicating that N flux towards seeds, in itself, is not the main determinant of seed growth potential.

  7. [Effects of tree diameter at breast height and soil moisture on transpiration of Schima superba based on sap flow pattern and normalization].

    PubMed

    Mei, Ting-ting; Zhao, Ping; Wang, Quan; Cai, Xi-an; Yu, Meng-hao; Zhu, Li-wei; Zou, Lü-liu; Zeng, Xiao-ping

    2010-10-01

    The eigenvalues of continuous sap flow pattern, i. e. , skewness and kurtosis, were used to investigate the water usage of Schima superba with different diameter at breast height (DBH), and the method of normalization was firstly applied to eliminate the effects of strong affecting factor (photosynthetic active radiation, PAR) to explore the possible relationship between weak affecting factor (soil moisture) and sap flow. Generally, the trees with larger DBH had smaller skewness of sap flux density and later-appeared but larger peak values, suggesting that much more water was transpired, and the larger trees showed smaller skewness and later-appeared larger peak values in wet season than in dry season, suggesting that more water was transpired in wet season. On the other hand, smaller trees had lesser differences in the skewness between dry and wet seasons, suggesting that there was no significant difference in the transpiration between the two seasons. The relationship between individual tree's transpiration and soil moisture was significant and positive after the two parameters being normalized with PAR peak values. When the soil moisture content was higher, the transpiration of the trees with larger DBH was steadily increasing with soil moisture, while that of the trees with moderate or smaller DBH had opposite trend, presumably due to their transpiration and water absorption were approached to the limit.

  8. Targeting and Cytotoxicity of SapC-DOPS Nanovesicles in Pancreatic Cancer

    PubMed Central

    Chu, Zhengtao; Abu-Baker, Shadi; Palascak, Mary B.; Ahmad, Syed A.; Franco, Robert S.; Qi, Xiaoyang

    2013-01-01

    Only a small number of promising drugs target pancreatic cancer, which is the fourth leading cause of cancer deaths with a 5-year survival of less than 5%. Our goal is to develop a new biotherapeutic agent in which a lysosomal protein (saposin C, SapC) and a phospholipid (dioleoylphosphatidylserine, DOPS) are assembled into nanovesicles (SapC-DOPS) for treating pancreatic cancer. A distinguishing feature of SapC-DOPS nanovesicles is their high affinity for phosphatidylserine (PS) rich microdomains, which are abnormally exposed on the membrane surface of human pancreatic tumor cells. To evaluate the role of external cell PS, in vitro assays were used to correlate PS exposure and the cytotoxic effect of SapC-DOPS in human tumor and nontumorigenic pancreatic cells. Next, pancreatic tumor xenografts (orthotopic and subcutaneous models) were used for tumor targeting and therapeutic efficacy studies with systemic SapC-DOPS treatment. We observed that the nanovesicles selectively killed human pancreatic cancer cells in vitro by inducing apoptotic death, whereas untransformed cells remained unaffected. This in vitro cytotoxic effect correlated to the surface exposure level of PS on the tumor cells. Using xenografts, animals treated with SapC-DOPS showed clear survival benefits and their tumors shrank or disappeared. Furthermore, using a double-tracking method in live mice, we showed that the nanovesicles were specifically targeted to orthotopically-implanted, bioluminescent pancreatic tumors. These data suggest that the acidic phospholipid PS is a biomarker for pancreatic cancer that can be effectively targeted for therapy utilizing cancer-selective SapC-DOPS nanovesicles. This study provides convincing evidence in support of developing a new therapeutic approach to pancreatic cancer. PMID:24124494

  9. Photovoltaics for municipal planners. Cost-effective municipal applications of photovoltaics for electric power

    SciTech Connect

    Not Available

    1993-04-01

    This booklet is intended for city and county government personnel, as well as community organizations, who deal with supplying, regulating, or recommending electric power resources. Specifically, this document deals with photovoltaic (PV) power, or power from solar cells, which is currently the most cost-effective energy source for electricity requirements that are relatively small, located in isolated areas, or difficult to serve with conventional technology. Recently, PV has been documented to be more cost-effective than conventional alternatives (such as line extensions or engine generators) in dozens of applications within the service territories of electric, gas, and communications utilities. Here, we document numerous cost-effective urban applications, chosen by planners and utilities because they were the most cost-effective option or because they were appropriate for environmental or logistical reasons. These applications occur within various municipal departments, including utility, parks and recreation, traffic engineering, transportation, and planning, and they include lighting applications, communications equipment, corrosion protection, irrigation control equipment, remote monitoring, and even portable power supplies for emergency situations.

  10. Design and implementation of a replay framework based on a partial order planner

    SciTech Connect

    Ihrig, L.H.; Kambhampati, S.

    1996-12-31

    In this paper we describe the design and implementation of the derivation replay framework, DFRSNLP+EBL (Derivational SNLP+EBL), which is based within a partial order planner. DERSNLP+EBL replays previous plan derivations by first repeating its earlier decisions in the context of the new problem situation, then extending the replayed path to obtain a complete solution for the new problem. When the replayed path cannot be extended into a new solution, explanation-based learning (EBL) techniques are employed to identify the features of the new problem which prevent this extension. These features are then added as censors on the retrieval of the stored case. To keep retrieval costs low, DERSNLP+EBL normally stores plan derivations for individual goals, and replays one or more of these derivations in solving multi-goal problems. Cases covering multiple goals are stored only when subplans for individual goals cannot be successfully merged. The aim in constructing the case library is to predict these goal interactions and to store a multi-goal case for each set of negatively interacting goals. We provide empirical results demonstrating the effectiveness of DERSNLP+EBL in improving planning performance on randomly-generated problems drawn from a complex domain.

  11. The Dynamic Planner: The Sequencer, Scheduler, and Runway Allocator for Air Traffic Control Automation

    NASA Technical Reports Server (NTRS)

    Wong, Gregory L.; Denery, Dallas (Technical Monitor)

    2000-01-01

    The Dynamic Planner (DP) has been designed, implemented, and integrated into the Center-TRACON Automation System (CTAS) to assist Traffic Management Coordinators (TMCs), in real time, with the task of planning and scheduling arrival traffic approximately 35 to 200 nautical miles from the destination airport. The TMC may input to the DP a series of current and future scheduling constraints that reflect the operation and environmental conditions of the airspace. Under these constraints, the DP uses flight plans, track updates, and Estimated Time of Arrival (ETA) predictions to calculate optimal runway assignments and arrival schedules that help ensure an orderly, efficient, and conflict-free flow of traffic into the terminal area. These runway assignments and schedules can be shown directly to controllers or they can be used by other CTAS tools to generate advisories to the controllers. Additionally, the TMC and controllers may override the decisions made by the DP for tactical considerations. The DP will adapt to computations to accommodate these manual inputs.

  12. An endorsement-based approach to student modeling for planner-controlled intelligent tutoring systems

    NASA Technical Reports Server (NTRS)

    Murray, William R.

    1990-01-01

    An approach is described to student modeling for intelligent tutoring systems based on an explicit representation of the tutor's beliefs about the student and the arguments for and against those beliefs (called endorsements). A lexicographic comparison of arguments, sorted according to evidence reliability, provides a principled means of determining those beliefs that are considered true, false, or uncertain. Each of these beliefs is ultimately justified by underlying assessment data. The endorsement-based approach to student modeling is particularly appropriate for tutors controlled by instructional planners. These tutors place greater demands on a student model than opportunistic tutors. Numerical calculi approaches are less well-suited because it is difficult to correctly assign numbers for evidence reliability and rule plausibility. It may also be difficult to interpret final results and provide suitable combining functions. When numeric measures of uncertainty are used, arbitrary numeric thresholds are often required for planning decisions. Such an approach is inappropriate when robust context-sensitive planning decisions must be made. A TMS-based implementation of the endorsement-based approach to student modeling is presented, this approach is compared to alternatives, and a project history is provided describing the evolution of this approach.

  13. Beyond hydrology in the sustainability assessment of dams: A planners perspective - The Sarawak experience

    NASA Astrophysics Data System (ADS)

    Andre, Edward

    2012-01-01

    SummaryThere is increasing concern about the availability of water supplies in developing countries to provide clean drinking water and sanitation as well as providing for irrigation for food security. This has led to hydrologically led investigation to establish the feasibility and storage capacity of potentially new dam sites. This task has become more difficult for hydrologists and others with the uncertainties created by climate change and the measurement of the hydrological, geographical and ecological footprint of new dams. The questions asked by hydrologists are increasingly likely to be required to be cast in terms of the four pillars of sustainability; environmental, economic, social and institutional. Similarly, regional planners have to be more cognisant of the social outcomes of dam development while understanding the wider hydrological context at a watershed and basin level. The paper defines the concept of sustainability assessment in the context of resettlement and analyses its implications for the Bakun Hydro-electric project in Sarawak, Malaysia. Specifically it attempts to address the question of what social sustainability would really mean in the context of communities affected by dam projects, and their catchments using hermeneutics, tradeoffs and offsets. The findings of this question were presented at a hydrological conference held in Santiago in October 2010, based on the outcome of specific questionnaire responses received from indigenous peoples affected by the Bakun Dam hydroelectric project. The paper also offers some insights pertaining to the social sustainability assessment aspects of dams and their catchments.

  14. Arsenate Impact on the Metabolite Profile, Production, and Arsenic Loading of Xylem Sap in Cucumbers (Cucumis sativus L.).

    PubMed

    Uroic, M Kalle; Salaün, Pascal; Raab, Andrea; Feldmann, Jörg

    2012-01-01

    Arsenic uptake and translocation studies on xylem sap focus generally on the concentration and speciation of arsenic in the xylem. Arsenic impact on the xylem sap metabolite profile and its production during short term exposure has not been reported in detail. To investigate this, cucumbers were grown hydroponically and arsenate (As(V)) and DMA were used for plant treatment for 24 h. Total arsenic and arsenic speciation in xylem sap was analyzed including a metabolite profiling under As(V) stress. Produced xylem sap was quantified and absolute arsenic transported was determined. As(V) exposure had a significant impact on the metabolite profile of xylem sap. Four m/z values corresponding to four compounds were up-regulated, one compound down-regulated by As(V) exposure. The compound down-regulated was identified to be isoleucine. Furthermore, As(V) exposure had a significant influence on sap production, leading to a reduction of up to 96% sap production when plants were exposed to 1000 μg kg(-1) As(V). No difference to control plants was observed when plants were exposed to 1000 μg kg(-1) DMA. Absolute arsenic amount in xylem sap was the lowest at high As(V) exposure. These results show that As(V) has a significant impact on the production and metabolite profile of xylem sap. The physiological importance of isoleucine needs further attention.

  15. Grape Cultivar and Sap Culture Conditions Affect the Development of Xylella fastidiosa Phenotypes Associated with Pierce's Disease

    PubMed Central

    Hoch, Harvey C.; Burr, Thomas J.; Mowery, Patricia

    2016-01-01

    Xylella fastidiosa is a xylem-limited bacterium in plant hosts and causes Pierce’s disease (PD) of grapevines, which differ in susceptibility according to the Vitis species (spp.). In this work we compared X. fastidiosa biofilm formation and population dynamics when cultured in xylem saps from PD-susceptible and -resistant Vitis spp. under different conditions. Behaviors in a closed-culture system were compared to those in different sap-renewal cultures that would more closely mimic the physicochemical environment encountered in planta. Significant differences in biofilm formation and growth in saps from PD-susceptible and -resistant spp. were only observed using sap renewal culture. Compared to saps from susceptible V. vinifera, those from PD-resistant V. aestivalis supported lower titers of X. fastidiosa and less biofilm and V. champinii suppressed both growth and biofilm formation, behaviors which are correlated with disease susceptibility. Furthermore, in microfluidic chambers X. fastidiosa formed thick mature biofilm with three-dimensional (3-D) structures, such as pillars and mounds, in saps from all susceptible spp. In contrast, only small aggregates of various shapes were formed in saps from four out of five of the resistant spp.; sap from the resistant spp. V. mustangensis was an exception in that it also supported thick lawns of biofilm but not the above described 3-D structures typically seen in a mature biofilm from the susceptible saps. Our findings provide not only critical technical information for future bioassays, but also suggest further understanding of PD susceptibility. PMID:27508296

  16. Biodiversity Monitoring at the Tonle Sap Lake of Cambodia: A Comparative Assessment of Local Methods

    NASA Astrophysics Data System (ADS)

    Seak, Sophat; Schmidt-Vogt, Dietrich; Thapa, Gopal B.

    2012-10-01

    This paper assesses local biodiversity monitoring methods practiced in the Tonle Sap Lake of Cambodia. For the assessment we used the following criteria: methodological rigor, perceived cost, ease of use (user friendliness), compatibility with existing activities, and effectiveness of intervention. Constraints and opportunities for execution of the methods were also considered. Information was collected by use of: (1) key informant interview, (2) focus group discussion, and (3) researcher's observation. The monitoring methods for fish, birds, reptiles, mammals and vegetation practiced in the research area have their unique characteristics of generating data on biodiversity and biological resources. Most of the methods, however, serve the purpose of monitoring biological resources rather than biodiversity. There is potential that the information gained through local monitoring methods can provide input for long-term management and strategic planning. In order to realize this potential, the local monitoring methods should be better integrated with each other, adjusted to existing norms and regulations, and institutionalized within community-based organization structures.

  17. Sap flow is Underestimated by Thermal Dissipation Sensors due to Alterations of Wood Anatomy

    NASA Astrophysics Data System (ADS)

    Marañón-Jiménez, S.; Wiedemann, A.; van den Bulcke, J.; Cuntz, M.; Rebmann, C.; Steppe, K.

    2014-12-01

    The thermal dissipation technique (TD) is one of the most commonly adopted methods for sap flow measurements. However, underestimations of up to 60% of the tree transpiration have been reported with this technique, although the causes are not certainly known. The insertion of TD sensors within the stems causes damage of the wood tissue and subsequent healing reactions, changing wood anatomy and likely the sap flow path. However, the anatomical changes in response to the insertion of sap flow sensors and the effects on the measured flow have not been assessed yet. In this study, we investigate the alteration of vessel anatomy on wounds formed around TD sensors. Our main objectives were to elucidate the anatomical causes of sap flow underestimation for ring-porous and diffuse-porous species, and relate these changes to sap flow underestimations. Successive sets of TD probes were installed in early, mid and end of the growing season in Fagus sylvatica (diffuse-porous) and Quercus petraea (ring-porous) trees. They were logged after the growing season and additional sets of sensors were installed in the logged stems with presumably no healing reaction. The wood tissue surrounding each sensor was then excised and analysed by X-ray computed microtomography (X-ray micro CT). This technique allowed the quantification of vessel anatomical characteristics and the reconstruction of the 3-D internal microstructure of the xylem vessels so that extension and shape of the altered area could be determined. Gels and tyloses clogged the conductive vessels around the sensors in both beech and oak. The extension of the affected area was larger for beech although these anatomical changes led to similar sap flow underestimations in both species. The higher vessel size in oak may explain this result and, therefore, larger sap flow underestimation per area of affected conductive tissue. The wound healing reaction likely occurred within the first weeks after sensor installation, which

  18. Campylobacter fetus sap inversion occurs in the absence of RecA function.

    PubMed

    Ray, K C; Tu, Z C; Grogono-Thomas, R; Newell, D G; Thompson, S A; Blaser, M J

    2000-10-01

    Phase variation of Campylobacter fetus surface layer proteins (SLPs) occurs by inversion of a 6.2-kb DNA segment containing the unique sap promoter, permitting expression of a single SLP-encoding gene. Previous work has shown that the C. fetus sap inversion system is RecA dependent. When we challenged a pregnant ewe with a recA mutant of wild-type C. fetus (strain 97-211) that expressed the 97-kDa SLP, 15 of the 16 ovine-passaged isolates expressed the 97-kDa protein. However, one strain (97-209) expressed a 127-kDa SLP, suggesting that chromosomal rearrangement may have occurred to enable SLP switching. Lack of RecA function in strains 97-211 and 97-209 was confirmed by their sensitivity to the DNA-damaging agent methyl methanesulfonate. Southern hybridization and PCR of these strains indicated that the aphA insertion into recA was stably present. However, Southern hybridizations demonstrated that in strain 97-209 inversion had occurred in the sap locus. PCR data confirmed inversion of the 6.2-kb DNA element and indicated that in these recA mutants the sap inversion frequency is reduced by 2 to 3 log(10) units compared to that in the wild type. Thus, although the major sap inversion pathway in C. fetus is RecA dependent, alternative lower-frequency, RecA-independent inversion mechanisms exist.

  19. Measuring Sap-Flow Velocity at Low Power with a Single Probe

    NASA Astrophysics Data System (ADS)

    Wong, B.; Glaser, S. D.

    2012-12-01

    The measurement of plant evapotranspiration under natural conditions provides information that is useful for real-time water management and understanding ecological services. It is common to use sap flow measurements to estimate ET. The common instruments to measure sap flow are unwieldy to install, consume large amounts of electrical energy, and involve a number of simplifying assumptions to transform from electrical input to heat to sap flow estimates. We present new instrumentation for an ET sensor that uses a single thermistor probe is used to implement a thermal pulse decay method to measure sap-flow velocity, which can then be converted to a volumetric flow-rate that is indicative of plant transpiration. The instrument makes use of the thermistor self-heating mode to rapidly heat the transducer isothermally. The temperature decay over time is directly proportional to sap-flow velocity. The method uses 2 milliamps to make a measurement so that a D-cell battery can supply a useful lifetime for an array of sensors. We show the results of device calibration in controlled laboratory conditions and in the field.

  20. [Stem sap flow and water consumption of Tamarix ramosissima in hinterland of Taklimakan Desert].

    PubMed

    Xu, Hao; Zhang, Xi-Ming; Yan, Hai-Long; Yao, Shi-Jun

    2007-04-01

    From April to November 2005, the stem sap flow and water consumption of Tamarix ramosissima in the hinterland of Taklimakan Desert was measured by Flow-32 System. The results showed that, in the extremely arid hinterland of Taklimakan Desert and under enough water supply, the average daily water consumption of T. ramosissima with a stem diameter of 3.5 cm and 2.0 cm was 6.322 kg and 1.179 kg, respectively in one growth season. The stem sap flow of T. ramosissima presented a single-peaked curve, with an obvious day and night variation rhythm and fluctuated with environment factors. Under enough water supply, the environmenal factors such as total radiation, wind speed and air temperature were the main factors affecting the stem sap flow, and the dynamics of stem sap flow could be predicted by the liner regression model based on total radiation and wind speed. Because of the extremely arid environment and enough water supply, T. ramosissima had a relatively higher stem sap flow rate and a great water consumption.

  1. Symbiotic maple saps minimize disruption of the mice intestinal microbiota after oral antibiotic administration.

    PubMed

    Hammami, Riadh; Ben Abdallah, Nour; Barbeau, Julie; Fliss, Ismail

    2015-01-01

    This study was undertaken to evaluate the in vivo impact of new symbiotic products based on liquid maple sap or its concentrate. Sap and concentrate, with or without inulin (2%), were inoculated with Bifidobacterium lactis Bb12 and Lactobacillus rhamnosus GG valio at initial counts of 2-4 × 10(8) cfu mL(-1). The experiments started with intra-gastric administration of antibiotic (kanamycin 40 mg in 0.1 cc) (to induce microbiota disturbance and/or diarrhea) to 3-to-5-week-old C57BL/6 female mice followed by a combination of prebiotic and probiotics included in the maple sap or its concentrate for a week. The combination inulin and probiotics in maple sap and concentrate appeared to minimize the antibiotic-induced breakdown of mice microbiota with a marked effect on bifidobacterium and bacteroides levels, thus permitting a more rapid re-establishment of the baseline microbiota levels. Results suggest that maple sap and its concentrate represent good candidates for the production of non-dairy functional foods.

  2. Dissolved atmospheric gas in xylem sap measured with membrane inlet mass spectrometry.

    PubMed

    Schenk, H Jochen; Espino, Susana; Visser, Ate; Esser, Bradley K

    2016-04-01

    A new method is described for measuring dissolved gas concentrations in small volumes of xylem sap using membrane inlet mass spectrometry. The technique can be used to determine concentrations of atmospheric gases, such as argon, as reported here, or for any dissolved gases and their isotopes for a variety of applications, such as rapid detection of trace gases from groundwater only hours after they were taken up by trees and rooting depth estimation. Atmospheric gas content in xylem sap directly affects the conditions and mechanisms that allow for gas removal from xylem embolisms, because gas can dissolve into saturated or supersaturated sap only under gas pressure that is above atmospheric pressure. The method was tested for red trumpet vine, Distictis buccinatoria (Bignoniaceae), by measuring atmospheric gas concentrations in sap collected at times of minimum and maximum daily temperature and during temperature increase and decline. Mean argon concentration in xylem sap did not differ significantly from saturation levels for the temperature and pressure conditions at any time of collection, but more than 40% of all samples were supersaturated, especially during the warm parts of day. There was no significant diurnal pattern, due to high variability between samples.

  3. SCF(SAP) controls organ size by targeting PPD proteins for degradation in Arabidopsis thaliana.

    PubMed

    Wang, Zhibiao; Li, Na; Jiang, Shan; Gonzalez, Nathalie; Huang, Xiahe; Wang, Yingchun; Inzé, Dirk; Li, Yunhai

    2016-04-06

    Control of organ size by cell proliferation and growth is a fundamental process, but the mechanisms that determine the final size of organs are largely elusive in plants. We have previously revealed that the ubiquitin receptor DA1 regulates organ size by repressing cell proliferation in Arabidopsis. Here we report that a mutant allele of STERILE APETALA (SAP) suppresses the da1-1 mutant phenotype. We show that SAP is an F-box protein that forms part of a SKP1/Cullin/F-box E3 ubiquitin ligase complex and controls organ size by promoting the proliferation of meristemoid cells. Genetic analyses suggest that SAP may act in the same pathway with PEAPOD1 and PEAPOD2, which are negative regulators of meristemoid proliferation, to control organ size, but does so independently of DA1. Further results reveal that SAP physically associates with PEAPOD1 and PEAPOD2, and targets them for degradation. These findings define a molecular mechanism by which SAP and PEAPOD control organ size.

  4. SAP(E) - A cell-penetrating polyproline helix at lipid interfaces.

    PubMed

    Franz, Johannes; Lelle, Marco; Peneva, Kalina; Bonn, Mischa; Weidner, Tobias

    2016-09-01

    Cell-penetrating peptides (CPPs) are short membrane-permeating amino acid sequences that can be used to deliver cargoes, e.g. drugs, into cells. The mechanism for CPP internalization is still subject of ongoing research. An interesting family of CPPs is the sweet arrow peptides - SAP(E) - which are known to adopt a polyproline II helical secondary structure. SAP(E) peptides stand out among CPPs because they carry a net negative charge while most CPPs are positively charged, the latter being conducive to electrostatic interaction with generally negatively charged membranes. For SAP(E)s, an internalization mechanism has been proposed, based on polypeptide aggregation on the cell surface, followed by an endocytic uptake. However, this process has not yet been observed directly - since peptide-membrane interactions are inherently difficult to monitor on a molecular scale. Here, we use sum frequency generation (SFG) vibrational spectroscopy to investigate molecular interactions of SAP(E) with differently charged model membranes, in both mono- and bi-layer configurations. The data suggest that the initial binding mechanism is accompanied by structural changes of the peptide. Also, the peptide-model membrane interaction depends on the charge of the lipid headgroup with phosphocholine being a favorable binding site. Moreover, while direct penetration has also been observed for some CPPs, the spectroscopy reveals that for SAP(E), its interaction with model membranes remains limited to the headgroup region, and insertion into the hydrophobic core of the lipid layer does not occur.

  5. Observation of Intravascular Changes of Superabsorbent Polymer Microsphere (SAP-MS) with Monochromatic X-Ray Imaging

    SciTech Connect

    Tanimoto, Daigo Ito, Katsuyoshi; Yamamoto, Akira; Sone, Teruki; Kobatake, Makito; Tamada, Tsutomu; Umetani, Keiji

    2010-10-15

    This study was designed to evaluate the intravascular transformation behavior of superabsorbent polymer microsphere (SAP-MS) in vivo macroscopically by using monochromatic X-ray imaging and to quantitatively compare the expansion rate of SAP-MS among different kinds of mixtures. Fifteen rabbits were used for our study and transcatheter arterial embolization (TAE) was performed for their auricular arteries using monochromatic X-ray imaging. We used three kinds of SAP-MS (particle diameter 100-150 {mu}m) mixture as embolic spherical particles: SAP-MS(H) absorbed with sodium meglumine ioxaglate (Hexabrix 320), SAP-MS(V) absorbed with isosmolar contrast medium (Visipaque 270), and SAP-MS(S) absorbed with 0.9% sodium saline. The initial volume of SAP-MS particles just after TAE and its final volume 10 minutes after TAE in the vessel were measured to calculate the expansion rate (ER) (n = 30). Intravascular behavior of SAP-MS particles was clearly observed in real time at monochromatic X-ray imaging. Averaged initial volumes of SAP-MS (H) (1.24 x 10{sup 7} {mu}m{sup 3}) were significantly smaller (p < 0.001) than those of SAP-MS (V) (5.99 x 10{sup 7} {mu}m{sup 3}) and SAP-MS (S) (5.85 x 10{sup 7} {mu}m{sup 3}). Averaged final volumes of SAP-MS (H) were significantly larger than averaged initial volumes (4.41 x 10{sup 7} {mu}m{sup 3} vs. 1.24 x 10{sup 7} {mu}m{sup 3}; p < 0.0001, ER = 3.55). There were no significant difference between averaged final volumes and averaged initial volumes of SAP-MS (V) and SAP-MS (S). SAP-MS (H), which first travels distally, reaches to small arteries, and then expands to adapt to the vessel lumen, is an effective particle as an embolic agent, causing effective embolization.

  6. Measurement and modelling of sap flow in maize plants

    NASA Astrophysics Data System (ADS)

    Heinlein, Florian; Biernath, Christian; Hoffmann, Peter; Klein, Christian; Thieme, Christoph; Priesack, Eckart

    2014-05-01

    Climate change as well as the changing composition of the atmosphere will have an impact on future yield of agricultural plants. In order to better estimate these impacts new, mechanistic plant growth models are needed. These models should be able to dynamically reproduce the plants' reactions to modified climate state variables like temperature, atmospheric CO2-concentration and water availability. In particular, to better describe the crop response to more strongly changing water availability the simulation of plant-internal water and solute transport processes in xylem and phloem needs to be improved. Our existing water transport model consists of two coupled 1-D Richards equations to calculate water transport in the soil and in the plants. This model has already been successfully applied to single Fagus sylvatica L. trees. At present it is adapted to agricultural plants such as maize. To simulate the water transport within the plants a representation of the flow paths, i.e. the plant architecture, is required. Aboveground plant structures are obtained from terrestrial laser scan (TLS) measurements at different development stages. These TLSs have been executed at the lysimeter facilities of Helmholtz Zentrum München and at the TERENO (Terrestrial Environmental Observatories) research farm Scheyern. Additionally, an L-system model is used to simulate aboveground and belowground plant architectures. In a further step, the quality of the explicit water flow model has to be tested using measurements. The Heat-Ratio-Method has been employed to directly measure sap flow in larger maize plants during a two-months-period in summer 2013 with a resolution of 10 minutes and thus, the plants' transpiration can be assessed. Water losses from the soil are determined by measuring the weight of lysimeters. From this evapotranspiration can be calculated. Transpiration and evapotranspiration are also simulated by application of the modelling system Expert-N. This framework

  7. Anti-serum amyloid component P antibodies in patients with systemic lupus erythematosus correlate with disease activity

    PubMed Central

    Zandman-Goddard, G; Blank, M; Langevitz, P; Slutsky, L; Pras, M; Levy, Y; Shovman, O; Witte, T; Doria, A; Rovensky, J; Shoenfeld, Y

    2005-01-01

    Objective: To determine the presence of raised titres of anti-serum amyloid P component (SAP) antibodies in patients with systemic lupus erythematosus (SLE) and to evaluate their correlation with clinical disease by the SLEDAI and clinical manifestations. Methods: 452 samples were screened for raised anti-SAP antibody titres by an ELISA. Clinical measures and SLEDAI scores were independently reviewed from medical records. 21 serial samples from 7 patients with SLE were assessed for a change in anti-SAP antibody titres after treatment. Results: Raised anti-SAP antibody titres were detected in 145/328 (44%) SLE samples. In 112 randomly selected samples, 69/112 (62%) patients had raised anti-SAP antibodies and anti-dsDNA antibody titres, whereas only 32/112 (28%) had raised anti-dsDNA antibody titres without raised anti-SAP antibody titres. The mean titre of anti-SAP antibodies in patients with active disease was higher than in patients with inactive disease and controls. SLEDAI scores, assessed in 54 patients, were raised in 26/31 (84%) patients with raised anti-SAP antibody titres. A SLEDAI score ⩾8 was found in 16/31 (52%) patients with raised anti-SAP antibody titres but in only 5/23 (22%) patients without raised titres. No specific pattern of disease was detected in patients with or without raised titres of anti-SAP antibodies. Serial sampling from patients with active SLE and raised anti-SAP antibody titres showed that anti-SAP antibody titres decreased after treatment and correlated with clinical improvement. Conclusion: Raised anti-SAP antibody titres detected in patients with SLE correlate with disease activity and decrease with improvement of clinical disease, and thus may serve as an additional prognostic marker. PMID:16014675

  8. Vascular Sap Proteomics: Providing Insight into Long-Distance Signaling during Stress

    PubMed Central

    Carella, Philip; Wilson, Daniel C.; Kempthorne, Christine J.; Cameron, Robin K.

    2016-01-01

    The plant vascular system, composed of the xylem and phloem, is important for the transport of water, mineral nutrients, and photosynthate throughout the plant body. The vasculature is also the primary means by which developmental and stress signals move from one organ to another. Due to practical and technological limitations, proteomics analysis of xylem and phloem sap has been understudied in comparison to accessible sample types such as leaves and roots. However, recent advances in sample collection techniques and mass spectrometry technology are making it possible to comprehensively analyze vascular sap proteomes. In this mini-review, we discuss the emerging field of vascular sap proteomics, with a focus on recent comparative studies to identify vascular proteins that may play roles in long-distance signaling and other processes during stress responses in plants. PMID:27242852

  9. Signaling lymphocyte activation molecule-associated protein is a negative regulator of the CD8 T cell response in mice.

    PubMed

    Chen, Gang; Tai, Albert K; Lin, Miao; Chang, Francesca; Terhorst, Cox; Huber, Brigitte T

    2005-08-15

    The primary manifestation of X-linked lymphoproliferative syndrome, caused by a dysfunctional adapter protein, signaling lymphocyte activation molecule-associated protein (SAP), is an excessive T cell response upon EBV infection. Using the SAP-/- mouse as a model system for the human disease, we compared the response of CD8+ T cells from wild-type (wt) and mutant mice to various stimuli. First, we observed that CD8+ T cells from SAP-/- mice proliferate more vigorously than those from wt mice upon CD3/CD28 cross-linking in vitro. Second, we analyzed the consequence of SAP deficiency on CTL effector function and homeostasis. For this purpose, SAP-/- and wt mice were infected with the murine gamma-herpesvirus 68 (MHV-68). At 2 wk postinfection, the level of viral-specific CTL was much higher in mutant than in wt mice, measured both ex vivo and in vivo. In addition, we established that throughout 45 days of MHV-68 infection the frequency of virus-specific CD8+ T cells producing IFN-gamma was significantly higher in SAP-/- mice. Consequently, the level of latent infection by MHV-68 was considerably lower in SAP-/- mice, which indicates that SAP-/- CTL control this infection more efficiently than wt CTL. Finally, we found that the Vbeta4-specific CD8+ T cell expansion triggered by MHV-68 infection is also enhanced and prolonged in SAP-/- mice. Taken together, our data indicate that SAP functions as a negative regulator of CD8+ T cell activation.

  10. Sap flow measurement in a street and park of a hot and arid city

    NASA Astrophysics Data System (ADS)

    Cohen, S.; Shashua-Bar, L.; Potchter, O.; Yaakov, Y.; Bar-Kutiel, P.; Tanny, J.

    2012-04-01

    Urban trees mitigate hot climate by shading, but also through transpirational cooling. Transpiration from urban trees can be a significant part of the urban energy budget, but is difficult to quantify. A direct method for measuring tree transpiration is through the use of sap flow sensors. Several methods have been developed for this, where the most common use heat as a tracer of sap flow. The most popular method among plant environmental ecologists is the thermal dissipation or 'Granier' method, the latter name for its inventor. In this method continuously heated and unheated sensors are inserted into the tree stem and the temperature difference between the two is roughly inversely proportional to sap flux density. Although the method can be accurate, sap flux density can be highly variable in the stem, depending on depth in the stem and azimuth. Inter-tree variation is also large, so a number of sensors per tree and a number of trees need to be monitored for accurate determinations. Finally, it is a good idea to calibrate the sensors for the configuration and species being monitored. We measured sap flow in a tree covered open mall and a city park in Beer Sheva, Israel - a hot and arid city. Trees that shaded the open mall were of the Delonix regia species while those in the park were Prosopis and Tamarix sp. Individual tree sap flux for large trees exceeded 100 liters on many of the days, equivalent to over 100 W m-2 at mid-day. This paper will discuss methodological issues as well as some of the results.

  11. Sap flow characteristics of neotropical mangroves in flooded and drained soils

    USGS Publications Warehouse

    Krauss, Ken W.; Young, P. Joy; Chambers, Jim L.; Doyle, Thomas W.; Twilley, Robert R.

    2007-01-01

    Effects of flooding on water transport in mangroves have previously been investigated in a few studies, most of which were conducted on seedlings in controlled settings. In this study, we used heat-dissipation sap probes to determine if sap flow (Js) attenuates with radial depth into the xylem of mature trees of three south Florida mangrove species growing in Rookery Bay. This was accomplished by inserting sap probes at multiple depths and monitoring diurnal flow. For most species and diameter size class combinations tested, Js decreased dramatically beyond a radial depth of 2 or 4 cm, with little sap flow beyond a depth of 6 cm. Mean Js was reduced on average by 20% in Avicennia germinans (L.) Stearn, Laguncularia racemosa (L.) Gaertn. f. and Rhizophora mangle L. trees when soils were flooded. Species differences were highly significant, with L. racemosahaving the greatest midday Js of about 26g H2O H2O m−2s−1 at a radial depth of 2 cm compared with a mean for the other two species of about 15 g H2O m−2s−1. Sap flow at a depth of 2 cm in mangroves was commensurate with rates reported for other forested wetland tree species. We conclude that: (1) early spring flooding of basin mangrove forests causes reductions in sap flow in mature mangrove trees; (2) the sharp attenuations in Js along the radial profile have implications for understanding whole-tree water use strategies by mangrove forests; and (3) regardless of flood state, individual mangrove tree water use follows leaf-level mechanisms in being conservative.

  12. Changes in the Proteome of Xylem Sap in Brassica oleracea in Response to Fusarium oxysporum Stress.

    PubMed

    Pu, Zijing; Ino, Yoko; Kimura, Yayoi; Tago, Asumi; Shimizu, Motoki; Natsume, Satoshi; Sano, Yoshitaka; Fujimoto, Ryo; Kaneko, Kentaro; Shea, Daniel J; Fukai, Eigo; Fuji, Shin-Ichi; Hirano, Hisashi; Okazaki, Keiichi

    2016-01-01

    Fusarium oxysporum f.sp. conlutinans (Foc) is a serious root-invading and xylem-colonizing fungus that causes yellowing in Brassica oleracea. To comprehensively understand the interaction between F. oxysporum and B. oleracea, composition of the xylem sap proteome of the non-infected and Foc-infected plants was investigated in both resistant and susceptible cultivars using liquid chromatography-tandem mass spectrometry (LC-MS/MS) after in-solution digestion of xylem sap proteins. Whole genome sequencing of Foc was carried out and generated a predicted Foc protein database. The predicted Foc protein database was then combined with the public B. oleracea and B. rapa protein databases downloaded from Uniprot and used for protein identification. About 200 plant proteins were identified in the xylem sap of susceptible and resistant plants. Comparison between the non-infected and Foc-infected samples revealed that Foc infection causes changes to the protein composition in B. oleracea xylem sap where repressed proteins accounted for a greater proportion than those of induced in both the susceptible and resistant reactions. The analysis on the proteins with concentration change > = 2-fold indicated a large portion of up- and down-regulated proteins were those acting on carbohydrates. Proteins with leucine-rich repeats and legume lectin domains were mainly induced in both resistant and susceptible system, so was the case of thaumatins. Twenty-five Foc proteins were identified in the infected xylem sap and 10 of them were cysteine-containing secreted small proteins that are good candidates for virulence and/or avirulence effectors. The findings of differential response of protein contents in the xylem sap between the non-infected and Foc-infected samples as well as the Foc candidate effectors secreted in xylem provide valuable insights into B. oleracea-Foc interactions.

  13. Uncertainty in sap flow-based transpiration due to xylem properties

    NASA Astrophysics Data System (ADS)

    Looker, N. T.; Hu, J.; Martin, J. T.; Jencso, K. G.

    2014-12-01

    Transpiration, the evaporative loss of water from plants through their stomata, is a key component of the terrestrial water balance, influencing streamflow as well as regional convective systems. From a plant physiological perspective, transpiration is both a means of avoiding destructive leaf temperatures through evaporative cooling and a consequence of water loss through stomatal uptake of carbon dioxide. Despite its hydrologic and ecological significance, transpiration remains a notoriously challenging process to measure in heterogeneous landscapes. Sap flow methods, which estimate transpiration by tracking the velocity of a heat pulse emitted into the tree sap stream, have proven effective for relating transpiration dynamics to climatic variables. To scale sap flow-based transpiration from the measured domain (often <5 cm of tree cross-sectional area) to the whole-tree level, researchers generally assume constancy of scale factors (e.g., wood thermal diffusivity (k), radial and azimuthal distributions of sap velocity, and conducting sapwood area (As)) through time, across space, and within species. For the widely used heat-ratio sap flow method (HRM), we assessed the sensitivity of transpiration estimates to uncertainty in k (a function of wood moisture content and density) and As. A sensitivity analysis informed by distributions of wood moisture content, wood density and As sampled across a gradient of water availability indicates that uncertainty in these variables can impart substantial error when scaling sap flow measurements to the whole tree. For species with variable wood properties, the application of the HRM assuming a spatially constant k or As may systematically over- or underestimate whole-tree transpiration rates, resulting in compounded error in ecosystem-scale estimates of transpiration.

  14. Sap flow characteristics of neotropical mangroves in flooded and drained soils.

    PubMed

    Krauss, Ken W; Young, P Joy; Chambers, Jim L; Doyle, Thomas W; Twilley, Robert R

    2007-05-01

    Effects of flooding on water transport in mangroves have previously been investigated in a few studies, most of which were conducted on seedlings in controlled settings. In this study, we used heat-dissipation sap probes to determine if sap flow (J(s)) attenuates with radial depth into the xylem of mature trees of three south Florida mangrove species growing in Rookery Bay. This was accomplished by inserting sap probes at multiple depths and monitoring diurnal flow. For most species and diameter size class combinations tested, J(s) decreased dramatically beyond a radial depth of 2 or 4 cm, with little sap flow beyond a depth of 6 cm. Mean J(s) was reduced on average by 20% in Avicennia germinans (L.) Stearn, Laguncularia racemosa (L.) Gaertn. f. and Rhizophora mangle L. trees when soils were flooded. Species differences were highly significant, with L. racemosa having the greatest midday J(s) of about 26 g H(2)O m(-2) s(-1) at a radial depth of 2 cm compared with a mean for the other two species of about 15 g H(2)O m(-2) s(-1). Sap flow at a depth of 2 cm in mangroves was commensurate with rates reported for other forested wetland tree species. We conclude that: (1) early spring flooding of basin mangrove forests causes reductions in sap flow in mature mangrove trees; (2) the sharp attenuations in J(s) along the radial profile have implications for understanding whole-tree water use strategies by mangrove forests; and (3) regardless of flood state, individual mangrove tree water use follows leaf-level mechanisms in being conservative.

  15. Campylobacter fetus uses multiple loci for DNA inversion within the 5' conserved regions of sap homologs.

    PubMed

    Tu, Z C; Ray, K C; Thompson, S A; Blaser, M J

    2001-11-01

    Campylobacter fetus cells possess multiple promoterless sap homologs, each capable of expressing a surface layer protein (SLP) by utilizing a unique promoter present on a 6.2-kb invertible element. Each sap homolog includes a 626-bp 5' conserved region (FCR) with 74 bp upstream and 552 bp within the open reading frame. After DNA inversion, the splice is seamless because the FCRs are identical. In mutant strain 23D:ACA2K101, in which sapA and sapA2 flanking the invertible element in opposite orientations were disrupted by promoterless chloramphenicol resistance (Cm(r)) and kanamycin resistance (Km(r)) cassettes, respectively, the frequency of DNA inversion is 100-fold lower than that of wild-type strain 23D. To define the roles of a 15-bp inverted repeat (IR) and a Chi-like site (CLS) in the FCR, we mutagenized each upstream of sapA2 in 23D:ACA2K101 by introducing NotI and KpnI sites to create strains 23D:ACA2K101N and 23D:ACA2K101K, respectively. Alternatively selecting colonies for Cm(r) or Km(r) showed that mutagenizing the IR or CLS had no apparent effect on the frequency of the DNA inversion. However, mapping the unique NotI or KpnI site in relation to the Cm(r) or Km(r) cassette in the cells that changed phenotype showed that splices occurred both upstream and downstream of the mutated sites. PCR and sequence analyses also showed that the splice could occur in the 425-bp portion of the FCR downstream of the cassettes. In total, these data indicate that C. fetus can use multiple sites within the FCR for its sap-related DNA inversion.

  16. Measurement of sap flow in roots of woody plants: a commentary.

    PubMed

    Burgess, S S; Adams, M A; Bleby, T M

    2000-07-01

    Measurements of sap flow in roots have recently been used to study patterns of resource acquisition by woody plants; however, the various thermometric methods employed have yielded disparate findings. These findings may be harmonized by accounting for the phenomenon of reverse sap flow in roots. We suggest that only methods capable of measuring slow and reverse rates of flow and that do not require assumptions of zero flow during the night are applicable to studies with roots. The heat ratio method and the constant power heat balance method fit these criteria, whereas the constant temperature heat balance, compensation heat pulse and thermal dissipation methods do not.

  17. Regional Evapotranspiration Estimation by Using Wireless Sap Flow and Soil Moisture Measurement Systems

    NASA Astrophysics Data System (ADS)

    Kuo, C.; Yu, P.; Yang, T.; Davis, T. W.; Liang, X.; Tseng, C.; Cheng, C.

    2011-12-01

    The objective of this study proposed herein is to estimate regional evapotranspiration via sap flow and soil moisture measurements associated with wireless sensor network in the field. Evapotranspiration is one of the important factors in water balance computation. Pan evaporation collected from the meteorological station can only be accounted as a single-point scale measurement rather than the water loss of the entire region. Thus, we need a multiple-site measurement for understanding the regional evapotranspiration. Applying sap flow method with self-made probes, we could calculate transpiration. Soil moisture measurement was used to monitor the daily soil moisture variety for evaporation. Sap flow and soil moisture measurements in multiple sites are integrated by using wireless sensor network (WSN). Then, the measurement results of each site were scaled up and combined into the regional evapotranspiration. This study used thermal dissipation method to measure sap flow in trees to represent the plant transpiration. Sap flow was measured by using the self-made sap probes which needed to be calibrated before setting up at the observation field. Regional transpiration was scaled up through the Leaf Area Index (LAI). The LAI of regional scale was from the MODIS image calculated at 1km X 1km grid size. The soil moistures collected from areas outside the distributing area of tree roots and tree canopy were used to represent the evaporation. The observation was undertaken to collect soil moisture variety from five different soil depths of 10, 20, 30, 40 and 50 cm respectively. The regional evaporation can be estimated by averaging the variation of soil moisture from each site within the region. The result data measured by both sap flow and soil moisture measurements of each site were collected through the wireless sensor network. The WSN performs the functions of P2P and mesh networking. That can collect data in multiple locations simultaneously and has less power

  18. The density of the cell sap and endoplasm of Nitellopsis and Chara

    NASA Technical Reports Server (NTRS)

    Wayne, R.; Staves, M. P.

    1991-01-01

    We measured the densities of the cell sap, endoplasm and cell wall of Nitellopsis obtusa and Chara corallina using interference microscopy, refractometry, immersion refractometry, equilibrium sedimentation and chemical microanalysis techniques. These values are important for the determination of many rheological properties of the cytoplasm as well as for understanding buoyancy regulation, dispersal mechanisms and how cells respond to gravity. The average densities of the cell sap, endoplasm and cell wall are 1,006.9, 1,016.7 and 1,371 kg m-3 for Nitellopsis and 1,005.0, 1,013.9, and 1,355.3 kg m-3 for Chara.

  19. Estimating sap flux densities in date palm trees using the heat dissipation method and weighing lysimeters.

    PubMed

    Sperling, Or; Shapira, Or; Cohen, Shabtai; Tripler, Effi; Schwartz, Amnon; Lazarovitch, Naftali

    2012-09-01

    In a world of diminishing water reservoirs and a rising demand for food, the practice and development of water stress indicators and sensors are in rapid progress. The heat dissipation method, originally established by Granier, is herein applied and modified to enable sap flow measurements in date palm trees in the southern Arava desert of Israel. A long and tough sensor was constructed to withstand insertion into the date palm's hard exterior stem. This stem is wide and fibrous, surrounded by an even tougher external non-conducting layer of dead leaf bases. Furthermore, being a monocot species, water flow does not necessarily occur through the outer part of the palm's stem, as in most trees. Therefore, it is highly important to investigate the variations of the sap flux densities and determine the preferable location for sap flow sensing within the stem. Once installed into fully grown date palm trees stationed on weighing lysimeters, sap flow as measured by the modified sensors was compared with the actual transpiration. Sap flow was found to be well correlated with transpiration, especially when using a recent calibration equation rather than the original Granier equation. Furthermore, inducing the axial variability of the sap flux densities was found to be highly important for accurate assessments of transpiration by sap flow measurements. The sensors indicated no transpiration at night, a high increase of transpiration from 06:00 to 09:00, maximum transpiration at 12:00, followed by a moderate reduction until 08:00; when transpiration ceased. These results were reinforced by the lysimeters' output. Reduced sap flux densities were detected at the stem's mantle when compared with its center. These results were reinforced by mechanistic measurements of the stem's specific hydraulic conductivity. Variance on the vertical axis was also observed, indicating an accelerated flow towards the upper parts of the tree and raising a hypothesis concerning dehydrating

  20. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  1. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  2. 30 CFR 585.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 585.659 Section 585.659 Mineral Resources BUREAU OF OCEAN ENERGY... What requirements must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply...

  3. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  4. 30 CFR 585.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 585.659 Section 585.659 Mineral Resources BUREAU OF OCEAN ENERGY... What requirements must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply...

  5. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  6. 49 CFR 40.287 - What information is an employer required to provide concerning SAP services to an employee who...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... provide concerning SAP services to an employee who has a DOT drug and alcohol regulation violation? 40.287... § 40.287 What information is an employer required to provide concerning SAP services to an employee who... (including an applicant or new employee) who violates a DOT drug and alcohol regulation a listing of...

  7. 30 CFR 285.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 285.659 Section 285.659 Mineral Resources BUREAU OF OCEAN ENERGY... Pipeline Deviations § 285.659 What requirements must I include in my SAP, COP, or GAP regarding air...

  8. 30 CFR 285.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 285.659 Section 285.659 Mineral Resources MINERALS MANAGEMENT SERVICE... must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply with the Clean Air...

  9. Genetic variability of the phloem sap metabolite content of maize (Zea mays L.) during the kernel-filling period.

    PubMed

    Yesbergenova-Cuny, Zhazira; Dinant, Sylvie; Martin-Magniette, Marie-Laure; Quilleré, Isabelle; Armengaud, Patrick; Monfalet, Priscilla; Lea, Peter J; Hirel, Bertrand

    2016-11-01

    Using a metabolomic approach, we have quantified the metabolite composition of the phloem sap exudate of seventeen European and American lines of maize that had been previously classified into five main groups on the basis of molecular marker polymorphisms. In addition to sucrose, glutamate and aspartate, which are abundant in the phloem sap of many plant species, large quantities of aconitate and alanine were also found in the phloem sap exudates of maize. Genetic variability of the phloem sap composition was observed in the different maize lines, although there was no obvious relationship between the phloem sap composition and the five previously classified groups. However, following hierarchical clustering analysis there was a clear relationship between two of the subclusters of lines defined on the basis of the composition of the phloem sap exudate and the earliness of silking date. A comparison between the metabolite contents of the ear leaves and the phloem sap exudates of each genotype, revealed that the relative content of most of the carbon- and nitrogen-containing metabolites was similar. Correlation studies performed between the metabolite content of the phloem sap exudates and yield-related traits also revealed that for some carbohydrates such as arabitol and sucrose there was a negative or positive correlation with kernel yield and kernel weight respectively. A posititive correlation was also found between kernel number and soluble histidine.

  10. 30 CFR 585.659 - What requirements must I include in my SAP, COP, or GAP regarding air quality?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false What requirements must I include in my SAP, COP, or GAP regarding air quality? 585.659 Section 585.659 Mineral Resources BUREAU OF OCEAN ENERGY... What requirements must I include in my SAP, COP, or GAP regarding air quality? (a) You must comply...

  11. Molecular characterization of a novel vegetative insecticidal protein from Bacillus thuringiensis effective against sap-sucking insect pest.

    PubMed

    Sattar, Sampurna; Maiti, Mrinal K

    2011-09-01

    Several isolates of Bacillus thuringiensis (Bt) were screened for the vegetative insecticidal protein (Vip) effective against sap-sucking insect pests. Screening results were based on LC(50) values against cotton aphid (Aphis gossypii), one of the dangerous pests of various crop plants including cotton. Among the isolates, the Bt#BREF24 showed promising results, and upon purification the aphidicidal protein was recognized as a binary toxin. One of the components of this binary toxin was identified by peptide sequencing to be a homolog of Vip2A that has been reported previously in other Bacillus spp. Vip2 belongs to the binary toxin group Vip1-Vip2, and is responsible for the enzymatic activity; and Vip1 is the translocation and receptor binding protein. The two genes encoding the corresponding proteins of the binary toxin, designated as vip2Ae and vip1Ae, were cloned from the Bt#BREF24, sequenced, and heterologously expressed in Escherichia coli. Aphid feeding assay with the recombinant proteins confirmed that these proteins are indeed the two components of the binary toxins, and the presence of both partners is essential for the activity. Aphid specificity of the binary toxin was further verified by ligand blotting experiment, which identified an ~50 kDa receptor in the brush border membrane vesicles of the cotton aphids only, but not in the lepidopteran insects. Our finding holds a promise of its use in future as a candidate gene for developing transgenic crop plants tolerant against sap-sucking insect pests.

  12. Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh

    PubMed Central

    Nahar, Nazmun; Paul, Repon C.; Sultana, Rebeca; Gurley, Emily S.; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P.

    2015-01-01

    Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1–1.3, p<0.001). When sap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9–1.1, p = 0.512). Respondents’ knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission. PMID:26551202

  13. Dams on Mekong tributaries as significant contributors of hydrological alterations to the Tonle Sap Floodplain in Cambodia

    NASA Astrophysics Data System (ADS)

    Arias, M. E.; Piman, T.; Lauri, H.; Cochrane, T. A.; Kummu, M.

    2014-02-01

    River tributaries have a key role in the biophysical functioning of the Mekong Basin. Of particular attention are the Sesan, Srepok, and Sekong (3S) rivers, which contribute nearly a quarter of the total Mekong discharge. Forty two dams are proposed in the 3S, and once completed they will exceed the active storage of China's large dam cascade in the upper Mekong. Given their proximity to the lower Mekong floodplains, the 3S dams could alter the flood-pulse hydrology driving the productivity of downstream ecosystems. Therefore, the main objective of this study was to quantify how hydropower development in the 3S would alter the hydrology of the Tonle Sap floodplain, the largest wetland in the Mekong and home to one of the most productive inland fisheries in the world. We coupled results from four numerical models representing the basin's surface hydrology, water resources development, and floodplain hydrodynamics. The scale of alterations caused by hydropower in the 3S was compared with the basin's definite future development scenario (DF) driven by the upper Mekong dam cascade. The DF or the 3S development scenarios could independently increase Tonle Sap's 30 day minimum water levels by 30 ± 5 cm and decrease annual water level fall rates by 0.30 ± 0.05 cm d-2. When analyzed together (DF + 3S), these scenarios are likely to eliminate all baseline conditions (1986-2000) of extreme low water levels, a particularly important component of Tonle Sap's environmental flows. Given the ongoing trends and large economic incentives in the hydropower business in the region, there is a high possibility that most of the 3S hydropower potential will actually be exploited and that dams would be built even in locations where there is a high risk of ecological disruptions. Hence, retrofitting current designs and operations to promote sustainable hydropower practices that optimize multiple river services - rather than just maximize hydropower generation - appear to be the most

  14. Dams on Mekong tributaries as significant contributors of hydrological alterations to the Tonle Sap Floodplain in Cambodia

    NASA Astrophysics Data System (ADS)

    Arias, M. E.; Piman, T.; Lauri, H.; Cochrane, T. A.; Kummu, M.

    2014-12-01

    River tributaries have a key role in the biophysical functioning of the Mekong Basin. Of particular interest are the Sesan, Srepok, and Sekong (3S) rivers, which contribute nearly a quarter of the total Mekong discharge. Forty two dams are proposed in the 3S, and once completed they will exceed the active storage of China's large dam cascade in the Upper Mekong. Given their proximity to the Lower Mekong floodplains, the 3S dams could alter the flood-pulse hydrology driving the productivity of downstream ecosystems. Therefore, the main objective of this study was to quantify how hydropower development in the 3S, together with definite future (DF) plans for infrastructure development through the basin, would alter the hydrology of the Tonle Sap's Floodplain, the largest wetland in the Mekong and home to one of the most productive inland fisheries in the world. We coupled results from four numerical models representing the basin's surface hydrology, water resources development, and floodplain hydrodynamics. The scale of alterations caused by hydropower in the 3S was compared with the basin's DF scenario driven by the Upper Mekong dam cascade. The DF or the 3S development scenarios could independently increase Tonle Sap's 30-day minimum water levels by 30 ± 5 cm and decrease annual water level fall rates by 0.30 ± 0.05 cm day-1. When analyzed together (DF + 3S), these scenarios are likely to eliminate all baseline conditions (1986-2000) of extreme low water levels, a particularly important component of Tonle Sap's environmental flows. Given the ongoing trends and large economic incentives in the hydropower business in the region, there is a high possibility that most of the 3S hydropower potential will be exploited and that dams will be built even in locations where there is a high risk of ecological disruption. Hence, retrofitting current designs and operations to promote sustainable hydropower practices that optimize multiple river services - rather than just

  15. Effect of L-Valine on the growth and characterization of Sodium Acid Phthalate (SAP) single crystals

    NASA Astrophysics Data System (ADS)

    Nirmala, L. Ruby; Prakash, J. Thomas Joseph

    2013-06-01

    Undoped and amino acid doped good quality single crystals of Sodium Acid Phthalate crystals (SAP) were grown by slow evaporation solution growth technique which are semiorganic in nature. The effect of amino acid (L-Valine) dopant on the growth and the properties of SAP single crystal was investigated. The single crystal X-ray diffraction studies and FT-IR studies were carried out to identify the crystal structure and the presence of functional groups in undoped and L-Valine doped SAP crystals. The transparent nature of the grown crystal was observed using UV-Visible spectrum. The thermal decomposition of the doped SAP crystals was investigated by thermo gravimetric analysis (TGA) and differential thermal analysis (DTA). The enhancement in the NLO property of the undoped and L-Valine doped SAP crystals using KDP crystal as a reference was studied using SHG measurements. Vickers micro hardness measurements are used for the study of mechanical strength of the grown crystals.

  16. Phylogeny and expression analysis of C-reactive protein (CRP) and serum amyloid-P (SAP) like genes reveal two distinct groups in fish.

    PubMed

    Lee, P T; Bird, S; Zou, J; Martin, S A M

    2017-03-20

    The acute phase response (APR) is an early innate immune function that is initiated by inflammatory signals, leading to the release of acute phase proteins to the bloodstream to re-establish homeostasis following microbial infection. In this study we analysed the Atlantic salmon (Salmo salar) whole-genome database and identified five C-reactive protein (CRP)/serum amyloid P component (SAP) like molecules namely CRP/SAP-1a, CRP/SAP-1b, CRP/SAP-1c, CRP/SAP-2 and CRP/SAP-3. These CRP/SAP genes formed two distinct sub-families, a universal group (group I) present in all vertebrates and a fish/amphibian specific group (group II). Salmon CRP/SAP-1a, CRP/SAP-1b and CRP/SAP-1c and CRP/SAP-2 belong to the group I family whilst salmon CRP/SAP-3 is a member of group II. Gene expression analysis showed that the salmon CRP/SAP-1a as well as serum amyloid A-5 (SAA-5), one of the major acute phase proteins, were significantly up-regulated by recombinant cytokines (rIL-1β and rIFNγ) in primary head kidney cells whilst the other four CRP/SAPs remained refractory. Furthermore, SAA-5 was produced as the main acute phase protein (APP) in Atlantic salmon challenged with Aeromonas salmonicida (aroA(-) strain) whilst salmon CRP/SAPs remained unaltered. Overall, these data illustrate the potential different functions of expanded salmon CRP/SAPs to their mammalian homologues.

  17. Effects of Transparency on Pilot Trust and Agreement in the Autonomous Constrained Flight Planner

    NASA Technical Reports Server (NTRS)

    Sadler, Garrett; Battiste, Henri; Ho, Nhut; Hoffmann, Lauren; Lyons, Joseph; Johnson, Walter; Shively, Robert; Smith, David

    2016-01-01

    We performed a human-in-the-loop study to explore the role of transparency in engendering trust and reliance within highly automated systems. Specifically, we examined how transparency impacts trust in and reliance upon the Autonomous Constrained Flight Planner (ACFP), a critical automated system being developed as part of NASA's Reduced Crew Operations (RCO) Concept. The ACFP is designed to provide an enhanced ground operator, termed a super dispatcher, with recommended diversions for aircraft when their primary destinations are unavailable. In the current study, 12 commercial transport rated pilots who played the role of super dispatchers were given six time-pressured all land scenarios where they needed to use the ACFP to determine diversions for multiple aircraft. Two factors were manipulated. The primary factor was level of transparency. In low transparency scenarios the pilots were given a recommended airport and runway, plus basic information about the weather conditions, the aircraft types, and the airport and runway characteristics at that and other airports. In moderate transparency scenarios the pilots were also given a risk evaluation for the recommended airport, and for the other airports if they requested it. In the high transparency scenario additional information including the reasoning for the risk evaluations was made available to the pilots. The secondary factor was level of risk, either high or low. For high-risk aircraft, all potential diversions were rated as highly risky, with the ACFP giving the best option for a bad situation. For low-risk aircraft the ACFP found only low-risk options for the pilot. Both subjective and objective measures were collected, including rated trust, whether the pilots checked the validity of the automation recommendation, and whether the pilots eventually flew to the recommended diversion airport. Key results show that: 1) Pilots trust increased with higher levels of transparency, 2) Pilots were more likely to

  18. Climate Resiliency Planning: Making Extreme Event Science Useful for Managers and Planners in Northern Nevada

    NASA Astrophysics Data System (ADS)

    McCarthy, M.; Kenneston, A.; Wall, T. U.; Brown, T. J.; Redmond, K. T.

    2014-12-01

    Effective climate resiliency planning at the regional level requires extensive interactive dialogue among climate scientists, emergency managers, public health officials, urban planners, social scientists, and policy makers. Engaging federal, tribal, state, local governments and private sector business and infrastructure owners/operators in defining, assessing and characterizing the impacts of extreme events allows communities to understand how different events "break the system" forcing local communities to seek support and resources from state/federal governments and/or the private sector and what actions can be taken proactively to mitigate consequences and accelerate recovery. The Washoe County Regional Resiliency Study was prepared in response to potential climate variability related impacts specific to the Northern Nevada Region. The last several decades have seen dramatic growth in the region, coupled with increased resource demands that have forced local governments to consider how those impacts will affect the region and may, in turn, impact the region's ability to provide essential services. The Western Regional Climate Center of the Desert Research Institute provided a synthesis of climate studies with predictions regarding plausible changes in the local climate of Northern California and Nevada for the next 50 years. In general, these predictions indicate that the region's climate is undergoing a gradual shift, which will primarily affect the frequency, amount, and form of precipitation in the Sierra Nevada and Great Basin. Changes in water availability and other extreme events may have serious and long lasting effects in the Northern Nevada Region, and create a variety of social, environmental and economic concerns. A range of extreme events were considered including Adverse Air Quality, Droughts, Floods, Heat Waves, High Wind, Structure Fires, Wildland Fires, and Major Winter Storms. Due to the complexity of our climate systems, and the difficulty in

  19. Seasonal and diel variation in xylem CO2 concentration and sap pH in sub-Mediterranean oak stems.

    PubMed

    Salomón, Roberto; Valbuena-Carabaña, María; Teskey, Robert; McGuire, Mary Anne; Aubrey, Doug; González-Doncel, Inés; Gil, Luis; Rodríguez-Calcerrada, Jesús

    2016-04-01

    Since a substantial portion of respired CO2 remains within the stem, diel and seasonal trends in stem CO2 concentration ([CO2]) are of major interest in plant respiration and carbon budget research. However, continuous long-term stem [CO2] studies are scarce, and generally absent in Mediterranean climates. In this study, stem [CO2] was monitored every 15min together with stem and air temperature, sap flow, and soil water storage during a growing season in 16 stems of Quercus pyrenaica to elucidate the main drivers of stem [CO2] at different temporal scales. Fluctuations in sap pH were also assessed during two growing seasons to evaluate potential errors in estimates of the concentration of CO2 dissolved in xylem sap ([CO2*]) calculated using Henry's law. Stem temperature was the best predictor of stem [CO2] and explained more than 90% and 50% of the variability in stem [CO2] at diel and seasonal scales, respectively. Under dry conditions, soil water storage was the main driver of stem [CO2]. Likewise, the first rains after summer drought caused intense stem [CO2] pulses, suggesting enhanced stem and root respiration and increased resistance to radial CO2 diffusion. Sap flow played a secondary role in controlling stem [CO2] variations. We observed night-time sap pH acidification and progressive seasonal alkalinization. Thus, if the annual mean value of sap pH (measured at midday) was assumed to be constant, night-time sap [CO2*] was substantially overestimated (40%), and spring and autumn sap [CO2*] were misestimated by 25%. This work highlights that diel and seasonal variations in temperature, tree water availability, and sap pH substantially affect xylem [CO2] and sap [CO2*].

  20. Interactions Between QTL SAP6 and SU91 on Resistance to Common Bacterial Blight in Red Kidney Bean and Pinto Bean Populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to common bacterial blight in common bean is a complex trait that is quantitatively inherited. We examined the interaction between two independent QTL, SAP6 and SU91, which condition resistance to CBB.The QTL were studied in a pinto bean F2 population a cross between Othello (sap6 sap6 //...

  1. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  2. 30 CFR 585.611 - What information must I submit with my SAP to assist BOEM in complying with NEPA and other...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What information must I submit with my SAP to... of the Site Assessment Plan § 585.611 What information must I submit with my SAP to assist BOEM in complying with NEPA and other relevant laws? (a) You must submit with your SAP detailed information...

  3. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  4. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  5. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  6. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  7. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  8. 30 CFR 285.611 - What information must I submit with my SAP to assist MMS in complying with NEPA and other...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What information must I submit with my SAP to... Assessment Plan § 285.611 What information must I submit with my SAP to assist MMS in complying with NEPA and other relevant laws? (a) You must submit with your SAP detailed information to assist MMS in...

  9. 30 CFR 585.611 - What information must I submit with my SAP to assist BOEM in complying with NEPA and other...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What information must I submit with my SAP to... of the Site Assessment Plan § 585.611 What information must I submit with my SAP to assist BOEM in complying with NEPA and other relevant laws? (a) You must submit with your SAP detailed information...

  10. 30 CFR 285.611 - What information must I submit with my SAP to assist MMS in complying with NEPA and other...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What information must I submit with my SAP to... Requirements Contents of the Site Assessment Plan § 285.611 What information must I submit with my SAP to assist MMS in complying with NEPA and other relevant laws? (a) You must submit with your SAP...

  11. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  12. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  13. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  14. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  15. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  16. 49 CFR 40.309 - What are the employer's responsibilities with respect to the SAP's directions for follow-up tests?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... respect to the SAP's directions for follow-up tests? 40.309 Section 40.309 Transportation Office of the... responsibilities with respect to the SAP's directions for follow-up tests? (a) As the employer, you must carry out the SAP's follow-up testing requirements. You may not allow the employee to continue to perform...

  17. 49 CFR 40.313 - Where is other information on SAP functions and the return-to-duty process found in this regulation?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false Where is other information on SAP functions and... on SAP functions and the return-to-duty process found in this regulation? You can find other information on the role and functions of SAPs in the following sections of this part: § 40.3—Definition. §...

  18. 30 CFR 585.611 - What information and certifications must I submit with my SAP to assist BOEM in complying with...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... submit with my SAP to assist BOEM in complying with NEPA and other relevant laws? 585.611 Section 585.611... with my SAP to assist BOEM in complying with NEPA and other relevant laws? You must submit, with your SAP, detailed information to assist BOEM in complying with NEPA and other relevant laws as...

  19. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  20. 49 CFR 40.291 - What is the role of the SAP in the evaluation, referral, and treatment process of an employee who...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What is the role of the SAP in the evaluation... Process § 40.291 What is the role of the SAP in the evaluation, referral, and treatment process of an employee who has violated DOT agency drug and alcohol testing regulations? (a) As a SAP, you are...

  1. MusaSAP1, a A20/AN1 zinc finger gene from banana functions as a positive regulator in different stress responses.

    PubMed

    Sreedharan, Shareena; Shekhawat, Upendra K Singh; Ganapathi, Thumballi R

    2012-11-01

    A20/AN1 zinc finger domain containing Stress Associated Proteins (SAP) are involved in diverse stress response pathways in plants. In the present study, a novel banana SAP gene, MusaSAP1, was identified from banana EST database and was subsequently characterized by overexpression in transgenic banana plants. Expression profiling in native banana plants showed that MusaSAP1 was up-regulated by drought, salt, cold, heat and oxidative stress as well as by treatment with abscisic acid. Cellular localization assay carried out by making a MusaSAP1::GFP fusion protein indicated that MusaSAP1 is incompletely translocated to nucleus. Copy number analysis performed using real time PCR and Southern blotting indicated that MusaSAP1 occurs in the banana genome in a single copy per 11 chromosome set. Transgenic banana plants constitutively overexpressing MusaSAP1 displayed better stress endurance characteristics as compared to controls in both in vitro and ex vivo assays. Lesser membrane damage as indicated by reduced malondialdehyde levels in transgenic leaves subjected to drought, salt or oxidative stress pointed towards significant role for MusaSAP1 in stress amelioration pathways of banana. Strong up-regulation of a polyphenol oxidase (PPO) coding transcript in MusaSAP1 overexpressing plants together with induction of MusaSAP1 by wounding and methyl jasmonate treatment indicated possible involvement of MusaSAP1 in biotic stress responses where PPOs perform major functions in multiple defense pathways.

  2. Piloting the use of indigenous methods to prevent Nipah virus infection by interrupting bats' access to date palm sap in Bangladesh.

    PubMed

    Nahar, Nazmun; Mondal, Utpal Kumar; Sultana, Rebeca; Hossain, M Jahangir; Khan, M Salah Uddin; Gurley, Emily S; Oliveras, Elizabeth; Luby, Stephen P

    2013-09-01

    People in Bangladesh frequently drink fresh date palm sap. Fruit bats (Pteropus giganteus) also drink raw sap and may contaminate the sap by shedding Nipah virus through saliva and urine. In a previous study we identified two indigenous methods to prevent bats accessing the sap, bamboo skirts and lime (calcium carbonate). We conducted a pilot study to assess the acceptability of these two methods among sap harvesters. We used interactive community meetings and group discussions to encourage all the sap harvesters (n = 12) from a village to use either bamboo skirts or lime smear that some of them (n = 4) prepared and applied. We measured the preparation and application time and calculated the cost of bamboo skirts. We conducted interviews after the use of each method. The sap harvesters found skirts effective in preventing bats from accessing sap. They were sceptical that lime would be effective as the lime was washed away by the sap flow. Preparation of the skirt took ∼105 min. The application of each method took ∼1 min. The cost of the bamboo skirt is minimal because bamboo is widely available and they made the skirts with pieces of used bamboo. The bamboo skirt method appeared practical and affordable to the sap harvesters. Further studies should explore its ability to prevent bats from accessing date palm sap and assess if its use produces more or better quality sap, which would provide further incentives to make it more acceptable for its regular use.

  3. [Influence of measurement position on calculating pear tree stem sap flow].

    PubMed

    Sun, Huizhen; Kang, Sha-Ozhong; Gong, Daozhi

    2006-11-01

    By the method of heat pulse, this paper studied the influence of different measurement positions on calculating the stem sap flow velocity and quantity of pear trees. The results showed that at definite depths, the directional variation of the volume fraction of water and wood was lower than the seasonal change of wood physical parameters. The directional and seasonal variation of the volumetric water and wood was 0.01 - 0.03 and 0 - 0.02, and 0.02 - 0.09 and 0.02 -0.08, respectively. The sap flow velocity at definite depth, which was calculated by different depths wood physical parameters measured at the same time, had no significant difference, but that calculated by the same depth wood parameters measured at different time was significantly different. The sap flow quantity measured at the inner two points and four points was underestimated 1.5 and 4.9 times of that measured at the outer corresponding measurement positions, relative to the estimation obtained from a multi-point measurement. The sap flow quantity measured by four-point at the position of 0 - 0.6 from the cambium could represent the water consumption of whole tree.

  4. Plant eats plant: sap-feeding witchweeds and other parasitic angiosperms.

    PubMed

    Press, M C; Gurney, A L

    2000-09-01

    About one in every hundred species of flowering plant is parasitic and obtain some or all of their carbon, nutrients and water from the sap of their hosts. They possess unique morphological and metabolic adaptations but are more than just botanical curiosities.

  5. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  6. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  7. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  8. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  9. 49 CFR 40.285 - When is a SAP evaluation required?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false When is a SAP evaluation required? 40.285 Section 40.285 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the Return-to-Duty...

  10. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  11. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  12. 49 CFR 40.297 - Does anyone have the authority to change a SAP's initial evaluation?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Does anyone have the authority to change a SAP's initial evaluation? 40.297 Section 40.297 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  13. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  14. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  15. 49 CFR 40.297 - Does anyone have the authority to change a SAP's initial evaluation?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false Does anyone have the authority to change a SAP's initial evaluation? 40.297 Section 40.297 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...

  16. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  17. 49 CFR 40.311 - What are the requirements concerning SAP reports?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false What are the requirements concerning SAP reports? 40.311 Section 40.311 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals and the...

  18. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  19. 49 CFR 40.289 - Are employers required to provide SAP and treatment services to employees?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Are employers required to provide SAP and treatment services to employees? 40.289 Section 40.289 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance...

  20. 49 CFR 40.297 - Does anyone have the authority to change a SAP's initial evaluation?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false Does anyone have the authority to change a SAP's initial evaluation? 40.297 Section 40.297 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Substance Abuse Professionals...