Science.gov

Sample records for acts propagation activities

  1. ACTS mobile propagation campaign

    NASA Technical Reports Server (NTRS)

    Goldhirsh, Julius; Vogel, Wolfhard J.; Torrence, Geoffrey W.

    1994-01-01

    Preliminary results are presented for three propagation measurement campaigns involving a mobile receiving laboratory and 20 GHz transmissions from the Advanced Communications Technology Satellite (ACTS). Four 1994 campaigns were executed during weekly periods in and around Austin, Texas in February and May, in Central Maryland during March, and in Fairbanks, Alaska and environs in June. Measurements tested the following effects at 20 GHz: (1) attenuation due to roadside trees with and without foliage, (2) multipath effects for scenarios in which line-of-sight paths were unshadowed, (3) fades due to terrain and roadside obstacles, (4) fades due to structures in urban environs, (5) single tree attenuation, and (6) effects of fading at low elevation angles (8 deg in Fairbanks, Alaska) and high elevation angles (55 deg in Austin, Texas). Results presented here cover sampled measurements in Austin, Texas for foliage and non-foliage cases and in Central Maryland for non-foliage runs.

  2. ACTS and OLYMPUS propagation experiments

    NASA Technical Reports Server (NTRS)

    Bostian, Charles W.; Baker, Kenneth R.

    1988-01-01

    The OLYMPUS and ACTS satellites both provide opportunities for 10 to 30 GHz propagation measurements. The spacecraft are sufficiently alike that OLYMPUS can be used to test some prototype ACTS equipment and experiments. Data are particularly needed on short term signal behavior and in support of uplink power control and adaptive forward error correction (FEC) techniques. The Virginia Tech Satellite Communications Group has proposed a set of OLYMPUS experiments including attenuation and fade rate measurements, data communications, uplink power control, rain scatter interference, and small-scale site diversity operation. A digital signal processing receiver for the OLYMPUS and ACTS beacon signals is being developed.

  3. ACTS propagation experiment discussion: Ka-band propagation measurements using the ACTS propagation terminal and the CSU-CHILL and Space Communications Technology Center Florida propagation program

    NASA Technical Reports Server (NTRS)

    Bringi, V. N.; Chandrasekar, V.; Mueller, Eugene A.; Turk, Joseph; Beaver, John; Helmken, Henry F.; Henning, Rudy

    1993-01-01

    Papers on Ka-band propagation measurements using the ACTS propagation terminal and the Colorado State University CHILL multiparameter radar and on Space Communications Technology Center Florida Propagation Program are discussed. Topics covered include: microwave radiative transfer and propagation models; NASA propagation terminal status; ACTS channel characteristics; FAU receive only terminal; FAU terminal status; and propagation testbed.

  4. ACTS Propagation Measurements in Maryland and Virginia

    NASA Technical Reports Server (NTRS)

    Dissanayake, Asoka; Lin, Kuan-Ting

    1996-01-01

    Rapid growth in new satellite services incorporating very small aperture terminals (VSAT) and ultra small aperture terminals (USAT) is expected in the coming years. Small size terminals allow for widespread use of satellite services in small business and domestic applications. Due to congestion of lower frequency bands such as C and Ku, most of these services will use Ka-band (2/20 GHz) frequencies. Propagation impairments produced by the troposphere is a limiting factor for the effective use of the 20/30 GHz band and the use of smaller Earth terminals makes it difficult to provide sufficient link margins for propagation related outages. In this context, reliable prediction of propagation impairments for low margin systems becomes important. Due to the complexity of propagation phenomena propagation modeling is mainly attempted on an empirical basis. As such, the availability of reliable measured data that extend to probability levels well in excess of the traditional limit of 1 percent is of great importance in the development, validation, and refinement of propagation models. The beacon payload on the Advanced Communications Technology Satellite (ACTS) together with the propagation measurement terminals developed under the NASA ACTS propagation program provide an excellent opportunity to collect such data on a long-term basis. This paper presents the results of ACTS propagation measurements conducted in the Washington, DC metropolitan area by COMSAT Laboratories.

  5. Propagation measurements in Alaska using ACTS beacons

    NASA Technical Reports Server (NTRS)

    Mayer, Charles E.

    1991-01-01

    The placement of an ACTS propagation terminal in Alaska has several distinct advantages. First is the inclusion of a new and important climatic zone to the global propagation model. Second is the low elevation look angle from Alaska to ACTS. These two unique opportunities also present problems unique to the location, such as extreme temperatures and lower power levels. These problems are examined and compensatory solutions are presented.

  6. Proceedings of the Seventeenth NASA Propagation Experimenters Meeting (NAPEX 17) and the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop

    NASA Technical Reports Server (NTRS)

    Davarian, Faramaz (Editor)

    1993-01-01

    The NASA Propagation Experimenters Meeting (NAPEX) is convened annually to discuss studies made on radio wave propagation by investors from domestic and international organizations. NAPEX 17 was held on 15 June 1993. The meeting was organized into two technical sessions. The first session was dedicated to slant path propagation studies and experiments. The second session focused on propagation studies for mobile and personal communications. Preceding NAPEX 17, the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop was held on 14 June 1993 to review ACTS propagation activities with emphasis on ACTS experiments status and data collection, processing, and exchange.

  7. Proceedings of the Fourteenth NASA Propagation Experimenters Meeting (NAPEX 14) and the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop

    NASA Technical Reports Server (NTRS)

    Davarian, Faramaz (Editor)

    1990-01-01

    The NASA Propagation Experimenters Meeting (NAPEX), supported by the NASA Propagation Program, is convened annually to discuss studies made on radio wave propagation by investigators from domestic and international organizations. NAPEX XIV was held on May 11, 1990, at the Balcones Research Centers, University of Texas, Austin, Texas. The meeting was organized into two technical sessions: Satellite (ACTS) and the Olympus Spacecraft, while the second focused on the fixed and mobile satellite propagation studies and experiments. Following NAPEX XIV, the ACTS Miniworkshop was held at the Hotel Driskill, Austin, Texas, on May 12, 1990, to review ACTS propagation activities since the First ACTS Propagation Studies Workshop was held in Santa Monica, California, on November 28 and 29, 1989.

  8. Proceedings of the Fifteenth NASA Propagation Experimenters Meeting (NAPEX 15) and the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop

    NASA Technical Reports Server (NTRS)

    Davarian, Faramaz (Editor)

    1991-01-01

    The NASA Propagation Experimenters Meeting (NAPEX), supported by the NASA Propagation Program, is convened annually to discuss studies made on radio wave propagation by investigators from domestic and international organizations. The meeting was organized into three technical sessions. The first session was dedicated to Olympus and ACTS studies and experiments, the second session was focused on the propagation studies and measurements, and the third session covered computer-based propagation model development. In total, sixteen technical papers and some informal contributions were presented. Following NAPEX 15, the Advanced Communications Technology Satellite (ACTS) miniworkshop was held on 29 Jun. 1991, to review ACTS propagation activities, with emphasis on ACTS hardware development and experiment planning. Five papers were presented.

  9. Proceedings of the Eighteenth NASA Propagation Experimenters Meeting (NAPEX 18) and the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop

    NASA Technical Reports Server (NTRS)

    Davarian, Faramaz (Editor)

    1994-01-01

    The NASA Propagation Experimenters Meeting (NAPEX), supported by the NASA Propagation Program, is convened annually to discuss studies made on radio wave propagation by investigators from domestic and international organizations. Participants included representatives from Canada, the Netherlands, England, and the United States, including researchers from universities, government agencies, and private industry. The meeting was organized into two technical sessions. The first session was dedicated to slant path propagation studies and experiments. The second session focused on propagation studies for mobile, personal, and sound broadcast systems. In total, 14 technical papers and some informal contributions were presented. Preceding NAPEX_17, the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop was held to review ACTS propagation activities.

  10. Proceedings of the 16th NASA Propagation Experimenters Meeting (NAPEX 16) and the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop

    NASA Technical Reports Server (NTRS)

    Davarian, Faramaz (Editor)

    1992-01-01

    The NASA Propagation Experimenters Meeting (NAPEX), supported by the NASA Propagation Program, is convened annually to discuss studies made on radio wave propagation by investigators from domestic and international organizations. NAPEX 16 was held on May 29, 1992 in Houston, Texas. The meeting was organized into two technical sessions. The first session was dedicated to slant path propagation studies and measurements. The second session focused on Olympus propagation measurements and results. Following NAPEX 16, the Advanced Communications Technology Satellite (ACTS) Miniworkshop was held to review ACTS propagation activities with emphasis on ACTS hardware development and experiment planning. Eight technical papers were presented by contributors from government agencies, private industry, and university research establishments.

  11. Proceedings of the Twentieth NASA Propagation Experimenters Meeting (NAPEX XX) and the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop

    NASA Technical Reports Server (NTRS)

    Golshan, Nassar (Editor)

    1996-01-01

    The NASA Propagation Experimenters (NAPEX) Meeting and associated Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop convene yearly to discuss studies supported by the NASA Propagation Program. Representatives from the satellite communications (satcom)industry, academia, and government with an interest in space-ground radio wave propagation have peer discussion of work in progress, disseminate propagation results, and interact with the satcom industry. NAPEX XX, in Fairbanks, Alaska, June 4-5, 1996, had three sessions: (1) "ACTS Propagation Study: Background, Objectives, and Outcomes," covered results from thirteen station-years of Ka-band experiments; (2) "Propagation Studies for Mobile and Personal Satellite Applications," provided the latest developments in measurement, modeling, and dissemination of propagation phenomena of interest to the mobile, personal, and aeronautical satcom industry; and (3)"Propagation Research Topics," covered a range of topics including space/ground optical propagation experiments, propagation databases, the NASA Propagation Web Site, and revision plans for the NASA propagation effects handbooks. The ACTS Miniworkshop, June 6, 1996, covered ACTS status, engineering support for ACTS propagation terminals, and the ACTS Propagation Data Center. A plenary session made specific recommendations for the future direction of the program.

  12. Interim Findings of ACTS Ka-Band Propagation Campaign

    NASA Technical Reports Server (NTRS)

    Golshan, N.

    1997-01-01

    The ACTS propagation campaign is focusing on two broad areas: 1) Rain/signal attenuation data collection at seven sites in North America, 2) Theoretical and empirical consideratons for a global model to predict first & second order temporal and spatial statistics on attenuation, scintillation, conherence bandwidth, and depolarization due to weather (precipitation and atmospheric including interaction of weather with the antenna) for satellite systems at Ka-band.

  13. Proceedings of the Twenty-First NASA Propagation Experiments Meeting (NAPEX XXI) and the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop

    NASA Technical Reports Server (NTRS)

    Golshan, Nasser (Editor)

    1997-01-01

    The NASA Propagation Experimenters (NAPEX) meeting is convened each year to discuss studies supported by the NASA Propagation Program. Representatives from the satellite communications industry, academia and government who have an interest in space-ground radio wave propagation are invited to NAPEX meetings for discussions and exchange of information. The reports delivered at this meeting by program managers and investigators present recent activities and future plans. This forum provides an opportunity for peer discussion of work in progress, timely dissemination of propagation results, and close interaction with the satellite communications industry. NAPEX XXI took place in El Segundo, California on June 11-12, 1997 and consisted of three sessions. Session 1, entitled "ACTS Propagation Study Results & Outcome " covered the results of 20 station-years of Ka-band radio-wave propagation experiments. Session 11, 'Ka-band Propagation Studies and Models,' provided the latest developments in modeling, and analysis of experimental results about radio wave propagation phenomena for design of Ka-band satellite communications systems. Session 111, 'Propagation Research Topics,' covered a diverse range of propagation topics of interest to the space community, including overviews of handbooks and databases on radio wave propagation. The ACTS Propagation Studies miniworkshop was held on June 13, 1997 and consisted of a technical session in the morning and a plenary session in the afternoon. The morning session covered updates on the status of the ACTS Project & Propagation Program, engineering support for ACTS Propagation Terminals, and the Data Center. The plenary session made specific recommendations for the future direction of the program.

  14. Proceedings of the 19th NASA Propagation Experimenters Meeting (NAPEX 19) and the 7th Advanced Communications Technology Satellite (ACTS) Propagation Studies Workshop (APSW 7)

    NASA Technical Reports Server (NTRS)

    Davarian, Faramaz (Editor)

    1995-01-01

    The NASA Propagation Experimenters Meeting (NAPEX), supported by the NASA Propagation Program, is convened annually to discuss studies made on radio wave propagation by investigators from domestic and international organizations. NAPEX 19 was held on 14 Jun. 1995, in Fort Collins, Colorado. Participants included representatives from Canada, Japan, and the United States, including researchers from universities, government agencies, and private industry. The meeting focused on mobile personal satellite systems and the use of 20/30-GHz band for fixed and mobile satellite applications. In total, 18 technical papers were presented. Following NAPEX 19, the Advanced Communications Technology Satellite (ACTS) Propagation Studies Workshop 7 (APSW 7) was held on 15-16 Jun. 1995, to review ACTS propagation activities with emphasis on the experimenters' status reports and dissemination of propagation data to industry.

  15. Mobile Propagation Results from Using the ACTS Mobile Terminal

    NASA Technical Reports Server (NTRS)

    Pinck, Deborah; Rice, Michael D.

    1996-01-01

    NASA's Advanced Communications Technology Satellite (ACTS) provides an ideal spaced-based platform for analyzing the Ka-band mobile satellite channel. This paper reports on the results of the Ka-band mobile propagation analysis campaign using the ACTS Mobile Terminal (AMT) developed by the Jet Propulsion Laboratory (JPL). The objectives of the mobile propagation experiments were to measure and analyze the fading characteristics of the Ka-band channel. The analysis involved examining pilot tone tests in three environments: lightly shadowed suburban, moderately shadowed suburban, and heavily shadowed suburban. The results indicate that Ka-band pilot tones experience significant multipath and fading effects. It may be possible to design link margins to provide reliable service for the lightly shadowed suburban environment at Ka-band. However, for areas with moderate and heavy shadowing, the link margin required to realize reliable communications with 99% availability is excessive (26 dB for moderate shadowing, and greater then 30 dB for heavy shadowing). An alternate approach would be to use shadowing/fading countermeasures (e.g., interleaved error control coding and antenna diversity). Such mitigation techniques, necessary for reliable Ka-band mobile communication within a suburban environment, are currently being considered within the NASA program.

  16. Ka-Band Propagation Studies using the ACTS Propagation Terminal and the CSU-CHILL Multiparameter Radar

    NASA Technical Reports Server (NTRS)

    Bringi, V. N.; Beaver, John

    1996-01-01

    One of the first experimental communications satellites using Ka-band technology is the NASA Advanced Communications Technology Satellite (ACTS). In September 1993, ACTS was deployed into a geostationary orbit near 100 degrees W longitude by the space shuttle Discovery. The ACTS system supports both communication and propagation experiments at the 20/30 GHz frequency bands. The propagation experiment involves multi-year attenuation measurements along the satellite-Earth slant path.

  17. Design and construction of a prototype ACTS propagation terminal

    NASA Technical Reports Server (NTRS)

    Stutzman, Warren; Pratt, Tim; Nunnally, Charles; Nealy, Randall; Remaklus, Will; Sylvester, Bill; Predoehl, Andrew; Gaff, Doug

    1993-01-01

    The launch schedule for the Advanced Communication Technology Satellite (ACTS) spacecraft did not leave sufficient time for completion of the prototype ACTS Propagation Terminals (APT) prior to initiation of the APT production phase. In fact, the approach used was to construct and test all subassemblies of the terminal with special emphasis on the technically challenging portions. These include the RF front end that uses a state-of-the-art down converter which integrates a low noise amplifier, mixer, post amplifier, filter, and local oscillator port frequency doubler into a single small package. In addition, a new digital receiver that uses the latest DSP technology was developed. Both of these subassemblies were thoroughly tested. The highest risk technology in the APT program was the digital receiver. Several candidate algorithms and DSP chips were investigated early on, primarily under JPL sponsorship. A receiver was constructed based on Texas Instruments chip. The final prototype digital receiver was one based on an Analog Devices chip. The design and test results are documented in a report prepared for this grant. A Primary Design Review (PDR) was conducted 30 May 1991, and a Critical Design Review was held 7 Jul. 1992. Final complete documentation of the APT's will appear in the form of three reports: a hardware description report, a report on the data collection code (ACTS VIEW), and a report on the preprocessing code.

  18. Ka-band propagation studies using the ACTS propagation terminal and the CSU-CHILL multiparameter, Doppler radar

    NASA Technical Reports Server (NTRS)

    Beaver, J.; Turk, J.; Bringi, V. N.

    1995-01-01

    An increase in the demand for satellite communications has led to an overcrowding of the current spectrums being used - mainly at C and Ku bands. To alleviate this overcrowding, new technology is being developed to open up the Ka-band for communications use. One of the first experimental communications satellites using this technology is NASA's Advanced Communications Technology Satellite (ACTS). In Sept. 1993, ACTS was deployed into a geostationary orbit near 100 deg W longitude. The ACTS system employs two Ka-band beacons for propagation experiments, one at 20.185 GHz and another at 27.505 GHz. Attenuation due to rain and tropospheric scintillations will adversely affect new technologies proposed for this spectrum. Therefore, before being used commercially, propagation effects at Ka-band must be studied. Colorado State University is one of eight sites across the United States and Canada conducting propagations studies; each site is equipped with the ACTS propagation terminal (APT). With each site located in a different climatic zone, the main objective of the propagation experiment is to obtain monthly and yearly attenuation statistics. Each site also has secondary objectives that are site dependent. At CSU, the CSU-CHILL radar facility is being used to obtain polarimetric radar data along the ACTS propagation path. During the expected two to four year period of the project, it is hoped to study several significant weather events. The S-band radar will be used to obtain Ka-band attenuation estimates and to initialize propagation models that have been developed, to help classify propagation events measured by the APT. Preliminary attenuation estimates for two attenuation events will be shown here - a bright band case that occurred on 13 May 1994 and a convective case that occurred on 20 Jun. 1994. The computations used to obtain Ka-band attenuation estimates from S-band radar data are detailed. Results from the two events are shown.

  19. Proceedings of the Twentieth NASA Propagation Experimenters Meeting (NAPEX 20) and the Advanced Communications Technology Satellite (ACTS) Propagation Studies Miniworkshop

    NASA Technical Reports Server (NTRS)

    Golshan, Nasser (Editor)

    1996-01-01

    The NASA Propagation Experimenters (NAPEX) Meeting is convened each year to discuss studies supported by the NASA Propagation Program. Representatives from the satellite communications (satcom) industry, academia, and government who have an interest in space-ground radio wave propagation are invited to NAPEX meetings for discussions and exchange of information. The reports delivered at these meetings by program managers and investigators present recent activities and future plans. This forum provides an opportunity for peer discussion of work in progress, timely dissemination of propagation results, and close interaction with the satcom industry.

  20. Learning activism, acting with phronesis

    NASA Astrophysics Data System (ADS)

    Lee, Yew-Jin

    2015-12-01

    The article "Socio-political development of private school children mobilising for disadvantaged others" by Darren Hoeg, Natalie Lemelin, and Lawrence Bencze described a language-learning curriculum that drew on elements of Socioscientific issues and Science, Technology, Society and Environment. Results showed that with a number of enabling factors acting in concert, learning about and engagement in practical action for social justice and equity are possible. An alternative but highly compatible framework is now introduced—phronetic social research—as an action-oriented, wisdom-seeking research stance for the social sciences. By so doing, it is hoped that forms of phronetic social research can gain wider currency among those that promote activism as one of many valued outcomes of an education in science.

  1. Hf propagation through actively modified ionospheres

    SciTech Connect

    Argo, P.E.; Fitzgerald, T.J.; Wolcott, J.H.; Simons, D.J. ); Warshaw, S.; Carlson, R. )

    1990-01-01

    We have developed a computer modeling capability to predict the effect of localized electron density perturbations created by chemical releases or high-power radio frequency heating upon oblique, one-hop hf propagation paths. We have included 3-d deterministic descriptions of the depleted or enhanced ionization, including formation, evolution, and drift. We have developed a homing ray trace code to calculate the path of energy propagation through the modified ionosphere in order to predict multipath effects. We also consider the effect of random index of refraction variations using a formalism to calculate the mutual coherence functions for spatial and frequency separations based upon a path integral solution of the parabolic wave equation for a single refracted path through an ionosphere which contains random electron density fluctuations. 5 refs., 8 figs.

  2. Two Years of ACTS (Advanced Communications Technology Satellite) Propagation Studies in Alaska

    NASA Technical Reports Server (NTRS)

    Mayer, Charles E.; Jaeger, Bradley E.

    1996-01-01

    The Alaska Advanced Communications Technology Satellite (ACTS) propagation terminal (APT) is located on top of the engineering building on the University of Alaska Fairbanks campus. The latitude and longitude of the site are 64 degrees 51 minutes, 28 seconds N and 147 degrees, 48 minutes, 59 seconds west. The geometrical elevation angle to ACTS is 7.97 degrees; including a normal atmospheric refractivity, the elevation angle increases to 8.10 degrees. The azimuth angle to ACTS is 129.36 degrees. The terminal is located at 580 feet above mean sea level. The site is located in ITU-R rain zone C and Crane global model zone B1. ACTS transmits vertical polarization beacons at 27.505 and 20.185 GHz. At the APT, the polarization tilt angle is 19.4 degrees rotated CCW with respect to vertical when looking towards the satellite. The beacons are transmitted in a CONUS pattern. The ACTS beacon footprint at the Alaska APT is 9 dB down from the transmission pattern peak at 27.505 GHz and 11 dB down from the pattern peak at 20.185 GHz.

  3. Can Neural Activity Propagate by Endogenous Electrical Field?

    PubMed Central

    Qiu, Chen; Shivacharan, Rajat S.; Zhang, Mingming

    2015-01-01

    It is widely accepted that synaptic transmissions and gap junctions are the major governing mechanisms for signal traveling in the neural system. Yet, a group of neural waves, either physiological or pathological, share the same speed of ∼0.1 m/s without synaptic transmission or gap junctions, and this speed is not consistent with axonal conduction or ionic diffusion. The only explanation left is an electrical field effect. We tested the hypothesis that endogenous electric fields are sufficient to explain the propagation with in silico and in vitro experiments. Simulation results show that field effects alone can indeed mediate propagation across layers of neurons with speeds of 0.12 ± 0.09 m/s with pathological kinetics, and 0.11 ± 0.03 m/s with physiologic kinetics, both generating weak field amplitudes of ∼2–6 mV/mm. Further, the model predicted that propagation speed values are inversely proportional to the cell-to-cell distances, but do not significantly change with extracellular resistivity, membrane capacitance, or membrane resistance. In vitro recordings in mice hippocampi produced similar speeds (0.10 ± 0.03 m/s) and field amplitudes (2.5–5 mV/mm), and by applying a blocking field, the propagation speed was greatly reduced. Finally, osmolarity experiments confirmed the model's prediction that cell-to-cell distance inversely affects propagation speed. Together, these results show that despite their weak amplitude, electric fields can be solely responsible for spike propagation at ∼0.1 m/s. This phenomenon could be important to explain the slow propagation of epileptic activity and other normal propagations at similar speeds. SIGNIFICANCE STATEMENT Neural activity (waves or spikes) can propagate using well documented mechanisms such as synaptic transmission, gap junctions, or diffusion. However, the purpose of this paper is to provide an explanation for experimental data showing that neural signals can propagate by means other than synaptic

  4. Planned LMSS propagation experiment using ACTS: Preliminary antenna pointing results during mobile operations

    NASA Technical Reports Server (NTRS)

    Rowland, John R.; Goldhirsh, Julius; Vogel, Wolfhard J.; Torrence, Geoffrey W.

    1991-01-01

    An overview and a status description of the planned LMSS mobile K band experiment with ACTS is presented. As a precursor to the ACTS mobile measurements at 20.185 GHz, measurements at 19.77 GHz employing the Olympus satellite were originally planned. However, because of the demise of Olympus in June of 1991, the efforts described here are focused towards the ACTS measurements. In particular, we describe the design and testing results of a gyro controlled mobile-antenna pointing system. Preliminary pointing measurements during mobile operations indicate that the present system is suitable for measurements employing a 15 cm aperture (beamwidth at approximately 7 deg) receiving antenna operating with ACTS in the high gain transponder mode. This should enable measurements with pattern losses smaller than plus or minus 1 dB over more than 95 percent of the driving distance. Measurements with the present mount system employing a 60 cm aperture (beamwidth at approximately 1.7 deg) results in pattern losses smaller than plus or minus 3 dB for 70 percent of the driving distance. Acceptable propagation measurements may still be made with this system by employing developed software to flag out bad data points due to extreme pointing errors. The receiver system including associated computer control software has been designed and assembled. Plans are underway to integrate the antenna mount with the receiver on the University of Texas mobile receiving van and repeat the pointing tests on highways employing a recently designed radome system.

  5. Planned LMSS propagation experiment using ACTS: Preliminary antenna pointing results during mobile operations

    NASA Astrophysics Data System (ADS)

    Rowland, John R.; Goldhirsh, Julius; Vogel, Wolfhard J.; Torrence, Geoffrey W.

    1991-07-01

    An overview and a status description of the planned LMSS mobile K band experiment with ACTS is presented. As a precursor to the ACTS mobile measurements at 20.185 GHz, measurements at 19.77 GHz employing the Olympus satellite were originally planned. However, because of the demise of Olympus in June of 1991, the efforts described here are focused towards the ACTS measurements. In particular, we describe the design and testing results of a gyro controlled mobile-antenna pointing system. Preliminary pointing measurements during mobile operations indicate that the present system is suitable for measurements employing a 15 cm aperture (beamwidth at approximately 7 deg) receiving antenna operating with ACTS in the high gain transponder mode. This should enable measurements with pattern losses smaller than plus or minus 1 dB over more than 95 percent of the driving distance. Measurements with the present mount system employing a 60 cm aperture (beamwidth at approximately 1.7 deg) results in pattern losses smaller than plus or minus 3 dB for 70 percent of the driving distance. Acceptable propagation measurements may still be made with this system by employing developed software to flag out bad data points due to extreme pointing errors. The receiver system including associated computer control software has been designed and assembled. Plans are underway to integrate the antenna mount with the receiver on the University of Texas mobile receiving van and repeat the pointing tests on highways employing a recently designed radome system.

  6. Comparative activity of Choristoneura fumiferana nucleopolyhedrovirus propagated in different hosts.

    PubMed

    Ebling, Peter M

    2004-07-01

    The biological activity of the Ireland strain of Choristoneura fumiferana (Clem) nucleopolyhedrovirus (CfMNPV) propagated in different hosts was determined to provide the basis upon which genetically modified CfMNPV, or other naturally occurring isolates, should be compared. Occlusion bodies (OB) derived from CF-203 cells were significantly larger and more pathogenic than those propagated in vivo when tested against the fifth larval instar of C fumiferana (Clem) and C occidentalis Freeman. The dose-responses (LD50 and LD95, expressed as occlusion bodies per larva) of C fumiferana larvae to in vitro-propagated OBs were 274 and 5785, respectively. The values of LD50 and LD95 to C occidentalis larvae were 19 and 118, respectively. There were no significant differences in pathogenicity or size when OBs propagated in C fumiferana larvae were tested against either insect species, nor were there significant differences for OBs propagated in C occidentalis larvae. The LD50 and LD95 of in vivo-produced OBs to C fumiferana were 925 and 61988, respectively. The LD50 and LD95 to C occidentalis were 50 and 453, respectively. OBs propagated in vitro had a mean volume of 13.13 microm3, whereas those propagated in vivo ranged from 0.84 to 1.41 microm3. The median survival time-responses (ST50) of fifth-instar C fumiferana or C occidentalis larvae to OBs propagated in vivo were not significantly different from those propagated in vitro at the dosage levels tested. Values of ST50 of C fumiferana larvae to in vitro- and in vivo-produced OBs at dosages causing less than 50% mortality rangedfrom 9.6 to 9.8 days post-inoculation (dpi), whereas a LD95 dose resulted in ST50 values ranging from 7.3 to 7.7 days. ST50 values of C occidentalis larvae at dosages causing less than 50% mortality ranged from 9.8 to 10.2 dpi, whereas a LD95 dose resulted in ST50 values ranging from 9.5 to 9.8 dpi. The median feeding cessation time-response (FT50) of fifth-instar C fumiferana larvae to OBs

  7. Exploring Primary Care Activities in ACT Teams

    PubMed Central

    Vanderlip, Erik R.; Williams, Nancy A.; Fiedorowicz, Jess G.; Katon, Wayne

    2014-01-01

    Background People with serious mental illness often receive inadequate primary and preventive care services. Federal healthcare reform endorses team-based care that provides high quality primary and preventive care to at risk populations. Assertive Community Treatment (ACT) teams offer a proven, standardized treatment approach effective in improving mental health outcomes for the seriously mentally ill. Much is known about the effectiveness of ACT teams in improving mental health outcomes, but the degree to which medical care needs are addressed is not established. Purpose The purpose of this study was to explore the extent to which ACT teams address the physical health of the population they serve. Methods ACT team leaders were invited to complete an anonymous, web-based survey to explore attitudes and activities involving the primary care needs of their clients. Information was collected regarding the use of health screening tools, physical health assessments, provision of medical care and collaboration with primary care systems. Results Data was analyzed from 127 team leaders across the country, of which 55 completed the entire survey. Nearly every ACT team leader believed ACT teams have a role in identifying and managing the medical co-morbidities of their clientele. ACT teams report participation in many primary care activities. Conclusions ACT teams are providing a substantial amount of primary and preventive services to their population. The survey suggests standardization of physical health identification, management or referral processes within ACT teams may result in improved quality of medical care. ACT teams are in a unique position to improve physical health care by virtue of having medically trained staff and frequent, close contact with their clients. PMID:24337472

  8. Propagating interfaces in mixtures of active and passive Brownian particles

    NASA Astrophysics Data System (ADS)

    Wysocki, Adam; Winkler, Roland G.; Gompper, Gerhard

    2016-12-01

    The emergent collective dynamics in phase-separated mixtures of isometric active and passive Brownian particles is studied numerically in two-dimensions. A novel steady-state of well-defined propagating interfaces is observed, where the interface between the dense and the dilute phase propagates and the bulk of both phases is (nearly) at rest. Two kind of interfaces, advancing and receding, are formed by spontaneous symmetry breaking, induced by an instability of a planar interface due to the formation of localized vortices. The propagation arises due to flux imbalance at the interface, resembling the growth behavior of rough surfaces far from equilibrium. Above a threshold, the interface velocity decreases linearly with increasing fraction of active particles.

  9. Propagation of Action Potentials: An Active Participation Exercise.

    ERIC Educational Resources Information Center

    Felsten, Gary

    1998-01-01

    Describes an active participation exercise that demonstrates the propagation of action potentials (the ability to transmit information through the neural network, dependent upon chemical interactions in the brain). Students assume the structure and function of the network by lining up around the room and communicating through hand signals and…

  10. Recent activities in antennas and propagation in Japan

    NASA Astrophysics Data System (ADS)

    Kagoshima, Kenichi; Shiokawa, Takayasu

    1992-04-01

    Recent Japanese activities in the fields of antennas and propagation are discussed. In the realm of antennas, developments in the areas of mobile communications antennas, multibeam earth station antennas, satellite-borne antennas for ETS-VI, and the shaped-beam antenna for the Superbird commercial domestic communications satellites are examined. In addition, antennas for the Japanese Earth Resources Satellite-1 SAR, the Japanese operational DBS, and for microwave radio-relay system are briefly discussed. In the field of propagation, developments in land-mobile radio systems, mobile satellite systems, fixed-satellite communication systems, and terrestrial radio systems are examined.

  11. How networks communicate: propagation patterns in spontaneous brain activity.

    PubMed

    Mitra, Anish; Raichle, Marcus E

    2016-10-05

    Initially regarded as 'noise', spontaneous (intrinsic) activity accounts for a large portion of the brain's metabolic cost. Moreover, it is now widely known that infra-slow (less than 0.1 Hz) spontaneous activity, measured using resting state functional magnetic resonance imaging of the blood oxygen level-dependent (BOLD) signal, is correlated within functionally defined resting state networks (RSNs). However, despite these advances, the temporal organization of spontaneous BOLD fluctuations has remained elusive. By studying temporal lags in the resting state BOLD signal, we have recently shown that spontaneous BOLD fluctuations consist of remarkably reproducible patterns of whole brain propagation. Embedded in these propagation patterns are unidirectional 'motifs' which, in turn, give rise to RSNs. Additionally, propagation patterns are markedly altered as a function of state, whether physiological or pathological. Understanding such propagation patterns will likely yield deeper insights into the role of spontaneous activity in brain function in health and disease.This article is part of the themed issue 'Interpreting blood oxygen level-dependent: a dialogue between cognitive and cellular neuroscience'.

  12. Correlation of S-Band Weather Radar Reflectivity and ACTS Propagation Data in Florida

    NASA Technical Reports Server (NTRS)

    Wolfe, Eric E.; Flikkema, Paul G.; Henning, Rudolf E.

    1997-01-01

    Previous work has shown that Ka-band attenuation due to rainfall and corresponding S-band reflectivity are highly correlated. This paper reports on work whose goal is to determine the feasibility of estimation and, by extension, prediction of one parameter from the other using the Florida ACTS propagation terminal (APT) and the nearby WSR-88D S-band Doppler weather radar facility operated by the National Weather Service. This work is distinguished from previous efforts in this area by (1) the use of a single-polarized radar, preventing estimation of the drop size distribution (e.g., with dual polarization) and (2) the fact that the radar and APT sites are not co-located. Our approach consists of locating the radar volume elements along the satellite slant path and then, from measured reflectivity, estimating the specific attenuation for each associated path segment. The sum of these contributions yields an estimation of the millimeter-wave attenuation on the space-ground link. Seven days of data from both systems are analyzed using this procedure. The results indicate that definite correlation of S-band reflectivity and Ka-band attenuation exists even under the restriciton of this experiment. Based on these results, it appears possible to estimate Ka-band attenuation using widely available operational weather radar data. Conversely, it may be possible to augment current radar reflectivity data and coverage with low-cost attenuation or sky temperature data to improve the estimation of rain rates.

  13. Multichannel activity propagation across an engineered axon network

    NASA Astrophysics Data System (ADS)

    Chen, H. Isaac; Wolf, John A.; Smith, Douglas H.

    2017-04-01

    Objective. Although substantial progress has been made in mapping the connections of the brain, less is known about how this organization translates into brain function. In particular, the massive interconnectivity of the brain has made it difficult to specifically examine data transmission between two nodes of the connectome, a central component of the ‘neural code.’ Here, we investigated the propagation of multiple streams of asynchronous neuronal activity across an isolated in vitro ‘connectome unit.’ Approach. We used the novel technique of axon stretch growth to create a model of a long-range cortico-cortical network, a modular system consisting of paired nodes of cortical neurons connected by axon tracts. Using optical stimulation and multi-electrode array recording techniques, we explored how input patterns are represented by cortical networks, how these representations shift as they are transmitted between cortical nodes and perturbed by external conditions, and how well the downstream node distinguishes different patterns. Main results. Stimulus representations included direct, synaptic, and multiplexed responses that grew in complexity as the distance between the stimulation source and recorded neuron increased. These representations collapsed into patterns with lower information content at higher stimulation frequencies. With internodal activity propagation, a hierarchy of network pathways, including latent circuits, was revealed using glutamatergic blockade. As stimulus channels were added, divergent, non-linear effects were observed in local versus distant network layers. Pairwise difference analysis of neuronal responses suggested that neuronal ensembles generally outperformed individual cells in discriminating input patterns. Significance. Our data illuminate the complexity of spiking activity propagation in cortical networks in vitro, which is characterized by the transformation of an input into myriad outputs over several network layers

  14. Regular Wave Propagation Out of Noise in Chemical Active Media

    SciTech Connect

    Alonso, S.; Sendina-Nadal, I.; Perez-Munuzuri, V.; Sancho, J. M.; Sagues, F.

    2001-08-13

    A pacemaker, regularly emitting chemical waves, is created out of noise when an excitable photosensitive Belousov-Zhabotinsky medium, strictly unable to autonomously initiate autowaves, is forced with a spatiotemporal patterned random illumination. These experimental observations are also reproduced numerically by using a set of reaction-diffusion equations for an activator-inhibitor model, and further analytically interpreted in terms of genuine coupling effects arising from parametric fluctuations. Within the same framework we also address situations of noise-sustained propagation in subexcitable media.

  15. Regular wave propagation out of noise in chemical active media.

    PubMed

    Alonso, S; Sendiña-Nadal, I; Pérez-Muñuzuri, V; Sancho, J M; Sagués, F

    2001-08-13

    A pacemaker, regularly emitting chemical waves, is created out of noise when an excitable photosensitive Belousov-Zhabotinsky medium, strictly unable to autonomously initiate autowaves, is forced with a spatiotemporal patterned random illumination. These experimental observations are also reproduced numerically by using a set of reaction-diffusion equations for an activator-inhibitor model, and further analytically interpreted in terms of genuine coupling effects arising from parametric fluctuations. Within the same framework we also address situations of noise-sustained propagation in subexcitable media.

  16. Propagation of curved activation fronts in anisotropic excitable media.

    PubMed

    Morozov, V G; Davydov, N V; Davydov, V A

    1999-06-01

    We study theoretical and numerical propagation of autowave fronts in excitable two-variable (activator-inhibitor) systems with anisotropic diffusion. A general curvature-velocity relation is derived for the case that the inhibitor diffusion is neglected. This relation predicts the break of an activation front when the front curvature exceeds a critical value, which is corroborated by computer simulations of a particular reaction-diffusion model. Some qualitative effects associated with the inhibitor diffusion are studied numerically. It is found that the critical value of curvature decreases with an increase in the inhibitor diffusion coefficient. The core of a spiral wave increases in size and turns through an angle which depends on the inhibitor diffusion coefficient. PACS Numbers: 05.50. +q, 05.70. Ln., 82.40. -g, 87.10. +e.

  17. Circadian rhythms in neuronal activity propagate through output circuits

    PubMed Central

    Cavey, Matthieu; Collins, Ben; Bertet, Claire; Blau, Justin

    2016-01-01

    24hr rhythms in behavior are organized by a network of circadian pacemaker neurons. Rhythmic activity in this network is generated by intrinsic rhythms in clock neuron physiology and communication between clock neurons. However, it is poorly understood how the activity of a small number of pacemaker neurons is translated into rhythmic behavior of the whole animal. To understand this, we screened for signals that could identify circadian output circuits in Drosophila. We found that Leucokinin neuropeptide (LK) and its receptor (LK-R) are required for normal behavioral rhythms. This LK/LK-R circuit connects pacemaker neurons to brain areas that regulate locomotor activity and sleep. Our experiments revealed that pacemaker neurons impose rhythmic activity and excitability on LK and LK-R expressing neurons. We also found pacemaker neuron-dependent activity rhythms in DH44-expressing neurons, a second circadian output pathway. We conclude that rhythmic clock neuron activity propagates to multiple downstream circuits to orchestrate behavioral rhythms. PMID:26928065

  18. Circadian rhythms in neuronal activity propagate through output circuits.

    PubMed

    Cavey, Matthieu; Collins, Ben; Bertet, Claire; Blau, Justin

    2016-04-01

    Twenty-four hour rhythms in behavior are organized by a network of circadian pacemaker neurons. Rhythmic activity in this network is generated by intrinsic rhythms in clock neuron physiology and communication between clock neurons. However, it is poorly understood how the activity of a small number of pacemaker neurons is translated into rhythmic behavior of the whole animal. To understand this, we screened for signals that could identify circadian output circuits in Drosophila melanogaster. We found that leucokinin neuropeptide (LK) and its receptor (LK-R) were required for normal behavioral rhythms. This LK/LK-R circuit connects pacemaker neurons to brain areas that regulate locomotor activity and sleep. Our experiments revealed that pacemaker neurons impose rhythmic activity and excitability on LK- and LK-R-expressing neurons. We also found pacemaker neuron-dependent activity rhythms in a second circadian output pathway controlled by DH44 neuropeptide-expressing neurons. We conclude that rhythmic clock neuron activity propagates to multiple downstream circuits to orchestrate behavioral rhythms.

  19. Federal Acts Relating to Continuing Education and Public Service Activities.

    ERIC Educational Resources Information Center

    Pennsylvania State Univ., University Park. Center for Continuing Liberal Education.

    A listing is given, with brief descriptions, of Acts of Congress which relate to continuing education and public service activities. Forty-nine laws specifically authorize funds for continuing education and public service programs (Adult Education Act of 1966, Higher Education Act of 1965, Omnibus Crime Control and Safe Streets Act of 1968, Older…

  20. VARIABILITY IN ACTIVE GALACTIC NUCLEI FROM PROPAGATING TURBULENT RELATIVISTIC JETS

    SciTech Connect

    Pollack, Maxwell; Pauls, David; Wiita, Paul J.

    2016-03-20

    We use the Athena hydrodynamics code to model propagating two-dimensional relativistic jets as approximations to the growth of radio-loud active galactic nuclei for various input jet velocities and jet-to-ambient matter density ratios. Using results from these simulations we estimate the changing synchrotron emission by summing the fluxes from a vertical strip of zones behind the reconfinement shock, which is nearly stationary, and from which a substantial portion of the flux variability should arise. We explore a wide range of timescales by considering two light curves from each simulation; one uses a relativistic turbulence code with bulk velocities taken from our simulations as input, while the other uses the bulk velocity data to compute fluctuations caused by variations in the Doppler boosting due to changes in the direction and the speed of the flow through all zones in the strip. We then calculate power spectral densities (PSDs) from the light curves for both turbulent and bulk velocity origins for variability. The range of the power-law slopes of the PSDs for the turbulence induced variations is −1.8 to −2.3, while for the bulk velocity produced variations this range is −2.1 to −2.9; these are in agreement with most observations. When superimposed, these power spectra span a very large range in frequency (about five decades), with the turbulent fluctuations yielding most of the shorter timescale variations and the bulk flow changes dominating the longer periods.

  1. 77 FR 1947 - Agency Information Collection Activities: Jade Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-12

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: Jade Act AGENCY: U.S... agencies to comment on an information collection requirement concerning the JADE Act. This request for...: Title: JADE Act. OMB Number: 1651-0133. Form Number: None. Abstract: The Tom Lantos Block Burmese...

  2. Use of Artificial Propagation and Supplementation for Rebuilding Salmon Stocks Listed under the Endangered Species Act : Recovery Issues for Threatened and Endangered Snake River Salmon : Technical Report 5 of 11.

    SciTech Connect

    Lichatowich, Jim; Watson, Bruce

    1993-06-01

    Conventional hatcheries, supplementation, and habitat protection are management activities located on a production continuum. At one end of the continuum is the conventional hatchery which attempts to separate artificially propagated fish from naturally reproducing populations. On the other end of the continuum is natural production. Supplementation which attempts to increase natural production through the use of artificial propagation lies somewhere between natural production and conventional hatcheries on the continuum. The use of artificial propagation in the recovery of listed species is controversial. Guidance on the use of artificial propagation in the recovery of listed species comes from three sources: The Endangered Species Act (ESA), US Fish and Wildlife Service (USFWS) policies and National Marine Fisheries Service (NMFS) guidelines.

  3. L- and K-band LMSS propagation measurements using MARECS-B, OLYMPUS, and ACTS

    NASA Technical Reports Server (NTRS)

    Vogel, W. J.; Torrence, G. W.; Goldhirsh, J.; Rowland, J. R.

    1992-01-01

    L-band measurements of land mobile satellite systems (LMSS) propagation effects were last made at the end of 1988, but some voids were left in the database, making modeling of low elevation roadside tree shadowing and multipath reflections difficult for some path geometries. Transmission of a pilot tone from MARECS-B at 55 deg West during Sep. and Dec. 1991 gave an opportunity to fill the gaps in the experimental results. Two campaigns during which fade data were obtained at elevation angles from 7 deg to 40 deg are described. Below 15 deg, specular terrain reflections in a non-shadowing, hilly environment were observed to introduce significant fading. Although the reflecting surface was at a distance of up to several km, it is shown that the reflected signals are delayed by less than 1 microsec. Mobile measurements were also attempted receiving the 20 GHz Olympus beacon, but antenna pointing problems restricted first results to straight-line driving.

  4. Self-organization of synchronous activity propagation in neuronal networks driven by local excitation.

    PubMed

    Bayati, Mehdi; Valizadeh, Alireza; Abbassian, Abdolhossein; Cheng, Sen

    2015-01-01

    Many experimental and theoretical studies have suggested that the reliable propagation of synchronous neural activity is crucial for neural information processing. The propagation of synchronous firing activity in so-called synfire chains has been studied extensively in feed-forward networks of spiking neurons. However, it remains unclear how such neural activity could emerge in recurrent neuronal networks through synaptic plasticity. In this study, we investigate whether local excitation, i.e., neurons that fire at a higher frequency than the other, spontaneously active neurons in the network, can shape a network to allow for synchronous activity propagation. We use two-dimensional, locally connected and heterogeneous neuronal networks with spike-timing dependent plasticity (STDP). We find that, in our model, local excitation drives profound network changes within seconds. In the emergent network, neural activity propagates synchronously through the network. This activity originates from the site of the local excitation and propagates through the network. The synchronous activity propagation persists, even when the local excitation is removed, since it derives from the synaptic weight matrix. Importantly, once this connectivity is established it remains stable even in the presence of spontaneous activity. Our results suggest that synfire-chain-like activity can emerge in a relatively simple way in realistic neural networks by locally exciting the desired origin of the neuronal sequence.

  5. ACT/ICAPS: Thermoplastic composite activities

    NASA Technical Reports Server (NTRS)

    Renieri, M. P.; Burpo, S. J.; Roundy, L. M.; Todd, S. M.

    1992-01-01

    McDonnell Aircraft Company (MCAIR) is teamed with Douglas Aircraft Company (DAC) under NASA's Advanced Composite Technology (ACT) initiative in a program entitled Innovative Composite Aircraft Primary Structures (ICAPS). Efforts at MCAIR have focused on the use of thermoplastic composite materials in the development of structural details associated with an advanced fighter fuselage section with applicability to transport design. Based on innovative design/manufacturing concepts for the fuselage section primary structure, elements were designed, fabricated, and structurally tested. These elements focused on key issues such as thick composite lugs and low cost forming of fastenerless, stiffener/moldline concepts. Manufacturing techniques included autoclave consideration, single diaphragm co-consolidation (SDCC), and roll-forming.

  6. Topic-Aware Physical Activity Propagation in a Health Social Network

    PubMed Central

    Phan, Nhathai; Ebrahimi, Javid; Kil, Dave; Piniewski, Brigitte; Dou, Dejing

    2016-01-01

    Modeling physical activity propagation, such as physical exercise level and intensity, is the key to preventing the conduct that can lead to obesity; it can also help spread wellness behavior in a social network. PMID:27087794

  7. Combined EEG-fMRI and tractography to visualise propagation of epileptic activity

    PubMed Central

    Hamandi, K; Powell, H W R; Laufs, H; Symms, M R; Barker, G J; Parker, G J M; Lemieux, L; Duncan, J S

    2008-01-01

    In a patient with refractory temporal lobe epilepsy, EEG-fMRI showed activation in association with left anterior temporal interictal discharges, in the left temporal, parietal and occipital lobes. Dynamic causal modelling suggested propagation of neural activity from the temporal focus to the area of occipital activation. Tractography showed connections from the site of temporal lobe activation to the site of occipital activation. This demonstrates the principle of combining EEG-fMRI and tractography to delineate the pathways of propagation of epileptic activity. PMID:18096681

  8. JPL Activated Carbon Treatment System (ACTS) for sewage

    NASA Technical Reports Server (NTRS)

    1976-01-01

    An Activated Carbon Treatment System (ACTS) was developed for sewage treatment and is being applied to a one-million gallon per day sewage treatment pilot plant in Orange County California. Activities reported include pyrolysis and activation of carbon-sewage sludge, and activated carbon treatment of sewage to meet ocean discharge standards. The ACTS Sewage treatment operations include carbon-sewage treatment, primary and secondary clarifiers, gravity (multi-media) filter, filter press dewatering, flash drying of carbon-sewage filter cake, and sludge pyrolysis and activation. Tests were conducted on a laboratory scale, 10,000 gallon per day demonstration plant and pilot test equipment. Preliminary economic studies are favorable to the ACTS process relative to activated sludge treatment for a 175,000,000 gallon per day sewage treatment plant.

  9. Propagated infra-slow intrinsic brain activity reorganizes across wake and slow wave sleep.

    PubMed

    Mitra, Anish; Snyder, Abraham Z; Tagliazucchi, Enzo; Laufs, Helmut; Raichle, Marcus E

    2015-11-09

    Propagation of slow intrinsic brain activity has been widely observed in electrophysiogical studies of slow wave sleep (SWS). However, in human resting state fMRI (rs-fMRI), intrinsic activity has been understood predominantly in terms of zero-lag temporal synchrony (functional connectivity) within systems known as resting state networks (RSNs). Prior rs-fMRI studies have found that RSNs are generally preserved across wake and sleep. Here, we use a recently developed analysis technique to study propagation of infra-slow intrinsic blood oxygen level dependent (BOLD) signals in normal adults during wake and SWS. This analysis reveals marked changes in propagation patterns in SWS vs. wake. Broadly, ordered propagation is preserved within traditionally defined RSNs but lost between RSNs. Additionally, propagation between cerebral cortex and subcortical structures reverses directions, and intra-cortical propagation becomes reorganized, especially in visual and sensorimotor cortices. These findings show that propagated rs-fMRI activity informs theoretical accounts of the neural functions of sleep.

  10. Babcock-Leighton Solar Dynamo: The Role of Downward Pumping and the Equatorward Propagation of Activity

    NASA Astrophysics Data System (ADS)

    Karak, Bidya Binay; Cameron, Robert

    2016-11-01

    The key elements of the Babcock-Leighton dynamos are the generation of poloidal field through decay and the dispersal of tilted bipolar active regions and the generation of toroidal field through the observed differential rotation. These models are traditionally known as flux transport dynamo models as the equatorward propagations of the butterfly wings in these models are produced due to an equatorward flow at the bottom of the convection zone. Here we investigate the role of downward magnetic pumping near the surface using a kinematic Babcock-Leighton model. We find that the pumping causes the poloidal field to become predominately radial in the near-surface shear layer, which allows the negative radial shear to effectively act on the radial field to produce a toroidal field. We observe a clear equatorward migration of the toroidal field at low latitudes as a consequence of the dynamo wave even when there is no meridional flow in the deep convection zone. Both the dynamo wave and the flux transport type solutions are thus able to reproduce some of the observed features of the solar cycle including the 11-year periodicity. The main difference between the two types of solutions is the strength of the Babcock-Leighton source required to produce the dynamo action. A second consequence of the magnetic pumping is that it suppresses the diffusion of fields through the surface, which helps to allow an 11-year cycle at (moderately) larger values of magnetic diffusivity than have previously been used.

  11. ALVIN investigation of an active propagating rift system, Galapagos 95.5° W

    USGS Publications Warehouse

    Hey, R.N.; Sinton, J.M.; Kleinrock, M.C.; Yonover, R.N.; MacDonald, K.C.; Miller, S.P.; Searle, R.C.; Christie, D.M.; Atwater, T.M.; Sleep, Norman H.; Johnson, H. Paul; Neal, C.A.

    1992-01-01

    ALVIN investigations have defined the fine-scale structural and volcanic patterns produced by active rift and spreading center propagation and failure near 95.5° W on the Galapagos spreading center. Behind the initial lithospheric rifting, which is propagating nearly due west at about 50 km m.y.−1, a triangular block of preexisting lithosphere is being stretched and fractured, with some recent volcanism along curving fissures. A well-organized seafloor spreading center, an extensively faulted and fissured volcanic ridge, develops ~ 10 km (~ 200,000 years) behind the tectonic rift tip. Regional variations in the chemical compositions of the youngest lavas collected during this program contrast with those encompassing the entire 3 m.y. of propagation history for this region. A maximum in degree of magmatic differentiation occurs about 9 km behind the propagating rift tip, in a region of diffuse rifting. The propagating spreading center shows a gentle gradient in magmatic differentiation culminating at the SW-curving spreading center tip. Except for the doomed rift, which is in a constructional phase, tectonic activity also dominates over volcanic activity along the failing spreading system. In contrast to the propagating rift, failing rift lavas show a highly restricted range of compositions consistent with derivation from a declining upwelling zone accompanying rift failure. The lithosphere transferred from the Cocos to the Nazca plate by this propagator is extensively faulted and characterized by ubiquitous talus in one of the most tectonically disrupted areas of seafloor known. The pseudofault scarps, where the preexisting lithosphere was rifted apart, appear to include both normal and propagator lavas and are thus more lithologically complex than previously thought. Biological communities, probably vestimentiferan tubeworms, occur near the top of the outer pseudofault scarp, although no hydrothermal venting was observed.

  12. Columnar interactions determine horizontal propagation of recurrent network activity in neocortex

    PubMed Central

    Wester, Jason C.; Contreras, Diego

    2012-01-01

    The cortex is organized in vertical and horizontal circuits that determine the spatiotemporal properties of distributed cortical activity. Despite detailed knowledge of synaptic interactions among individual cells in the neocortex, little is known about the rules governing interactions among local populations. Here we used self-sustained recurrent activity generated in cortex, also known as up-states, in rat thalamocortical slices in vitro to understand interactions among laminar and horizontal circuits. By means of intracellular recordings and fast optical imaging with voltage sensitive dyes, we show that single thalamic inputs activate the cortical column in a preferential L4→L2/3→L5 sequence, followed by horizontal propagation with a leading front in supra and infragranular layers. To understand the laminar and columnar interactions, we used focal injections of TTX to block activity in small local populations, while preserving functional connectivity in the rest of the network. We show that L2/3 alone, without underlying L5, does not generate self-sustained activity and is inefficient propagating activity horizontally. In contrast, L5 sustains activity in the absence of L2/3 and is necessary and sufficient to propagate activity horizontally. However, loss of L2/3 delays horizontal propagation via L5. Finally, L5 amplifies activity in L2/3. Our results show for the first time that columnar interactions between supra and infragranular layers are required for the normal propagation of activity in the neocortex. Our data suggest that supra and infragranular circuits with their specific and complex set of inputs and outputs, work in tandem to determine the patterns of cortical activation observed in vivo. PMID:22514308

  13. 77 FR 16552 - Agency Information Collection Activities: JADE Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-21

    ..., Office of Management and Budget. Comments should be addressed to the OMB Desk Officer for U.S. Customs... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: JADE Act AGENCY: U.S. Customs and Border Protection, Department of Homeland Security. ACTION: 30-Day notice and request...

  14. Neuronal activity enhances tau propagation and tau pathology in vivo.

    PubMed

    Wu, Jessica W; Hussaini, S Abid; Bastille, Isle M; Rodriguez, Gustavo A; Mrejeru, Ana; Rilett, Kelly; Sanders, David W; Cook, Casey; Fu, Hongjun; Boonen, Rick A C M; Herman, Mathieu; Nahmani, Eden; Emrani, Sheina; Figueroa, Y Helen; Diamond, Marc I; Clelland, Catherine L; Wray, Selina; Duff, Karen E

    2016-08-01

    Tau protein can transfer between neurons transneuronally and trans-synaptically, which is thought to explain the progressive spread of tauopathy observed in the brain of patients with Alzheimer's disease. Here we show that physiological tau released from donor cells can transfer to recipient cells via the medium, suggesting that at least one mechanism by which tau can transfer is via the extracellular space. Neuronal activity has been shown to regulate tau secretion, but its effect on tau pathology is unknown. Using optogenetic and chemogenetic approaches, we found that increased neuronal activity stimulates the release of tau in vitro and enhances tau pathology in vivo. These data have implications for disease pathogenesis and therapeutic strategies for Alzheimer's disease and other tauopathies.

  15. Autaptic pacemaker mediated propagation of weak rhythmic activity across small-world neuronal networks

    NASA Astrophysics Data System (ADS)

    Yilmaz, Ergin; Baysal, Veli; Ozer, Mahmut; Perc, Matjaž

    2016-02-01

    We study the effects of an autapse, which is mathematically described as a self-feedback loop, on the propagation of weak, localized pacemaker activity across a Newman-Watts small-world network consisting of stochastic Hodgkin-Huxley neurons. We consider that only the pacemaker neuron, which is stimulated by a subthreshold periodic signal, has an electrical autapse that is characterized by a coupling strength and a delay time. We focus on the impact of the coupling strength, the network structure, the properties of the weak periodic stimulus, and the properties of the autapse on the transmission of localized pacemaker activity. Obtained results indicate the existence of optimal channel noise intensity for the propagation of the localized rhythm. Under optimal conditions, the autapse can significantly improve the propagation of pacemaker activity, but only for a specific range of the autaptic coupling strength. Moreover, the autaptic delay time has to be equal to the intrinsic oscillation period of the Hodgkin-Huxley neuron or its integer multiples. We analyze the inter-spike interval histogram and show that the autapse enhances or suppresses the propagation of the localized rhythm by increasing or decreasing the phase locking between the spiking of the pacemaker neuron and the weak periodic signal. In particular, when the autaptic delay time is equal to the intrinsic period of oscillations an optimal phase locking takes place, resulting in a dominant time scale of the spiking activity. We also investigate the effects of the network structure and the coupling strength on the propagation of pacemaker activity. We find that there exist an optimal coupling strength and an optimal network structure that together warrant an optimal propagation of the localized rhythm.

  16. Parvalbumin-Positive Inhibitory Interneurons Oppose Propagation But Favor Generation of Focal Epileptiform Activity.

    PubMed

    Sessolo, Michele; Marcon, Iacopo; Bovetti, Serena; Losi, Gabriele; Cammarota, Mario; Ratto, Gian Michele; Fellin, Tommaso; Carmignoto, Giorgio

    2015-07-01

    Parvalbumin (Pv)-positive inhibitory interneurons effectively control network excitability, and their optogenetic activation has been reported to block epileptic seizures. An intense activity in GABAergic interneurons, including Pv interneurons, before seizures has been described in different experimental models of epilepsy, raising the hypothesis that an increased GABAergic inhibitory signal may, under certain conditions, initiate seizures. It is therefore unclear whether the activity of Pv interneurons enhances or opposes epileptiform activities. Here we use a mouse cortical slice model of focal epilepsy in which the epileptogenic focus can be identified and the role of Pv interneurons in the generation and propagation of seizure-like ictal events is accurately analyzed by a combination of optogenetic, electrophysiological, and imaging techniques. We found that a selective activation of Pv interneurons at the focus failed to block ictal generation and induced postinhibitory rebound spiking in pyramidal neurons, enhancing neuronal synchrony and promoting ictal generation. In contrast, a selective activation of Pv interneurons distant from the focus blocked ictal propagation and shortened ictal duration at the focus. We revealed that the reduced ictal duration was a direct consequence of the ictal propagation block, probably by preventing newly generated afterdischarges to travel backwards to the original focus of ictal initiation. Similar results were obtained upon individual Pv interneuron activation by intracellular depolarizing current pulses. The functional dichotomy of Pv interneurons here described opens new perspectives to our understanding of how local inhibitory circuits govern generation and spread of focal epileptiform activities.

  17. On the Theory of High-Power Ultrashort Pulse Propagation in Raman-Active Media

    NASA Technical Reports Server (NTRS)

    Belenov, E. M.; Isakov, V. A.; Kanavin, A. P.; Smetanin, I. V.

    1996-01-01

    The propagation of an intense femtosecond pulse in a Raman-active medium is analyzed. An analytic solution which describes in explicit form the evolution of the light pulse is derived. The field of an intense light wave undergoes a substantial transformation as the wave propagates through the medium. The nature of this transformation can change over time scales comparable to the period of the optical oscillations. As a result, the pulse of sufficiently high energy divides into stretched and compressed domains where the field decreases and increases respectively.

  18. Propagating Waves of Activity in the Neocortex: What They Are, What They Do

    PubMed Central

    WU, JIAN-YOUNG; HUANG, XIAOYING; ZHANG, CHUAN

    2009-01-01

    The development of voltage-sensitive dyes (VSD) and fast optical imaging techniques have brought us a new tool for examining spatiotemporal patterns of population neuronal activity in the neocortex. Propagating waves have been observed during almost every type of cortical processing examined by VSD imaging or electrode arrays. These waves provide subthreshold depolarization to individual neurons and increase their spiking probability. Therefore, the propagation of the waves sets up a spatiotemporal framework for increased excitability in neuronal populations, which can help to determine when and where the neurons are likely to fire. In this review, first discussed is propagating waves observed in various systems and possible mechanisms for generating and sustaining these waves. Then discussed are wave dynamics as an emergent behavior of the population activity that can, in turn, influence the activity of individual neurons. The functions of spontaneous and sensory-evoked waves remain to be explored. An important next step will be to examine the interaction between dynamics of propagating waves and functions in the cortex, and to verify if cortical processing can be modified when these waves are altered. PMID:18997124

  19. Intracerebral propagation of interictal activity in partial epilepsy: implications for source localisation.

    PubMed Central

    Alarcon, G; Guy, C N; Binnie, C D; Walker, S R; Elwes, R D; Polkey, C E

    1994-01-01

    The hypothesis that focal scalp EEG and MEG interictal epileptiform activity can be modelled by single dipoles or by a limited number of dipoles was examined. The time course and spatial distribution of interictal activity recorded simultaneously by surface electrodes and by electrodes next to mesial temporal structures in 12 patients being assessed for epilepsy surgery have been studied to estimate the degree of confinement of neural activity present during interictal paroxysms, and the degree to which volume conduction and neural propagation take part in the diffusion of interictal activity. Also, intrapatient topographical correlations of ictal onset zone and deep interictal activity have been studied. Correlations between the amplitudes of deep and surface recordings, together with previous reports on the amplitude of scalp signals produced by artificially implanted dipoles suggest that the ratio of deep to surface activity recorded during interictal epileptiform activity on the scalp is around 1:2000. This implies that most such activity recorded on the scalp does not arise from volume conduction from deep structures but is generated in the underlying neocortex. Also, time delays of up to 220 ms recorded between interictal paroxysms at different recording sites show that interictal epileptiform activity can propagate neuronally within several milliseconds to relatively remote cortex. Large areas of archicortex and neocortex can then be simultaneously or sequentially active via three possible mechanisms: (1) by fast association fibres directly, (2) by fast association fibres that trigger local phenomena which in turn give rise to sharp/slow waves or spikes, and (3) propagation along the neocortex. The low ratio of deep-to-surface signal on the scalp and the simultaneous activation of large neocortical areas can yield spurious equivalent dipoles localised in deeper structures. Frequent interictal spike activities can also take place independently in areas other

  20. Neural Activity Propagation in an Unfolded Hippocampal Preparation with a Penetrating Micro-electrode Array

    PubMed Central

    Gonzales-Reyes, Luis E.; Durand, Dominique M.

    2015-01-01

    This protocol describes a method for preparing a new in vitro flat hippocampus preparation combined with a micro-machined array to map neural activity in the hippocampus. The transverse hippocampal slice preparation is the most common tissue preparation to study hippocampus electrophysiology. A longitudinal hippocampal slice was also developed in order to investigate longitudinal connections in the hippocampus. The intact mouse hippocampus can also be maintained in vitro because its thickness allows adequate oxygen diffusion. However, these three preparations do not provide direct access to neural propagation since some of the tissue is either missing or folded. The unfolded intact hippocampus provides both transverse and longitudinal connections in a flat configuration for direct access to the tissue to analyze the full extent of signal propagation in the hippocampus in vitro. In order to effectively monitor the neural activity from the cell layer, a custom made penetrating micro-electrode array (PMEA) was fabricated and applied to the unfolded hippocampus. The PMEA with 64 electrodes of 200 µm in height could record neural activity deep inside the mouse hippocampus. The unique combination of an unfolded hippocampal preparation and the PMEA provides a new in-vitro tool to study the speed and direction of propagation of neural activity in the two-dimensional CA1-CA3 regions of the hippocampus with a high signal to noise ratio. PMID:25868081

  1. Distributed dynamical computation in neural circuits with propagating coherent activity patterns.

    PubMed

    Gong, Pulin; van Leeuwen, Cees

    2009-12-01

    Activity in neural circuits is spatiotemporally organized. Its spatial organization consists of multiple, localized coherent patterns, or patchy clusters. These patterns propagate across the circuits over time. This type of collective behavior has ubiquitously been observed, both in spontaneous activity and evoked responses; its function, however, has remained unclear. We construct a spatially extended, spiking neural circuit that generates emergent spatiotemporal activity patterns, thereby capturing some of the complexities of the patterns observed empirically. We elucidate what kind of fundamental function these patterns can serve by showing how they process information. As self-sustained objects, localized coherent patterns can signal information by propagating across the neural circuit. Computational operations occur when these emergent patterns interact, or collide with each other. The ongoing behaviors of these patterns naturally embody both distributed, parallel computation and cascaded logical operations. Such distributed computations enable the system to work in an inherently flexible and efficient way. Our work leads us to propose that propagating coherent activity patterns are the underlying primitives with which neural circuits carry out distributed dynamical computation.

  2. Calcium-Activated Potassium Channels at Nodes of Ranvier Secure Axonal Spike Propagation.

    PubMed

    Gründemann, Jan; Clark, Beverley A

    2015-09-22

    Functional connectivity between brain regions relies on long-range signaling by myelinated axons. This is secured by saltatory action potential propagation that depends fundamentally on sodium channel availability at nodes of Ranvier. Although various potassium channel types have been anatomically localized to myelinated axons in the brain, direct evidence for their functional recruitment in maintaining node excitability is scarce. Cerebellar Purkinje cells provide continuous input to their targets in the cerebellar nuclei, reliably transmitting axonal spikes over a wide range of rates, requiring a constantly available pool of nodal sodium channels. We show that the recruitment of calcium-activated potassium channels (IK, K(Ca)3.1) by local, activity-dependent calcium (Ca(2+)) influx at nodes of Ranvier via a T-type voltage-gated Ca(2+) current provides a powerful mechanism that likely opposes depolarizing block at the nodes and is thus pivotal to securing continuous axonal spike propagation in spontaneously firing Purkinje cells.

  3. Calcium-Activated Potassium Channels at Nodes of Ranvier Secure Axonal Spike Propagation

    PubMed Central

    Gründemann, Jan; Clark, Beverley A.

    2015-01-01

    Summary Functional connectivity between brain regions relies on long-range signaling by myelinated axons. This is secured by saltatory action potential propagation that depends fundamentally on sodium channel availability at nodes of Ranvier. Although various potassium channel types have been anatomically localized to myelinated axons in the brain, direct evidence for their functional recruitment in maintaining node excitability is scarce. Cerebellar Purkinje cells provide continuous input to their targets in the cerebellar nuclei, reliably transmitting axonal spikes over a wide range of rates, requiring a constantly available pool of nodal sodium channels. We show that the recruitment of calcium-activated potassium channels (IK, KCa3.1) by local, activity-dependent calcium (Ca2+) influx at nodes of Ranvier via a T-type voltage-gated Ca2+ current provides a powerful mechanism that likely opposes depolarizing block at the nodes and is thus pivotal to securing continuous axonal spike propagation in spontaneously firing Purkinje cells. PMID:26344775

  4. Rapid, parallel path planning by propagating wavefronts of spiking neural activity.

    PubMed

    Ponulak, Filip; Hopfield, John J

    2013-01-01

    Efficient path planning and navigation is critical for animals, robotics, logistics and transportation. We study a model in which spatial navigation problems can rapidly be solved in the brain by parallel mental exploration of alternative routes using propagating waves of neural activity. A wave of spiking activity propagates through a hippocampus-like network, altering the synaptic connectivity. The resulting vector field of synaptic change then guides a simulated animal to the appropriate selected target locations. We demonstrate that the navigation problem can be solved using realistic, local synaptic plasticity rules during a single passage of a wavefront. Our model can find optimal solutions for competing possible targets or learn and navigate in multiple environments. The model provides a hypothesis on the possible computational mechanisms for optimal path planning in the brain, at the same time it is useful for neuromorphic implementations, where the parallelism of information processing proposed here can fully be harnessed in hardware.

  5. Rapid, parallel path planning by propagating wavefronts of spiking neural activity

    PubMed Central

    Ponulak, Filip; Hopfield, John J.

    2013-01-01

    Efficient path planning and navigation is critical for animals, robotics, logistics and transportation. We study a model in which spatial navigation problems can rapidly be solved in the brain by parallel mental exploration of alternative routes using propagating waves of neural activity. A wave of spiking activity propagates through a hippocampus-like network, altering the synaptic connectivity. The resulting vector field of synaptic change then guides a simulated animal to the appropriate selected target locations. We demonstrate that the navigation problem can be solved using realistic, local synaptic plasticity rules during a single passage of a wavefront. Our model can find optimal solutions for competing possible targets or learn and navigate in multiple environments. The model provides a hypothesis on the possible computational mechanisms for optimal path planning in the brain, at the same time it is useful for neuromorphic implementations, where the parallelism of information processing proposed here can fully be harnessed in hardware. PMID:23882213

  6. Temporal Asymmetry in Dark–Bright Processing Initiates Propagating Activity across Primary Visual Cortex

    PubMed Central

    Rekauzke, Sascha; Nortmann, Nora; Staadt, Robert; Hock, Howard S.; Schöner, Gregor

    2016-01-01

    Differences between visual pathways representing darks and lights have been shown to affect spatial resolution and detection timing. Both psychophysical and physiological studies suggest an underlying retinal origin with amplification in primary visual cortex (V1). Here we show that temporal asymmetries in the processing of darks and lights create motion in terms of propagating activity across V1. Exploiting the high spatiotemporal resolution of voltage-sensitive dye imaging, we captured population responses to abrupt local changes of luminance in cat V1. For stimulation we used two neighboring small squares presented on either bright or dark backgrounds. When a single square changed from dark to bright or vice versa, we found coherent population activity emerging at the respective retinal input locations. However, faster rising and decay times were obtained for the bright to dark than the dark to bright changes. When the two squares changed luminance simultaneously in opposite polarities, we detected a propagating wave front of activity that originated at the cortical location representing the darkened square and rapidly expanded toward the region representing the brightened location. Thus, simultaneous input led to sequential activation across cortical retinotopy. Importantly, this effect was independent of the squares' contrast with the background. We suggest imbalance in dark–bright processing as a driving force in the generation of wave-like activity. Such propagation may convey motion signals and influence perception of shape whenever abrupt shifts in visual objects or gaze cause counterchange of luminance at high-contrast borders. SIGNIFICANCE STATEMENT An elementary process in vision is the detection of darks and lights through the retina via ON and OFF channels. Psychophysical and physiological studies suggest that differences between these channels affect spatial resolution and detection thresholds. Here we show that temporal asymmetries in the

  7. Active action potential propagation but not initiation in thalamic interneuron dendrites

    PubMed Central

    Casale, Amanda E.; McCormick, David A.

    2012-01-01

    Inhibitory interneurons of the dorsal lateral geniculate nucleus of the thalamus modulate the activity of thalamocortical cells in response to excitatory input through the release of inhibitory neurotransmitter from both axons and dendrites. The exact mechanisms by which release can occur from dendrites are, however, not well understood. Recent experiments using calcium imaging have suggested that Na/K based action potentials can evoke calcium transients in dendrites via local active conductances, making the back-propagating action potential a candidate for dendritic neurotransmitter release. In this study, we employed high temporal and spatial resolution voltage-sensitive dye imaging to assess the characteristics of dendritic voltage deflections in response to Na/K action potentials in interneurons of the mouse dorsal lateral geniculate nucleus. We found that trains or single action potentials elicited by somatic current injection or local synaptic stimulation led to action potentials that rapidly and actively back-propagated throughout the entire dendritic arbor and into the fine filiform dendritic appendages known to release GABAergic vesicles. Action potentials always appeared first in the soma or proximal dendrite in response to somatic current injection or local synaptic stimulation, and the rapid back-propagation into the dendritic arbor depended upon voltage-gated sodium and TEA-sensitive potassium channels. Our results indicate that thalamic interneuron dendrites integrate synaptic inputs that initiate action potentials, most likely in the axon initial segment, that then back-propagate with high-fidelity into the dendrites, resulting in a nearly synchronous release of GABA from both axonal and dendritic compartments. PMID:22171033

  8. Activity Catalog Tool (ACT) user manual, version 2.0

    NASA Technical Reports Server (NTRS)

    Segal, Leon D.; Andre, Anthony D.

    1994-01-01

    This report comprises the user manual for version 2.0 of the Activity Catalog Tool (ACT) software program, developed by Leon D. Segal and Anthony D. Andre in cooperation with NASA Ames Aerospace Human Factors Research Division, FLR branch. ACT is a software tool for recording and analyzing sequences of activity over time that runs on the Macintosh platform. It was designed as an aid for professionals who are interested in observing and understanding human behavior in field settings, or from video or audio recordings of the same. Specifically, the program is aimed at two primary areas of interest: human-machine interactions and interactions between humans. The program provides a means by which an observer can record an observed sequence of events, logging such parameters as frequency and duration of particular events. The program goes further by providing the user with a quantified description of the observed sequence, through application of a basic set of statistical routines, and enables merging and appending of several files and more extensive analysis of the resultant data.

  9. Effects of Calcium Spikes in the Layer 5 Pyramidal Neuron on Coincidence Detection and Activity Propagation

    PubMed Central

    Chua, Yansong; Morrison, Abigail

    2016-01-01

    The role of dendritic spiking mechanisms in neural processing is so far poorly understood. To investigate the role of calcium spikes in the functional properties of the single neuron and recurrent networks, we investigated a three compartment neuron model of the layer 5 pyramidal neuron with calcium dynamics in the distal compartment. By performing single neuron simulations with noisy synaptic input and occasional large coincident input at either just the distal compartment or at both somatic and distal compartments, we show that the presence of calcium spikes confers a substantial advantage for coincidence detection in the former case and a lesser advantage in the latter. We further show that the experimentally observed critical frequency phenomenon, in which action potentials triggered by stimuli near the soma above a certain frequency trigger a calcium spike at distal dendrites, leading to further somatic depolarization, is not exhibited by a neuron receiving realistically noisy synaptic input, and so is unlikely to be a necessary component of coincidence detection. We next investigate the effect of calcium spikes in propagation of spiking activities in a feed-forward network (FFN) embedded in a balanced recurrent network. The excitatory neurons in the network are again connected to either just the distal, or both somatic and distal compartments. With purely distal connectivity, activity propagation is stable and distinguishable for a large range of recurrent synaptic strengths if the feed-forward connections are sufficiently strong, but propagation does not occur in the absence of calcium spikes. When connections are made to both the somatic and the distal compartments, activity propagation is achieved for neurons with active calcium dynamics at a much smaller number of neurons per pool, compared to a network of passive neurons, but quickly becomes unstable as the strength of recurrent synapses increases. Activity propagation at higher scaling factors can be

  10. Effects of Calcium Spikes in the Layer 5 Pyramidal Neuron on Coincidence Detection and Activity Propagation.

    PubMed

    Chua, Yansong; Morrison, Abigail

    2016-01-01

    The role of dendritic spiking mechanisms in neural processing is so far poorly understood. To investigate the role of calcium spikes in the functional properties of the single neuron and recurrent networks, we investigated a three compartment neuron model of the layer 5 pyramidal neuron with calcium dynamics in the distal compartment. By performing single neuron simulations with noisy synaptic input and occasional large coincident input at either just the distal compartment or at both somatic and distal compartments, we show that the presence of calcium spikes confers a substantial advantage for coincidence detection in the former case and a lesser advantage in the latter. We further show that the experimentally observed critical frequency phenomenon, in which action potentials triggered by stimuli near the soma above a certain frequency trigger a calcium spike at distal dendrites, leading to further somatic depolarization, is not exhibited by a neuron receiving realistically noisy synaptic input, and so is unlikely to be a necessary component of coincidence detection. We next investigate the effect of calcium spikes in propagation of spiking activities in a feed-forward network (FFN) embedded in a balanced recurrent network. The excitatory neurons in the network are again connected to either just the distal, or both somatic and distal compartments. With purely distal connectivity, activity propagation is stable and distinguishable for a large range of recurrent synaptic strengths if the feed-forward connections are sufficiently strong, but propagation does not occur in the absence of calcium spikes. When connections are made to both the somatic and the distal compartments, activity propagation is achieved for neurons with active calcium dynamics at a much smaller number of neurons per pool, compared to a network of passive neurons, but quickly becomes unstable as the strength of recurrent synapses increases. Activity propagation at higher scaling factors can be

  11. Protein Folding Activity of the Ribosome is involved in Yeast Prion Propagation

    PubMed Central

    Blondel, Marc; Soubigou, Flavie; Evrard, Justine; Nguyen, Phu hai; Hasin, Naushaba; Chédin, Stéphane; Gillet, Reynald; Contesse, Marie-Astrid; Friocourt, Gaëlle; Stahl, Guillaume; Jones, Gary W.; Voisset, Cécile

    2016-01-01

    6AP and GA are potent inhibitors of yeast and mammalian prions and also specific inhibitors of PFAR, the protein-folding activity borne by domain V of the large rRNA of the large subunit of the ribosome. We therefore explored the link between PFAR and yeast prion [PSI+] using both PFAR-enriched mutants and site-directed methylation. We demonstrate that PFAR is involved in propagation and de novo formation of [PSI+]. PFAR and the yeast heat-shock protein Hsp104 partially compensate each other for [PSI+] propagation. Our data also provide insight into new functions for the ribosome in basal thermotolerance and heat-shocked protein refolding. PFAR is thus an evolutionarily conserved cell component implicated in the prion life cycle, and we propose that it could be a potential therapeutic target for human protein misfolding diseases. PMID:27633137

  12. Human activity recognition based on feature selection in smart home using back-propagation algorithm.

    PubMed

    Fang, Hongqing; He, Lei; Si, Hao; Liu, Peng; Xie, Xiaolei

    2014-09-01

    In this paper, Back-propagation(BP) algorithm has been used to train the feed forward neural network for human activity recognition in smart home environments, and inter-class distance method for feature selection of observed motion sensor events is discussed and tested. And then, the human activity recognition performances of neural network using BP algorithm have been evaluated and compared with other probabilistic algorithms: Naïve Bayes(NB) classifier and Hidden Markov Model(HMM). The results show that different feature datasets yield different activity recognition accuracy. The selection of unsuitable feature datasets increases the computational complexity and degrades the activity recognition accuracy. Furthermore, neural network using BP algorithm has relatively better human activity recognition performances than NB classifier and HMM.

  13. Propagating cell-membrane waves driven by curved activators of actin polymerization.

    PubMed

    Peleg, Barak; Disanza, Andrea; Scita, Giorgio; Gov, Nir

    2011-04-21

    Cells exhibit propagating membrane waves which involve the actin cytoskeleton. One type of such membranal waves are Circular Dorsal Ruffles (CDR) which are related to endocytosis and receptor internalization. Experimentally, CDRs have been associated with membrane bound activators of actin polymerization of concave shape. We present experimental evidence for the localization of convex membrane proteins in these structures, and their insensitivity to inhibition of myosin II contractility in immortalized mouse embryo fibroblasts cell cultures. These observations lead us to propose a theoretical model which explains the formation of these waves due to the interplay between complexes that contain activators of actin polymerization and membrane-bound curved proteins of both types of curvature (concave and convex). Our model predicts that the activity of both types of curved proteins is essential for sustaining propagating waves, which are abolished when one type of curved activator is removed. Within this model waves are initiated when the level of actin polymerization induced by the curved activators is higher than some threshold value, which allows the cell to control CDR formation. We demonstrate that the model can explain many features of CDRs, and give several testable predictions. This work demonstrates the importance of curved membrane proteins in organizing the actin cytoskeleton and cell shape.

  14. Blast shockwaves propagate Ca(2+) activity via purinergic astrocyte networks in human central nervous system cells.

    PubMed

    Ravin, Rea; Blank, Paul S; Busse, Brad; Ravin, Nitay; Vira, Shaleen; Bezrukov, Ludmila; Waters, Hang; Guerrero-Cazares, Hugo; Quinones-Hinojosa, Alfredo; Lee, Philip R; Fields, R Douglas; Bezrukov, Sergey M; Zimmerberg, Joshua

    2016-05-10

    In a recent study of the pathophysiology of mild, blast-induced traumatic brain injury (bTBI) the exposure of dissociated, central nervous system (CNS) cells to simulated blast resulted in propagating waves of elevated intracellular Ca(2+). Here we show, in dissociated human CNS cultures, that these calcium waves primarily propagate through astrocyte-dependent, purinergic signaling pathways that are blocked by P2 antagonists. Human, compared to rat, astrocytes had an increased calcium response and prolonged calcium wave propagation kinetics, suggesting that in our model system rat CNS cells are less responsive to simulated blast. Furthermore, in response to simulated blast, human CNS cells have increased expressions of a reactive astrocyte marker, glial fibrillary acidic protein (GFAP) and a protease, matrix metallopeptidase 9 (MMP-9). The conjoint increased expression of GFAP and MMP-9 and a purinergic ATP (P2) receptor antagonist reduction in calcium response identifies both potential mechanisms for sustained changes in brain function following primary bTBI and therapeutic strategies targeting abnormal astrocyte activity.

  15. Blast shockwaves propagate Ca2+ activity via purinergic astrocyte networks in human central nervous system cells

    PubMed Central

    Ravin, Rea; Blank, Paul S.; Busse, Brad; Ravin, Nitay; Vira, Shaleen; Bezrukov, Ludmila; Waters, Hang; Guerrero-Cazares, Hugo; Quinones-Hinojosa, Alfredo; Lee, Philip R.; Fields, R. Douglas; Bezrukov, Sergey M.; Zimmerberg, Joshua

    2016-01-01

    In a recent study of the pathophysiology of mild, blast-induced traumatic brain injury (bTBI) the exposure of dissociated, central nervous system (CNS) cells to simulated blast resulted in propagating waves of elevated intracellular Ca2+. Here we show, in dissociated human CNS cultures, that these calcium waves primarily propagate through astrocyte-dependent, purinergic signaling pathways that are blocked by P2 antagonists. Human, compared to rat, astrocytes had an increased calcium response and prolonged calcium wave propagation kinetics, suggesting that in our model system rat CNS cells are less responsive to simulated blast. Furthermore, in response to simulated blast, human CNS cells have increased expressions of a reactive astrocyte marker, glial fibrillary acidic protein (GFAP) and a protease, matrix metallopeptidase 9 (MMP-9). The conjoint increased expression of GFAP and MMP-9 and a purinergic ATP (P2) receptor antagonist reduction in calcium response identifies both potential mechanisms for sustained changes in brain function following primary bTBI and therapeutic strategies targeting abnormal astrocyte activity. PMID:27162174

  16. Mammalian intestinal alkaline phosphatase acts as highly active exopolyphosphatase.

    PubMed

    Lorenz, B; Schröder, H C

    2001-06-11

    Recent results revealed that inorganic polyphosphates (polyP), being energy-rich linear polymers of orthophosphate residues known from bacteria and yeast, also exist in higher eukaryotes. However, the enzymatic basis of their metabolism especially in mammalian cells is still uncertain. Here we demonstrate for the first time that alkaline phosphatase from calf intestine (CIAP) is able to cleave polyP molecules up to a chain length of about 800. The enzyme acts as an exopolyphosphatase degrading polyP in a processive manner. The pH optimum is in the alkaline range. Divalent cations are not required for catalytic activity but inhibit the degradation of polyP. The rate of hydrolysis of short-chain polyP by CIAP is comparable to that of the standard alkaline phosphatase (AP) substrate p-nitrophenyl phosphate. The specific activity of the enzyme decreases with increasing chain length of the polymer both in the alkaline and in the neutral pH range. The K(m) of the enzyme also decreases with increasing chain length. The mammalian tissue non-specific isoform of AP was not able to hydrolyze polyP under the conditions applied while the placental-type AP and the bacterial (Escherichia coli) AP displayed polyP-degrading activity.

  17. Activating and propagating polyclonal gamma delta T cells with broad specificity for malignancies

    PubMed Central

    Deniger, Drew C.; Maiti, Sourindra N.; Mi, Tiejuan; Switzer, Kirsten C.; Ramachandran, Vijaya; Hurton, Lenka V.; Ang, Sonny; Olivares, Simon; Rabinovich, Brian A.; Huls, Helen; Lee, Dean A.; Bast, Robert C.; Champlin, Richard E.; Cooper, Laurence J.N.

    2014-01-01

    Purpose To activate and propagate populations of γδT cells expressing polyclonal repertoire of γ and δ TCR chains for adoptive immunotherapy for cancer, which has yet to be achieved. Experimental Design Clinical-grade artificial antigen presenting cells (aAPC) derived from K562 tumor cells were used as irradiated feeders to activate and expand human γδT cells to clinical scale. These cells were tested for proliferation, TCR expression, memory phenotype, cytokine secretion, and tumor killing. Results γδT cell proliferation was dependent upon CD137L expression on aAPC and addition of exogenous IL-2 and IL-21. Propagated γδT cells were polyclonal as they expressed Vδ1, Vδ2, Vδ3, Vδ5, Vδ7, and Vδ8 with Vγ2, Vγ3, Vγ7, Vγ8, Vγ9, Vγ10, and Vγ11 TCR chains. Interferon-γ production by Vδ1, Vδ2, and Vδ1negVδ2neg subsets was inhibited by pan-TCRγδantibody when added to co-cultures of polyclonal γδT cells and tumor cell lines. Polyclonal γδT cells killed acute and chronic leukemia, colon, pancreatic, and ovarian cancer cell lines, but not healthy autologous or allogeneic normal B cells. Blocking antibodies demonstrated that polyclonal γδT cells mediated tumor cell lysis through combination of DNAM1, NKG2D, and TCRγδ. The adoptive transfer of activated and propagated γδT cells expressing polyclonal versus defined Vδ TCR chains imparted a hierarchy (polyclonal>Vδ1>Vδ1negVδ2neg>Vδ2) of survival of mice with ovarian cancer xenografts. Conclusions Polyclonal γδT cells can be activated and propagated with clinical-grade aAPC and demonstrate broad anti-tumor activities, which will facilitate the implementation of γδT cell cancer immunotherapies in humans. PMID:24833662

  18. Graphene-based electrically reconfigurable deep-subwavelength metamaterials for active control of THz light propagation

    NASA Astrophysics Data System (ADS)

    Arezoomandan, Sara; Yang, Kai; Sensale-Rodriguez, Berardi

    2014-08-01

    This work studies the terahertz light propagation through graphene-based reconfigurable metasurfaces where the unit cell dimensions are much smaller than the terahertz wavelength. The proposed devices, which poses deep-subwavelength unit cell and active region dimensions can operate as amplitude and/or phase modulators in certain specific frequency bands determined by the device geometry. Reconfigurability is attained via electrostatically tuning the optical conductivity of patterned graphene layers, which are strategically located in each unit cell. The ultra-small unit cell dimensions can be advantageous for beam shaping applications.

  19. A small change in neuronal network topology can induce explosive synchronization transition and activity propagation in the entire network.

    PubMed

    Wang, Zhenhua; Tian, Changhai; Dhamala, Mukesh; Liu, Zonghua

    2017-04-03

    We here study explosive synchronization transitions and network activity propagation in networks of coupled neurons to provide a new understanding of the relationship between network topology and explosive dynamical transitions as in epileptic seizures and their propagations in the brain. We model local network motifs and configurations of coupled neurons and analyze the activity propagations between a group of active neurons to their inactive neuron neighbors in a variety of network configurations. We find that neuronal activity propagation is limited to local regions when network is highly clustered with modular structures as in the normal brain networks. When the network cluster structure is slightly changed, the activity propagates to the entire network, which is reminiscent of epileptic seizure propagation in the brain. Finally, we analyze intracranial electroencephalography (IEEG) recordings of a seizure episode from a epilepsy patient and uncover that explosive synchronization-like transition occurs around the clinically defined onset of seizure. These findings may provide a possible mechanism for the recurrence of epileptic seizures, which are known to be the results of aberrant neuronal network structure and/or function in the brain.

  20. Valuing the Endangered Species Antirrhinum lopesianum: Neuroprotective Activities and Strategies for in vitro Plant Propagation

    PubMed Central

    Gomes, Andreia; Fortalezas, Sofia; Pimpão, Rui; Figueira, Inês; Maroco, João; Aguiar, Carlos; Ferreira, Ricardo B.; Miguel, Célia; Santos, Cláudia N.

    2013-01-01

    Plant phytochemicals are described as possessing considerable neuroprotective properties, due to radical scavenging capacity and acetylcholinesterase inhibitory activity, important bioactivities in neurodegeneration. Antirrhinum lopesianum is a rare endemism from the Iberian Peninsula, occurring at the northeastern border between Portugal and Spain. It is classified as Endangered, due to its highly fragmented geographical occupation, facing a high risk of extinction in the Portuguese territory, within 20 years. Here, we describe for the first time the chemical characterization of extracts of the species concerning total phenol content, flavonoid content and antioxidant properties. The profile of high performance liquid chromatography with diode array detector (HPLC-DAD) of the polyphenol-enriched fraction of plant extracts was also performed, showing the great potential of the species as a source of bioactive phytochemical compounds. A. lopesianum’s potential for neuroprotection was revealed by a significant acetylcholinesterase inhibitory activity and also by a neuroprotective effect on a human cell model of neurodegeneration. Moreover, this is the first report describing a successful procedure for the in vitro propagation of this endangered species. The comparison of phenolic content and the HPLC-DAD profile of wild and in vitro propagated plants revealed that in vitro plants maintain the ability to produce secondary metabolites, but the profiles are differentially affected by the growth regulators. The results presented here greatly contribute to the value for this species regarding its potential as a source of phytochemicals with prospective neuroprotective health benefits. PMID:26784465

  1. In vitro propagation of the medicinal plant Ziziphora tenuior L. and evaluation of its antioxidant activity

    PubMed Central

    Dakah, Abdulkarim; Zaid, Salim; Suleiman, Mohamad; Abbas, Sami; Wink, Michael

    2014-01-01

    Ziziphora tenuior L. (Lamiaceae) is an aromatic herb used for its medicinal values against fungi, bacteria. Micropropagation can be used for large-scale multiplication of essential oil producing plants thus avoiding an overexploitation of natural resources. This work aims to develop a reliable protocol for the in vitro propagation of Z. tenuior, and to compare the antioxidant activity between in vitro propagated and wild plants. The explants were sterilized and cultured on MS medium containing different concentrations of growth regulators naphthalene acetic acid (NAA) or indole-3-butyric acid (IBA) with 0.5 mg/L of kinetin (Kin) callus formation was 70.2% after 45 days of incubation in dark on medium supplemented with 1.5 mg/L of NAA. After one month of callus culture on medium supplemented with 2 mg/L BA the shoot number was 5.12 and for the multiplication stage. The shoot number was 4.21 and length was 6.17 cm on medium supplemented with 1 mg/L Kin + 0.1 mg/L NAA. DPPH• reagent was used to test the antioxidant activity. The aqueous and methanol extracts of in vitro plants which were treated with 1.5 and 1 mg/L of kin plus 0.1 mg/L of NAA showed a strong DPPH• scavenging activity where IC50 was 0.307 and 0.369 mg/ml, respectively, while the IC50 of aqueous and methanol extracts of wild plants was 0.516 and 9.229 mg/ml, respectively. Our results suggested that plant growth regulators and in vitro culture conditions increased the antioxidant activity. PMID:25183942

  2. Intra- and Interhemispheric Propagation of Electrophysiological Synchronous Activity and Its Modulation by Serotonin in the Cingulate Cortex of Juvenile Mice

    PubMed Central

    Rovira, Víctor; Geijo-Barrientos, Emilio

    2016-01-01

    Disinhibition of the cortex (e.g., by GABA -receptor blockade) generates synchronous and oscillatory electrophysiological activity that propagates along the cortex. We have studied, in brain slices of the cingulate cortex of mice (postnatal age 14–20 days), the propagation along layer 2/3 as well as the interhemispheric propagation through the corpus callosum of synchronous discharges recorded extracellularly and evoked in the presence of 10 μM bicuculline by electrical stimulation of layer 1. The latency of the responses obtained at the same distance from the stimulus electrode was longer in anterior cingulate cortex (ACC: 39.53 ± 2.83 ms, n = 7) than in retrosplenial cortex slices (RSC: 21.99 ± 2.75 ms, n = 5; p<0.05), which is equivalent to a lower propagation velocity in the dorso-ventral direction in ACC than in RSC slices (43.0 mm/s vs 72.9 mm/s). We studied the modulation of this propagation by serotonin. Serotonin significantly increased the latency of the intracortical synchronous discharges (18.9% in the ipsilateral hemisphere and 40.2% in the contralateral hemisphere), and also increased the interhemispheric propagation time by 86.4%. These actions of serotonin were mimicked by the activation of either 5-HT1B or 5-HT2A receptors, but not by the activation of the 5-HT1A subtype. These findings provide further knowledge about the propagation of synchronic electrical activity in the cerebral cortex, including its modulation by serotonin, and suggest the presence of deep differences between the ACC and RSC in the structure of the local cortical microcircuits underlying the propagation of synchronous discharges. PMID:26930051

  3. Intra- and Interhemispheric Propagation of Electrophysiological Synchronous Activity and Its Modulation by Serotonin in the Cingulate Cortex of Juvenile Mice.

    PubMed

    Rovira, Víctor; Geijo-Barrientos, Emilio

    2016-01-01

    Disinhibition of the cortex (e.g., by GABA -receptor blockade) generates synchronous and oscillatory electrophysiological activity that propagates along the cortex. We have studied, in brain slices of the cingulate cortex of mice (postnatal age 14-20 days), the propagation along layer 2/3 as well as the interhemispheric propagation through the corpus callosum of synchronous discharges recorded extracellularly and evoked in the presence of 10 μM bicuculline by electrical stimulation of layer 1. The latency of the responses obtained at the same distance from the stimulus electrode was longer in anterior cingulate cortex (ACC: 39.53 ± 2.83 ms, n = 7) than in retrosplenial cortex slices (RSC: 21.99 ± 2.75 ms, n = 5; p<0.05), which is equivalent to a lower propagation velocity in the dorso-ventral direction in ACC than in RSC slices (43.0 mm/s vs 72.9 mm/s). We studied the modulation of this propagation by serotonin. Serotonin significantly increased the latency of the intracortical synchronous discharges (18.9% in the ipsilateral hemisphere and 40.2% in the contralateral hemisphere), and also increased the interhemispheric propagation time by 86.4%. These actions of serotonin were mimicked by the activation of either 5-HT1B or 5-HT2A receptors, but not by the activation of the 5-HT1A subtype. These findings provide further knowledge about the propagation of synchronic electrical activity in the cerebral cortex, including its modulation by serotonin, and suggest the presence of deep differences between the ACC and RSC in the structure of the local cortical microcircuits underlying the propagation of synchronous discharges.

  4. Activation and propagation of Ca(2+) release during excitation-contraction coupling in atrial myocytes.

    PubMed

    Kockskämper, J; Sheehan, K A; Bare, D J; Lipsius, S L; Mignery, G A; Blatter, L A

    2001-11-01

    Fast two-dimensional confocal microscopy and the Ca(2+) indicator fluo-4 were used to study excitation-contraction (E-C) coupling in cat atrial myocytes which lack transverse tubules and contain both subsarcolemmal junctional (j-SR) and central nonjunctional (nj-SR) sarcoplasmic reticulum. Action potentials elicited by field stimulation induced transient increases of intracellular Ca(2+) concentration ([Ca(2+)](i)) that were highly inhomogeneous. Increases started at distinct subsarcolemmal release sites spaced approximately 2 microm apart. The amplitude and the latency of Ca(2+) release from these sites varied from beat to beat. Subsarcolemmal release fused to build a peripheral ring of elevated [Ca(2+)](i), which actively propagated to the center of the cells via Ca(2+)-induced Ca(2+) release. Resting myocytes exhibited spontaneous Ca(2+) release events, including Ca(2+) sparks and local (microscopic) or global (macroscopic) [Ca(2+)](i) waves. The microscopic [Ca(2+)](i) waves propagated in a saltatory fashion along the sarcolemma ("coupled" Ca(2+) sparks) revealing the sequential activation of Ca(2+) release sites of the j-SR. Moreover, during global [Ca(2+)](i) waves, Ca(2+) release was evident from individual nj-SR sites. Ca(2+) release sites were arranged in a regular three-dimensional grid as deduced from the functional data and shown by immunostaining of ryanodine receptor Ca(2+) release channels. The longitudinal and transverse distances between individual Ca(2+) release sites were both approximately 2 microm. Furthermore, electron microscopy revealed a continuous sarcotubular network and one peripheral coupling of j-SR with the sarcolemma per sarcomere. The results demonstrate directly that, in cat atrial myocytes, the action potential-induced whole-cell [Ca(2+)](i) transient is the spatio-temporal summation of Ca(2+) release from subsarcolemmal and central sites. First, j-SR sites are activated in a stochastic fashion by the opening of voltage

  5. Modeling and visualization of the activation wavefront propagation to improve understanding the QRS complex changes indicating left ventricular hypertrophy.

    PubMed

    Svehlikova, Jana; Zelinka, Jan; Bacharova, Ljuba; Tysler, Milan

    2016-01-01

    Activation wavefront propagation was computed and visualized in a geometrical heart model for pathological cases of reduced velocity of propagation, left ventricular hypertrophy and their combination. Selected parameters of a multiple dipole equivalent heart generator were computed and compared for three heart geometries and several degrees and extents of reduction of propagation velocity. First, the influence of geometrical changes modeling the left ventricular hypertrophy at reference propagation velocity was compared with reduction of the propagation velocity in the reference heart geometry. Reduced propagation velocity yielded similar or greater changes of the magnitude of the (electrical) heart vector representing the activation wavefront than the geometrical changes. Observations of the wavefront propagation with reduced velocity revealed longer presence of a large extent of the wavefront during depolarization which resulted in increased magnitude of the heart vector. The duration of depolarization was significantly prolonged only when the propagation velocity was decreased to 25% of its normal value. Changes of the direction of the maximal heart vector were dependent on the position of the region where the propagation velocity was reduced. Then the combination of the left ventricular hypertrophy and reduced propagation velocity was studied. Such combination enhanced the enlargement of the electrical heart vector and significantly prolonged the duration of depolarization. The influence of reduced activation velocity on the observed parameters was greater than the effect of the enlargement of the left ventricular mass. The presented study showed that intramyocardial conduction disturbances might cause increase of the actual surface area of propagation wavefront leading to changes of the amplitudes of ECG signals comparable with the changes resulting from the left ventricular hypertrophy. Intramyocardial conduction disturbances, as well as the modeled 50

  6. Sensory and decision-related activity propagate in a cortical feedback loop during touch perception

    PubMed Central

    Kwon, Sung Eun; Yang, Hongdian; Minamisawa, Genki; O’Connor, Daniel H.

    2016-01-01

    The brain transforms physical sensory stimuli into meaningful perceptions. In animals making choices about sensory stimuli, neuronal activity in successive cortical stages reflects a progression from sensation to decision. Feedforward and feedback pathways connecting cortical areas are critical for this transformation. However, the computational roles of these pathways are poorly understood because pathway-specific activity has rarely been monitored during a perceptual task. Using cellular-resolution, pathway-specific imaging, we measured neuronal activity across primary (S1) and secondary (S2) somatosensory cortices of mice performing a tactile detection task. S1 encoded the stimulus better than S2, while S2 activity more strongly reflected perceptual choice. S1 neurons projecting to S2 fed forward activity that predicted choice. Activity encoding touch and choice propagated in an S1–S2 loop along feedforward and feedback axons. Our results suggest that sensory inputs converge into a perceptual outcome as feedforward computations are reinforced in a feedback loop. PMID:27437910

  7. Spatio-temporal PLC activation in parallel with intracellular Ca2+ wave propagation in mechanically stimulated single MDCK cells.

    PubMed

    Tsukamoto, Akira; Hayashida, Yasunori; Furukawa, Katsuko S; Ushida, Takashi

    2010-03-01

    Intracellular Ca2+ transients are evoked either by the opening of Ca2+ channels on the plasma membrane or by phospholipase C (PLC) activation resulting in IP3 production. Ca2+ wave propagation is known to occur in mechanically stimulated cells; however, it remains uncertain whether and how PLC activation is involved in intracellular Ca2+ wave propagation in mechanically stimulated cells. To answer these questions, it is indispensable to clarify the spatio-temporal relations between intracellular Ca2+ wave propagation and PLC activation. Thus, we visualized both cytosolic Ca2+ and PLC activation using a real-time dual-imaging system in individual Mardin-Darby Canine Kidney (MDCK) cells. This system allowed us to simultaneously observe intracellular Ca2+ wave propagation and PLC activation in a spatio-temporal manner in a single mechanically stimulated MDCK cell. The results showed that PLC was activated not only in the mechanically stimulated region but also in other subcellular regions in parallel with intracellular Ca2+ wave propagation. These results support a model in which PLC is involved in Ca2+ signaling amplification in mechanically stimulated cells.

  8. 78 FR 42103 - Agency Information Collection Activities: African Growth and Opportunity Act Certificate of Origin

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-15

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: African Growth and... accordance with the Paperwork Reduction Act: African Growth and Opportunity Act Certificate of Origin (AGOA...: African Growth and Opportunity Act Certificate of Origin. OMB Number: 1651-0082. Form Number:...

  9. 75 FR 26974 - Agency Information Collection Activities: African Growth and Opportunity Act Certificate of Origin

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-13

    ... SECURITY Customs and Border Protection Agency Information Collection Activities: African Growth and... review and approval in accordance with the Paperwork Reduction Act: African Growth and Opportunity Act... forms of information. Title: African Growth and Opportunity Act Certificate of Origin. OMB Number:...

  10. Van Allen Probes observation and modeling of chorus excitation and propagation during weak geomagnetic activities

    DOE PAGES

    He, Yihua; Xiao, Fuliang; Zhou, Qinghua; ...

    2015-08-20

    We report correlated data on nightside chorus waves and energetic electrons during two small storm periods: 1 November 2012 (Dst ≈ –45) and 14 January 2013 (Dst ≈ –18). The Van Allen Probes simultaneously observed strong chorus waves at locations L = 5.8 – 6.3, with a lower frequency band 0.1–0.5fce and a peak spectral density ~10–4 nT2/Hz. In the same period, the fluxes and anisotropy of energetic (~10–300 keV) electrons were greatly enhanced in the interval of large negative interplanetary magnetic field Bz. Using a bi-Maxwellian distribution to model the observed electron distribution, we perform ray tracing simulations tomore » show that nightside chorus waves are indeed produced by the observed electron distribution with a peak growth for a field-aligned propagation approximately between 0.3fce and 0.4fce, at latitude <7°. Moreover, chorus waves launched with initial normal angles either θ < 90° or > 90° propagate along the field either northward or southward and then bounce back either away from Earth for a lower frequency or toward Earth for higher frequencies. The current results indicate that nightside chorus waves can be excited even during weak geomagnetic activities in cases of continuous injection associated with negative Bz. Furthermore, we examine a dayside event during a small storm C on 8 May 2014 (Dst ≈ –45) and find that the observed anisotropic energetic electron distributions potentially contribute to the generation of dayside chorus waves, but this requires more thorough studies in the future.« less

  11. Van Allen Probes observation and modeling of chorus excitation and propagation during weak geomagnetic activities

    SciTech Connect

    He, Yihua; Xiao, Fuliang; Zhou, Qinghua; Yang, Chang; Liu, Si; Baker, D. N.; Kletzing, C. A.; Kurth, W. S.; Hospodarsky, G. B.; Spence, H. E.; Reeves, G. D.; Funsten, H. O.; Blake, J. B.

    2015-08-20

    We report correlated data on nightside chorus waves and energetic electrons during two small storm periods: 1 November 2012 (Dst ≈ –45) and 14 January 2013 (Dst ≈ –18). The Van Allen Probes simultaneously observed strong chorus waves at locations L = 5.8 – 6.3, with a lower frequency band 0.1–0.5fce and a peak spectral density ~10–4 nT2/Hz. In the same period, the fluxes and anisotropy of energetic (~10–300 keV) electrons were greatly enhanced in the interval of large negative interplanetary magnetic field Bz. Using a bi-Maxwellian distribution to model the observed electron distribution, we perform ray tracing simulations to show that nightside chorus waves are indeed produced by the observed electron distribution with a peak growth for a field-aligned propagation approximately between 0.3fce and 0.4fce, at latitude <7°. Moreover, chorus waves launched with initial normal angles either θ < 90° or > 90° propagate along the field either northward or southward and then bounce back either away from Earth for a lower frequency or toward Earth for higher frequencies. The current results indicate that nightside chorus waves can be excited even during weak geomagnetic activities in cases of continuous injection associated with negative Bz. Furthermore, we examine a dayside event during a small storm C on 8 May 2014 (Dst ≈ –45) and find that the observed anisotropic energetic electron distributions potentially contribute to the generation of dayside chorus waves, but this requires more thorough studies in the future.

  12. Stretch-activated calcium channels relay fast calcium waves propagated by calcium-induced calcium influx.

    PubMed

    Jaffe, Lionel F

    2007-03-01

    For nearly 30 years, fast calcium waves have been attributed to a regenerative process propagated by CICR (calcium-induced calcium release) from the endoplasmic reticulum. Here, I propose a model containing a new subclass of fast calcium waves which is propagated by CICI (calcium-induced calcium influx) through the plasma membrane. They are called fast CICI waves. These move at the order of 100 to 1000 microm/s (at 20 degrees C), rather than the order of 3 to 30 microm/s found for CICR. Moreover, in this proposed subclass, the calcium influx which drives calcium waves is relayed by stretch-activated calcium channels. This model is based upon reports from approx. 60 various systems. In seven of these reports, calcium waves were imaged, and, in five of these, evidence was presented that these waves were regenerated by CICI. Much of this model involves waves that move along functioning flagella and cilia. In these systems, waves of local calcium influx are thought to cause waves of local contraction by inducing the sliding of dynein or of kinesin past tubulin microtubules. Other cells which are reported to exhibit waves, which move at speeds in the fast CICI range, include ones from a dozen protozoa, three polychaete worms, three molluscs, a bryozoan, two sea urchins, one arthropod, four insects, Amphioxus, frogs, two fish and a vascular plant (Equisetum), together with numerous healthy, as well as cancerous, mammalian cells, including ones from human. In two of these systems, very gentle local mechanical stimulation is reported to initiate waves. In these non-flagellar systems, the calcium influxes are thought to speed the sliding of actinomyosin filaments past each other. Finally, I propose that this mechanochemical model could be tested by seeing if gentle mechanical stimulation induces waves in more of these systems and, more importantly, by imaging the predicted calcium waves in more of them.

  13. The Extracellular IFI16 Protein Propagates Inflammation in Endothelial Cells Via p38 MAPK and NF-κB p65 Activation.

    PubMed

    Bawadekar, Mandar; De Andrea, Marco; Lo Cigno, Irene; Baldanzi, Gianluca; Caneparo, Valeria; Graziani, Andrea; Landolfo, Santo; Gariglio, Marisa

    2015-06-01

    The nuclear interferon-inducible-16 (IFI16) protein acts as DNA sensor in inflammasome signaling and as viral restriction factor. Following Herpesvirus infection or UV-B treatment, IFI16 delocalizes from the nucleus to the cytoplasm and is eventually released into the extracellular milieu. Recently, our group has demonstrated the occurrence of IFI16 in sera of systemic-autoimmune patients that hampers biological activity of endothelia through high-affinity membrane binding. As a continuation, we studied the activity of endotoxin-free recombinant IFI16 (rIFI16) protein on primary endothelial cells. rIFI16 caused dose/time-dependent upregulation of IL-6, IL-8, CCL2, CCL5, CCL20, ICAM1, VCAM1, and TLR4, while secretion of IL-6 and IL-8 was amplified with lipopolysaccharide synergy. Overall, cytokine secretion was completely inhibited in MyD88-silenced cells and partially by TLR4-neutralizing antibodies. By screening downstream signaling pathways, we found that IFI16 activates p38, p44/42 MAP kinases, and NF-kB. In particular, activation of p38 is an early event required for subsequent p44/42 MAP kinases activity and cytokine induction indicating a key role of this kinase in IFI16 signaling. Altogether, our data conclude that extracellular IFI16 protein alone or by synergy with lipopolysaccharide acts like Damage-associated molecular patterns propagating "Danger Signal" through MyD88-dependent TLR-pathway.

  14. Influence of optical activity on rogue waves propagating in chiral optical fibers

    NASA Astrophysics Data System (ADS)

    Temgoua, D. D. Estelle; Kofane, T. C.

    2016-06-01

    We derive the nonlinear Schrödinger (NLS) equation in chiral optical fiber with right- and left-hand nonlinear polarization. We use the similarity transformation to reduce the generalized chiral NLS equation to the higher-order integrable Hirota equation. We present the first- and second-order rational solutions of the chiral NLS equation with variable and constant coefficients, based on the modified Darboux transformation method. For some specific set of parameters, the features of chiral optical rogue waves are analyzed from analytical results, showing the influence of optical activity on waves. We also generate the exact solutions of the two-component coupled nonlinear Schrödinger equations, which describe optical activity effects on the propagation of rogue waves, and their properties in linear and nonlinear coupling cases are investigated. The condition of modulation instability of the background reveals the existence of vector rogue waves and the number of stable and unstable branches. Controllability of chiral optical rogue waves is examined by numerical simulations and may bring potential applications in optical fibers and in many other physical systems.

  15. The vertical propagation and extent of stratospheric temperature and wind anomalies related to enhanced geomagnetic activity

    NASA Astrophysics Data System (ADS)

    Seppälä, A. M.; Baumgaertner, A. J.; Jöckel, P.; Clilverd, M.

    2010-12-01

    Model studies have suggested that Odd Nitrogen, NOx, created by Energetic Particle Precipitation (EPP) and the consequent ozone loss through catalytic loss cycles could have an effect on stratospheric and tropospheric (e.g. surface level) temperatures. These effects can potentially be comparable to the effects induced by the solar cycle at high latitudes. Significant mesospheric and stratospheric NOx enhancements have been observed during times of high solar activity (e.g. during Solar Proton Events). NOx can also be, through dynamics, transported from high altitudes (mesosphere-lower thermosphere), where it's created by EPP, down to the stratosphere. Once the NOx reaches the the stratosphere, ozone loss reactions involving NOx provide a link to the general stratospheric ozone balance. Surface temperature effects similar to those reported in the model studies were recently found in re-analysis meteorological data sets, but the mechanism connecting the high altitude NOx production to the surface level remained unclear. In this work, using meteorological re-analysis and operational data sets from the European Centre for Medium Range Weather Forecast and the UK Met Office from 1957 to 2009, we examine the vertical propagation and extent, particularly in the stratosphere, of temperature and wind anomalies related to enhanced geomagnetic activity (i.e. enhanced EPP into the atmosphere), to provide better understanding of the linking mechanism. Furthermore we discuss results from the atmospheric chemistry general circulation model ECHAM5/MESSy, which provides a more comprehensive view of the variation in atmospheric parameters as a result of varying EPP input.

  16. Influence of optical activity on rogue waves propagating in chiral optical fibers.

    PubMed

    Temgoua, D D Estelle; Kofane, T C

    2016-06-01

    We derive the nonlinear Schrödinger (NLS) equation in chiral optical fiber with right- and left-hand nonlinear polarization. We use the similarity transformation to reduce the generalized chiral NLS equation to the higher-order integrable Hirota equation. We present the first- and second-order rational solutions of the chiral NLS equation with variable and constant coefficients, based on the modified Darboux transformation method. For some specific set of parameters, the features of chiral optical rogue waves are analyzed from analytical results, showing the influence of optical activity on waves. We also generate the exact solutions of the two-component coupled nonlinear Schrödinger equations, which describe optical activity effects on the propagation of rogue waves, and their properties in linear and nonlinear coupling cases are investigated. The condition of modulation instability of the background reveals the existence of vector rogue waves and the number of stable and unstable branches. Controllability of chiral optical rogue waves is examined by numerical simulations and may bring potential applications in optical fibers and in many other physical systems.

  17. Electron Propagation within Redox-Active Microdomains in Thin Films of Ferrocene-Containing Diblock Copolymers.

    PubMed

    Ghimire, Govinda; Yi, Yi; Derylo, Maksymilian A; Baker, Lane A; Ito, Takashi

    2015-11-10

    This paper reports the electrochemical behavior of redox-active microdomains in thin films of ferrocene-containing diblock copolymers, polystyrene-block-poly(2-(acryloyloxy)ethyl ferrocenecarboxylate) (PS-b-PAEFc). PS-b-PAEFc with different PAEFc volume fractions (PS154-b-PAEFc51, PS154-b-PAEFc26, and PS154-b-PAEFc12, where the subscripts represent the polymerization degree of each block; f(PAEFc) = 0.47, 0.30, and 0.17, respectively) was synthesized by sequential atom transfer radical polymerization. PS-b-PAEFc films of controlled thicknesses (20-160 nm) were prepared on gold substrates via spin-coating and characterized by ellipsometry. Microdomains were observed via atomic force microscopy on the surfaces of PS154-b-PAEFc51 and PS154-b-PAEFc26 thin films but not on the surfaces of PS154-b-PAEFc12 thin films. Electrochemical behavior of films was assessed by cyclic voltammetry and chronocoulometry in acetonitrile solution. The redox potential of ferrocene moieties was similar (ca. + 0.29 V vs Fc(+)/Fc) regardless of fPAEFc and film thickness. For PS154-b-PAEFc51 and PS154-b-PAEFc26, thicker films afforded larger faradaic peak currents and exhibited diffusion-controlled voltammograms at faster sweep rates. PS154-b-PAEFc26 produced voltammograms less influenced by solvent-induced swelling than PS154-b-PAEFc51, reflecting the improved morphological stability of PAEFc microdomains by redox-inert PS frameworks. In contrast, PS154-b-PAEFc12 films yielded similar faradaic peak currents regardless of film thickness and exhibited voltammograms indicative of surface-confined species. These observations suggest that PS154-b-PAEFc51 and PS154-b-PAEFc26 films contain continuous PAEFc microdomains extending from the electrode to the surface, in contrast to the PS154-b-PAEFc12 films which contain isolated PAEFc microdomains buried within the PS matrix. Electron propagation took place only through PAEFc microdomains that could electrically communicate with the underlying

  18. Evidence for propagating, active tensional faulting in Upper Kåfjord valley, Troms County, Norway

    NASA Astrophysics Data System (ADS)

    Redfield, T. F.; Osmundsen, P. T.; Henderson, I. H. C.; Hermanns, R. L.

    2010-05-01

    New concepts governing margin extension and post-rift passive margin evolution are appearing from onshore and offshore studies. In Norway topographic escarpments, creation, preservation and destruction of landforms, and drainage patterns are related to structural templates created during the Jurassic rift phase. Contradicting the notion that post-rift isostatic compensation, thermal subsidence, and topographic degradation mark a passive margin's final evolutionary phases, we present geological evidence for currently-active tensional deformation, accommodated by release faulting, in uppermost Kåfjordalen and Signaldalen. In Signaldalen, propagation of the deformation tip has introduced active normal faulting to Finland. Ground observations indicate a large normal fault defines the eastern border of the Lyngen 'Alps' peninsula. There, a series of exceptionally well-preserved triangular facets adorn a sharp, elevated escarpment. To the east a swarm of small NE-trending normal faults are exposed in roadside outcrops near the mouth of Kåfjord, dipping both to the NW and SE. Displacement across the fault swarm is asymmetric, the greatest component of motion being down-to-the-NW in the direction of the Lyngen Fault. Another set of NE trending, NW dipping faults crop out at Revsdalfjellet. We interpret these faults to reflect splays to the Lyngen Fault. The hanging wall of the Lyngen Fault is characterized by numerous clusters of fault-controlled rockslides. We interpret the valleys of Signaldalen, Skibotndalen, and Kåfjordalen, located in the hanging wall of the Lyngen Fault, to have formed at least partly under the influence of release faults that accommodated hanging wall flexure and failure. Other fault scarps, trending more NW-SE, crop out at two Kåfjord rockslide sites, Nomandalstinden and Litledalen. Mineralized surfaces exhibiting dip-slip slickenlines indicate most of these faults are true tectonic features, not simply gravitationally-driven 'sackung' planes

  19. Active learning for semi-supervised clustering based on locally linear propagation reconstruction.

    PubMed

    Chang, Chin-Chun; Lin, Po-Yi

    2015-03-01

    The success of semi-supervised clustering relies on the effectiveness of side information. To get effective side information, a new active learner learning pairwise constraints known as must-link and cannot-link constraints is proposed in this paper. Three novel techniques are developed for learning effective pairwise constraints. The first technique is used to identify samples less important to cluster structures. This technique makes use of a kernel version of locally linear embedding for manifold learning. Samples neither important to locally linear propagation reconstructions of other samples nor on flat patches in the learned manifold are regarded as unimportant samples. The second is a novel criterion for query selection. This criterion considers not only the importance of a sample to expanding the space coverage of the learned samples but also the expected number of queries needed to learn the sample. To facilitate semi-supervised clustering, the third technique yields inferred must-links for passing information about flat patches in the learned manifold to semi-supervised clustering algorithms. Experimental results have shown that the learned pairwise constraints can capture the underlying cluster structures and proven the feasibility of the proposed approach.

  20. Preliminary Study on Active Modulation of Polar Mesosphere Summer Echoes with the Radio Propagation in Layered Space Dusty Plasma

    NASA Astrophysics Data System (ADS)

    Zhou, Shengguo; Li, Hailong; Fu, Luyao; Wang, Maoyan

    2016-06-01

    Radar echoes intensity of polar mesosphere summer echoes (PMSE) is greatly affected by the temperature of dusty plasma and the frequency of electromagnetic wave about the radar. In this paper, a new method is developed to explain the active experiment results of PMSE. The theory of wave propagation in a layered media is used to study the propagation characteristics of an electromagnetic wave at different electron temperatures. The simulation results show that the variation tendency of the reflected power fraction almost agrees with the results observed by radar in the European Incoherent Scatter Scientific Association (EISCAT). The radar echoes intensity of PMSE greatly decreases with the increase of the radio frequency and the enhancement of the electron temperature. supported by National Natural Science Foundation of China (Nos. 41104097 and 41304119) and by the National Key Laboratory of Electromagnetic Environment, China Research Institute of Radiowave Propagation (CRIRP)

  1. Risk analysis for rumor propagation in metropolises based on improved 8-state ICSAR model and dynamic personal activity trajectories

    NASA Astrophysics Data System (ADS)

    Zhang, N.; Huang, H.; Duarte, M.; Zhang, J.

    2016-06-01

    Social media has developed extremely fast in metropolises in recent years resulting in more and more rumors disturbing our daily lives. Knowing the characteristics of rumor propagation in metropolises can help the government make efficient rumor refutation plans. In this paper, we established a dynamic spatio-temporal comprehensive risk assessment model for rumor propagation based on an improved 8-state ICSAR model (Ignorant, Information Carrier, Information Spreader, Advocate, Removal), large personal activity trajectory data, and governmental rumor refutation (anti-rumor) scenarios. Combining these relevant data with the 'big' traffic data on the use of subways, buses, and taxis, we simulated daily oral communications among inhabitants in Beijing. In order to analyze rumor and anti-rumor competition in the actual social network, personal resistance, personal preference, conformity, rumor intensity, government rumor refutation and other influencing factors were considered. Based on the developed risk assessment model, a long-term dynamic rumor propagation simulation for a seven day period was conducted and a comprehensive rumor propagation risk distribution map was obtained. A set of the sensitivity analyses were conducted for different social media and propagation routes. We assessed different anti-rumor coverage ratios and the rumor-spreading thresholds at which the government started to launch anti-rumor actions. The results we obtained provide worthwhile references useful for governmental decision making towards control of social-disrupting rumors.

  2. High-Speed imaging reveals opposing effects of chronic stress and antidepressants on neuronal activity propagation through the hippocampal trisynaptic circuit

    PubMed Central

    Stepan, Jens; Hladky, Florian; Uribe, Andrés; Holsboer, Florian; Schmidt, Mathias V.; Eder, Matthias

    2015-01-01

    Antidepressants (ADs) are used as first-line treatment for most stress-related psychiatric disorders. The alterations in brain circuit dynamics that can arise from stress exposure and underlie therapeutic actions of ADs remain, however, poorly understood. Here, enabled by a recently developed voltage-sensitive dye imaging (VSDI) assay in mouse brain slices, we examined the impact of chronic stress and concentration-dependent effects of eight clinically used ADs (belonging to different chemical/functional classes) on evoked neuronal activity propagations through the hippocampal trisynaptic circuitry (HTC: perforant path → dentate gyrus (DG) → area CA3 → area CA1). Exposure of mice to chronic social defeat stress led to markedly weakened activity propagations (“HTC-Waves”). In contrast, at concentrations in the low micromolar range, all ADs, which were bath applied to slices, caused an amplification of HTC-Waves in CA regions (invariably in area CA1). The fast-acting “antidepressant” ketamine, the mood stabilizer lithium, and brain-derived neurotrophic factor (BDNF) exerted comparable enhancing effects, whereas the antipsychotic haloperidol and the anxiolytic diazepam attenuated HTC-Waves. Collectively, we provide direct experimental evidence that chronic stress can depress neuronal signal flow through the HTC and demonstrate shared opposing effects of ADs. Thus, our study points to a circuit-level mechanism of ADs to counteract stress-induced impairment of hippocampal network function. However, the observed effects of ADs are impossible to depend on enhanced neurogenesis. PMID:26594153

  3. High-Speed imaging reveals opposing effects of chronic stress and antidepressants on neuronal activity propagation through the hippocampal trisynaptic circuit.

    PubMed

    Stepan, Jens; Hladky, Florian; Uribe, Andrés; Holsboer, Florian; Schmidt, Mathias V; Eder, Matthias

    2015-01-01

    Antidepressants (ADs) are used as first-line treatment for most stress-related psychiatric disorders. The alterations in brain circuit dynamics that can arise from stress exposure and underlie therapeutic actions of ADs remain, however, poorly understood. Here, enabled by a recently developed voltage-sensitive dye imaging (VSDI) assay in mouse brain slices, we examined the impact of chronic stress and concentration-dependent effects of eight clinically used ADs (belonging to different chemical/functional classes) on evoked neuronal activity propagations through the hippocampal trisynaptic circuitry (HTC: perforant path → dentate gyrus (DG) → area CA3 → area CA1). Exposure of mice to chronic social defeat stress led to markedly weakened activity propagations ("HTC-Waves"). In contrast, at concentrations in the low micromolar range, all ADs, which were bath applied to slices, caused an amplification of HTC-Waves in CA regions (invariably in area CA1). The fast-acting "antidepressant" ketamine, the mood stabilizer lithium, and brain-derived neurotrophic factor (BDNF) exerted comparable enhancing effects, whereas the antipsychotic haloperidol and the anxiolytic diazepam attenuated HTC-Waves. Collectively, we provide direct experimental evidence that chronic stress can depress neuronal signal flow through the HTC and demonstrate shared opposing effects of ADs. Thus, our study points to a circuit-level mechanism of ADs to counteract stress-induced impairment of hippocampal network function. However, the observed effects of ADs are impossible to depend on enhanced neurogenesis.

  4. Statistical and Prediction modeling of the Ka Band Using Experimental Results from ACTS Propagation Terminals at 20.185 and 27.505 GHZ

    NASA Technical Reports Server (NTRS)

    Ogunwuyi, Oluwatosin O.

    2004-01-01

    With the increase in demand for wireless communication services, most of the operating frequency bands have become very congested. The increase of wireless costumers is only fractional contribution to this phenomenon. The demand for more services such as video streams and internet explorer which require a lot of band width has been a more significant contributor to the congestion in a communication system. One way to increase the amount of information or data per unit of time transmitted with in a wireless communication system is to use a higher radio frequency. However in spite the advantage available in the using higher frequency bands such as, the Ka-band, higher frequencies also implies short wavelengths. And shorter wavelengths are more susceptible to rain attenuation. Until the Advanced Communication Technology Satellite (ACTS) was launched, the Ka- band frequency was virtually unused - the majority of communication satellites operated in lower frequency bands called the C- and Ku- bands. Ka-band is desirable because its higher frequency allows wide bandwidth applications, smaller spacecraft and ground terminal components, and stronger signal strength. Since the Ka-band is a high frequency band, the millimeter wavelengths of the signals are easily degraded by rain. This problem known as rain fade or rain attenuation The Advanced Communication Technology Satellite (ACTS) propagation experiment has collected 5 years of Radio Frequency (RF) attenuation data from December 1993 to November 1997. The objective of my summer work is to help develop the statistics and prediction techniques that will help to better characterize the Ka Frequency band. The statistical analysis consists of seasonal and cumulative five-year attenuation statistics for the 20.2 and 27.5 GHz. The cumulative five-year results give the link outage that occurs for a given link margin. The experiment has seven ground station terminals that can be attributed to a unique rain zone climate. The

  5. Thinking Globally and Acting Locally: Environmental Education Teaching Activities.

    ERIC Educational Resources Information Center

    Mann, Lori D.; Stapp, William B.

    Provided are teaching activities related to: (1) food production and distribution; (2) energy; (3) transportation; (4) solid waste; (5) chemicals in the environment; (6) resource management; (7) pollution; (8) population; (9) world linkages; (10) endangered species; and (11) lifestyle and environment. The activities, designed to help learners…

  6. Active tuning of vibration and wave propagation in elastic beams with periodically placed piezoelectric actuator/sensor pairs

    NASA Astrophysics Data System (ADS)

    Li, Fengming; Zhang, Chuanzeng; Liu, Chunchuan

    2017-04-01

    A novel strategy is proposed to actively tune the vibration and wave propagation properties in elastic beams. By periodically placing the piezoelectric actuator/sensor pairs along the beam axis, an active periodic beam structure which exhibits special vibration and wave propagation properties such as the frequency pass-bands and stop-bands (or band-gaps) is developed. Hamilton's principle is applied to establish the equations of motion of the sub-beam elements i.e. the unit-cells, bonded by the piezoelectric patches. A negative proportional feedback control strategy is employed to design the controllers which can provide a positive active stiffness to the beam for a positive feedback control gain, which can increase the stability of the structural system. By means of the added positive active stiffness, the periodicity or the band-gap property of the beam with periodically placed piezoelectric patches can be actively tuned. From the investigation, it is shown that better band-gap characteristics can be achieved by using the negative proportional feedback control. The band-gaps can be obviously broadened by properly increasing the control gain, and they can also be greatly enlarged by appropriately designing the structural sizes of the controllers. The control voltages applied on the piezoelectric actuators are in reasonable and controllable ranges, especially, they are very low in the band-gaps. Thus, the vibration and wave propagation behaviors of the elastic beam can be actively controlled by the periodically placed piezoelectric patches.

  7. Primary afferent terminals acting as excitatory interneurons contribute to spontaneous motor activities in the immature spinal cord.

    PubMed

    Bos, Rémi; Brocard, Frédéric; Vinay, Laurent

    2011-07-13

    Patterned, spontaneous activity plays a critical role in the development of neuronal networks. A robust spontaneous activity is observed in vitro in spinal cord preparations isolated from immature rats. The rhythmic ventral root discharges rely mainly on the depolarizing/excitatory action of GABA and glycine early during development, whereas at later stages glutamate drive is primarily responsible for the rhythmic activity and GABA/glycine are thought to play an inhibitory role. However, rhythmic discharges mediated by the activation of GABA(A) receptors are recorded from dorsal roots (DRs). In the present study, we used the in vitro spinal cord preparation of neonatal rats to identify the relationship between discharges that are conducted antidromically along DRs and the spontaneous activity recorded from lumbar motoneurons. We show that discharges in DRs precede those in ventral roots and that primary afferent depolarizations (PADs) start earlier than EPSPs in motoneurons. EPSP-triggered averaging revealed that the action potentials propagate not only antidromically in the DR but also centrally and trigger EPSPs in motoneurons. Potentiating GABAergic antidromic discharges by diazepam increased the EPSPs recorded from motoneurons; conversely, blocking DR bursts markedly reduced these EPSPs. High intracellular concentrations of chloride are maintained in primary afferent terminals by the sodium-potassium-chloride cotransporter NKCC1. Blocking these cotransporters by bumetanide decreased both dorsal and ventral root discharges. We conclude that primary afferent fibers act as excitatory interneurons and that GABA, through PADs reaching firing threshold, is still playing a key role in promoting spontaneous activity in neonates.

  8. Rehabilitation Services Administration Annual Report, Fiscal Year 2004: Report on Federal Activities under the "Rehabilitation Act"

    ERIC Educational Resources Information Center

    US Department of Education, 2007

    2007-01-01

    The "Rehabilitation Act of 1973," as amended (the act), provides the legislative basis for programs and activities that assist individuals with disabilities in the pursuit of gainful employment, independence, self-sufficiency and full integration into community life. This report is intended to provide a description of accomplishments and…

  9. 77 FR 13617 - Agency Information Collection Activities: Customs Modernization Act Recordkeeping Requirements

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-07

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: Customs Modernization Act Recordkeeping Requirements AGENCY: U.S. Customs and Border Protection (CBP), Department of... concerning the Customs Modernization Act Recordkeeping Requirements. This request for comment is being...

  10. 78 FR 15031 - Agency Information Collection Activities: Andean Trade Preferences Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-08

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: Andean Trade Preferences Act AGENCY: U.S. Customs and Border Protection (CBP), Department of Homeland Security. ACTION: 60... Reduction Act of 1995 (Pub. L. 104-13; 44 U.S.C. 3505(c)(2)). DATES: Written comments should be received...

  11. 78 FR 26650 - Agency Information Collection Activities: African Growth and Opportunity Act Certificate of Origin

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-07

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: African Growth and... comment on an information collection requirement concerning the African Growth and Opportunity Act...: Title: African Growth and Opportunity Act Certificate of Origin. OMB Number: 1651-0082. Form...

  12. 75 FR 9423 - Agency Information Collection Activities: African Growth and Opportunity Act Certificate of Origin

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-02

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: African Growth and... requirement concerning the African Growth and Opportunity Act Certificate of Origin (AGOA). This request for...: Title: African Growth and Opportunity Act Certificate of Origin. OMB Number: 1651-0082. Form...

  13. [Modulators of the regulatory protein activity acting at microdoses].

    PubMed

    Iamskova, V P; Krasnov, M S; Skripnikova, V S; Moliavka, A A; Il'ina, A P; Margasiuk, D V; Borisenko, A V; Berezin, B B; Iamskov, I A

    2009-01-01

    New, previously not studied bioregulators active in the ultra low doses corresponding of 10(-8) - 10(-17) mg/ml have been isolated from vitreoretinal tissue of eye. It has been shown that these bioregulators comprise some regulatory peptides-modulators represented by proteins with molecular weights 15-70 KDa one of which is bovine serum albumin. Correlation between the nanosize of bioregulators and their ability to show activity in ultra low doses is established.

  14. 77 FR 12367 - Agency Information Collection and Reporting Activities; Electronic Filing of Bank Secrecy Act...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-29

    ... Financial Crimes Enforcement Network Agency Information Collection and Reporting Activities; Electronic Filing of Bank Secrecy Act (BSA) Reports; Final Notice AGENCY: Financial Crimes Enforcement Network (Fin..., Financial Crimes Enforcement Network. BILLING CODE 4810-02-P...

  15. Activators and repressors: A balancing act for X-inactivation.

    PubMed

    Goodrich, Leeanne; Panning, Barbara; Leung, Karen Nicole

    2016-08-01

    In early female embryos X-chromosome inactivation occurs concomitant with up regulation of the non-coding RNA, Xist, on the future inactive X-chromosome. Up regulation of Xist and coating of the future inactive X is sufficient to induce silencing. Therefore unlocking the mechanisms of X-chromosome inactivation requires thorough understanding of the transcriptional regulators, both activators and repressors, which control Xist. Mouse pluripotent embryonic stem cells, which have two active X chromosomes, provide a tractable ex vivo model system for studying X-chromosome inactivation, since this process is triggered by differentiation signals in these cultured cells. Yet there are significant discrepancies found between ex vivo analyses in mouse embryonic stem cells and in vivo studies of early embryos. In this review we elaborate on potential models of how Xist is up regulated on a single X chromosome in female cells and how ex vivo and in vivo analyses enlighten our understanding of the activators and repressors that control this non-coding RNA gene.

  16. Synthesis of nano-sized amorphous boron powders through active dilution self-propagating high-temperature synthesis method

    SciTech Connect

    Wang, Jilin; Gu, Yunle; Li, Zili; Wang, Weimin; Fu, Zhengyi

    2013-06-01

    Graphical abstract: Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis (SHS) method. The effects of endothermic reaction rate, the possible chemical reaction mechanism and active dilution model for synthesis of the product were also discussed. Highlights: ► Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis method. ► The morphology, particle size and purity of the samples could be effectively controlled via changing the endothermic rate. ► The diluter KBH{sub 4} played an important role in active dilution synthesis of amorphous nano-sized boron powders. ► The active dilution method could be further popularized and become a common approach to prepare various inorganic materials. - Abstract: Nano-sized amorphous boron powders were synthesized by active dilution self-propagating high-temperature synthesis (SHS) method at temperatures ranging from 700 °C to 850 °C in a SHS furnace using Mg, B{sub 2}O{sub 3} and KBH{sub 4} as raw materials. Samples were characterized by X-ray powder diffraction (XRD), Laser particle size analyzer, Fourier transform infrared spectra (FTIR), X-ray energy dispersive spectroscopy (EDX), scanning electron microscopy (SEM), transmission electron microscopy (TEM) and high-resolution transmission TEM (HRTEM). The boron powders demonstrated an average particle size of 50 nm with a purity of 95.64 wt.%. The diluter KBH{sub 4} played an important role in the active dilution synthesis of amorphous nano-sized boron powders. The effects of endothermic reaction rate, the possible chemical reaction mechanism and active dilution model for synthesis of the product were also discussed.

  17. Tracking the silent epidemic and educating the public: CDC's traumatic brain injury-associated activities under the TBI Act of 1996 and the Children's Health Act of 2000.

    PubMed

    Langlois, Jean A; Marr, Angela; Mitchko, Jane; Johnson, Renee L

    2005-01-01

    The Traumatic Brain Injury Act of 1996 and the Children's Health Act of 2000 authorized the Centers for Disease Control and Prevention to conduct several activities associated with traumatic brain injury. This article describes how the Centers for Disease Control and Prevention responded to the legislation in 2 key areas: traumatic brain injury surveillance, and education and awareness.

  18. Propagation of Epileptiform Activity Can Be Independent of Synaptic Transmission, Gap Junctions, or Diffusion and Is Consistent with Electrical Field Transmission

    PubMed Central

    Zhang, Mingming; Ladas, Thomas P.; Qiu, Chen; Shivacharan, Rajat S.; Gonzalez-Reyes, Luis E.

    2014-01-01

    The propagation of activity in neural tissue is generally associated with synaptic transmission, but epileptiform activity in the hippocampus can propagate with or without synaptic transmission at a speed of ∼0.1 m/s. This suggests an underlying common nonsynaptic mechanism for propagation. To study this mechanism, we developed a novel unfolded hippocampus preparation, from CD1 mice of either sex, which preserves the transverse and longitudinal connections and recorded activity with a penetrating microelectrode array. Experiments using synaptic transmission and gap junction blockers indicated that longitudinal propagation is independent of chemical or electrical synaptic transmission. Propagation speeds of 0.1 m/s are not compatible with ionic diffusion or pure axonal conduction. The only other means of communication between neurons is through electric fields. Computer simulations revealed that activity can indeed propagate from cell to cell solely through field effects. These results point to an unexpected propagation mechanism for neural activity in the hippocampus involving endogenous field effect transmission. PMID:24453330

  19. Propagation of epileptiform activity can be independent of synaptic transmission, gap junctions, or diffusion and is consistent with electrical field transmission.

    PubMed

    Zhang, Mingming; Ladas, Thomas P; Qiu, Chen; Shivacharan, Rajat S; Gonzalez-Reyes, Luis E; Durand, Dominique M

    2014-01-22

    The propagation of activity in neural tissue is generally associated with synaptic transmission, but epileptiform activity in the hippocampus can propagate with or without synaptic transmission at a speed of ∼0.1 m/s. This suggests an underlying common nonsynaptic mechanism for propagation. To study this mechanism, we developed a novel unfolded hippocampus preparation, from CD1 mice of either sex, which preserves the transverse and longitudinal connections and recorded activity with a penetrating microelectrode array. Experiments using synaptic transmission and gap junction blockers indicated that longitudinal propagation is independent of chemical or electrical synaptic transmission. Propagation speeds of 0.1 m/s are not compatible with ionic diffusion or pure axonal conduction. The only other means of communication between neurons is through electric fields. Computer simulations revealed that activity can indeed propagate from cell to cell solely through field effects. These results point to an unexpected propagation mechanism for neural activity in the hippocampus involving endogenous field effect transmission.

  20. 45 CFR 90.3 - What programs or activities does the Age Discrimination Act of 1975 cover?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Discrimination Act of 1975 cover? 90.3 Section 90.3 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES... FINANCIAL ASSISTANCE General § 90.3 What programs or activities does the Age Discrimination Act of 1975 cover? (a) The Age Discrimination Act of 1975 applies to any program or activity receiving...

  1. Overview of NATO/AC 243/Panel 3 activities concerning radiowave propagation in coastal environments

    NASA Astrophysics Data System (ADS)

    Christophe, F.; Douchin, N.; Hurtaud, Y.; Dion, D.; Makaruschka, R.; Heemskerk, H.; Anderson, K.

    1995-02-01

    The performances of most systems operating at RF and millimeter waves can be seriously affected by propagation effects. That is the reason why NATO established the Research Study group No. 8 (RSG8) within Panel 3 (physics and electronics) of Defense Research Group (AC 243), with its Propagation Subgroup (PSG) responsible for the propagation aspects. Comparison of mm and other wavelengths was to be considered. In maritime and coastal environments, the use of such wavelengths for various military applications like anti-ship seekers, fire control radars, ship to ship communications or Electronic Support Measurements (ESM) led to the setting up of specific measurement campaigns; the last three are reported hereafter. The first two experiments used facilities close to Lorient, on the Atlantic coast, and Toulon, on the Mediterranean coast of France, with the purpose of documenting the refractive effects for medium range over the horizon paths. These experiments where are referred to as Lorient 89 and Toulon 90 campaigns, are described in this paper, and some typical results are presented. The latest cooperative work of RSG8/PSG took place recently (fall 1993) near Lorient, on a line-of-sight 10 km path over seawater. This experiment, referred to as Lorient 93 campaign, was devoted to the analysis of phase-front distortions due to multipath along with refractive effects, and to the assessment of performances for naval systems like short range tracking radars. Analysis of the data, either on a statistical base or as specific case studies, is being performed presently, but some early typical results will be given in this paper after a detailed description of the experiment.

  2. Propagation of frequency-modulated pulses in active one-dimensional photonic crystals

    SciTech Connect

    Zolotovskii, I O; Korobko, D A; Ostatochnikov, V A

    2015-02-28

    The propagation of frequency-modulated pulses in onedimensional photonic crystals with gain is considered. A correct expression is derived for the delay time of the pulse maximum. This expression takes into account the input pulse characteristics: duration, frequency modulation and spectrum position in the photonic band gap. The analytical results are basically in agreement with the results of numerical simulation. The influence of gain in the photonic-crystal structure is considered. It is shown that the parameters of a transmitted pulse can be controlled by changing the inputpulse frequency modulation. (nonlinear optical phenomena)

  3. A review of the effects of long-acting progestogen-only contraceptives on ovarian activity.

    PubMed

    Li, X F; Davies, G C; Newton, J

    1992-03-01

    Progestogen-only contraception acts mainly by blocking cervical mucus and preventing sperm penetration through it does have a variable pattern of contraceptive effects on the endometrium and ovary. In contrast with the complete suppression of ovarian function with combined pill or injectable use, a variable degree of endocrine activity is demonstrated in women choosing a long-acting progestogen-only contraceptive. This degree of suppression of ovarian activity explains the decrease in systemic side-effects, the rapid resumption of ovulation and recovery of fertility following the discontinuation of the method. New delivery systems of progestogens, the vaginal ring and implant, offer better and more consistent contraceptive effects.

  4. Eikonal-based initiation of fibrillatory activity in thin-walled cardiac propagation models

    NASA Astrophysics Data System (ADS)

    Herlin, Antoine; Jacquemet, Vincent

    2011-12-01

    Reentrant arrhythmias can be simulated in electrophysiological models of electrical impulse propagation governed by a reaction-diffusion system. To facilitate the initiation of a large number of independent episodes of simulated arrhythmias with controllable level of complexity, a new approach is proposed for thin-walled geometries in which depolarization wave dynamics is essentially two-dimensional. Points representing phase singularities are first randomly distributed over the epicardial surface and are assigned a topological charge (direction of rotation). A qualitatively-correct phase map is then reconstructed on the whole surface by interpolation. The eikonal-diffusion equation is used to iteratively regularize the phase map based on a priori information on wavefront propagation. An initial condition for the reaction-diffusion model is created from the resulting phase map with multiple functional/anatomical reentries. Results in an atrial model demonstrate the ability to generate statistical realizations of the same dynamics and to vary the level of complexity measured by the number of phase singularities. A library of 100 simulations with an average number of phase singularities ranging from 1 to 10 is created. An extension to volumetric patient-specific atrial models including fiber orientation and a fast conducting system is presented to illustrate possible applications.

  5. Active nonlinear spectroscopy of biexcitons in semiconductors: Propagation effects and Fano interferences

    NASA Astrophysics Data System (ADS)

    Maruani, A.; Chemla, D. S.

    1981-01-01

    Four-wave degenerate-frequency mixing is used to study experimentally and theoretically the Γ1 biexciton in CuCl and CdS. Propagation and polarization effects, which are particularly important in the case of CdS, are evidenced; giant oscillator strengths and autoionizing characters are also revealed. A formalism is sketched, which describes, for a coherent anti-Stokes Raman scattering-type experiment, the most general third-order susceptibility tensor in a solid where a three-nearly-equidistant-level system is distinguished amidst a large number of other, nonresonant, levels and where there is one two-photon-resonant autoionizing state. The propagation analysis accounts accurately on one side for the large shifts between the maxima of the spectra and the energetic position of the resonances, and on the other side for the severe nonlinearities and the highly structured profile of the observed line shapes. Thus, a very satisfactory agreement between experiment and theory is obtained and a number of biexciton parameters, including Fano's q parameter, is determined.

  6. 78 FR 38068 - Agency Information Collection Activities: United States-Caribbean Basin Trade Partnership Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-25

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: United States-Caribbean Basin Trade Partnership Act AGENCY: U.S. Customs and Border Protection, Department of Homeland...: 1651-0083. SUMMARY: U.S. Customs and Border Protection (CBP) will be submitting the...

  7. 75 FR 15446 - Agency Information Collection Activities: United States-Caribbean Basin Trade Partnership Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-29

    ... SECURITY U.S. Customs And Border Protection Agency Information Collection Activities: United States- Caribbean Basin Trade Partnership Act AGENCY: U.S. Customs and Border Protection, Department of Homeland.... Customs and Border (CBP) invites the general public and other Federal agencies to comment on...

  8. 78 FR 23280 - Agency Information Collection Activities: United States-Caribbean Basin Trade Partnership Act...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-18

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: United States-Caribbean Basin Trade Partnership Act (CBTPA) AGENCY: U.S. Customs and Border Protection (CBP), Department...: Direct all written comments to U.S. Customs and Border Protection, Attn: Tracey Denning, Regulations...

  9. 77 FR 27787 - Agency Information Collection Activities: Customs Modernization Act Recordkeeping Requirements

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-11

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: Customs Modernization Act Recordkeeping Requirements AGENCY: U.S. Customs and Border Protection, Department of Homeland.... SUMMARY: U.S. Customs and Border Protection (CBP) of the Department of Homeland Security will...

  10. A Review of CBO's Activities in 2008 under the Unfunded Mandates Reform Act. A CBO Report

    ERIC Educational Resources Information Center

    Lex, Leo

    2009-01-01

    In this report, part of an annual series that began in 1997, the Congressional Budget Office (CBO) reviews its activities under the Unfunded Mandates Reform Act of 1995. The report covers public laws enacted and legislation considered by the Congress in 2008 that would impose federal mandates on state, local, or tribal governments or on the…

  11. Atmospheric-pressure plasma jets: Effect of gas flow, active species, and snake-like bullet propagation

    SciTech Connect

    Wu, S.; Wang, Z.; Huang, Q.; Tan, X.; Lu, X.; Ostrikov, K.

    2013-02-15

    Cold atmospheric-pressure plasma jets have recently attracted enormous interest owing to numerous applications in plasma biology, health care, medicine, and nanotechnology. A dedicated study of the interaction between the upstream and downstream plasma plumes revealed that the active species (electrons, ions, excited OH, metastable Ar, and nitrogen-related species) generated by the upstream plasma plume enhance the propagation of the downstream plasma plume. At gas flows exceeding 2 l/min, the downstream plasma plume is longer than the upstream plasma plume. Detailed plasma diagnostics and discharge species analysis suggest that this effect is due to the electrons and ions that are generated by the upstream plasma and flow into the downstream plume. This in turn leads to the relatively higher electron density in the downstream plasma. Moreover, high-speed photography reveals a highly unusual behavior of the plasma bullets, which propagate in snake-like motions, very differently from the previous reports. This behavior is related to the hydrodynamic instability of the gas flow, which results in non-uniform distributions of long-lifetime active species in the discharge tube and of surface charges on the inner surface of the tube.

  12. Assessment of MSFCs Process for the Development and Activation of Space Act Agreement

    NASA Technical Reports Server (NTRS)

    Daugherty, Rachel

    2014-01-01

    Space Act Agreements (SAAs) are contractual agreements that NASA utilizes to form partnerships with researchers, industry, and academia to stimulate cutting-edge innovation within the science and technology communities. center dot This study assessed the current SAA development and activation process at Marshall Space Flight Center (MSFC) to determine if improvements could be implemented to increase productivity, decrease time to activation, and improve the quality of deliverables.

  13. An Iridium(III) Complex Inhibits JMJD2 Activities and Acts as a Potential Epigenetic Modulator.

    PubMed

    Liu, Li-Juan; Lu, Lihua; Zhong, Hai-Jing; He, Bingyong; Kwong, Daniel W J; Ma, Dik-Lung; Leung, Chung-Hang

    2015-08-27

    A novel iridium(III) complex was synthesized and evaluated for its ability to target JMJD2 enzymatic activity. The iridium(III) complex 1 can inhibit JMJD2 activity and was selective for JMJD2 activity over JARID, JMJD3, and HDAC activities. Moreover, 1 suppressed the trimethylation of the p21 promoter on H3K9me3 and interrupted the JMJD2D-H3K9me3 interactions in human cells, suggesting that it could act as an epigenetic modulator. To our knowledge, 1 represents the first metal-based JMJD2 inhibitor reported in the literature.

  14. Toll-Like Receptor 4–Mediated Nuclear Factor Kappa B Activation Is Essential for Sensing Exogenous Oxidants to Propagate and Maintain Oxidative/Nitrosative Cellular Stress

    PubMed Central

    Karki, Rajendra; Igwe, Orisa J.

    2013-01-01

    The mechanism(s) by which cells can sense exogenous oxidants that may contribute to intracellular oxidative/nitrosative stress is not clear. The objective of this study was to determine how cells might respond to exogenous oxidants to potentially initiate, propagate and/or maintain inflammation associated with many human diseases through NF-κB activation. First, we used HEK-Blue cells that are stably transfected with mouse toll-like receptor 4 (mTLR4) or mouse TLR2. These cells also express optimized secreted embryonic alkaline phosphatase (SEAP) reporter gene under the control of a promoter inducible by NF-κB transcription factor. These cells were challenged with their respective receptor-specific ligands, different pro-oxidants and/or inhibitors that act at different levels of the receptor signaling pathways. A neutralizing antibody directed against TLR4 inhibited responses to both TLR4-specific agonist and a prooxidant, which confirmed that both agents act through TLR4. We used the level of SEAP released into the culture media due to NF-κB activation as a measure of TLR4 or TLR2 stimulation. Pro-oxidants evoked increased release of SEAP from HEK-Blue mTLR4 cells at a much lower concentration compared with release from the HEK-Blue mTLR2 cells. Specific TLR4 signaling pathway inhibitors and oxidant scavengers (anti-oxidants) significantly attenuated oxidant-induced SEAP release by TLR4 stimulation. Furthermore, a novel pro-oxidant that decays to produce the same reactants as activated phagocytes induced inflammatory pain responses in the mouse orofacial region with increased TLR4 expression, and IL-1β and TNFα tissue levels. EUK-134, a synthetic serum-stable scavenger of oxidative species decreased these effects. Our data provide in vitro and related in vivo evidence that exogenous oxidants can induce and maintain inflammation by acting mainly through a TLR4-dependent pathway, with implications in many chronic human ailments. PMID:24058497

  15. 12 CFR 225.145 - Limitations established by the Competitive Equality Banking Act of 1987 on the activities and...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Equality Banking Act of 1987 on the activities and growth of nonbank banks. 225.145 Section 225.145 Banks... Companies Interpretations § 225.145 Limitations established by the Competitive Equality Banking Act of 1987... Competitive Equality Banking Act of 1987 (“CEBA”) redefined the term “bank” in the Bank Holding Company...

  16. 12 CFR 225.145 - Limitations established by the Competitive Equality Banking Act of 1987 on the activities and...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Equality Banking Act of 1987 on the activities and growth of nonbank banks. 225.145 Section 225.145 Banks... Companies Interpretations § 225.145 Limitations established by the Competitive Equality Banking Act of 1987... Competitive Equality Banking Act of 1987 (“CEBA”) redefined the term “bank” in the Bank Holding Company...

  17. In Vitro Derivation and Propagation of Spermatogonial Stem Cell Activity from Mouse Pluripotent Stem Cells.

    PubMed

    Ishikura, Yukiko; Yabuta, Yukihiro; Ohta, Hiroshi; Hayashi, Katsuhiko; Nakamura, Tomonori; Okamoto, Ikuhiro; Yamamoto, Takuya; Kurimoto, Kazuki; Shirane, Kenjiro; Sasaki, Hiroyuki; Saitou, Mitinori

    2016-12-06

    The in vitro derivation and propagation of spermatogonial stem cells (SSCs) from pluripotent stem cells (PSCs) is a key goal in reproductive science. We show here that when aggregated with embryonic testicular somatic cells (reconstituted testes), primordial germ cell-like cells (PGCLCs) induced from mouse embryonic stem cells differentiate into spermatogonia-like cells in vitro and are expandable as cells that resemble germline stem cells (GSCs), a primary cell line with SSC activity. Remarkably, GSC-like cells (GSCLCs), but not PGCLCs, colonize adult testes and, albeit less effectively than GSCs, contribute to spermatogenesis and fertile offspring. Whole-genome analyses reveal that GSCLCs exhibit aberrant methylation at vulnerable regulatory elements, including those critical for spermatogenesis, which may restrain their spermatogenic potential. Our study establishes a strategy for the in vitro derivation of SSC activity from PSCs, which, we propose, relies on faithful epigenomic regulation.

  18. Implementation of the 2011 Therapeutic Activity Act: will commercialization improve the financial performance of Polish hospitals?

    PubMed

    Sagan, Anna; Sobczak, Alicja

    2014-11-01

    The Therapeutic Activity Act that came into force on 1 July 2011 was aimed at achieving a large-scale transformation of public hospitals into Commercial Code companies. The change of the legal form, from a public entity to a for-profit company, was expected to improve the poor economic efficiency of the public hospital sector. However, the mere change of the legal form does not guarantee a better financial performance of hospitals and thus the success of the Act. In many cases, deep internal changes are needed to achieve improvements in the financial performance of particular hospitals. In addition, a set of other measures at the national and regional levels, such as the mapping of health needs of the population, have to accompany the legal transformations in order to improve the efficiency of the hospital sector. The recent slowdown in the rate of the transformations is another factor that renders the success of the Act uncertain.

  19. ChIP-seq Mapping of Distant-Acting Enhancers and Their In Vivo Activities

    SciTech Connect

    Visel, Axel; Pennacchio, Len A.

    2011-06-01

    The genomic location and function of most distant-acting transcriptional enhancers in the human genome remains unknown We performed ChIP-seq for various transcriptional coactivator proteins (such as p300) directly from different embryonic mouse tissues, identifying thousands of binding sitesTransgenic mouse experiments show that p300 and other co-activator peaks are highly predictive of genomic location AND tissue-specific activity patterns of distant-acting enhancersMost enhancers are active only in one or very few tissues Genomic location of tissue-specific p300 peaks correlates with tissue-specific expression of nearby genes Most binding sites are conserved, but the global degree of conservation varies between tissues

  20. Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-κB and proinflammatory gene program activation in intestinal epithelial cells

    PubMed Central

    Tallant, Thomas; Deb, Amitabha; Kar, Niladri; Lupica, Joseph; de Veer, Michael J; DiDonato, Joseph A

    2004-01-01

    Background Infection of intestinal epithelial cells by pathogenic Salmonella leads to activation of signaling cascades that ultimately initiate the proinflammatory gene program. The transcription factor NF-κB is a key regulator/activator of this gene program and is potently activated. We explored the mechanism by which Salmonella activates NF-κB during infection of cultured intestinal epithelial cells and found that flagellin produced by the bacteria and contained on them leads to NF-κB activation in all the cells; invasion of cells by the bacteria is not required to activate NF-κB. Results Purified flagellin activated the mitogen activated protein kinase (MAPK), stress-activated protein kinase (SAPK) and Ikappa B kinase (IKK) signaling pathways that lead to expression of the proinflammatory gene program in a temporal fashion nearly identical to that of infection of intestinal epithelial cells by Salmonella. Flagellin expression was required for Salmonella invasion of host cells and it activated NF-κB via toll-like receptor 5 (TLR5). Surprisingly, a number of cell lines found to be unresponsive to flagellin express TLR5 and expression of exogenous TLR5 in these cells induces NF-κB activity in response to flagellin challenge although not robustly. Conversely, overexpression of dominant-negative TLR5 alleles only partially blocks NF-κB activation by flagellin. These observations are consistent with the possibility of either a very stable TLR5 signaling complex, the existence of a low abundance flagellin co-receptor or required adapter, or both. Conclusion These collective results provide the evidence that flagellin acts as the main determinant of Salmonella mediated NF-κB and proinflammatory signaling and gene activation by this flagellated pathogen. In addition, expression of the fli C gene appears to play an important role in the proper functioning of the TTSS since mutants that fail to express fli C are defective in expressing a subset of Sip proteins and

  1. The non-radial propagation of coronal streamers in minimum activity epoch

    NASA Astrophysics Data System (ADS)

    Tlatov, Andrey G.; Vasil'eva, Valeria V.

    2010-02-01

    We have analyzed the shape of the solar corona using the data of daily observations with Mark-3/4 (1980-2008) and SOHO/Lasco-2 (1996-2008) telescopes. The angles of deviation of coronal rays from the radial direction Δθ vary cyclically, reaching the maximum deviation towards the solar equator at the minimum of the solar activity. At the minimum of the 24-th cycle of activity, the Δθ angles were smaller than they were at the minimum of the 22-nd and 23-rd cycles. We also analyzed of the solar structure corona during eclipses for minimum activity from 1870 till 2008. We examined changes in the index, which characterizes the angle of large coronal streamers to the equatorial plane. It has been shown that the index has been smoothly changing during the last 140 years. The maximal value of an index was during 17-19 activity cycles. The minimal values are reached in the end of 19 centuries and at the present time. We consider the relations between the angles of deviation of coronal rays at the minimum of activity, the parameters of the global magnetic field of the Sun, and the amplitude of the subsequent cycle of activity, and discuss the hypothesis that the variations of the inclination of coronal rays may affect the parameters of the solar wind and the indices of geomagnetic perturbations at the minima of the solar activity cycles.

  2. Solitary wave propagation through two-dimensional treelike structures.

    PubMed

    Falls, William J; Sen, Surajit

    2014-02-01

    It is well known that a velocity perturbation can travel through a mass spring chain with strongly nonlinear interactions as a solitary and antisolitary wave pair. In recent years, nonlinear wave propagation in 2D structures have also been explored. Here we first consider the propagation of such a velocity perturbation for cases where the system has a 2D "Y"-shaped structure. Here each of the three pieces that make up the "Y" are made of a small mass spring chain. In addition, we consider a case where multiple "Y"-shaped structures are used to generate a "tree." We explore the early time dynamical behavior associated with the propagation of a velocity perturbation initiated at the trunk and at the extremities for both cases. We are looking for the energy transmission properties from one branch to another of these "Y"-shaped structures. Our dynamical simulations suggest the following broad observations: (i) for strongly nonlinear interactions, mechanical energy propagation resembles pulse propagation with the energy propagation being dispersive in the linear case; (ii) for strong nonlinear interactions, the tree-like structure acts as an energy gate showing preference for large perturbations in the system while the behavior of the linear case shows no such preference, thereby suggesting that such structures can possibly act as switches that activate at sufficiently high energies. The study aspires to develop insights into the nature of nonlinear wave propagation through a network of linear chains.

  3. An active K/Ka-band antenna array for the NASA ACTS mobile terminal

    NASA Technical Reports Server (NTRS)

    Tulintseff, A.; Crist, R.; Densmore, Art; Sukamto, L.

    1993-01-01

    An active K/Ka-band antenna array is currently under development for NASA's ACTS Mobile Terminal (AMT). The AMT task will demonstrate voice, data, and video communications to and from the AMT vehicle in Los Angeles, California, and a base station in Cleveland, Ohio, via the ACTS satellite at 30 and 20 GHz. Satellite tracking for the land-mobile vehicular antenna system involves 'mechanical dithering' of the antenna, where the antenna radiates a fixed beam 46 deg. above the horizon. The antenna is to transmit horizontal polarization and receive vertical polarization at 29.634 plus or minus 0.15 GHz and 19.914 plus or minus 0.15 GHz, respectively. The active array will provide a minimum of 22 dBW EIRP transmit power density and a -8 dB/K deg. receive sensitivity.

  4. An active K/Ka-band antenna array for the NASA ACTS mobile terminal

    NASA Astrophysics Data System (ADS)

    Tulintseff, A.; Crist, R.; Densmore, Art; Sukamto, L.

    An active K/Ka-band antenna array is currently under development for NASA's ACTS Mobile Terminal (AMT). The AMT task will demonstrate voice, data, and video communications to and from the AMT vehicle in Los Angeles, California, and a base station in Cleveland, Ohio, via the ACTS satellite at 30 and 20 GHz. Satellite tracking for the land-mobile vehicular antenna system involves 'mechanical dithering' of the antenna, where the antenna radiates a fixed beam 46 deg. above the horizon. The antenna is to transmit horizontal polarization and receive vertical polarization at 29.634 plus or minus 0.15 GHz and 19.914 plus or minus 0.15 GHz, respectively. The active array will provide a minimum of 22 dBW EIRP transmit power density and a -8 dB/K deg. receive sensitivity.

  5. The spatial response of nonlinear strain propagation in response to actively driven microspheres through entangled actin networks

    NASA Astrophysics Data System (ADS)

    Falzone, Tobias; Blair, Savanna; Robertson-Anderson, Rae

    2015-03-01

    The semiflexible biopolymer actin, a ubiquitous component of nearly all biological organisms, plays an important role in many mechanically-driven processes such as muscle contraction, cancer invasion and cell motility. As such, entangled actin networks, which possess unique and complex viscoelastic properties, have been the subject of much theoretical and experimental work. However, due to this viscoelastic complexity, much is still unknown regarding the correlation of the applied stress on actin networks to the induced filament strain at the molecular and micro scale. Here, we use simultaneous optical trapping and fluorescence microscopy to characterize the link between applied microscopic forces and strain propagation as a function of strain rate and concentration. Specifically, we track fiduciary markers on entangled actin filaments before, during and after actively driving embedded microspheres through the network. These measurements provide much needed insight into the molecular-level dynamics connecting stress and strain in semiflexible polymer networks.

  6. Determination of local optical properties of the rat barrel cortex during neural activation: Monte-Carlo approach to light propagation

    NASA Astrophysics Data System (ADS)

    Migacheva, E. V.; Chamot, S. R.; Seydoux, O.; Weber, B.; Depeursinge, C.; Marquet, P.; Magistretti, P. J.

    2010-04-01

    Spatially-spectrally-resolved reflectance measurements allow in vivo measuring the optical coefficients of absorption and scattering within the cortical tissue. This method, if applied to neural tissue during enhanced activity, could allow a straightforward monitoring of the blood oxygen saturation changes occurring in the brain cortex during hemodynamic responses. Furthermore, it may provide valuable information on possible absorption and scattering changes occurring during stimulation. The feasibility of such measurements was investigated by carrying a preliminary numerical study using a Monte-Carlo light propagation routine. Experimental parameters such as the geometry of the optical probe, baseline cortex optical coefficients retrieved from the literature and anatomical characteristics of the rat barrel cortex were used as an input for the simulations. The sensitivity of the probe to the local variations of optical coefficients was investigated with this numerical approach. Additionally, the influence of the barrel cortex dimensions and the probe positioning relatively to the activated region were studied for instrumental optimization purpose. It was found that typical variations of optical coefficients can be detected if the activated region of barrel cortex has a volume of typically 1 mm3 or larger. The decay of the probe sensitivity to changes was studied as a function of the depth of the activated region. The results showed that the best sensitivity is achieved by placing the light injection fiber of the optical probe aligned onto the center of the cylindrical barrel.

  7. Characterization of Novel Antimalarial Compound ACT-451840: Preclinical Assessment of Activity and Dose–Efficacy Modeling

    PubMed Central

    Le Bihan, Amélie; Angulo-Barturen, Iñigo; Binkert, Christoph; Boss, Christoph; Brun, Reto; Brunner, Ralf; Buchmann, Stephan; Dechering, Koen J.; Delves, Michael; Ewerling, Sonja; Ferrer, Santiago; Fischli, Christoph; Gamo–Benito, Francisco Javier; Heidmann, Bibia; Jiménez-Díaz, María Belén; Leroy, Didier; Martínez, Maria Santos; Meyer, Solange; Moehrle, Joerg J.; Noviyanti, Rintis; Sanz, Laura María; Sauerwein, Robert W.; Scheurer, Christian; Schleiferboeck, Sarah; Sinden, Robert; Snyder, Christopher; Straimer, Judith; Wirjanata, Grennady; Marfurt, Jutta; Weller, Thomas; Clozel, Martine; Wittlin, Sergio

    2016-01-01

    Background Artemisinin resistance observed in Southeast Asia threatens the continued use of artemisinin-based combination therapy in endemic countries. Additionally, the diversity of chemical mode of action in the global portfolio of marketed antimalarials is extremely limited. Addressing the urgent need for the development of new antimalarials, a chemical class of potent antimalarial compounds with a novel mode of action was recently identified. Herein, the preclinical characterization of one of these compounds, ACT-451840, conducted in partnership with academic and industrial groups is presented. Method and Findings The properties of ACT-451840 are described, including its spectrum of activities against multiple life cycle stages of the human malaria parasite Plasmodium falciparum (asexual and sexual) and Plasmodium vivax (asexual) as well as oral in vivo efficacies in two murine malaria models that permit infection with the human and the rodent parasites P. falciparum and Plasmodium berghei, respectively. In vitro, ACT-451840 showed a 50% inhibition concentration of 0.4 nM (standard deviation [SD]: ± 0.0 nM) against the drug-sensitive P. falciparum NF54 strain. The 90% effective doses in the in vivo efficacy models were 3.7 mg/kg against P. falciparum (95% confidence interval: 3.3–4.9 mg/kg) and 13 mg/kg against P. berghei (95% confidence interval: 11–16 mg/kg). ACT-451840 potently prevented male gamete formation from the gametocyte stage with a 50% inhibition concentration of 5.89 nM (SD: ± 1.80 nM) and dose-dependently blocked oocyst development in the mosquito with a 50% inhibitory concentration of 30 nM (range: 23–39). The compound’s preclinical safety profile is presented and is in line with the published results of the first-in-man study in healthy male participants, in whom ACT-451840 was well tolerated. Pharmacokinetic/pharmacodynamic (PK/PD) modeling was applied using efficacy in the murine models (defined either as antimalarial activity or as

  8. 50 CFR 80.51 - What activities are eligible for funding under the Dingell-Johnson Sport Fish Restoration Act?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... under the Dingell-Johnson Sport Fish Restoration Act? 80.51 Section 80.51 Wildlife and Fisheries UNITED... SPORT FISH RESTORATION PROGRAM ADMINISTRATIVE REQUIREMENTS, PITTMAN-ROBERTSON WILDLIFE RESTORATION AND DINGELL-JOHNSON SPORT FISH RESTORATION ACTS Eligible Activities § 80.51 What activities are eligible...

  9. 12 CFR 225.145 - Limitations established by the Competitive Equality Banking Act of 1987 on the activities and...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Equality Banking Act of 1987 on the activities and growth of nonbank banks. 225.145 Section 225.145 Banks... Interpretations § 225.145 Limitations established by the Competitive Equality Banking Act of 1987 on the activities and growth of nonbank banks. (a) Introduction. Effective August 10, 1987, the Competitive...

  10. 50 CFR 80.51 - What activities are eligible for funding under the Dingell-Johnson Sport Fish Restoration Act?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... under the Dingell-Johnson Sport Fish Restoration Act? 80.51 Section 80.51 Wildlife and Fisheries UNITED... SPORT FISH RESTORATION PROGRAM ADMINISTRATIVE REQUIREMENTS, PITTMAN-ROBERTSON WILDLIFE RESTORATION AND DINGELL-JOHNSON SPORT FISH RESTORATION ACTS Eligible Activities § 80.51 What activities are eligible...

  11. 50 CFR 80.50 - What activities are eligible for funding under the Pittman-Robertson Wildlife Restoration Act?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... SPORT FISH RESTORATION PROGRAM ADMINISTRATIVE REQUIREMENTS, PITTMAN-ROBERTSON WILDLIFE RESTORATION AND DINGELL-JOHNSON SPORT FISH RESTORATION ACTS Eligible Activities § 80.50 What activities are eligible...

  12. Babcock-Leighton solar dynamo: the role of downward pumping and the equatorward propagation of activity

    NASA Astrophysics Data System (ADS)

    Karak, Bidya Binay; Cameron, Robert

    2016-05-01

    We investigate the role of downward magnetic pumping near the surface using a kinematic Babcock-Leighton model. We find that the pumping causes the poloidal field to become predominately radial in the near-surface shear layer. This allows the negative radial shear in the near-surface layer to effectively act on the radial field to produce a toroidal field. Consequently, we observe a clear equatorward migration of the toroidal field at low latitudes even when there is no meridional flow in the deep CZ. We show a case where the period of a dynamo wave solution is approximately 11 years. Flux transport models are also shown with periods close to 11 years. Both the dynamo wave and flux transport dynamo are thus able to reproduce some of the observed features of solar cycle. The main difference between the two types of dynamo is the value of $\\alpha$ required to produce dynamo action. In both types of dynamo, the surface meridional flow helps to advect and build the polar field in high latitudes, while in flux transport dynamo the equatorward flow near the bottom of CZ advects toroidal field to cause the equatorward migration in butterfly wings and this advection makes the dynamo easier by transporting strong toroidal field to low latitudes where $\\alpha$ effect works. Another conclusion of our study is that the magnetic pumping suppresses the diffusion of fields through the photospheric surface which helps to achieve the 11-year dynamo cycle at a moderately larger value of magnetic diffusivity than has previously been used.

  13. Feed-Forward Propagation of Temporal and Rate Information between Cortical Populations during Coherent Activation in Engineered In Vitro Networks

    PubMed Central

    DeMarse, Thomas B.; Pan, Liangbin; Alagapan, Sankaraleengam; Brewer, Gregory J.; Wheeler, Bruce C.

    2016-01-01

    Transient propagation of information across neuronal assembles is thought to underlie many cognitive processes. However, the nature of the neural code that is embedded within these transmissions remains uncertain. Much of our understanding of how information is transmitted among these assemblies has been derived from computational models. While these models have been instrumental in understanding these processes they often make simplifying assumptions about the biophysical properties of neurons that may influence the nature and properties expressed. To address this issue we created an in vitro analog of a feed-forward network composed of two small populations (also referred to as assemblies or layers) of living dissociated rat cortical neurons. The populations were separated by, and communicated through, a microelectromechanical systems (MEMS) device containing a strip of microscale tunnels. Delayed culturing of one population in the first layer followed by the second a few days later induced the unidirectional growth of axons through the microtunnels resulting in a primarily feed-forward communication between these two small neural populations. In this study we systematically manipulated the number of tunnels that connected each layer and hence, the number of axons providing communication between those populations. We then assess the effect of reducing the number of tunnels has upon the properties of between-layer communication capacity and fidelity of neural transmission among spike trains transmitted across and within layers. We show evidence based on Victor-Purpura’s and van Rossum’s spike train similarity metrics supporting the presence of both rate and temporal information embedded within these transmissions whose fidelity increased during communication both between and within layers when the number of tunnels are increased. We also provide evidence reinforcing the role of synchronized activity upon transmission fidelity during the spontaneous

  14. Atmospheric Propagation

    NASA Technical Reports Server (NTRS)

    Embleton, Tony F. W.; Daigle, Gilles A.

    1991-01-01

    Reviewed here is the current state of knowledge with respect to each basic mechanism of sound propagation in the atmosphere and how each mechanism changes the spectral or temporal characteristics of the sound received at a distance from the source. Some of the basic processes affecting sound wave propagation which are present in any situation are discussed. They are geometrical spreading, molecular absorption, and turbulent scattering. In geometrical spreading, sound levels decrease with increasing distance from the source; there is no frequency dependence. In molecular absorption, sound energy is converted into heat as the sound wave propagates through the air; there is a strong dependence on frequency. In turbulent scattering, local variations in wind velocity and temperature induce fluctuations in phase and amplitude of the sound waves as they propagate through an inhomogeneous medium; there is a moderate dependence on frequency.

  15. Motor patterns of the small intestine explained by phase-amplitude coupling of two pacemaker activities: the critical importance of propagation velocity.

    PubMed

    Huizinga, Jan D; Parsons, Sean P; Chen, Ji-Hong; Pawelka, Andrew; Pistilli, Marc; Li, Chunpei; Yu, Yuanjie; Ye, Pengfei; Liu, Qing; Tong, Mengting; Zhu, Yong Fang; Wei, Defei

    2015-09-15

    Phase-amplitude coupling of two pacemaker activities of the small intestine, the omnipresent slow wave activity generated by interstitial cells of Cajal of the myenteric plexus (ICC-MP) and the stimulus-dependent rhythmic transient depolarizations generated by ICC of the deep muscular plexus (ICC-DMP), was recently hypothesized to underlie the orchestration of the segmentation motor pattern. The aim of the present study was to increase our understanding of phase-amplitude coupling through modeling. In particular the importance of propagation velocity of the ICC-DMP component was investigated. The outcome of the modeling was compared with motor patterns recorded from the rat or mouse intestine from which propagation velocities within the different patterns were measured. The results show that the classical segmentation motor pattern occurs when the ICC-DMP component has a low propagation velocity (<0.05 cm/s). When the ICC-DMP component has a propagation velocity in the same order of magnitude as that of the slow wave activity (∼1 cm/s), cluster type propulsive activity occurs which is in fact the dominant propulsive activity of the intestine. Hence, the only difference between the generation of propagating cluster contractions and the Cannon-type segmentation motor pattern is the propagation velocity of the low-frequency component, the rhythmic transient depolarizations originating from the ICC-DMP. Importantly, the proposed mechanism explains why both motor patterns have distinct rhythmic waxing and waning of the amplitude of contractions. The hypothesis is brought forward that the velocity is modulated by neural regulation of gap junction conductance within the ICC-DMP network.

  16. Motor patterns of the small intestine explained by phase-amplitude coupling of two pacemaker activities: the critical importance of propagation velocity

    PubMed Central

    Parsons, Sean P.; Chen, Ji-Hong; Pawelka, Andrew; Pistilli, Marc; Li, Chunpei; Yu, Yuanjie; Ye, Pengfei; Liu, Qing; Tong, Mengting; Zhu, Yong Fang; Wei, Defei

    2015-01-01

    Phase-amplitude coupling of two pacemaker activities of the small intestine, the omnipresent slow wave activity generated by interstitial cells of Cajal of the myenteric plexus (ICC-MP) and the stimulus-dependent rhythmic transient depolarizations generated by ICC of the deep muscular plexus (ICC-DMP), was recently hypothesized to underlie the orchestration of the segmentation motor pattern. The aim of the present study was to increase our understanding of phase-amplitude coupling through modeling. In particular the importance of propagation velocity of the ICC-DMP component was investigated. The outcome of the modeling was compared with motor patterns recorded from the rat or mouse intestine from which propagation velocities within the different patterns were measured. The results show that the classical segmentation motor pattern occurs when the ICC-DMP component has a low propagation velocity (<0.05 cm/s). When the ICC-DMP component has a propagation velocity in the same order of magnitude as that of the slow wave activity (∼1 cm/s), cluster type propulsive activity occurs which is in fact the dominant propulsive activity of the intestine. Hence, the only difference between the generation of propagating cluster contractions and the Cannon-type segmentation motor pattern is the propagation velocity of the low-frequency component, the rhythmic transient depolarizations originating from the ICC-DMP. Importantly, the proposed mechanism explains why both motor patterns have distinct rhythmic waxing and waning of the amplitude of contractions. The hypothesis is brought forward that the velocity is modulated by neural regulation of gap junction conductance within the ICC-DMP network. PMID:26135802

  17. Magnetohydrodynamic (MHD) analyses of various forms of activity and their propagation through helio spheric space

    NASA Technical Reports Server (NTRS)

    Wu, S. T.

    1987-01-01

    Theoretical and numerical modeling of solar activity and its effects on the solar atmosphere within the context of magnetohydrodynamics were examined. Specifically, the scientific objectives were concerned with the physical mechanisms for the flare energy build-up and subsequent release. In addition, transport of this energy to the corona and solar wind was also investigated. Well-posed, physically self-consistent, numerical simulation models that are based upon magnetohydrodynamics were sought. A systematic investigation of the basic processes that determine the macroscopic dynamic behavior of solar and heliospheric phenomena was conducted. A total of twenty-three articles were accepted and published in major journals. The major achievements are summarized.

  18. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    PubMed

    Pritzkow, Sandra; Wagenführ, Katja; Daus, Martin L; Boerner, Susann; Lemmer, Karin; Thomzig, Achim; Mielke, Martin; Beekes, Michael

    2011-01-01

    Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA) for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1)- to ≥10(5.5)-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological scrapie

  19. A brief review on anti diabetic plants: Global distribution, active ingredients, extraction techniques and acting mechanisms

    PubMed Central

    Chan, Chung-Hung; Ngoh, Gek-Cheng; Yusoff, Rozita

    2012-01-01

    A study has been conducted with the aim to provide researchers with general information on anti diabetic extracts based on relevant research articles collected from 34 reliable medical journals. The study showed that Asian and African continents have 56% and 17% share of the worldwide distribution of therapeutic herbal plants, respectively. In Asia, India and China are the leading countries in herbal plants research, and there has been an increase in medicinal research on plants extract for diabetes treatment since 1995 in these regions. The information collected shows that plant leaves are about 20% more favorable for storing active ingredients, as compared to other parts of herbal plants. A brief review on the extraction techniques for the mentioned parts is also included. Furthermore, the acting mechanisms for the anti diabetic activity were described, and the related active ingredients were identified. The findings reveal that most of the anti diabetic research is focused on the alteration of glucose metabolism to prevent diabetes. PMID:22654401

  20. Stress Activation and Propagation of Electronic Charge Carriers in Igneous Rocks

    NASA Astrophysics Data System (ADS)

    Ling, J.; Freund, F. T.

    2007-12-01

    Igneous and high-grade metamorphic rocks in the Earth's crust generate electric currents when subjected to deviatoric stresses. The reason is that these rocks contain dormant electronic charge carriers in the form of peroxy links. Peroxy links are sites in the crystal structures of the constituent minerals where oxygen anions have converted from their common 2- valence state to the 1- valence state, O3X-OO-XO3 with X=Si4+, Al3+ etc. As rocks are stressed and dislocations sweep through the mineral grains, the peroxy links break up, activating electrons and pholes ("phole" is an abbreviation for "positive hole", a defect electron on the oxygen sublattice, chemically O- in a matrix of O2-). The pholes are mobile electronic charge carriers that can spread out of the stressed rock into the surrounding unstressed rock. They travel via energy levels at the upper edge of the valence bands, cross grain boundaries and achieve a phase velocity on the order of 200±50 m/sec, consistent with phonon-assisted electron hopping. Due to mutual repulsion inside the rock volume the pholes spread to the surface, where they build up a positive surface charge. The surface charge can be measured with a non-contact capacitive sensor. If a Cu contact is applied to the surface of the rock, electrons are injected from ground into the rock in response to the evolving positive charge on the rock surface. We modeled surface potentials and burst-like electron injections following low and medium velocity impact experiments, 100 m/sec and 1.5 km/sec respectively.

  1. 10 CFR 50.13 - Attacks and destructive acts by enemies of the United States; and defense activities.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Attacks and destructive acts by enemies of the United States; and defense activities. 50.13 Section 50.13 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC... the effects of (a) attacks and destructive acts, including sabotage, directed against the facility...

  2. 10 CFR 50.13 - Attacks and destructive acts by enemies of the United States; and defense activities.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Attacks and destructive acts by enemies of the United States; and defense activities. 50.13 Section 50.13 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC... the effects of (a) attacks and destructive acts, including sabotage, directed against the facility...

  3. 50 CFR 80.50 - What activities are eligible for funding under the Pittman-Robertson Wildlife Restoration Act?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... under the Pittman-Robertson Wildlife Restoration Act? 80.50 Section 80.50 Wildlife and Fisheries UNITED... SPORT FISH RESTORATION PROGRAM ADMINISTRATIVE REQUIREMENTS, PITTMAN-ROBERTSON WILDLIFE RESTORATION AND... funding under the Pittman-Robertson Wildlife Restoration Act? The following activities are eligible...

  4. 10 CFR 50.13 - Attacks and destructive acts by enemies of the United States; and defense activities.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Attacks and destructive acts by enemies of the United States; and defense activities. 50.13 Section 50.13 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC... the effects of (a) attacks and destructive acts, including sabotage, directed against the facility...

  5. Estimating the active space of male koala bellows: propagation of cues to size and identity in a Eucalyptus forest.

    PubMed

    Charlton, Benjamin D; Reby, David; Ellis, William A H; Brumm, Jacqui; Fitch, W Tecumseh

    2012-01-01

    Examining how increasing distance affects the information content of vocal signals is fundamental for determining the active space of a given species' vocal communication system. In the current study we played back male koala bellows in a Eucalyptus forest to determine the extent that individual classification of male koala bellows becomes less accurate over distance, and also to quantify how individually distinctive acoustic features of bellows and size-related information degrade over distance. Our results show that the formant frequencies of bellows derived from Linear Predictive Coding can be used to classify calls to male koalas over distances of 1-50 m. Further analysis revealed that the upper formant frequencies and formant frequency spacing were the most stable acoustic features of male bellows as they propagated through the Eucalyptus canopy. Taken together these findings suggest that koalas could recognise known individuals at distances of up to 50 m and indicate that they should attend to variation in the upper formant frequencies and formant frequency spacing when assessing the identity of callers. Furthermore, since the formant frequency spacing is also a cue to male body size in this species and its variation over distance remained very low compared to documented inter-individual variation, we suggest that male koalas would still be reliably classified as small, medium or large by receivers at distances of up to 150 m.

  6. Single-domain intrabodies against hepatitis C virus core inhibit viral propagation and core-induced NFκB activation.

    PubMed

    Suzuki, Ryosuke; Saito, Kenji; Matsuda, Mami; Sato, Mitsuru; Kanegae, Yumi; Shi, Guoli; Watashi, Koichi; Aizaki, Hideki; Chiba, Joe; Saito, Izumu; Wakita, Takaji; Suzuki, Tetsuro

    2016-04-01

    Hepatitis C virus (HCV) core plays a key role in viral particle formation and is involved in viral pathogenesis. Here, constructs for single-domain intrabodies consisting of variable regions derived from mouse mAbs against HCV core were established. Expressed single-domain intrabodies were shown to bind to HCV core, and inhibit the growth of cell culture-produced HCV derived from JFH-1 (genotype 2a) and a TH (genotype 1b)/JFH-1 chimera. Adenovirus vectors expressing intrabodies were also capable of reducing HCV propagation. Intrabody expression did not affect viral entry or genome replication of single-round infectious trans-complemented HCV particles. However, intrabody expression reduced intracellular and extracellular infectious titres in CD81-defective Huh7-25 cells transfected with the HCV genome, suggesting that these intrabodies impair HCV assembly. Furthermore, intrabody expression suppressed HCV core-induced NFκB promoter activity. These intrabodies may therefore serve as tools for elucidating the role of core in HCV pathogenesis.

  7. The Properties of Large Amplitude Whistler Mode Waves in the Magnetosphere: Propagation and Relationship with Geomagnetic Activity

    NASA Technical Reports Server (NTRS)

    Wilson, L. B., III; Cattell, C. A.; Kellogg, P. J.; Wygant, J. R.; Goetz, K.; Breneman, A.; Kersten, K.

    2011-01-01

    Wepresent resultsof a studyof the characteristicsof very large amplitude whistler mode waves inside the terrestrial magnetosphere at radial distances of less than 15 RE using waveform capture data from the Wind spacecraft. We observed 247 whistler mode waves with at least one electric field component (105/247 had !80 mV/m peak!to!peak amplitudes) and 66 whistler mode waves with at least one search coil magnetic field component (38/66 had !0.8 nT peak!to!peak amplitudes). Wave vectors determined from events with three magnetic field components indicate that 30/46 propagate within 20 of the ambient magnetic field, though some are more oblique (up to "50 ). No relationship was observed between wave normal angle and GSM latitude. 162/247 of the large amplitude whistler mode waves were observed during magnetically active periods (AE > 200 nT). 217 out of 247 total whistler mode waves examined were observed inside the radiation belts. We present a waveform capture with the largest whistler wave magnetic field amplitude (^8 nT peak!to!peak) ever reported in the radiation belts. The estimated Poynting flux magnitude associated with this wave is ^300 mW/m2, roughly four orders of magnitude above estimates from previous satellite measurements. Such large Poynting flux values are consistent with rapid energization of electrons.

  8. Integrative application of active controls (IAAC) technology to an advanced subsonic transport project. Initial act configuration design study

    NASA Technical Reports Server (NTRS)

    1980-01-01

    The performance and economic benefits of a constrained application of Active Controls Technology (ACT) are identified, and the approach to airplane design is established for subsequent steps leading to the development of a less constrained final ACT configuration. The active controls configurations are measured against a conventional baseline configuration, a state-of-the-art transport, to determine whether the performance and economic changes resulting from ACT merit proceeding with the project. The technology established by the conventional baseline configuration was held constant except for the addition of ACT. The wing, with the same planform, was moved forward on the initial ACT configuration to move the loading range aft relative to the wing mean aerodynamic chord. Wing trailing-edge surfaces and surface controls also were reconfigured for load alleviation and structural stabilization.

  9. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transpot project-demonstration act system definition

    NASA Technical Reports Server (NTRS)

    Hanks, G. W.; Shomber, H. A.; Crumb, C. B.; Flora, C. C.; Macdonald, K. A. B.; Smith, R. D.; Sassi, A. P.; Dorwart, R. J.

    1982-01-01

    The 1985 ACT airplane is the Final Active Controls Technology (ACT) Airplane with the addition of three-axis fly by wire. Thus it retains all the efficiency features of the full ACT system plus the weight and cost savings accruing from deletion of the mechanical control system. The control system implements the full IAAC spectrum of active controls except flutter-mode control, judged essentially nonbeneficial, and incorporates new control surfaces called flaperons to make the most of wing-load alleviation. This redundant electronic system is conservatively designed to preserve the extreme reliability required of crucial short-period pitch augmentation, which provides more than half of the fuel savings.

  10. Phytochemicals increase the antibacterial activity of antibiotics by acting on a drug efflux pump

    PubMed Central

    Ohene-Agyei, Thelma; Mowla, Rumana; Rahman, Taufiq; Venter, Henrietta

    2014-01-01

    Drug efflux pumps confer resistance upon bacteria to a wide range of antibiotics from various classes. The expression of efflux pumps are also implicated in virulence and biofilm formation. Moreover, organisms can only acquire resistance in the presence of active drug efflux pumps. Therefore, efflux pump inhibitors (EPIs) are attractive compounds to reverse multidrug resistance and to prevent the development of resistance in clinically relevant bacterial pathogens. We investigated the potential of pure compounds isolated from plants to act as EPIs. In silico screening was used to predict the bioactivity of plant compounds and to compare that with the known EPI, phe-arg-β-naphthylamide (PAβN). Subsequently, promising products have been tested for their ability to inhibit efflux. Plumbagin nordihydroguaretic acid (NDGA) and to a lesser degree shikonin, acted as sensitizers of drug-resistant bacteria to currently used antibiotics and were able to inhibit the efflux pump-mediated removal of substrate from cells. We demonstrated the feasibility of in silico screening to identify compounds that potentiate the action of antibiotics against drug-resistant strains and which might be potentially useful lead compounds for an EPI discovery program. PMID:25224951

  11. Active normal faulting during the 1997 seismic sequence in Colfiorito, Umbria: Did slip propagate to the surface?

    NASA Astrophysics Data System (ADS)

    Mildon, Zoë K.; Roberts, Gerald P.; Faure Walker, Joanna P.; Wedmore, Luke N. J.; McCaffrey, Ken J. W.

    2016-10-01

    In order to determine whether slip during an earthquake on the 26th September 1997 propagated to the surface, structural data have been collected along a bedrock fault scarp in Umbria, Italy. These collected data are used to investigate the relationship between the throw associated with a debated surface rupture (observed as a pale unweathered stripe at the base of the bedrock fault scarp) and the strike, dip and slip-vector. Previous studies have suggested that the surface rupture was produced either by primary surface slip or secondary compaction of hangingwall sediments. Some authors favour the latter because sparse surface fault dip measurements do not match nodal plane dips at depth. It is demonstrated herein that the strike, dip and height of the surface rupture, represented by a pale unweathered stripe at the base of the bedrock scarp, shows a systematic relationship with respect to the geometry and kinematics of faulting in the bedrock. The strike and dip co-vary and the throw is greatest where the strike is oblique to the slip-vector azimuth where the highest dip values are recorded. This implies that the throw values vary to accommodate spatial variation in the strike and dip of the fault across fault plane corrugations, a feature that is predicted by theory describing conservation of strain along faults, but not by compaction. Furthermore, published earthquake locations and reported fault dips are consistent with the analysed surface scarps when natural variation for surface dips and uncertainty for nodal plane dips at depth are taken into account. This implies that the fresh stripe is indeed a primary coseismic surface rupture whose slip is connected to the seismogenic fault at depth. We discuss how this knowledge of the locations and geometry of the active faults can be used as an input for seismic hazard assessment.

  12. Factor C acts as a lipopolysaccharide-responsive C3 convertase in horseshoe crab complement activation.

    PubMed

    Ariki, Shigeru; Takahara, Shusaku; Shibata, Toshio; Fukuoka, Takaaki; Ozaki, Aya; Endo, Yuichi; Fujita, Teizo; Koshiba, Takumi; Kawabata, Shun-ichiro

    2008-12-01

    The complement system in vertebrates plays an important role in host defense against and clearance of invading microbes, in which complement component C3 plays an essential role in the opsonization of pathogens, whereas the molecular mechanism underlying C3 activation in invertebrates remains unknown. In an effort to understand the molecular activation mechanism of invertebrate C3, we isolated and characterized an ortholog of C3 (designated TtC3) from the horseshoe crab Tachypleus tridentatus. Flow cytometric analysis using an Ab against TtC3 revealed that the horseshoe crab complement system opsonizes both Gram-negative and Gram-positive bacteria. Evaluation of the ability of various pathogen-associated molecular patterns to promote the proteolytic conversion of TtC3 to TtC3b in hemocyanin-depleted plasma indicated that LPS, but not zymosan, peptidoglycan, or laminarin, strongly induces this conversion, highlighting the selective response of the complement system to LPS stimulation. Although originally characterized as an LPS-sensitive initiator of hemolymph coagulation stored within hemocytes, we identified factor C in hemolymph plasma. An anti-factor C Ab inhibited various LPS-induced phenomena, including plasma amidase activity, the proteolytic activation of TtC3, and the deposition of TtC3b on the surface of Gram-negative bacteria. Moreover, activated factor C present on the surface of Gram-negative bacteria directly catalyzed the proteolytic conversion of the purified TtC3, thereby promoting TtC3b deposition. We conclude that factor C acts as an LPS-responsive C3 convertase on the surface of invading Gram-negative bacteria in the initial phase of horseshoe crab complement activation.

  13. The enduring role of the Emergency Medical Treatment and Active Labor Act.

    PubMed

    Rosenbaum, Sara

    2013-12-01

    The Emergency Medical Treatment and Active Labor Act (EMTALA) is a seminal law that imposes screening, stabilization, and transfer duties on all Medicare-participating hospitals that have emergency departments. More than twenty-five years after its enactment, EMTALA continues to generate controversy over the scope and depth of its obligations on issues ranging from the nature of the screening obligation and rules regarding on-call specialists to whether EMTALA's stabilization protections exclude emergency inpatients. Despite ongoing questions that flow from its detailed provisions, EMTALA is an enduring testament to society's evolving views that hospitals must provide emergency care not only to their established patients but to the broader communities they serve.

  14. Fly DPP10 acts as a channel ancillary subunit and possesses peptidase activity

    PubMed Central

    Shiina, Yohei; Muto, Tomohiro; Zhang, Zhili; Baihaqie, Ahmad; Yoshizawa, Takamasa; Lee, Hye-in J.; Park, Eulsoon; Tsukiji, Shinya; Takimoto, Koichi

    2016-01-01

    Mammalian DPP6 (DPPX) and DPP10 (DPPY) belong to a family of dipeptidyl peptidases, but lack enzyme activity. Instead, these proteins form complexes with voltage-gated K+ channels in Kv4 family to control their gating and other properties. Here, we find that the fly DPP10 ortholog acts as an ancillary subunit of Kv4 channels and digests peptides. Similarly to mammalian DPP10, the fly ortholog tightly binds to rat Kv4.3 protein. The association causes negative shifts in voltage dependence of channel activation and steady state inactivation. It also results in faster inactivation and recovery from inactivation. In addition to its channel regulatory role, fly DPP10 exhibits significant dipeptidyl peptidase activity with Gly-Pro-MCA (glycyl-L-proline 4-methylcoumaryl-7-amide) as a substrate. Heterologously expressed Flag-tagged fly DPP10 and human DPP4 show similar Km values towards this substrate. However, fly DPP10 exhibits approximately a 6-times-lower relative kcat value normalized with anti-Flag immunoreactivity than human DPP4. These results demonstrate that fly DPP10 is a dual functional protein, controlling Kv4 channel gating and removing bioactive peptides. PMID:27198182

  15. Motor activity affects adult skeletal muscle re-innervation acting via tyrosine kinase receptors.

    PubMed

    Sartini, Stefano; Bartolini, Fanny; Ambrogini, Patrizia; Betti, Michele; Ciuffoli, Stefano; Lattanzi, Davide; Di Palma, Michael; Cuppini, Riccardo

    2013-05-01

    Recently, muscle expression of brain-derived neurotrophic factor (BDNF) mRNA and protein under activity control has been reported. BDNF is a neurotrophin known to be involved in axon sprouting in the CNS. Hence, we set out to study the effect of chronic treadmill mid-intensity running on adult rat muscle re-innervation, and to explore the involvement of BDNF and tropomyosin-related kinase (Trk) receptors. After nerve crush, muscle re-innervation was evaluated using intracellular recordings, tension recordings, immunostaining and Western blot analyses. An enhanced muscle multiple innervation was found in running rats that was fully reversed to control values blocking Trk receptors or interrupting the running activity. An increase in muscle multiple innervation was also found in sedentary rats treated with a selective TrkB receptor agonist. The expression of TrkB receptors by intramuscular axons was demonstrated, and increased muscle expression of BDNF was found in running animals. The increase in muscle multiple innervation was consistent with the faster muscle re-innervation that we found in running animals. We conclude that, when regenerating axons contact muscle cells, muscle activity progressively increases modulating BDNF and possibly other growth factors, which in turn, acting via Trk receptors, induce axon sprouting to re-innervate skeletal muscle.

  16. GRC RF Propagation Studies

    NASA Technical Reports Server (NTRS)

    Nessel, James

    2013-01-01

    NASA Glenn Research Center has been involved in the characterization of atmospheric effects on space communications links operating at Ka-band and above for the past 20 years. This presentation reports out on the most recent activities of propagation characterization that NASA is currently involved in.

  17. 12 CFR 225.145 - Limitations established by the Competitive Equality Banking Act of 1987 on the activities and...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 3 2011-01-01 2011-01-01 false Limitations established by the Competitive Equality Banking Act of 1987 on the activities and growth of nonbank banks. 225.145 Section 225.145 Banks... activities and growth of nonbank banks. (a) Introduction. Effective August 10, 1987, the Competitive...

  18. Acting Atoms.

    ERIC Educational Resources Information Center

    Farin, Susan Archie

    1997-01-01

    Describes a fun game in which students act as electrons, protons, and neutrons. This activity is designed to help students develop a concrete understanding of the abstract concept of atomic structure. (DKM)

  19. Assessment of MSFCs Process for the Development and Activation of Space Act Agreements

    NASA Technical Reports Server (NTRS)

    Daugherty, Rachel A.

    2014-01-01

    A Space Act Agreement (SAA) is a contractual vehicle that NASA utilizes to form partnerships with non-NASA entities to stimulate cutting-edge innovation within the science and technology communities while concurrently supporting the NASA missions. SAAs are similar to traditional contracts in that they involve the commitment of Agency resources but allow more flexibility and are more cost effective to implement than traditional contracts. Consequently, the use of SAAs to develop partnerships has greatly increased over the past several years. To facilitate this influx of SAAs, Marshall Space Flight Center (MSFC) developed a process during a kaizen event to streamline and improve the quality of SAAs developed at the Center level. This study assessed the current SAA process to determine if improvements could be implemented to increase productivity, decrease time to activation, and improve the quality of deliverables. Using a combination of direct procedural observation, personnel interviews, and statistical analysis, elements of the process in need of remediation were identified and potential solutions developed. The findings focus primarily on the difficulties surrounding tracking and enforcing process adherence and communication issues among stakeholders. Potential solutions include utilizing customer relationship management (CRM) software to facilitate process coordination and co-locating or potentially merging the two separate organizations involved in SAA development and activation at MSFC.

  20. Characteristics of electron cyclotron harmonic waves observed in an active two-point propagation experiment in the ionosphere

    NASA Astrophysics Data System (ADS)

    James, H. G.; Wallis, D. D.

    2008-07-01

    Electrostatic electron cyclotron waves (ECWs), also-called electron Bernstein waves, observed at harmonics nfc of the electron cyclotron frequency fc were transmitted over field-aligned emitter-receiver separations of hundreds of meters in the active rocket experiment OEDIPUS-C. Although the 300-μs rectangular current pulses into the emitting antenna were smoothly maintained during the experiment, the resulting ECW pulses at the receiver exhibited considerable variety in both the time and frequency domains. A full hot-plasma dispersion relation has been applied to ray-tracing investigations to identify the rays that could connect the emitter and receiver in a smoothly varying model of the auroral ionospheric magnetoplasma. Theoretical connecting rays were limited to frequencies extending from 1 to a few kilohertz above 2fc, which was about 2.6 MHz. But the observed pulse spectra extended over a much broader bandwidth, from several kilohertz below nfc to several kilohertz above, for n = 2, 3, and 4. The broadening is interpreted as a consequence of Doppler effect caused by payload motion and backscatter of the ECWs. Field-aligned density irregularities typical of the auroral topside ionosphere or waves nonlinearly induced by the intense near fields of the HEX antenna may act as the scatterers.

  1. Drosophila myeloid leukemia factor acts with DREF to activate the JNK signaling pathway

    PubMed Central

    Yanai, H; Yoshioka, Y; Yoshida, H; Nakao, Y; Plessis, A; Yamaguchi, M

    2014-01-01

    Drosophila myelodysplasia/myeloid leukemia factor (dMLF), a homolog of human MLF1, oncogene was first identified by yeast two-hybrid screen using the DNA replication-related element-binding factor (DREF) as bait. DREF is a transcription factor that regulates proliferation-related genes in Drosophila. It is known that overexpression of dMLF in the wing imaginal discs through the engrailed-GAL4 driver causes an atrophied wing phenotype associated with the induction of apoptosis. However, the precise mechanisms involved have yet to be clarified. Here, we found the atrophied phenotype to be suppressed by loss-of-function mutation of Drosophila Jun N-terminal kinase (JNK), basket (bsk). Overexpression of dMLF induced ectopic JNK activation in the wing disc monitored with the puckered-lacZ reporter line, resulting in induction of apoptosis. The DREF-binding consensus DRE sequence could be shown to exist in the bsk promoter. Chromatin immunoprecipitation assays in S2 cells with anti-dMLF IgG and quantitative real-time PCR revealed that dMLF binds specifically to the bsk promoter region containing the DRE sequence. Furthermore, using a transient luciferase expression assay, we provide evidence that knockdown of dMLF reduced bsk gene promoter activity in S2 cells. Finally, we show that dMLF interacts with DREF in vivo. Altogether, these data indicate that dMLF acts with DREF to stimulate the bsk promoter and consequently activates the JNK pathway to promote apoptosis. PMID:24752236

  2. Signal propagation through feedforward neuronal networks with different operational modes

    NASA Astrophysics Data System (ADS)

    Li, Jie; Liu, Feng; Xu, Ding; Wang, Wei

    2009-02-01

    How neuronal activity is propagated across multiple layers of neurons is a fundamental issue in neuroscience. Using numerical simulations, we explored how the operational mode of neurons —coincidence detector or temporal integrator— could affect the propagation of rate signals through a 10-layer feedforward network with sparse connectivity. Our study was based on two kinds of neuron models. The Hodgkin-Huxley (HH) neuron can function as a coincidence detector, while the leaky integrate-and-fire (LIF) neuron can act as a temporal integrator. When white noise is afferent to the input layer, rate signals can be stably propagated through both networks, while neurons in deeper layers fire synchronously in the absence of background noise; but the underlying mechanism for the development of synchrony is different. When an aperiodic signal is presented, the network of HH neurons can represent the temporal structure of the signal in firing rate. Meanwhile, synchrony is well developed and is resistant to background noise. In contrast, rate signals are somewhat distorted during the propagation through the network of LIF neurons, and only weak synchrony occurs in deeper layers. That is, coincidence detectors have a performance advantage over temporal integrators in propagating rate signals. Therefore, given weak synaptic conductance and sparse connectivity between layers in both networks, synchrony does greatly subserve the propagation of rate signals with fidelity, and coincidence detection could be of considerable functional significance in cortical processing.

  3. Proceedings of the Thirteenth NASA Propagation Experimenters Meeting (NAPEX 13)

    NASA Technical Reports Server (NTRS)

    Davarian, Faramaz (Editor)

    1989-01-01

    The NASA Propagation Experimenters Meeting (NAPEX), supported by the NASA Propagation Program, is convened annually to discuss studies made on radio wave propagation by investigators from domestic and international organizations. The meeting was organized into three technical sessions: the first focused on mobile satellite propagation; the second examined the propagation effects for frequencies above 10 GHz; and the third addressed studies devoted exclusively to the Olympus/Advanced Communications Technology Satellite (ACTS) Program.

  4. Role of gastrocnemius activation in knee joint biomechanics: gastrocnemius acts as an ACL antagonist.

    PubMed

    Adouni, M; Shirazi-Adl, A; Marouane, H

    2016-01-01

    Gastrocnemius is a premier muscle crossing the knee, but its role in knee biomechanics and on the anterior cruciate ligament (ACL) remains less clear when compared to hamstrings and quadriceps. The effect of changes in gastrocnemius force at late stance when it peaks on the knee joint response and ACL force was initially investigated using a lower extremity musculoskeletal model driven by gait kinematics-kinetics. The tibiofemoral joint under isolated isometric contraction of gastrocnemius was subsequently analyzed at different force levels and flexion angles (0°-90°). Changes in gastrocnemius force at late stance markedly influenced hamstrings forces. Gastrocnemius acted as ACL antagonist by substantially increasing its force. Simulations under isolated contraction of gastrocnemius confirmed this role at all flexion angles, in particular, at extreme knee flexion angles (0° and 90°). Constraint on varus/valgus rotations substantially decreased this effect. Although hamstrings and gastrocnemius are both knee joint flexors, they play opposite roles in respectively protecting or loading ACL. Although the quadriceps is also recognized as antagonist of ACL, at larger joint flexion and in contrast to quadriceps, activity in gastrocnemius substantially increased ACL forces (anteromedial bundle). The fact that gastrocnemius is an antagonist of ACL should help in effective prevention and management of ACL injuries.

  5. Self-assembled gold nanocrystal micelles act as an excellent artificial nanozyme with ribonuclease activity.

    PubMed

    Zhang, Zhiming; Fu, Qiuan; Li, Xiangqiu; Huang, Xin; Xu, Jiayun; Shen, Jiacong; Liu, Junqiu

    2009-06-01

    Water-soluble Au nanocrystal (NC) micelles with an inserted catalytic Cu(II) center that act as excellent nanoenzyme models for imitating ribonuclease were constructed by supramolecular self-assembly. The dodecane-1-thiol-based Au NC was constructed first, and subsequently the cationic surfactant hexadecyltrimethylammonium bromide and the catalytic ligand (N1,N1-bis(2-aminoethyl)-N2-dodecylethane-1,2-diamine) copper(II) were installed on the surface of the Au NC via hydrophobic interaction. The catalytic capability of the Au NC micelles designed was estimated by the cleavage of a typical RNA analogue, 2-hydroxypropyl p-nitrophenyl phosphate (HPNP). The study of the catalytic behavior of Au NC micelle catalysis showed that the Au NC micelles exhibited dramatic ribonuclease-like activity: a high rate acceleration of k(cat)/k(uncat) = 1.10 x 10(5) for the cleavage of HPNP in comparison with the spontaneous cleavage of HPNP (k(uncat)) was observed. The catalytic capability for HPNP cleavage by these functionalized Au NC micelles can be compared with that of covalent Au nanoparticles reported previously as nanozymes under comparable conditions. A detailed investigation of enzymatic kinetics was carried out and a possible mechanism was suggested.

  6. 50 CFR 80.50 - What activities are eligible for funding under the Pittman-Robertson Wildlife Restoration Act?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 50 Wildlife and Fisheries 9 2014-10-01 2014-10-01 false What activities are eligible for funding under the Pittman-Robertson Wildlife Restoration Act? 80.50 Section 80.50 Wildlife and Fisheries UNITED...) Obtain data to guide and direct the regulation of hunting. (4) Acquire real property suitable or...

  7. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project: Final ACT configuration evaluation

    NASA Technical Reports Server (NTRS)

    1982-01-01

    The Final ACT Configuration Evaluation Task of the Integrated Application of Active Controls (IAAC) technology project within the energy efficient transport program is summarized. The Final ACT Configuration, through application of Active Controls Technology (ACT) in combination with increased wing span, exhibits significant performance improvements over the conventional baseline configuration. At the design range for these configurations, 3590 km, the block fuel used is 10% less for the Final ACT Configuration, with significant reductions in fuel usage at all operational ranges. Results of this improved fuel usage and additional system and airframe costs and the complexity required to achieve it were analyzed to determine its economic effects. For a 926 km mission, the incremental return on investment is nearly 25% at 1980 fuel prices. For longer range missions or increased fuel prices, the return is greater. The technical risks encountered in the Final ACT Configuration design and the research and development effort required to reduce these risks to levels acceptable for commercial airplane design are identified.

  8. Investigating possible influence of solar activity on some reported seismic-induced ionospheric precursors via VLF wave propagation in Earth-ionosphere waveguide

    NASA Astrophysics Data System (ADS)

    Nwankwo, Victor U. J.; Chakrabarti, Sandip Kumar; Sasmal, Sudipta; Ray, Suman

    2016-07-01

    The diurnal propagation characteristic of VLF radio signal have been widely used to study pre-seismic ionospheric anomalies, some of which are often reported to be associated with the event. On the other hand, Solar particle events and geomagnetic activity also drive changes in the magnetosphere, which modify ionospheric parameters through the Earth's magnetic field. There are also effects originating from planetary and tidal waves, thermospheric tides and stratospheric warming. Distinguishing or separating seismically induced ionospheric fluctuations from those of other origin remain vital and challenging. In this work, we investigated the influence of solar and geomagnetic origin on some reported 'seismic ionospheric precursors' before a few major earthquakes. We also investigated anomalies in VLF day-length signal during period of low solar and geomagnetic activity (in relation to seismic activity), to understand the occurrence of VLF anomaly that are unrelated to seismicity and solar activity.

  9. Comparative effects of long-acting and short-acting loop diuretics on cardiac sympathetic nerve activity in patients with chronic heart failure

    PubMed Central

    Matsuo, Yae; Kasama, Shu; Toyama, Takuji; Funada, Ryuichi; Takama, Noriaki; Koitabashi, Norimichi; Ichikawa, Shuichi; Suzuki, Yasuyuki; Matsumoto, Naoya; Sato, Yuichi; Kurabayashi, Masahiko

    2016-01-01

    Objective Short-acting loop diuretics are known to enhance cardiac sympathetic nerve activity (CSNA) in patients with chronic heart failure (CHF). The effects of two loop diuretics—long-acting azosemide and short-acting furosemide—on CSNA were evaluated using 123I-metaiodobenzylguanidine (MIBG) scintigraphy in patients with CHF. Methods The present study was a subanalysis of our previously published study, which had reported that serial 123I-MIBG studies were the most useful prognostic indicator in patients with CHF. Patients with CHF (n=208, left ventricular ejection fraction <45%) but no history of cardiac events for at least 5 months prior to the study were identified according to their histories of acute decompensated heart failure requiring hospitalisation. Patients underwent 123I-MIBG scintigraphy immediately before hospital discharge and at a 6-month follow-up. The delayed % denervation, delayed heart/mediastinum count (H/M) ratio and washout rate (WR) were determined using 123I-MIBG scintigraphy. A total of 108 patients were selected, and propensity score matching was used to compare patients treated with either oral azosemide (n=54) or furosemide (n=54). Results After treatment, 123I-MIBG scintigraphic parameters improved in both groups. However, the degree of change in % denervation was −13.8±10.5 in the azosemide group and −5.7±12.7 in the furosemide group (p<0.01), the change in H/M ratio was 0.20±0.16 in the azosemide group and 0.06±0.19 in the furosemide group (p<0.01), and the change in WR was −11.3±9.2% in the azosemide group and −3.0±12.7% in the furosemide group (p<0.01). Moreover, multivariate analysis showed an independent and significant positive relationship between furosemide and δ-WR from hospital discharge to 6 months after treatment in patients with CHF (p=0.001). Conclusions These findings indicate that azosemide suppresses CSNA compared with furosemide in patients with CHF. Trial registration number UMIN000000626

  10. Measuring Parental Support for Children’s Physical Activity in White and African American Parents: The Activity Support Scale for Multiple Groups (ACTS-MG)

    PubMed Central

    Davison, Kirsten K.; Li, Kaigang; Baskin, Monica L.; Cox, Tiffany; Affuso, Olivia

    2010-01-01

    Objectives The Activity Support Scale (ACTS) was expanded for use with African American families. Its factorial invariance and internal reliability were examined for non-Hispanic white and African American parents. Methods The ACTS was modified to improve its applicability to African American families based on information from five focus groups with 27 African American parents of elementary school-aged children. Between 2006 and 2008, the revised scale was administered to 119 African American and 117 non-Hispanic white parents in northeastern NY and Alabama. Its factorial invariance across race/ethnicity and internal consistency were examined. Results Factor analysis of the revised scale, the Activity Support Scale for Multiple Groups (ACTS-MG), identified four parenting factors in white and African American parents including logistic support, modeling, use of community resources to promote physical activity (PA), and restriction of sedentary behaviors. Results supported the scale’s internal reliability and factorial invariance across race/ethnicity. Conclusion The ACTS-MG is appropriate for use with non-Hispanic white and African American families and will enable the extension of current research with white families to the examination of strategies supporting PA in African American families. Additional psychometric work with the ACTS-MG is encouraged. PMID:21111755

  11. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project: Test act system validation

    NASA Technical Reports Server (NTRS)

    1985-01-01

    The primary objective of the Test Active Control Technology (ACT) System laboratory tests was to verify and validate the system concept, hardware, and software. The initial lab tests were open loop hardware tests of the Test ACT System as designed and built. During the course of the testing, minor problems were uncovered and corrected. Major software tests were run. The initial software testing was also open loop. These tests examined pitch control laws, wing load alleviation, signal selection/fault detection (SSFD), and output management. The Test ACT System was modified to interface with the direct drive valve (DDV) modules. The initial testing identified problem areas with DDV nonlinearities, valve friction induced limit cycling, DDV control loop instability, and channel command mismatch. The other DDV issue investigated was the ability to detect and isolate failures. Some simple schemes for failure detection were tested but were not completely satisfactory. The Test ACT System architecture continues to appear promising for ACT/FBW applications in systems that must be immune to worst case generic digital faults, and be able to tolerate two sequential nongeneric faults with no reduction in performance. The challenge in such an implementation would be to keep the analog element sufficiently simple to achieve the necessary reliability.

  12. Retroelements: propagation and adaptation.

    PubMed

    Hull, R; Covey, S N

    1995-01-01

    Retroelements are genetic entities that exist in both DNA and RNA forms generated by cyclic alternation of transcription and reverse transcription. They have in common a genetic core (the gag-pol core), encoding conserved functions of a structural protein and a replicase. These are supplemented with a variety of cis-acting nucleic acid sequences controlling transcription and reverse transcription. Most retroelements have additional genes with regulatory or adaptive roles, both within the cell and for movement between cells and organisms. These features reflect the variety of mechanisms that have developed to ensure propagation of the elements and their ability to adapt to specific niches in their hosts with which they co-evolve.

  13. 29 CFR 779.110 - Employees in retailing whose activities may bring them under the Act.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... retail or service field whose individual activities constitute engagement in interstate or foreign... individual activities ordinarily constitute engagement in commerce or in the production of goods for...

  14. Annual Report to the President and the Congress on Federal Activities Related to the Administration of the Rehabilitation Act of 1973, as Amended. Fiscal Year 1981. Executive Summary.

    ERIC Educational Resources Information Center

    Rehabilitation Services Administration (ED), Washington, DC.

    The fiscal year 1981 annual report of the Rehabilitation Services Administration's activities under the Rehabilitation Act of 1973, as amended, is presented; program operations, program development activities, functions of the National Institute of Handicapped Research, and other provisions of the Act, are described. Program operations include:…

  15. The Activity Support Scale for Multiple Groups (ACTS-MG): Child-reported Physical Activity Parenting in African American and Non-Hispanic White Families.

    PubMed

    Lampard, Amy M; Nishi, Akihiro; Baskin, Monica L; Carson, Tiffany L; Davison, Kirsten K

    2016-01-01

    This study aimed to assess the psychometric properties of a child-report, multidimensional measure of physical activity (PA) parenting, the Activity Support Scale for Multiple Groups (ACTS-MG), in African American and non-Hispanic white families. The ACTS-MG was administered to children aged 5 to 12 years. A three factor model of PA parenting (Modeling of PA, Logistic Support, and Restricting Access to Screen-based Activities) was tested separately for mother's and fathers' PA parenting. The proposed three-factor structure was supported in both racial groups for mothers' PA parenting and in the African American sample for fathers' PA parenting. Factorial invariance between racial groups was demonstrated for mother's PA parenting. Building on a previous study examining the ACTS-MG parent-report, this study supports the use of the ACTS-MG child-report for mothers' PA parenting. However, further research is required to investigate the measurement of fathers' PA parenting across racial groups.

  16. Olympus propagation experiments

    NASA Technical Reports Server (NTRS)

    Arbesser-Rastburg, Bertram

    1994-01-01

    A summary of the activities of the OPEX (Olympus Propagation EXperimenters) group is given and some of the recent findings are presented. OLYMPUS, a telecommunication satellite owned by the European Space Agency, was launched on 12 June 1989. After the in-orbit tests were completed (in September 1989) the first propagation experiments started. Throughout 1990 the spacecraft functioned very well and a large number of experimenters received the beacon signals. On 29 May 1991 the spacecraft became inoperational after a major technical problem. With a series of complicated procedures OLYMPUS was recovered on 15 August 1991 - the first time in history that a civilian telecommunications satellite was brought back to service after losing power and telemetry. The propagation experiments were back on track. However, the recovery had used up so much fuel that the North-South station keeping had to be abandoned, which led to a natural increase of inclination at a rate of about 0.8 deg per year. On 10 October 1992 the second 30 GHz beacon tube failed, causing a loss of this beacon signal. The other two beacon frequencies continued to deliver a stable signal for more than two years. On 12 August 1993 the spacecraft experienced another problem with the altitude control, but this time there was not enough fuel left for a recovery maneuver and thus the mission came to an end.

  17. Integrated application of active controls (IAAC) technology to an advanced subsonic transport project. Initial ACT configuration design study

    NASA Technical Reports Server (NTRS)

    1980-01-01

    The initial ACT configuration design task of the integrated application of active controls (IAAC) technology project within the Energy Efficient Transport Program is summarized. A constrained application of active controls technology (ACT) resulted in significant improvements over a conventional baseline configuration previously established. The configuration uses the same levels of technology, takeoff gross weight, payload, and design requirements/objectives as the baseline, except for flying qualities, flutter, and ACT. The baseline wing is moved forward 1.68 m. The configuration incorporates pitch-augmented stability (which enabled an approximately 10% aft shift in cruise center of gravity and a 45% reduction in horizontal tail size), lateral/directional-augmented stability, an angle of attack limiter, wing load alleviation, and flutter mode control. This resulted in a 930 kg reduction in airplane operating empty weight and a 3.6% improvement in cruise efficiency, yielding a 13% range increase. Adjusted to the 3590 km baseline mission range, this amounts to 6% block fuel reduction and a 15.7% higher incremental return on investment, using 1978 dollars and fuel cost.

  18. Photoelectron circular dichroism in the multiphoton ionization by short laser pulses. I. Propagation of single-active-electron wave packets in chiral pseudo-potentials

    SciTech Connect

    Artemyev, Anton N.; Müller, Anne D.; Demekhin, Philipp V.; Hochstuhl, David

    2015-06-28

    A theoretical method to study the angle-resolved multiphoton ionization of polyatomic molecules is developed. It is based on the time-dependent formulation of the Single Center (TDSC) method and consists in the propagation of single-active-electron wave packets in the effective molecular potentials in the presence of intense laser pulses. For this purpose, the time-dependent Schrödinger equation for one electron, moving in a molecular field and interacting with an arbitrary laser pulse, is solved in spherical coordinates by an efficient numerical approach. As a test, the method is applied to the one- and two-photon ionizations of a model methane-like chiral system by circularly polarized short intense high-frequency laser pulses. Thereby, we analyze the photoelectron circular dichroism (PECD) in the momentum distribution. The considered model application illustrates the capability of the TDSC method to study multiphoton PECD in fixed-in-space and randomly oriented chiral molecules.

  19. Photoelectron circular dichroism in the multiphoton ionization by short laser pulses. I. Propagation of single-active-electron wave packets in chiral pseudo-potentials

    NASA Astrophysics Data System (ADS)

    Artemyev, Anton N.; Müller, Anne D.; Hochstuhl, David; Demekhin, Philipp V.

    2015-06-01

    A theoretical method to study the angle-resolved multiphoton ionization of polyatomic molecules is developed. It is based on the time-dependent formulation of the Single Center (TDSC) method and consists in the propagation of single-active-electron wave packets in the effective molecular potentials in the presence of intense laser pulses. For this purpose, the time-dependent Schrödinger equation for one electron, moving in a molecular field and interacting with an arbitrary laser pulse, is solved in spherical coordinates by an efficient numerical approach. As a test, the method is applied to the one- and two-photon ionizations of a model methane-like chiral system by circularly polarized short intense high-frequency laser pulses. Thereby, we analyze the photoelectron circular dichroism (PECD) in the momentum distribution. The considered model application illustrates the capability of the TDSC method to study multiphoton PECD in fixed-in-space and randomly oriented chiral molecules.

  20. Human herpesvirus 6A (HHV-6A) exhibits restrictive propagation with limited activation of PKR-eIF2α stress pathway.

    PubMed

    Sharon, Eyal; Frenkel, Niza

    2017-02-15

    The eIF2α protein plays a critical role in the regulation of translation. The production of dsRNA during viral replication can activate protein kinase R (PKR) which phosphorylates the eIF2α, leading to inhibition of the initial step of translation. Many viruses have evolved gene products targeting PKR-eIF2a pathway, indicating its importance in antiviral defense. In the present study we focus on alternations of PKR-eIF2a pathway along HHV-6A infection while monitoring viral gene expression and infectious viral yields. We have found increased phosphorylated PKR as well as phosphorylated eIF2α coincidental with accumulation of the late gp82-105 viral protein. The level of total PKR was relatively constant, but it decreased by 144 hours post infection. The phosphorylation of eIF2a led to a moderate increase in ATF4 accumulation, indicating moderate inhibition of protein translation during HHV-6A infection. The overexpression of PKR led to decreased viral propagation coincidental with increased accumulation of phosphorylated PKR and phosphorylated eIF2a. Moreover, addition of dominant-negative PKR mutant resulted in a moderate increase in viral replication. HHV-6A exhibits relatively low propagation efficiency of progeny virus secreted into the culture media. This study suggests that the replicative strategy of HHV-6A involves a mild infection over lengthy life cycle in culture, while preventing severe activation of the PKR-eIF2α pathway.IMPORTANCE Human herpesvirus 6A (HHV-6A) and HHV-6B are common, wildly prevalent viruses, causing from mild to severe disease. Our study focuses on the PKR-eIF2α stress pathway that limits viral replication. The HHV-6 genome encodes multiple genes transcribed from the two strands predicting accumulation of dsRNAs which can activates PKR and inhibition of protein synthesis. We report that HHV-6A induced the accumulation of phosphorylated PKR, phosphorylated eIF2α and a moderate increase of the activating transcription factor 4

  1. Application of the French Space Operation Act and the Development of Space Activities in the Field of Launchers

    NASA Astrophysics Data System (ADS)

    Cahuzac, F.; Biard, A.

    2012-01-01

    The development of space activities has led France to define a new legal framework: French Space Operation Act (FSOA). The aim of this act, is to define the conditions according to which the French government authorizes and checks the spatial operations under its jurisdiction or its international responsibility as State of launch, according to the international treaties of the UN on space, in particular the Treaty (1967) on Principles Governing the Activities of States in the Exploration and Use of Outer Space, the Convention ( 1972 ) on International Liability for Damage Caused by Space Objects, and the Convention (1975) on Registration of Objects Launched into Outer Space. The main European space centre is the Guiana Space Centre (CSG), settled in France. A clarification of the French legal framework was compulsory to allow the arrival of new launchers (Soyuz and Vega). This act defines the competent authority, the procedure of authorization and licenses, the regime for operations led from foreign countries, the control of spatial objects, the enabling of inspectors, the delegation of monitoring to CNES, the procedure for urgent measures necessary for the safety, the registration of spatial objects. In this framework, the operator is fully responsible of the operation that he leads. He is subjected to a regime of authorization and to governmental technical monitoring delegated to CNES. In case of litigation, the operator gets the State guarantee above a certain level of damage to third party. The introduction of FSOA has led to issue a Technical Regulation set forth, in particular for the safety of persons and property, the protection of public health and the environment. This general regulation is completed by a specific regulation applicable to CSG that covers the preparation phase of the launch, and all specificities of the launch range, as regards the beginning of the launch. The Technical Regulation is based on 30 years of Ariane's activities and on the

  2. Annual Report to the President and to the Congress on Federal Activities Related to the Rehabilitation Act of 1973, as Amended. Fiscal Year 1995.

    ERIC Educational Resources Information Center

    Rehabilitation Services Administration (ED), Washington, DC.

    This report documents activities and accomplishments of the Rehabilitation Services Administration and the National Institute on Disability and Rehabilitation Research during fiscal year 1995 as mandated under the Rehabilitation Act of 1973. An executive summary briefly describes the programs authorized under the Act and highlights major…

  3. Acoustic phonon propagation in ultra-thin Si membranes under biaxial stress field

    NASA Astrophysics Data System (ADS)

    Graczykowski, B.; Gomis-Bresco, J.; Alzina, F.; Reparaz, J. S.; Shchepetov, A.; Prunnila, M.; Ahopelto, J.; Sotomayor Torres, C. M.

    2014-07-01

    We report on stress induced changes in the dispersion relations of acoustic phonons propagating in 27 nm thick single crystalline Si membranes. The static tensile stress (up to 0.3 GPa) acting on the Si membranes was achieved using an additional strain compensating silicon nitride frame. Dispersion relations of thermally activated hypersonic phonons were measured by means of Brillouin light scattering spectroscopy. The theory of Lamb wave propagation is developed for anisotropic materials subjected to an external static stress field. The dispersion relations were calculated using the elastic continuum approximation and taking into account the acousto-elastic effect. We find an excellent agreement between the theoretical and the experimental dispersion relations.

  4. VAV-1 acts in a single interneuron to inhibit motor circuit activity in Caenorhabditis elegans.

    PubMed

    Fry, Amanda L; Laboy, Jocelyn T; Norman, Kenneth R

    2014-11-21

    The complex molecular and cellular mechanisms underlying neuronal control of animal movement are not well understood. Locomotion of Caenorhabditis elegans is mediated by a neuronal circuit that produces coordinated sinusoidal movement. Here we utilize this simple, yet elegant, behaviour to show that VAV-1, a conserved guanine nucleotide exchange factor for Rho-family GTPases, negatively regulates motor circuit activity and the rate of locomotion. While vav-1 is expressed in a small subset of neurons, we find that VAV-1 function is required in a single interneuron, ALA, to regulate motor neuron circuit activity. Furthermore, we show by genetic and optogenetic manipulation of ALA that VAV-1 is required for the excitation and activation of this neuron. We find that ALA signalling inhibits command interneuron activity by abrogating excitatory signalling in the command interneurons, which is responsible for promoting motor neuron circuit activity. Together, our data describe a novel neuromodulatory role for VAV-1-dependent signalling in the regulation of motor circuit activity and locomotion.

  5. PP2A and GSK-3beta act antagonistically to regulate active zone development.

    PubMed

    Viquez, Natasha M; Füger, Petra; Valakh, Vera; Daniels, Richard W; Rasse, Tobias M; DiAntonio, Aaron

    2009-09-16

    The synapse is composed of an active zone apposed to a postsynaptic cluster of neurotransmitter receptors. Each Drosophila neuromuscular junction comprises hundreds of such individual release sites apposed to clusters of glutamate receptors. Here, we show that protein phosphatase 2A (PP2A) is required for the development of structurally normal active zones opposite glutamate receptors. When PP2A is inhibited presynaptically, many glutamate receptor clusters are unapposed to Bruchpilot (Brp), an active zone protein required for normal transmitter release. These unapposed receptors are not due to presynaptic retraction of synaptic boutons, since other presynaptic components are still apposed to the entire postsynaptic specialization. Instead, these data suggest that Brp localization is regulated at the level of individual release sites. Live imaging of glutamate receptors demonstrates that this disruption to active zone development is accompanied by abnormal postsynaptic development, with decreased formation of glutamate receptor clusters. Remarkably, inhibition of the serine-threonine kinase GSK-3beta completely suppresses the active zone defect, as well as other synaptic morphology phenotypes associated with inhibition of PP2A. These data suggest that PP2A and GSK-3beta function antagonistically to control active zone development, providing a potential mechanism for regulating synaptic efficacy at a single release site.

  6. Nonlinear biochemical signal processing via noise propagation

    NASA Astrophysics Data System (ADS)

    Kim, Kyung Hyuk; Qian, Hong; Sauro, Herbert M.

    2013-10-01

    Single-cell studies often show significant phenotypic variability due to the stochastic nature of intra-cellular biochemical reactions. When the numbers of molecules, e.g., transcription factors and regulatory enzymes, are in low abundance, fluctuations in biochemical activities become significant and such "noise" can propagate through regulatory cascades in terms of biochemical reaction networks. Here we develop an intuitive, yet fully quantitative method for analyzing how noise affects cellular phenotypes based on identifying a system's nonlinearities and noise propagations. We observe that such noise can simultaneously enhance sensitivities in one behavioral region while reducing sensitivities in another. Employing this novel phenomenon we designed three biochemical signal processing modules: (a) A gene regulatory network that acts as a concentration detector with both enhanced amplitude and sensitivity. (b) A non-cooperative positive feedback system, with a graded dose-response in the deterministic case, that serves as a bistable switch due to noise-induced ultra-sensitivity. (c) A noise-induced linear amplifier for gene regulation that requires no feedback. The methods developed in the present work allow one to understand and engineer nonlinear biochemical signal processors based on fluctuation-induced phenotypes.

  7. Long-acting neuroleptics used in wildlife management do not impair thermoregulation or physical activity in goats (Capra hircus).

    PubMed

    Fick, Linda; Mitchell, Duncan; Fuller, Andrea

    2007-06-01

    Long-acting neuroleptics commonly are used in wildlife management to decrease stress-related mortality in wild animals, but with possible effects on thermoregulation, which may contribute to residual morbidity and mortality. We investigated the effects of haloperidol (0.01, 0.1, 1 mg kg(-1), n=4), zuclopenthixol (0.1, 1, 10 mg kg(-1), n=4) and perphenazine (0.1, 1, 10 mg kg(-1), n=8), as well as control injections of sunflower oil, on body temperature and physical activity of laboratory goats under hot, cold and thermoneutral ambient temperatures. Implanted data loggers continuously recorded abdominal temperature, and data loggers attached externally on the foreleg recorded movement of unrestrained goats, in a climatic chamber at 35 degrees C, 10 degrees C and 22 degrees C. Cycling ambient temperature between 35 degrees C in daytime and 10 degrees C at night time caused a significant increase in amplitude of the circadian rhythm of body temperature in goats given sunflower oil (P=0.0012, unpaired t-test, n=8), but the administration of zuclopenthixol or perphenazine did not affect this change in amplitude (P>0.05, two-way ANOVA, n=4). Mean daily body temperature after administration of zuclopenthixol or perphenazine, and mean daily activity after zuclopenthixol administration, were not significantly different to those after control injections, at any ambient temperature, for the expected duration of drug activity (all P>0.05, two-way ANOVA, n=4). Thermal response indices, and mean activity, during heat, cold or thermoneutral exposure, of goats for 7 h after haloperidol injection, were not significantly different, at any dose or any ambient temperature, to those following control injections (all P>0.05, repeated measures ANOVA, n=4). Long-acting neuroleptics did not impair activity or thermoregulation of goats subjected to inescapable thermal challenges.

  8. GATA1 Activity Governed by Configurations of cis-Acting Elements.

    PubMed

    Hasegawa, Atsushi; Shimizu, Ritsuko

    2016-01-01

    The transcription factor GATA1 regulates the expression of essential erythroid and megakaryocytic differentiation genes through binding to the DNA consensus sequence WGATAR. The GATA1 protein has four functional domains, including two centrally located zinc-finger domains and two transactivation domains at the N- and C-termini. These functional domains play characteristic roles in the elaborate regulation of diversified GATA1 target genes, each of which exhibits a unique expression profile. Three types of GATA1-related hematological malignancies have been reported. One is a structural mutation in the GATA1 gene, resulting in the production of a short form of GATA1 that lacks the N-terminal transactivation domain and is found in Down syndrome-related acute megakaryocytic leukemia. The other two are cis-acting regulatory mutations affecting expression of the Gata1 gene, which have been shown to cause acute erythroblastic leukemia and myelofibrosis in mice. Therefore, imbalanced gene regulation caused by qualitative and quantitative changes in GATA1 is thought to be involved in specific hematological disease pathogenesis. In the present review, we discuss recent advances in understanding the mechanisms of differential transcriptional regulation by GATA1 during erythroid differentiation, with special reference to the binding kinetics of GATA1 at conformation-specific binding sites.

  9. GATA1 Activity Governed by Configurations of cis-Acting Elements

    PubMed Central

    Hasegawa, Atsushi; Shimizu, Ritsuko

    2017-01-01

    The transcription factor GATA1 regulates the expression of essential erythroid and megakaryocytic differentiation genes through binding to the DNA consensus sequence WGATAR. The GATA1 protein has four functional domains, including two centrally located zinc-finger domains and two transactivation domains at the N- and C-termini. These functional domains play characteristic roles in the elaborate regulation of diversified GATA1 target genes, each of which exhibits a unique expression profile. Three types of GATA1-related hematological malignancies have been reported. One is a structural mutation in the GATA1 gene, resulting in the production of a short form of GATA1 that lacks the N-terminal transactivation domain and is found in Down syndrome-related acute megakaryocytic leukemia. The other two are cis-acting regulatory mutations affecting expression of the Gata1 gene, which have been shown to cause acute erythroblastic leukemia and myelofibrosis in mice. Therefore, imbalanced gene regulation caused by qualitative and quantitative changes in GATA1 is thought to be involved in specific hematological disease pathogenesis. In the present review, we discuss recent advances in understanding the mechanisms of differential transcriptional regulation by GATA1 during erythroid differentiation, with special reference to the binding kinetics of GATA1 at conformation-specific binding sites. PMID:28119852

  10. Balancing act: approaches to healthy eating and physical activity among Boston public housing residents.

    PubMed

    Scammell, Madeleine Kangsen; Torres, Shioban; Wayman, Julie; Greenwood, Nechama; Thomas, Gerry; Kozlowski, Lauren; Bowen, Deborah

    2015-01-01

    Boston public housing residents are more likely to report fair or poor health status, been diagnosed with obesity, and to be physically inactive compared with other Boston residents (Digenis-Bury, Brooks, Chen, Ostrem, & Horsburgh, 2008 ). Little is known about perceptions of and opportunities for healthy eating and physical activity in this population. We conducted eight focus groups at public housing developments to explore residents' views regarding opportunities and barriers to healthy eating and physical activity. Sixty-seven English- and Spanish-speaking residents participated. Transcripts were analyzed using qualitative content analysis. All residents described the challenge of balancing considerations of food quality, access, and affordability. Other findings included underutilized nutritional resources; abundant availability of unhealthy food; and economic and structural barriers to exercise. Transportation-related challenges were a dominant theme. Building opportunities for physical activity and providing access to affordable and quality food choices may be important interventions for promoting health among public housing residents.

  11. Electro-Optic Propagation

    DTIC Science & Technology

    2003-09-30

    Electro - Optic Propagation Stephen Doss-Hammel SPAWARSYSCEN San Diego code 2858 49170 Propagation Path San Diego, CA 92152-7385 phone: (619...scenarios to extend the capabilities of TAWS to surface and low altitude situations. OBJECTIVES The electro - optical propagation objectives are: 1...development of a new propagation assessment tool called EOSTAR ( Electro - Optical Signal Transmission and Ranging). The goal of the EOSTAR project is to

  12. Two different factors act separately or together to specify functionally distinct activities at a single transcriptional enhancer.

    PubMed Central

    DeFranco, D; Yamamoto, K R

    1986-01-01

    The expression of genes fused downstream of the Moloney murine sarcoma virus (MoMSV) long terminal repeat is stimulated by glucocorticoids. We mapped the glucocorticoid response element that conferred this hormonal regulation and found that it is a hormone-dependent transcriptional enhancer, designated Sg; it resides within DNA fragments that also carry a previously described enhancer element (B. Levinson, G. Khoury, G. Vande Woude, and P. Gruss, Nature [London] 295:568-572, 1982), here termed Sa, whose activity is independent of the hormone. Nuclease footprinting revealed that purified glucocorticoid receptor bound at multiple discrete sites within and at the borders of the tandemly repeated sequence motif that defines Sa. The Sa and Sg activities stimulated the apparent efficiency of cognate or heterologous promoter utilization, individually providing modest enhancement and in concert yielding higher levels of activity. A deletion mutant lacking most of the tandem repeat but retaining a single receptor footprint sequence lost Sa activity but still conferred Sg activity. The two enhancer components could also be distinguished physiologically: both were operative within cultured rat fibroblasts, but only Sg activity was detectable in rat exocrine pancreas cells. Therefore, the sequence determinants of Sa and Sg activity may be interdigitated, and when both components are active, the receptor and a putative Sa factor can apparently bind and act simultaneously. We concluded that MoMSV enhancer activity is effected by at least two distinct binding factors, suggesting that combinatorial regulation of promoter function can be mediated even from a single genetic element. Images PMID:3023887

  13. LIME acts as a transmembrane adapter mediating BCR-dependent B-cell activation.

    PubMed

    Ahn, Eunseon; Lee, Hyunsook; Yun, Yungdae

    2006-02-15

    Assembly of a signaling complex around the transmembrane adapter LAT is essential for the transmission of T-cell receptor (TCR)-mediated signaling. However, a LAT-like molecule responsible for the initial activation events in B-cell receptor (BCR) signaling has not yet been identified. Here, we show that LIME is a transmembrane adaptor required for BCR-mediated B-cell activation. LIME was found to be expressed in mouse splenic B cells. Upon BCR cross-linking, LIME was tyrosine phosphorylated by Lyn and associated with Lyn, Grb2, PLC-gamma2, and PI3K. Reduction of LIME expression by the introduction of siRNA resulted in the disruption of BCR-mediated activation of MAPK, calcium flux, NF-AT, PI3K, and NF-kappaB. Taken together, these results establish that LIME is an essential transmembrane adaptor linking BCR ligation to the downstream signaling events that lead to B-cell activation.

  14. 77 FR 35323 - National Environmental Policy Act: Categorical Exclusions for Soil and Water Restoration Activities

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-13

    ... scientific analyses, research papers, and monitoring reports about activities identified under these... property. Civil Justice Reform The Agency has reviewed this proposed rule under Executive Order 12988 of February 7, 1996, ``Civil Justice Reform.'' After adoption of this proposed rule, (1) all state and...

  15. 78 FR 25477 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; Trade Act...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-01

    ... management information to the Congress and other Federal agencies, and to improve the effectiveness of job... technological collection techniques or other forms of information technology, e.g., permitting electronic... of the Secretary Agency Information Collection Activities; Submission for OMB Review; Comment...

  16. Dynamic Neurovascular Coupling and Uncoupling during Ictal Onset, Propagation, and Termination Revealed by Simultaneous In Vivo Optical Imaging of Neural Activity and Local Blood Volume

    PubMed Central

    Zhao, Mingrui; Schwartz, Theodore H.

    2013-01-01

    Traditional models of ictal propagation involve the concept of an initiation site and a progressive outward march of activation. The process of neurovascular coupling, whereby the brain supplies oxygenated blood to metabolically active neurons presumably results in a similar outward cascade of hyperemia. However, ictal neurovascular coupling has never been assessed in vivo using simultaneous measurements of membrane potential change and hyperemia with wide spatial sampling. In an acute rat ictal model, using simultaneous intrinsic optical signal (IOS) and voltage-sensitive dye (VSD) imaging of cerebral blood volume and membrane potential changes, we demonstrate that seizures consist of multiple dynamic multidirectional waves of membrane potential change with variable onset sites that spread through a widespread network. Local blood volume evolves on a much slower spatiotemporal scale. At seizure onset, the VSD waves extend beyond the IOS signal. During evolution, spatial correlation with hemodynamic signal only exists briefly at the maximal spread of the VSD signal. At termination, the IOS signal extends spatially and temporally beyond the VSD waves. Hence, vascular reactivity evolves in a separate but parallel fashion to membrane potential changes resulting in a mechanism of neurovascular coupling and uncoupling, which is as dynamic as the seizure itself. PMID:22499798

  17. Protein disulfide isomerase acts as an injury response signal that enhances fibrin generation via tissue factor activation

    PubMed Central

    Reinhardt, Christoph; von Brühl, Marie-Luise; Manukyan, Davit; Grahl, Lenka; Lorenz, Michael; Altmann, Berid; Dlugai, Silke; Hess, Sonja; Konrad, Ildiko; Orschiedt, Lena; Mackman, Nigel; Ruddock, Lloyd; Massberg, Steffen; Engelmann, Bernd

    2008-01-01

    The activation of initiator protein tissue factor (TF) is likely to be a crucial step in the blood coagulation process, which leads to fibrin formation. The stimuli responsible for inducing TF activation are largely undefined. Here we show that the oxidoreductase protein disulfide isomerase (PDI) directly promotes TF-dependent fibrin production during thrombus formation in vivo. After endothelial denudation of mouse carotid arteries, PDI was released at the injury site from adherent platelets and disrupted vessel wall cells. Inhibition of PDI decreased TF-triggered fibrin formation in different in vivo murine models of thrombus formation, as determined by intravital fluorescence microscopy. PDI infusion increased — and, under conditions of decreased platelet adhesion, PDI inhibition reduced — fibrin generation at the injury site, indicating that PDI can directly initiate blood coagulation. In vitro, human platelet–secreted PDI contributed to the activation of cryptic TF on microvesicles (microparticles). Mass spectrometry analyses indicated that part of the extracellular cysteine 209 of TF was constitutively glutathionylated. Mixed disulfide formation contributed to maintaining TF in a state of low functionality. We propose that reduced PDI activates TF by isomerization of a mixed disulfide and a free thiol to an intramolecular disulfide. Our findings suggest that disulfide isomerases can act as injury response signals that trigger the activation of fibrin formation following vessel injury. PMID:18274674

  18. The calcium-activated chloride channel anoctamin 1 acts as a heat sensor in nociceptive neurons.

    PubMed

    Cho, Hawon; Yang, Young Duk; Lee, Jesun; Lee, Byeongjoon; Kim, Tahnbee; Jang, Yongwoo; Back, Seung Keun; Na, Heung Sik; Harfe, Brian D; Wang, Fan; Raouf, Ramin; Wood, John N; Oh, Uhtaek

    2012-05-27

    Nociceptors are a subset of small primary afferent neurons that respond to noxious chemical, thermal and mechanical stimuli. Ion channels in nociceptors respond differently to noxious stimuli and generate electrical signals in different ways. Anoctamin 1 (ANO1 also known as TMEM16A) is a Ca(2+)-activated chloride channel that is essential for numerous physiological functions. We found that ANO1 was activated by temperatures over 44 °C with steep heat sensitivity. ANO1 was expressed in small sensory neurons and was highly colocalized with nociceptor markers, which suggests that it may be involved in nociception. Application of heat ramps to dorsal root ganglion (DRG) neurons elicited robust ANO1-dependent depolarization. Furthermore, knockdown or deletion of ANO1 in DRG neurons substantially reduced nociceptive behavior in thermal pain models. These results indicate that ANO1 is a heat sensor that detects nociceptive thermal stimuli in sensory neurons and possibly mediates nociception.

  19. Monitoring the onset, propagation, associated bedform migration, and wake of active turbidity currents on the Squamish prodelta slope

    NASA Astrophysics Data System (ADS)

    Hughes Clarke, J. E.; Pratomo, D. G.; Videira Marques, C. R.

    2012-12-01

    . Multibeam water column imagery is used to view the onset, development and decay of turbidity currents in channels on the Squamish prodelta slope. The 2011 program consisted of daily resurveys for a period of 120 days during the freshet period. The initial focus was on resolving bathymetric surface change. Typical morphologic change indicated intermittent upslope migration of in-channel bedforms, sometimes, but not always, associated with an upper slope discrete slide scar. As a serendipitous byproduct, it was found that the deep scattering layer in the fjord was occasionally perturbed by what appeared to be bottom-following intrusive flows. A distally-located, seabed-mounted ADCP confirmed 20 discrete turbidity current events. Surface lowered, optical backscatter profiles indicated that these intrusions were correlated with near-seabed turbidity peaks. In 2012, a week-long program was implemented using hourly resurveys of the channels around the low water spring tide periods. Repetitive underway optical backscatter and CTD profiles were collected extending along the active channels from the delta lip to 1000m offshore. These established the sediment load and relative buoyancy of the surface plume and the fact that the enhanced acoustic volume scattering below represented a descending rain of suspended sediments into the higher density saline lower layers. For several of the events, that descending plume was seen to markedly increase in turbidity close to the seabed, indicating a transition to hyperpycnal conditions. A drop of salinity was also associated with those near seabed high turbidity layers. Those events were followed by the onset of a turbidity current as interpreted from the acoustic volume scattering. The period of upslope bedform migration was restricted to the onset of basal turbidity and first appearance of the flow in the acoustic volume scattering. In the wake of the active flow, an anomalously low acoustic scattering cloud would appear above the

  20. DJ-1 Is a Copper Chaperone Acting on SOD1 Activation*

    PubMed Central

    Girotto, Stefania; Cendron, Laura; Bisaglia, Marco; Tessari, Isabella; Mammi, Stefano; Zanotti, Giuseppe; Bubacco, Luigi

    2014-01-01

    Lack of oxidative stress control is a common and often prime feature observed in many neurodegenerative diseases. Both DJ-1 and SOD1, proteins involved in familial Parkinson disease and amyotrophic lateral sclerosis, respectively, play a protective role against oxidative stress. Impaired activity and modified expression of both proteins have been observed in different neurodegenerative diseases. A potential cooperative action of DJ-1 and SOD1 in the same oxidative stress response pathway may be suggested based on a copper-mediated interaction between the two proteins reported here. To investigate the mechanisms underlying the antioxidative function of DJ-1 in relation to SOD1 activity, we investigated the ability of DJ-1 to bind copper ions. We structurally characterized a novel copper binding site involving Cys-106, and we investigated, using different techniques, the kinetics of DJ-1 binding to copper ions. The copper transfer between the two proteins was also examined using both fluorescence spectroscopy and specific biochemical assays for SOD1 activity. The structural and functional analysis of the novel DJ-1 copper binding site led us to identify a putative role for DJ-1 as a copper chaperone. Alteration of the coordination geometry of the copper ion in DJ-1 may be correlated to the physiological role of the protein, to a potential failure in metal transfer to SOD1, and to successive implications in neurodegenerative etiopathogenesis. PMID:24567322

  1. Electronically Integrated Active Compliant Transmission (ACT) Actuation Technologies Proof-of-Concept Investigation of Active Velcro for Smart Attachment Mechanisms

    DTIC Science & Technology

    2006-05-31

    down and be in the center position when off, the current amplification systems that exploit very high energy density materials (such as EC98 by EDO ...project was the synergistic development of complete piezoelectric actuation systems with integrated electronic drivers, material transduction and Active...4 1.2.1. INSTAR System Description

  2. Cytokinins act synergistically with salicylic acid to activate defense gene expression in rice.

    PubMed

    Jiang, Chang-Jie; Shimono, Masaki; Sugano, Shoji; Kojima, Mikiko; Liu, Xinqiong; Inoue, Haruhiko; Sakakibara, Hitoshi; Takatsuji, Hiroshi

    2013-03-01

    Hormone crosstalk is pivotal in plant-pathogen interactions. Here, we report on the accumulation of cytokinins (CK) in rice seedlings after infection of blast fungus Magnaporthe oryzae and its potential significance in rice-M. oryzae interaction. Blast infection to rice seedlings increased levels of N(6)-(Δ(2)-isopentenyl) adenine (iP), iP riboside (iPR), and iPR 5'-phosphates (iPRP) in leaf blades. Consistent with this, CK signaling was activated around the infection sites, as shown by histochemical staining for β-glucuronidase activity driven by a CK-responsive OsRR6 promoter. Diverse CK species were also detected in the hyphae (mycelium), conidia, and culture filtrates of blast fungus, indicating that M. oryzae is capable of production as well as hyphal secretion of CK. Co-treatment of leaf blades with CK and salicylic acid (SA), but not with either one alone, markedly induced pathogenesis-related genes OsPR1b and probenazole-induced protein 1 (PBZ1). These effects were diminished by RNAi-knockdown of OsNPR1 or WRKY45, the key regulators of the SA signaling pathway in rice, indicating that the effects of CK depend on these two regulators. Taken together, our data imply a coevolutionary rice-M. oryzae interaction, wherein M. oryzae probably elevates rice CK levels for its own benefits such as nutrient translocation. Rice plants, on the other hand, sense it as an infection signal and activate defense reactions through the synergistic action with SA.

  3. Phosphorylation acts positively and negatively to regulate MRTF-A subcellular localisation and activity

    PubMed Central

    Panayiotou, Richard; Miralles, Francesc; Pawlowski, Rafal; Diring, Jessica; Flynn, Helen R; Skehel, Mark; Treisman, Richard

    2016-01-01

    The myocardin-related transcription factors (MRTF-A and MRTF-B) regulate cytoskeletal genes through their partner transcription factor SRF. The MRTFs bind G-actin, and signal-regulated changes in cellular G-actin concentration control their nuclear accumulation. The MRTFs also undergo Rho- and ERK-dependent phosphorylation, but the function of MRTF phosphorylation, and the elements and signals involved in MRTF-A nuclear export are largely unexplored. We show that Rho-dependent MRTF-A phosphorylation reflects relief from an inhibitory function of nuclear actin. We map multiple sites of serum-induced phosphorylation, most of which are S/T-P motifs and show that S/T-P phosphorylation is required for transcriptional activation. ERK-mediated S98 phosphorylation inhibits assembly of G-actin complexes on the MRTF-A regulatory RPEL domain, promoting nuclear import. In contrast, S33 phosphorylation potentiates the activity of an autonomous Crm1-dependent N-terminal NES, which cooperates with five other NES elements to exclude MRTF-A from the nucleus. Phosphorylation thus plays positive and negative roles in the regulation of MRTF-A. DOI: http://dx.doi.org/10.7554/eLife.15460.001 PMID:27304076

  4. Development and validation of quantitative structure-activity relationship models for compounds acting on serotoninergic receptors.

    PubMed

    Zydek, Grażyna; Brzezińska, Elżbieta

    2012-01-01

    A quantitative structure-activity relationship (QSAR) study has been made on 20 compounds with serotonin (5-HT) receptor affinity. Thin-layer chromatographic (TLC) data and physicochemical parameters were applied in this study. RP2 TLC 60F(254) plates (silanized) impregnated with solutions of propionic acid, ethylbenzene, 4-ethylphenol, and propionamide (used as analogues of the key receptor amino acids) and their mixtures (denoted as S1-S7 biochromatographic models) were used in two developing phases as a model of drug-5-HT receptor interaction. The semiempirical method AM1 (HyperChem v. 7.0 program) and ACD/Labs v. 8.0 program were employed to calculate a set of physicochemical parameters for the investigated compounds. Correlation and multiple linear regression analysis were used to search for the best QSAR equations. The correlations obtained for the compounds studied represent their interactions with the proposed biochromatographic models. The good multivariate relationships (R(2) = 0.78-0.84) obtained by means of regression analysis can be used for predicting the quantitative effect of biological activity of different compounds with 5-HT receptor affinity. "Leave-one-out" (LOO) and "leave-N-out" (LNO) cross-validation methods were used to judge the predictive power of final regression equations.

  5. PEGylated recombinant human interferon-ω as a long-acting antiviral agent: structure, antiviral activity and pharmacokinetics.

    PubMed

    Yu, Weili; Yu, Changming; Wu, Ling; Fang, Ting; Qiu, Rui; Zhang, Jinlong; Yu, Ting; Fu, Ling; Chen, Wei; Hu, Tao

    2014-08-01

    Recombinant human interferon-ω (rhIFN-ω) exhibits a potent antiviral activity. Because of poor pharmacokinetics (PK) of rhIFN-ω, frequent dosing of rhIFN-ω is necessitated to achieve the sustained antiviral efficacy. PEGylation can efficiently improve the PK of rhIFN-ω while substantially decrease its bioactivity. The structure, antiviral activity and PK of the PEGylated rhIFN-ω were measured to establish their relationship with PEGylation sites, polyethylene glycol (PEG) mass and PEG structure. Accordingly, N-terminus and the lysine residues were selected as the PEGylation sites. PEGs with Mw of 20kDa and 40kDa were used to investigate the effect of PEG mass. Linear and branched PEGs were used to investigate the effect of PEG structure. PEGylation decreased the antiviral activity of rhIFN-ω and improved its PK. The PEGylation sites determine the bioactivity of the PEGylated rhIFN-ω and the conjugated PEG mass determines the PK. N-terminally PEGylated rhIFN-ω with 40kDa linear PEG maintains 21.7% of the rhIFN-ω antiviral activity with a half-life of 139.6h. Thus, N-terminally PEGylated rhIFN-ω with linear 40kDa PEG is a potential antiviral agent for long-acting treatment of the viral diseases.

  6. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project. ACT/Control/Guidance System study, volume 1

    NASA Technical Reports Server (NTRS)

    1982-01-01

    The active control technology (ACT) control/guidance system task of the integrated application of active controls (IAAC) technology project within the NASA energy efficient transport program was documented. The air traffic environment of navigation and air traffic control systems and procedures were extrapolated. An approach to listing flight functions which will be performed by systems and crew of an ACT configured airplane of the 1990s, and a determination of function criticalities to safety of flight, are the basis of candidate integrated ACT/Control/Guidance System architecture. The system mechanizes five active control functions: pitch augmented stability, angle of attack limiting, lateral/directional augmented stability, gust load alleviation, and maneuver load control. The scope and requirements of a program for simulating the integrated ACT avionics and flight deck system, with pilot in the loop, are defined, system and crew interface elements are simulated, and mechanization is recommended. Relationships between system design and crew roles and procedures are evaluated.

  7. LATE MERISTEM IDENTITY2 acts together with LEAFY to activate APETALA1.

    PubMed

    Pastore, Jennifer J; Limpuangthip, Andrea; Yamaguchi, Nobutoshi; Wu, Miin-Feng; Sang, Yi; Han, Soon-Ki; Malaspina, Lauren; Chavdaroff, Natasha; Yamaguchi, Ayako; Wagner, Doris

    2011-08-01

    The switch from producing vegetative structures (branches and leaves) to producing reproductive structures (flowers) is a crucial developmental transition that significantly affects the reproductive success of flowering plants. In Arabidopsis, this transition is in large part controlled by the meristem identity regulator LEAFY (LFY). The molecular mechanisms by which LFY orchestrates a precise and robust switch to flower formation is not well understood. Here, we show that the direct LFY target LATE MERISTEM IDENTITY2 (LMI2) has a role in the meristem identity transition. Like LFY, LMI2 activates AP1 directly; moreover, LMI2 and LFY interact physically. LFY, LMI2 and AP1 are connected in a feed-forward and positive feedback loop network. We propose that these intricate regulatory interactions not only direct the precision of this crucial developmental transition in rapidly changing environmental conditions, but also contribute to its robustness and irreversibility.

  8. Cardiolipins Act as a Selective Barrier to Toll-Like Receptor 4 Activation in the Intestine

    PubMed Central

    Coats, Stephen R.; Hashim, Ahmed; Paramonov, Nikolay A.; Curtis, Michael A.

    2016-01-01

    ABSTRACT Intestinal homeostasis mechanisms must protect the host intestinal tissue from endogenous lipopolysaccharides (LPSs) produced by the intestinal microbiota. In this report, we demonstrate that murine intestinal fecal lipids effectively block Toll-like receptor 4 (TLR4) responses to naturally occurring Bacteroidetes sp. LPS. Cardiolipin (CL) represents a significant proportion of the total intestinal and fecal lipids and, furthermore, potently antagonizes TLR4 activation by reducing LPS binding at the lipopolysaccharide binding protein (LBP), CD14, and MD-2 steps of the TLR4 signaling pathway. It is further demonstrated that intestinal lipids and CL are less effective at neutralizing more potent Enterobacteriaceae-type LPS, which is enriched in feces obtained from mice with dextran sodium sulfate (DSS)-treated inflammatory bowel disease. The selective inhibition of naturally occurring LPS structures by intestinal lipids may represent a novel homeostasis mechanism that blocks LPS activation in response to symbiotic but not dysbiotic microbial communities. IMPORTANCE The guts of animals harbor a variety of Gram-negative bacteria associated with both states of intestinal health and states of disease. Environmental factors, such as dietary habits, can drive the microbial composition of the host animal's intestinal bacterial community toward a more pathogenic state. Both beneficial and harmful Gram-negative bacteria are capable of eliciting potentially damaging inflammatory responses from the host intestinal tissues via a lipopolysaccharide (LPS)-dependent pathway. Physical mucosal barriers and antibodies produced by the intestinal immune system protect against the undesired inflammatory effects of LPS, although it is unknown why some bacteria are more effective at overcoming the protective barriers than others. This report describes the discovery of a lipid-type protective barrier in the intestine that reduces the deleterious effects of LPSs from beneficial

  9. GIT2 Acts as a Systems-Level Coordinator of Neurometabolic Activity and Pathophysiological Aging

    PubMed Central

    Martin, Bronwen; Chadwick, Wayne; Janssens, Jonathan; Premont, Richard T.; Schmalzigaug, Robert; Becker, Kevin G.; Lehrmann, Elin; Wood, William H.; Zhang, Yongqing; Siddiqui, Sana; Park, Sung-Soo; Cong, Wei-na; Daimon, Caitlin M.; Maudsley, Stuart

    2016-01-01

    Aging represents one of the most complicated and highly integrated somatic processes. Healthy aging is suggested to rely upon the coherent regulation of hormonal and neuronal communication between the central nervous system and peripheral tissues. The hypothalamus is one of the main structures in the body responsible for sustaining an efficient interaction between energy balance and neurological activity and therefore likely coordinates multiple systems in the aging process. We previously identified, in hypothalamic and peripheral tissues, the G protein-coupled receptor kinase interacting protein 2 (GIT2) as a stress response and aging regulator. As metabolic status profoundly affects aging trajectories, we investigated the role of GIT2 in regulating metabolic activity. We found that genomic deletion of GIT2 alters hypothalamic transcriptomic signatures related to diabetes and metabolic pathways. Deletion of GIT2 reduced whole animal respiratory exchange ratios away from those related to primary glucose usage for energy homeostasis. GIT2 knockout (GIT2KO) mice demonstrated lower insulin secretion levels, disruption of pancreatic islet beta cell mass, elevated plasma glucose, and insulin resistance. High-dimensionality transcriptomic signatures from islets isolated from GIT2KO mice indicated a disruption of beta cell development. Additionally, GIT2 expression was prematurely elevated in pancreatic and hypothalamic tissues from diabetic-state mice (db/db), compared to age-matched wild type (WT) controls, further supporting the role of GIT2 in metabolic regulation and aging. We also found that the physical interaction of pancreatic GIT2 with the insulin receptor and insulin receptor substrate 2 was diminished in db/db mice compared to WT mice. Therefore, GIT2 appears to exert a multidimensional “keystone” role in regulating the aging process by coordinating somatic responses to energy deficits. PMID:26834700

  10. Screening of plants acting against Heterometrus laoticus scorpion venom activity on fibroblast cell lysis.

    PubMed

    Uawonggul, Nunthawun; Chaveerach, Arunrat; Thammasirirak, Sompong; Arkaravichien, Tarinee; Chuachan, Chattong; Daduang, Sakda

    2006-01-16

    The aqueous extracts of 64 plant species, listed as animal- or insect-bite antidotes in old Thai drug recipes were screened for their activity against fibroblast cell lysis after Heterometrus laoticus scorpion venom treatment. The venom was preincubated with plant extract for 30 min and furthered treated to confluent fibroblast cells for 30 min. More than 40% efficiency (test/control) was obtained from cell treatment with venom preincubated with extracts of Andrographis paniculata Nees (Acanthaceae), Barringtonia acutangula (L.) Gaertn. (Lecythidaceae), Calamus sp. (Palmae), Clinacanthus nutans Lindau (Acanthaceae), Euphorbia neriifolia L. (Euphorbiaceae), Ipomoea aquatica Forssk (Convolvulaceae), Mesua ferrea L. (Guttiferae), Passiflora laurifolia L. (Passifloraceae), Plectranthus amboinicus (Lour.) Spreng. (Labiatae), Ricinus communis L. (Euphorbiaceae), Rumex sp. (Polygonaceae) and Sapindus rarak DC. (Sapindaceae), indicating that they had a tendency to be scorpion venom antidotes. However, only Andrographis paniculata and Barringtonia acutangula extracts provided around 50% viable cells from extract treatments without venom preincubation. These two plant extracts are expected to be scorpion venom antidotes with low cytotoxicity.

  11. Active compensation of aperture discontinuities for WFIRST-AFTA: analytical and numerical comparison of propagation methods and preliminary results with a WFIRST-AFTA-like pupil

    NASA Astrophysics Data System (ADS)

    Mazoyer, Johan; Pueyo, Laurent; Norman, Colin; N'Diaye, Mamadou; van der Marel, Roeland P.; Soummer, Rémi

    2016-03-01

    The new frontier in the quest for the highest contrast levels in the focal plane of a coronagraph is now the correction of the large diffraction artifacts introduced at the science camera by apertures of increasing complexity. Indeed, the future generation of space- and ground-based coronagraphic instruments will be mounted on on-axis and/or segmented telescopes; the design of coronagraphic instruments for such observatories is currently a domain undergoing rapid progress. One approach consists of using two sequential deformable mirrors (DMs) to correct for aberrations introduced by secondary mirror structures and segmentation of the primary mirror. The coronagraph for the WFIRST-AFTA mission will be the first of such instruments in space with a two-DM wavefront control system. Regardless of the control algorithm for these multiple DMs, they will have to rely on quick and accurate simulation of the propagation effects introduced by the out-of-pupil surface. In the first part of this paper, we present the analytical description of the different approximations to simulate these propagation effects. In Appendix A, we prove analytically that in the special case of surfaces inducing a converging beam, the Fresnel method yields high fidelity for simulations of these effects. We provide numerical simulations showing this effect. In the second part, we use these tools in the framework of the active compensation of aperture discontinuities (ACAD) technique applied to pupil geometries similar to WFIRST-AFTA. We present these simulations in the context of the optical layout of the high-contrast imager for complex aperture telescopes, which will test ACAD on a optical bench. The results of this analysis show that using the ACAD method, an apodized pupil Lyot coronagraph, and the performance of our current DMs, we are able to obtain, in numerical simulations, a dark hole with a WFIRST-AFTA-like. Our numerical simulation shows that we can obtain contrast better than 2×10-9 in

  12. Privacy Act

    EPA Pesticide Factsheets

    Learn about the Privacy Act of 1974, the Electronic Government Act of 2002, the Federal Information Security Management Act, and other information about the Environmental Protection Agency maintains its records.

  13. Transcription factors GAF and HSF act at distinct regulatory steps to modulate stress-induced gene activation.

    PubMed

    Duarte, Fabiana M; Fuda, Nicholas J; Mahat, Dig B; Core, Leighton J; Guertin, Michael J; Lis, John T

    2016-08-01

    The coordinated regulation of gene expression at the transcriptional level is fundamental to development and homeostasis. Inducible systems are invaluable when studying transcription because the regulatory process can be triggered instantaneously, allowing the tracking of ordered mechanistic events. Here, we use precision run-on sequencing (PRO-seq) to examine the genome-wide heat shock (HS) response in Drosophila and the function of two key transcription factors on the immediate transcription activation or repression of all genes regulated by HS. We identify the primary HS response genes and the rate-limiting steps in the transcription cycle that GAGA-associated factor (GAF) and HS factor (HSF) regulate. We demonstrate that GAF acts upstream of promoter-proximally paused RNA polymerase II (Pol II) formation (likely at the step of chromatin opening) and that GAF-facilitated Pol II pausing is critical for HS activation. In contrast, HSF is dispensable for establishing or maintaining Pol II pausing but is critical for the release of paused Pol II into the gene body at a subset of highly activated genes. Additionally, HSF has no detectable role in the rapid HS repression of thousands of genes.

  14. Identification of positive-acting domains in GCN2 protein kinase required for translational activation of GCN4 expression

    SciTech Connect

    Wek, R.C.; Ramirez, M.; Jackson, B.M.; Hinnebusch, A.G. )

    1990-06-01

    GCN4 is a transcriptional activator of amino acid-biosynthetic genes in the yeast {ital Saccharomyces cerevisiae}. GCN2, a translational activator of {ital GCN4} expression, contains a domain homologous to the catalytic subunit of eukaryotic protein kinases. Substitution of a highly conserved lysine residue in the kinase domain abolished GCN2 regulatory function in vivo and its ability to autophosphorylate in vitro, indicating that GCN2 acts as a protein kinase in stimulating {ital GCN4} expression. Elevated {ital GCN2} gene dosage led to depression of {ital GCN4} under nonstarvation conditions; however, the authors found that {ital GCN2} mRNA and protein levels did not increase in wild-type cells in response to amino acid starvation. Therefore, it appears that GCN2 protein kinase function is stimulated postranslationally in amino acid-starved cells. Three dominant-constitutive {ital GCN2} point mutations were isolated that led to derepressed {ital GCN4} expression under nonstarvation conditions. Two of the {ital GCN2}(Con) mutations mapped in the kinase domain itself. The third mapped just downstream from a carboxyl-terminal segment homologous to histidyl-tRNA synthetase (HisRS), which the authors suggest might function to detect uncharged tRNA in amino acid-starved cells and activate the adjacent protein kinase moiety.

  15. Histone Methyltransferase Inhibitors Are Orally Bioavailable, Fast-Acting Molecules with Activity against Different Species Causing Malaria in Humans

    PubMed Central

    Sundriyal, Sandeep; Caron, Joachim; Chen, Patty; Witkowski, Benoit; Menard, Didier; Suwanarusk, Rossarin; Renia, Laurent; Nosten, Francois; Jiménez-Díaz, María Belén; Angulo-Barturen, Iñigo; Martínez, María Santos; Ferrer, Santiago; Sanz, Laura M.; Gamo, Francisco-Javier; Wittlin, Sergio; Duffy, Sandra; Avery, Vicky M.; Ruecker, Andrea; Delves, Michael J.; Sinden, Robert E.; Fuchter, Matthew J.

    2014-01-01

    Current antimalarials are under continuous threat due to the relentless development of drug resistance by malaria parasites. We previously reported promising in vitro parasite-killing activity with the histone methyltransferase inhibitor BIX-01294 and its analogue TM2-115. Here, we further characterize these diaminoquinazolines for in vitro and in vivo efficacy and pharmacokinetic properties to prioritize and direct compound development. BIX-01294 and TM2-115 displayed potent in vitro activity, with 50% inhibitory concentrations (IC50s) of <50 nM against drug-sensitive laboratory strains and multidrug-resistant field isolates, including artemisinin-refractory Plasmodium falciparum isolates. Activities against ex vivo clinical isolates of both P. falciparum and Plasmodium vivax were similar, with potencies of 300 to 400 nM. Sexual-stage gametocyte inhibition occurs at micromolar levels; however, mature gametocyte progression to gamete formation is inhibited at submicromolar concentrations. Parasite reduction ratio analysis confirms a high asexual-stage rate of killing. Both compounds examined displayed oral efficacy in in vivo mouse models of Plasmodium berghei and P. falciparum infection. The discovery of a rapid and broadly acting antimalarial compound class targeting blood stage infection, including transmission stage parasites, and effective against multiple malaria-causing species reveals the diaminoquinazoline scaffold to be a very promising lead for development into greatly needed novel therapies to control malaria. PMID:25421480

  16. β-Glucuronidase activity and mitochondrial dysfunction: the sites where flavonoid glucuronides act as anti-inflammatory agents.

    PubMed

    Kawai, Yoshichika

    2014-05-01

    Epidemiological and experimental studies suggest that the consumption of flavonoid-rich diets decreases the risk of various chronic diseases such as cardiovascular diseases. Although studies on the bioavailability of flavonoids have been well-characterized, the tissue and cellular localizations underlying their biological mechanisms are largely unknown. The development and application of novel monoclonal antibodies revealed that macrophages could be the major target of dietary flavonoids in vivo. Using macrophage-like cell lines in vitro, we examined the molecular basis of the interaction between the macrophages and flavonoids, especially the glucuronide metabolites. We have found that extracellular β-glucuronidase secreted from macrophages is essential for the bioactivation of the glucuronide conjugates into the aglycone, and that the enzymatic activity, which requires an acidic pH, is promoted by the increased secretion of lactate in response to the mitochondrial dysfunction. This review describes our recent findings indicating the molecular mechanisms responsible for the anti-inflammatory activity of dietary flavonoids within the inflammation sites. We propose that the extracellular activity of β-glucuronidase associated with the status of the mitochondrial function in the target cells might be important biomarkers for the specific sites where the glucuronides of dietary flavonoids can act as anti-atherosclerotic and anti-inflammatory agents in vivo.

  17. Faults paragenesis and paleostress state in the zone of actively propagating continental strike-slip on the example of North Khangai fault (Northern Mongolia)

    NASA Astrophysics Data System (ADS)

    Sankov, Vladimir; Parfeevets, Anna

    2014-05-01

    Sublatitudinal North Khangai fault extends from Ubsunuur basin to the eastern part of the Selenga corridor trough 800 km. It is the northern boundary of the massive Mongolian block and limits of the Baikal rift system structures propagation in the south (Logatchev, 2003). Late Cenozoic and present-day fault activity are expressed in the left-lateral displacements of a different order of river valleys and high seismicity. We have carried out studies of the kinematics of active faults and palaeostresses reconstruction in the zone of the dynamic influence of North Khangai fault, the width of which varies along the strike and can exceeds 100 km. The result shows that the fault zone has a longitudinal and a transverse zoning. Longitudinal zonation presented gradual change from west to east regions of compression and transpression regimes (Khan-Khukhey ridge) to strike-slip regime (Bolnay ridge) and strike-slip and transtensive regimes (west of Selenga corridor). Strike-slip zones are represented by linearly concentrated rupture deformations. In contrast, near the termination of the fault the cluster fault deformation formed. Here, from north to south, there are radical changes in the palaeostress state. In the north-western sector (east of Selenga corridor) strike-slip faults, strike-slip faults with normal components and normal faults are dominated. For this sector the stress tensors of extensive, transtension and strike-slip regimes are typical. South-western sector is separated from the north-eastern one by massive Buren Nuruu ridge within which the active faults are not identified. In the south-western sector between the Orkhon and Tola rivers the cluster of NW thrusts and N-S strike-slip faults with reverse component are discovered. The faults are perfectly expressed by NW and N-S scarps in the relief. The most structures dip to the east and north-east. Holocene fault activity is demonstrated by the hanging river valleys and horizontal displacements with amplitudes

  18. 45 CFR 90.3 - What programs or activities does the Age Discrimination Act of 1975 cover?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Assistance Act of 1972 (31 U.S.C. 1221 et seq.). (b) The Age Discrimination Act of 1975 does not apply to: (1... employment under the Comprehensive Employment and Training Act of 1974 (CETA), (29 U.S.C. 801 et seq.)....

  19. Fathoms Below: Propagation of Deep Water-driven Fractures and Implications for Surface Expression and Temporally-varying Activity at Europa

    NASA Astrophysics Data System (ADS)

    Walker, C. C.; Craft, K.; Schmidt, B. E.

    2015-12-01

    The fracture and failure of Europa's icy shell are not only observable scars of variable stress and activity throughout its evolution, they also serve key as mechanisms in the interaction of surface and subsurface material, and thus crucial aspects of the study of crustal overturn and ice shell habitability. Galileo images, our best and only reasonable-resolution views of Europa until the Europa Multiple Flyby Mission arrives in the coming decades, illustrates a single snapshot in time in Europa's history from which we deduce many temporally-based hypotheses. One of those hypotheses, which we investigate here, is that sub-surface water-both in the form of Great Lake-sized perched water pockets in the near-surface and the larger global ocean below-drives the deformation, fracture, and failure of the surface. Using Galileo's snapshot in time, we use a 2D/3D hydraulic fracturing model to investigate the propagation of vertical fractures upward into the ice shell, motion of water within and between fractures, and the subsequent break-up of ice over shallow water, forming the chaos regions and other smaller surface features. We will present results from a cohesive fragmentation model to determine the time over which chaos formation occurs, and use a fracking model to determine the time interval required to allow water to escape from basal fractures in the ice shell. In determining the style, energy, and timescale of these processes, we constrain temporal variability in observable activity and topography at the surface. Finally, we compare these results to similar settings on Earth-Antarctica-where we have much higher resolution imagery and observations to better understand how sub-surface water can affect ice surface morphology, which most certainly have implications for future flyby and surface lander exploration.

  20. Dynamical states, possibilities and propagation of stress signal

    PubMed Central

    Malik, Md. Zubbair; Ali, Shahnawaz; Singh, Soibam Shyamchand; Ishrat, Romana; Singh, R. K. Brojen

    2017-01-01

    The stress driven dynamics of Notch-Wnt-p53 cross-talk is subjected to a few possible dynamical states governed by simple fractal rules, and allowed to decide its own fate by choosing one of these states which are contributed from long range correlation with varied fluctuations due to active molecular interaction. The topological properties of the networks corresponding to these dynamical states have hierarchical features with assortive structure. The stress signal driven by nutlin and modulated by mediator GSK3 acts as anti-apoptotic signal in this system, whereas, the stress signal driven by Axin and modulated by GSK3 behaves as anti-apoptotic for a certain range of Axin and GSK3 interaction, and beyond which the signal acts as favor-apoptotic signal. However, this stress system prefers to stay in an active dynamical state whose counterpart complex network is closest to hierarchical topology with exhibited roles of few interacting hubs. During the propagation of stress signal, the system allows the propagator pathway to inherit all possible properties of the state to the receiver pathway/pathways with slight modifications, indicating efficient information processing and democratic sharing of responsibilities in the system via cross-talk. The increase in the number of cross-talk pathways in the system favors to establish self-organization. PMID:28106087

  1. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project: Current and advanced act control system definition study. Volume 2: Appendices

    NASA Technical Reports Server (NTRS)

    Hanks, G. W.; Shomber, H. A.; Dethman, H. A.; Gratzer, L. B.; Maeshiro, A.; Gangsaas, D.; Blight, J. D.; Buchan, S. M.; Crumb, C. B.; Dorwart, R. J.

    1981-01-01

    The current status of the Active Controls Technology (ACT) for the advanced subsonic transport project is investigated through analysis of the systems technical data. Control systems technologies under examination include computerized reliability analysis, pitch axis fly by wire actuator, flaperon actuation system design trade study, control law synthesis and analysis, flutter mode control and gust load alleviation analysis, and implementation of alternative ACT systems. Extensive analysis of the computer techniques involved in each system is included.

  2. Annual Report to the President and the Congress Fiscal Year 1985 on Federal Activities Related to the Administration of the Rehabilitation Act of 1973 as Amended.

    ERIC Educational Resources Information Center

    Rehabilitation Services Administration (ED), Washington, DC.

    This report describes program activities related to the administration of the Rehabilitation Act of 1973 from October 1, 1984 through September 30, 1985. Information is presented on funding efforts, program development, and other activities relating to: vocational rehabilitation services (e.g., American Indian vocational rehabilitation services,…

  3. Insulin acts in the arcuate nucleus to increase lumbar sympathetic nerve activity and baroreflex function in rats

    PubMed Central

    Cassaglia, Priscila A; Hermes, Sam M; Aicher, Sue A; Brooks, Virginia L

    2011-01-01

    Abstract Although the central effects of insulin to activate the sympathetic nervous system and enhance baroreflex gain are well known, the specific brain site(s) at which insulin acts has not been identified. We tested the hypotheses that (1) the paraventricular nucleus of the hypothalamus (PVN) and the arcuate nucleus (ArcN) are necessary brain sites and (2) insulin initiates its effects directly in the PVN and/or the ArcN. In α-chloralose anaesthetised female Sprague–Dawley rats, mean arterial pressure (MAP), heart rate (HR) and lumbar sympathetic nerve activity (LSNA) were recorded continuously, and baroreflex gain of HR and LSNA were measured before and during a hyperinsulinaemic–euglycaemic clamp. After 60 min, intravenous infusion of insulin (15 mU kg−1 min−1), but not saline, significantly increased (P < 0.05) basal LSNA (to 228 ± 28% control) and gain of baroreflex control of LSNA (from 3.8 ± 1.1 to 7.4 ± 2.4% control mmHg−1). These effects were reversed (P < 0.05) by local inhibition (bilateral microinjection of musimol) of the PVN (LSNA to 124 ± 8.8% control; LSNA gain to 3.9 ± 1.7% control mmHg−1) or of the ArcN (LSNA in % control: from 100 ± 0 to 198 ± 24 (insulin), then 133 ± 23 (muscimol) LSNA gain in % control mmHg−1: from 3.9 ± 0.3 to 8.9 ± 0.9 (insulin), then 5.1 ± 0.5 (muscimol)). While insulin receptor immunoreactivity was identified in neurons in pre-autonomic PVN subnuclei, microinjection of insulin (0.6, 6 and 60 nU) into the PVN failed to alter LSNA or LSNA gain. However, ArcN insulin increased (P < 0.05) basal LSNA (in % control to 162 ± 19, 0.6 nU; 193 ± 19, 6 nU; and 205 ± 28, 60 nU) and LSNA baroreflex gain (in % control mmHg−1 from 4.3 ± 1.2 to 6.9 ± 1.0, 0.6 nU; 7.7 ± 1.2, 6 nU; and 7.8 ± 1.3, 60 nU). None of the treatments altered MAP, HR, or baroreflex control of HR. Our findings identify the ArcN as the site at which insulin acts to activate the sympathetic nervous system and increase baroreflex

  4. Clobetasol and Halcinonide Act as Smoothened Agonists to Promote Myelin Gene Expression and RxRγ Receptor Activation

    PubMed Central

    De Nardis, Velia; Di Giandomenico, Daniele; Lucisano, Giuseppe; Scardapane, Marco; Poma, Anna; Ragnini-Wilson, Antonella

    2015-01-01

    One of the causes of permanent disability in chronic multiple sclerosis patients is the inability of oligodendrocyte progenitor cells (OPCs) to terminate their maturation program at lesions. To identify key regulators of myelin gene expression acting at the last stages of OPC maturation we developed a drug repositioning strategy based on the mouse immortalized oligodendrocyte (OL) cell line Oli-neu brought to the premyelination stage by stably expressing a key factor regulating the last stages of OL maturation. The Prestwick Chemical Library® of 1,200 FDA-approved compound(s) was repositioned at three dosages based on the induction of Myelin Basic Protein (MBP) expression. Drug hits were further validated using dosage-dependent reproducibility tests and biochemical assays. The glucocorticoid class of compounds was the most highly represented and we found that they can be divided in three groups according to their efficacy on MBP up-regulation. Since target identification is crucial before bringing compounds to the clinic, we searched for common targets of the primary screen hits based on their known chemical-target interactomes, and the pathways predicted by top ranking compounds were validated using specific inhibitors. Two of the top ranking compounds, Halcinonide and Clobetasol, act as Smoothened (Smo) agonists to up-regulate myelin gene expression in the Oli-neuM cell line. Further, RxRγ activation is required for MBP expression upon Halcinonide and Clobetasol treatment. These data indicate Clobetasol and Halcinonide as potential promyelinating drugs and also provide a mechanistic understanding of their mode of action in the pathway leading to myelination in OPCs. Furthermore, our classification of glucocorticoids with respect to MBP expression provides important novel insights into their effects in the CNS and a rational criteria for their choice in combinatorial therapies in de-myelinating diseases. PMID:26658258

  5. Clobetasol and Halcinonide Act as Smoothened Agonists to Promote Myelin Gene Expression and RxRγ Receptor Activation.

    PubMed

    Porcu, Giampiero; Serone, Eliseo; De Nardis, Velia; Di Giandomenico, Daniele; Lucisano, Giuseppe; Scardapane, Marco; Poma, Anna; Ragnini-Wilson, Antonella

    2015-01-01

    One of the causes of permanent disability in chronic multiple sclerosis patients is the inability of oligodendrocyte progenitor cells (OPCs) to terminate their maturation program at lesions. To identify key regulators of myelin gene expression acting at the last stages of OPC maturation we developed a drug repositioning strategy based on the mouse immortalized oligodendrocyte (OL) cell line Oli-neu brought to the premyelination stage by stably expressing a key factor regulating the last stages of OL maturation. The Prestwick Chemical Library of 1,200 FDA-approved compound(s) was repositioned at three dosages based on the induction of Myelin Basic Protein (MBP) expression. Drug hits were further validated using dosage-dependent reproducibility tests and biochemical assays. The glucocorticoid class of compounds was the most highly represented and we found that they can be divided in three groups according to their efficacy on MBP up-regulation. Since target identification is crucial before bringing compounds to the clinic, we searched for common targets of the primary screen hits based on their known chemical-target interactomes, and the pathways predicted by top ranking compounds were validated using specific inhibitors. Two of the top ranking compounds, Halcinonide and Clobetasol, act as Smoothened (Smo) agonists to up-regulate myelin gene expression in the Oli-neuM cell line. Further, RxRγ activation is required for MBP expression upon Halcinonide and Clobetasol treatment. These data indicate Clobetasol and Halcinonide as potential promyelinating drugs and also provide a mechanistic understanding of their mode of action in the pathway leading to myelination in OPCs. Furthermore, our classification of glucocorticoids with respect to MBP expression provides important novel insights into their effects in the CNS and a rational criteria for their choice in combinatorial therapies in de-myelinating diseases.

  6. Acetylcholine acts through M3 muscarinic receptor to activate the EGFR signaling and promotes gastric cancer cell proliferation

    PubMed Central

    Yu, Huangfei; Xia, Hongwei; Tang, Qiulin; Xu, Huanji; Wei, Guoqing; Chen, Ying; Dai, Xinyu; Gong, Qiyong; Bi, Feng

    2017-01-01

    Acetylcholine (ACh), known as a neurotransmitter, regulates the functions of numerous fundamental central and peripheral nervous system. Recently, emerging evidences indicate that ACh also plays an important role in tumorigenesis. However, little is known about the role of ACh in gastric cancer. Here, we reported that ACh could be auto-synthesized and released from MKN45 and BGC823 gastric cancer cells. Exogenous ACh promoted cell proliferation in a does-dependent manner. The M3R antagonist 4-DAMP, but not M1R antagonist trihexyphenidyl and M2/4 R antagonist AFDX-116, could reverse the ACh-induced cell proliferation. Moreover, ACh, via M3R, activated the EGFR signaling to induce the phosphorylation of ERK1/2 and AKT, and blocking EGFR pathway by specific inhibitor AG1478 suppressed the ACh induced cell proliferation. Furthermore, the M3R antagonist 4-DAMP and darifenacin could markedly inhibit gastric tumor formation in vivo. 4-DAMP could also significantly enhance the cytotoxic activity of 5-Fu against the MKN45 and BGC823 cells, and induce the expression of apoptosis-related proteins such as Bax and Caspase-3. Together, these findings indicated that the autocrine ACh could act through M3R and the EGFR signaling to promote gastric cancer cells proliferation, targeting M3R or EGFR may provide us a potential therapeutic strategy for gastric cancer treatment. PMID:28102288

  7. Eps15 membrane-binding and -bending activity acts redundantly with Fcho1 during clathrin-mediated endocytosis

    PubMed Central

    Wang, Lei; Johnson, Adam; Hanna, Michael; Audhya, Anjon

    2016-01-01

    Clathrin coat assembly on membranes requires cytosolic adaptors and accessory proteins, which bridge triskeleons with the lipid bilayer and stabilize lattice architecture throughout the process of vesicle formation. In Caenorhabditis elegans, the prototypical AP-2 adaptor complex, which is activated by the accessory factor Fcho1 at the plasma membrane, is dispensable during embryogenesis, enabling us to define alternative mechanisms that facilitate clathrin-mediated endocytosis. Here we uncover a synthetic genetic interaction between C. elegans Fcho1 (FCHO-1) and Eps15 (EHS-1), suggesting that they function in a parallel and potentially redundant manner. Consistent with this idea, we find that the FCHO-1 EFC/F-BAR domain and the EHS-1 EH domains exhibit highly similar membrane-binding and -bending characteristics in vitro. Furthermore, we demonstrate a critical role for EHS-1 when FCHO-1 membrane-binding and -bending activity is specifically eliminated in vivo. Taken together, our data highlight Eps15 as an important membrane-remodeling factor, which acts in a partially redundant manner with Fcho proteins during the earliest stages of clathrin-mediated endocytosis. PMID:27385343

  8. DCA1 Acts as a Transcriptional Co-activator of DST and Contributes to Drought and Salt Tolerance in Rice.

    PubMed

    Cui, Long-Gang; Shan, Jun-Xiang; Shi, Min; Gao, Ji-Ping; Lin, Hong-Xuan

    2015-10-01

    Natural disasters, including drought and salt stress, seriously threaten food security. In previous work we cloned a key zinc finger transcription factor gene, Drought and Salt Tolerance (DST), a negative regulator of drought and salt tolerance that controls stomatal aperture in rice. However, the exact mechanism by which DST regulates the expression of target genes remains unknown. In the present study, we demonstrated that DST Co-activator 1 (DCA1), a previously unknown CHY zinc finger protein, acts as an interacting co-activator of DST. DST was found to physically interact with itself and to form a heterologous tetramer with DCA1. This transcriptional complex appears to regulate the expression of peroxidase 24 precursor (Prx 24), a gene encoding an H2O2 scavenger that is more highly expressed in guard cells. Downregulation of DCA1 significantly enhanced drought and salt tolerance in rice, and overexpression of DCA1 increased sensitivity to stress treatment. These phenotypes were mainly influenced by DCA1 and negatively regulated stomatal closure through the direct modulation of genes associated with H2O2 homeostasis. Our findings establish a framework for plant drought and salt stress tolerance through the DCA1-DST-Prx24 pathway. Moreover, due to the evolutionary and functional conservation of DCA1 and DST in plants, engineering of this pathway has the potential to improve tolerance to abiotic stress in other important crop species.

  9. The Relationship between Psychosocial Correlates and Physical Activity in Underserved Adolescent Boys and Girls in the ACT Trial

    PubMed Central

    Lawman, Hannah G.; Wilson, Dawn K.; Van Horn, M. Lee; Resnicow, Ken; Kitzman-Ulrich, Heather

    2011-01-01

    Background Previous research suggests motivation, enjoyment, and self-efficacy may be important psychosocial factors for understanding physical activity (PA) in youth. While previous studies have shown mixed results, emerging evidence indicates relationships between psychosocial factors and PA may be stronger in boys than girls. This study expands on previous research by examining the effects of motivation, enjoyment and self-efficacy on PA in underserved adolescent (low income, ethnic minorities) boys and girls. Based on previous literature, it was hypothesized the effects of motivation, enjoyment and self-efficacy on moderate-to-vigorous PA (MVPA) would be stronger in boys than in girls. Methods Baseline cross-sectional data were obtained from a randomized, school-based trial (Active by Choice Today; ACT) in underserved 6th graders (N=771 girls, 651 boys). Intrapersonal variables for PA were assessed via self-report and confirmatory factor analyses were conducted for each predictor. MVPA was assessed with 7-day accelerometry estimates. Results Multivariate regression analyses stratified by sex demonstrated a significant positive main effect of self-efficacy and motivation on MVPA for girls. Boys also showed a positive trend for the effect of motivation on MVPA. Conclusions The results from this study suggest motivation and self-efficacy should be better integrated to facilitate the development of more effective interventions for increasing PA in underserved adolescents. PMID:21359129

  10. GOES dynamic propagation of attitude

    NASA Technical Reports Server (NTRS)

    Markley, F. Landis; Seidewitz, ED; Chu, Don; Rowe, John N.

    1988-01-01

    The spacecraft in the next series of Geostationary Operational Environmental Satellites (GOES-Next) are Earth pointing and have 5-year mission lifetimes. Because gyros can be depended on only for a few years of continuous use, they will be turned off during routine operations. This means attitude must, at times, be determined without benefit of gyros and, often, using only Earth sensor data. To minimize the interruption caused by dumping angular momentum, these spacecraft have been designed to reduce the environmental torque acting on them and incorporate an adjustable solar trim tab for fine adjustment. A new support requirement for GOES-Next is that of setting the solar trim tab. Optimizing its setting requires an estimate of the unbalanced torque on the spacecraft. These two requirements, determining attitude without gyros and estimating the external torque, are addressed by replacing or supplementing the gyro propagation with a dynamic one, that is, one that integrates the rigid body equations of motion. By processing quarter-orbit or longer batches, this approach takes advantage of roll-yaw coupling to observe attitude completely without Sun sensor data. Telemetered momentum wheel speeds are used as observations of the unbalanced external torques. GOES-Next provides a unique opportunity to study dynamic attitude propagation. The geosynchronous altitude and adjustable trim tab minimize the external torque and its uncertainty, making long-term dynamic propagation feasible. This paper presents the equations for dynamic propagation, an analysis of the environmental torques, and an estimate of the accuracies obtainable with the proposed method.

  11. 7alpha-Hydroxypregnenolone acts as a neuronal activator to stimulate locomotor activity of breeding newts by means of the dopaminergic system.

    PubMed

    Matsunaga, Masahiro; Ukena, Kazuyoshi; Baulieu, Etienne-Emile; Tsutsui, Kazuyoshi

    2004-12-07

    It is becoming clear that steroids can be synthesized de novo by the brain and other nervous systems. Such steroids are called neurosteroids, and de novo neurosteroidogenesis from cholesterol is a conserved property of vertebrate brains. In this study, we show that the newt brain actively produces 7alpha-hydroxypregnenolone, a previously undescribed amphibian neurosteroid that stimulates locomotor activity. 7alpha-hydroxypregnenolone was identified as a most abundant amphibian neurosteroid in the newt brain by using biochemical techniques combined with HPLC, TLC, and GC-MS analyses. The production of 7alpha-hydroxypregnenolone in the diencephalon and rhombencephalon was higher than that in the telencephalon and peripheral steroidogenic glands. In addition, 7alpha-hydroxypregnenolone synthesis in the brain showed marked changes during the annual breeding cycle, with a maximal level in the spring breeding period when locomotor activity of the newt increases. Behavioral analysis of newts in the nonbreeding period demonstrated that administration of this previously undescribed amphibian neurosteroid acutely increased locomotor activity. In vitro analysis further revealed that 7alpha-hydroxypregnenolone treatment resulted in a dose-dependent increase in the release of dopamine from cultured brain tissue of nonbreeding newts. The effect of this neurosteroid on locomotion also was abolished by dopamine D(2)-like receptor antagonists. These results indicate that 7alpha-hydroxypregnenolone acts as a neuronal activator to stimulate locomotor activity of breeding newts through the dopaminergic system. This study demonstrates a physiological function of 7alpha-hydroxypregnenolone that has not been described previously in any vertebrate class. This study also provides findings on the regulatory mechanism of locomotor activity from a unique standpoint.

  12. The Rice Transcription Factor WRKY53 Suppresses Herbivore-Induced Defenses by Acting as a Negative Feedback Modulator of Mitogen-Activated Protein Kinase Activity1

    PubMed Central

    Hu, Lingfei; Ye, Meng; Zhang, Tongfang; Zhou, Guoxin; Wang, Qi; Lu, Jing

    2015-01-01

    The mechanisms by which herbivore-attacked plants activate their defenses are well studied. By contrast, little is known about the regulatory mechanisms that allow them to control their defensive investment and avoid a defensive overshoot. We characterized a rice (Oryza sativa) WRKY gene, OsWRKY53, whose expression is rapidly induced upon wounding and induced in a delayed fashion upon attack by the striped stem borer (SSB) Chilo suppressalis. The transcript levels of OsWRKY53 are independent of endogenous jasmonic acid but positively regulated by the mitogen-activated protein kinases OsMPK3/OsMPK6. OsWRKY53 physically interacts with OsMPK3/OsMPK6 and suppresses their activity in vitro. By consequence, it modulates the expression of defensive, MPK-regulated WRKYs and thereby reduces jasmonic acid, jasmonoyl-isoleucine, and ethylene induction. This phytohormonal reconfiguration is associated with a reduction in trypsin protease inhibitor activity and improved SSB performance. OsWRKY53 is also shown to be a negative regulator of plant growth. Taken together, these results show that OsWRKY53 functions as a negative feedback modulator of MPK3/MPK6 and thereby acts as an early suppressor of induced defenses. OsWRKY53 therefore enables rice plants to control the magnitude of their defensive investment during early signaling. PMID:26453434

  13. The study of electromagnetic wave propagation in photonic crystals via planewave based transfer (scattering) matrix method with active gain material applications

    NASA Astrophysics Data System (ADS)

    Li, Ming

    In this dissertation, a set of numerical simulation tools are developed under previous work to efficiently and accurately study one-dimensional (1D), two-dimensional (2D), 2D slab and three-dimensional (3D) photonic crystal structures and their defects effects by means of spectrum (transmission, reflection, absorption), band structure (dispersion relation), and electric and/or magnetic fields distribution (mode profiles). Further more, the lasing property and spontaneous emission behaviors are studied when active gain materials are presented in the photonic crystal structures. First, the planewave based transfer (scattering) matrix method (TMM) is described in every detail along with a brief review of photonic crystal history (Chapter 1 and 2). As a frequency domain method, TMM has the following major advantages over other numerical methods: (1) the planewave basis makes Maxwell's Equations a linear algebra problem and there are mature numerical package to solve linear algebra problem such as Lapack and Scalapack (for parallel computation). (2) Transfer (scattering) matrix method make 3D problem into 2D slices and link all slices together via the scattering matrix (S matrix) which reduces computation time and memory usage dramatically and makes 3D real photonic crystal devices design possible; and this also makes the simulated domain no length limitation along the propagation direction (ideal for waveguide simulation). (3) It is a frequency domain method and calculation results are all for steady state, without the influences of finite time span convolution effects and/or transient effects. (4) TMM can treat dispersive material (such as metal at visible light) naturally without introducing any additional computation; and meanwhile TMM can also deal with anisotropic material and magnetic material (such as perfectly matched layer) naturally from its algorithms. (5) Extension of TMM to deal with active gain material can be done through an iteration procedure with gain

  14. Propagation in polymer parameterised field theory

    NASA Astrophysics Data System (ADS)

    Varadarajan, Madhavan

    2017-01-01

    The Hamiltonian constraint operator in loop quantum gravity acts ultralocally. Smolin has argued that this ultralocality seems incompatible with the existence of a quantum dynamics which propagates perturbations between macroscopically seperated regions of quantum geometry. We present evidence to the contrary within an LQG type ‘polymer’ quantization of two dimensional parameterised field theory (PFT). PFT is a generally covariant reformulation of free field propagation on flat spacetime. We show explicitly that while, as in LQG, the Hamiltonian constraint operator in PFT acts ultralocally, states in the joint kernel of the Hamiltonian and diffeomorphism constraints of PFT necessarily describe propagation effects. The particular structure of the finite triangulation Hamiltonian constraint operator plays a crucial role, as does the necessity of imposing (the continuum limit of) its kinematic adjoint as a constraint. Propagation is seen as a property encoded by physical states in the kernel of the constraints rather than that of repeated actions of the finite triangulation Hamiltonian constraint on kinematic states. The analysis yields robust structural lessons for putative constructions of the Hamiltonian constraint in LQG for which ultralocal action co-exists with a description of propagation effects by physical states.

  15. Active ingredients in sunscreens act as topical penetration enhancers for the herbicide 2,4-dichlorophenoxyacetic acid.

    PubMed

    Pont, Adam R; Charron, Anna R; Brand, Rhonda M

    2004-03-15

    Agricultural workers are encouraged to use sunscreen to decrease the risk of UV-related skin cancer. Our previous studies have shown certain commercial sunscreens to be penetration enhancers. The focus of this project is to determine whether active ingredients in sunscreen formulations (i.e., the UV absorbing components and insect repellants for the sunscreen/bug repellant combinations) also act as dermal penetration enhancers for herbicides in vitro. The total percentages of 2,4-dichlorophenoxyacetic acid (2,4-D) penetrating through hairless mouse skin in 24 h ranged from 54.9 +/- 4.7 for the no sunscreen control to 86.9 +/- 2.5 for padimate-o. Of the active ingredients tested (7.5% octyl methoxycinnamate, 7% octocrylene, 0.6% oxybenzone, 5% homosalate, 5% octyl salicylate, 8% padimate-o, 10% sulisobenzone, and 9.5% and 19% N,N-diethyl-m-toluamide [DEET]), all but octocrylene led to a significant increase in total 2,4-D penetration as compared to the control (P < 0.05), and only octocrylene and oxybenzone did not significantly decrease the corresponding lag time. Octyl salicylate (P < 0.01) and octyl methoxycinnimate (P < 0.05) significantly increased the 3H2O penetration across mouse skin, indicating physical damage to the stratum corneum. Additional studies demonstrated that the penetration enhancement seen across hairless mouse skin also occurred with human skin. Thus, the active ingredients of sunscreen formulations enhance dermal penetration of the moderately lipophilic herbicide 2,4-D.

  16. Galectin-3 and soluble fibrinogen act in concert to modulate neutrophil activation and survival: involvement of alternative MAPK pathways.

    PubMed

    Fernández, Gabriela C; Ilarregui, Juan M; Rubel, Carolina J; Toscano, Marta A; Gómez, Sonia A; Beigier Bompadre, Macarena; Isturiz, Martín A; Rabinovich, Gabriel A; Palermo, Marina S

    2005-05-01

    Galectin-3 (Gal-3), a member of a family of highly conserved carbohydrate-binding proteins, has recently emerged as a novel cellular modulator at inflammatory foci. Here we investigated the effects of Gal-3 on central effector functions of human neutrophils, including phagocytosis, exocytosis of secretory granules, and survival. We examined the effects of Gal-3 alone or in combination with soluble fibrinogen (sFbg), an extracellular mediator that plays a key role during the early phase of the inflammatory response through binding to integrin receptors. In addition we evaluated the intracellular signals triggered by these mediators in human neutrophils. Human neutrophils incubated with recombinant Gal-3 alone increased their phagocytic activity and CD66 surface expression. In contrast to the known antiapoptotic effect of Gal-3 on many cellular types, Gal-3 enhanced PMN apoptotic rate. Preincubation with Gal-3 primed neutrophils to the effects of sFbg, resulting in a synergistic action on degranulation. On the other hand, Gal-3 and sFbg had opposite effects on PMN survival, and the simultaneous action of both agonists partially counteracted the proapoptotic effects of Gal-3. In addition, although sFbg induced its effects through the activation of the ERKs, Gal-3 led to p38 phosphorylation. Disruption of this signaling pathway abrogated Gal-3-mediated modulation of neutrophil degranulation, phagocytosis, and apoptosis. Together, our results support the notion that Gal-3 and sFbg are two physiological mediators present at inflammatory sites that activate different components of the MAPK pathway and could be acting in concert to modulate the functionality and life span of neutrophils.

  17. [Characteristics of antagonism between ceruletide and various central-acting drugs: investigation by means of ambulatory activity in mice].

    PubMed

    Ida, I; Asami, T; Kuribara, H; Machiyama, Y; Tadokoro, S

    1990-12-01

    Behavioral characteristics of ceruletide, a cholecystokinin-like decapeptide, were investigated by means of ambulatory activity in mice. Ceruletide at 100 and 300 micrograms/kg, i.p. slightly but significantly decreased the mouse's activity for 20 min. Therefore, 100 micrograms/kg of ceruletide was used in the experiment of combined administration with the central-acting drugs. Ceruletide reduced the increased activity which was produced by methamphetamine (2 mg/kg, s.c.), ephedrine (80 mg/kg, i.p.), methylphenidate (4 mg/kg, s.c.), cocaine (20 mg/kg, s.c.), mazindol (2.5 mg/kg, s.c.), apomorphine (0.5 mg/kg, s.c.), bromocriptine (8 mg/kg, i.p.), scopolamine (0.5 mg/kg, s.c.), caffeine (10 mg/kg, s.c.) and morphine (20 mg/kg, s.c.) with different potencies and durations. The mice that had experienced ceruletide at 3 micrograms/kg for 5 times at intervals of 3-4 days demonstrated a significant increase in the sensitivity to methamphetamine, although the same treatment with 10-300 micrograms/kg of ceruletide was without effect. On the other hand, when 3-300 micrograms/kg of ceruletide was combined with 2 mg/kg of methamphetamine, the development of reverse tolerance to the ambulation-increasing effect of methamphetamine was inhibited dependently on the doses of ceruletide. However, the reverse tolerance to methamphetamine once established was scarcely modified by ceruletide when it was administered afterwards.

  18. Propagation research in Japan

    NASA Technical Reports Server (NTRS)

    Wakana, Hiromitsu

    1991-01-01

    L-band propagation measurements for land-mobile, maritime, and aeronautical satellite communications have been carried out by using the Japanese Engineering Test Satellite-Five (ETS-5) which was launched in Aug. 1987. This paper presents propagation characteristics for each of the mobile satellite communication channels.

  19. NASA Propagation Information Center

    NASA Technical Reports Server (NTRS)

    Smith, Ernest K.; Flock, Warren L.

    1989-01-01

    The NASA Propagation Information Center became formally operational in July 1988. It is located in the Department of Electrical and Computer Engineering of the University of Colorado at Boulder. The Center is several things: a communications medium for the propagation with the outside world, a mechanism for internal communication within the program, and an aid to management.

  20. Shallow-Water Propagation

    DTIC Science & Technology

    2016-06-07

    Shallow- Water Propagation William L. Siegmann Rensselaer Polytechnic Institute 110 Eighth Street Troy, New York 12180-3590 phone: (518) 276...ocean_acoustics LONG-TERM GOALS Develop methods for propagation and coherence calculations in complex shallow- water environments, determine...intensity and coherence. APPROACH (A) Develop high accuracy PE techniques for applications to shallow- water sediments, accounting for

  1. Millimeter wavelength propagation studies

    NASA Technical Reports Server (NTRS)

    Hodge, D. B.

    1974-01-01

    The investigations conducted for the Millimeter Wavelength Propagation Studies during the period December, 1966, to June 1974 are reported. These efforts included the preparation for the ATS-5 Millimeter Wavelength Propagation Experiment and the subsequent data acquisition and data analysis. The emphasis of the OSU participation in this experiment was placed on the determination of reliability improvement resulting from the use of space diversity on a millimeter wavelength earth-space communication link. Related measurements included the determination of the correlation between radiometric temperature and attenuation along the earth-space propagation path. Along with this experimental effort a theoretical model was developed for the prediction of attenuation statistics on single and spatially separated earth space propagation paths. A High Resolution Radar/Radiometer System and Low Resolution Radar System were developed and implemented for the study of intense rain cells in preparation for the ATS-6 Millimeter Wavelength Propagation Experiment.

  2. Foxa2 acts as a co-activator potentiating expression of the Nurr1-induced DA phenotype via epigenetic regulation.

    PubMed

    Yi, Sang-Hoon; He, Xi-Biao; Rhee, Yong-Hee; Park, Chang-Hwan; Takizawa, Takumi; Nakashima, Kinichi; Lee, Sang-Hun

    2014-02-01

    Understanding how dopamine (DA) phenotypes are acquired in midbrain DA (mDA) neuron development is important for bioassays and cell replacement therapy for mDA neuron-associated disorders. Here, we demonstrate a feed-forward mechanism of mDA neuron development involving Nurr1 and Foxa2. Nurr1 acts as a transcription factor for DA phenotype gene expression. However, Nurr1-mediated DA gene expression was inactivated by forming a protein complex with CoREST, and then recruiting histone deacetylase 1 (Hdac1), an enzyme catalyzing histone deacetylation, to DA gene promoters. Co-expression of Nurr1 and Foxa2 was established in mDA neuron precursor cells by a positive cross-regulatory loop. In the presence of Foxa2, the Nurr1-CoREST interaction was diminished (by competitive formation of the Nurr1-Foxa2 activator complex), and CoREST-Hdac1 proteins were less enriched in DA gene promoters. Consequently, histone 3 acetylation (H3Ac), which is responsible for open chromatin structures, was strikingly increased at DA phenotype gene promoters. These data establish the interplay of Nurr1 and Foxa2 as the crucial determinant for DA phenotype acquisition during mDA neuron development.

  3. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging.

    PubMed

    Pocock, Ginger M; Zimdars, Laraine L; Yuan, Ming; Eliceiri, Kevin W; Ahlquist, Paul; Sherer, Nathan M

    2017-02-01

    Cis-acting RNA structural elements govern crucial aspects of viral gene expression. How these structures and other posttranscriptional signals affect RNA trafficking and translation in the context of single cells is poorly understood. Herein we describe a multicolor, long-term (>24 h) imaging strategy for measuring integrated aspects of viral RNA regulatory control in individual cells. We apply this strategy to demonstrate differential mRNA trafficking behaviors governed by RNA elements derived from three retroviruses (HIV-1, murine leukemia virus, and Mason-Pfizer monkey virus), two hepadnaviruses (hepatitis B virus and woodchuck hepatitis virus), and an intron-retaining transcript encoded by the cellular NXF1 gene. Striking behaviors include "burst" RNA nuclear export dynamics regulated by HIV-1's Rev response element and the viral Rev protein; transient aggregations of RNAs into discrete foci at or near the nuclear membrane triggered by multiple elements; and a novel, pulsiform RNA export activity regulated by the hepadnaviral posttranscriptional regulatory element. We incorporate single-cell tracking and a data-mining algorithm into our approach to obtain RNA element-specific, high-resolution gene expression signatures. Together these imaging assays constitute a tractable, systems-based platform for studying otherwise difficult to access spatiotemporal features of viral and cellular gene regulation.

  4. SET1 and p300 Act Synergistically, through Coupled Histone Modifications, in Transcriptional Activation by p53

    PubMed Central

    Tang, Zhanyun; Chen, Wei-Yi; Shimada, Miho; Nguyen, Uyen T.T.; Kim, Jaehoon; Sun, Xiao-Jian; Sengoku, Toru; McGinty, Robert K.; Fernandez, Joseph P.; Muir, Tom W.; Roeder, Robert G.

    2014-01-01

    SUMMARY The H3K4me3 mark in chromatin is closely correlated with actively transcribed genes, although the mechanisms involved in its generation and function are not fully understood. In vitro studies with recombinant chromatin and purified human factors demonstrate a robust SET1 complex (SET1C)-mediated H3K4 trimethylation that is dependent upon p53- and p300-mediated H3 acetylation, a corresponding SET1C-mediated enhancement of p53- and p300-dependent transcription that reflects a primary effect of SET1C through H3K4 trimethylation, and direct SET1C-p53 and SET1C-p300 interactions indicative of a targeted recruitment mechanism. Complementary cell-based assays demonstrate a DNA-damage-induced p53-SET1C interaction, a corresponding enrichment of SET1C and H3K4me3 on a p53 target gene (p21/WAF1), and a corresponding codependency of H3K4 trimethylation and transcription upon p300 and SET1C. These results establish a mechanism in which SET1C and p300 act cooperatively, through direct interactions and coupled histone modifications, to facilitate the function of p53. PMID:23870121

  5. Gear crack propagation investigations

    NASA Technical Reports Server (NTRS)

    Lewicki, David G.; Ballarini, Roberto

    1996-01-01

    Analytical and experimental studies were performed to investigate the effect of gear rim thickness on crack propagation life. The FRANC (FRacture ANalysis Code) computer program was used to simulate crack propagation. The FRANC program used principles of linear elastic fracture mechanics, finite element modeling, and a unique re-meshing scheme to determine crack tip stress distributions, estimate stress intensity factors, and model crack propagation. Various fatigue crack growth models were used to estimate crack propagation life based on the calculated stress intensity factors. Experimental tests were performed in a gear fatigue rig to validate predicted crack propagation results. Test gears were installed with special crack propagation gages in the tooth fillet region to measure bending fatigue crack growth. Good correlation between predicted and measured crack growth was achieved when the fatigue crack closure concept was introduced into the analysis. As the gear rim thickness decreased, the compressive cyclic stress in the gear tooth fillet region increased. This retarded crack growth and increased the number of crack propagation cycles to failure.

  6. Gear Crack Propagation Investigation

    NASA Technical Reports Server (NTRS)

    1995-01-01

    Reduced weight is a major design goal in aircraft power transmissions. Some gear designs incorporate thin rims to help meet this goal. Thin rims, however, may lead to bending fatigue cracks. These cracks may propagate through a gear tooth or into the gear rim. A crack that propagates through a tooth would probably not be catastrophic, and ample warning of a failure could be possible. On the other hand, a crack that propagates through the rim would be catastrophic. Such cracks could lead to disengagement of a rotor or propeller from an engine, loss of an aircraft, and fatalities. To help create and validate tools for the gear designer, the NASA Lewis Research Center performed in-house analytical and experimental studies to investigate the effect of rim thickness on gear-tooth crack propagation. Our goal was to determine whether cracks grew through gear teeth (benign failure mode) or through gear rims (catastrophic failure mode) for various rim thicknesses. In addition, we investigated the effect of rim thickness on crack propagation life. A finite-element-based computer program simulated gear-tooth crack propagation. The analysis used principles of linear elastic fracture mechanics, and quarter-point, triangular elements were used at the crack tip to represent the stress singularity. The program had an automated crack propagation option in which cracks were grown numerically via an automated remeshing scheme. Crack-tip stress-intensity factors were estimated to determine crack-propagation direction. Also, various fatigue crack growth models were used to estimate crack-propagation life. Experiments were performed in Lewis' Spur Gear Fatigue Rig to validate predicted crack propagation results. Gears with various backup ratios were tested to validate crack-path predictions. Also, test gears were installed with special crack-propagation gages in the tooth fillet region to measure bending-fatigue crack growth. From both predictions and tests, gears with backup ratios

  7. Factors Associated with Implementation of the South Carolina Students Health and Fitness Act of 2005: Elementary School Principals' and Physical Activity Directors' Ratings

    ERIC Educational Resources Information Center

    Evans, Miriam Jones

    2012-01-01

    This study explores factors associated with implementation of the physical education and physical activity standards of the South Carolina Students Health and Fitness Act of 2005 in Title I elementary schools. The study was framed using selected components of the diffusion of innovations theory, which looked at characteristics of the law and their…

  8. Progress in Prevention: Report on the National Study of Local Education Agency Activities under the Safe and Drug Free Schools and Communities Act.

    ERIC Educational Resources Information Center

    Hantman, Irene; Crosse, Scott

    Although school districts are critical to the operation of the Safe and Drug-Free Schools and Communities Act (SDFSCA) Program, relatively little is known about how they plan, implement, and evaluate their SDFSCA-funded prevention activities. The U.S. Department of Education initiated this study to provide a more complete description of the ways…

  9. Propagation of Environmental Noise

    ERIC Educational Resources Information Center

    Lyon, R. H.

    1973-01-01

    Solutions for environmental noise pollution lie in systematic study of many basic processes such as reflection, scattering, and spreading. Noise propagation processes should be identified in different situations and assessed for their relative importance. (PS)

  10. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project: Final ACT configuration evaluation. Final Report, October 1980-April 1981

    SciTech Connect

    Not Available

    1982-02-01

    The Final ACT Configuration Evaluation Task of the Integrated Application of Active Controls (IAAC) technology project within the energy efficient transport program is summarized. The Final ACT Configuration, through application of Active Controls Technology (ACT) in combination with increased wing span, exhibits significant performance improvements over the conventional baseline configuration. At the design range for these configurations, 3590 km, the block fuel used is 10% less for the Final ACT Configuration, with significant reductions in fuel usage at all operational ranges. Results of this improved fuel usage and additional system and airframe costs and the complexity required to achieve it were analyzed to determine its economic effects. For a 926 km mission, the incremental return on investment is nearly 25% at 1980 fuel prices. For longer range missions or increased fuel prices, the return is greater. The technical risks encountered in the Final ACT Configuration design and the research and development effort required to reduce these risks to levels acceptable for commercial airplane design are identified.

  11. Wave Propagation Program

    SciTech Connect

    McCandless, Kathleen; Petersson, Anders; Nilsson, Stefan; Sjogreen, Bjorn

    2007-01-08

    WPP is a massively parallel, 3D, C++, finite-difference elastodynamic wave propagation code. Typical applications for wave propagation with WPP include: evaluation of seismic event scenarios and damage from earthquakes, non-destructive evaluation of materials, underground facility detection, oil and gas exploration, predicting the electro-magnetic fields in accelerators, and acoustic noise generation. For more information, see User’s Manual [1].

  12. Performance test results of noninvasive characterization of Resource Conservation and Recovery Act surrogate waste by prompt gamma neutron activation analysis

    SciTech Connect

    Gehrke, R.J.; Streier, G.G.

    1997-03-01

    During FY-96, a performance test was carried out with funding from the Mixed Waste Focus Area (MWFA) of the Department of Energy (DOE) to determine the noninvasive elemental assay capabilities of commercial companies for Resource Conservation and Recovery Act (RCRA) metals present in 8-gal drums containing surrogate waste. Commercial companies were required to be experienced in the use of prompt gamma neutron activation analysis (PGNAA) techniques and to have a prototype assay system with which to conduct the test assays. Potential participants were identified through responses to a call for proposals advertised in the Commerce Business Daily and through personal contacts. Six companies were originally identified. Two of these six were willing and able to participate in the performance test, as described in the test plan, with some subsidizing from the DOE MWFA. The tests were conducted with surrogate sludge waste because (1) a large volume of this type of waste awaits final disposition and (2) sludge tends to be somewhat homogeneous. The surrogate concentrations of the above RCRA metals ranged from {approximately} 300 ppm to {approximately} 20,000 ppm. The lower limit was chosen as an estimate of the expected sensitivity of detection required by noninvasive, pretreatment elemental assay systems to be of value for operational and compliance purposes and to still be achievable with state-of-the-art methods of analysis. The upper limit of {approximately} 20,000 ppm was chosen because it is the opinion of the author that assay above this concentration level is within current state-of-the-art methods for most RCRA constituents. This report is organized into three parts: Part 1, Test Plan to Evaluate the Technical Status of Noninvasive Elemental Assay Techniques for Hazardous Waste; Part 2, Participants` Results; and Part 3, Evaluation of and Comments on Participants` Results.

  13. Chlamydia screening for sexually active young women under the Affordable Care Act: new opportunities and lingering barriers.

    PubMed

    Loosier, Penny S; Malcarney, Mary-Beth; Slive, Lauren; Cramer, Ryan C; Burgess, Brittany; Hoover, Karen W; Romaguera, Raul

    2014-09-01

    The Affordable Care Act of 2010 (ACA) contains a provision requiring private insurers issuing or renewing plans on or after September 23, 2010, to provide, without cost sharing, preventive services recommended by US Preventive Services Task Force (grades A and B), among other recommending bodies. As a grade A recommendation, chlamydia screening for sexually active young women 24 years and younger and older women at risk for chlamydia falls under this requirement. This article examines the potential effect on chlamydia screening among this population across private and public health plans and identifies lingering barriers not addressed by this legislation. Examination of the impact on women with private insurance touches upon the distinction between coverage under grandfathered plans, where the requirement does not apply, and nongrandfathered plans, where the requirement does apply. Acquisition of private health insurance through health insurance Marketplaces is also discussed. For public health plans, coverage of preventive services without cost sharing differs for individuals enrolled in standard Medicaid, covered under the Medicaid expansion included in the ACA, or those enrolled under the Children's Health Insurance Program or who fall under Early, Periodic, Screening, Diagnosis and Treatment criteria. The discussion of lingering barriers not addressed by the ACA includes the uninsured, physician reimbursement, cost sharing, confidentiality, low rates of appropriate sexual history taking by providers, and disclosures of sensitive information. In addition, the role of safety net programs that provide health care to individuals regardless of ability to pay is examined in light of the expectation that they also remain a payer of last resort.

  14. Memory re-differentiation and reduced lymphocyte activation in chronic HCV-infected patients receiving direct-acting antivirals.

    PubMed

    Burchill, M A; Golden-Mason, L; Wind-Rotolo, M; Rosen, H R

    2015-12-01

    Recently, the treatment of HCV has advanced significantly due to the introduction of direct-acting antivirals (DAAs). Studies using interferon (IFN)-containing regimens failed to consistently show restoration of immunologic responses. Therefore, IFN-free DAA formulations provide a unique opportunity to dissect the immunologic effect of HCV cure. This study investigates the restoration of the immune compartment as a consequence of rapid viral clearance in patients successfully treated with DAAs and in the absence of IFN and ribavirin. Here, we evaluate the immunologic changes that occurred following DAA-mediated HCV cure. Peripheral blood from nineteen previously treatment-naïve patients with chronic HCV genotype 1a/1b who received an IFN and ribavirin-free regimen of daclatasvir, asunaprevir and BMS-791325 was evaluated. Immune reconstitution occurs in patients in whom HCV was successfully eradicated via DAA therapy. Restoration of the CD4(+) T-cell compartment in the peripheral blood and a re-differentiation of the T lymphocyte memory compartment resulted in a more effector memory cell population and a reduction in expression in the co-inhibitory molecule TIGIT in bulk T lymphocytes. Furthermore, we observed a partial reversal of the exhausted phenotype in HCV-specific CD8(+) T cells and a dampening of the activation state in peripheral NK cells. Collectively, our data provide the groundwork for dissecting the effect of DAA therapy on the immune system and identifying novel mechanisms by which chronic HCV infection exerts immunosuppressive effects on T cells through the recently described co-inhibitory molecule TIGIT.

  15. 20 CFR 652.209 - What are the requirements under the Act for providing reemployment services and other activities...

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... FUNCTIONING OF STATE EMPLOYMENT SERVICES Wagner-Peyser Act Services in a One-Stop Delivery System Environment... part of the One-Stop delivery system, must provide reemployment services to UI claimants for whom...

  16. Comparing Adaptive Control of Thought-Rational (ACT-R) Baseline Activation Terms for Implementation in the Symbolic and Subsymbolic Robotic Intelligence Control System (SS-RICS)

    DTIC Science & Technology

    2014-04-01

    Comparing Adaptive Control of Thought–Rational (ACT-R) Baseline Activation Terms for Implementation in the Symbolic and Subsymbolic Robotic ...Baseline Activation Terms for Implementation in the Symbolic and Subsymbolic Robotic Intelligence Control System (SS-RICS) Craig T. Lennon...Implementation in the Symbolic and Subsymbolic Robotic Intelligence Control System (SS-RICS) 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  17. Specificity, propagation, and memory of pericentric heterochromatin

    PubMed Central

    Müller-Ott, Katharina; Erdel, Fabian; Matveeva, Anna; Mallm, Jan-Philipp; Rademacher, Anne; Hahn, Matthias; Bauer, Caroline; Zhang, Qin; Kaltofen, Sabine; Schotta, Gunnar; Höfer, Thomas; Rippe, Karsten

    2014-01-01

    The cell establishes heritable patterns of active and silenced chromatin via interacting factors that set, remove, and read epigenetic marks. To understand how the underlying networks operate, we have dissected transcriptional silencing in pericentric heterochromatin (PCH) of mouse fibroblasts. We assembled a quantitative map for the abundance and interactions of 16 factors related to PCH in living cells and found that stably bound complexes of the histone methyltransferase SUV39H1/2 demarcate the PCH state. From the experimental data, we developed a predictive mathematical model that explains how chromatin-bound SUV39H1/2 complexes act as nucleation sites and propagate a spatially confined PCH domain with elevated histone H3 lysine 9 trimethylation levels via chromatin dynamics. This “nucleation and looping” mechanism is particularly robust toward transient perturbations and stably maintains the PCH state. These features make it an attractive model for establishing functional epigenetic domains throughout the genome based on the localized immobilization of chromatin-modifying enzymes. PMID:25134515

  18. Dike Propagation Near Drifts

    SciTech Connect

    NA

    2002-03-04

    The purpose of this Analysis and Model Report (AMR) supporting the Site Recommendation/License Application (SR/LA) for the Yucca Mountain Project is the development of elementary analyses of the interactions of a hypothetical dike with a repository drift (i.e., tunnel) and with the drift contents at the potential Yucca Mountain repository. This effort is intended to support the analysis of disruptive events for Total System Performance Assessment (TSPA). This AMR supports the Process Model Report (PMR) on disruptive events (CRWMS M&O 2000a). This purpose is documented in the development plan (DP) ''Coordinate Modeling of Dike Propagation Near Drifts Consequences for TSPA-SR/LA'' (CRWMS M&O 2000b). Evaluation of that Development Plan and the work to be conducted to prepare Interim Change Notice (ICN) 1 of this report, which now includes the design option of ''Open'' drifts, indicated that no revision to that DP was needed. These analyses are intended to provide reasonable bounds for a number of expected effects: (1) Temperature changes to the waste package from exposure to magma; (2) The gas flow available to degrade waste containers during the intrusion; (3) Movement of the waste package as it is displaced by the gas, pyroclasts and magma from the intruding dike (the number of packages damaged); (4) Movement of the backfill (Backfill is treated here as a design option); (5) The nature of the mechanics of the dike/drift interaction. These analyses serve two objectives: to provide preliminary analyses needed to support evaluation of the consequences of an intrusive event and to provide a basis for addressing some of the concerns of the Nuclear Regulatory Commission (NRC) expressed in the Igneous Activity Issue Resolution Status Report.

  19. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project: Current and advanced act control system definition study, volume 1

    NASA Technical Reports Server (NTRS)

    Hanks, G. W.; Shomber, H. A.; Dethman, H. A.; Gratzer, L. B.; Maeshiro, A.; Gangsaas, D.; Blight, J. D.; Buchan, S. M.; Crumb, C. B.; Dorwart, R. J.

    1981-01-01

    An active controls technology (ACT) system architecture was selected based on current technology system elements and optimal control theory was evaluated for use in analyzing and synthesizing ACT multiple control laws. The system selected employs three redundant computers to implement all of the ACT functions, four redundant smaller computers to implement the crucial pitch-augmented stability function, and a separate maintenance and display computer. The reliability objective of probability of crucial function failure of less than 1 x 10 to the -9th power per flight of 1 hr can be met with current technology system components, if the software is assumed fault free and coverage approaching 1.0 can be provided. The optimal control theory approach to ACT control law synthesis yielded comparable control law performance much more systematically and directly than the classical s-domain approach. The ACT control law performance, although somewhat degraded by the inclusion of representative nonlinearities, remained quite effective. Certain high-frequency gust-load alleviation functions may require increased surface rate capability.

  20. DROMO Propagator Revisited

    NASA Astrophysics Data System (ADS)

    Urrutxua, H.; Sanjurjo-Rivo, M.; Peláez, J.

    2013-12-01

    In year 2000 a house-made orbital propagator was developed by the SDGUPM (former Grupo de Dinámica de Tethers) based in a set of redundant variables including Euler parameters. This propagator was called DROMO. and it was mainly used in numerical simulations of electrodynamic tethers. It was presented for the first time in the international meeting V Jornadas de Trabajo en Mecánica Celeste, held in Albarracín, Spain, in 2002 (see reference 1). The special perturbation method associated with DROMO can be consulted in the paper.2 In year 1975, Andre Deprit in reference 3 proposes a propagation scheme very similar to the one in which DROMO is based, by using the ideal frame concept of Hansen. The different approaches used in references 3 and 2 gave rise to a small controversy. In this paper we carried out a different deduction of the DROMO propagator, underlining its close relation with the Hansen ideal frame concept, and also the similarities and the differences with the theory carried out by Deprit in 3. Simultaneously we introduce some improvements in the formulation that leads to a more synthetic propagator.

  1. Hypersonic phonon propagation in one-dimensional surface phononic crystal

    NASA Astrophysics Data System (ADS)

    Graczykowski, B.; Sledzinska, M.; Kehagias, N.; Alzina, F.; Reparaz, J. S.; Sotomayor Torres, C. M.

    2014-03-01

    Hypersonic, thermally activated surface acoustic waves propagating in the surface of crystalline silicon patterned with periodic stripes were studied by Brillouin light scattering. Two characteristic directions (normal and parallel to the stripes) of surface acoustic waves propagation were examined exhibiting a distinctive propagation behavior. The measured phononic band structure exhibits diverse features, such as zone folding, band gap opening, and hybridization to local resonance for waves propagating normal to the stripes, and a variety of dispersive modes propagating along the stripes. Experimental results were supported by theoretical calculations performed using finite element method.

  2. Elevated Temperature Crack Propagation

    NASA Technical Reports Server (NTRS)

    Orange, Thomas W.

    1994-01-01

    This paper is a summary of two NASA contracts on high temperature fatigue crack propagation in metals. The first evaluated the ability of fairly simple nonlinear fracture parameters to correlate crack propagation. Hastelloy-X specimens were tested under isothermal and thermomechanical cycling at temperatures up to 980 degrees C (1800 degrees F). The most successful correlating parameter was the crack tip opening displacement derived from the J-integral. The second evaluated the ability of several path-independent integrals to correlate crack propagation behavior. Inconel 718 specimens were tested under isothermal, thermomechanical, temperature gradient, and creep conditions at temperatures up to 650 degrees C (1200 degrees F). The integrals formulated by Blackburn and by Kishimoto correlated the data reasonably well under all test conditions.

  3. Elevated temperature crack propagation

    SciTech Connect

    Orange, T.W.

    1994-02-01

    This paper is a summary of two NASA contracts on high temperature fatigue crack propagation in metals. The first evaluated the ability of fairly simple nonlinear fracture parameters to correlate crack propagation. Hastelloy-X specimens were tested under isothermal and thermomechanical cycling at temperatures up to 980 degrees C (1800 degrees F). The most successful correlating parameter was the crack tip opening displacement derived from the J-integral. The second evaluated the ability of several path-independent integrals to correlate crack propagation behavior. Inconel 718 specimens were tested under isothermal, thermomechanical, temperature gradient, and creep conditions at temperatures up to 650 degrees C (1200 degrees F). The integrals formulated by Blackburn and by Kishimoto correlated the data reasonably well under all test conditions.

  4. Turbofan Duct Propagation Model

    NASA Technical Reports Server (NTRS)

    Lan, Justin H.; Posey, Joe W. (Technical Monitor)

    2001-01-01

    The CDUCT code utilizes a parabolic approximation to the convected Helmholtz equation in order to efficiently model acoustic propagation in acoustically treated, complex shaped ducts. The parabolic approximation solves one-way wave propagation with a marching method which neglects backwards reflected waves. The derivation of the parabolic approximation is presented. Several code validation cases are given. An acoustic lining design process for an example aft fan duct is discussed. It is noted that the method can efficiently model realistic three-dimension effects, acoustic lining, and flow within the computational capabilities of a typical computer workstation.

  5. 10 CFR 50.13 - Attacks and destructive acts by enemies of the United States; and defense activities.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Attacks and destructive acts by enemies of the United... LICENSING OF PRODUCTION AND UTILIZATION FACILITIES Requirement of License, Exceptions § 50.13 Attacks and... required to provide for design features or other measures for the specific purpose of protection...

  6. 10 CFR 50.13 - Attacks and destructive acts by enemies of the United States; and defense activities.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Attacks and destructive acts by enemies of the United... LICENSING OF PRODUCTION AND UTILIZATION FACILITIES Requirement of License, Exceptions § 50.13 Attacks and... required to provide for design features or other measures for the specific purpose of protection...

  7. 50 CFR 80.50 - What activities are eligible for funding under the Pittman-Robertson Wildlife Restoration Act?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... under the Pittman-Robertson Wildlife Restoration Act? 80.50 Section 80.50 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR (CONTINUED) FINANCIAL ASSISTANCE-WILDLIFE...-oriented recreation. (7) Operate or maintain: (i) Projects that the State fish and wildlife...

  8. 77 FR 59204 - Agency Information Collection Activities: Affidavit of Support Under Section 213A of the Act...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-26

    ... Section 213A of the Act; Form I-864W, Intending Immigrant's Affidavit of Support Exemption; Revision of a..., Intending Immigrant's Affidavit of Support Exemption; USCIS. (4) Affected public who will be asked or... by family-based and certain employment-based immigrants to have the petitioning relative execute...

  9. Transcriptional activation of the herpes simplex virus type 1 UL38 promoter conferred by the cis-acting downstream activation sequence is mediated by a cellular transcription factor.

    PubMed

    Guzowski, J F; Singh, J; Wagner, E K

    1994-12-01

    The herpes simplex virus (HSV) type 1 strict late (gamma) UL38 promoter contains three cis-acting transcriptional elements: a TATA box, a specific initiator element, and the downstream activation sequence (DAS). DAS is located between positions +20 and +33 within the 5' untranslated leader region and strongly influences transcript levels during productive infection. In this communication, we further characterize DAS and investigate its mechanism of action. DAS function has a strict spacing requirement, and DAS contains an essential 6-bp core element. A similarly positioned element from the gamma gC gene (UL44) has partial DAS function within the UL38 promoter context, and the promoter controlling expression of the gamma US11 transcript contains an identically located element with functional and sequence similarity to UL38 DAS. These data suggest that downstream elements are a common feature of many HSV gamma promoters. Results with recombinant viruses containing modifications of the TATA box or initiator element of the UL38 promoter suggest that DAS functions to increase transcription initiation and not the efficiency of transcription elongation. In vitro transcription assays using uninfected HeLa nuclear extracts show that, as in productive infection with recombinant viruses, the deletion of DAS from the UL38 promoter dramatically decreases RNA expression. Finally, electrophoretic mobility shift assays and UV cross-linking experiments show that DAS DNA forms a specific, stable complex with a cellular protein (the DAS-binding factor) of approximately 35 kDa. These data strongly suggest that the interaction of cellular DAS-binding factor with DAS is required for efficient expression of UL38 and other HSV late genes.

  10. DROMO propagator revisited

    NASA Astrophysics Data System (ADS)

    Urrutxua, Hodei; Sanjurjo-Rivo, Manuel; Peláez, Jesús

    2016-01-01

    In the year 2000 an in-house orbital propagator called DROMO (Peláez et al. in Celest Mech Dyn Astron 97:131-150, 2007. doi: 10.1007/s10569-006-9056-3) was developed by the Space Dynamics Group of the Technical University of Madrid, based in a set of redundant variables including Euler-Rodrigues parameters. An original deduction of the DROMO propagator is carried out, underlining its close relation with the ideal frame concept introduced by Hansen (Abh der Math-Phys Cl der Kon Sachs Ges der Wissensch 5:41-218, 1857). Based on the very same concept, Deprit (J Res Natl Bur Stand Sect B Math Sci 79B(1-2):1-15, 1975) proposed a formulation for orbit propagation. In this paper, similarities and differences with the theory carried out by Deprit are analyzed. Simultaneously, some improvements are introduced in the formulation, that lead to a more synthetic and better performing propagator. Also, the long-term effect of the oblateness of the primary is studied in terms of DROMO variables, and new numerical results are presented to evaluate the performance of the method.

  11. PROPER: Optical propagation routines

    NASA Astrophysics Data System (ADS)

    Krist, John E.

    2014-05-01

    PROPER simulates the propagation of light through an optical system using Fourier transform algorithms (Fresnel, angular spectrum methods). Distributed as IDL source code, it includes routines to create complex apertures, aberrated wavefronts, and deformable mirrors. It is especially useful for the simulation of high contrast imaging telescopes (extrasolar planet imagers like TPF).

  12. Synaptic Contacts Enhance Cell-to-Cell Tau Pathology Propagation.

    PubMed

    Calafate, Sara; Buist, Arjan; Miskiewicz, Katarzyna; Vijayan, Vinoy; Daneels, Guy; de Strooper, Bart; de Wit, Joris; Verstreken, Patrik; Moechars, Diederik

    2015-05-26

    Accumulation of insoluble Tau protein aggregates and stereotypical propagation of Tau pathology through the brain are common hallmarks of tauopathies, including Alzheimer's disease (AD). Propagation of Tau pathology appears to occur along connected neurons, but whether synaptic contacts between neurons are facilitating propagation has not been demonstrated. Using quantitative in vitro models, we demonstrate that, in parallel to non-synaptic mechanisms, synapses, but not merely the close distance between the cells, enhance the propagation of Tau pathology between acceptor hippocampal neurons and Tau donor cells. Similarly, in an artificial neuronal network using microfluidic devices, synapses and synaptic activity are promoting neuronal Tau pathology propagation in parallel to the non-synaptic mechanisms. Our work indicates that the physical presence of synaptic contacts between neurons facilitate Tau pathology propagation. These findings can have implications for synaptic repair therapies, which may turn out to have adverse effects by promoting propagation of Tau pathology.

  13. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project: Test act system description

    NASA Technical Reports Server (NTRS)

    1983-01-01

    The engineering and fabrication of the test ACT system, produced in the third program element of the IAAC Project is documented. The system incorporates pitch-augmented stability and wing-load alleviation, plus full authority fly-by-wire control of the elevators. The pitch-augmented stability is designed to have reliability sufficient to allow flight with neutral or negative inherent longitudinal stability.

  14. Results of screening activities in salt states prior to the enactment of the Nationall Waste Policy Act

    SciTech Connect

    Carbiener, W.A.

    1983-01-01

    The identification of potential sites for a nuclear waste repository through screening procedures in the salt states is a well-established, deliberate process. This screening process has made it possible to carry out detailed studies of many of the most promising potential sites, and general studies of all the sites, in anticipation of the siting guidelines specified in the Nuclear Waste Policy Act. The screening work completed prior to the passage of the Act allowed the Secretary of Energy to identify seven salt sites as potentially acceptable under the provisions of Section 116(a) of the Act. These sites were formally identified by letters from Secretary Hodel to the states of Texas, Utah, Mississippi, and Louisiana on February 2, 1983. The potentially acceptable salt sites were in Deaf Smith and Swisher Counties in Texas; Davis and Lavender Canyons in the Gibson Dome location in Utah; Richton and Cypress Creek Domes in Mississippi; and Vacherie Dome in Louisiana. Further screening will include comparison of each potentially acceptable site against disqualification factors and selection of a preferred site in each of the three geohydrologic settings from those remaining, in accordance with the siting guidelines. These steps will be documented in statutory Environmental Assessments prepared for each site to be nominated for detailed characterization. 9 references.

  15. Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project: Current and advanced act control system definition study

    NASA Technical Reports Server (NTRS)

    1982-01-01

    The Current and Advanced Technology ACT control system definition tasks of the Integrated Application of Active Controls (IAAC) Technology project within the Energy Efficient Transport Program are summarized. The systems mechanize six active control functions: (1) pitch augmented stability; (2) angle of attack limiting; (3) lateral/directional augmented stability; (4) gust load alleviation; (5) maneuver load control; and (6) flutter mode control. The redundant digital control systems meet all function requirements with required reliability and declining weight and cost as advanced technology is introduced.

  16. In vitro propagation by asymbiotic seed germination and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity studies of tissue culture raised plants of three medicinally important species of dendrobium.

    PubMed

    Lo, Shu-Fung; Nalawade, Satish Manohar; Mulabagal, Vanisree; Matthew, Susan; Chen, Chung-Li; Kuo, Chao-Lin; Tsay, Hsin-Sheng

    2004-05-01

    A simple and efficient plant propagation system has been developed by asymbiotic germination of seeds in three medicinally important Dendrobium species, namely, Dendrobium tosaense, Dendrobium moniliforme, and Dendrobium linawianum. Plants obtained from natural habitats were grown in the greenhouse. The flowers were hand pollinated. Seeds of the capsules derived after 12 weeks of hand-pollination germinated asymbiotically (50-74%) on half strength Murashige and Skoog's (MS) basal medium with 3% sucrose and solidified with 0.9% Difco agar. Active growth in the germinated seedlings was achieved by re-culturing on full strength MS basal medium supplemented with 8% banana homogenate, 8% potato homogenate, 8% coconut water, 1.5% sucrose and 0.9% Difco agar. Healthy plantlets, transferred to plastic trays containing moss or moss and tree fern, successfully acclimatized (84-100%) in the greenhouse. A marked varied response was observed in the free radical scavenging activity of methanolic extracts of in vitro propagated plants, on 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical using a UV spectrophotometer assay. Methanolic extracts were prepared by dissolving the powdered plant material, obtained from six months old in vitro propagated plants, each about 5 g, in boiling methanol. The percentage of scavenging effect of D. tosaense extract was 95.9% at 0.4 mg/ml concentration, whereas D. monoliforme, and D. linawianum extracts scavenged 83.4% and 92.3%, respectively, at a concentration of 0.4 mg/ml. All the extracts scavenged DPPH radical significantly in a concentration dependent manner.

  17. A Database for Propagation Models

    NASA Technical Reports Server (NTRS)

    Kantak, Anil V.; Rucker, James

    1997-01-01

    The Propagation Models Database is designed to allow the scientists and experimenters in the propagation field to process their data through many known and accepted propagation models. The database is an Excel 5.0 based software that houses user-callable propagation models of propagation phenomena. It does not contain a database of propagation data generated out of the experiments. The database not only provides a powerful software tool to process the data generated by the experiments, but is also a time- and energy-saving tool for plotting results, generating tables and producing impressive and crisp hard copy for presentation and filing.

  18. The Redox Cycler Plasmodione Is a Fast-Acting Antimalarial Lead Compound with Pronounced Activity against Sexual and Early Asexual Blood-Stage Parasites

    PubMed Central

    Ehrhardt, Katharina; Deregnaucourt, Christiane; Goetz, Alice-Anne; Tzanova, Tzvetomira; Gallo, Valentina; Arese, Paolo; Pradines, Bruno; Adjalley, Sophie H.; Bagrel, Denyse; Blandin, Stephanie; Lanzer, Michael

    2016-01-01

    Previously, we presented the chemical design of a promising series of antimalarial agents, 3-[substituted-benzyl]-menadiones, with potent in vitro and in vivo activities. Ongoing studies on the mode of action of antimalarial 3-[substituted-benzyl]-menadiones revealed that these agents disturb the redox balance of the parasitized erythrocyte by acting as redox cyclers—a strategy that is broadly recognized for the development of new antimalarial agents. Here we report a detailed parasitological characterization of the in vitro activity profile of the lead compound 3-[4-(trifluoromethyl)benzyl]-menadione 1c (henceforth called plasmodione) against intraerythrocytic stages of the human malaria parasite Plasmodium falciparum. We show that plasmodione acts rapidly against asexual blood stages, thereby disrupting the clinically relevant intraerythrocytic life cycle of the parasite, and furthermore has potent activity against early gametocytes. The lead's antiplasmodial activity was unaffected by the most common mechanisms of resistance to clinically used antimalarials. Moreover, plasmodione has a low potential to induce drug resistance and a high killing speed, as observed by culturing parasites under continuous drug pressure. Drug interactions with licensed antimalarial drugs were also established using the fixed-ratio isobologram method. Initial toxicological profiling suggests that plasmodione is a safe agent for possible human use. Our studies identify plasmodione as a promising antimalarial lead compound and strongly support the future development of redox-active benzylmenadiones as antimalarial agents. PMID:27297478

  19. Glucocorticoid acts on a putative G protein-coupled receptor to rapidly regulate the activity of NMDA receptors in hippocampal neurons.

    PubMed

    Zhang, Yanmin; Sheng, Hui; Qi, Jinshun; Ma, Bei; Sun, Jihu; Li, Shaofeng; Ni, Xin

    2012-04-01

    Glucocorticoids (GCs) have been demonstrated to act through both genomic and nongenomic mechanisms. The present study demonstrated that corticosterone rapidly suppressed the activity of N-methyl-D-aspartate (NMDA) receptors in cultured hippocampal neurons. The effect was maintained with corticosterone conjugated to bovine serum albumin and blocked by inhibition of G protein activity with intracellular GDP-β-S application. Corticosterone increased GTP-bound G(s) protein and cyclic AMP (cAMP) production, activated phospholipase Cβ(3) (PLC-β(3)), and induced inositol-1,4,5-triphosphate (IP(3)) production. Blocking PLC and the downstream cascades with PLC inhibitor, IP(3) receptor antagonist, Ca(2+) chelator, and protein kinase C (PKC) inhibitors prevented the actions of corticosterone. Blocking adenylate cyclase (AC) and protein kinase A (PKA) caused a decrease in NMDA-evoked currents. Application of corticosterone partly reversed the inhibition of NMDA currents caused by blockage of AC and PKA. Intracerebroventricular administration of corticosterone significantly suppressed long-term potentiation (LTP) in the CA1 region of the hippocampus within 30 min in vivo, implicating the possibly physiological significance of rapid effects of GC on NMDA receptors. Taken together, our results indicate that GCs act on a putative G protein-coupled receptor to activate multiple signaling pathways in hippocampal neurons, and the rapid suppression of NMDA activity by GCs is dependent on PLC and downstream signaling.

  20. Propagating Instabilities in Solids

    NASA Astrophysics Data System (ADS)

    Kyriakides, Stelios

    1998-03-01

    Instability is one of the factors which limit the extent to which solids can be loaded or deformed and plays a pivotal role in the design of many structures. Such instabilities often result in localized deformation which precipitates catastrophic failure. Some materials have the capacity to recover their stiffness following a certain amount of localized deformation. This local recovery in stiffness arrests further local deformation and spreading of the instability to neighboring material becomes preferred. Under displacement controlled loading the propagation of the transition fronts can be achieved in a steady-state manner at a constant stress level known as the propagation stress. The stresses in the transition fronts joining the highly deformed zone to the intact material overcome the instability nucleation stresses and, as a result, the propagation stress is usually much lower than the stress required to nucleate the instability. The classical example of this class of material instabilities is L/"uders bands which tend to affect mild steels and other metals. Recent work has demonstrated that propagating instabilities occur in several other materials. Experimental and analytical results from four examples will be used to illustrate this point: First the evolution of L=FCders bands in mild steel strips will be revisited. The second example involves the evolution of stress induced phase transformations (austenite to martensite phases and the reverse) in a shape memory alloy under displacement controlled stretching. The third example is the crushing behavior of cellular materials such as honeycombs and foams made from metals and polymers. The fourth example involves the axial broadening/propagation of kink bands in aligned fiber/matrix composites under compression. The microstructure and, as a result, the micromechanisms governing the onset, localization, local arrest and propagation of instabilities in each of the four materials are vastly different. Despite this

  1. Waves on Reissner's membrane: a mechanism for the propagation of otoacoustic emissions from the cochlea.

    PubMed

    Reichenbach, Tobias; Stefanovic, Aleksandra; Nin, Fumiaki; Hudspeth, A J

    2012-04-19

    Sound is detected and converted into electrical signals within the ear. The cochlea not only acts as a passive detector of sound, however, but can also produce tones itself. These otoacoustic emissions are a striking manifestation of the cochlea's mechanical active process. A controversy remains of how these mechanical signals propagate back to the middle ear, from which they are emitted as sound. Here, we combine theoretical and experimental studies to show that mechanical signals can be transmitted by waves on Reissner's membrane, an elastic structure within the cochlea. We develop a theory for wave propagation on Reissner's membrane and its role in otoacoustic emissions. Employing a scanning laser interferometer, we measure traveling waves on Reissner's membrane in the gerbil, guinea pig, and chinchilla. The results are in accord with the theory and thus support a role for Reissner's membrane in otoacoustic emissions.

  2. Longitudinal elastic wave propagation characteristics of inertant acoustic metamaterials

    NASA Astrophysics Data System (ADS)

    Kulkarni, Prateek P.; Manimala, James M.

    2016-06-01

    Longitudinal elastic wave propagation characteristics of acoustic metamaterials with various inerter configurations are investigated using their representative one-dimensional discrete element lattice models. Inerters are dynamic mass-amplifying mechanical elements that are activated by a difference in acceleration across them. They have a small device mass but can provide a relatively large dynamic mass presence depending on accelerations in systems that employ them. The effect of introducing inerters both in local attachments and in the lattice was examined vis-à-vis the propagation characteristics of locally resonant acoustic metamaterials. A simple effective model based on mass, stiffness, or their combined equivalent was used to establish dispersion behavior and quantify attenuation within bandgaps. Depending on inerter configurations in local attachments or in the lattice, both up-shift and down-shift in the bandgap frequency range and their extent are shown to be possible while retaining static mass addition to the host structure to a minimum. Further, frequency-dependent negative and even extreme effective-stiffness regimes are encountered. The feasibility of employing tuned combinations of such mass-delimited inertant configurations to engineer acoustic metamaterials that act as high-pass filters without the use of grounded elements or even as complete longitudinal wave inhibitors is shown. Potential device implications and strategies for practical applications are also discussed.

  3. Radar propagation in coastal environments: Vampira results

    NASA Astrophysics Data System (ADS)

    Essen, Helmut; Fuchs, Hans-Hellmuth; Pagels, Anke

    2006-09-01

    The performance of sensors operating in coastal environments is severely influenced by the actual atmospheric conditions and the sea surface. Propagation models are in existence, which cope with the varying environment and allow a performance prediction for sensors in different bands of the electromagnetic spectrum. Model calculations give evidence for a complementary performance of sensors operating in the IR region and at radar frequencies ranging from X- to W-band. To validate existing radar propagation models like TERPEM and to compare IR with mm-wave propagation over sea under various atmospherically conditions, joint experiments with IR- and radar sensors were conducted over transmission ranges well beyond the horizon. For the measurements a naval vessel was moving on outbound and inbound courses ranging from the sensor site over the horizon, carrying corner reflectors acting as point targets at different heights above sea. This allowed a thorough investigation of duct propagation at different heights above the sea surface. The measurements were accompanied by a detailed environmental characterization of the sea surface and the atmosphere. The paper describes the experimental approach and gives representative results for measurement and simulation. The implications on performance especially for a multispectral (IR/mmW) approach are discussed.

  4. 20 CFR 667.220 - What Workforce Investment Act title I functions and activities constitute the costs of...

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., utilities, office supplies, postage, and rental and maintenance of office space; (4) Travel costs incurred..., and demand occupation information; (iii) Performance and program cost information on eligible providers of training services, youth activities, and appropriate education activities; (iv) Local...

  5. 20 CFR 667.220 - What Workforce Investment Act title I functions and activities constitute the costs of...

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ..., utilities, office supplies, postage, and rental and maintenance of office space; (4) Travel costs incurred..., and demand occupation information; (iii) Performance and program cost information on eligible providers of training services, youth activities, and appropriate education activities; (iv) Local...

  6. 20 CFR 667.220 - What Workforce Investment Act title I functions and activities constitute the costs of...

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ..., utilities, office supplies, postage, and rental and maintenance of office space; (4) Travel costs incurred..., and demand occupation information; (iii) Performance and program cost information on eligible providers of training services, youth activities, and appropriate education activities; (iv) Local...

  7. 20 CFR 667.220 - What Workforce Investment Act title I functions and activities constitute the costs of...

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., utilities, office supplies, postage, and rental and maintenance of office space; (4) Travel costs incurred..., and demand occupation information; (iii) Performance and program cost information on eligible providers of training services, youth activities, and appropriate education activities; (iv) Local...

  8. 20 CFR 667.220 - What Workforce Investment Act title I functions and activities constitute the costs of...

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ..., utilities, office supplies, postage, and rental and maintenance of office space; (4) Travel costs incurred..., and demand occupation information; (iii) Performance and program cost information on eligible providers of training services, youth activities, and appropriate education activities; (iv) Local...

  9. Atmospheric sound propagation

    NASA Technical Reports Server (NTRS)

    Cook, R. K.

    1969-01-01

    The propagation of sound waves at infrasonic frequencies (oscillation periods 1.0 - 1000 seconds) in the atmosphere is being studied by a network of seven stations separated geographically by distances of the order of thousands of kilometers. The stations measure the following characteristics of infrasonic waves: (1) the amplitude and waveform of the incident sound pressure, (2) the direction of propagation of the wave, (3) the horizontal phase velocity, and (4) the distribution of sound wave energy at various frequencies of oscillation. Some infrasonic sources which were identified and studied include the aurora borealis, tornadoes, volcanos, gravity waves on the oceans, earthquakes, and atmospheric instability waves caused by winds at the tropopause. Waves of unknown origin seem to radiate from several geographical locations, including one in the Argentine.

  10. Presentations of the Ninth Advanced Communications Technology Satellite Propagation Studies Workshop (APSW IX)

    NASA Technical Reports Server (NTRS)

    Golshan, Nasser (Editor)

    1997-01-01

    The Advanced Communications Technology Satellite Propagation Studies Workshop (APSW) is convened each year to present the results of the ACTS Propagation Campaign. Representatives from the satellite communications (satcom) industry, academia, and government are invited to APSW for discussions and exchange of information. The ACTS Propagation campaign is completing three years of Ka-Band data collection at seven sites in North America. Through this effort, NASA is making a major contribution to growth of satcom services by providing timely propagation data and models for predicting the performance of Ka-Band satellite communications systems.

  11. Florida's propagation report

    NASA Technical Reports Server (NTRS)

    Helmken, Henry; Henning, Rudolf

    1994-01-01

    One of the key goals of the Florida Center is to obtain a maximum of useful information on propagation behavior unique to its subtropical weather and subtropical climate. Such weather data is of particular interest when it is (or has the potential to become) useful for developing and implementing techniques to compensate for adverse weather effects. Also discussed are data observations, current challenges, CDF's, sun movement, and diversity experiments.

  12. Transionospheric Propagation Code (TIPC)

    SciTech Connect

    Roussel-Dupre, R.; Kelley, T.A.

    1990-10-01

    The Transionospheric Propagation Code is a computer program developed at Los Alamos National Lab to perform certain tasks related to the detection of vhf signals following propagation through the ionosphere. The code is written in Fortran 77, runs interactively and was designed to be as machine independent as possible. A menu format in which the user is prompted to supply appropriate parameters for a given task has been adopted for the input while the output is primarily in the form of graphics. The user has the option of selecting from five basic tasks, namely transionospheric propagation, signal filtering, signal processing, DTOA study, and DTOA uncertainty study. For the first task a specified signal is convolved against the impulse response function of the ionosphere to obtain the transionospheric signal. The user is given a choice of four analytic forms for the input pulse or of supplying a tabular form. The option of adding Gaussian-distributed white noise of spectral noise to the input signal is also provided. The deterministic ionosphere is characterized to first order in terms of a total electron content (TEC) along the propagation path. In addition, a scattering model parameterized in terms of a frequency coherence bandwidth is also available. In the second task, detection is simulated by convolving a given filter response against the transionospheric signal. The user is given a choice of a wideband filter or a narrowband Gaussian filter. It is also possible to input a filter response. The third task provides for quadrature detection, envelope detection, and three different techniques for time-tagging the arrival of the transionospheric signal at specified receivers. The latter algorithms can be used to determine a TEC and thus take out the effects of the ionosphere to first order. Task four allows the user to construct a table of delta-times-of-arrival (DTOAs) vs TECs for a specified pair of receivers.

  13. Nonlinear Wave Propagation

    DTIC Science & Technology

    2009-02-09

    of parameters. Hence one expects that the solutions of the two equations , PES and NLS, are comparable. In Fig. 3 we plot the two solutions for...power saturated term, in the PES equation ) have stable soliton solutions or mode-locking evolution. In general the solitons are found to be unstable...literature. Generally speaking, the above lattice equations omitting nonlinear terms have solutions propagating along z direction, i.e., ψ(r, z) = e−iµzϕ(r

  14. ADP-Ribosylation Factor 6 Acts as an Allosteric Activator for the Folded but not Disordered Cholera Toxin A1 Polypeptide

    PubMed Central

    Banerjee, Tuhina; Taylor, Michael; Jobling, Michael G.; Burress, Helen; Yang, ZhiJie; Serrano, Albert; Holmes, Randall K.; Tatulian, Suren A.; Teter, Ken

    2014-01-01

    Summary The catalytic A1 subunit of cholera toxin (CTA1) has a disordered structure at 37°C. An interaction with host factors must therefore place CTA1 in a folded conformation for the modification of its Gsα target which resides in a lipid raft environment. Host ADP-ribosylation factors (ARFs) act as in vitro allosteric activators of CTA1, but the molecular events of this process are not fully characterized. Isotope-edited Fourier transform infrared spectroscopy monitored ARF6-induced structural changes to CTA1, which were correlated to changes in CTA1 activity. We found ARF6 prevents the thermal disordering of structured CTA1 and stimulates the activity of stabilized CTA1 over a range of temperatures. Yet ARF6 alone did not promote the refolding of disordered CTA1 to an active state. Instead, lipid rafts shifted disordered CTA1 to a folded conformation with a basal level of activity that could be further stimulated by ARF6. Thus, ARF alone is unable to activate disordered CTA1 at physiological temperature: additional host factors such as lipid rafts place CTA1 in the folded conformation required for its ARF-mediated activation. Interaction with ARF is required for in vivo toxin activity, as enzymatically active CTA1 mutants that cannot be further stimulated by ARF6 fail to intoxicate cultured cells. PMID:25257027

  15. Dose determination of the persistent activity of moxidectin long-acting injectable formulations against various nematode species in cattle.

    PubMed

    Yazwinski, T A; Williams, J C; Smith, L L; Tucker, C; Loyacano, A F; Derosa, A; Peterson, P; Bruer, D J; Delay, R L

    2006-04-30

    The effectiveness, safety and production-enhancing benefit (improved weight gains) of moxidectin long-acting injection given subcutaneously in the ear at the rates of 0.75, 1.0 and 1.5mg/kg bw were evaluated in three studies under common protocol. The only adverse reaction to treatment was a mild (<2 tablespoons in volume), and for the most part transient (<28 days for the treatment rate of 1.0mg/kg bw) injection site swelling as noted in a minority of the animals (12.2% of the animals treated at the rate of 1.0mg/kg bw). Regardless of study site, post-treatment interval or dose rate, average daily gains were improved over control cattle by approximately 33%. Reductions in strongyle EPG counts relative to controls were > or = 90% for all dose rates of moxidectin for a post-treatment period of 42 days (Wisconsin), 84 days (Arkansas) and 140 days (Louisiana). In Arkansas and Louisiana, the majority (>80%) of post-treatment strongyle eggs, as determined by coproculture, were Cooperia spp. As determined by sequential necropsies, periods of continuous, post-treatment protection (> or = 90% efficacy in at least two out of three studies) for moxidectin long-acting injection given at the rate of 1.0 mg/kg bw were 90 days (adult Haemonchus spp.), 120 days (Dictyocaulus viviparus and adult Ostertagia and Oesophagostomum) and 150 days (Ostertagia spp. EL4).

  16. Potentiation of local anesthetic activity of neosaxitoxin with bupivacaine or epinephrine: development of a long-acting pain blocker.

    PubMed

    Rodriguez-Navarro, Alberto J; Lagos, Marcelo; Figueroa, Cristian; Garcia, Carlos; Recabal, Pedro; Silva, Pamela; Iglesias, Veronica; Lagos, Nestor

    2009-11-01

    Local anesthetics effectively block and relieve pain, but with a relatively short duration of action, limiting its analgesic effectiveness. Therefore, a long-acting local anesthetic would improve the management of pain, but no such agent is yet available for clinical use. The aim of this study is to evaluate the potentiation of the anesthetic effect of neosaxitoxin, with bupivacaine or epinephrine in a randomized double-blind clinical trial. Ten healthy males were subcutaneously injected into the left and right forearms with a randomized pair of the following treatments: (i) bupivacaine (5 mg); (ii) neosaxitoxin (10 microg); (iii) neosaxitoxin (10 microg) plus bupivacaine (5 mg), and (iv) neosaxitoxin (10 microg) plus epinephrine (1:100.000), but all participant received all four formulations (in 2 ml; s.c.), with 1 month elapsing between the two round of experiments. A validated sensory and pain paradigm was used for evaluating the effect of the treatment 0-72 h after the injections, measuring sensory, pain, and mechanical touch perception threshold. The duration of the effect produced by combined treatments was longer than that by the single drugs. In conclusion, bupivacaine and epinephrine potentiate the local anesthetic effect of neosaxitoxin in humans when co-injected subcutaneously. The present results support the idea that neosaxitoxin is a new long-acting local pain blocker, with highly potential clinical use.

  17. A liver X receptor (LXR)-{beta} alternative splicing variant (LXRBSV) acts as an RNA co-activator of LXR-{beta}

    SciTech Connect

    Hashimoto, Koshi; Ishida, Emi; Matsumoto, Shunichi; Shibusawa, Nobuyuki; Okada, Shuichi; Monden, Tsuyoshi; Satoh, Tetsurou; Yamada, Masanobu; Mori, Masatomo

    2009-12-25

    We report the isolation and functional characterization of a novel transcriptional co-activator, termed LXRBSV. LXRBSV is an alternative splicing variant of liver X receptor (LXR)-{beta} LXRBSV has an intronic sequence between exons 2 and 3 in the mouse LXR-{beta} gene. The LXRBSV gene is expressed in various tissues including the liver and brain. We sub-cloned LXRBSV into pSG5, a mammalian expression vector, and LXRBSV in pSG5 augmented human Sterol Response Element Binding Protein (SREBP)-1c promoter activity in HepG2 cells in a ligand (TO901317) dependent manner. The transactivation mediated by LXRBSV is selective for LXR-{beta}. The LXRBSV protein was deduced to be 64 amino acids in length; however, a GAL4-LXRBSV fusion protein was not able to induce transactivation. Serial deletion constructs of LXRBSV demonstrated that the intronic sequence inserted in LXRBSV is required for its transactivation activity. An ATG mutant of LXRBSV was able to induce transactivation as wild type. Furthermore, LXRBSV functions in the presence of cycloheximide. Taken together, we have concluded that LXRBSV acts as an RNA transcript not as a protein. In the current study, we have demonstrated for the first time that an alternative splicing variant of a nuclear receptor acts as an RNA co-activator.

  18. The effectiveness of physical activity monitoring and distance counselling in an occupational health setting - a research protocol for a randomised controlled trial (CoAct)

    PubMed Central

    2009-01-01

    Background The CoAct (Cocreating Activity) study is investigating a novel lifestyle intervention, aimed at the working population, with daily activity monitoring and distance counselling via telephone and secure web messages. The main purpose of this study is to evaluate the effectiveness of lifestyle counselling on the level of physical activity in an occupational health setting. The purposes include also analysing the potential effects of changes in physical activity on productivity at work and sickness absence, and healthcare costs. This article describes the design of the study and the participant flow until and including randomization. Methods/Design CoAct is a randomised controlled trial with two arms: a control group and intervention group with daily activity monitoring and distance counselling. The intervention focuses on lifestyle modification and takes 12 months. The study population consists of volunteers from 1100 eligible employees of a Finnish insurance company. The primary outcomes of this study are change in physical activity measured in MET minutes per week, work productivity and sickness absence, and healthcare utilisation. Secondary outcomes include various physiological measures. Cost-effectiveness analysis will also be performed. The outcomes will be measured by questionnaires at baseline, after 6, 12, and 24 months, and sickness absence will be obtained from the employer's registers. Discussion No trials are yet available that have evaluated the effectiveness of daily physical activity monitoring and distance counselling in an occupational health setting over a 12 month period and no data on cost-effectiveness of such intervention are available. Trial Registration ClinicalTrials.gov identifier: NCT00994565 PMID:20043831

  19. Potassium Acts as a GTPase-Activating Element on Each Nucleotide-Binding Domain of the Essential Bacillus subtilis EngA

    PubMed Central

    Foucher, Anne-Emmanuelle; Reiser, Jean-Baptiste; Ebel, Christine; Housset, Dominique; Jault, Jean-Michel

    2012-01-01

    EngA proteins form a unique family of bacterial GTPases with two GTP-binding domains in tandem, namely GD1 and GD2, followed by a KH (K-homology) domain. They have been shown to interact with the bacterial ribosome and to be involved in its biogenesis. Most prokaryotic EngA possess a high GTPase activity in contrast to eukaryotic GTPases that act mainly as molecular switches. Here, we have purified and characterized the GTPase activity of the Bacillus subtilis EngA and two shortened EngA variants that only contain GD1 or GD2-KH. Interestingly, the GTPase activity of GD1 alone is similar to that of the whole EngA, whereas GD2-KH has a 150-fold lower GTPase activity. At physiological concentration, potassium strongly stimulates the GTPase activity of each protein construct. Interestingly, it affects neither the affinities for nucleotides nor the monomeric status of EngA or the GD1 domain. Thus, potassium likely acts as a chemical GTPase-activating element as proposed for another bacterial GTPase like MnmE. However, unlike MnmE, potassium does not promote dimerization of EngA. In addition, we solved two crystal structures of full-length EngA. One of them contained for the first time a GTP-like analogue bound to GD2 while GD1 was free. Surprisingly, its overall fold was similar to a previously solved structure with GDP bound to both sites. Our data indicate that a significant structural change must occur upon K+ binding to GD2, and a comparison with T. maritima EngA and MnmE structures allowed us to propose a model explaining the chemical basis for the different GTPase activities of GD1 and GD2. PMID:23056455

  20. Properties of Cu-based nanocomposites produced by mechanically-activated self-propagating high-temperature synthesis and spark-plasma sintering.

    PubMed

    Kim, Ji Soon; Dudina, Dina V; Kim, Jin Chun; Kwon, Young Soon; Park, Jin Ju; Rhee, Chang Kyu

    2010-01-01

    One of the possible reasons for low conductivity of in-situ produced dispersion strengthened copper matrix composites may be the incompleteness of the reaction between the initial reactants that remain in a state of solid solutions in the copper matrix. We report in-situ synthesis of TiB2-Cu composites starting from the powder mixtures with the limited content of copper ensuring a high probability of contact between the particles of titanium and boron and, as a result, their full conversion into the TiB2 phase. The nanoparticles were formed in a self-propagating mode in the ball milled Ti-B-Cu powder mixture corresponding to 57 vol.% TiB2-Cu composition. Afterwards, the system was "diluted" with the required amount of the copper matrix using subsequent ball milling. Highly conductive 4.5 vol.% TiB2-Cu composites showing 82-87% IACS (International Annealed Copper Standard) conductivity were obtained by Spark Plasma Sintering (SPS) of the powders.

  1. The Effects of Pragmatic Consciousness-­-Raising Activities on the Learning of Speech Acts in the Beginning CFL Classroom

    ERIC Educational Resources Information Center

    Yang, Li; Zhu, Jia

    2016-01-01

    This study investigates the effects of instruction on learners' pragmatic competence by integrating pragmatic consciousness-raising (PCR) activities into a beginning-level Chinese language course during one academic semester. The study also examines the effect of integrating the PCR activities, i.e., before or after the instruction of a…

  2. Balancing Act

    ERIC Educational Resources Information Center

    Kennedy, Mike

    2007-01-01

    For some administrators and planners, designing and building education facilities may sometimes seem like a circus act--trying to project a persona of competence and confidence while juggling dozens of issues. Meanwhile, the audience--students, staff members and taxpayers--watch and wait with anticipation in hopes of getting what they paid for and…

  3. Atmospheric propagation issues relevant to optical communications

    NASA Technical Reports Server (NTRS)

    Churnside, James H.; Shaik, Kamran

    1989-01-01

    Atmospheric propagation issues relevant to space-to-ground optical communications for near-earth applications are studied. Propagation effects, current optical communication activities, potential applications, and communication techniques are surveyed. It is concluded that a direct-detection space-to-ground link using redundant receiver sites and temporal encoding is likely to be employed to transmit earth-sensing satellite data to the ground some time in the future. Low-level, long-term studies of link availability, fading statistics, and turbulence climatology are recommended to support this type of application.

  4. Abnormal sperm in mice with targeted deletion of the act (activator of cAMP-responsive element modulator in testis) gene

    PubMed Central

    Kotaja, Noora; De Cesare, Dario; Macho, Betina; Monaco, Lucia; Brancorsini, Stefano; Goossens, Ellen; Tournaye, Herman; Gansmuller, Anne; Sassone-Corsi, Paolo

    2004-01-01

    ACT [activator of cAMP-responsive element modulator (CREM) in testis] is a LIM-only protein that interacts with transcription factor CREM in postmeiotic male germ cells and enhances CREM-dependent transcription. CREM regulates many crucial genes required for spermatid maturation, and targeted mutation of the Crem gene in the mouse germ-line blocks spermatogenesis. Here we report the phenotype of mice in which targeted disruption of the act gene was obtained by homologous recombination. Whereas the seminiferous tubules of the act–/– mice contain all of the developmental stages of germ cells and the mice are fertile, the amount of mature sperm in the epididymis is drastically reduced. The residual sperm display severe abnormalities, including fully folded tails and aberrant head shapes. These results indicate that numerous postmeiotic genes under CREM control require the coactivator function of ACT. Thus, the fine-tuning of sperm development is achieved by the coordinated action of two transcriptional regulators. PMID:15247423

  5. Temporal scaling in information propagation

    NASA Astrophysics Data System (ADS)

    Huang, Junming; Li, Chao; Wang, Wen-Qiang; Shen, Hua-Wei; Li, Guojie; Cheng, Xue-Qi

    2014-06-01

    For the study of information propagation, one fundamental problem is uncovering universal laws governing the dynamics of information propagation. This problem, from the microscopic perspective, is formulated as estimating the propagation probability that a piece of information propagates from one individual to another. Such a propagation probability generally depends on two major classes of factors: the intrinsic attractiveness of information and the interactions between individuals. Despite the fact that the temporal effect of attractiveness is widely studied, temporal laws underlying individual interactions remain unclear, causing inaccurate prediction of information propagation on evolving social networks. In this report, we empirically study the dynamics of information propagation, using the dataset from a population-scale social media website. We discover a temporal scaling in information propagation: the probability a message propagates between two individuals decays with the length of time latency since their latest interaction, obeying a power-law rule. Leveraging the scaling law, we further propose a temporal model to estimate future propagation probabilities between individuals, reducing the error rate of information propagation prediction from 6.7% to 2.6% and improving viral marketing with 9.7% incremental customers.

  6. Temporal scaling in information propagation.

    PubMed

    Huang, Junming; Li, Chao; Wang, Wen-Qiang; Shen, Hua-Wei; Li, Guojie; Cheng, Xue-Qi

    2014-06-18

    For the study of information propagation, one fundamental problem is uncovering universal laws governing the dynamics of information propagation. This problem, from the microscopic perspective, is formulated as estimating the propagation probability that a piece of information propagates from one individual to another. Such a propagation probability generally depends on two major classes of factors: the intrinsic attractiveness of information and the interactions between individuals. Despite the fact that the temporal effect of attractiveness is widely studied, temporal laws underlying individual interactions remain unclear, causing inaccurate prediction of information propagation on evolving social networks. In this report, we empirically study the dynamics of information propagation, using the dataset from a population-scale social media website. We discover a temporal scaling in information propagation: the probability a message propagates between two individuals decays with the length of time latency since their latest interaction, obeying a power-law rule. Leveraging the scaling law, we further propose a temporal model to estimate future propagation probabilities between individuals, reducing the error rate of information propagation prediction from 6.7% to 2.6% and improving viral marketing with 9.7% incremental customers.

  7. Fourth International Symposium on Long-Range Sound Propagation

    NASA Technical Reports Server (NTRS)

    Willshire, William L., Jr. (Compiler)

    1990-01-01

    Long range sound propagation is an aspect of many acoustical problems ranging from en route aircraft noise to the acoustic detection of aircraft. Over the past decade, the University of Mississippi and the Open University of England, together with a third institution, have held a symposium approx. every 2 years so that experts in the field of long range propagation could exchange information on current research, identify areas needing additional work, and coordinate activities as much as possible. The Fourth International Symposium on Long Range Sound Propagation was jointly sponsored by the University of Mississippi, the Open University of England, and NASA. Papers were given in the following areas: ground effects on propagation; infrasound propagation; and meteorological effects on sound propagation. A compilation of the presentations made at the symposium is presented along with a list of attendees, and the agenda.

  8. Transport with Feynman propagators

    SciTech Connect

    White, R.H.

    1990-11-06

    Richard Feynman's formulation of quantum electrodynamics suggests a Monte Carlo algorithm for calculating wave propagation. We call this the Sum Over All Paths (SOAP) method. The method is applied to calculate diffraction by double slits of finite width and by a reflection grating. Calculations of reflection by plane and parabolic mirrors of finite aperture and from several figured surfaces are shown. An application to a one-dimensional scattering problem is discussed. A variation of SOAP can be applied to the diffusion equation. 2 refs., 8 figs.

  9. Beam Propagation Experimental Study.

    DTIC Science & Technology

    1982-03-01

    30- -40- -50 I 0 100 200 300 Time (ns) Figure 2. FX-100 diode voltage and current. The gas- insulated coax was charged to 4.2 MV in order to produce...limit the usable gradient. The voltage standoff capability will be further limited by electron bombardment of the insulators , which may lead to flashover ...the low-pressure window for stable propagation has been inferred from measurements of the time delay for the beam arrival at a given axial position. 8

  10. Effects of fluctuations on propagating fronts

    NASA Astrophysics Data System (ADS)

    Panja, Debabrata

    Propagating fronts are seen in varieties of nonequilibrium pattern forming systems in Physics, Chemistry and Biology. In the last two decades, many researchers have contributed to the understanding of the underlying dynamics of the propagating fronts. Of these, the deterministic and mean-field dynamics of the fronts were mostly understood in late 1980s and 1990s. On the other hand, although the earliest work on the effect of fluctuations on propagating fronts dates back to early 1980s, the subject of fluctuating fronts did not reach its adolescence until the mid 1990s. From there onwards the last few years witnessed a surge in activities in the effect of fluctuations on propagating fronts. Scores of papers have been written on this subject since then, contributing to a significant maturity of our understanding, and only recently a full picture of fluctuating fronts has started to emerge. This review is an attempt to collect all the works on fluctuating (propagating) fronts in a coherent and cogent manner in proper perspective. It is based on the idea of making our knowledge in this field available to a broader audience, and it is also expected to help to collect bits and pieces of loose thread-ends together for possible further investigation.

  11. 50 CFR 80.51 - What activities are eligible for funding under the Dingell-Johnson Sport Fish Restoration Act?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... populations due to fishing, other human activities, or natural causes; and (iii) Effects of any measures or... opportunities. (2) Increase participation in sport fishing and boating. (3) Advance the adoption of...

  12. 50 CFR 80.51 - What activities are eligible for funding under the Dingell-Johnson Sport Fish Restoration Act?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... populations due to fishing, other human activities, or natural causes; and (iii) Effects of any measures or... opportunities. (2) Increase participation in sport fishing and boating. (3) Advance the adoption of...

  13. Sea Changes - ACT : Artists and Scientists collaborating to promote ocean activism and conservation. (www.seachanges.org)

    NASA Astrophysics Data System (ADS)

    Lueker, T.

    2012-12-01

    We are a group of ocean scientists, artists, and educators working to publicize the urgent environmental problems facing our ocean environs, including overfishing, climate change and ocean acidification, and environmental degradation due to plastic and other forms of pollution. Our team leader, Kira Carrillo Corser, is an artist and educator known nationally for affecting policy and social change. Our collaboration results from the DNA of Creativity Project - the brainchild of Patricia Frischer, co-ordinator for the San Diego Visual Arts Network (http://dnaofc.weebly.com). The DNA of Creativity funded teams composed of artists and scientists with the goal of fusing the creative energies of both into projects that will enhance the public's perception of creativity, and make the complexities of art and science collaborations accessible to a new and larger audience. Sea Changes - ACT was funded initially by the DNA of Creativity Project. Our project goals are : 1) To entice people to participate in the joys of discovery of art AND science and 2) To motivate the public to work for real, committed and innovative change to protect our oceans. Part of our strategy for achieving our goals is to create a traveling art installation to illustrate the beauty of the oceans and to instill in our viewers the joys of discovery and creativity that we as scientists and artists pursue. And following this, to make the destructive changes occurring in the ocean and the future consequences more visible and understandable. We will develop lesson plans to integrate our ideas into the educational system and we are documenting our collaborative and creative process to inform future art-science collaborations. Finally, after emotionally connecting with our viewers to provide a means to ACT to make real and positive CHANGES for the future. Our project aims to build commitment and action for environmental conservation and stewardship as we combine scientific research with ways to take action

  14. Simulation of action potential propagation in plants.

    PubMed

    Sukhov, Vladimir; Nerush, Vladimir; Orlova, Lyubov; Vodeneev, Vladimir

    2011-12-21

    Action potential is considered to be one of the primary responses of a plant to action of various environmental factors. Understanding plant action potential propagation mechanisms requires experimental investigation and simulation; however, a detailed mathematical model of plant electrical signal transmission is absent. Here, the mathematical model of action potential propagation in plants has been worked out. The model is a two-dimensional system of excitable cells; each of them is electrically coupled with four neighboring ones. Ion diffusion between excitable cell apoplast areas is also taken into account. The action potential generation in a single cell has been described on the basis of our previous model. The model simulates active and passive signal transmission well enough. It has been used to analyze theoretically the influence of cell to cell electrical conductivity and H(+)-ATPase activity on the signal transmission in plants. An increase in cell to cell electrical conductivity has been shown to stimulate an increase in the length constant, the action potential propagation velocity and the temperature threshold, while the membrane potential threshold being weakly changed. The growth of H(+)-ATPase activity has been found to induce the increase of temperature and membrane potential thresholds and the reduction of the length constant and the action potential propagation velocity.

  15. TMF and glycitin act synergistically on keratinocytes and fibroblasts to promote wound healing and anti-scarring activity

    PubMed Central

    Seo, Ga Young; Lim, Yoongho; Koh, Dongsoo; Huh, Jung Sik; Hyun, Changlim; Kim, Young Mee; Cho, Moonjae

    2017-01-01

    Keratinocyte-fibroblast interactions are critical for skin repair after injury. During the proliferative phase of wound healing, proliferation, migration and differentiation of these cells are the major mechanisms leading to tissue remodeling. We have previously reported that glycitin, a major soy isoflavone, stimulates dermal fibroblast proliferation; and the phytochemical, 4′,6,7-trimethoxyisoflavone (TMF), induces migration of HaCaT keratinocyte cells. We therefore investigated whether these compounds display synergistic effects on skin cells during wound healing in vitro and in vivo. Co-treatment with TMF and glycitin synergistically promotes the proliferation and migration of both keratinocytes and dermal fibroblasts, with a 1:1 ratio of these compounds showing the greatest efficacy in our co-culture system. This keratinocyte-fibroblast interaction occurred via the secretion of TGF-β, and the induction of differentiation and proliferation was confirmed in both indirect and direct co-culture assays. In an excisional and burn wound animal model, mice treated with a 1:1 ratio of TMF and glycitin showed faster wound closure, regeneration and scar reduction than even the positive control drug. These data indicate that two isoflavones, TMF and glycitin, act synergistically to promote wound healing and anti-scarring and could potentially be developed together as a bioactive therapeutic for wound treatment. PMID:28303029

  16. Desertification by front propagation?

    PubMed

    Zelnik, Yuval R; Uecker, Hannes; Feudel, Ulrike; Meron, Ehud

    2017-04-07

    Understanding how desertification takes place in different ecosystems is an important step in attempting to forecast and prevent such transitions. Dryland ecosystems often exhibit patchy vegetation, which has been shown to be an important factor on the possible regime shifts that occur in arid regions in several model studies. In particular, both gradual shifts that occur by front propagation, and abrupt shifts where patches of vegetation vanish at once, are a possibility in dryland ecosystems due to their emergent spatial heterogeneity. However, recent theoretical work has suggested that the final step of desertification - the transition from spotted vegetation to bare soil - occurs only as an abrupt shift, but the generality of this result, and its underlying origin, remain unclear. We investigate two models that detail the dynamics of dryland vegetation using a markedly different functional structure, and find that in both models the final step of desertification can only be abrupt. Using a careful numerical analysis, we show that this behavior is associated with the disappearance of confined spot-pattern domains as stationary states, and identify the mathematical origin of this behavior. Our findings show that a gradual desertification to bare soil due to a front propagation process can not occur in these and similar models, and opens the question of whether these dynamics can take place in nature.

  17. Bolt beam propagation analysis

    NASA Astrophysics Data System (ADS)

    Shokair, I. R.

    BOLT (Beam on Laser Technology) is a rocket experiment to demonstrate electron beam propagation on a laser ionized plasma channel across the geomagnetic field in the ion focused regime (IFR). The beam parameters for BOLT are: beam current I(sub b) = 100 Amps, beam energy of 1--1.5 MeV (gamma =3-4), and a Gaussian beam and channel of radii r(sub b) = r(sub c) = 1.5 cm. The N+1 ionization scheme is used to ionize atomic oxygen in the upper atmosphere. This scheme utilizes 130 nm light plus three IR lasers to excite and then ionize atomic oxygen. The limiting factor for the channel strength is the energy of the 130 nm laser, which is assumed to be 1.6 mJ for BOLT. At a fixed laser energy and altitude (fixing the density of atomic oxygen), the range can be varied by adjusting the laser tuning, resulting in a neutralization fraction axial profile of the form: f(z) = f(sub 0) e(exp minus z)/R, where R is the range. In this paper we consider the propagation of the BOLT beam and calculate the range of the electron beam taking into account the fact that the erosion rates (magnetic and inductive) vary with beam length as the beam and channel dynamically respond to sausage and hose instabilities.

  18. Verification of the in vivo activity of three distinct cis-acting elements within the Gata1 gene promoter-proximal enhancer in mice.

    PubMed

    Shimizu, Ritsuko; Hasegawa, Atsushi; Ottolenghi, Sergio; Ronchi, Antonella; Yamamoto, Masayuki

    2013-11-01

    The transcription factor GATA1 is essential for erythroid and megakaryocytic cell differentiation. Gata1 hematopoietic regulatory domain (G1HRD) has been shown to recapitulate endogenous Gata1 gene expression in transgenic mouse assays in vivo. G1HRD contains a promoter-proximal enhancer composed of a GATA-palindrome motif, four CP2-binding sites and two CACCC boxes. We prepared transgenic reporter mouse lines in which green fluorescent protein and β-galactosidase expression are driven by wild-type G1HRD (as a positive control) and the G1HRD harboring mutations within these cis-acting elements (as the experimental conditions), respectively. Exploiting this transgenic dual reporter (TDR) assay, we show here that in definitive erythropoiesis, G1HRD activity was markedly affected by individual mutations in the GATA-palindrome motif and the CACCC boxes. Mutation of CP2-binding sites also moderately decreased G1HRD activity. The combined mutation of the CP2-binding sites and the GATA-palindrome motif resulted in complete loss of G1HRD activity. In contrast, in primitive erythroid cells, individual mutations of each element did not affect G1HRD activity; G1HRD activity was abolished only when these three mutations were combined. These results thus show that all three elements independently and cooperatively contribute to G1HRD activity in vivo in definitive erythropoiesis, although these are contributing redundantly to primitive erythropoiesis.

  19. WAC regulates mTOR activity by acting as an adaptor for the TTT and Pontin/Reptin complexes

    PubMed Central

    David-Morrison, Gabriela; Xu, Zhen; Rui, Yan-Ning; Charng, Wu-Lin; Jaiswal, Manish; Yamamoto, Shinya; Xiong, Bo; Zhang, Ke; Sandoval, Hector; Duraine, Lita; Zuo, Zhongyuan; Zhang, Sheng; Bellen, Hugo J.

    2015-01-01

    SUMMARY The ability to sense energy status is crucial in the regulation of metabolism via the mechanistic Target of Rapamycin Complex 1 (mTORC1). The assembly of the TTT-Pontin/Reptin complex is responsive to changes in energy status. In energy sufficient conditions, the TTT-Pontin/Reptin complex promotes mTORC1 dimerization and mTORC1-Rag interaction, which are critical for mTORC1 activation. We show that WAC is a regulator of energy-mediated mTORC1 activity. In a Drosophila screen designed to isolate mutations that cause neuronal dysfunction, we identified wacky, the homolog of WAC. Loss of Wacky leads to neurodegeneration, defective mTOR activity and increased autophagy. Wacky and WAC have conserved physical interactions with mTOR and its regulators, including Pontin and Reptin which bind to the TTT complex to regulate energy-dependent activation of mTORC1. WAC promotes the interaction between TTT and Pontin/Reptin in an energy-dependent manner, thereby promoting mTORC1 activity by facilitating mTORC1 dimerization and mTORC1-Rag interaction. PMID:26812014

  20. Effect of triterpenoids on the inflammation induced by protein kinase C activators, neuronally acting irritants and other agents.

    PubMed

    Huguet, A; del Carmen Recio, M; Máñez, S; Giner, R; Ríos, J

    2000-12-20

    In order to establish the mode of the anti-inflammatory activity of triterpenoids, 11 naturally occurring compounds were assayed on mouse ear oedema induced by the protein kinase C activators, mezerein, 12-O-tetradecanoylphorbol-13-acetate (TPA), two 12-deoxyphorbol-13-monoesters (13-tetradecanoate (DPT) and 13-phenylacetate (DPP)) and bryostatin 1, and by resiniferatoxin, xylene and arachidonic acid. The effects on bradykinin-induced paw oedema and on the rat skin inflammation caused by hydrogen peroxide were also examined. The oedema induced by mezerein and DPT was reduced to different extents by the triterpenoids administered epicutaneously (0.5 mg per ear). Against DPT-induced oedema, lupane and oleanane derivatives were the most effective compounds. Oleananes and lupanes possessing a carboxyl group were active against bryostatin 1-induced oedema. Most of the triterpenoids were ineffective against the neurogenic inflammation caused by resiniferatoxin and xylene. Many triterpenoids, especially oleanane and lupane alcoholic derivatives, were active against the plantar oedema induced by bradykinin and on the intradermal inflammation induced by hydrogen peroxide. In conclusion, the anti-inflammatory activity of triterpenoids may depend on inhibition of protein kinase C, without any involvement of neurogenic inflammatory mechanisms.

  1. What powers the starburst activity of NGC 1068? Star-driven gravitational instabilities caught in the act

    NASA Astrophysics Data System (ADS)

    Romeo, Alessandro B.; Fathi, Kambiz

    2016-08-01

    We explore the role that gravitational instability plays in NGC 1068, a nearby Seyfert galaxy that exhibits unusually vigorous starburst activity. For this purpose, we use the Romeo-Falstad disc instability diagnostics and data from the BIMA Survey of Nearby Galaxies, the Sloan Digital Sky Survey and the Spectrographic Areal Unit for Research on Optical Nebulae. Our analysis illustrates that NGC 1068 is a gravitationally unstable `monster'. Its starburst disc is subject to unusually powerful instabilities. Several processes, including feedback from the active galactic nucleus and starburst activity, try to quench such instabilities from inside out by depressing the surface density of molecular gas across the central kpc, but they do not succeed. Gravitational instability `wins' because it is driven by the stars via their much higher surface density. In this process, stars and molecular gas are strongly coupled, and it is such a coupling that ultimately triggers local gravitational collapse/fragmentation in the molecular gas.

  2. Theoretical and Experimental Studies of HF Ducted Propagation

    DTIC Science & Technology

    1980-12-01

    publication. APPROVED: TERENCE J. ELKINS, Acting Chief Propagation Branch Electromagnetic Sciences Division APPROVED: ALLAN C. SCHELL , Chief Electromagnetic...irregularities are presented. The interpretation of results is facilitated by a numerical study in which raytracing through computationally specified model ...ionospheric models . The detection of ducted signals by means of an artificially induced scatter volume is shown to be possible. Unclassified SECURITY

  3. Spike propagation in driven chain networks with dominant global inhibition

    NASA Astrophysics Data System (ADS)

    Chang, Wonil; Jin, Dezhe Z.

    2009-05-01

    Spike propagation in chain networks is usually studied in the synfire regime, in which successive groups of neurons are synaptically activated sequentially through the unidirectional excitatory connections. Here we study the dynamics of chain networks with dominant global feedback inhibition that prevents the synfire activity. Neural activity is driven by suprathreshold external inputs. We analytically and numerically demonstrate that spike propagation along the chain is a unique dynamical attractor in a wide parameter regime. The strong inhibition permits a robust winner-take-all propagation in the case of multiple chains competing via the inhibition.

  4. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  5. Protocol of a longitudinal cohort study on physical activity behaviour in physically disabled patients participating in a rehabilitation counselling programme: ReSpAct

    PubMed Central

    Alingh, Rolinde A; Hoekstra, Femke; van der Schans, Cees P; Hettinga, Florentina J; Dekker, Rienk; van der Woude, Lucas H V

    2015-01-01

    Introduction Stimulating physical activity behaviour in persons with a physical disability is important, especially after discharge from rehabilitation. A tailored counselling programme covering both the period of the rehabilitation treatment and the first months at home seems on the average effective. However, a considerable variation in response is observed in the sense that some patients show a relevant beneficial response while others show no or only a small response on physical activity behaviour. The Rehabilitation, Sports and Active lifestyle (ReSpAct) study aims to estimate the associations of patient and programme characteristics with patients’ physical activity behaviour after their participation in a tailored counselling programme. Methods and analysis A questionnaire-based nationwide longitudinal prospective cohort study is conducted. Participants are recruited from 18 rehabilitation centres and hospitals in The Netherlands. 2000 participants with a physical disability or chronic disease will be followed during and after their participation in a tailored counselling programme. Programme outcomes on physical activity behaviour and patient as well as programme characteristics that may be associated with differences in physical activity behaviour after programme completion are being assessed. Data collection takes place at baseline and 14, 33 and 52 weeks after discharge from rehabilitation. Ethics and dissemination The study protocol has been approved by the Medical Ethics Committee of the University Medical Centre Groningen and at individual participating institutions. All participants give written informed consent. The study results will provide new insights into factors that may help explain the differences in physical activity behaviour of patients with a physical disability after they have participated in the same physical activity and sports stimulation programme. Thereby, it will support healthcare professionals to tailor their guidance and

  6. CaMK-II activation is essential for zebrafish inner ear development and acts through Delta-Notch signaling.

    PubMed

    Rothschild, Sarah C; Lahvic, Jamie; Francescatto, Ludmila; McLeod, Jamie J A; Burgess, Shawn M; Tombes, Robert M

    2013-09-01

    Zebrafish inner ear development is characterized by the crystallization of otoliths onto immotile kinocilia that protrude from sensory "hair" cells. The stereotypical formation of these sensory structures is dependent on the expression of key patterning genes and on Ca2+ signals. One potential target of Ca2+ signaling in the inner ear is the type II Ca2+/calmodulin-dependent protein kinase (CaMK-II), which is preferentially activated in hair cells, with intense activation at the base of kinocilia. In zebrafish, CaMK-II is encoded by seven genes; the expression of one of these genes (camk2g1) is enriched in hair cells. The suppression of camk2g1 expression by antisense morpholino oligonucleotides or inhibition of CaMK-II activation by the pharmacological antagonist, KN-93, results in aberrant otolith formation without preventing cilia formation. In fact, CaMK-II suppression results in additional ciliated hair cells and altered levels of Delta-Notch signaling members. DeltaA and deltaD transcripts are increased and DeltaD protein accumulates in hair cells of CaMK-II morphants, indicative of defective recycling and/or exocytosis. Our findings indicate that CaMK-II plays a critical role in the developing ear, influencing cell differentiation through extranuclear effects on Delta-Notch signaling. Continued expression and activation of CaMK-II in maculae and cristae in older embryos suggests continued roles in auditory sensory maturation and transduction.

  7. Requirements and feasibility study of flight demonstration of Active Controls Technology (ACT) on the NASA 515 airplane

    NASA Technical Reports Server (NTRS)

    Gordon, C. K.

    1975-01-01

    A preliminary design study was conducted to evaluate the suitability of the NASA 515 airplane as a flight demonstration vehicle, and to develop plans, schedules, and budget costs for fly-by-wire/active controls technology flight validation in the NASA 515 airplane. The preliminary design and planning were accomplished for two phases of flight validation.

  8. NSC23766, a widely used inhibitor of Rac1 activation, additionally acts as a competitive antagonist at muscarinic acetylcholine receptors.

    PubMed

    Levay, Magdolna; Krobert, Kurt Allen; Wittig, Karola; Voigt, Niels; Bermudez, Marcel; Wolber, Gerhard; Dobrev, Dobromir; Levy, Finn Olav; Wieland, Thomas

    2013-10-01

    Small molecules interfering with Rac1 activation are considered as potential drugs and are already studied in animal models. A widely used inhibitor without reported attenuation of RhoA activity is NSC23766 [(N(6)-[2-[[4-(diethylamino)-1-methylbutyl]amino]-6-methyl-4-pyrimidinyl]-2-methyl-4,6-quinolinediamine trihydrochloride]. We found that NSC23766 inhibits the M2 muscarinic acetylcholine receptor (M2 mAChR)-induced Rac1 activation in neonatal rat cardiac myocytes. Surprisingly, NSC27366 concomitantly suppressed the carbachol-induced RhoA activation and a M2 mAChR-induced inotropic response in isolated neonatal rat hearts requiring the activation of Rho-dependent kinases. We therefore aimed to identify the mechanisms by which NSC23766 interferes with the differentially mediated, M2 mAChR-induced responses. Interestingly, NSC23766 caused a rightward shift of the carbachol concentration response curve for the positive inotropic response without modifying carbachol efficacy. To analyze the specificity of NSC23766, we compared the carbachol and the similarly Giβγ-mediated, adenosine-induced activation of Gi protein-regulated potassium channel (GIRK) channels in human atrial myocytes. Application of NSC23766 blocked the carbachol-induced K(+) current but had no effect on the adenosine-induced GIRK current. Similarly, an adenosine A1 receptor-induced positive inotropic response in neonatal rat hearts was not attenuated by NSC23766. To investigate its specificity toward the different mAChR types, we studied the carbachol-induced elevation of intracellular Ca(2+) concentrations in human embryonic kidney 293 (HEK-293) cells expressing M1, M2, or M3 mAChRs. NSC23766 caused a concentration-dependent rightward shift of the carbachol concentration response curves at all mAChRs. Thus, NSC23766 is not only an inhibitor of Rac1 activation, but it is within the same concentration range a competitive antagonist at mAChRs. Molecular docking analysis at M2 and M3 mAChR crystal

  9. Antitumour activity of novel taxanes that act at the same time as cytotoxic agents and P-glycoprotein inhibitors

    PubMed Central

    Ferlini, C; Distefano, M; Pignatelli, F; Lin, S; Riva, A; Bombardelli, E; Mancuso, S; Ojima, I; Scambia, G

    2000-01-01

    Taxanes antitumour agents such as paclitaxel and docetaxel represent a successful family of chemotherapeutic drugs. Unfortunately, acquired and innate resistance represents a clinical problem for these drugs. We investigated, on a panel of 7 human cancer cell lines, the growth inhibition effect of 3 newly developed taxanes (SB-T-1213, SB-T-1250 and SB-T-101187) with modification at the C10 and C3′ positions of the taxane framework. These positions have been previously characterized as critical to make taxanes highly active against cells overexpressing the efflux pump P-glycoprotein (P-gp). Paclitaxel and docetaxel were used as reference compounds. Results unambiguously indicate the exceptional activity of the novel taxanes toward P-gp positive cells (up to >400 fold higher potency than that of paclitaxel). SB-T-1213 and SB-T-1250 are also substantially more active than the reference compounds against P-gp negative cells. To better understand the mechanisms underlying the enhanced activity of the newly developed taxanes, we performed cell cycle and apoptosis analysis. This study demonstrates that the striking growth inhibition effect exhibited by the novel taxanes is ascribed to their increased ability in inducing apoptosis and G 2/M cell cycle block. SB-T-1213 and SB-T-1250 are also more active than reference compounds in inducing intracellular accumulation of the beta-tubulin subunits. Finally, it is revealed that these novel taxanes have ability to inhibit the function of the P-gp efflux pump on the basis of the Rhodamine 123 assay. These findings strongly suggest that SB-T-1213, SB-T-1250 and SB-T-101187 represent a new tool to overcome innate or acquired P-gp mediated taxane-resistance. © 2000 Cancer Research Campaign http://www.bjcancer.com PMID:11104578

  10. Analysis of "Teno-uchi" maneuver in releasing Japanese-style bows based on muscle activities and forces acting on the bow.

    PubMed

    Hosoya, Satoshi; Byun, Keigo Ohyama; Okada, Morihiko

    2004-12-01

    Since a Japanese-style bow has a very complicated shape and structure, an archer has to apply the "Teno-uchi" maneuver including horizontally twisting torque, or "Nejiri", and sagittally down-pushing torque, or "Uwa-oshi", to the restoring bow in order to hit the target. The purpose of this study was to investigate the biomechanical relationship between the muscular activities of the left forearm and the operation of "Teno-uchi" maneuver. Surface EMG of left forearm muscles and the two kinds of torque acting on the bow around the time of release were recorded in 10 experienced subjects during arrow shooting. The "Biku", an involuntary resignation from release happening in the shooting, was also examined. Close analyses of the results revealed that activation of the extensor carpi ulnaris and extensor digitorum muscles together with inhibition of the flexor carpi ulnaris muscle brought about "Nejiri", while activation of the extensor carpi ulnaris as well as flexor carpi ulnaris muscles and inhibition of the extensor carpi redialis longus and extensor digitorum muscles gave rise to "Uwa-oshi", thus causing activities of trade-off nature in the extensor digitorum and flexor carpi ulnaris muscles for the "Nejiri" and "Uwa-oshi. The trade-off activities were presumably actualized through time-sharing coordination between the muscles.

  11. The proapoptotic and antimitogenic protein p66SHC acts as a negative regulator of lymphocyte activation and autoimmunity.

    PubMed

    Finetti, Francesca; Pellegrini, Michela; Ulivieri, Cristina; Savino, Maria Teresa; Paccagnini, Eugenio; Ginanneschi, Chiara; Lanfrancone, Luisa; Pelicci, Pier Giuseppe; Baldari, Cosima T

    2008-05-15

    The ShcA locus encodes 3 protein isoforms that differ in tissue specificity, subcellular localization, and function. Among these, p66Shc inhibits TCR coupling to the Ras/MAPK pathway and primes T cells to undergo apoptotic death. We have investigated the outcome of p66Shc deficiency on lymphocyte development and homeostasis. We show that p66Shc(-/-) mice develop an age-related lupus-like autoimmune disease characterized by spontaneous peripheral T- and B-cell activation and proliferation, autoantibody production, and immune complex deposition in kidney and skin, resulting in autoimmune glomerulonephritis and alopecia. p66Shc(-/-) lymphocytes display enhanced proliferation in response to antigen receptor engagement in vitro and more robust immune responses both to vaccination and to allergen sensitization in vivo. The data identify p66Shc as a negative regulator of lymphocyte activation and show that loss of this protein results in breaking of immunologic tolerance and development of systemic autoimmunity.

  12. Quantum Graphical Models and Belief Propagation

    SciTech Connect

    Leifer, M.S. Poulin, D.

    2008-08-15

    Belief Propagation algorithms acting on Graphical Models of classical probability distributions, such as Markov Networks, Factor Graphs and Bayesian Networks, are amongst the most powerful known methods for deriving probabilistic inferences amongst large numbers of random variables. This paper presents a generalization of these concepts and methods to the quantum case, based on the idea that quantum theory can be thought of as a noncommutative, operator-valued, generalization of classical probability theory. Some novel characterizations of quantum conditional independence are derived, and definitions of Quantum n-Bifactor Networks, Markov Networks, Factor Graphs and Bayesian Networks are proposed. The structure of Quantum Markov Networks is investigated and some partial characterization results are obtained, along the lines of the Hammersley-Clifford theorem. A Quantum Belief Propagation algorithm is presented and is shown to converge on 1-Bifactor Networks and Markov Networks when the underlying graph is a tree. The use of Quantum Belief Propagation as a heuristic algorithm in cases where it is not known to converge is discussed. Applications to decoding quantum error correcting codes and to the simulation of many-body quantum systems are described.

  13. Department of the Army Field Contracting Activities’ Contracting Efforts Under the Javits-Wagner-O’Day Act

    DTIC Science & Technology

    1993-12-01

    Question Eleven The contracting activities were asked to compare the quality of JWOD products and services with the quality of products and services they...Eleven is below: (a) How does the quality of the products provided to your agency under the JWOD Program compare with the quality of products provided to...services provided to your agency under the JWOD Program compare with the quality of products provided to you by other contractors? JWOD services are better

  14. Intrathecal rosiglitazone acts at peroxisome proliferator-activated receptor γ to rapidly inhibit neuropathic pain in rats

    PubMed Central

    Churi, Sajay B.; Abdel-Aleem, Omar S.; Tumber, Kiranjeet K.; Scuderi-Porter, Heather; Taylor, Bradley K.

    2008-01-01

    We first demonstrate the transcription, expression, and DNA binding properties of the PPARγ subtype of the peroxisome proliferator-activated nuclear receptor family to the spinal cord with real time PCR, western blot, and electrophoretic mobility shift assay. To test the hypothesis that activation of spinal PPARγ decreases nerve injury-induced allodynia, we intrathecally administered PPARγ agonists and/or antagonists in rats following transection of the tibial and common peroneal branches of the sciatic nerve. Single injection of either a natural (15-deoxy-prostaglandin J2, 15d-PGJ2) or synthetic (rosiglitazone) PPARγ agonist dose-dependently decreased mechanical and cold hypersensitivity. These effects were maximal at a dose of 100μg and peaked at ~60 min after injection, a rapid time course suggestive of transcription-independent mechanisms of action. Concurrent administration of a PPARγ antagonist (bisphenol A diglycidyl ether, BADGE) reversed the effects of 15d-PGJ2 and rosiglitazone, further indicating a receptor-mediated effect. In animals without nerve injury, rosiglitazone did not alter motor coordination, von Frey threshold, or withdrawal response to a cool stimulus. Intraperitoneal and intracerebroventricular administration of PPARγ agonists (100μg) did not decrease mechanical and cold hypersensitivity, arguing against effects subsequent to diffusion from the intrathecal space. We conclude that ligand-induced activation of spinal PPARγ rapidly reverses nerve injury-induced mechanical allodynia. New or currently-available drugs targeted at spinal PPARγ may yield important therapeutic effects for the management of neuropathic pain. PERSPECTIVE PPARγ receptor agonists such as rosiglitazone and pioglitazone remain FDA approved as insulin sensitizers. We demonstrate PPARγ expression in the spinal cord, and report that activation of these receptors inhibits allodynia. BBB-permeant PPARγ agonists may yield important therapeutic effects for the

  15. Gauge engineering and propagators

    NASA Astrophysics Data System (ADS)

    Maas, Axel

    2017-03-01

    Beyond perturbation theory gauge-fixing becomes more involved due to the Gribov-Singer ambiguity: The appearance of additional gauge copies requires to define a procedure how to handle them. For the case of Landau gauge the structure and properties of these additional gauge copies will be investigated. Based on these properties gauge conditions are constructed to account for these gauge copies. The dependence of the propagators on the choice of these complete gauge-fixings will then be investigated using lattice gauge theory for Yang-Mills theory. It is found that the implications for the infrared, and to some extent mid-momentum behavior, can be substantial. In going beyond the Yang-Mills case it turns out that the influence of matter can generally not be neglected. This will be briefly discussed for various types of matter.

  16. Propagation Terminal Design and Measurements

    NASA Technical Reports Server (NTRS)

    Nessel, James

    2015-01-01

    The NASA propagation terminal has been designed and developed by the Glenn Research Center and is presently deployed at over 5 NASA and partner ground stations worldwide collecting information on the effects of the atmosphere on Ka-band and millimeter wave communications links. This lecture provides an overview of the fundamentals and requirements of the measurement of atmospheric propagation effects and, specifically, the types of hardware and digital signal processing techniques employed by current state-of-the-art propagation terminal systems.

  17. Interferometric Propagation Delay

    NASA Technical Reports Server (NTRS)

    Goldstein, Richard

    1999-01-01

    Radar interferometry based on (near) exact repeat passes has lately been used by many groups of scientists, worldwide, to achieve state of the art measurements of topography, glacier and ice stream motion, earthquake displacements, oil field subsidence, lava flows, crop-induced surface decorrelation, and other effects. Variations of tropospheric and ionospheric propagation delays limit the accuracy of all such measurements. We are investigating the extent of this limitation, using data from the Shuttle radar flight, SIR-C, which is sensitive to the troposphere, and the Earth Resources Satellites, ERS-1/2, which are sensitive to both the troposphere and the ionosphere. We are presently gathering statistics of the delay variations over selected, diverse areas to determine the best accuracy possible for repeat track interferometry. The phases of an interferogram depend on both the topography of the scene and variations in propagation delay. The delay variations can be caused by movement of elements in the scene, by changes in tropospheric water vapor and by changes of the charge concentrations in the ionosphere. We plan to separate these causes by using the data from a third satellite visit (three-pass interferometry). The figure gives the geometry of the three-pass observations. The page of the figure is taken to be perpendicular to the spacecraft orbits. The three observational locations are marked on the figure, giving baselines B-12 and B-13, separated by the angle alpha. These parameters are almost constant over the whole scene. However, each pixel has an individual look angle, theta, which is related to the topography, rho is the slant range. A possible spurious time delay is shown. Additional information is contained in the original.

  18. The Equal Access Act.

    ERIC Educational Resources Information Center

    Catron, J. Gregory

    1987-01-01

    Reviews past history of access of religious activities in public schools in relation to the establishment clause of the First Amendment and sets forth the prerequisites in the Equal Access Act of 1984 for creating a well-defined forum for student-initiated free speech including religious groups in public high schools. (MD)

  19. Special Appropriation Act Projects

    EPA Pesticide Factsheets

    EPA is sometimes directed to provide funding to a specific entity for study, purpose, or activity.This information will be of interest to a community or other entity that has been identified in one of EPA's appropriations acts to receive such funding.

  20. Job Training Partnership Act.

    ERIC Educational Resources Information Center

    Tindall, Lloyd W.; Hedberg, Sally B.

    1987-01-01

    The Job Training Partnership Act, which provides money to programs preparing disadvantaged (including disabled) individuals for entry into the labor force, has helped special education students in such programs as the Special Education Local Plan Areas Job Project and the Day Training Activity Center at the Las Trampas School, Inc. in Lafayette,…

  1. Inhibitory responses in Aplysia pleural sensory neurons act to block excitability, transmitter release, and PKC Apl II activation.

    PubMed

    Dunn, Tyler W; Farah, Carole A; Sossin, Wayne S

    2012-01-01

    Expression of the 5-HT(1Apl(a)) receptor in Aplysia pleural sensory neurons inhibited 5-HT-mediated translocation of the novel PKC Apl II in sensory neurons and prevented PKC-dependent synaptic facilitation at sensory to motoneuron synapses (Nagakura et al. 2010). We now demonstrate that the ability of inhibitory receptors to block PKC activation is a general feature of inhibitory receptors and is found after expression of the 5-HT(1Apl(b)) receptor and with activation of endogenous dopamine and FMRFamide receptors in sensory neurons. Pleural sensory neurons are heterogeneous for their inhibitory response to endogenous transmitters, with dopamine being the most prevalent, followed by FMRFamide, and only a small number of neurons with inhibitory responses to 5-HT. The inhibitory response is dominant, reduces membrane excitability and synaptic efficacy, and can reverse 5-HT facilitation at both naive and depressed synapses. Indeed, dopamine can reverse PKC translocation during the continued application of 5-HT. Reversal of translocation can also be seen after translocation mediated by an analog of diacylglycerol, suggesting inhibition is not through blockade of diacylglycerol production. The effects of inhibition on PKC translocation can be rescued by phosphatidic acid, consistent with the inhibitory response involving a reduction or block of production of this lipid. However, phosphatidic acid could not recover PKC-dependent synaptic facilitation due to an additional inhibitory effect on the non-L-type calcium flux linked to synaptic transmission. In summary, we find a novel mechanism downstream of inhibitory receptors linked to inhibition of PKC activation in Aplysia sensory neurons.

  2. Leptin acts in the forebrain to differentially influence baroreflex control of lumbar, renal, and splanchnic sympathetic nerve activity and heart rate.

    PubMed

    Li, Baoxin; Shi, Zhigang; Cassaglia, Priscila A; Brooks, Virginia L

    2013-04-01

    Although leptin is known to increase sympathetic nerve activity (SNA), we tested the hypothesis that leptin also enhances baroreflex control of SNA and heart rate (HR). Using α-chloralose anesthetized male rats, mean arterial pressure (MAP), HR, lumbar SNA (LSNA), splanchnic SNA (SSNA), and renal SNA (RSNA) were recorded before and for 2 hours after lateral cerebroventricular leptin or artificial cerebrospinal fluid administration. Baroreflex function was assessed using a 4-parameter sigmoidal fit of HR and SNA responses to slow ramp (3-5 minutes) changes in MAP, induced by intravenous infusion of nitroprusside and phenylephrine. Leptin (3 μg) increased (P<0.05) basal LSNA, SSNA, RSNA, HR, and MAP, and the LSNA, SSNA, RSNA, and HR baroreflex maxima. Leptin also increased gain of baroreflex control of LSNA and RSNA, but not of SSNA or HR. The elevations in HR were eliminated by pretreatment with methscopalamine, to block parasympathetic nerve activity; however, after cardiac sympathetic blockade with atenolol, leptin still increased basal HR and MAP and the HR baroreflex maximum and minimum. Leptin (1.5 μg) also increased LSNA and enhanced LSNA baroreflex gain and maximum, but did not alter MAP, HR, or the HR baroreflex. Lateral cerebroventricular artificial cerebrospinal fluid had no effects. Finally, to test whether leptin acts in the brain stem, leptin (3 μg) was infused into the 4th ventricle; however, no significant changes were observed. In conclusion, leptin acts in the forebrain to differentially influence baroreflex control of LSNA, RSNA, SSNA, and HR, with the latter action mediated via suppression of parasympathetic nerve activity.

  3. 4,5-Substituted 3-Isoxazolols with Insecticidal Activity Act as Competitive Antagonists of Housefly GABA Receptors.

    PubMed

    Liu, Genyan; Ozoe, Fumiyo; Furuta, Kenjiro; Ozoe, Yoshihisa

    2015-07-22

    The insect GABA receptor (GABAR), which is composed of five RDL subunits, represents an important target for insecticides. A series of 4,5-disubstituted 3-isoxazolols, including muscimol analogues, were synthesized and examined for their activities against four splice variants (ac, ad, bc, and bd) of housefly GABARs expressed in Xenopus oocytes. Muscimol was a more potent agonist than GABA in all four splice variants, whereas synthesized analogues did not exhibit agonism but rather antagonism in housefly GABARs. The introduction of bicyclic aromatic groups at the 4-position of muscimol and the simultaneous replacement of the aminomethyl group with a carbamoyl group at the 5-position to afford six 4-aryl-5-carbamoyl-3-isoxazolols resulted in compounds that exhibited significantly enhanced antagonism with IC50 values in the low micromolar range in the ac variant. The inhibition of GABA-induced currents by 100 μM analogues was approximately 1.5-4-fold greater in the ac and bc variants than in the ad and bd variants. 4-(3-Biphenylyl)-5-carbamoyl-3-isoxazolol displayed competitive antagonism, with IC50 values of 30, 34, 107, and 96 μM in the ac, bc, ad, and bd variants, respectively, and exhibited moderate insecticidal activity against houseflies, with an LD50 value of 5.6 nmol/fly. These findings suggest that these 3-isoxazolol analogues are novel lead compounds for the design and development of insecticides that target the orthosteric site of housefly GABARs.

  4. Induction of mixed function oxidase activity in man by rifapentine (MDL 473), a long-acting rifamycin derivative.

    PubMed Central

    Vital Durand, D; Hampden, C; Boobis, A R; Park, B K; Davies, D S

    1986-01-01

    The effects of rifapentine (MDL 473) administration on hepatic mixed function oxidase activity in man have been investigated in six healthy volunteers. Administration of rifapentine (600 mg 48 h-1) for 10 days resulted in a significant reduction in antipyrine half-life (from 13.2 +/- 1.0 h to 7.7 +/- 0.4 h) and a corresponding increase in its total body clearance (from 41.8 +/- 5.5 ml min-1 to 67.4 +/- 5.6 ml min-1). Twelve days after stopping rifapentine administration, these values had largely returned to base-line. 24-Hour excretion of 6 beta-hydroxycortisol was significantly increased, by approximately three-fold, following administration of rifapentine for 10 days. Again, 12 days after stopping drug administration, 6 beta-hydroxycortisol excretion had returned to pretreatment values. Clearance of antipyrine to its three oxidative metabolites was increased by rifapentine administration, although the increase for 3-hydroxymethylantipyrine was not significant. The greatest increase (+140%) was observed for norantipyrine. Twelve days after the last dose of rifapentine, all values had returned to control levels. It is concluded that, like rifampicin, rifapentine is a potent inducer of mixed function oxidase activity in man and that the possibility of clinically significant drug interactions should be anticipated in the therapeutic use of this compound. PMID:3947503

  5. Structure-activity relationships of 1,4-dihydropyridines that act as enhancers of the vanilloid receptor 1 (TRPV1).

    PubMed

    Roh, Eun Joo; Keller, Jason M; Olah, Zoltan; Iadarola, Michael J; Jacobson, Kenneth A

    2008-10-15

    Vanilloid agonists such as capsaicin activate ion flux through the TRPV1 channel, a heat- and ligand-gated cation channel that transduces painful chemical or thermal stimuli applied to peripheral nerve endings in skin or deep tissues. We have probed the SAR of a variety of 1,4-dihydropyridine (DHP) derivatives as novel 'enhancers' of TRPV1 activity by examining changes in capsaicin-induced elevations in (45)Ca(2+)-uptake in either cells ectopically expressing TRPV1 or in cultured dorsal root ganglion (DRG) neurons. The enhancers increased the maximal capsaicin effect on (45)Ca(2+)-uptake by typically 2- to 3-fold without producing an action when used alone. The DHP enhancers contained 6-aryl substitution and small alkyl groups at the 1 and 4 positions, and a 3-phenylalkylthioester was tolerated. Levels of free intracellular Ca(2+), as measured by calcium imaging, were also increased in DRG neurons when exposed to the combination of capsaicin and the most efficacious enhancer 23 compared to capsaicin alone. Thus, DHPs can modulate TRPV1 channels in a positive fashion.

  6. Identification of a monoclonal antibody against the leptin receptor that acts as an antagonist and blocks human monocyte and T cell activation.

    PubMed

    Fazeli, Mehdi; Zarkesh-Esfahani, Hamid; Wu, Zida; Maamra, Mabrouka; Bidlingmaier, Martin; Pockley, A Graham; Watson, Philip; Matarese, Giuseppe; Strasburger, Christian J; Ross, Richard J M

    2006-05-30

    Nutritional status has a major impact on the immune response and this is in part mediated by leptin, a pro-inflammatory cytokine. Preliminary data suggest that antagonism of leptin may offer a therapeutic approach for the treatment of some inflammatory disorders. We have tested monoclonal antibodies (mAbs) to the human leptin receptor (ObR) for antagonist activity using a leptin signalling bioassay. We identified a mAb, 9F8, which demonstrated dose-dependent antagonist activity in the leptin bioassay. Specificity of the mAb for ObR was confirmed using a plate binding assay. The 9F8 mAb displaced leptin binding to human ObR and enzymatically generated Fab fragments of 9F8 retained antagonist activity. Therefore the Fab fragment of 9F8 was cloned and recombinant 9F8 Fab (rFab) was purified from E. coli periplasmic fraction using a C-terminal His tag. Purified 9F8 rFab bound to human ObR and exhibited leptin antagonist activity. In vitro studies demonstrated that the 9F8 mAb inhibited leptin induced TNF-alpha production from human monocytes and anti-CD3 mAb induced proliferation of human T cells in PBMC culture. In conclusion, this study has identified a mAb to the human leptin receptor which inhibits leptin signalling and acts as a leptin antagonist in vitro.

  7. GalR Acts as a Transcriptional Activator of galKT in the Presence of Galactose in Streptococcus pneumoniae.

    PubMed

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Kuipers, Oscar P

    2015-01-01

    We explored the regulatory mechanism of Leloir pathway genes in Streptococcus pneumoniae D39. Here, we demonstrate that the expression of galKT is galactose dependent. By microarray analysis and quantitative RT-PCR, we further show the role of the transcriptional regulator GalR, present upstream of galKT, as a transcriptional activator of galKT in the presence of galactose. Moreover, we predict a 19-bp regulatory site (5'-GATAGTTTAGTAAAATTTT-3') for the transcriptional regulator GalR in the promoter region of galK, which is also highly conserved in other streptococci. Growth comparison of D39 ΔgalK with the D39 wild type grown in the presence of galactose shows that galK is required for the proper growth of S. pneumoniae on galactose.

  8. Rational Design of Fatty Acid Amide Hydrolase Inhibitors that Act by Covalently Bonding to Two Active Site Residues

    PubMed Central

    Otrubova, Katerina; Brown, Monica; McCormick, Michael S.; Han, Gye W.; O’Neal, Scott T.; Cravatt, Benjamin F.; Stevens, Raymond C.; Lichtman, Aron H.; Boger, Dale L.

    2013-01-01

    The design and characterization of α-ketoheterocycle fatty acid amide hydrolase (FAAH) inhibitors are disclosed that additionally and irreversibly target a cysteine (Cys269) found in the enzyme cytosolic port while maintaining the reversible covalent Ser241 attachment responsible for their rapid and initially reversible enzyme inhibition. Two α-ketooxazoles (3 and 4) containing strategically placed electrophiles at the C5 position of the pyridyl substituent of 2 (OL-135) were prepared and examined as inhibitors of FAAH. Consistent with the observed time-dependent non-competitive inhibition, the co-crystal X-ray structure of 3 bound to a humanized variant of rat FAAH revealed that 3 was not only covalently bound to the active site catalytic nucleophile Ser241 as a deprotonated hemiketal, but also to Cys269 through the pyridyl C5-substituent, thus providing an inhibitor with dual covalent attachment in the enzyme active site. In vivo characterization of the prototypical inhibitors in mice demonstrate that they raise endogenous brain levels of FAAH substrates to a greater extent and for a much longer duration (>6 h) than the reversible inhibitor 2, indicating that the inhibitors accumulate and persist in the brain to completely inhibit FAAH for a prolonged period. Consistent with this behavior and the targeted irreversible enzyme inhibition, 3 reversed cold allodynia in the chronic constriction injury model of neuropathic pain in mice for a sustained period (>6 h) beyond that observed with the reversible inhibitor 2, providing effects that were unchanged over the 1–6 h time course monitored. PMID:23581831

  9. A Dimeric Chlorite Dismutase Exhibits O2-Generating Activity and Acts as a Chlorite Antioxidant in Klebsiella pneumoniae MGH 78578

    PubMed Central

    2015-01-01

    Chlorite dismutases (Clds) convert chlorite to O2 and Cl–, stabilizing heme in the presence of strong oxidants and forming the O=O bond with high efficiency. The enzyme from the pathogen Klebsiella pneumoniae (KpCld) represents a subfamily of Clds that share most of their active site structure with efficient O2-producing Clds, even though they have a truncated monomeric structure, exist as a dimer rather than a pentamer, and come from Gram-negative bacteria without a known need to degrade chlorite. We hypothesized that KpCld, like others in its subfamily, should be able to make O2 and may serve an in vivo antioxidant function. Here, it is demonstrated that it degrades chlorite with limited turnovers relative to the respiratory Clds, in part because of the loss of hypochlorous acid from the active site and destruction of the heme. The observation of hypochlorous acid, the expected leaving group accompanying transfer of an oxygen atom to the ferric heme, is consistent with the more open, solvent-exposed heme environment predicted by spectroscopic measurements and inferred from the crystal structures of related proteins. KpCld is more susceptible to oxidative degradation under turnover conditions than the well-characterized Clds associated with perchlorate respiration. However, wild-type K. pneumoniae has a significant growth advantage in the presence of chlorate relative to a Δcld knockout strain, specifically under nitrate-respiring conditions. This suggests that a physiological function of KpCld may be detoxification of endogenously produced chlorite. PMID:25437493

  10. Intracerebroventricular morphine decreases descending inhibitions acting on lumbar dorsal horn neuronal activities related to pain in the rat.

    PubMed

    Bouhassira, D; Villanueva, L; Le Bars, D

    1988-10-01

    Recordings were made from convergent neurons in the lumbar dorsal horn of the rat. These neurons were activated by both innocuous and noxious stimuli applied to their excitatory receptive fields located on the extremity of the ipsilateral hindpaw. Transcutaneous application of suprathreshold 2-msec square-wave pulses to the center of the receptive field resulted in responses to A- and C-fiber activation being observed: 27.2 +/- 2.2 (mean +/- S.E.M.) C-fiber latency spikes were evoked per stimulus. This type of response was inhibited by applying noxious conditioning stimuli to heterotopic areas of the body; in particular, immersing the tail in a 52 degrees C waterbath caused a 74.2 +/- 2.0% inhibition of the C-fiber evoked responses; such inhibitory processes have been termed diffuse noxious inhibitory controls (DNIC). The effects of microinjections of morphine (0.6-40 micrograms; 2 microliter) within the 3rd ventricle on both the unconditioned C-fiber-evoked responses and the inhibitory processes triggered from the tail were investigated in an attempt to answer two questions: 1) does i.c.v. morphine increase tonic descending inhibitory processes? and 2) what are the effects of i.c.v. morphine on descending inhibitory processes triggered phasically by noxious stimuli? The predominant effect of i.c.v. morphine on the C-fiber-evoked responses was a facilitation (17 of 26 cases). Such a facilitation was dose-related in the 0.6 to 40 microgram range and naloxone reversible; it plateaued from 20 min after the microinjection. No clear relationship was found between the number of C-fiber evoked responses in the control sequences and the subsequent effect of i.c.v. morphine. Intracerebroventricular morphine clearly reduced DNIC in the majority of cases (21 of 26). Such a reduction was dose-related in the 0.6 to 2.5 microgram range and naloxone reversible; it plateaued within 90 min of microinjection. No clear relationship was found between the changes in DNIC and either the

  11. Length heterogeneity at conserved sequence block 2 in human mitochondrial DNA acts as a rheostat for RNA polymerase POLRMT activity

    PubMed Central

    Tan, Benedict G.; Wellesley, Frederick C.; Savery, Nigel J.; Szczelkun, Mark D.

    2016-01-01

    The guanine (G)-tract of conserved sequence block 2 (CSB 2) in human mitochondrial DNA can result in transcription termination due to formation of a hybrid G-quadruplex between the nascent RNA and the nontemplate DNA strand. This structure can then influence genome replication, stability and localization. Here we surveyed the frequency of variation in sequence identity and length at CSB 2 amongst human mitochondrial genomes and used in vitro transcription to assess the effects of this length heterogeneity on the activity of the mitochondrial RNA polymerase, POLRMT. In general, increased G-tract length correlated with increased termination levels. However, variation in the population favoured CSB 2 sequences which produced efficient termination while particularly weak or strong signals were avoided. For all variants examined, the 3′ end of the transcripts mapped to the same downstream sequences and were prevented from terminating by addition of the transcription factor TEFM. We propose that CSB 2 length heterogeneity allows variation in the efficiency of transcription termination without affecting the position of the products or the capacity for regulation by TEFM. PMID:27436287

  12. IK acts as an immunoregulator of inflammatory arthritis by suppressing TH17 cell differentiation and macrophage activation

    PubMed Central

    Park, Hye-Lim; Lee, Sang-Myeong; Min, Jun-Ki; Moon, Su-Jin; Kim, Inki; Kang, Kyung-Won; Park, Sooho; Choi, SeulGi; Jung, Ha-Na; Lee, Dong-Hee; Nam, Jae-Hwan

    2017-01-01

    Pathogenic T helper cells (TH) and macrophages have been implicated in the development of rheumatoid arthritis (RA), which can lead to severe synovial inflammation and bone destruction. A range of therapies have been widely used for RA, including specific monoclonal antibodies and chemical inhibitors against inflammatory cytokines produced by these cells. However, these have not been sufficient to meet the medical need. Here, we show that in transgenic mice expressing truncated IK (tIK) cytokine, inflammatory arthritis symptoms were ameliorated as the result of suppression of the differentiation of TH1 and TH17 cells and of macrophage activation. During inflammatory responses, tIK cytokine systemically regulated macrophage functions and TH17 cell differentiation through inactivation of the MAPK and NF-κB pathways. Interestingly, the level of tIK cytokine was higher in synovial fluid of RA patients compared with that in osteoarthritis (OA) patients. Our observations suggest that tIK cytokine can counterbalance the induction of inflammatory cells related to RA and thus could be a new therapeutic agent for the treatment of RA. PMID:28071693

  13. Pharmacological experiments in healthy volunteers with bopindolol, a long-acting beta-adrenoceptor blocking drug with partial agonist activity.

    PubMed Central

    Aellig, W H

    1985-01-01

    Bopindolol is a potent and specific beta-adrenoceptor antagonist with partial agonist activity. In animal experiments it blocks both beta 1- and beta 2-adrenoceptors and possesses a long duration of action. In the present study in healthy volunteers bopindolol was about ten times more potent than pindolol in reducing isoprenaline-induced and exercise-induced tachycardia. In experiments on exercise-induced tachycardia an oral dose of 2 mg produced a near maximum reduction of exercise heart rate, occurring within 2 to 3 h of administration. With higher doses (up to 12 mg) the maximum effect was reached earlier (between 1 and 2 h). The long duration of action of bopindolol observed in animal studies was confirmed in man. Twenty-four hours after 4 and 10 mg bopindolol more than 2/3 of the maximum effect was still present. After 48 h 38% of the maximum effect of 4 mg and 50% of that of 12 mg remained. Even at 72 and 96 h exercise-induced tachycardia was still significantly lowered after both doses of the drug. When bopindolol was administered once daily for 5 days there was a slight increase in the maximum reduction of exercise-induced tachycardia during treatment with 1 mg/day but not with 4 mg/day, which produced a near maximum effect. PMID:2862891

  14. Melatonin acts through MT1/MT2 receptors to activate hypothalamic Akt and suppress hepatic gluconeogenesis in rats.

    PubMed

    Faria, Juliana A; Kinote, Andrezza; Ignacio-Souza, Letícia M; de Araújo, Thiago M; Razolli, Daniela S; Doneda, Diego L; Paschoal, Lívia B; Lellis-Santos, Camilo; Bertolini, Gisele L; Velloso, Lício A; Bordin, Silvana; Anhê, Gabriel F

    2013-07-15

    Melatonin can contribute to glucose homeostasis either by decreasing gluconeogenesis or by counteracting insulin resistance in distinct models of obesity. However, the precise mechanism through which melatonin controls glucose homeostasis is not completely understood. Male Wistar rats were administered an intracerebroventricular (icv) injection of melatonin and one of following: an icv injection of a phosphatidylinositol 3-kinase (PI3K) inhibitor, an icv injection of a melatonin receptor (MT) antagonist, or an intraperitoneal (ip) injection of a muscarinic receptor antagonist. Anesthetized rats were subjected to pyruvate tolerance test to estimate in vivo glucose clearance after pyruvate load and in situ liver perfusion to assess hepatic gluconeogenesis. The hypothalamus was removed to determine Akt phosphorylation. Melatonin injections in the central nervous system suppressed hepatic gluconeogenesis and increased hypothalamic Akt phosphorylation. These effects of melatonin were suppressed either by icv injections of PI3K inhibitors and MT antagonists and by ip injection of a muscarinic receptor antagonist. We conclude that melatonin activates hypothalamus-liver communication that may contribute to circadian adjustments of gluconeogenesis. These data further suggest a physiopathological relationship between the circadian disruptions in metabolism and reduced levels of melatonin found in type 2 diabetes patients.

  15. UNC-16 (JIP3) Acts Through Synapse-Assembly Proteins to Inhibit the Active Transport of Cell Soma Organelles to Caenorhabditis elegans Motor Neuron Axons.

    PubMed

    Edwards, Stacey L; Morrison, Logan M; Yorks, Rosalina M; Hoover, Christopher M; Boominathan, Soorajnath; Miller, Kenneth G

    2015-09-01

    The conserved protein UNC-16 (JIP3) inhibits the active transport of some cell soma organelles, such as lysosomes, early endosomes, and Golgi, to the synaptic region of axons. However, little is known about UNC-16's organelle transport regulatory function, which is distinct from its Kinesin-1 adaptor function. We used an unc-16 suppressor screen in Caenorhabditis elegans to discover that UNC-16 acts through CDK-5 (Cdk5) and two conserved synapse assembly proteins: SAD-1 (SAD-A Kinase), and SYD-2 (Liprin-α). Genetic analysis of all combinations of double and triple mutants in unc-16(+) and unc-16(-) backgrounds showed that the three proteins (CDK-5, SAD-1, and SYD-2) are all part of the same organelle transport regulatory system, which we named the CSS system based on its founder proteins. Further genetic analysis revealed roles for SYD-1 (another synapse assembly protein) and STRADα (a SAD-1-interacting protein) in the CSS system. In an unc-16(-) background, loss of the CSS system improved the sluggish locomotion of unc-16 mutants, inhibited axonal lysosome accumulation, and led to the dynein-dependent accumulation of lysosomes in dendrites. Time-lapse imaging of lysosomes in CSS system mutants in unc-16(+) and unc-16(-) backgrounds revealed active transport defects consistent with the steady-state distributions of lysosomes. UNC-16 also uses the CSS system to regulate the distribution of early endosomes in neurons and, to a lesser extent, Golgi. The data reveal a new and unprecedented role for synapse assembly proteins, acting as part of the newly defined CSS system, in mediating UNC-16's organelle transport regulatory function.

  16. Join-Graph Propagation Algorithms

    PubMed Central

    Mateescu, Robert; Kask, Kalev; Gogate, Vibhav; Dechter, Rina

    2010-01-01

    The paper investigates parameterized approximate message-passing schemes that are based on bounded inference and are inspired by Pearl's belief propagation algorithm (BP). We start with the bounded inference mini-clustering algorithm and then move to the iterative scheme called Iterative Join-Graph Propagation (IJGP), that combines both iteration and bounded inference. Algorithm IJGP belongs to the class of Generalized Belief Propagation algorithms, a framework that allowed connections with approximate algorithms from statistical physics and is shown empirically to surpass the performance of mini-clustering and belief propagation, as well as a number of other state-of-the-art algorithms on several classes of networks. We also provide insight into the accuracy of iterative BP and IJGP by relating these algorithms to well known classes of constraint propagation schemes. PMID:20740057

  17. Propagating Resource Constraints Using Mutual Exclusion Reasoning

    NASA Technical Reports Server (NTRS)

    Frank, Jeremy; Sanchez, Romeo; Do, Minh B.; Clancy, Daniel (Technical Monitor)

    2001-01-01

    One of the most recent techniques for propagating resource constraints in Constraint Based scheduling is Energy Constraint. This technique focuses in precedence based scheduling, where precedence relations are taken into account rather than the absolute position of activities. Although, this particular technique proved to be efficient on discrete unary resources, it provides only loose bounds for jobs using discrete multi-capacity resources. In this paper we show how mutual exclusion reasoning can be used to propagate time bounds for activities using discrete resources. We show that our technique based on critical path analysis and mutex reasoning is just as effective on unary resources, and also shows that it is more effective on multi-capacity resources, through both examples and empirical study.

  18. Leupaxin is expressed in mammary carcinoma and acts as a transcriptional activator of the estrogen receptor α

    PubMed Central

    KAULFUSS, SILKE; HERR, ANNA-MARIA; BÜCHNER, ANJA; HEMMERLEIN, BERNHARD; GÜNTHERT, ANDREAS R.; BURFEIND, PETER

    2015-01-01

    Leupaxin belongs to the group of paxillin proteins and was reported to play a major role in the invasion and migration of prostate cancer cells. In the present study we were able to show by using a cDNA cancer profiling array that leupaxin is upregulated in breast and endometrial cancer, whereas downregulation of leupaxin was observed in lung cancer. In addition, immunohistochemical studies using a leupaxin-specific antibody on human breast cancer specimens (n=127) revealed that leupaxin is expressed mainly in invasive ductal carcinomas and ductal carcinoma in situ (40 and 49% respectively), and only in a minority of lobular mammary carcinomas. To further investigate the role of leupaxin in the progression of breast cancer the expression of leupaxin was analysed in six breast cancer cell lines. The estrogen receptor α (ERα)-positive HCC70 and the ERα-negative MDA-MB-231 cells showed leupaxin expression on the RNA and protein level. Leupaxin localizes in these mammary carcinoma cells at focal adhesion sites and shuttles between membrane and nucleus via its LD4 motif as major nuclear export signal. Interaction partners of leupaxin in the nucleus represent the estrogen receptors ERα and ERβ. Both ERα and ERβ bind to the LIM domains of leupaxin via their AF-1/DNA binding domains. Furthermore, leupaxin is able to induce transcriptional activity of ERα independent of the presence of estradiol. The specific downregulation of leupaxin expression using siRNAs in mammary carcinoma cells resulted in reduced migratory capability and diminished invasiveness whereas no effect on proliferation was observed. Collectively, these results show that leupaxin has particular influence on the progression and invasion of breast cancer cells and may therefore represent an interesting candidate protein for diagnosis and therapeutic interventions. PMID:25955236

  19. A general method for assaying homo- and hetero-transglycanase activities that act on plant cell-wall polysaccharides.

    PubMed

    Franková, Lenka; Fry, Stephen C

    2015-04-01

    Transglycanases (endotransglycosylases) cleave a polysaccharide (donor-substrate) in mid-chain, and then transfer a portion onto another poly- or oligosaccharide (acceptor-substrate). Such enzymes contribute to plant cell-wall assembly and/or re-structuring. We sought a general method for revealing novel homo- and hetero-transglycanases, applicable to diverse polysaccharides and oligosaccharides, separating transglycanase-generated (3)H-polysaccharides from unreacted (3)H-oligosaccharides--the former immobilized (on filter-paper, silica-gel or glass-fiber), the latter eluted. On filter-paper, certain polysaccharides [e.g. (1→3, 1→4)-β-D-glucans] remained satisfactorily adsorbed when water-washed; others (e.g. pectins) were partially lost. Many oligosaccharides (e.g. arabinan-, galactan-, xyloglucan-based) were successfully eluted in appropriate solvents, but others (e.g. [(3)H]xylohexaitol, [(3)H]mannohexaitol [(3)H]cellohexaitol) remained immobile. On silica-gel, all (3)H-oligosaccharides left an immobile 'ghost' spot (contaminating any (3)H-polysaccharides), which was diminished but not prevented by additives e.g. sucrose or Triton X-100. The best stratum was glass-fiber (GF), onto which the reaction-mixture was dried then washed in 75% ethanol. Washing led to minimal loss or lateral migration of (3)H-polysaccharides if conducted by slow percolation of acidified ethanol. The effectiveness of GF-blotting was well demonstrated for Chara vulgaris trans-β-mannanase. In conclusion, our novel GF-blotting technique efficiently frees transglycanase-generated (3)H-polysaccharides from unreacted (3)H-oligosaccharides, enabling high-throughput screening of multiple postulated transglycanase activities utilising chemically diverse donor- and acceptor-substrates.

  20. Modeling turbulent flame propagation

    SciTech Connect

    Ashurst, W.T.

    1994-08-01

    Laser diagnostics and flow simulation techniques axe now providing information that if available fifty years ago, would have allowed Damkoehler to show how turbulence generates flame area. In the absence of this information, many turbulent flame speed models have been created, most based on Kolmogorov concepts which ignore the turbulence vortical structure, Over the last twenty years, the vorticity structure in mixing layers and jets has been shown to determine the entrainment and mixing behavior and these effects need to be duplicated by combustion models. Turbulence simulations reveal the intense vorticity structure as filaments and simulations of passive flamelet propagation show how this vorticity Creates flame area and defines the shape of the expected chemical reaction surface. Understanding how volume expansion interacts with flow structure should improve experimental methods for determining turbulent flame speed. Since the last decade has given us such powerful new tools to create and see turbulent combustion microscopic behavior, it seems that a solution of turbulent combustion within the next decade would not be surprising in the hindsight of 2004.

  1. Directed HK propagator.

    PubMed

    Kocia, Lucas; Heller, Eric J

    2015-09-28

    We offer a more formal justification for the successes of our recently communicated "directed Heller-Herman-Kluk-Kay" (DHK) time propagator by examining its performance in one-dimensional bound systems which exhibit at least quasi-periodic motion. DHK is distinguished by its single one-dimensional integral--a vast simplification over the usual 2N-dimensional integral in full Heller-Herman-Kluk-Kay (for an N-dimensional system). We find that DHK accurately captures particular coherent state autocorrelations when its single integral is chosen to lie along these states' fastest growing manifold, as long as it is not perpendicular to their action gradient. Moreover, the larger the action gradient, the better DHK will perform. We numerically examine DHK's accuracy in a one-dimensional quartic oscillator and illustrate that these conditions are frequently satisfied such that the method performs well. This lends some explanation for why DHK frequently seems to work so well and suggests that it may be applicable to systems exhibiting quite strong anharmonicity.

  2. Directed HK propagator

    NASA Astrophysics Data System (ADS)

    Kocia, Lucas; Heller, Eric J.

    2015-09-01

    We offer a more formal justification for the successes of our recently communicated "directed Heller-Herman-Kluk-Kay" (DHK) time propagator by examining its performance in one-dimensional bound systems which exhibit at least quasi-periodic motion. DHK is distinguished by its single one-dimensional integral—a vast simplification over the usual 2N-dimensional integral in full Heller-Herman-Kluk-Kay (for an N-dimensional system). We find that DHK accurately captures particular coherent state autocorrelations when its single integral is chosen to lie along these states' fastest growing manifold, as long as it is not perpendicular to their action gradient. Moreover, the larger the action gradient, the better DHK will perform. We numerically examine DHK's accuracy in a one-dimensional quartic oscillator and illustrate that these conditions are frequently satisfied such that the method performs well. This lends some explanation for why DHK frequently seems to work so well and suggests that it may be applicable to systems exhibiting quite strong anharmonicity.

  3. AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration

    PubMed Central

    Linares, Daniel M.; del Rio, Beatriz; Redruello, Begoña; Martin, M. Cruz; de Jong, Anne; Kuipers, Oscar P.; Fernandez, Maria

    2015-01-01

    Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. PMID:26116671

  4. TALE1 from Xanthomonas axonopodis pv. manihotis acts as a transcriptional activator in plant cells and is important for pathogenicity in cassava plants.

    PubMed

    Castiblanco, Luisa F; Gil, Juliana; Rojas, Alejandro; Osorio, Daniela; Gutiérrez, Sonia; Muñoz-Bodnar, Alejandra; Perez-Quintero, Alvaro L; Koebnik, Ralf; Szurek, Boris; López, Camilo; Restrepo, Silvia; Verdier, Valérie; Bernal, Adriana J

    2013-01-01

    Many plant-pathogenic bacteria suppress pathogen-associated molecular pattern (PAMP)-triggered immunity by injecting effector proteins into the host cytoplasm during infection through the type III secretion system (TTSS). This type III secretome plays an important role in bacterial pathogenicity in susceptible hosts. Xanthomonas axonopodis pv. manihotis (Xam), the causal agent of cassava bacterial blight, injects several effector proteins into the host cell, including TALE1(Xam) . This protein is a member of the Transcriptional Activator-Like effector (TALE) protein family, formerly known as the AvrBs3/PthA family. TALE1(Xam) has 13.5 tandem repeats of 34 amino acids each, as well as two nuclear localization signals and an acidic activation domain at the C-terminus. In this work, we demonstrate the importance of TALE1(Xam) in the pathogenicity of Xam. We use versions of the gene that lack different domains in the protein in structure-function studies to show that the eukaryotic domains at the 3' end are critical for pathogenicity. In addition, we demonstrate that, similar to the characterized TALE proteins from other Xanthomonas species, TALE1(Xam) acts as a transcriptional activator in plant cells. This is the first report of the identification of a TALE in Xam, and contributes to our understanding of the pathogenicity mechanisms employed by this bacterium to colonize and cause disease in cassava.

  5. AguR, a Transmembrane Transcription Activator of the Putrescine Biosynthesis Operon in Lactococcus lactis, Acts in Response to the Agmatine Concentration.

    PubMed

    Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A

    2015-09-01

    Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins.

  6. Vestigial-like 2 acts downstream of MyoD activation and is associated with skeletal muscle differentiation in chick myogenesis.

    PubMed

    Bonnet, Aline; Dai, Fangping; Brand-Saberi, Beate; Duprez, Delphine

    2010-01-01

    The co-factor Vestigial-like 2 (Vgl-2), in association with the Scalloped/Tef/Tead transcription factors, has been identified as a component of the myogenic program in the C2C12 cell line. In order to understand Vgl-2 function in embryonic muscle formation, we analysed Vgl-2 expression and regulation during chick embryonic development. Vgl-2 expression was associated with all known sites of skeletal muscle formation, including those in the head, trunk and limb. Vgl-2 was expressed after the myogenic factor MyoD, regardless of the site of myogenesis. Analysis of Vgl-2 regulation by Notch signalling showed that Vgl-2 expression was down-regulated by Delta1-activated Notch, similarly to the muscle differentiation genes MyoD, Myogenin,Desmin, and Mef2c, while the expression of the muscle progenitor markers such as Myf5, Six1 and FgfR4 was not modified. Moreover, we established that the Myogenic Regulatory Factors (MRFs) associated with skeletal muscle differentiation (MyoD, Myogenin and Mrf4) were sufficient to activate Vgl-2 expression, while Myf5 was not able to do so. The Vgl-2 endogenous expression, the similar regulation of Vgl-2 and that of MyoD and Myogenin by Notch signalling, and the positive regulation of Vgl-2 by these MRFs suggest that Vgl-2 acts downstream of MyoD activation and is associated with the differentiation step in embryonic skeletal myogenesis.

  7. The Slicer Activity of ARGONAUTE1 Is Required Specifically for the Phasing, Not Production, of Trans-Acting Short Interfering RNAs in Arabidopsis[OPEN

    PubMed Central

    Marchais, Antonin; Poulsen, Christian; Hauptmann, Judith; Meister, Gunter

    2016-01-01

    ARGONAUTE1 (AGO1) mediates posttranscriptional silencing by microRNAs (miRNAs) and short interfering RNAS (siRNAs). AGO1-catalyzed RNA cleavage (slicing) represses miRNA targets, but current models also highlight the roles of slicing in formation of siRNAs and siRNA-AGO1 complexes. miRNA-guided slicing is required for biogenesis of phased, trans-acting siRNAs (tasiRNAs), whose cleaved precursor fragments are converted to double-stranded RNA by RNA-dependent RNA polymerase 6 (RDR6). In addition, unwinding of duplex siRNA bound to AGO1 requires passenger strand cleavage in vitro. In this study, we analyze how mutation of four metal ion-coordinating residues of Arabidopsis thaliana AGO1 affects slicer activity in vitro and siRNA function in vivo. We show that while all four residues are required for slicer activity, they do not contribute equally to catalysis. Moreover, passenger strand cleavage is required for assembly of active AGO1-siRNA complexes in vivo, and many AGO1-bound siRNAs are trimmed in the absence of slicer activity. Remarkably, seedlings defective in AGO1 slicer activity produce abundant siRNAs from tasiRNA loci in vivo. These siRNAs depend on RDR6 and SUPPRESSOR OF GENE SILENCING3, but unlike wild-type tasiRNAs, they are unphased. These results demonstrate that slicing is solely required for phase definition of tasiRNAs, and they strongly support recruitment of RDR6 by AGO1 rather than by cleavage fragments. PMID:27354557

  8. Propagation of dissection in a residually-stressed artery model.

    PubMed

    Wang, Lei; Roper, Steven M; Hill, Nicholas A; Luo, Xiaoyu

    2017-02-01

    This paper studies dissection propagation subject to internal pressure in a residually-stressed two-layer arterial model. The artery is assumed to be infinitely long, and the resultant plane strain problem is solved using the extended finite element method. The arterial layers are modelled using the anisotropic hyperelastic Holzapfel-Gasser-Ogden model, and the tissue damage due to tear propagation is described using a linear cohesive traction-separation law. Residual stress in the arterial wall is determined by an opening angle [Formula: see text] in a stress-free configuration. An initial tear is introduced within the artery which is subject to internal pressure. Quasi-static solutions are computed to determine the critical value of the pressure, at which the dissection starts to propagate. Our model shows that the dissection tends to propagate radially outwards. Interestingly, the critical pressure is higher for both very short and very long tears. The simulations also reveal that the inner wall buckles for longer tears, which is supported by clinical CT scans. In all simulated cases, the critical pressure is found to increase with the opening angle. In other words, residual stress acts to protect the artery against tear propagation. The effect of residual stress is more prominent when a tear is of intermediate length ([Formula: see text]90[Formula: see text] arc length). There is an intricate balance between tear length, wall buckling, fibre orientation, and residual stress that determines the tear propagation.

  9. Proceedings of the Eleventh Advanced Communications Technology Satellite Propagation Studies Workshop (APSW 11)

    NASA Technical Reports Server (NTRS)

    Golshan, Nasser (Editor); Ho, Christian (Editor)

    1998-01-01

    The Advanced Communications Technology Satellite Propagation Studies Workshop (APSW) is convened each year to present the results of the Advanced Communications Technology Satellite (ACTS) Ka-band propagation campaign. Representatives from the space community including industry, academia, and government who are interested in radiowave propagation at Ka-band are invited to APSW for discussions and exchange of information. The ACTS Propagation campaign will complete five years of Ka-Band data collection at seven sites in North America by December 31, 1998. Through this effort, NASA is making a major contribution to the effective utilization of this band by providing timely propagation data and models for predicting the performance of Ka-band links between space and ground.

  10. Mineral replacement front propagation in deformed rocks

    NASA Astrophysics Data System (ADS)

    Beaudoin, Nicolas; Koehn, Daniel; Kelka, Ulrich

    2015-04-01

    Fluid migrations are a major agent of contaminant transport leading to mineral replacement in rocks, impacting their properties as porosity, permeability, and rheology. Understanding the physical and chemical mechanisms that govern mineralogical replacement during and after deformation is required to better understand complex interplays between fluid and rocks that are involved in faulting, seismic cycle, and resource distribution in the upper crust. Dolomitization process related to hydrothermal fluid flow is one of the most studied and debated replacement processes in earth sciences. Dolomitization of limestone is of economic importance as well, as it stands as unconventional oil reservoirs and is systematically observed in Mississippian-Valley Type ore deposit. Despite recent breakthrough about dolomitization processes at large-scale, the small-scale propagation of the reaction front remains unclear. It is poorly documented in the occurrence of stylolites and fractures in the medium while pressure-solution and fracture network development are the most efficient deformation accomodation mechanism in limestone from early compaction to layer-parallel shortening. Thus, the impact of such network on geometry of replaced bodies and on replacement front propagation deserves specific attention. This contribution illustrates the role of fracture and stylolites on the propagation of a reaction front. In a 2 dimensional numerical model we simulate the dolomitization front propagation in a heterogeneous porous medium. The propagation of the reaction front is governed by the competition between advection and diffusion processes, and takes into account reaction rates, disorder in the location of the potential replacement seeds, and permeability heterogeneities. We add stylolites and fractures that can act as barriers or drains to fluid flow according to their orientation and mineralogical content, which can or cannot react with the contaminant. The patterns produced from

  11. Uncertainty propagation in nuclear forensics.

    PubMed

    Pommé, S; Jerome, S M; Venchiarutti, C

    2014-07-01

    Uncertainty propagation formulae are presented for age dating in support of nuclear forensics. The age of radioactive material in this context refers to the time elapsed since a particular radionuclide was chemically separated from its decay product(s). The decay of the parent radionuclide and ingrowth of the daughter nuclide are governed by statistical decay laws. Mathematical equations allow calculation of the age of specific nuclear material through the atom ratio between parent and daughter nuclides, or through the activity ratio provided that the daughter nuclide is also unstable. The derivation of the uncertainty formulae of the age may present some difficulty to the user community and so the exact solutions, some approximations, a graphical representation and their interpretation are presented in this work. Typical nuclides of interest are actinides in the context of non-proliferation commitments. The uncertainty analysis is applied to a set of important parent-daughter pairs and the need for more precise half-life data is examined.

  12. Ascorbate does not act as a pro-oxidant towards lipids and proteins in human plasma exposed to redox-active transition metal ions and hydrogen peroxide.

    PubMed

    Suh, Jung; Zhu, Ben-Zhan; Frei, Balz

    2003-05-15

    The combination of ascorbate, transition metal ions, and hydrogen peroxide (H(2)O(2)) is an efficient hydroxyl radical generating system called "the Udenfriend system." Although the pro-oxidant role of ascorbate in this system has been well characterized in vitro, it is uncertain whether ascorbate also acts as a pro-oxidant under physiological conditions. To address this question, human plasma, used as a representative biological fluid, was either depleted of endogenous ascorbate with ascorbate oxidase, left untreated, or supplemented with 25 microM-1 mM ascorbate. Subsequently, the plasma samples were incubated at 37 degrees C with 50 microM-1 mM iron (from ferrous ammonium sulfate), 60 or 100 microM copper (from cupric sulfate), and/or 200 microM or 1 mM H(2)O(2). Although endogenous and added ascorbate was depleted rapidly in the presence of transition metal ions and H(2)O(2), no cholesterol ester hydroperoxides or malondialdehyde were formed, i.e., ascorbate protected against, rather than promoted, lipid peroxidation. Conversely, depletion of endogenous ascorbate was sufficient to cause lipid peroxidation, the rate and extent of which were enhanced by the addition of metal ions but not H(2)O(2). Ascorbate also did not enhance protein oxidation in plasma exposed to metal ions and H(2)O(2), as assessed by protein carbonyl formation and depletion of reduced thiols. Interestingly, neither the rate nor the extent of endogenous alpha-tocopherol oxidation in plasma was affected by any of the treatments. Our data show that even in the presence of redox-active iron or copper and H(2)O(2), ascorbate acts as an antioxidant that prevents lipid peroxidation and does not promote protein oxidation in human plasma in vitro.

  13. Activity of the human immunodeficiency virus type 1 cell cycle-dependent internal ribosomal entry site is modulated by IRES trans-acting factors.

    PubMed

    Vallejos, Maricarmen; Deforges, Jules; Plank, Terra-Dawn M; Letelier, Alejandro; Ramdohr, Pablo; Abraham, Christopher G; Valiente-Echeverría, Fernando; Kieft, Jeffrey S; Sargueil, Bruno; López-Lastra, Marcelo

    2011-08-01

    The 5' leader of the human immunodeficiency virus type 1 (HIV-1) genomic RNA harbors an internal ribosome entry site (IRES) that is functional during the G2/M phase of the cell cycle. Here we show that translation initiation mediated by the HIV-1 IRES requires the participation of trans-acting cellular factors other than the canonical translational machinery. We used 'standard' chemical and enzymatic probes and an 'RNA SHAPE' analysis to model the structure of the HIV-1 5' leader and we show, by means of a footprinting assay, that G2/M extracts provide protections to regions previously identified as crucial for HIV-1 IRES activity. We also assessed the impact of mutations on IRES function. Strikingly, mutations did not significantly affect IRES activity suggesting that the requirement for pre-formed stable secondary or tertiary structure within the HIV-1 IRES may not be as strict as has been described for other viral IRESes. Finally, we used a proteomic approach to identify cellular proteins within the G2/M extracts that interact with the HIV-1 5' leader. Together, data show that HIV-1 IRES-mediated translation initiation is modulated by cellular proteins.

  14. Activity of the human immunodeficiency virus type 1 cell cycle-dependent internal ribosomal entry site is modulated by IRES trans-acting factors

    PubMed Central

    Vallejos, Maricarmen; Deforges, Jules; Plank, Terra-Dawn M.; Letelier, Alejandro; Ramdohr, Pablo; Abraham, Christopher G.; Valiente-Echeverría, Fernando; Kieft, Jeffrey S.; Sargueil, Bruno; López-Lastra, Marcelo

    2011-01-01

    The 5′ leader of the human immunodeficiency virus type 1 (HIV-1) genomic RNA harbors an internal ribosome entry site (IRES) that is functional during the G2/M phase of the cell cycle. Here we show that translation initiation mediated by the HIV-1 IRES requires the participation of trans-acting cellular factors other than the canonical translational machinery. We used ‘standard’ chemical and enzymatic probes and an ‘RNA SHAPE’ analysis to model the structure of the HIV-1 5′ leader and we show, by means of a footprinting assay, that G2/M extracts provide protections to regions previously identified as crucial for HIV-1 IRES activity. We also assessed the impact of mutations on IRES function. Strikingly, mutations did not significantly affect IRES activity suggesting that the requirement for pre-formed stable secondary or tertiary structure within the HIV-1 IRES may not be as strict as has been described for other viral IRESes. Finally, we used a proteomic approach to identify cellular proteins within the G2/M extracts that interact with the HIV-1 5′ leader. Together, data show that HIV-1 IRES-mediated translation initiation is modulated by cellular proteins. PMID:21482538

  15. Small heat shock protein IbpB acts as a robust chaperone in living cells by hierarchically activating its multi-type substrate-binding residues.

    PubMed

    Fu, Xinmiao; Shi, Xiaodong; Yin, Linxiang; Liu, Jiafeng; Joo, Keehyoung; Lee, Jooyoung; Chang, Zengyi

    2013-04-26

    As ubiquitous molecular chaperones, small heat shock proteins (sHSPs) are crucial for protein homeostasis. It is not clear why sHSPs are able to bind a wide spectrum of non-native substrate proteins and how such binding is enhanced by heat shock. Here, by utilizing a genetically incorporated photo-cross-linker (p-benzoyl-l-phenylalanine), we systematically characterized the substrate-binding residues in IbpB (a sHSP from Escherichia coli) in living cells over a wide spectrum of temperatures (from 20 to 50 °C). A total of 20 and 48 residues were identified at normal and heat shock temperatures, respectively. They are not necessarily hydrophobic and can be classified into three types: types I and II were activated at low and normal temperatures, respectively, and type III mediated oligomerization at low temperature but switched to substrate binding at heat shock temperature. In addition, substrate binding of IbpB in living cells began at temperatures as low as 25 °C and was further enhanced upon temperature elevation. Together, these in vivo data provide novel structural insights into the wide substrate spectrum of sHSPs and suggest that sHSP is able to hierarchically activate its multi-type substrate-binding residues and thus act as a robust chaperone in cells under fluctuating growth conditions.

  16. Action potential propagation and propagation block by GABA in rat posterior pituitary nerve terminals.

    PubMed Central

    Jackson, M B; Zhang, S J

    1995-01-01

    conductance. 7. These results imply two modes of propagation block, one resulting from highly localized release of inhibitory transmitter under conditions potentiating GABA responses, and the other resulting from widespread release of GABA in the absence of receptor potentiation. 8. The Na+ channels of the posterior pituitary nerve terminal have a unique voltage dependence that allows small depolarizations to inactivate without causing activation. The voltage dependence of this Na+ channel may serve as a specialized adaptation that facilitates in allowing small depolarizing conductances to block action potential propagation. Images Figure 9 PMID:7776246

  17. Rga4 modulates the activity of the fission yeast cell integrity MAPK pathway by acting as a Rho2 GTPase-activating protein.

    PubMed

    Soto, Teresa; Villar-Tajadura, Maria Antonia; Madrid, Marisa; Vicente, Jero; Gacto, Mariano; Pérez, Pilar; Cansado, José

    2010-04-09

    Rho GTPase-activating proteins (GAPs) are responsible for the inactivation of Rho GTPases, which are involved in the regulation of critical biological responses in eukaryotic cells, ranging from cell cycle control to cellular morphogenesis. The genome of fission yeast Schizosaccharomyces pombe contains six genes coding for putative Rho GTPases, whereas nine genes code for predicted Rho GAPs (Rga1 to Rga9). One of them, Rga4, has been recently described as a Cdc42 GAP, involved in the control of cell diameter and symmetry in fission yeast. In this work we show that Rga4 is also a Rho2 GAP that negatively modulates the activity of the cell integrity pathway and its main effector, MAPK Pmk1. The DYRK-type protein kinase Pom1, which regulates both the localization and phosphorylation state of Rga4, is also a negative regulator of the Pmk1 pathway, but this control is not dependent upon the Rga4 role as a Rho2-GAP. Hence, two subsets of Rga4 negatively regulate Cdc42 and Rho2 functions in a specific and unrelated way. Finally, we show that Rga7, another Rho2 GAP, down-regulates the Pmk1 pathway in addition to Rga4. These results reinforce the notion of the existence of complex mechanisms determining the selectivity of Rho GAPs toward Rho GTPases and their functions.

  18. Actively coupled optical waveguides

    NASA Astrophysics Data System (ADS)

    Alexeeva, N. V.; Barashenkov, I. V.; Rayanov, K.; Flach, S.

    2014-01-01

    We consider light propagation through a pair of nonlinear optical waveguides with absorption, placed in a medium with power gain. The active medium boosts the in-phase component of the overlapping evanescent fields of the guides, while the nonlinearity of the guides couples it to the damped out-of-phase component creating a feedback loop. As a result, the structure exhibits stable stationary and oscillatory regimes in a wide range of gain-loss ratios. We show that the pair of actively coupled (AC) waveguides can act as a stationary or integrate-and-fire comparator sensitive to tiny differences in their input powers.

  19. Propagation of the deformation front beyond a decollement disrupted by a step : from the Jura case to general conclusions.

    NASA Astrophysics Data System (ADS)

    Caer, Typhaine; Souloumiac, Pauline; Maillot, Bertrand; Leturmy, Pascale

    2016-04-01

    The North of the Jura fold-and-thrust-belt is an example of a thin-skin belt developed over a disrupted décollement. During Oligocene, the area of the current northern Jura undergoes the West European E-W extension that opens the Rhine and Bresse grabens, offsetting the Triassic evaporitic décollement layer. During Miocene, the alpine, roughly N-S, compressive regime folds this prefractured cover. The presence of deformation to the North of a step down in the décollement is sometimes interpreted as the proof of the activation of a deeper décollement, on the basis that outward propagation of deformation must activate shallower decollements and cannot activate deeper ones. Using the limit analysis theory, we demonstrate that for a given set of physical parameters (friction/cohesion), a lowered portion of a décollement can be reactivated depending on the height of the offset and on the topography above it. By sandbox experiment, we illustrate the general behavior of this localization along a disrupted décollement, we show that the offsets represent slowdowns in the deformation. They act as catching points that localize a ramp until the created topography is sufficient to block the ongoing deformation on this ramp allowing it propagation farther along the lowered portion of the décollement level. We use the mechanical analysis to quantify the general conditions in which an offset can block or not the propagation of deformation.

  20. Toxic Substances Control Act

    SciTech Connect

    Not Available

    1992-05-15

    This Reference Book contains a current copy of the Toxic Substances Control Act and those regulations that implement the statute and appear to be most relevant to DOE activities. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. Questions concerning this Reference Book may be directed to Mark Petts, EH-231 (202/586-2609).

  1. Review of aircraft noise propagation

    NASA Technical Reports Server (NTRS)

    Putnam, T. W.

    1975-01-01

    The current state of knowledge about the propagation of aircraft noise was reviewed. The literature on the subject is surveyed and methods for predicting the most important and best understood propagation effects are presented. Available empirical data are examined and the data's general validity is assessed. The methods used to determine the loss of acoustic energy due to uniform spherical spreading, absorption in a homogeneous atmosphere, and absorption due to ground cover are presented. A procedure for determining ground induced absorption as a function of elevation angle between source and receiver is recommended. Other factors that affect propagation, such as refraction and scattering due to turbulence, which were found to be less important for predicting the propagation of aircraft noise, are also evaluated.

  2. Photon propagator for axion electrodynamics

    SciTech Connect

    Itin, Yakov

    2007-10-15

    The axion modified electrodynamics is usually used as a model for description of possible violation of Lorentz invariance in field theory. The low-energy manifestation of Lorentz violation can hopefully be observed in experiments with electromagnetic waves. It justifies the importance of studying how a small axion addition can modify the wave propagation. Although a constant axion does not contribute to the dispersion relation at all, even a slowly varying axion field destroys the light cone structure. In this paper, we study the wave propagation in the axion modified electrodynamics in the framework of the premetric approach. In addition to the modified dispersion relation, we derive the axion generalization of the photon propagator in Feynman and Landau gauge. Our consideration is free of the usual restriction to the constant gradient axion field. It is remarkable that the axion modified propagator is Hermitian. Consequently, the dissipation effects are absent even in the phenomenological model considered here.

  3. Propagation Limitations in Remote Sensing.

    DTIC Science & Technology

    Contents: Multi-sensors and systems in remote sensing ; Radar sensing systems over land; Remote sensing techniques in oceanography; Influence of...propagation media and background; Infrared techniques in remote sensing ; Photography in remote sensing ; Analytical studies in remote sensing .

  4. A database for propagation models

    NASA Technical Reports Server (NTRS)

    Kantak, Anil V.; Suwitra, Krisjani S.

    1992-01-01

    In June 1991, a paper at the fifteenth NASA Propagation Experimenters Meeting (NAPEX 15) was presented outlining the development of a database for propagation models. The database is designed to allow the scientists and experimenters in the propagation field to process their data through any known and accepted propagation model. The architecture of the database also incorporates the possibility of changing the standard models in the database to fit the scientist's or the experimenter's needs. The database not only provides powerful software to process the data generated by the experiments, but is also a time- and energy-saving tool for plotting results, generating tables, and producing impressive and crisp hard copy for presentation and filing.

  5. Reconstruction of nonlinear wave propagation

    DOEpatents

    Fleischer, Jason W; Barsi, Christopher; Wan, Wenjie

    2013-04-23

    Disclosed are systems and methods for characterizing a nonlinear propagation environment by numerically propagating a measured output waveform resulting from a known input waveform. The numerical propagation reconstructs the input waveform, and in the process, the nonlinear environment is characterized. In certain embodiments, knowledge of the characterized nonlinear environment facilitates determination of an unknown input based on a measured output. Similarly, knowledge of the characterized nonlinear environment also facilitates formation of a desired output based on a configurable input. In both situations, the input thus characterized and the output thus obtained include features that would normally be lost in linear propagations. Such features can include evanescent waves and peripheral waves, such that an image thus obtained are inherently wide-angle, farfield form of microscopy.

  6. Propagating plasmons on silver nanowires

    NASA Astrophysics Data System (ADS)

    He, Weidong; Wei, Hong; Li, Zhipeng; Huang, Yingzhou; Fang, Yurui; Li, Ping; Xu, Hongxing

    2010-08-01

    Chemically synthesized Ag nanowires (NWs) can serve as waveguides to support propagating surface plasmons (SPs). By using the propagating SPs on Ag NWs, the surface-enhanced Raman scattering of molecules, located in the nanowire-nanoparticle junction a few microns away from the laser spot on one end of the NW, was excited. The propagating SPs can excite the excitons in quantum dots, and in reverse, the decay of excitons can generate SPs. The direction and polarization of the light emitted through the Ag NW waveguide. The emission polarization depends strongly on the shape of the NW terminals. In branched NW structures, the SPs can be switched between the main NW and the branch NW, by tuning the incident polarization. The light of different wavelength can also be controlled to propagate along different ways. Thus, the branched NW structure can serve as controllable plasmonic router and multiplexer.

  7. Monascin and ankaflavin act as natural AMPK activators with PPARα agonist activity to down-regulate nonalcoholic steatohepatitis in high-fat diet-fed C57BL/6 mice.

    PubMed

    Hsu, Wei-Hsuan; Chen, Ting-Hung; Lee, Bao-Hong; Hsu, Ya-Wen; Pan, Tzu-Ming

    2014-02-01

    Yellow pigments monascin (MS) and ankaflavin (AK) are secondary metabolites derived from Monascus-fermented products. The hypolipidemic and anti-inflammatory effects of MS and AK indicate that they have potential on preventing or curing nonalcoholic fatty liver disease (NAFLD). Oleic acid (OA) and high-fat diet were used to induce steatosis in FL83B hepatocytes and NAFLD in mice, respectively. We found that both MS and AK prevented fatty acid accumulation in hepatocytes by inhibiting fatty acid uptake, lipogenesis, and promoting fatty acid beta-oxidation mediated by activating peroxisome proliferator-activated receptor (PPAR)-α and AMP-activated kinase (AMPK). Furthermore, MS and AK significantly attenuated high-fat diet-induced elevation of total cholesterol (TC), triaceylglycerol (TG), free fatty acid (FFA), and low density lipoprotein-cholesterol (LDL-C) in plasma. MS and AK promoted AMPK phosphorylation, suppressed the steatosis-related mRNA expression and inflammatory cytokines secretion, as well as upregulated farnesoid X receptor (FXR), peroxisome proliferator-activated receptor gamma co-activator (PGC)-1α, and PPARα expression to induce fatty acid oxidation in the liver of mice. We provided evidence that MS and AK act as PPARα agonists to upregulate AMPK activity and attenuate NAFLD. MS and AK may be supplied in food supplements or developed as functional foods to reduce the risk of diabetes and obesity.

  8. Increased locomotor activity induced by heroin in mice: pharmacokinetic demonstration of heroin acting as a prodrug for the mediator 6-monoacetylmorphine in vivo.

    PubMed

    Andersen, Jannike Mørch; Ripel, Ase; Boix, Fernando; Normann, Per Trygve; Mørland, Jørg

    2009-10-01

    We investigated the relative importance of heroin and its metabolites in eliciting a behavioral response in mice by studying the relationship between concentrations of heroin, 6-monoacetylmorphine (6MAM), and morphine in brain tissue and the effects on locomotor activity. Low doses (subcutaneous) of heroin (< or =5 micromol/kg) or 6MAM (< or =15 micromol/kg) made the mice run significantly more than mice given equimolar doses of morphine. There were no differences in the response between heroin and 6MAM, although we observed a shift to the left of the dose-response curve for the maximal response of heroin. The behavioral responses were abolished by pretreatment with 1 mg/kg naltrexone. Heroin was detected in brain tissue after injection, but the levels were low and its presence too short-lived to be responsible for the behavioral response observed. The concentration of 6MAM in brain tissue increased shortly after administration of both heroin and 6MAM and the concentration changes during the first hour roughly reflected the changes in locomotor activity. Both the maximal and the total concentration of 6MAM were higher after administration of heroin than after administration of 6MAM itself. The morphine concentration increased slowly after injection and could not explain the immediate behavioral response. In summary, the locomotor activity response after injection of heroin was mediated by 6MAM, which increased shortly after administration. Heroin acted as an effective prodrug. The concentration of morphine was too low to stimulate the immediate response observed but might have an effect on the later part of the heroin-induced behavioral response curve.

  9. Identification of a cis-acting element in the class I major histocompatibility complex gene promoter responsive to activation by retroviral sequences.

    PubMed Central

    Choi, S Y; van de Mark, K; Faller, D V

    1997-01-01

    The infection of cells with Moloney murine leukemia virus (M-MuLV) causes an increase in specific cellular gene products, including the major histocompatibility complex (MHC) class I antigens. This upregulation occurs through a transactivation process mediated by the long terminal repeat (LTR) of M-MuLV, and we show here that the gene activation response to the LTR requires at least one specific cis element within the MHC proximal promoter region. Nested deletions of MHC class I H-2Kb gene promoter sequence were subcloned into a chloramphenicol acetyltransferase (CAT) reporter vector and then transiently introduced into BALB/c-3T3 cells expressing M-MuLV or cotransfected into BALB/c-3T3 cells with a vector containing subgenomic portions of the virus, including the LTR. CAT activity assays demonstrated that a minimal H-2Kb gene promoter (-64 to +12) contained elements sufficient for this transactivation. DNase I footprinting assays located a protein-binding site in the region of -64 to -34 bp from the transcriptional start site, and point mutation analysis confirmed the location of this cis-acting element, designated the let response element (LRE), and defined a binding motif. This LRE is distinct from binding sites for currently known transcription factors in the class I MHC gene promoter and is conserved in the promoters of human and murine MHC class I genes. Mutation of the LRE resulted in dramatic reduction in both DNA-protein binding activity in electrophoretic mobility shift assay and in the ability of the mutated promoter to respond to retroviral transactivation. Addition of the LRE to a heterologous promoter conferred the ability to respond to retroviral transactivation. PMID:8995614

  10. Suppression of retroviral propagation and disease by suramin in murine systems.

    PubMed Central

    Ruprecht, R M; Rossoni, L D; Haseltine, W A; Broder, S

    1985-01-01

    Retroviral propagation crucially depends on reverse transcriptase (RT). We have developed murine models to test the biological effectiveness of the RT inhibitor suramin. The drug was active in our assay system, which includes (i) inhibition of RT activity in the murine T-cell tropic virus SL3-3 and Rauscher murine leukemia virus (MuLV), (ii) inhibition of plaque formation in the XC plaque assay, (iii) inhibition of viral infection of cultured murine T cells, and (iv) inhibition of splenomegaly induced by Rauscher MuLV in BALB/c mice. Suramin decreases viral titers significantly, even if started 36 hr after infection. Viral titers and number of infected cells increased to control levels after removal of the drug. BALB/c mice treated i.v. with 40 mg of suramin per kg twice per week following infection with Rauscher MuLV showed a 35% decrease in splenomegaly. Suramin is an active antiretroviral agent whose effect on retroviral propagation is reversible. We conclude that it acts as a virustatic drug and that long-term administration of suramin will be necessary if it is used for experimental treatment of human retroviral illnesses such as the acquired immune deficiency syndrome. PMID:2415971

  11. Propagating rifts on midocean ridges

    NASA Astrophysics Data System (ADS)

    Hey, Richard; Duennebier, Frederick K.; Morgan, W. Jason

    1980-07-01

    Spreading center jumps identified west of the Galapagos Islands near 95°W occur in a pattern consistent with the propagating rift hypothesis. A new rift is gradually breaking through the Cocos plate. Each successive jump is slightly longer than the preceding jump. The new spreading center grows at a new azimuth toward the west as the old one dies. The jumps are a manifestation of rift propagation. We extend the analysis of propagating rifts to the case of continuous propagation and predict patterns of magnetic anomalies and bathymetry consistent with the observed patterns. In particular, we correctly predict the trends of fossil spreading centers and V patterns of magnetic anomaly offsets required by the propagating rift hypothesis. Similar V patterns have been observed on many other spreading centers and have been interpreted in various ways. The propagating rift hypothesis appears to offer a simple explanation, consistent with rigid plate tectonics, for each of these patterns. This hypothesis may also have important implications for continental rifting.

  12. Orbital Propagation of Momentum Exchange Tether Systems

    NASA Technical Reports Server (NTRS)

    Westerhoff, John

    2002-01-01

    An advanced concept in in-space transportation currently being studied is the Momentum-Exchange/Electrodynamic Reboost Tether System (MXER). The system acts as a large momentum wheel, imparting a Av to a payload in low earth orbit (LEO) at the expense of its own orbital energy. After throwing a payload, the system reboosts itself using an electrodynamic tether to push against Earth's magnetic field and brings itself back up to an operational orbit to prepare for the next payload. The ability to reboost itself allows for continued reuse of the system without the expenditure of propellants. Considering the cost of lifting propellant from the ,ground to LEO to do the same Av boost at $10000 per pound, the system cuts the launch cost of the payload dramatically, and subsequently, the MXER system pays for itself after a small number of missions.1 One of the technical hurdles to be overcome with the MXER concept is the rendezvous maneuver. The rendezvous window for the capture of the payload is on the order of a few seconds, as opposed to traditional docking maneuvers, which can take as long ets necessary to complete a precise docking. The payload, therefore, must be able to match its orbit to meet up with the capture device on the end of the tether at a specific time and location in the future. In order to be able to determine that location, the MXER system must be numerically propagated forward in time to predict where the capture device will be at that instant. It should be kept in mind that the propagation computation must be done faster than real-time. This study focuses on the efforts to find and/or build the tools necessary to numerically propagate the motion of the MXER system as accurately as possible.

  13. Propagation of electromagnetic radiation in mitochondria?

    PubMed

    Thar, Roland; Kühl, Michael

    2004-09-21

    Mitochondria are the main source of ultra-weak chemiluminescence generated by reactive oxygen species, which are continuously formed during the mitochondrial oxidative metabolism. Vertebrate cells show typically filamentous mitochondria associated with the microtubules of the cytoskeleton, forming together a continuous network (mitochondrial reticulum). The refractive index of both mitochondria and microtubules is higher than the surrounding cytoplasm, which results that the mitochondrial reticulum can act as an optical waveguide, i.e. electromagnetic radiation can propagate within the network. A detailed analysis of the inner structure of mitochondria shows, that they can be optically modelled as a multi-layer system with alternating indices of refraction. The parameters of this multi-layer system are dependent on the physiologic state of the mitochondria. The effect of the multi-layer system on electromagnetic radiation propagating along the mitochondrial reticulum is analysed by the transfer-matrix method. If induced light emission could take place in mitochondria, the multi-layer system could lead to lasing action like it has been realized in technical distributed feedback laser. Based on former reports about the influence of external illumination on the physiology of mitochondria it is speculated whether there exists some kind of long-range interaction between individual mitochondria mediated by electromagnetic radiation.

  14. Propagation considerations in the American Mobile Satellite system design

    NASA Technical Reports Server (NTRS)

    Kittiver, Charles; Sigler, Charles E., Jr.

    1993-01-01

    An overview of the American Mobile Satellite Corporation (AMSC) mobile satellite services (MSS) system with special emphasis given to the propagation issues that were considered in the design is presented. The aspects of the voice codec design that effect system performance in a shadowed environment are discussed. The strategies for overcoming Ku-Band rain fades in the uplink and downlink paths of the gateway station are presented. A land mobile propagation study that has both measurement and simulation activities is described.

  15. Propagation considerations in the American Mobile Satellite system design

    NASA Astrophysics Data System (ADS)

    Kittiver, Charles; Sigler, Charles E., Jr.

    1993-08-01

    An overview of the American Mobile Satellite Corporation (AMSC) mobile satellite services (MSS) system with special emphasis given to the propagation issues that were considered in the design is presented. The aspects of the voice codec design that effect system performance in a shadowed environment are discussed. The strategies for overcoming Ku-Band rain fades in the uplink and downlink paths of the gateway station are presented. A land mobile propagation study that has both measurement and simulation activities is described.

  16. The physical theory and propagation model of THz atmospheric propagation

    NASA Astrophysics Data System (ADS)

    Wang, R.; Yao, J. Q.; Xu, D. G.; Wang, J. L.; Wang, P.

    2011-02-01

    Terahertz (THz) radiation is extensively applied in diverse fields, such as space communication, Earth environment observation, atmosphere science, remote sensing and so on. And the research on propagation features of THz wave in the atmosphere becomes more and more important. This paper firstly illuminates the advantages and outlook of THz in space technology. Then it introduces the theoretical framework of THz atmospheric propagation, including some fundamental physical concepts and processes. The attenuation effect (especially the absorption of water vapor), the scattering of aerosol particles and the effect of turbulent flow mainly influence THz atmosphere propagation. Fundamental physical laws are illuminated as well, such as Lamber-beer law, Mie scattering theory and radiative transfer equation. The last part comprises the demonstration and comparison of THz atmosphere propagation models like Moliere(V5), SARTre and AMATERASU. The essential problems are the deep analysis of physical mechanism of this process, the construction of atmospheric propagation model and databases of every kind of material in the atmosphere, and the standardization of measurement procedures.

  17. ZnO nanoparticles act as supportive therapy in DSS-induced ulcerative colitis in mice by maintaining gut homeostasis and activating Nrf2 signaling

    PubMed Central

    Li, Jinquan; Chen, Hanqing; Wang, Bing; Cai, Chengxu; Yang, Xu; Chai, Zhifang; Feng, Weiyue

    2017-01-01

    Inflammatory bowel diseases (IBD) are widespread inflammatory diseases that cause debilitating health problems including cancer. In this study, we show that ZnO nanoparticle (ZnONP) treatment has markedly dose-dependent effects on the remission of dextran sulfate sodium (DSS)-induced ulcerative colitis in mice. We demonstrate the mechanism involves the antioxidant and anti-inflammatory abilities of ZnONPs to suppress ROS and malondialdehyde (MDA) production; increase GSH level; suppress proinflammatory cytokines IL-1β and TNF-α and myeloperoxidase (MPO). The ZnONP treatment is able to activate the Nrf2 pathway in the cellular antioxidant defense system. The novel finding is that ZnONP combined with mesalazine (5-ASA) can enhance the therapeutic efficacy of 5-ASA in the treatment of DSS-induced colitis. Lastly, we found that ZnONP treatment can restore the changes in special colonic bacteria of DSS-mice while the drug 5-ASA cannot. These results indicate that ZnONPs can act as a medical additive for the therapy of IBD. PMID:28233796

  18. p53 in the mitochondria, as a trans-acting protein, provides error-correction activities during the incorporation of non-canonical dUTP into DNA.

    PubMed

    Bonda, Elad; Rahav, Galia; Kaya, Angelina; Bakhanashvili, Mary

    2016-11-08

    Mutations in mitochondrial DNA is an outcome of errors produced by DNA polymerase γ during replication and failure of the repair mechanism. Misincorporation of non-canonical dUTP leads to mutagenesis or apoptosis, and may contribute to the cytotoxic effects of 5'-fluorouracil chemotherapy. Tumor suppressor p53 protein in the mitochondria displays physical and functional interactions with mitochondrial DNA and polymerase γ, and by its intrinsic 3'→5' exonuclease activity can diminish the polymerization errors. Here we demonstrate the impact of p53 on incorporation of uracil into DNA examined with mitochondrial fractions, as the source of polymerase γ. p53 in mitochondria facilitates DNA damage repair functions resulting from uracil-DNA misincorporation. Our biochemical studies revealed that the procession of U:A and mismatched U:G lesions enhances in the presence of recombinant or endogenous cytoplasmic p53. p53 in mitochondria can function as an exonuclease/proofreader for polymerase γ by either decreasing the incorporation of non-canonical dUTP into DNA or by promoting the excision of incorporated nucleotide from nascent DNA, thus expanding the spectrum of DNA damage sites exploited for proofreading as a trans-acting protein. The data suggest that p53 may contribute to defense of the cells from consequences of dUTP misincorporation in both normal and tumor cells.

  19. p53 in the mitochondria, as a trans-acting protein, provides error-correction activities during the incorporation of non-canonical dUTP into DNA

    PubMed Central

    Bonda, Elad; Rahav, Galia; Kaya, Angelina; Bakhanashvili, Mary

    2016-01-01

    Mutations in mitochondrial DNA is an outcome of errors produced by DNA polymerase γ during replication and failure of the repair mechanism. Misincorporation of non-canonical dUTP leads to mutagenesis or apoptosis, and may contribute to the cytotoxic effects of 5′-fluorouracil chemotherapy. Tumor suppressor p53 protein in the mitochondria displays physical and functional interactions with mitochondrial DNA and polymerase γ, and by its intrinsic 3′→5′ exonuclease activity can diminish the polymerization errors. Here we demonstrate the impact of p53 on incorporation of uracil into DNA examined with mitochondrial fractions, as the source of polymerase γ. p53 in mitochondria facilitates DNA damage repair functions resulting from uracil–DNA misincorporation. Our biochemical studies revealed that the procession of U:A and mismatched U:G lesions enhances in the presence of recombinant or endogenous cytoplasmic p53. p53 in mitochondria can function as an exonuclease/proofreader for polymerase γ by either decreasing the incorporation of non-canonical dUTP into DNA or by promoting the excision of incorporated nucleotide from nascent DNA, thus expanding the spectrum of DNA damage sites exploited for proofreading as a trans-acting protein. The data suggest that p53 may contribute to defense of the cells from consequences of dUTP misincorporation in both normal and tumor cells. PMID:27689337

  20. The geometry of propagating rifts

    NASA Astrophysics Data System (ADS)

    McKenzie, Dan

    1986-03-01

    The kinematics of two different processes are investigated, both of which have been described as rift propagation. Courtillot uses this term to describe the change from distributed to localised extension which occurs during the early development of an ocean basin. The term localisation is instead used here to describe this process, to distinguish it from Hey's type of propagation. Localisation generally leads to rotation of the direction of magnetisation. To Hey propagation means the extension of a rift into the undeformed plate beyond a transform fault. Detail surveys of the Galapagos rift have shown that the propagating and failing rifts are not connected by a single transform fault, but by a zone which is undergoing shear. The principal deformation is simple shear, and the kinematics of this deformation are investigated in some detail. The strike of most of the lineations observed in the area can be produced by such deformation. The mode of extension on the propagating rift appears to be localised for some periods but to be distributed for others. Neither simple kinematic arguments nor stretching of the lithosphere with conservation of crust can account for the observed variations in water depth.

  1. User needs for propagation data

    NASA Technical Reports Server (NTRS)

    Sullivan, Thomas M.

    1993-01-01

    New and refined models of radio signal propagation phenomena are needed to support studies of evolving satellite services and systems. Taking an engineering perspective, applications for propagation measurements and models in the context of various types of analyses that are of ongoing interest are reviewed. Problems that were encountered in the signal propagation aspects of these analyses are reviewed, and potential solutions to these problems are discussed. The focus is on propagation measurements and models needed to support design and performance analyses of systems in the Mobile-Satellite Service (MSS) operating in the 1-3 GHz range. These systems may use geostationary or non-geostationary satellites and Frequency Division Multiple Access (FDMA), Time Division Multiple Access Digital (TDMA), or Code Division Multiple Access (CDMA) techniques. Many of the propagation issues raised in relation to MSS are also pertinent to other services such as broadcasting-satellite (sound) at 2310-2360 MHz. In particular, services involving mobile terminals or terminals with low gain antennas are of concern.

  2. Propagation of New Innovations: An Approach to Classify Human Behavior and Movement from Available Social Network Data

    NASA Technical Reports Server (NTRS)

    Mahmud, Faisal; Samiul, Hasan

    2010-01-01

    It is interesting to observe new innovations, products, or ideas propagating into the society. One important factor of this propagation is the role of individual's social network; while another factor is individual's activities. In this paper, an approach will be made to analyze the propagation of different ideas in a popular social network. Individuals' responses to different activities in the network will be analyzed. The properties of network will also be investigated for successful propagation of innovations.

  3. New concept for long-acting insulin: spontaneous conversion of an inactive modified insulin to the active hormone in circulation: 9-fluorenylmethoxycarbonyl derivative of insulin.

    PubMed

    Gershonov, E; Shechter, Y; Fridkin, M

    1999-07-01

    Insulin is a short-lived species in the circulatory system. After binding to its receptor sites and transmission of its biological signals, bound insulin undergoes receptor-mediated endocytosis and consequent degradation. An inactive insulin derivative that is not recognized by the receptor has a longer circulation life, but obviously is biologically impotent. (Fmoc)2 insulin is an insulin derivative purified through high-performance liquid chromatography in which two 9-fluorenylmethoxycarbonyl (Fmoc) moieties are covalently linked to the (alpha-amino group of phenylalanine B1 and the epsilon-amino group of lysine B29. It has 1-2% of the biological potency and receptor binding capacity of the native hormone. After incubation, (Fmoc)2 insulin undergoes a time-dependent spontaneous conversion to fully active insulin in aqueous solution at 37 degrees C and a pH range of 7-8.5. At pH 7.4, the conversion proceeds slowly (t1/2 = 12 +/- 1 days) and biological activity is generated gradually. A single subcutaneous administration of (Fmoc)2 insulin to streptozocin-treated diabetic rats normalized their blood glucose levels and maintained the animals in an anabolic state over 2-3 days. A broad shallow peak of immunoreactive insulin was found to persist in circulation over this period. To confirm further that the long-acting effect of (Fmoc)2 insulin proceeds via slow release in the blood circulation itself, we administered native insulin, NPH insulin, or the (Fmoc)2 derivative intraperitoneally. The rats recovered from hypoglycemia at t1/2 = 8.0 +/- 0.3 and 10 +/- 0.4 h after administration of native and NPH insulin, respectively. In contrast, (Fmoc)2 insulin was active for a significantly longer time, with an extended onset of t1/2 = 26 +/- 1h, and a glucose-lowering effect even 40 h after administration. (Fmoc)2 insulin was also found to be more resistant to proteolysis. Finally, we found that (Fmoc)2 insulin does not induce antigenic effects. In summary, we present here a

  4. Wave propagation in ballistic gelatine.

    PubMed

    Naarayan, Srinivasan S; Subhash, Ghatu

    2017-01-23

    Wave propagation characteristics in long cylindrical specimens of ballistic gelatine have been investigated using a high speed digital camera and hyper elastic constitutive models. The induced transient deformation is modelled with strain rate dependent Mooney-Rivlin parameters which are determined by modelling the stress-strain response of gelatine at a range of strain rates. The varying velocity of wave propagation through the gelatine cylinder is derived as a function of prestress or stretch in the gelatine specimen. A finite element analysis is conducted using the above constitutive model by suitably defining the impulse imparted by the polymer bar into the gelatine specimen. The model results are found to capture the experimentally observed wave propagation characteristics in gelatine effectively.

  5. Propagating substorm injection fronts

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Arnoldy, R. L.; Feynman, J.; Hardy, D. A.

    1981-01-01

    It is argued that a series of two-satellite observations leads to a clarification of substorm plasma injection, in which boundary motion plays a major role. Emphasis is put on a type of event characterized by abrupt, dispersionless changes in electron intensity and a coincident perturbation that consists of both a field magnitude increase and a small rotation toward more dipolar orientation. Comparing plasma observations at two points, it is found that in active, preinjection conditions the two most important features of the plasma sheet are: (1) the low-energy convection boundary for near-zero energy particles, determined by the magnitude of the large-scale convection electric field; and (2) the precipitation-flow boundary layer between the hot plasma sheet and the atmospherically contaminated inner plasma sheet.

  6. Dynamical Realism and Uncertainty Propagation

    NASA Astrophysics Data System (ADS)

    Park, Inkwan

    In recent years, Space Situational Awareness (SSA) has become increasingly important as the number of tracked Resident Space Objects (RSOs) continues their growth. One of the most significant technical discussions in SSA is how to propagate state uncertainty in a consistent way with the highly nonlinear dynamical environment. In order to keep pace with this situation, various methods have been proposed to propagate uncertainty accurately by capturing the nonlinearity of the dynamical system. We notice that all of the methods commonly focus on a way to describe the dynamical system as precisely as possible based on a mathematical perspective. This study proposes a new perspective based on understanding dynamics of the evolution of uncertainty itself. We expect that profound insights of the dynamical system could present the possibility to develop a new method for accurate uncertainty propagation. These approaches are naturally concluded in goals of the study. At first, we investigate the most dominant factors in the evolution of uncertainty to realize the dynamical system more rigorously. Second, we aim at developing the new method based on the first investigation enabling orbit uncertainty propagation efficiently while maintaining accuracy. We eliminate the short-period variations from the dynamical system, called a simplified dynamical system (SDS), to investigate the most dominant factors. In order to achieve this goal, the Lie transformation method is introduced since this transformation can define the solutions for each variation separately. From the first investigation, we conclude that the secular variations, including the long-period variations, are dominant for the propagation of uncertainty, i.e., short-period variations are negligible. Then, we develop the new method by combining the SDS and the higher-order nonlinear expansion method, called state transition tensors (STTs). The new method retains advantages of the SDS and the STTs and propagates

  7. Wave equations for pulse propagation

    SciTech Connect

    Shore, B.W.

    1987-06-24

    Theoretical discussions of the propagation of pulses of laser radiation through atomic or molecular vapor rely on a number of traditional approximations for idealizing the radiation and the molecules, and for quantifying their mutual interaction by various equations of propagation (for the radiation) and excitation (for the molecules). In treating short-pulse phenomena it is essential to consider coherent excitation phenomena of the sort that is manifest in Rabi oscillations of atomic or molecular populations. Such processes are not adequately treated by rate equations for excitation nor by rate equations for radiation. As part of a more comprehensive treatment of the coupled equations that describe propagation of short pulses, this memo presents background discussion of the equations that describe the field. This memo discusses the origin, in Maxwell's equations, of the wave equation used in the description of pulse propagation. It notes the separation into lamellar and solenoidal (or longitudinal and transverse) and positive and negative frequency parts. It mentions the possibility of separating the polarization field into linear and nonlinear parts, in order to define a susceptibility or index of refraction and, from these, a phase and group velocity. The memo discusses various ways of characterizing the polarization characteristics of plane waves, that is, of parameterizing a transverse unit vector, such as the Jones vector, the Stokes vector, and the Poincare sphere. It discusses the connection between macroscopically defined quantities, such as the intensity or, more generally, the Stokes parameters, and microscopic field amplitudes. The material presented here is a portion of a more extensive treatment of propagation to be presented separately. The equations presented here have been described in various books and articles. They are collected here as a summary and review of theory needed when treating pulse propagation.

  8. 75 FR 65554 - Additional Designations, Foreign Narcotics Kingpin Designation Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-25

    ... Office of Foreign Assets Control Additional Designations, Foreign Narcotics Kingpin Designation Act... interests in property has been blocked pursuant to the Foreign Narcotics Kingpin Designation Act (``Kingpin..., 1999. The Kingpin Act establishes a program targeting the activities of significant foreign...

  9. 78 FR 59766 - Additional Designations, Foreign Narcotics Kingpin Designation Act

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-27

    ... Office of Foreign Assets Control Additional Designations, Foreign Narcotics Kingpin Designation Act... Narcotics Kingpin Designation Act (``Kingpin Act''). DATES: The designation by the Director of OFAC of the... establishes a program targeting the activities of significant foreign narcotics ] traffickers and...

  10. Gap soliton propagation in optical fiber gratings

    NASA Astrophysics Data System (ADS)

    Mohideen, U.; Slusher, R. E.; Mizrahi, V.; Erdogan, T.; Kuwata-Gonokami, M.; Lemaire, P. J.; Sipe, J. E.; Martijn de Sterke, C.; Broderick, Neil G. R.

    1995-08-01

    Intense optical pulse propagation in a GeO2 -doped silica glass fiber grating results in nonlinear pulse propagation velocities and increased transmission at wavelengths where the grating reflects light in the linear limit. These nonlinear pulse propagation effects are predicted by numerical simulations of gap soliton propagation. The large linear refractive-index variations used for the fiber gratings in these experiments permit the propagation of gap solitons in short lengths of fiber.

  11. Centrally acting hypotensive agents with affinity for 5-HT1A binding sites inhibit forskolin-stimulated adenylate cyclase activity in calf hippocampus.

    PubMed Central

    Schoeffter, P.; Hoyer, D.

    1988-01-01

    1. A number of centrally acting hypotensive agents and other ligands with high affinity for 5-hydroxytryptamine1A (5-HT1A) recognition sites have been tested on forskolin-stimulated adenylate cyclase activity in calf hippocampus, a functional model for 5-HT1A-receptors. 2. Concentration-dependent inhibition of forskolin-stimulated adenylate cyclase activity was elicited by the reference 5-HT1-receptor agonists (mean EC50 value, nM): 5-HT (22), 5-carboxamidotryptamine (5-CT, 3.2), 8-hydroxy-2-(di-n-propylamino)-tetralin (8-OH-DPAT, 8.6), N,N-dipropyl-5-carboxamidotryptamine (DP-5-CT, 2.3), 1-[2-(4-aminophenyl)ethyl]-4-(3-trifluoromethylphenyl)-piperazine (PAPP or LY 165163, 20), 5-methoxy-3-(1,2,3,6-tetrahydro-4-pyridinyl)-1H indole (RU 24969, 20), buspirone (65) and ipsapirone (56). Emax amounted to 18-20% inhibition for all but the latter two agonists (14%). 3. The following hypotensive agents with high affinity for 5-HT1A sites were potent agonists in this system (mean EC50 value, nM): flesinoxan (24), indorenate (99), erythro-1-(1-[2-(1,4-benzodioxan-2-yl)-2-hydroxyethyl]-4-piperidyl )- 2-benzimidazolinone (R 28935, 2.5), urapidil (390) and 5-methyl-urapidil (3.5). The first two agents were full agonists, whereas the latter three acted as partial agonists with 60-80% efficacy. 4. Metergoline and methysergide behaved as full agonists and cyanopindolol as a partial agonist with low efficacy. Spiroxatrine and 2-(2,6-dimethoxyphenoxyethyl)aminomethyl- 1,4-benzodioxane (WB 4101) which bind to 5-HT1A sites with nanomolar affinity, were agonists and inhibited potently forskolin-stimulated adenylate cyclase in calf hippocampus, showing mean EC50 values of 23 and 15 nM, respectively. Spiroxatrine and WB 4101 yielded 90% and 50% efficacy, respectively. 5. Spiperone and methiothepin (each 1 microM) caused rightward shifts of the concentration-effect curve to 8-OH-DPAT, without loss of the maximal effect, as did the partial agonist cyanopindolol (0.1 microM) and the

  12. Propagation of olfactory information in Drosophila.

    PubMed

    Root, Cory M; Semmelhack, Julia L; Wong, Allan M; Flores, Jorge; Wang, Jing W

    2007-07-10

    Investigating how information propagates between layers in the olfactory system is an important step toward understanding the olfactory code. Each glomerular output projection neuron (PN) receives two sources of input: the olfactory receptor neurons (ORNs) of the same glomerulus and interneurons that innervate many glomeruli. We therefore asked how these inputs interact to produce PN output. We used receptor gene mutations to silence all of the ORNs innervating a specific glomerulus and recorded PN activity with two-photon calcium imaging and electrophysiology. We found evidence for balanced excitatory and inhibitory synaptic inputs but saw little or no response in the absence of direct ORN input. We next asked whether any transformation of activity occurs at successive layers of the antennal lobe. We found a strong link between PN firing and dendritic calcium elevation, the latter of which is tightly correlated with calcium activity in ORN axons, supporting the idea of glomerular propagation of olfactory information. Finally, we showed that odors are represented by a sparse population of PNs. Together, these results are consistent with the idea that direct receptor input provides the main excitatory drive to PNs, whereas interneurons modulate PN output. Balanced excitatory and inhibitory interneuron input may provide a mechanism to adjust PN sensitivity.

  13. Turbulent flame propagation in partially premixed flames

    NASA Technical Reports Server (NTRS)

    Poinsot, T.; Veynante, D.; Trouve, A.; Ruetsch, G.

    1996-01-01

    Turbulent premixed flame propagation is essential in many practical devices. In the past, fundamental and modeling studies of propagating flames have generally focused on turbulent flame propagation in mixtures of homogeneous composition, i.e. a mixture where the fuel-oxidizer mass ratio, or equivalence ratio, is uniform. This situation corresponds to the ideal case of perfect premixing between fuel and oxidizer. In practical situations, however, deviations from this ideal case occur frequently. In stratified reciprocating engines, fuel injection and large-scale flow motions are fine-tuned to create a mean gradient of equivalence ratio in the combustion chamber which provides additional control on combustion performance. In aircraft engines, combustion occurs with fuel and secondary air injected at various locations resulting in a nonuniform equivalence ratio. In both examples, mean values of the equivalence ratio can exhibit strong spatial and temporal variations. These variations in mixture composition are particularly significant in engines that use direct fuel injection into the combustion chamber. In this case, the liquid fuel does not always completely vaporize and mix before combustion occurs, resulting in persistent rich and lean pockets into which the turbulent flame propagates. From a practical point of view, there are several basic and important issues regarding partially premixed combustion that need to be resolved. Two such issues are how reactant composition inhomogeneities affect the laminar and turbulent flame speeds, and how the burnt gas temperature varies as a function of these inhomogeneities. Knowledge of the flame speed is critical in optimizing combustion performance, and the minimization of pollutant emissions relies heavily on the temperature in the burnt gases. Another application of partially premixed combustion is found in the field of active control of turbulent combustion. One possible technique of active control consists of pulsating

  14. Propagators in polymer quantum mechanics

    NASA Astrophysics Data System (ADS)

    Flores-González, Ernesto; Morales-Técotl, Hugo A.; Reyes, Juan D.

    2013-09-01

    Polymer Quantum Mechanics is based on some of the techniques used in the loop quantization of gravity that are adapted to describe systems possessing a finite number of degrees of freedom. It has been used in two ways: on one hand it has been used to represent some aspects of the loop quantization in a simpler context, and, on the other, it has been applied to each of the infinite mechanical modes of other systems. Indeed, this polymer approach was recently implemented for the free scalar field propagator. In this work we compute the polymer propagators of the free particle and a particle in a box; amusingly, just as in the non polymeric case, the one of the particle in a box may be computed also from that of the free particle using the method of images. We verify the propagators hereby obtained satisfy standard properties such as: consistency with initial conditions, composition and Green's function character. Furthermore they are also shown to reduce to the usual Schrödinger propagators in the limit of small parameter μ0, the length scale introduced in the polymer dynamics and which plays a role analog of that of Planck length in Quantum Gravity.

  15. Microwave Propagation in Dielectric Fluids.

    ERIC Educational Resources Information Center

    Lonc, W. P.

    1980-01-01

    Describes an undergraduate experiment designed to verify quantitatively the effect of a dielectric fluid's dielectric constant on the observed wavelength of microwave radiation propagating through the fluid. The fluid used is castor oil, and results agree with the expected behavior within 5 percent. (Author/CS)

  16. UWB pulse propagation into human tissues

    NASA Astrophysics Data System (ADS)

    Cavagnaro, Marta; Pittella, Erika; Pisa, Stefano

    2013-12-01

    In this paper the propagation of a UWB pulse into a layered model of the human body is studied to characterize absorption and reflection of the UWB signal due to the different body tissues. Several time behaviours for the incident UWB pulse are considered and compared with reference to the feasibility of breath and heartbeat activity monitoring. Results show that if the UWB source is placed far from the human body, the reflection coming from the interface between air and skin can be used to detect the respiratory activity. On the contrary, if the UWB source is placed close to the human body, a small reflection due to the interface between the posterior lung wall and the bone, which is well distanced in time from the reflections due to the first layers of the body model, can be used to detect lung and heart changes associated with the cardio-respiratory activity.

  17. Medium frequency propagation characteristics of different transmission lines in an underground coal mine

    PubMed Central

    Li, Jingcheng; Waynert, Joseph A.; Whisner, Bruce G.

    2015-01-01

    A medium frequency (MF) communication system operating in an underground coal mine couples its signals to a long conductor, which acts as an MF transmission line (TL) in a tunnel to permit communications among transceivers along the line. The TL is generally the longest signal path for the system, and its propagation characteristics will have a major impact on the performance of the MF communication system. In this study, the propagation characteristics of three types of MF TLs in two layouts—on the roof and on the floor of a coal mine tunnel—were obtained in an effort to understand the propagation characteristics of different TLs in different locations. The study confirmed a low MF signal loss on all of these TLs. The study also found that the TLs in different layouts had substantially different propagation characteristics. The propagation characteristics of these different TLs in different layouts are presented in the paper. PMID:26203349

  18. Medium frequency propagation characteristics of different transmission lines in an underground coal mine.

    PubMed

    Li, Jingcheng; Waynert, Joseph A; Whisner, Bruce G

    A medium frequency (MF) communication system operating in an underground coal mine couples its signals to a long conductor, which acts as an MF transmission line (TL) in a tunnel to permit communications among transceivers along the line. The TL is generally the longest signal path for the system, and its propagation characteristics will have a major impact on the performance of the MF communication system. In this study, the propagation characteristics of three types of MF TLs in two layouts-on the roof and on the floor of a coal mine tunnel-were obtained in an effort to understand the propagation characteristics of different TLs in different locations. The study confirmed a low MF signal loss on all of these TLs. The study also found that the TLs in different layouts had substantially different propagation characteristics. The propagation characteristics of these different TLs in different layouts are presented in the paper.

  19. Influence of atmospheric structure and topography on infrasonic wave propagation

    NASA Astrophysics Data System (ADS)

    Lacanna, G.; Ichihara, M.; Iwakuni, M.; Takeo, M.; Iguchi, M.; Ripepe, M.

    2014-04-01

    The effects of topography and atmospheric structures on infrasonic wave propagation from a volcanic source were investigated using observations and numerical modeling. This paper presents the first long-term observational data set showing spatiotemporal variations in patterns of infrasound propagation at distances of up to 60 km from a persistently active infrasound source (Sakurajima Volcano, Japan). The data show that the amplitudes of infrasonic waves received at distant stations relative to those received at a reference station close to the source can vary up to an order of magnitude over short time intervals and short distances and that they do not follow the theoretical geometric decay expected for homogeneous media. Moreover, waveforms also change significantly in both time and space. Numerical simulations were performed using a two-dimensional finite difference time domain (2-D FDTD) method. Effects of atmospheric structure and topography are included in a vertical section parallel to the wave propagation direction. The simulation successfully reproduced the variations of amplitudes and waveforms. Results are interpreted in terms of wave refraction due to sound and wind speed gradients and wave diffraction at topographic barriers. Our numerical results indicate that both atmospheric and topographic propagation effects are nonnegligible. To evaluate the propagation effects and determine source processes in spatially and temporally varying infrasound data, atmospheric data with a time resolution higher than is currently available are required. If the data are available, the present results suggest that the propagation effects could be evaluated using 2-D FDTD modeling at realistic calculation times.

  20. Distension-stimulated propagated contractions in human colon.

    PubMed

    Bassotti, G; Gaburri, M; Imbimbo, B P; Morelli, A; Whitehead, W E

    1994-09-01

    To investigate the mechanisms for elicitation of peristaltic activity in the human colon, we studied the effect of balloon distension of the transverse, descending, and sigmoid colon and the rectum. Fifteen healthy subjects were studied by means of a colonoscopically positioned probe carrying a 5-cm latex balloon. After positioning of the probe, stepwise distension was performed for each colonic segment (transverse, descending, sigmoid, rectum), and the onset of large (> 50 mm Hg) and small (< 50 mm Hg) propagated waves was observed. Analysis of the tracings showed: (1) In 8/15 subjects (53.3%), balloon distension elicited propagated contractions, but these contractions were qualitatively different from the spontaneously occurring high-amplitude propagated contractions previously found to occur in association with defecation. Therefore, intraluminal distension is probably not the cause of defecation-associated high-amplitude propagated contractions. (2) Pain reports were poorly correlated with propagated contractions elicited by balloon distension, suggesting that these contractions are not the cause of the pain produced by balloon distension. (3) The transverse colon shows lower pressures, fewer pain reports, and fewer large propagated contractions in response to balloon distension as compared to the descending and the sigmoid colon.

  1. The effects of solidification on sill propagation dynamics and geometry

    NASA Astrophysics Data System (ADS)

    Lola, Chanceaux; Thierry, Menand

    2015-04-01

    structures similar to those of lava flows. Our experiments show how these lobate structures could reflect the effect of magma solidification during their emplacement. Moreover, these experiments show also that a non-continuous geometry as observed in the field does not necessarily involve multiple injections. Also, like dykes, a discontinuous propagation should be associated with bursts of seismic activity (e.g. Taisne and Tait, 2011; Taisne et al., 2011). Finally, sills are considered as the building blocks for constructing larger magmatic bodies as plutons. Our study shows how solidification effects restrict the surface of sills, which impacts directly the size of plutons constructed incrementally by amalgamated sills.

  2. Effect of magnetic storms (substorms) on HF propagation: A review

    NASA Astrophysics Data System (ADS)

    Blagoveshchenskii, D. V.

    2013-07-01

    The manifestations of the so-called main ionospheric effect during geomagnetic storms (substorms) in the character of decameter-wave propagation are analyzed. On HF radio paths, the main effect is observed as variations in the signal amplitude and the MOF-LOF working frequency band similarly to the critical frequency of the ionospheric F2 layer. Specifically, these parameters increase before the disturbance active phase, decrease during the active phase, and increase again after this phase. The propagation outside the great circle arc, the change in the propagation processes, and the HF radio noise behavior were also considered on these paths during storms (substorms). It is assumed that the storm (substorm) development onset can be predicted.

  3. Swa2, the yeast homolog of mammalian auxilin, is specifically required for the propagation of the prion variant [URE 3‐1

    PubMed Central

    Troisi, Elizabeth M.; Rockman, Michael E.; Nguyen, Phil P.; Oliver, Emily E.

    2015-01-01

    Summary Yeast prions require a core set of chaperone proteins including Sis1, Hsp70 and Hsp104 to generate new amyloid templates for stable propagation, yet emerging studies indicate that propagation of some prions requires additional chaperone activities, demonstrating chaperone specificity beyond the common amyloid requirements. To comprehensively assess such prion‐specific requirements for the propagation of the [URE 3] prion variant [URE 3‐1], we screened 12 yeast cytosolic J‐proteins, and here we report a novel role for the J‐protein Swa2/Aux1. Swa2 is the sole yeast homolog of the mammalian protein auxilin, which, like Swa2, functions in vesicle‐mediated endocytosis by disassembling the structural lattice formed by the protein clathrin. We found that, in addition to Sis1, [URE 3‐1] is specifically dependent upon Swa2, but not on any of the 11 other J‐proteins. Further, we show that [URE 3‐1] propagation requires both a functional J‐domain and the tetratricopeptide repeat (TPR) domain, but surprisingly does not require Swa2‐clathrin binding. Because the J‐domain of Swa2 can be replaced with the J‐domains of other proteins, our data strongly suggest that prion‐chaperone specificity arises from the Swa2 TPR domain and supports a model where Swa2 acts through Hsp70, most likely to provide additional access points for Hsp104 to promote prion template generation. PMID:26031938

  4. Macroscopic electrical propagation in the guinea pig urinary bladder.

    PubMed

    Hammad, F T; Stephen, B; Lubbad, L; Morrison, J F B; Lammers, W J

    2014-07-15

    There is little knowledge about macroscopic electrical propagation in the wall of the urinary bladder. Recording simultaneously from a large number of extracellular electrodes is one technology that could be used to study the patterns of macroscopic electrical propagations. The urinary bladders from 14 guinea pigs were isolated and placed in an organ bath. A 16 × 4-electrode array was positioned at various sites on the serosal bladder surface, and recordings were performed at different intravesical volumes. In four experiments, carbachol (CCH; 10(-6) M), nifedipine (10 mM), or tetrodotoxin (TTX; 10(-6) M) was added to the superfusing fluid. After the experiments, the extracellular signals were analyzed and propagation maps were constructed. Electrical waves were detected at all sites on the bladder surface and propagated for a limited distance before terminating spontaneously. The majority of waves (>90%) propagated in the axial direction (i.e., from dome to base or vice versa). An increase in vesicle volume significantly decreased the conduction velocity (from 4.9 ± 1.5 to 2.7 ± 0.7 cm/s; P < 0.05). CCH increased, nifedipine decreased, while TTX had little effect on electrical activities. In addition, a new electrical phenomenon, termed a "patch," was discovered whereby a simultaneous electrical deflection was detected across an area of the bladder surface. Two types of electrical activities were detected on the bladder surface: 1) electrical waves propagating preferentially in the axial direction and 2) electrical patches. The propagating electrical waves could form the basis for local spontaneous contractions in the bladder during the filling phase.

  5. Sound propagation in choked ducts

    NASA Technical Reports Server (NTRS)

    Hersh, A. S.; Liu, C. Y.

    1976-01-01

    The linearized equations describing the propagation of sound in variable area ducts containing flow are shown to be singular when the duct mean flow is sonic. The singularity is removed when previously ignored nonlinear terms are retained. The results of a numerical study, for the case of plane waves propagating in a one-dimensional converging-diverging duct, show that the sound field is adequately described by the linearized equations only when the axial mean flow Mach number at the duct throat M sub th 0.6. For M sub th 0.6, the numerical results showed that acoustic energy flux was not conserved. An attempt was made to extend the study to include the nonlinear behavior of the sound field. Meaningful results were not obtained due, primarily, to numerical difficulties.

  6. Exact propagators in harmonic superspace

    NASA Astrophysics Data System (ADS)

    Kuzenko, Sergei M.

    2004-10-01

    Within the background field formulation in harmonic superspace for quantum N = 2 super-Yang-Mills theories, the propagators of the matter, gauge and ghost superfields possess a complicated dependence on the SU(2) harmonic variables via the background vector multiplet. This dependence is shown to simplify drastically in the case of an on-shell vector multiplet. For a covariantly constant background vector multiplet, we exactly compute all the propagators. In conjunction with the covariant multi-loop scheme developed in arxiv:hep-th/0302205, these results provide an efficient (manifestly N = 2 supersymmetric) technical setup for computing multi-loop quantum corrections to effective actions in N = 2 supersymmetric gauge theories, including the N = 4 super-Yang-Mills theory.

  7. Atmospheric propagation of THz radiation.

    SciTech Connect

    Wanke, Michael Clement; Mangan, Michael A.; Foltynowicz, Robert J.

    2005-11-01

    In this investigation, we conduct a literature study of the best experimental and theoretical data available for thin and thick atmospheres on THz radiation propagation from 0.1 to 10 THz. We determined that for thick atmospheres no data exists beyond 450 GHz. For thin atmospheres data exists from 0.35 to 1.2 THz. We were successful in using FASE code with the HITRAN database to simulate the THz transmission spectrum for Mauna Kea from 0.1 to 2 THz. Lastly, we successfully measured the THz transmission spectra of laboratory atmospheres at relative humidities of 18 and 27%. In general, we found that an increase in the water content of the atmosphere led to a decrease in the THz transmission. We identified two potential windows in an Albuquerque atmosphere for THz propagation which were the regions from 1.2 to 1.4 THz and 1.4 to 1.6 THz.

  8. Fracture propagation, pipe deformation study

    SciTech Connect

    Aloe, A.; Di Candia, A.; Bramante, M.

    1983-04-15

    Shear fracture propagation has become an important research subject connected with design aspects of gas pipelines. Difficulties involved in predicting safe service conditions from pure theoretical studies require 1:1 scale experiments. Through these tests, semiempirical design criteria was formulated where the minimum level of material quality, indicated by Charpy V energy in the ductile range, is determined as a function of pipe geometry and hoop stress. Disagreements exist among these criteria. Different arrest energy predictions at high hoop stresses and different effects ascribed to the thickness have called for further research in the field. Some interesting indications were obtained about shape and size of the plastic zone ahead of the propagating crack. Burst tests have been conducted and are discussed.

  9. Calibration of seismic wave propagation in Jordan

    SciTech Connect

    Al-Husien, A; Amrat, A; Harris, D; Mayeda, K; Nakanishi, K; Rodgers, A; Ruppert, S; Ryall, F; Skinnell, K; Yazjeen, T

    1999-07-23

    The Natural Resources Authority of Jordan (NRA), the USGS and LLNL have a collaborative project to improve the calibration of seismic propagation in Jordan and surrounding regions. This project serves common goals of CTBT calibration and earthquake hazard assessment in the region. These objectives include accurate location of local and regional earthquakes, calibration of magnitude scales, and the development of local and regional propagation models. In the CTBT context, better propagation models and more accurately located events in the Dead Sea rift region can serve as (potentially GT5) calibration events for generating IMS location corrections. The detection and collection of mining explosions underpins discrimination research. The principal activity of this project is the deployment of two broadband stations at Hittiyah (south Jordan) and Ruweishid (east Jordan). These stations provide additional paths in the region to constrain structure with surface wave and body wave tomography. The Ruweishid station is favorably placed to provide constraints on Arabian platform structure. Waveform modeling with long-period observations of larger earthquakes will provide constraints on 1-D velocity models of the crust and upper mantle. Data from these stations combined with phase observations from the 26 short-period stations of the Jordan National Seismic Network (JNSN) may allow the construction of a more detailed velocity model of Jordan. The Hittiyah station is an excellent source of ground truth information for the six phosphate mines of southern Jordan and Israel. Observations of mining explosions collected by this station have numerous uses: for definition of templates for screening mining explosions, as ground truth events for calibrating travel-time models, and as explosion populations in development and testing discriminants. Following previously established procedures for identifying explosions, we have identified more than 200 explosions from the first 85 days of

  10. Special Topics in HF Propagation

    DTIC Science & Technology

    1979-11-01

    data for the prediction of auroral absorption experienced by high-frequency radio waves: Basler (1965), Gorbushina et al. (1969), Agy (1970), Vargas ...Thomas (1959), Studies in polar blackout morphology, URSI-AGI, Com- mittee Report. Vargas -Vila, R. (1972), Auroral absorption predictions for high...cuide wa]ls in mho/m permeability of the propagation medium in henry /m E. permittivity of the propagat.on medium iiu fa-ad/m. For TE. modes, thi-s

  11. A database for propagation models

    NASA Technical Reports Server (NTRS)

    Kantak, Anil V.; Suwitra, Krisjani; Le, Chuong

    1995-01-01

    A database of various propagation phenomena models that can be used by telecommunications systems engineers to obtain parameter values for systems design is presented. This is an easy-to-use tool and is currently available for either a PC using Excel software under Windows environment or a Macintosh using Excel software for Macintosh. All the steps necessary to use the software are easy and many times self explanatory.

  12. A database for propagation models

    NASA Technical Reports Server (NTRS)

    Kantak, Anil V.; Suwitra, Krisjani; Le, Choung

    1994-01-01

    A database of various propagation phenomena models that can be used by telecommunications systems engineers to obtain parameter values for systems design is presented. This is an easy-to-use tool and is currently available for either a PC using Excel software under Windows environment or a Macintosh using Excel software for Macintosh. All the steps necessary to use the software are easy and many times self-explanatory; however, a sample run of the CCIR rain attenuation model is presented.

  13. A database for propagation models

    NASA Astrophysics Data System (ADS)

    Kantak, Anil V.; Suwitra, Krisjani; Le, Chuong

    1995-08-01

    A database of various propagation phenomena models that can be used by telecommunications systems engineers to obtain parameter values for systems design is presented. This is an easy-to-use tool and is currently available for either a PC using Excel software under Windows environment or a Macintosh using Excel software for Macintosh. All the steps necessary to use the software are easy and many times self explanatory.

  14. UHF Radiowave Propagation through Forests

    DTIC Science & Technology

    1982-09-01

    sde It nece sary and Identify b block number) " A model for UHF radiowave propagation thzough a forest of tree trunks, branches, and leaves is...all having prescribed location and orientation statistics. Tree trunks are modelled as infinitely-long, circular, lossy-di- electric cylinders...results. An anisotropic half-space model of the forest is developed based upon the effective dyadic susceptibility and the direct-, reflected-, and

  15. Preparing Administrators and Faculty of Cuyahoga Community College for a More Active Role in Implementing the Comprehensive Employment and Training Act (CETA).

    ERIC Educational Resources Information Center

    Eppley, George

    This five-part report discusses the Comprehensive Employment and Training Act of 1973 (CETA), explains how it operates locally through the Cleveland Area Western Reserve Manpower Consortium (CAWRMC), and specifies ways in which Cuyahoga Community College (CCC) can play a greater role in the CETA system. Part I describes existing federal manpower…

  16. Information Processing Model of Test Anxiety and Its Effect on the Speed-Accuracy Tradeoff (ACT or the Spreading Activation Explanation).

    ERIC Educational Resources Information Center

    Lee, Ju Hyun

    This paper presents an information processing model of test anxiety in an attempt to explain the mechanism of test anxiety's effect on working memory within the framework of the American College Testing Program Assessment (ACT). The model suggests that the construct of test anxiety, both worry and emotionality, is represented in the declarative…

  17. Jet propagation through energetic materials

    SciTech Connect

    Pincosy, P; Poulsen, P

    2004-01-08

    In applications where jets propagate through energetic materials, they have been observed to become sufficiently perturbed to reduce their ability to effectively penetrate subsequent material. Analytical calculations of the jet Bernoulli flow provides an estimate of the onset and extent of such perturbations. Although two-dimensional calculations show the back-flow interaction pressure pulses, the symmetry dictates that the flow remains axial. In three dimensions the same pressure impulses can be asymmetrical if the jet is asymmetrical. The 3D calculations thus show parts of the jet having a significant component of radial velocity. On the average the downstream effects of this radial flow can be estimated and calculated by a 2D code by applying a symmetrical radial component to the jet at the appropriate position as the jet propagates through the energetic material. We have calculated the 3D propagation of a radio graphed TOW2 jet with measured variations in straightness and diameter. The resultant three-dimensional perturbations on the jet result in radial flow, which eventually tears apart the coherent jet flow. This calculated jet is compared with jet radiographs after passage through the energetic material for various material thickness and plate thicknesses. We noted that confinement due to a bounding metal plate on the energetic material extends the pressure duration and extent of the perturbation.

  18. Turbofan Acoustic Propagation and Radiation

    NASA Technical Reports Server (NTRS)

    Eversman, Walter

    2000-01-01

    This document describes progress in the development of finite element codes for the prediction of near and far field acoustic radiation from the inlet and aft fan ducts of turbofan engines. The report consists of nine papers which have appeared in archival journals and conference proceedings, or are presently in review for publication. Topics included are: 1. Aft Fan Duct Acoustic Radiation; 2. Mapped Infinite Wave Envelope Elements for Acoustic Radiation in a Uniformly Moving Medium; 3. A Reflection Free Boundary Condition for Propagation in Uniform Flow Using Mapped Infinite Wave Envelope Elements; 4. A Numerical Comparison Between Multiple-Scales and FEM Solution for Sound Propagation in Lined Flow Ducts; 5. Acoustic Propagation at High Frequencies in Ducts; 6. The Boundary Condition at an Impedance Wall in a Nonuniform Duct with Potential Flow; 7. A Reverse Flow Theorem and Acoustic Reciprocity in Compressible Potential Flows; 8. Reciprocity and Acoustics Power in One Dimensional Compressible Potential Flows; and 9. Numerical Experiments on Acoustic Reciprocity in Compressible Potential Flows.

  19. Sound Propagation in the Atmosphere

    NASA Astrophysics Data System (ADS)

    Attenborough, Keith

    Propagation of sound close to the ground outdoors involves geometric spreading, air absorption, interaction with the ground, barriers, vegetation and refraction associated with wind and temperature gradients. After a brief survey of historical aspects of the study of outdoor sound and its applications, this chapter details the physical principles associated with various propagation effects, reviews data that demonstrate them and methods for predicting them. The discussion is concerned primarily with the relatively short ranges and spectra of interest when predicting and assessing community noise rather than the frequencies and long ranges of concern, for example, in infrasonic global monitoring or used for remote sensing of the atmosphere. Specific phenomena that are discussed include spreading losses, atmospheric absorption, diffraction by barriers and buildings, interaction of sound with the ground (ground waves, surface waves, ground impedance associated with porosity and roughness, and elasticity effects), propagation through crops, shrubs and trees, wind and temperature gradient effects, shadow zones and incoherence due to atmospheric turbulence. The chapter concludes by suggesting a few areas that require further research.

  20. Transequatorial Propagation and Depletion Precursors

    NASA Astrophysics Data System (ADS)

    Miller, E. S.; Bust, G. S.; Kaeppler, S. R.; Frissell, N. A.; Paxton, L. J.

    2014-12-01

    The bottomside equatorial ionosphere in the afternoon and evening sector frequently evolves rapidly from smoothly stratified to violently unstable with large wedges of depleted plasma growing through to the topside on timescales of a few tens of minutes. These depletions have numerous practical impacts on radio propagation, including amplitude scintillation, field-aligned irregularity scatter, HF blackouts, and long-distance transequatorial propagation at frequencies above the MUF. Practical impacts notwithstanding, the pathways and conditions under which depletions form remain a topic of vigorous inquiry some 80 years after their first report. Structuring of the pre-sunset ionosphere---morphology of the equatorial anomalies and long-wavelength undulations of the isodensity contours on the bottomside---are likely to hold some clues to conditions that are conducive to depletion formation. The Conjugate Depletion Experiment is an upcoming transequatorial forward-scatter HF/VHF experiment to investigate pre-sunset undulations and their connection with depletion formation. We will present initial results from the Conjugate Depletion Experiment, as well as a companion analysis of a massive HF propagation data set.

  1. Calculations of precursor propagation in dispersive dielectrics.

    SciTech Connect

    Bacon, Larry Donald

    2003-08-01

    The present study is a numerical investigation of the propagation of electromagnetic transients in dispersive media. It considers propagation in water using Debye and composite Rocard-Powles-Lorentz models for the complex permittivity. The study addresses this question: For practical transmitted spectra, does precursor propagation provide any features that can be used to advantage over conventional signal propagation in models of dispersive media of interest? A companion experimental study is currently in progress that will attempt to measure the effects studied here.

  2. Confining crack propagation in defective graphene.

    PubMed

    López-Polín, Guillermo; Gómez-Herrero, Julio; Gómez-Navarro, Cristina

    2015-03-11

    Crack propagation in graphene is essential to understand mechanical failure in 2D materials. We report a systematic study of crack propagation in graphene as a function of defect content. Nanoindentations and subsequent images of graphene membranes with controlled induced defects show that while tears in pristine graphene span microns length, crack propagation is strongly reduced in the presence of defects. Accordingly, graphene oxide exhibits minor crack propagation. Our work suggests controlled defect creation as an approach to avoid catastrophic failure in graphene.

  3. Japanese propagation experiments with ETS-5

    NASA Technical Reports Server (NTRS)

    Ikegami, Tetsushi

    1989-01-01

    Propagation experiments for maritime, aeronautical, and land mobile satellite communications were performed using Engineering Test Satellite-Five (ETS-5). The propagation experiments are one of major mission of Experimental Mobile Satellite System (EMSS) which is aimed for establishing basic technology for future general mobile satellite communication systems. A brief introduction is presented for the experimental results on propagation problems of ETS-5/EMSS.

  4. Understanding and Predicting Urban Propagation Losses

    DTIC Science & Technology

    2009-09-01

    available, the vast variety of physical cond Propagation Loss Tool will also be entered into a variety of examples, to test a few of the propagation loss...Model for Urban Areas. Rep. Silva, Junior, Edgar, and Gilberto A. Carrijo. "A Vectorial Istanbul: Bogazici University. Analysis of UHF Propagation

  5. 49 CFR 195.111 - Fracture propagation.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 3 2014-10-01 2014-10-01 false Fracture propagation. 195.111 Section 195.111... PIPELINE Design Requirements § 195.111 Fracture propagation. A carbon dioxide pipeline system must be designed to mitigate the effects of fracture propagation....

  6. 49 CFR 195.111 - Fracture propagation.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 3 2012-10-01 2012-10-01 false Fracture propagation. 195.111 Section 195.111... PIPELINE Design Requirements § 195.111 Fracture propagation. A carbon dioxide pipeline system must be designed to mitigate the effects of fracture propagation....

  7. 49 CFR 195.111 - Fracture propagation.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 3 2013-10-01 2013-10-01 false Fracture propagation. 195.111 Section 195.111... PIPELINE Design Requirements § 195.111 Fracture propagation. A carbon dioxide pipeline system must be designed to mitigate the effects of fracture propagation....

  8. 49 CFR 195.111 - Fracture propagation.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 3 2011-10-01 2011-10-01 false Fracture propagation. 195.111 Section 195.111... PIPELINE Design Requirements § 195.111 Fracture propagation. A carbon dioxide pipeline system must be designed to mitigate the effects of fracture propagation....

  9. 49 CFR 195.111 - Fracture propagation.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Fracture propagation. 195.111 Section 195.111... PIPELINE Design Requirements § 195.111 Fracture propagation. A carbon dioxide pipeline system must be designed to mitigate the effects of fracture propagation. [Amdt. 195-45, 56 FR 26926, June 12, 1991]...

  10. Furrows in the wake of propagating d-cones

    NASA Astrophysics Data System (ADS)

    Gottesman, Omer; Efrati, Efi; Rubinstein, Shmuel M.

    2015-06-01

    A crumpled sheet of paper displays an intricate pattern of creases and point-like singular structures, termed d-cones. It is typically assumed that elongated creases form when ridges connecting two d-cones fold beyond the material yielding threshold, and scarring is thus a by-product of the folding dynamics that seek to minimize elastic energy. Here we show that rather than merely being the consequence of folding, plasticity can act as its instigator. We introduce and characterize a different type of crease that is inherently plastic and is formed by the propagation of a single point defect. When a pre-existing d-cone is strained beyond a certain threshold, the singular structure at its apex sharpens abruptly. The resulting focusing of strains yields the material just ahead of the singularity, allowing it to propagate, leaving a furrow-like scar in its wake. We suggest an intuitive fracture analogue to explain the creation of furrows.

  11. An automated workflow for patient-specific quality control of contour propagation.

    PubMed

    Beasley, William J; McWilliam, Alan; Slevin, Nicholas J; Mackay, Ranald I; van Herk, Marcel

    2016-12-21

    Contour propagation is an essential component of adaptive radiotherapy, but current contour propagation algorithms are not yet sufficiently accurate to be used without manual supervision. Manual review of propagated contours is time-consuming, making routine implementation of real-time adaptive radiotherapy unrealistic. Automated methods of monitoring the performance of contour propagation algorithms are therefore required. We have developed an automated workflow for patient-specific quality control of contour propagation and validated it on a cohort of head and neck patients, on which parotids were outlined by two observers. Two types of error were simulated-mislabelling of contours and introducing noise in the scans before propagation. The ability of the workflow to correctly predict the occurrence of errors was tested, taking both sets of observer contours as ground truth, using receiver operator characteristic analysis. The area under the curve was 0.90 and 0.85 for the observers, indicating good ability to predict the occurrence of errors. This tool could potentially be used to identify propagated contours that are likely to be incorrect, acting as a flag for manual review of these contours. This would make contour propagation more efficient, facilitating the routine implementation of adaptive radiotherapy.

  12. An automated workflow for patient-specific quality control of contour propagation

    NASA Astrophysics Data System (ADS)

    Beasley, William J.; McWilliam, Alan; Slevin, Nicholas J.; Mackay, Ranald I.; van Herk, Marcel

    2016-12-01

    Contour propagation is an essential component of adaptive radiotherapy, but current contour propagation algorithms are not yet sufficiently accurate to be used without manual supervision. Manual review of propagated contours is time-consuming, making routine implementation of real-time adaptive radiotherapy unrealistic. Automated methods of monitoring the performance of contour propagation algorithms are therefore required. We have developed an automated workflow for patient-specific quality control of contour propagation and validated it on a cohort of head and neck patients, on which parotids were outlined by two observers. Two types of error were simulated—mislabelling of contours and introducing noise in the scans before propagation. The ability of the workflow to correctly predict the occurrence of errors was tested, taking both sets of observer contours as ground truth, using receiver operator characteristic analysis. The area under the curve was 0.90 and 0.85 for the observers, indicating good ability to predict the occurrence of errors. This tool could potentially be used to identify propagated contours that are likely to be incorrect, acting as a flag for manual review of these contours. This would make contour propagation more efficient, facilitating the routine implementation of adaptive radiotherapy.

  13. Role of cell death in the propagation of PrP(Sc) in immune cells.

    PubMed

    Takahashi, Kenichi; Inoshima, Yasuo; Ishiguro, Naotaka

    2015-03-01

    A number of studies have suggested that macrophages, dendritic cells, and follicular dendritic cells play an important role in the propagation of PrP(Sc). Both accumulation and proteolysis of PrP(Sc) have been demonstrated in peripheral macrophages. Macrophages may act as reservoirs for PrP(Sc) particles if the cells die during transient PrP(Sc) propagation. However, whether cell death plays a role in PrP(Sc) propagation in macrophages remains unclear. In this study, we investigated the possibility of propagation and transmission of PrP(Sc) between dead immune cells and living neural cells. We found that under specific conditions, transient PrP(Sc) propagation occurs in dead cells, indicating that interaction between PrP(C) and PrP(Sc) on plasma membrane lipid rafts might be important for PrP(Sc) propagation. Co-culturing of killed donor PrP(Sc)-infected macrophages with recipient N2a-3 neuroblastoma cells accelerated PrP(Sc) transmission. Our results suggest that cell death may play an important role in PrP(Sc) propagation, whereas transient PrP(Sc) propagation in macrophages has little effect on PrP(Sc) transmission.

  14. Seismotectonics of mid-ocean ridge propagation

    NASA Astrophysics Data System (ADS)

    Floyd, Jacqueline Suzanne

    This dissertation investigates the rifting-spreading transition of two propagating mid-ocean spreading centers within actively rifting lithosphere, Woodlark Basin and Hess Deep. Hess Deep is a 5.4 km-deep oceanic rift basin at the westernmost tip of the Galapagos Spreading Center where it meets the East Pacific Rise at the Galapagos Triple Junction. Hydroacoustic seismicity data recorded over 200 earthquakes in Hess Deep that reveal earthquake and deformation patterns that are similar to those found in the process zone of laboratory-scale propagating tensile cracks. Seismicity and deformation patterns observed in Hess Deep are consistent with those from crack tip process zones Process zone deformation releases large crack tip stresses predicted by theoretical fracture mechanics and allows stable propagation to occur; thus, viscous suction or other forces are not required to balance the crack tip stress as proposed by previous investigators. The western Woodlark Basin of Papua New Guinea is the site of a major low-angle detachment fault immediately ahead of the westward propagating spreading center. We present the results of two studies of this fault: one using reflection seismology to image the fault zone velocity structure and composition, and one using deep crustal refraction seismology to image the large-scale velocity structure of the fault and surrounding crust. Results from genetic algorithm inversion of seismic reflection data show that the fault contains a frictionally weak fault gouge layer and fluids, while results from seismic tomography show that the fault is a major rift boundary between the northern and southern rift margins of the western Woodlark Basin. We conclude that favorable conditions exist for frictional slip at angles of 30° or less and that this will be the last fault to form before the crust completely rifts apart to create new oceanic crust and lithosphere. The morphology of the rifting-spreading transitions in Woodlark Basin and Hess

  15. Acoustic propagation in a thermally stratified atmosphere

    NASA Technical Reports Server (NTRS)

    Vanmoorhem, W. K.

    1985-01-01

    This report describes the activities during the fifth six month period of the investigation of acoustic propagation in the atmosphere with a realistic temperature profile. Progress has been achieved in two major directions: comparisons between the lapse model and experimental data taken by NASA during the second tower experiment, and development of a model propagation in an inversion. Data from the second tower experiment became available near the end of 1984 and some comparisons have been carried out, but this work is not complete. Problems with the temperature profiler during the experiment have produced temperature profiles that are difficult to fit the assumed variation of temperature with height, but in cases where reasonable fits have been obtained agreement between the model and the experiments are close. The major weaknesses in the model appear to be the presence of discontinuities in some regions, the low sound levels predicted near the source height, and difficulties with the argument of the Hankel function being outside the allowable range. Work on the inversion model has progressed slowly, and the rays for that case are discussed along with a simple energy conservation model of sound level enhancement in the inversion case.

  16. 50 CFR 21.30 - Raptor propagation permits.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... that neither bald eagles (Haliaeetus leucocephalus) nor golden eagles (Aquila chrysaetos) may be... chapter, with the following exceptions: (1) You may not propagate bald eagles (Haliaeetus leucocephalus..., eagles, hawks, caracaras, falcons, and owls) listed in § 10.13 of this chapter unless the activities...

  17. 50 CFR 21.30 - Raptor propagation permits.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... that neither bald eagles (Haliaeetus leucocephalus) nor golden eagles (Aquila chrysaetos) may be... chapter, with the following exceptions: (1) You may not propagate bald eagles (Haliaeetus leucocephalus..., eagles, hawks, caracaras, falcons, and owls) listed in § 10.13 of this chapter unless the activities...

  18. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  19. Formation and Propagation of Tau Oligomeric Seeds

    PubMed Central

    Gerson, Julia E.; Kayed, Rakez

    2013-01-01

    Tau misfolding and aggregation leads to the formation of neurofibrillary tangles (NFTs), which have long been considered one of the main pathological hallmarks for numerous neurodegenerative diseases known as tauopathies, including Alzheimer’s Disease (AD) and Parkinson’s Disease (PD). However, recent studies completed both in vitro and in vivo suggest that intermediate forms of tau, known as tau oligomers, between the monomeric form and NFTs are the true toxic species in disease and the best targets for anti-tau therapies. However, the exact mechanism by which the spread of pathology occurs is unknown. Evidence suggests that tau oligomers may act as templates for the misfolding of native tau, thereby seeding the spread of the toxic forms of the protein. Recently, researchers have reported the ability of tau oligomers to enter and exit cells, propagating from disease-affected regions to unaffected areas. While the mechanism by which the spreading of misfolded tau occurs has yet to be elucidated, there are a few different models which have been proposed, including cell membrane stress and pore-formation, endocytosis and exocytosis, and non-traditional secretion of protein not enclosed by a membrane. Coming to an understanding of how toxic tau species seed and spread through the brain will be crucial to finding effective treatments for neurodegenerative tauopathies. PMID:23882255

  20. Cutting line determination for plant propagation

    NASA Astrophysics Data System (ADS)

    Lo, Li-Yun; Hsia, Chi-Chun; Sun, Hua-Hong; Chen, Hsiang-Ju; Wu, Xin-Ting; Hu, Min-Chun

    2014-01-01

    Investigating an efficient method for plant propagation can help not only prevent extinction of plants but also facilitate the development of botanical industries. In this paper, we propose to use image processing techniques to determine the cutting-line for the propagation of two kinds of plants, i.e. Melaleuca alternifolia Cheel and Cinnamomum kanehirai Hay, which have quite different characteristics in terms of shape, structure, and propagation way (e.g. propagation by seeding and rooting, respectively). The proposed cutting line determination methods can be further applied to develop an automatic control system to reduce labor cost and increase the effectiveness of plant propagation.

  1. Studies on propagation of microbes in the airborne state

    NASA Technical Reports Server (NTRS)

    Dimmick, R. L.; Wolochow, H.; Straat, P.; Chatigny, M. A.

    1974-01-01

    An investigation was conducted to demonstrate whether airborne microbes could propagate. The procedure consisted of: (1) looking for dilution of a labelled base in DNA; (2) looking for labelling of DNA by mixing aerosols of the label and the cells; (3) examining changes in cell size; (4) testing the possibility of spore germination; and (5) seeking evidence of an increase in cell number. Results indicate that growth and propagation can occur under special conditions, principally at temperatures of approximately 30 C (87 F) and water activity equivalents of 0.95 to 0.98.

  2. Microscale spatiotemporal dynamics during neocortical propagation of human focal seizures.

    PubMed

    Wagner, Fabien B; Eskandar, Emad N; Cosgrove, G Rees; Madsen, Joseph R; Blum, Andrew S; Potter, N Stevenson; Hochberg, Leigh R; Cash, Sydney S; Truccolo, Wilson

    2015-11-15

    Some of the most clinically consequential aspects of focal epilepsy, e.g. loss of consciousness, arise from the generalization or propagation of seizures through local and large-scale neocortical networks. Yet, the dynamics of such neocortical propagation remain poorly understood. Here, we studied the microdynamics of focal seizure propagation in neocortical patches (4×4 mm) recorded via high-density microelectrode arrays (MEAs) implanted in people with pharmacologically resistant epilepsy. Our main findings are threefold: (1) a newly developed stage segmentation method, applied to local field potentials (LFPs) and multiunit activity (MUA), revealed a succession of discrete seizure stages, each lasting several seconds. These different stages showed characteristic evolutions in overall activity and spatial patterns, which were relatively consistent across seizures within each of the 5 patients studied. Interestingly, segmented seizure stages based on LFPs or MUA showed a dissociation of their spatiotemporal dynamics, likely reflecting different contributions of non-local synaptic inputs and local network activity. (2) As previously reported, some of the seizures showed a peak in MUA that happened several seconds after local seizure onset and slowly propagated across the MEA. However, other seizures had a more complex structure characterized by, for example, several MUA peaks, more consistent with the succession of discrete stages than the slow propagation of a simple wavefront of increased MUA. In both cases, nevertheless, seizures characterized by spike-wave discharges (SWDs, ~2-3 Hz) eventually evolved into patterns of phase-locked MUA and LFPs. (3) Individual SWDs or gamma oscillation cycles (25-60 Hz), characteristic of two different types of recorded seizures, tended to propagate with varying degrees of directionality, directions of propagation and speeds, depending on the identified seizure stage. However, no clear relationship was observed between the MUA

  3. Microscale Spatiotemporal Dynamics during Neocortical Propagation of Human Focal Seizures

    PubMed Central

    Wagner, Fabien B.; Eskandar, Emad N.; Cosgrove, G. Rees; Madsen, Joseph R.; Blum, Andrew S.; Potter, N. Stevenson; Hochberg, Leigh R.; Cash, Sydney S.; Truccolo, Wilson

    2015-01-01

    Some of the most clinically consequential aspects of focal epilepsy, e.g. loss of consciousness, arise from the generalization or propagation of seizures through local and large-scale neocortical networks. Yet, the dynamics of such neocortical propagation remain poorly understood. Here, we studied the microdynamics of focal seizure propagation in neocortical patches (4 × 4 mm) recorded via high-density microelectrode arrays (MEAs) implanted in people with pharmacologically resistant epilepsy. Our main findings are threefold: (1) A newly developed stage segmentation method, applied to local field potentials (LFPs) and multi-unit activity (MUA), revealed a succession of discrete seizure stages, each lasting several seconds. These different stages showed characteristic evolutions in overall activity and spatial patterns, which were relatively consistent across seizures within each of the 5 patients studied. Interestingly, segmented seizure stages based on LFPs or MUA showed a dissociation of their spatiotemporal dynamics, likely reflecting different contributions of non-local synaptic inputs and local network activity. (2) As previously reported, some of the seizures showed a peak in MUA that happened several seconds after local seizure onset and slowly propagated across the MEA. However, other seizures had a more complex structure characterized by, for example, several MUA peaks, more consistent with the succession of discrete stages than the slow propagation of a simple wavefront of increased MUA. In both cases, nevertheless, seizures characterized by spike-wave discharges (SWDs, ~ 2–3Hz) eventually evolved into patterns of phase-locked MUA and LFPs. (3) Individual SWDs or gamma oscillation cycles (25–60 Hz), characteristic of two different types of recorded seizures, tended to propagate with varying degrees of directionality, directions of propagation and speeds, depending on the identified seizure stage. However, no clear relationship was observed between the

  4. Community Environmental Response Facilitation Act

    EPA Pesticide Factsheets

    To amend the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 to require the Federal Government, before termination of Federal activities on any real property owned by the Government, to identify real property where no hazardous substance was stored, released, or disposed of.

  5. Land mobile satellite propagation measurements in Japan using ETS-V satellite

    NASA Technical Reports Server (NTRS)

    Obara, Noriaki; Tanaka, Kenji; Yamamoto, Shin-Ichi; Wakana, Hiromitsu

    1993-01-01

    Propagation characteristics of land mobile satellite communications channels have been investigated actively in recent years. Information of propagation characteristics associated with multipath fading and shadowing is required to design commercial land mobile satellite communications systems, including protocol and error correction method. CRL (Communications Research Laboratory) has carried out propagation measurements using the Engineering Test Satellite-V (ETS-V) at L band (1.5 GHz) through main roads in Japan by a medium gain antenna with an autotracking capability. This paper presents the propagation statistics obtained in this campaign.

  6. Error propagation in a digital avionic processor: A simulation-based study

    NASA Technical Reports Server (NTRS)

    Lomelino, D.; Iyer, R. K.

    1986-01-01

    An experimental analysis to study error propagation from the gate to the chip level is described. The target system is the CPU in the Bendix BDX-930, an avionic miniprocessor. Error activity data for the study was collected via a gate-level simulation. A family of distributions to characterize the error propagation, both within the chip and at the pins, was then generated. Based on these distributions, measures of error propagation and severity were defined. The analysis quantifies the dependency of the measured error propagation on the location of the fault and the type of instruction/microinstruction executed.

  7. Wave Propagation in Bimodular Geomaterials

    NASA Astrophysics Data System (ADS)

    Kuznetsova, Maria; Pasternak, Elena; Dyskin, Arcady; Pelinovsky, Efim

    2016-04-01

    Observations and laboratory experiments show that fragmented or layered geomaterials have the mechanical response dependent on the sign of the load. The most adequate model accounting for this effect is the theory of bimodular (bilinear) elasticity - a hyperelastic model with different elastic moduli for tension and compression. For most of geo- and structural materials (cohesionless soils, rocks, concrete, etc.) the difference between elastic moduli is such that their modulus in compression is considerably higher than that in tension. This feature has a profound effect on oscillations [1]; however, its effect on wave propagation has not been comprehensively investigated. It is believed that incorporation of bilinear elastic constitutive equations within theory of wave dynamics will bring a deeper insight to the study of mechanical behaviour of many geomaterials. The aim of this paper is to construct a mathematical model and develop analytical methods and numerical algorithms for analysing wave propagation in bimodular materials. Geophysical and exploration applications and applications in structural engineering are envisaged. The FEM modelling of wave propagation in a 1D semi-infinite bimodular material has been performed with the use of Marlow potential [2]. In the case of the initial load expressed by a harmonic pulse loading strong dependence on the pulse sign is observed: when tension is applied before compression, the phenomenon of disappearance of negative (compressive) strains takes place. References 1. Dyskin, A., Pasternak, E., & Pelinovsky, E. (2012). Periodic motions and resonances of impact oscillators. Journal of Sound and Vibration, 331(12), 2856-2873. 2. Marlow, R. S. (2008). A Second-Invariant Extension of the Marlow Model: Representing Tension and Compression Data Exactly. In ABAQUS Users' Conference.

  8. Privacy Act Statement

    EPA Pesticide Factsheets

    Any information you provide to the Environmental Protection Agency’s (EPA) Suspension and Debarment Program will be governed by the Privacy Act and will be included in the EPA Debarment and Suspension Files, a Privacy Act system of records.

  9. ACTS data center

    NASA Technical Reports Server (NTRS)

    Syed, Ali; Vogel, Wolfhard J.

    1993-01-01

    Viewgraphs on ACTS Data Center status report are included. Topics covered include: ACTS Data Center Functions; data flow overview; PPD flow; RAW data flow; data compression; PPD distribution; RAW Data Archival; PPD Audit; and data analysis.

  10. Recovery Act Milestones

    ScienceCinema

    Rogers, Matt

    2016-07-12

    Every 100 days, the Department of Energy is held accountable for a progress report on the American Recovery and Reinvestment Act. Update at 200 days, hosted by Matt Rogers, Senior Advisor to Secretary Steven Chu for Recovery Act Implementation.

  11. Autism: Why Act Early?

    MedlinePlus

    ... What's this? Submit Button Past Emails CDC Features Autism: Why Act Early? Language: English Español (Spanish) Recommend ... helped the world make sense." Florida teenager with Autism Spectrum Disorder "Because my parents acted early, I ...

  12. Recovery Act Milestones

    SciTech Connect

    Rogers, Matt

    2009-01-01

    Every 100 days, the Department of Energy is held accountable for a progress report on the American Recovery and Reinvestment Act. Update at 200 days, hosted by Matt Rogers, Senior Advisor to Secretary Steven Chu for Recovery Act Implementation.

  13. Energy propagation throughout chemical networks.

    PubMed

    Le Saux, Thomas; Plasson, Raphaël; Jullien, Ludovic

    2014-06-14

    In order to maintain their metabolism from an energy source, living cells rely on chains of energy transfer involving functionally identified components and organizations. However, propagation of a sustained energy flux through a cascade of reaction cycles has only been recently reproduced at a steady state in simple chemical systems. As observed in living cells, the spontaneous onset of energy-transfer chains notably drives local generation of singular dissipative chemical structures: continuous matter fluxes are dynamically maintained at boundaries between spatially and chemically segregated zones but in the absence of any membrane or predetermined material structure.

  14. LCMV: Propagation, quantitation, and storage

    PubMed Central

    Seedhom, Mina O.

    2011-01-01

    Lymphocytic choriomeningitis virus (LCMV) is an enveloped ambisense RNA virus and the prototypic virus of the arenavirus group. It can cause viral meningitis and other ailments in humans, but it's natural host is the mouse. The LCMV/mouse model has been useful for examining mechanisms of viral persistence and basic concepts of virus-induced immunity and immunopathology. Here we discuss strain differences and biosafety containment issues for LCMV. Recommendations are made for techniques to propagate LCMV to high titers, to quantify it by plaque assay and PCR techniques, and to preserve its infectivity by appropriate storage. PMID:18770534

  15. Mode II fatigue crack propagation.

    NASA Technical Reports Server (NTRS)

    Roberts, R.; Kibler, J. J.

    1971-01-01

    Fatigue crack propagation rates were obtained for 2024-T3 bare aluminum plates subjected to in-plane, mode I, extensional loads and transverse, mode II, bending loads. These results were compared to the results of Iida and Kobayashi for in-plane mode I-mode II extensional loads. The engineering significance of mode I-mode II fatigue crack growth is considered in view of the present results. A fatigue crack growth equation for handling mode I-mode II fatigue crack growth rates from existing mode I data is also discussed.

  16. Modeling of Transionospheric Radio Propagation

    DTIC Science & Technology

    1975-08-01

    sin cpj dcp dq (17) where and VXz = Fresnel-zone radius at scattering layer 2 2 7 (0,0’) = [l + tan e cos (0 - «(*)] ß...y /nai, - 7 «T MODELING OF JRANSIONOSPHKir RADIO PROPAGATION RADI ^ja By: E. J. TREMOUW C L. RINO (£>. Augm IB?5 Prepared for: ROME A|R...following three relationships arise from Eqs. (1) and (2) 2 Ro cos (26) ( 7 ) R [ r. 2 o 0 = y ^ll + ^^cos (26) 2 L

  17. Ultrasound propagation measurements and applications

    NASA Technical Reports Server (NTRS)

    Lynnworth, L. C.; Papadakis, E. P.; Fowler, K. A.

    1977-01-01

    This paper reviews three systems designed for accurately measuring the propagation of ultrasonic pulses. The three systems are presented in order of velocity-measuring precision: + or - 100 ns, + or - 1 ns, + or - 0.2 ns. Also included is a brief discussion of phase and group velocities, with reference to dispersive, highly attenuating materials. Measurement of attenuation by pulse-echo buffer rod techniques is described briefly. These techniques and instruments have been used to measure sound velocity and attenuation in a variety of materials and shapes, over a wide temperature range.

  18. Propagation modelling in microcellular environments

    NASA Astrophysics Data System (ADS)

    Sharples, P. A.; Mehler, M. J.

    This paper describes a microcellular model, based on ray tracing techniques. Ray tracing is a stationary phase technique which relies on the quasi-optical properties of radio waves in regions where any obstacles are large in terms of a wavelength. The model described is a very versatile implementation which can be used to study both indoor and outdoor propagation phenomena for a number of different types of service. In its fullest form it requires input data of a sophistication that is not commercially available. However, this allows the model to be used to assess the implications in terms of the achievable accuracy when using commercial building databases.

  19. Light Propagation through Anisotropic Turbulence

    DTIC Science & Technology

    2011-03-01

    Kolmogorov stratospheric turbulence on star image motion,” Proc. SPIE 3126, 113–123 (1997). 5. B. E . Stribling, B. M . Welsh, and M . C. Roggemann...746407 (2009). 10. M . Chang, C. O. Font, F. Santiago, Y. Luna, E . Roura, and S. Restaino, “Marine environment optical propagation measure- ments,” Proc...Anisotropic factor as a function of alpha for several zeta values. Toselli et al. Vol. 28, No. 3 / March 2011 / J. Opt. Soc. Am. A 487 14. M . S

  20. Continuous propagation of microalgae. III.

    NASA Technical Reports Server (NTRS)

    Hanson, D. T.; Fredrickson, A. G.; Tsuchiya, H. M.

    1971-01-01

    Data are presented which give the specific photosynthetic rate and the specific utilization rates of urea and carbon dioxide as functions of specific growth rate for Chlorella. A mathematical model expresses a set of mass balance relations between biotic and environmental materials. Criteria of validity are used to test this model. Predictive procedures are complemented by a particular model of microbial growth. Methods are demonstrated for predicting substrate utilization rates, production rates of extracellular metabolites, growth limiting conditions, and photosynthetic quotients from propagator variables.